Improved methods for detecting soil pathogens

Abstract

The invention relates to methods and kits for the detection of pea rot pathogens in a soil sample using a loop-mediated isothermal amplification (LAMP) assay, where the assay comprises primers for at least one pea rot pathogen.

Description

[0001] M&C PC933755LU

[0002] 1

[0003] Improved methods for detecting soil pathogens

[0004] FIELD OF THE INVENTION

[0005] The invention relates to methods and kits for the detection of pea rot pathogens in a soil sample using a loop-mediated isothermal amplification (LAMP) assay, where the assay comprises primers for at least one pea rot pathogen.

[0006] BACKGROUD TO THE INVENTION

[0007] Legumes plays a vital role in sustainable agriculture due to their nitrogen-fixing abilities which reduces soil’s fertilizer requirement. Additionally, legumes, such as peas, serve as an excellent source of plant-based protein while having lower carbon footprints compared to animal-based proteins. As such, legumes are becoming a preferred substitute for soy protein among consumers due to their hypoallergenic properties, mild flavour profile and lack of genetic modification. With the growing awareness of their nutritional value, the pea protein market is expected to achieve a compound annual growth rate (CAGR) of about 13% from 2022 to 2030. Despite their considerable potential, growers often approach investment in pea cultivation with caution due to its yield variability. A significant challenge facing pea production worldwide is the prevalence of soil-borne root pathogens, which can cause severe damage by infecting various parts of the root system, leading to decay and substantial yield losses.

[0008] Pea root rot is caused by a complex of fungal and oomycete pathogens, primarily Aphanomyces euteiches and Fusarium species, including F. avenaceum, F. oxysporum, F. redolens, and F. solani. Different geographical regions may have varying dominant pathogen species within the complex due to variations in environmental conditions such as soil moisture, compaction, temperature and pH, as well as host genotype and agricultural practices. For example, a study conducted in major pea-growing regions in Canada found that Fusarium spp. are widely distributed, with F. solani and F. avenaceum being the two major and virulent players infecting pea roots. Conversely, Aphanomyces, which was recently detected in Canada in 2012, is highly aggressive on pea given the presence of free moisture in the soil. Most of the time, both Fusarium and Aphanomyces act together synergistically to cause severe root rot symptoms in pea. These pathogens produce thick-walled, resilient spores that can survive in the soil for decades, even in the absence of a host. When a susceptible host is planted, these spores germinate and infect

[0009] 15293147-1M&C PC933755LU

[0010] 2

[0011] the host roots. The disease is observed as yellow patches in the field, with stunting, yellowing, or wilting symptoms in the aerial parts. The root system of infected plants are poorly developed with characteristic honey-brown discolouration common to Aphanomyces, along with black lesions extending up to the base of the stem are caused by Fusarium infections. The root rot complex can be even further complicated due to the presence of other members, including Rhizoctonia solani, Pythium ultimum and some lesser-known pathogens.

[0012] Currently, there are limited seed treatments and no complete genetic resistance available to target the root rot complex. The current management strategy to mitigate losses involves testing soil for infestation levels prior to planting. For heavily infested fields, it is recommended to either avoid planting or extend the crop rotation for six to eight years. However, in fields with low to moderate infestation levels, growers can choose to plant either winter peas or avoid susceptible cultivars for spring sowing. Soil inoculum potential is assessed using a soil baiting method, wherein peas are grown in pots filled with soil collected from infected fields, and favourable conditions are maintained for disease development. After 5-6 weeks, the plants are evaluated for root discolouration on a scale of 1-5. Several modifications to this method and culture-based techniques have been developed. However, most of these methods are time-consuming, expensive, and require significant labour and space.

[0013] Recently, sensitive and specific molecular methods targeting conserved regions in the pathogen genome have been developed. These include quantitative polymerase chain reaction (qPCR) by targeting multicopy internal transcribed spacer 1 (ITS1) from the ribosomal DNA operons or translation elongation factor 1-a gene (TEF1). These methods have been adapted into multiplex qPCR for detection of both Fusarium and Aphanomyces and droplet digital PCR to quantify low inoculum levels in the soil, establishing a relationship between oospore density and disease severity in plants.

[0014] While these methods are good at predicting soil inoculum potential, they are expensive, time consuming, and necessitate sending soil samples to the testing facility. There is therefore a need to provide a rapid, on-farm and cost-effective testing system accessible to the growers. The present invention addresses this need.

[0015] SUMMARY OF THE INVENTION

[0016] 15293147-1M&C PC933755LU

[0017] 3

[0018] We have developed a portable and cost-effective Loop-mediated isothermal amplification (LAMP) assay for the rapid detection of pea root rot pathogens, particularly A. euteiches, F. solani, F. oxysporum and Pythium ultimum. Conserved unique regions within the internal transcribed spacer 1 (ITS1) sequences were identified and used to design the LAMP primers for each target pathogen. We have found that these primers exhibited particularly high specificity and could detect pathogen concentrations as low as 0.0002 ng within 35 minutes or less and for all pathogens tested, as low as 0.02 ng within 45 minutes or less, which was further reduced to 20 minutes for DNA concentrations above 10 ng. Furthermore, we tested the in planta effectiveness of both colorimetric and real time fluorometric LAMP (RealAmp) for detecting A. euteiches and F. solani spore concentrations ranging from 10 to 105. Both assays could differentiate between all concentrations for F. solani.

[0019] In one aspect of the invention, there is provided a method for the detection of at least one pathogen in a sample, wherein the method comprises collecting the sample and performing loop-mediated isothermal amplification (LAMP) on the sample using at least one primer set, wherein each primer set comprises at least four primers, and wherein the primer set is selected from

[0020] a. SEQ ID NO: 1 to 4 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 1, 2, 3 and 4 respectively; and / or

[0021] b. SEQ ID NO: 5 to 8, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 5, 6, 7 and 8 respectively; and / or

[0022] c. SEQ ID NO: 9 to 12, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 9, 10, 11 and 12 respectively; and / or

[0023] d. SEQ ID NO: 13 to 16 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 13, 14, 15 and 16 respectively.

[0024] In an embodiment, the method comprises performing LAMP or RealAmp.

[0025] In an embodiment, the pathogen is a plant pathogen, preferably a root rot pathogen. Preferably, the pathogen is selected from the genus: Aphanomyces and / or Fusarium and / or Pythium.

[0026] 15293147-1M&C PC933755LU

[0027] 4

[0028] In an embodiment, the pathogen is Aphanomyces euteiches.

[0029] In an embodiment, the pathogen is selected from F. avenaceum, F. oxysporum, F. redolens, and F. solani.

[0030] In an embodiment, the pathogen is Pythium ultimum.

[0031] In an embodiment, the method comprises determining from LAMP the type of pathogen present in the sample. In an alternative embodiment, the method comprises determining from RealAmp the quantity of pathogen present in the sample.

[0032] In an embodiment, the sample is a soil sample or a plant sample.

[0033] In another aspect of the invention, there is provided a kit for the detection of at least one pathogen, the kit comprising at least one LAMP primer set, wherein the primer set is selected from

[0034] a. SEQ ID NO: 1 to 4 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 1, 2, 3 and 4 respectively; and / or

[0035] b. SEQ ID NO: 5 to 8, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 5, 6, 7 and 8 respectively; and / or

[0036] c. SEQ ID NO: 9 to 12, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 9, 10, 11 and 12 respectively; and / or

[0037] d. SEQ ID NO: 13 to 16 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 13, 14, 15 and 16 respectively.

[0038] In an embodiment, the pathogen is a plant pathogen, preferably a root rot pathogen. Preferably, the pathogen is selected from the genus: Aphanomyces and / or Fusarium and / or Pythium.

[0039] In an embodiment, the pathogen is Aphanomyces euteiches.

[0040] 15293147-1M&C PC933755LU

[0041] 5

[0042] In an embodiment, the pathogen is selected from F. avenaceum, F. oxysporum, F. redolens, and F. solani.

[0043] In an embodiment, the pathogen is Pythium ultimum.

[0044] In an embodiment, the device is capable of performing LAMP or RealAmp (real time loop-mediated isothermal amplification).

[0045] In another aspect of the invention, there is provided a loop-mediated isothermal amplification (LAMP) primer set specific for at least one plant root rot pathogen, wherein the primer set is selected from

[0046] a. SEQ ID NO: 1 to 4 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 1, 2, 3 and 4 respectively; and b. SEQ ID NO: 5 to 8, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 5, 6, 7 and 8 respectively; and c. SEQ ID NO: 9 to 12, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 9, 10, 11 and 12 respectively; and

[0047] d. SEQ ID NO: 13 to 16 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 13, 14, 15 and 16 respectively.

[0048] In another aspect of the invention, there is provided use of the LAMP primer set defined herein to detect at least one plant root rot pathogen in a sample, wherein preferably the sample is selected from a soil or plant sample.

[0049] DESCRIPTION OF THE DRAWINGS

[0050] The invention is further described in the following non-limiting figures:

[0051] Figure 1 shows primer design and specificity assessment. (A) LAMP primers were designed based on partial ITS1 sequences of the targeted pathogen. The Forward Inner Primer (FIP) is shown in two shades of green, with the F2 region at the 3’ (dark green) and the F1c region in the 5’ end (light green). The F3 primer or Forward Outer Primer (FOP) is represented in blue. The Backward Inner Primer (BIP) is depicted in two shades of magenta, with the B2 region at the 3’ (fuchsia) and the B1c region at the 5’ end (pink). The Backward Outer Primer or B3 is shown in yellow. (B) Colorimetric LAMP specificity testing was performed on a set of 20 fungal and oomycete isolates. All primers sets were

[0052] 15293147-1M&C PC933755LU

[0053] 6

[0054] tested with 10 ng of gDNA at 66 °C for 35 minutes, except for the P. ultimum primers, which required an extended incubation time of 41 minutes.

[0055] Figure 2 shows the LAMP detection threshold. (A) Colorimetric LAMP assay conducted using four primer sets across a gradient of pure gDNA concentrations for all target pathogens. Reactions were performed at 66 °C for 35 minutes, except for P. ultimum, which required 41 minutes of incubation. (B-E) RealAmp fluorometric detection of gDNA from each pathogen using their respective primer sets. (B) A. euteiches Drechsler, (C) P. ultimum var. ultimum, (D) F. solani and (E) F. oxysporum. The tested gDNA concentrations were 0.02 ng (dark blue), 0.2 ng (light blue), 2 ng (sky blue), 10 ng (light green), 20 ng (dark green) and 40 ng (black).

[0056] Figure 3 shows in planta detection by LAMP. (A) Colorimetric LAMP performed on root gDNA with A. euteiches and F. solani primers from plants grown in autoclaved vermiculite. The assay was evaluated at 30 and 45 minutes with results based on two independent biological replicates, a representative colour change is shown here. (B-C) RealAmp detection of root gDNA using with A. euteiches and F. solani primers from plants grown in autoclaved vermiculite. Results are based on two biological replicates and two technical replicates, with graphs showing mean values at each time point. (D) Colorimetric LAMP of root and soil gDNA performed with A. euteiches and F. solani primers from plants grown in autoclaved soil, evaluated at 35, 45 and 60 minutes. Results are based on two biological replicates, with a representative colour change shown here. (E-H) RealAmp detection of (E-F) root gDNA and (G, H) performed with A. euteiches and F. solani primers from plants grown in autoclaved soil, evaluated at 35, 45 and 60 minutes. Results are based on up to four biological and two technical replicates, graphs show mean values at each time point. (I) Colorimetric LAMP assay on root and soil gDNA performed with A. euteiches and F. solani primers from plants grown in pot soil for four weeks, evaluated at 35, 45 and 60 minutes. Results are based on two biological replicates, with a representative colour change shown here. (J-M) RealAmp detection of (J, K) root gDNA and (L, M) soil gDNA performed with A. euteiches and F. solani primers from plants grown in pot soil. Results are based on up to four biological and two technical replicates, with graphs showing mean values at each time point. Note that for all roots samples, 20 ng of gDNA were used as input, whereas 10

[0057] Figure 4 shows portable detection with LAMP. A. Soil baiting assay of 10 days old plants using agriculture field. Zoom-in microscope images taken at 40X. B. Field samples PEBBLE results. C. Lab 4 wpi soil samples PEBBLE results. D. Lab 4 wpi root samples

[0058] 15293147-1M&C PC933755LU

[0059] 7

[0060] PEBBLE results. E. Colorimetric change observed in the PEBBLE samples after 60 min of incubation. F. Field samples RealAmp results. Biological replicates were pooled together following gDNA extraction and 5 pl were used per reaction in two technical replicates. For all PEBBLE runs, biological reps were pulled down following gDNA extraction and 5 ml were used per reaction in two technical reps.

[0061] Figure 5 shows a proposed workflow for root rot pathogens detection by the portable device PEBBLE. Samples can be collected from either diseased roots or field soil, for which a traditional W-shape sampling and subsequent soil homogenisation is followed. Samples gDNA extraction can be done using a commercial column-based method when a laboratory set-up is available or using magnetic beads for quick gDNA isolation. Reaction set-up is achieved by adding the isolated gDNA together with a LAMP mix that includes all the required reagents and is followed by incubation in the PEBBLE device for 60 minutes. After one hour, results can be read via the PEBBLE app on a mobile device or by observing the colour change.

[0062] Figure 6 shows in planta detection by qPCR. (A-B) qPCR performed on root gDNA with A. euteiches (A) and F. solani (B) primers from plants grown in autoclaved vermiculite. (C-F) qPCR detection of (C, E) root gDNA and (D, F) soil gDNA performed with A. euteiches and F. solani primers from plants grown in autoclaved soil. (G-J) qPCR detection of (G, I) root gDNA and (H, J) soil gDNA performed with A. euteiches and F. solani primers from plants grown in pot soil. All results are based on up to four biological and two technical replicates, with graphs showing mean values at each time point. Note that for all roots samples, 20 ng of gDNA were used as input, whereas 10 ng were used in the soil samples.

[0063] Figure 7 shows in planta infections with root rot pathogens (A) Plants grown in autoclaved vermiculite evaluated at 2 weeks post inoculation (wpi). (B) Plants grown in autoclaved soil evaluated at 2 wpi. (C) Plants grown in pot soil evaluated at 4 wpi. Plants were inoculated with A. euteiches and F. solani, individually and in co-inoculation, with increasing spore concentrations.

[0064] Figure 8 shows PEBBLE device detection threshold evaluated across a gradient of pure gDNA concentrations for all target pathogens. (A) Detection of A. euteiches, (B) F. solani, (C) P. ultimum and (D) F. oxysporum. The tested gDNA concentrations were 0.02 ng (light blue), 0.2 ng (sky blue), 2 ng (light green), 10 ng (olive green), 20 ng (dark blue) and non-template control (NTC) (black). All reactions were performed at 78 °C for 60

[0065] 15293147-1M&C PC933755LU

[0066] 8

[0067] minutes to achieve 66 °C in the sample, except for F. solani where the temperature was increased to 80 °C.

[0068] Figure 9. A. euteiches RealAmp assay for magnetic bead-based gDNA extraction. (A) Field samples. (B) Lab 4 wpi root samples. (D) Lab 4 wpi soil samples. All reactions were performed at 66 °C for 60 minutes. Biological reps were pulled down following gDNA extraction and 5 pl were used per reaction in two technical reps.

[0069] Figure 10 shows A. euteiches RealAmp assay for field samples using column-based gDNA extraction. All samples were subjected to column base gDNA extraction and evaluated using RealAmp with A. euteiches primers. Note that for all roots samples, 20 ng of gDNA were used as input, whereas 10 ng were used in the soil samples.

[0070] Figure 11 shows a graphical representation of LAMP results (purple / pink / yellow) for three root rot pathogens including in the assay. Pythium ultimum was excluded from this figure as all samples were negative pre and post baiting. Plants were scored on a scale of 1 -5 for root disease symptoms, these results are shown in the central two strips with red being severe disease and blue being completely healthy roots.

[0071] Figure 12 shows a graphical representation of LAMP results for three root rot pathogens including in the assay. Soil was incubated with either water or a growth stimulant for 3 or 7 days before testing.

[0072] DETAILED DESCRIPTION

[0073] The present invention will now be further described. In the following passages, different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated to the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous.

[0074] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of botany, microbiology, tissue culture, molecular biology, chemistry, biochemistry and recombinant DNA technology, bioinformatics, which are within the skill of the art. Such techniques are explained fully in the literature.

[0075] As used herein, the words "nucleic acid", "nucleic acid sequence", "nucleotide", "nucleic acid molecule" or "polynucleotide" are intended to include DNA molecules (e.g., cDNA

[0076] 15293147-1M&C PC933755LU

[0077] 9

[0078] or genomic DNA), RNA molecules (e.g., mRNA), natural occurring, mutated, synthetic DNA or RNA molecules, and analogues of the DNA or RNA generated using nucleotide analogues. It can be single-stranded or double-stranded. Such nucleic acids or polynucleotides include, but are not limited to, coding sequences of structural genes, anti-sense sequences, and non-coding regulatory sequences that do not encode mRNAs or protein products. These terms also encompass a gene. The term "gene" or “gene sequence” is used broadly to refer to a DNA nucleic acid associated with a biological function. Thus, genes may include introns and exons as in the genomic sequence, or may comprise only a coding sequence as in cDNAs, and / or may include cDNAs in combination with regulatory sequences.

[0079] The following features apply to all aspects of the invention.

[0080] Traditionally, diagnosing the pea root rot complex has typically involved evaluating the severity of root rot using a scale to assess root discoloration plus in planta symptoms visualisation. This is followed by determining the root rot incidence per field, which is the proportion of affected plants compared to the total number of plants sampled. However, many times the final identification of the causal agent of the disease is not achieved and a more exhaustive analysis must be carried out in a specialised set up, which usually involves microscopic tissue observation and pathogen isolation. Isolation of the root rot complex members cannot be efficiently achieved from infected soil and often requires of an additional step of soil baiting to ensure root infection. During this process, a susceptible pea cultivar is planted into the suspected diseased soil, optimising the environmental conditions to allow maximum disease manifestation. This is then followed by disease ranking to evaluate inoculum potential of the soil and tissue plating onto selective media for subsequent characterisation of the pathogen. While these techniques are quite reliable, they are costly and can take between 2 - 6 weeks for the growers to get a result.

[0081] By utilizing the highly variable ITS1 region and taking the advantages of LAMP technology, we have developed a robust and efficient diagnostic tool. The successful implementation of the LAMP assay as a portable device would provide farmers and agronomists with a valuable tool for early and accurate disease diagnosis, enabling timely interventions in disease management and ultimately minimizing economic losses associated with the root rot complex.

[0082] 15293147-1M&C PC933755LU

[0083] 10

[0084] Accordingly, in a first aspect of the invention, there is provided a method for the detection of at least one pathogen in a sample using loop-mediated isothermal amplification (LAMP). Also provided is a kit for the detection of at least one pathogen in a sample using a loop-mediated isothermal amplification (LAMP).

[0085] The pathogen may be a plant pathogen, and in particular a fungal or oomycete plant pathogen. In one embodiment, the pathogen is a root pathogen, and in particular a root rot pathogen, and even more particularly a legume root rot pathogen. As discussed above, legume root rots significantly affect yield in legumes.

[0086] In one embodiment, the pathogen is selected from the genus Aphanomyces. In particular, the pathogen is Aphanomyces euteiches.

[0087] In another embodiment, the pathogen is selected from the genus Fusarium. In particular, the pathogen is selected from F. avenaceum, F. oxysporum, F. redolens, and F. solani. In one embodiment, the pathogen is F. oxysporum or F. solani. In some embodiments, the pathogen is any strain of the above pathogens.

[0088] In another embodiment, the pathogen is selected from the genus Pythium. In particular, the pathogen is selected from Pythium ultimum.

[0089] In one embodiment, the methods of the invention can be used to detect a Aphanomyces infection and / or a Fusarium infection and / or a Pythium infection. This is important as the members of the root rot complex are known for their co-existence and co-infection in the plant host. For this reason, being able to detect multiple members of the root rot complex is essential to be able to determine the causal agent of the disease and subsequently take the appropriate actions.

[0090] The sample may be a soil sample. The soil sample may be taken from one or a plurality of soil sites or from a single soil site. Where the sample is taken from a plurality of soil sample sites the more than one soil sample may subsequently be pooled before testing, as shown in Figure 5. In one embodiment, the soil sample site may be the rhizosphere. As used herein, the rhizosphere may refer to the area or zone of soil surrounding a plant and that is influenced by root secretions and associated soil microorganisms. The rhizosphere may contain what is known as the rhizosphere microbiome.

[0091] Alternatively, the sample may be a plant sample. That is, the sample may be a portion of the root of the plant - for example, the root / apportion of the root tissue of a legume.

[0092] 15293147-1M&C PC933755LU

[0093] 11

[0094] Following collection of the sample the sample may be lysed and genomic DNA eluted.

[0095] The method may therefore comprise collecting or obtaining the sample, as described above, lysing the sample and eluting the genomic DNA before LAMP is carried out.

[0096] LAMP or loop-mediated isothermal amplification is an isothermal amplification technique that amplifies DNA with high specificity, sensitivity, and efficiency under constant temperature conditions. It offers several advantages over conventional PCR, including simplicity, rapidity, and robustness. The LAMP assay can be performed using basic equipment like a water bath or heating block, eliminating the need for sophisticated and expensive thermal cyclers. Additionally, LAMP amplification products can be visualized using various methods, such as colorimetric indicators or fluorescent dyes, enabling easy and real-time detection. Its high specificity arises from the use of multiple primers targeting multiple regions within the target DNA, reducing the likelihood of non-specific amplification. The use of DNA polymerases with strand displacement activity in the LAMP reaction further enhances its efficiency and specificity. The isothermal nature of LAMP allows for rapid amplification, typically within 30-60 minutes, enabling on-site and real-time detection, which is particularly advantageous for disease management decisions. Several compact and portable LAMP devices are now available which can be used for point-of-care testing in remote and resource-limited settings.

[0097] The process of LAMP is described in e.g. US6410278. LAMP typically requires the use of at least one set of primers, where each set comprises between 4 to 6 different primers that recognise 6-8 distinct regions of the target DNA strand. Preferably the LAMP primer sets are suitable for use in detecting at least one plant pathogen, preferably a root rot pathogen selected from the genus Aphanomyces, Fusarium and / or Pythium.

[0098] As an alternative to (standard) LAMP, RealAmp (real time loop-mediated isothermal amplification), as described, for example, in Patel et al., (Patel JC, Oberstaller J, Xayavong M, Narayanan J, DeBarry JD, Srinivasamoorthy G, et al. (2013) Real-Time Loop-Mediated Isothermal Amplification (RealAmp) for the Species-Specific Identification of Plasmodium vivax. PLoS ONE 8(1): e54986. https: / / doi.orq / 10.1371 / journal. pone.0054986) may be used. RealAmp integrates the isothermal amplification technique (LAMP) with a fluorescent detection unit. RealAmp allows the collection of real-time data collection via the collection of the fluorescent signal. According to the present invention “LAMP” as used throughout the application in

[0099] 15293147-1M&C PC933755LU

[0100] 12

[0101] the context of LAMP primers and so on encompasses all forms of LAMP, including RealAmp.

[0102] In one embodiment, the method may comprise providing or collecting the sample and providing a LAMP reaction mixture, where the LAMP reaction mixture comprises at least one LAMP primer set and a DNA polymerase (a strand displacement polymerase), incubating the sample and reaction mixture under conditions suitable to produce a reaction product (also referred to herein as an amplification product, such terms may be used interchangeably) and detecting the amplification product. Suitable incubation conditions would be known to the skilled person. As an example, the reaction mixture may be incubated at 66°C for 35 to 45minutes, as described in Example I.

[0103] Where the method comprising performing RealAmp, the method requires the addition of a fluorescent or intercalating dye to the reaction mixture. For example, the dye may be SYTO-9 or SYBR Green. Preferably, the dye used is SYTO-9.

[0104] In some embodiments the method may further comprise the addition of a growth stimulant. The growth stimulant may be added before of after collection of the sample, and before addition of the LAMP reaction mixture, and incubation of the sample. The purpose of the growth stimulant is to increase pathogen abundance before analysis. Suitable growth stimulants will be known to the skilled person, and can include, for example simple sugars, low molecular weight organic acids, amino acid mixtures, soil organic matter fraction and plant derived root exudate analogues. In one embodiment, the growth stimulant comprises germinated pea seedlings that is ground, filtered and autoclaved before use, as described in the Examples.

[0105] In the context of the present invention the detection of one or more amplified products using one or more of the above described primers in the sample is indicative of the presence of one or more pathogen and is also indicative of the presence or likely presence of root rot in plants planted in the sample area or is indicative that root rot is or could develop in plants planted in the sample area.

[0106] The amplification product can be detected using photometry. For example, magnesium pyrophosphate produced during the reaction can be observed as a white precipitate. Alternatively, the amplification product can be detected using fluorescence (e.g. using an intercalating dye) or using colorimetries (detecting the amplification product visually). Alternatively, a lateral flow can be used.

[0107] 15293147-1M&C PC933755LU

[0108] 13

[0109] The amplification product may be detected in as little as 20 minutes. Accordingly, the method of the invention may further comprise the step of detecting amplified product, where the presence of amplified product is indicative of the presence of a pathogen in a sample, wherein the amplified product may be detected after at least 15 minutes, preferably at least 20 minutes, preferably at least 25 minutes, preferably at least 30 minutes, preferably at least 35 minutes, preferably at least 40 minutes, preferably at least 45 minutes, preferably at least 50 minutes, preferably at least 55 minutes and more preferably at least 60 minutes. As explained herein the time to detection may depend on the concentration of pathogen in the sample. By “concentration of pathogen in the sample” is meant a detectable nucleic acid sample, such as DNA (e.g., genomic DNA (gDNA), plasmid DNA, extracellular DNA, (eDNA) or viral DNA) or RNA (e.g., mRNA, rRNA, viral RNA or small / regulatory RNAs). Preferably, the concentration of pathogen in the sample refers to the concentration of DNA in said sample, more preferably gDNA in said sample.

[0110] Preferably, the amplification product is detected after at least 35 minutes, more preferably at least 40 minutes or also more preferably at least 45 minutes.

[0111] In one embodiment, the concentration of pathogen in the sample comprises or consists of nucleic acid(s) detectable from at least 50 ng, 40 ng, 30 ng, 25 ng, 20 ng, 15 ng, 10 ng, 5 ng, 2 ng, 1 ng, 0.5 ng, 0.2 ng, 0.05 ng, 0.02 ng, 0.005 ng, 0.002 ng, 0.0005 ng or at least 0.0002 ng. Preferably, the concentration of pathogen in the sample is selected from at least 40 ng, 20 ng, 2 ng, 0.2 ng, 0.02 ng, 0.002 ng or at least 0.0002 ng of a nucleic acid, preferably gDNA. Concentrations of pathogens being detectable from a 0.0002 ng - 40 ng gDNA sample are shown in Figure 2.

[0112] In a preferred embodiment, the concentration of pathogen in the sample comprises or consists at least 40 ng, at least 20 ng or at least 10 ng, at least 2 ng or at least 0.2 ng of a nucleic acid, preferably gDNA and the amplification product is detected after at least 45 minutes, more preferably after at least 40 minutes, most preferably after at least 35 minutes. We report here that using the RealAmp platform, concentrations ranging from 0.02 to 40 ng were detected at the lowest concentration (0.02 ng) within 40 minutes for all pathogens (Figure 2 B-E) and multiple pathogens within 35 minutes.

[0113] In a preferred embodiment, the concentration of pathogen in the sample comprises or consists at least 40 ng, at least 20 ng or at least 10 ng of a nucleic acid, preferably gDNA

[0114] 15293147-1M&C PC933755LU

[0115] 14

[0116] and the amplification product is detected after at least 35 minutes, more preferably after at least 30 minutes, most preferably after at least 20 minutes.

[0117] In a preferred embodiment, the concentration of pathogen in the sample comprises or consists at least 40 ng, at least 20 ng or at least 10 ng of a nucleic acid, preferably gDNA and the amplification product is detected after at least 20 minutes. Figure 2 B-E show that the amplification products of gDNA concentrations of 40 ng, 20 ng and 10 ng were consistently detectable after 20 minutes.

[0118] In a more preferred embodiment, the concentration of pathogen in the sample comprises or consists at least 10 ng of a nucleic acid, preferably gDNA and the amplification product is detected after at least 20 minutes. Figure 2 B-E show that the amplification products of gDNA concentrations of 10 ng were consistently detectable after 20 minutes.

[0119] In a more preferred embodiment, the concentration of pathogen in the sample comprises or consists at least 2 ng or at least 0.2 ng of a nucleic acid, preferably gDNA and the amplification product is detected after at least 40 minutes, more preferably at least 35 minutes, most preferably at 30 minutes. Figure 2 B-E show that the amplification products of gDNA concentrations of 0.2 ng and 2 ng were detectable after as little as 30 minutes.

[0120] In a most preferred embodiment, the concentration of pathogen in the sample comprises or consists at least 0.0002 ng of a nucleic acid, preferably gDNA and the amplification product is detected after at least 40 minutes, most preferably at least 35 minutes. Figure 2A shows that F.solani was detected using the methods described herein from a 0.0002 ng gDNA sample.

[0121] In one embodiment, the LAMP primer set comprise four primers comprising a pair of forward (FIP) and reverse (BIP) inner primers, and a pair of forward (F3) and reverse (B3) outer primers. More preferably, the LAMP primer sets suitable for use in the present invention may also include a loop forward (LF) and / or loop back (LB) primer to accelerate amplification (and reduce the detection time) of any target nucleic acid / target fungi present in the sample.

[0122] Accordingly, there is provided a method or kit for detecting at least one pathogen in a sample with a LAMP assay where the LAMP assay comprises a set of primers for a root

[0123] 15293147-1M&C PC933755LU

[0124] 15

[0125] rot pathogen where the pathogen is selected form A. euteiches, P. ultimum, F. solani, and F. oxysporum.

[0126] In one embodiment, the LAMP assay comprises at least one primer set and wherein the primer set comprises at least four primers specific to four different regions of the F. solani genome, and in particular four different regions of ITS1 (internal transcribed spacer 1). In one embodiment, the primer set comprises SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 and SEQ ID NO: 4 or variants thereof. This may be referred to herein as the F. solani primer set.

[0127] In another embodiment, the LAMP assay comprises at least one primer set and wherein the primer set comprises at least four primers specific to four different regions of the F. oxysporum genome, and four different regions of ITS1 (internal transcribed spacer 1). In one embodiment, the primer set comprises SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7 and SEQ ID NO: 8 or variants thereof. This may be referred to herein as the F. oxysporum primer set.

[0128] In one embodiment, the LAMP assay comprises at least one primer set and wherein the primer set comprises at least four primers specific to four different regions of the A. euteiches genome, four different regions of ITS1 (internal transcribed spacer 1). In one embodiment, the primer set comprises SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11 and SEQ ID NO: 12 or variants thereof. This may be referred to herein as the A. euteiches primer set.

[0129] In one embodiment, the LAMP assay comprises at least one primer set and wherein the primer set comprises at least four primers specific to four different regions of the P. ultimum genome, and in particular to four different regions of the ITS1 (internal transcribed spacer 1). In one embodiment, the primer set comprises SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15 and SEQ ID NO: 16 or variants thereof. This may be referred to herein as the P. ultimum primer set.

[0130] It is known from previous results, that A. euteiches-mfec ed pea plants are more susceptible to Fusarium root rot, potentially further increasing yield loss in affected areas.

[0131] Accordingly, in a further embodiment, there is provided a method or kit for detecting at least two pathogens in a sample using a LAMP assay, where the LAMP assay comprises two primer sets selected from the F. solani primer set, the F. oxysporum primer set, the

[0132] 15293147-1M&C PC933755LU

[0133] 16

[0134] A. euteiches primer set and the P. ultimum primer set. In particular the two primer sets may consist of the A. euteiches and the F. solani primer set. Alternatively, the primer set may be the A. euteiches and the F. oxysporum primer set.

[0135] In another embodiment, there is provided a method or kit for detecting at least three pathogens in a sample using a LAMP assay, where the LAMP assay comprises three primer sets selected from the F. solani primer set, the F. oxysporum primer set, the A. euteiches primer set and the P. ultimum primer set. In particular, the three primer set may consist of the A. euteiches, the F. solani primer set and the F. oxysporum primer set.

[0136] In one embodiment, there is provided a method or kit for detecting at least four pathogens in a sample using a LAMP assay, where the LAMP assay comprises four primer sets, wherein the four primer sets are the F. solani (Fsol) primer set, the F. oxysporum (Foxy) primer set, the A. euteiches (Apha) primer set and the P. ultimum (Pul) primer set.

[0137] In another embodiment, the primer is selected from one or more primer selected from Table 1 below.

[0138] Table 1: LAMP primers

[0139] n Pr ■imer name S eequence SEQ F3_Fsol GCCGTAAAACACCCAACTTC1B3_Fsol CGTTCCAGGGAACTCGGA2FIP_Fsol TGGGGCAATCCCTGTTGGTTTCTCAGGTAGGAATACCCGCTG3BIP_Fsol TTGAAATCTGGCTCTCGGGCCAGGCACCTCACCAAAAGC4F3_Foxy TTTCAACAACGGATCTCTTG5B3_Foxy AATTAACGCGAGTCCCAA6FIP_Foxy TGATTCACTGAATTCTGCAATTCACCTGGCATCGATGAAGAACG7BIP_Foxy CCAGTATTCTGGCGGGCATGCACCAAGCTGTGCTTGAG8F3_Apha AAAACCATCCACGTGAATG9B3_Apha CAGTTCGCTGTGGTCTTC10FIP_Apha ATCGGTTCCTTGCGAAACCTTATTCTTTATGAGGCTTGTGC11BIP_Apha AACTAGCATCAGAAATGAAGCTTGTTGTGCGAGCCTAGACATC12Pul_F3 ATTTATACTGTGGGGACGAA13Pul_B3 AGAAAAAGAAAGGCAAGTTT14

[0140] 15293147-1M&C PC933755LU

[0141] Pul_FIP CTTCATCGATGTGCGAGCCTAGGTCCTTGC I I I IACTAGATAACAAC15Pul_BIP ACGTAATGCGAATTGCAGAATTCAAGACATACTTCCAGGCATAA16

[0142] As shown in the examples, the above-described primers have been evaluated for their specificity towards the intended target among closely related species and other common fungal members of the root microbiome of pea. In particular, we studied primer specificity towards a differential set of 18 fungal and 2 oomycetal isolates. Our primers yielded up to 100% specificity. In addition, the above primers were able to detect pathogen concentrations as low as 0.02ng in less than 45 minutes or 20 minutes if the pathogen concentrations are higher than 10ng.

[0143] As used herein, the term “variant” refers to a variant polypeptide sequence or part of the polypeptide sequence that retains the desired function of the full non-variant sequence. For example, a desired function of a LAMP primer retains the ability to bind (i.e. hybridise) to a target sequence.

[0144] As used in any aspect described herein, a “variant” has at least 25%, 26%, 27%, 28%, 29%, 30%, 31%, 32%, 33%, 34%, 35%, 36%, 37%, 38%, 39%, 40%, 41%, 42%, 43%, 44%, 45%, 46%, 47%, 48%, 49%, 50%, 51%, 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 61%, 62%, 63%, 64%, 65%, 66%, 67%, 68%, 69%, 70%, 71%, 72%, 73%, 74%, 75%, 76%, 77%, 78%, 79%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or at least 99% overall sequence identity to the non-variant nucleic acid sequence - e.g. SEQ ID NO: 1, 2, 3, 4, 5, 6 7, 8, 9, 10, 11, 12, 13, 14, 15 or 16. The sequence identity of a variant can be determined using any number of sequence alignment programs known in the art. As an example, Emboss Stretcher from the EMBL-EBI may be used: https: / / www.ebi.ac.uk / Tools / psa / emboss stretcher / (using default parameters: pair output format, Matrix = BLOSUM62, Gap open = 1, Gap extend = 1 for proteins; pair output format, Matrix = DNAfull, Gap open = 16, Gap extend = 4 for nucleotides).

[0145] As described above, the plant is preferably a legume, and more preferably pea (Pisum sativum).

[0146] In one aspect of the invention, the kit for detection of at least one pathogen comprises reagents and a device for performing LAMP as well as at least one primer set, as

[0147] 15293147-1M&C PC933755LU

[0148] 18

[0149] described above. The kit may also comprise instructions for use. The reagents may comprise a strand displacement polymerase, dNTPs, buffer and where the kit is for performing RealAmp, a fluorescent dye.

[0150] While the foregoing disclosure provides a general description of the subject matter encompassed within the scope of the present invention, including methods, as well as the best mode thereof, of making and using this invention, the following examples are provided to further enable those skilled in the art to practice this invention and to provide a complete written description thereof. However, those skilled in the art will appreciate that the specifics of these examples should not be read as limiting on the invention, the scope of which should be apprehended from the claims and equivalents thereof appended to this disclosure. Various further aspects and embodiments of the present invention will be apparent to those skilled in the art in view of the present disclosure.

[0151] Unless context dictates otherwise, the descriptions and definitions of the features set out above are not limited to any particular aspect or embodiment of the invention and apply equally to all aspects and embodiments which are described.

[0152] The invention is now described in the following non-limiting examples.

[0153] EXAMPLE

[0154] This study specifically focuses on the design and evaluation of LAMP primers for the specific detection of pea root rot pathogens, including A. euteiches, P. ultimum, F. solani, and F. oxysporum.

[0155] Identification and design of the LAMP primers

[0156] For the detection of key members of the root rot complex, namely A. euteiches, P. ultimum, F. solani and F. oxysporum, the internal transcribed spacer 1 (ITS1) was chosen as the molecular marker. The designed primers were in silico validated for specificity using BLASTn against the nucleotide database on NCBI. A summary of the conserved regions and the locations of the primers is depicted in Figure 1, and Table 1 lists all the primers used.

[0157] Specificity of the LAMP primers

[0158] 15293147-1M&C PC933755LU

[0159] 19

[0160] The members of the root rot complex are known for their co-existence and co-infection both in the soil and in the plant host. The inherent complexity of this complex makes it challenging to individually detect the causal agents of the disease. Therefore, it is crucial to screen primer sets among common fungal isolates found in pea roots. For this purpose, two different strains of A. euteiches, one of P. ultimum, one of F. solani and two of F. oxysporum were selected along with 14 additional isolates from our lab collection. These isolates included other common pea root pathogens such as Phoma medicaginis (SA7) or Rhizoctonia solani (SA9), as well as environmental isolates found to co-inhabit pea roots, such as Mucorsp. or other members of the Fusaria group.

[0161] Following the optimized reaction conditions, we observed that the A. euteiches primers produced a positive yellow colour reaction exclusively with the two A. euteiches strains, AeRB84 and AeD. The P. ultimum primers also yielded positive results only when paired with their corresponding gDNA, indicating high specificity for their intended targets. The F. solani primers successfully detected five out of six F. solani isolates, namely FsolNIAB, SA73, SA87, SA101 and SA 105, with a very weak off-target amplification observed for SA 119, previously identified as F. redolens. Notably, the F. oxysporum primers showed 100% detection efficiency, producing positive results for both the control strains (FoxyNIAB and FoxyRI) and for SA77, also identified as F. oxysporum (Figure 1 B). These results highlighted two key findings (i) the ITS region serves as an effective marker for target identification, providing sufficient resolution to distinguish closely related and co-occurring species, and (ii) the LAMP assay demonstrated up to 100% efficacy in detecting various members of the pea root rot complex, with no crossreactivity observed with non-target species.

[0162] Molecular detection and sensitivity of LAMP

[0163] The soil microbial community is extremely diverse, particularly in the vicinity of the plant and within the rhizosphere. Consequently, discerning the individual presence of specific members within the plant microbiome can be challenging. Therefore, it is crucial to explore the detection limit of a potential disease diagnostics tool to assess its effectiveness.

[0164] To evaluate the minimum detection threshold of the targeted pathogens using the LAMP assay, a range of their gDNA concentrations from 0.02 ng to 40 ng was tested (Figure 2). In the colorimetric assay, all primers effectively detected their respective targets at gDNA concentrations as low as 0.2 ng under optimised reaction conditions (Figure 2A).

[0165] 15293147-1M&C PC933755LU

[0166] 20

[0167] Notably, the F. solani primers showed weak but positive detection at the lowest tested concentration of 0.02 ng within 35 minutes. Additionally, using the RealAmp platform, a fluorescence signal was observed even at the lowest concentration of 0.02 ng at approximately 40 minutes for all pathogens (Figure 2B-E). For higher gDNA concentrations (>10 ng), signal saturation was evident, with detection occurring as early as 20 minutes, particularly for A. euteiches (Figure 2B). These results indicate that the LAMP assay is highly sensitive, reliably detecting pathogen gDNA at concentrations as low as 0.02 ng within 45 minutes. Notably, for F. solani, detection was achieved at concentrations of 0.0002 ng gDNA within 35 min (Fig. 2B). Furthermore, detection time can be reduced to 20 minutes when pathogen DNA concentrations exceed 10 ng.

[0168] Evaluation of F. solani and A. euteiches inoculum levels in pea roots and soil by LAMP

[0169] To evaluate the effectiveness of the LAMP primers in planta, controlled inoculation experiments were conducted using F. solani (FsolNIAB) and A. euteiches (AeRB84), both individually and as a co-inoculum. Five different concentrations of conidia or zoospores (10 to 105) were used to inoculate one-week old pea plants grown in axenic vermiculite, autoclaved soil and standard soil (Figure 3). Root tissue and adjacent soil were sampled for gDNA extraction and analysis two weeks after inoculation in the autoclaved substrates and four weeks after inoculation in the standard soil.

[0170] (i) Pathogen detection using LAMP in vermiculite

[0171] In vermiculite, colorimetric LAMP detected A. euteiches at an initial inoculum concentration of 102zoospores within 30 minutes, with partial colour change observed for co-inoculation with F. solani. Complete detection of all A. euteiches and co-inoculation concentrations was achieved within 45 minutes, except for the lowest concentration of 10 zoospores (Figure 3A). No off-target amplification was observed in control plants. These results were also confirmed by RealAmp (Figure 3B-C) which detected all A. euteiches concentrations above 10 zoospores within 40 minutes and F. solani concentrations, including the lowest at 10 spores, within 50 minutes. Notably, no fluorescence signal was observed in the control plants, even after 60 minutes of incubation. For spore concentrations between 103and 105in the co-inoculation experiment, gDNA extraction failed due to the extremely low amount of tissue recovered, likely caused by severe disease symptoms.

[0172] (ii) Pathogen detection using LAMP in autoclaved soil

[0173] 15293147-1M&C PC933755LU

[0174] 21

[0175] In experiments conducted with autoclaved soil in 50 ml tubes (Figure 3D-H), colorimetric LAMP detected A. euteiches concentrations at 104zoospores within 35 minutes and at 102zoospores after 60 minutes in root samples. In co-inoculation experiments with both FsolNIAB and AeRB84, detection sensitivity improved to 103zoospores at 35 minutes and 102zoospores by 60 minutes. However, using soil gDNA, the lowest concentration detected for both AeRB84 alone and co-inoculated samples with FsolNIAB was 103spores within 60 minutes. For F. solani, all concentrations were detected in root samples within 45 minutes and in soil within 60 minutes (Figure 3D). RealAmp analysis confirmed these findings (Figure 3E-H). For A. euteiches primers, fluorescence was detected in roots in less than 60 minutes for all concentrations tested, except for co-inoculated samples with 10 spores per organism (Figure 3E), whereas in the soil, the lowest concentration detected was 103spores at 60 minutes, both for AeRB84 alone and in coinoculation with FsolNIAB (Figure 3G). For F. solani primers, all tested concentrations were effectively detected in both roots (Figure 3F) and the soil (Figure 3H). As in previous tests, no signal was detected in the uninoculated control plants, indicating high specificity of the LAMP primers. These results provided an approximation of the detection threshold of our tool for assessing soil disease potential.

[0176] (iii) Pathogen detection using LAMP in standard soil

[0177] plants grown in pots containing standard soil where also evaluated as a proxy to investigate the detection capability when other microbiome members are present in the soil (Figure 3 l-M). Colorimetric LAMP detected A. euteiches zoospores at 103concentrations in roots within 35 minutes, which improved to 102zoospores in coinoculated samples with F. solani. At 60 minutes, the assay’s sensitivity increased, detecting 102zoospores in the single inoculations, while all tested concentrations were detected in co-inoculated samples. In soil, sensitivity was reduced by 10-fold, detecting 103spores for individual inoculation and 102spores for co-inoculation within 60 minutes (Figure 3I). Using F. solani primers, 102spores were detected in roots within 45 minutes and 103spores in soil, although co-inoculation showed improved sensitivity, enabling detection of 10 spores after 60 minutes. RealAmp confirmed these results, capturing pathogen concentrations more effectively (Figure 3J-M). For A. euteiches primers, all concentrations above 10 spores were successfully detected in the diseased roots (Figure 3J). In soil samples, initial concentrations of 103or higher were detected for single inoculation, while 102spores were detected in co-inoculated samples (Figure 3L). For F. solani primers, detection was successful for all tested concentrations in both roots and soil samples within 60 minutes (Figure 3K, M).

[0178] 15293147-1M&C PC933755LU

[0179] 22

[0180] (iv) LAMP comparison with qPCR

[0181] To compare the detection efficacy of the LAMP primers with qPCR, reactions were set up for all three substrates used in the experiments (Fig 6). In vermiculite tubes, qPCR analysis showed that A. euteiches detection matched LAMP sensitivity for initial inoculum concentrations as low as 102zoospores. However, after more than 30 cycles, off-target amplification was observed for both the lowest concentration of 10 zoospores and uninoculated controls (Figure 6A). In the autoclaved soil, A. euteiches concentrations below 102zoospores could not be clearly differentiated from the uninoculated controls in both root and soil samples (Figure 6C,E). For F. solani, qPCR struggled to differentiate spore concentrations in root samples but performed better with soil samples.

[0182] In pot assays using standard soil, qPCR detected both pathogens but failed to differentiate between their concentrations (Figure 6G-J). These results conclude that our LAMP assay demonstrated equivalent or superior sensitivity compared to qPCR, with no off-target amplification.

[0183] (v) Correlation of LAMP results with disease severity in plants

[0184] A clear correlation was observed between the LAMP detection threshold and disease severity in plants, with increasing pathogen concentrations linked to more severe symptoms (Figure 7). This trend was particularly evident at spore concentrations of 103or greater, especially for A. euteiches in microbiome-free substrates (Figure 7 A, B). In co- inoculation assays, the synergistic effect of the pathogens further exacerbated disease severity. These observations highlight the utility of LAMP for early detection and its correlation with disease progression. Samples with higher initial pathogen loads caused more severe disease symptoms, which could be reliably detected using LAMP in less than 45 minutes for both roots and soil.

[0185] These results conclude that colorimetric LAMP provides a rapid and qualitative tool for pathogen detection, while RealAmp has the potential to serve as an accurate quantitative alternative to qPCR for these pathogens. The high specificity of LAMP, along with its strong correlation between detection time and disease severity, reinforce its potential as an effective diagnostic tools for root rot pathogens.

[0186] LAMP as a portable diagnostic tool

[0187] The study aims to develop a diagnostics kit that is portable and suitable for use outside research facilities without requiring highly specialized technical skills. Currently, soil

[0188] 15293147-1M&C PC933755LU

[0189] 23

[0190] baiting is used as a standard diagnostic method for detecting root rot pathogens in the UK. We set up baiting plates with soil samples collected from the pea field with known incidence of root rot disease. Of 21 soil plates tested, oospores (a definitive sign of A euteiches infection) were detected in only one sample (JCM 2 R), while 13 plates exhibited characteristic honey-brown discoloration. Control plants displayed healthy roots, while infected samples (JCM 2 R and JCM 3 R) showed honey-brown discoloration and dark lesions typical of Fusarium infections (6). Notably, honey-browning often cooccurred with darker lesions even in the absence of visible oospores (Figure 4A).

[0191] Building on advancements in portable diagnostic tools, such as the PEBBLE device by Papadakis et al, which enables real-time quantitative colorimetric LAMP assays, we assessed its applicability to our system. Initial evaluations confirmed the efficacy of our primers for amplification across different concentrations of pure gDNA for the target pathogens (Figure 8). We also evaluated efficacy of the PEBBLE device using soil samples collected from fields with a known history of root rot disease along with our 4wpi soil samples included as control from previous experiment. gDNA was extracted from these samples using both a column-based method and our magnetic bead protocol and was subjected to PEBBLE and RealAmp analysis. Diseased root tissues from the field experiment showed positive detection for A. euteiches (JCM 2 R and JCM 3 R), while the bulk mixed soil (JCM W S) and control roots yielded negative results (Figure 4B, 4E; Figure 9A, 6). For the 4wpi pot experiment, root samples detection was successful for both 103and 105zoospores (Figure 4D and E, Figure 9B), while soil samples showed a positive signal for zoospores concentration of 105(Figure 4C), which was much more evident in the reaction colour change and the RealAmp (Figure 4E, Figure 9C). In all cases, no positive signal was captured from the control samples, showing the strong specificity towards the pathogens targeted. Altogether, the positive results observed for the PEBBLE device coupled with the quick gDNA extraction method open an exciting opportunity to a more accessible pea root rot testing in as little as 60 minutes.

[0192] Field study

[0193] In this example, we aimed to test the ability of the LAMP primers of the invention (as shown in Table 1) to accurately detect pea root rot pathogens within field soils from pea growing areas. The soils were tested using loop-mediated isothermal amplification (LAMP) for a subset of pea root rot pathogens (Fusarium solani, Fusarium oxysporum, Aphanomyces euteiches, Pythium ultimum). The soils were then evaluated for disease

[0194] 15293147-1M&C PC933755LU

[0195] 24

[0196] causing ability using two different methods of baiting, plate baiting (as used by PGRO for diagnosis) or pot baiting.

[0197] These experiments were performed using air-dried soil from 20 fields supplied by collaborators. These fields were either being considered for pea cultivation in the coming growing season or had exhibited root rot symptoms in the previous growing season.

[0198] As shown in Figure 11 (pre-baiting), the test was able to be used to identify pathogen containing fields with no further input. However, some fields showing no detectable pathogens in the “raw” soil were still able to cause severe symptoms during baiting, and when tested with LAMP after baiting were positive for previously undetected pathogens. This may suggest that, in the original test, the assay was only able to correctly positively identify fields with a high pathogen load.

[0199] We further tested the effect of addition of a growth stimulant in combination with the LAMP primers to detect even lower levels of pathogen present in the soil. The aim of the stimulant was to increase pathogen abundance in the soil, in a short as possible timeframe, to provide more DNA for amplification with LAMP. Increased target DNA would lead to increased sensitivity of the assay. The stimulant was added and incubated with the soil for 3 or 7 days to test the impact on pathogen detection. The stimulant in this scenario was broth made from germinated pea seedlings, ground, filtered and autoclaved. 4 soils were chosen for this test due to their change in LAMP results from pre and post baiting tests along with having unexpected disease scores (soils 6, 8, 13 & 19).

[0200] Using this stimulant (Figure 12), the LAMP assay is able to robustly detect F. solani within the field samples, without the requirement for baiting.

[0201] Material and Methods

[0202] Microbial isolates

[0203] All fungal and oomycete isolates used in this study are listed in Table 2. A subset of these isolates were obtained as pure cultures from various sources (Table 2), while others were isolated from the roots of pea plants grown in soil collected from an agricultural pea field in Reepham, Norfolk, UK. To test the specificity and sensitivity of the LAMP test, additional isolates from other species were included. These species were

[0204] 15293147-1M&C PC933755LU

[0205] 25

[0206] Fusarium redolens, Fusarium acuminatum, Phoma medicaginis and Rhizoctonia solani, and other common soil organisms such as Mucor hiemalis and Mortierella spp.

[0207] Table 2. Microbial strains used in this work

[0208] Isolate name Species Origin

[0209] BCCM / MUCL Agro-food & AeD Aphanomyces euteiches Drechsler Environmental Fungal Collection

[0210] AeRB84 Aphanomyces euteiches RB84 INRAE, IGEPP

[0211] Pul Pythium ultimum var. ultimum NIAB

[0212] FsolNIAB Fusarium solani _NIAB NIAB

[0213] FoxyNIAB Fusarium oxysporum_N\AB NIAB

[0214] FoxyRI Fusarium oxysporum Race 1 SASA

[0215] SA7 Phoma medicaginis NIAB

[0216] SA9 Rhizoctonia solani NIAB

[0217] SA13 Mucor hiemalis _MBV01222 This work

[0218] SA17 Mortierella sp._MBV01228 This work

[0219] SA27 Fusarium redolens_M GA01222 This work

[0220] SA39 Mucor / 7 / ema / / s_MBV01225 This work

[0221] SA49 Fusarium acuminatum_MGA0422'\ This work

[0222] SA59 Fusarium solani_M GA04227 This work

[0223] SA73 Fusarium solani_M GA 042215 This work

[0224] SA77 Fusarium oxysport / m_MGA042218 This work

[0225] SA87 Fusarium solani_MBV04223 This work

[0226] SA101 Fusarium so / an / _MGA052211 This work

[0227] SA105 Fusarium so / an / _M GA052213 This work

[0228] SA119 Fusarium recfo / ens_MGA052220 This work

[0229] Isolation of genomic DNA

[0230] For microbial gDNA extraction, liquid cultures were grown in 10 ml of Potato Dextrose Broth (PDB) (Formedium, UK) with one actively growing mycelial plug. After 3-5 days,

[0231] 15293147-1M&C PC933755LU

[0232] 26

[0233] the cultures were centrifuged, the supernatant was removed, and approximately 250 mg of mycelial pellet was crushed in liquid nitrogen using a pestle and mortar or with glass beads in a TissueLyser II (Qiagen, Germany).

[0234] When roots were used as the starting material, the entire root system was crushed in liquid nitrogen and 250 mg of tissue were taken for DNA extraction. The disrupted tissue was then processed using the DNeasy® PowerSoil® Pro kit (Qiagen, Germany), following the manufacturer’s instructions. The quality (A260 / A280) and quantity of the isolated DNA samples were evaluated using Nanodrop 2000 spectrophotometer (Thermo Fisher Scientific, USA) and Qubit fluorometer (Invitrogen, USA).

[0235] Plant material and sterilisation

[0236] Pisum sativum cv. Ambassador, provided by van Waveren Saaten Seeds (Germany), was used throughout this study for all in-planta experiments. The seeds were surface sterilised using 70% ethanol for 1 min, followed by a 2-minute immersion in a 5% sodium hypochlorite solution. Subsequently, the seeds were rinsed up to six times with sterile deionised water. The sterilised seeds were then placed on 1.5% water agar plates and incubated in the dark at 25 °C for three days to allow germination.

[0237] LAMP reaction setup and product visualisation

[0238] For the colorimetric LAMP reaction, a 10X primer mix containing all four primers was prepared. The FIP and BIP primers were prepared at a concentration of 16 pM, while F3 and B3 were prepared at 2 pM. The gDNA extracted from all samples was normalised to the same concentration, 20 ng / pl for roots and 5ng / pl for soil. Additionally, 20 ng of pure target gDNA was included as a positive control. Each reaction contained 10 pl of WarmStart® Colorimetric LAMP 2X Master Mix (NEB, USA), 2 pl of 10X primer mix and 1-5 pl of target DNA, with the final reaction volume adjusted to 20 pl using PCR grade water. For optimisation, different temperatures (65 and 66 °C) and reaction durations (35-60 minutes) were tested using a thermocycler. Results were visualised by observing colour changes with naked eye, and high-resolution images were taken using a white lighting panel.

[0239] Additionally, fluorometric LAMP assays were performed using the WarmStart® Fluorescent LAMP / RealAmp Kit (NEB, USA) following the manufacturer’s standard protocol. Each reaction mixture contained 10 pl multi-purpose LAMP / RT-LAMP 2X Master Mix (NEB, USA), 2 pl of 10X primer mix, 0.4 pl of LAMP Fluorescent Dye 50X

[0240] 15293147-1M&C PC933755LU

[0241] 27

[0242] (NEB, USA), 1-5 l of target DNA, with the final reaction volume adjusted to 20 pl using PCR grade water. The reaction was incubated at 66 °C for 60 min (as optimised for colorimetric assay). Fluorescent signals were recorded with the SYBR® / FAM channel of a CFX96 Real-Time PCR Detection System (Bio-Rad, USA) and relative fluorescence units (RFU) were plotted against time.

[0243] Evaluating the specificity and sensitivity of LAMP

[0244] The specificity of the LAMP assay was evaluated for all the primers sets across a set of 20 fungal and oomycete isolates (Table 1). The primer sets were tested by setting up a colorimetric LAMP reaction with 10 ng of microbial gDNA at 66 °C for 35-41 minutes. A positive LAMP reaction was indicated by a colour change from pink to bright yellow, while negative reactions remained pink.

[0245] To determine the minimum detectable concentration of the pathogens, a serial dilution of their gDNA ranging from 0.0002 ng up to 40 ng was utilised as input for both the colorimetric and RealAmp LAMP assay at 66 °C for 35-41 minutes and 60 minutes respectively.

[0246] In planta severity assays and inoculum preparation

[0247] For the in planta severity assays, different substrate mixes were used depending on the experimental setup. In the vermiculite-based assay, 25 ml glass tubes were filled with pre-wetted medium-grade vermiculite, followed by 10 ml of modified Fahraeus medium (modFP) containing 1 mM CaCh, 0.5 mM MgSCL, 0.7 mM KH2PO4, 0.8 mM Na2HPC>4, 50 pM Fe EDTA and 0.1 mg / L of each of the following microelements: MnSCL, CuSCL, ZnSC>4, H3BO3 et Na2MoC>4, with the pH adjusted to 6. The entire system was autoclaved and stored at room temperature until use. For the autoclaved soil-based assay, a 1:1 mixture of John Innes Centre’s cereal mix and sand was prepared and used to fill 50 ml tubes to a volume of 45 ml, after which 10 ml of distilled water was added. The tubes were then autoclaved and stored at room temperature until use. In the pot assay, 9cm pots were filled with the same cereal mix (JIC) and sand mixture used in the autoclaved soil-based assay and used immediately.

[0248] Three-days old pea seedlings were transplanted into the 25 or 50 ml tubes and 5 ml of denoised water was added after transplanting. In the pot assay, two seedlings were planted per pot. Plants were kept in a controlled growth chamber set at 25 °C during the day and 23 °C at night, with a 14-hour light / 10-hour dark cycle. Watering was done twice

[0249] 15293147-1M&C PC933755LU

[0250] 28

[0251] weekly, with 5 ml added to the tubes and 30 ml added to the pots. Plants were inoculated at seven days post-planting with different combinations of AeRB84 and FsolNIAB. To prepare AeRB84 zoospores, 6-10 plugs of actively growing mycelium were transferred into 25 ml of PG medium (20 g / L peptone, 5 g / L glucose) and statically incubated in the dark at 25 °C for about 10 days. The mycelial mats were rinsed at 2-hour intervals with Volvic water and incubated for at least 16 hours at 25 °C with shaking at 60 rpm. Zoospore concentrations were assessed the following day under a microscope using a hemacytometer and diluted to a final concentration of 105zoospores / ml. To prepare FsolNIAB conidia, 200 ml of PDB medium was inoculated with up to three plugs of actively growing mycelium and incubated in the dark at 25 °C for 5-7 days. Cultures were then filtered through two layers of sterile Miracloth, spores were counted under a microscope using a hemacytometer and the inoculum was diluted to a final concentration of 105conidia / ml using PBS (Formedium, UK) before setting up dilution series. For coinoculation assays, AeRB84 zoospres and FsolNIAB spores were mixed in a 1:1 ratio and 1 ml of the the suspension was applied at the base of each plant. Plants were evaluated at 2 or 4 wpi and gDNA was extracted from both root and soil samples as described earlier.

[0252] qPCR for detection of F. solani and A. euteiches

[0253] Previously published primers were used to detect the presence of F. solani (11) and A. euteiches (10) in pea plants inoculated during the disease severity assay. gDNA extracted from all samples was normalised to the same concentration: 20 ng / pl for roots and 5ng / pl for soil. Additionally, 20 ng of pure gDNA from the target was included as a positive control. qPCR reactions were prepared using 2x qPCRBIO SyGreen Mix Lo-ROX (PCR Biosystems, UK) following the manufacturer’s instructions. The reactions were run with an annealing temperature of 60 °C with 40 amplification cycles, and data was acquired on the FAM channel using a CFX96 Real-Time PCR Detection System (Bio-Rad, USA).

[0254] Soil sampling and root rot baiting

[0255] Field soil was collected from a site that showed severe pea root rot symptoms during the previous growing season (coordinates: 52.56765, 0.04128). Soil was sampled across the field in a W pattern, starting in the south-eastern corner, with samples taken approximately every 50 meters. Using these soil samples, root rot soil baiting was carried out as described by Processors and Growers Research Organisation (PGRO) (20).

[0256] 15293147-1M&C PC933755LU

[0257] 29

[0258] Briefly, sterilised pea seeds were germinated in the dark for five days before being transferred to petri dishes containing two layers of sterile filter paper, 15 g of air-dried field soil was placed on one edge of each dish and 9 ml of sterile water was added. Seedlings were positioned such that their roots made contact with the soil while the seeds and shoots remained uncontaminated. The plates were sealed with micropore tape and incubated in the dark at 25 °C for 11-14 days. After incubation, seedlings were removed from the soil, washed with water and photographed. Root and / or soil samples were flash-frozen in liquid nitrogen for subsequent DNA extraction.

[0259] Microscope slides were prepared by cutting 0.5-1 cm pieces of root, ensuring a mix of primary and lateral roots. These sections were placed on a slide and crushed using another slide. A small volume of either water or trypan blue solution was added, a coverslip was placed on the top and slides were stored at 4 °C as they were not fixed. Microscopy was performed using a Zeiss Axio Imager in brightfield mode at 20x and 40x with air lenses. Images were captured using an AxioCam 506 colour camera with a colibri 7 light source. Post-capture processing was conducted using Fiji (Imaged), including gamma correction (0.45), white balancing, and scale bar calibration.

[0260] PEBBLE-based LAMP assay

[0261] A magnetic bead-based DNA extraction protocol was optimised for both soil and root tissue, following a modified version of the protocol described by Radhakrishnan et al.( Radhakrishnan GV, Cook NM, Bueno-Sancho V, Lewis CM, Persoons A, Mitiku AD, et al. MARPLE, a point-of-care, strain-level disease diagnostics and surveillance tool for complex fungal pathogens. BMC Biol. 2019;17(1):65). For this protocol, either 3 cm of root tissue or 250 mg of soil was used as the input material, along with 800 iL of lysis buffer. For roots, the tissue was disrupted with a mini pestle, followed by the addition of glass beads and vortexing for 5 minutes. For soil samples, glass beads were added directly to the soil before vortexing for 5 minutes. The resulting lysate was incubated in lysis buffer for 10 minutes and centrifuged at 13,000 g for 3-5 minutes. Subsequently, 500 .L of the supernatant was transferred into a fresh tube, and 50 iL of SeraSil-Mag™ 400 beads (Cytiva, USA) and 600 iL of binding buffer were added. The remaining steps of the protocol followed the original procedure without modification. gDNA was quantified using a Qubit fluorometer, with concentrations ranging from 1 to 6 ng / .L. The extracted gDNA was used directly for the LAMP assay.

[0262] 15293147-1M&C PC933755LU

[0263] 30

[0264] The LAMP assay was performed using the PEBBLE-R qcLAMP platform (BIOPIX DNA TECHNOLOGY P.O, Greece), a device capable of executing real-time colorimetric LAMP. WarmStart Colorimetric LAMP 2X Master Mix (NEB, USA) was used following the manufacturer's standard protocol with 5 iL of gDNA as input. Due to the design of the heating device in the PEBBLE platform, the reaction was incubated at an elevated temperature of 78-80 °C for 60 minutes to achieve 66 °C in the sample.

[0265] Determining the detection threshold

[0266] To evaluate the minimum detection threshold of the targeted pathogens using the LAMP assay, a range of different gDNA concentrations was tested (Fig. 2). In the colorimetric assay, concentrations from 0.0002 to 40 ng were tested (Fig. 2A). All primer sets effectively detected their respective targets at gDNA concentrations as low as 0.2 ng under optimised reaction conditions (Fig. 2A). Notably, the F. solani primers showed weak but positive detection even at the lowest concentration of 0.0002 ng (0.2 pg) within 35 min. Additionally, using the RealAmp platform, concentrations ranging from 0.02 to 40 ng were also tested, with fluorescence signals observed at the lowest concentration (0.02 ng) within 40 min for all pathogens (Fig. 2B-E). At higher gDNA concentrations (>10 ng), signal saturation was observed, and detection occurred as early as 20 min, particularly for A. euteiches (Fig. 2B). These results demonstrate that the LAMP assay is highly sensitive, reliably detecting pathogen gDNA at concentrations as low as 0.02 ng within 45 min for all the pathogens tested, except F. solani for which detection was achieved at 0.0002 ng within 35 min. Furthermore, detection time can be reduced to 20 min when pathogen DNA concentrations exceed 10 ng.

[0267] Sequences

[0268] SEQ ID NO: 17 (Figure 1A, A. euteiches) ATCATTACCACACCAAAAAAACCATCCACGTGAATGTGTATTCTTTATGAGGCTTG TGCTCTTTTCAGGGGCTAGCCGAAGGTTTCGCAAGGAACCGATGTATTTTTAATCC CTTTATAAATGACTGATTTAAACTAGCATCAGAAATGAAGCTCAATTCTATACAACT TTCAACAGTGGATGTCTAGGCTCGCACATCGATGAAGACCACAGCGAACTGTGAT ACGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAACGTTGAAC

[0269] SEQ ID NO: 18 (Figure 1A, P.ultimum left hand side)

[0270] TTGTAATCGAAG

[0271] 15293147-1M&C PC933755LU

[0272] 31

[0273] SEQ ID NO: 19 (Figure 1A, P.ultimum right hand side)

[0274] AAATACTGATTTATACTGTGGGGACGAAAGTCCTTGCTTTTACTAGATAACAACTTT CAGCAGTGGATGTCTAGGCTCGCACATCGATGAAGAACGCTGCGAACTGCGATA CGTAATGCGAATTGCAGAATTCAGTGAGTCATCGAAATTTTGAACGCATATTGCAC TTTCGGGTTATGCCTGGAAGTATGTCTGTATCAGTGTCCGTAAATCAAACTTGCCT TTCTTTTTCTGTGTAGTCAGGGATGGA

[0275] SEQ ID NO: 20 (Figure 1A, F. solani left hand side)

[0276] Tgtgggcacadg

[0277] SEQ ID NO: 21 (Figure 1A, F. solani right hand side) CADGCCGTAAAACACCCAATCTTCTGAATGTTGACCTCGAATCAGGTAGGAACTTA AGCATATCAATAAGCGGAGGAAAAGAAACCAACAGGGATTGCCCCAGTAACGGC GAGTGAAGCGGCAACAGCTCAAATTTGAAATCTGGCTCTCGGGCCCGAGTTGTAA TTTGTAGAGGATGCTTTTGGTGAGGTGCCTTCCGAGTTCCCTGGAACGGGACGCC ATAGAGGGTGANAGCCCCGTCTGGTTGG

[0278] SEQ ID NO: 22 (Figure 1A, F. oxysporum left hand side) - intentionally skipped as less than 10 defined nucleotides.

[0279] CCCCTAAA

[0280] SEQ ID NO: 23 (Figure 1A, F. oxysporum right hand side) AAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCAAAAT GCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCATCGAATCTTTGAACGC ACATTGCGCCCGCCAGTATTCTGGCGGGGCATGCTGTTCGAGCGTCATTTCAACC CTCAAGCACAGCTTGGTGTTGGGACTCGCGTTAATTCGCGTTCCTCAAATTGATTG GCGGTCACGTCGAGCTTCCATAGC

[0281] 15293147-1

Claims

M&C PC933755LU32CLAIMS:

1. A method for the detection of at least one pathogen in a sample, wherein the method comprises collecting the sample and performing loop-mediated isothermal amplification (LAMP) on the sample using at least one primer set, wherein each primer set comprises at least four primers, and wherein the primer set is selected froma. SEQ ID NO: 1 to 4 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 1, 2, 3 and 4 respectively; and / orb. SEQ ID NO: 5 to 8, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 5, 6, 7 and 8 respectively; and / orc. SEQ ID NO: 9 to 12, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 9, 10, 11 and 12 respectively; and / ord. SEQ ID NO: 13 to 16 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 13, 14, 15 and 16 respectively.

2. The method of claim 1, wherein the pathogen is a plant pathogen, preferably a root rot pathogen.

3. The method of claim 1 or 2, wherein the pathogen is selected from the genus:Aphanomyces and / or Fusarium and / or Pythium.

4. The method of claim 3, wherein the pathogen is selected from Aphanomyces euteiches.

5. The method of claim 3, wherein the pathogen is selected from F. avenaceum, F.oxysporum, F. redolens, and F. solani.

6. The method of claim 3, wherein the pathogen is Pythium ultimum.

7. The method of any preceding claim, wherein the method comprises performing LAMP or RealAmp.15293147-1M&C PC933755LU338. The method of claim 7, wherein the method comprises determining from LAMP the type of pathogen present in the sample.

9. The method of claim 7, wherein the method comprises determining from RealAmp the quantity of pathogen present in the sample.

10. The method of any preceding claim, wherein the sample is a soil sample or a plant sample.

11. A kit for the detection of at least one pathogen, the kit comprising at least one LAMP primer set, wherein the primer set is selected froma. SEQ ID NO: 1 to 4 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 1, 2, 3 and 4 respectively; and / orb. SEQ ID NO: 5 to 8, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 5, 6, 7 and 8 respectively; and / orc. SEQ ID NO: 9 to 12, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 9, 10, 11 and 12 respectively; and / ord. SEQ ID NO: 13 to 16 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 13, 14, 15 and 16 respectively.

12. The kit of claim 11, wherein the pathogen is a plant pathogen, preferably a root rot pathogen.

13. The kit of claim 12, wherein the pathogen is selected from the genus:Aphanomyces and / or Fusarium and / or Pythium.

14. The kit of claim 13, wherein the pathogen is selected from Aphanomyces euteiches.

15. The kit of claim 13, wherein the pathogen is selected from F. avenaceum, F.oxysporum, F. redolens, and F. solani.

16. The kit of claim 13, wherein the pathogen is Pythium ultimum.15293147-1M&C PC933755LU3417. The kit of claim 13, wherein the device is capable of performing LAMP or RealAmp.

18. A loop-mediated isothermal amplification (LAMP) primer set specific for at least one plant root rot pathogen, wherein the primer set is selected froma. SEQ ID NO: 1 to 4 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 1, 2, 3 and 4 respectively; andb. SEQ ID NO: 5 to 8, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 5, 6, 7 and 8 respectively; andc. SEQ ID NO: 9 to 12, or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 9, 10, 11 and 12 respectively; andd. SEQ ID NO: 13 to 16 or variants thereof, wherein the variants have at least 60% overall sequence identity to SEQ ID NO: 13, 14, 15 and 16 respectively.

19. Use of the LAMP primer set of claim 18 to detect at least one plant root rot pathogen in a sample, wherein preferably the sample is selected from a soil or plant sample.15293147-1

Images