RNA engineering and direct sequencing
By engineering RNA molecules with a 3’-terminal polynucleotide tail, direct sequencing methods can accurately assess RNA integrity and purity, overcoming limitations of existing technologies that require a poly(A) tail.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- LONZA SALES AG
- Filing Date
- 2026-01-22
- Publication Date
- 2026-07-30
AI Technical Summary
Current RNA sequencing methods, such as nanopore sequencing, are limited in their ability to detect RNA molecules without a poly(A) tail, leading to undetected impurities and inaccuracies in RNA integrity assessment.
Engineering RNA molecules to incorporate a 3’-terminal polynucleotide tail comprising nucleoside analogs, allowing for direct sequencing to determine sequence characteristics like length, identity, and poly(A) tail presence or absence, independent of the original poly(A) tail.
Enables accurate determination of RNA integrity and purity by distinguishing between natural nucleotides and nucleoside analogs, improving the detection of degraded or non-polyadenylated RNA molecules.
Smart Images

Figure IMGF000004_0001 
Figure IMGF000005_0001 
Figure IMGF000005_0002
Abstract
Description
[0001] LO019P -1- 260122
[0002] RNA ENGINEERING AND DIRECT SEQUENCING
[0003] FIELD OF THE INVENTION
[0004] The invention refers to certain methods and kits for engineering RNA molecules to allow direct determination of sequence characteristics by direct sequencing.
[0005] BACKGROUND RNA-based therapeutics are promising treatment strategies in immunotherapy, gene therapy, and cancer treatments. RNA or mRNA may be produced either synthetically via organic chemical syntheses or enzymatically via an In vitro Transcription (IVT) reaction. The latter approach is at present favored for larger molecules. During these processes, side products are formed that differ from the desired molecule. In addition, mRNA molecules are intrinsically unstable. Following storage or further processing (e.g. encapsulation into Lipid Nanoparticles (LNPs)), the molecules can degrade which leads to the formation of by-products.
[0006] The purity of RNA preparations is a Critical Quality Attribute (CQA) of a RNA preparation. Therefore, it is important to measure the integrity of RNA molecules when producing pharmaceutical products such as a drug or vaccine.
[0007] Currently, RNA integrity is assessed mainly via size and / or charge separationbased analytical techniques: UHPLC-UV and Capillary Gel Electrophoresis (CGE). Both assess samples that contain mixtures of RNA from which the purity of the desired species is measured. Both UHPLC-UV and CGE are limited in terms of resolution to distinguish integer molecules ( / .e. desired RNA constructs or products) from side products.
[0008] Oxford Nanopore Technologies pic. (UK, “ONT”) provides a DNA / RNA sequencing technology called “nanopore sequencing” which employs flow cells that contain an array of nanopores embedded in an electro-resistant membrane. Each nanopore corresponds to its own electrode connected to a channel and sensor chip, which measures the electric current that flows through the nanopore. When a molecule passes through a nanopore, the current is disrupted to produce a characteristic ‘squiggle’. The squiggle is then decoded using base calling algorithms to determine the DNA or RNA sequence in real time.
[0009] When determining RNA integrity of a RNA preparation by nanopore sequencing, RNA molecules contained in the preparation shall be analyzed and the distribution orLO019P -2- 260122
[0010] proportion of RNA molecules with a correct RNA sequence in said preparation determined.
[0011] The Direct RNA Sequencing Kit (SQK-RNA004) of ONT can be used to prepare poly(A)-tailed RNA for sequencing by attaching a sequencing adapter that contains a motor protein which regulates transit of the RNA molecule through the nanopore. Prior to attachment of the sequencing adapter, reverse transcription is performed to synthesize a complementary DNA strand for improved stability and sequencing output.
[0012] At present, nanopore sequencing cannot be used for measuring RNA that does not have a poly(A) tail. This is because the presence of a poly(A) oligomer at the 3’-end of the RNA is required to attach a commercially available double-stranded primer (a reverse transcription adaptor) containing a single-stranded (ss) oligo(T) overhang on its 5’ end (also referred to as 5' oligo(dT) overhang) to anneal to the poly(A) tail and initiate reverse transcription.
[0013] Therefore, any RNA molecules that do not contain a poly(A) moiety would not be detected by the current method of nanopore sequencing. For example, an originally integer RNA molecule that has lost its poly(A) moiety through hydrolysis cannot be determined by such a method, despite contributing to impurities in a preparation of RNA including molecules that contain a poly(A) moiety.
[0014] Wang et al. (Nature Biotechnology 2021, 39:1348-1365) review the nanopore sequencing technology and its applications.
[0015] W02013067208A1 discloses sequencing of a nucleic acid sample by associating oligonucleotide analogs comprising universal bases which do not form hydrogen bonds with A, C, T or G, and directing the nucleic acid sample through a nanopore, where an individual oligonucleotide analog becomes disassociated from the nucleic acid sample as the sequence of the nucleic acid sample is determined.
[0016] US20240309447A1 discloses methods for preparing a sample of RNA molecules for sequencing. In a “one-pot 3’-extension reaction”, the sample is first reacted with a reaction mixture of a poly(A) polymerase and nucleotides analogues to add a first RNA tail and then with ATP to add a second tail consisting of an oligo(A) sequence onto the first tail. The first tail can serve as a marker to locate the last base of the 3’-tail of individual RNA molecules, and the second tail anneals with the sequencing adapter.
[0017] Yuan Yinan et al. (preprint doi: https: / / doi.org / 10.1101 / 2024.02.24.581884; the version posted February 25, 2024) discloses 3'-end tailing of RNA for nanopore directLO019P -3- 260122
[0018] total RNA sequencing using yeast poly(A) polymerase (YPAP) to add modified ATP analogs, in particular 2'-O-methyladenosine.
[0019] US2020377875A1 discloses a method of adding a polymer of non-canonical nucleotides to the 3' end of a ribonucleic acid (RNA) using a polynucleotide-3' nucleotidyl transferase and non- canonical nucleotides, in particular inosine, 5-methyluracil (ribothymidine), 4-thiouracil, 6-methyladenine, or 2'-O-methyladenine.
[0020] SUMMARY OF THE INVENTION
[0021] It is the objective of the invention to improve methods of direct RNA sequencing by direct sequencing to allow measuring sequence characteristics of RNA molecules. It is a further objective to determine one or more sequence characteristics for the integrity of mRNA molecules or mixtures of mRNA molecules (such as total length, sequence identity and poly(A) tail length) by direct sequencing, independent of the presence or absence or length of a poly(A) tail. Specifically, it is the objective of the invention to provide improved methods to determine the distribution of one or more sequence characteristics in mixtures of RNA molecules (e.g., mRNA molecules), such as the purity of RNA (or mRNA) preparations.
[0022] The objective of the invention is solved by the subject matter as claimed, and as further described herein.
[0023] According to a specific aspect, RNA molecules are engineered to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA), thereby forming a polynucleotide NA tail, the method preferably comprising in vitro enzymatic treatment of the RNA molecule with
[0024] i) a nucleotidyltransferase using using at least one nucleoside triphosphate analog as a substrate, wherein said at least one nucleoside triphosphate analog comprises said at least one NA; or
[0025] ii) a ligase and a polynucleotide tail block which comprises said at least one NA.
[0026] Specifically, said polynucleotide NA tail comprises said at least one NA in the form of respective nucleotides, specifically in the form of nucleoside triphosphates.
[0027] The respective nucleotides are also referred to as nucleotide analogs. The respective nucleoside triphosphates are also referred to as nucleoside triphosphate analogs.
[0028] The invention specifically provides for a method of engineering an RNA molecule to incorporate a 3’-terminal polynucleotide tail, which consists of nucleotides comprisingLO019P -4- 260122
[0029] a nucleoside analog (NA), thereby forming a polynucleotide NA tail, and determining one or more sequence characteristics of the RNA molecule by direct sequencing, the method comprising
[0030] a) in vitro enzymatic treatment of the RNA molecule with
[0031] i) a nucleotidyltransferase using a nucleoside triphosphate analog as a substrate, wherein said nucleoside triphosphate analog comprises said NA; or
[0032] ii) a ligase and a polynucleotide NA tail block which consists of nucleotides comprising an NA,
[0033] thereby obtaining an RNA construct comprising the RNA molecule with a 3’-terminal polynucleotide NA tail; and
[0034] b) direct sequencing of the RNA construct to determine said one or more sequence characteristics;
[0035] wherein the NA is an adenosine analog of a compound selected from Formula (I), (II) (III), or (IV),
[0036] Formula (I):
[0037]
[0038] RO is OH or NH2;
[0039] R1 is N or CH;
[0040] R2 is N or CH;
[0041] R3 is O, S, NH or CH2;
[0042] R4 is O, S, NH or CH2;
[0043] R5 is O, S, N or CH;
[0044] R6 is OH, H, N3, F, or Cl;
[0045] R7 is a triphosphate.LO019P -5- 260122
[0046] Formula (II)
[0047]
[0048] RO is OH or NH2;
[0049] R1,2,3,4, and 5 are independently selected from N or CH; R6 is OH, H, N3, F, or Cl;
[0050] R7 is a triphosphate.
[0051] Formula (III)
[0052]
[0053] RO is OH or NH2;
[0054] R1 is N or CH;
[0055] R2 is N or CH;
[0056] R3 is O, S, NH or CH2;
[0057] R4 is O, S, NH or CH2;
[0058] R5 is O, S, N or CH;
[0059] R6 is a triphosphate.LO019P -6- 260122
[0060] Formula (IV)
[0061]
[0062] RO is OH or NH2
[0063] R1,2,3,4, and 5 are independently selected from N or CH;
[0064] R6 is a triphosphate.
[0065] A preferred adenosine analog as used in any of the methods and products or kits described herein is 7-deaza adenosine.
[0066] Specifically, the polynucleotide NA tail consists of nucleotides with the same NA or a mix of NA, such as selected from Formula (I), (II) (III), or (IV), preferably the same NA.
[0067] Specifically, said polynucleotide NA tail comprises at least one nucleotide analog which comprises said at least one NA, specifically in the form of nucleoside triphosphate analogs.
[0068] Specifically, said at least one NA is comprised in the polynucleotide NA tail at its 5’-end.
[0069] Specifically, said polynucleotide tail block comprises said at least one NA at its 5’-end.
[0070] Said at least one NA is preferably used as a starting point of the addition of nucleotides to the RNA molecule RNA. Specifically, at least the first nucleotide attached to the RNA molecule is a NA.
[0071] Preferably,
[0072] a) said at least one NA is comprised in the polynucleotide NA tail at its 5’-end; and
[0073] b) said polynucleotide tail block comprises said at least one NA at its 5’-end. Specifically, said at least one NA, said polynucleotide NA tail and / or said polynucleotide tail block are characterised as further described herein.
[0074] Preferably, the RNA is an mRNA. The mRNA may contain a poly(A) tail of varying length or no poly(A) tail. In a preparation of mRNA, a target mRNA may comprise a specific sequence and a defined poly(A) tail, or no poly(A) tail. Such mRNA preparationLO019P -7- 260122
[0075] may comprise various mRNA molecules which comprise similar or distinct nucleotide sequence, such as a poly(A) tail of varying length or without a poly(A) tail. Engineering RNA molecules as described herein particularly allows for determining one or more sequence characteristics of said various mRNA molecules comprised in an mRNA preparation, by direct sequencing.
[0076] Specifically, direct sequencing as described herein is direct nanopore sequencing (also referred to as nanopore direct sequencing), abbreviated “nanopore sequencing”.
[0077] Preferably, the RNA molecules are engineered before direct (or nanopore) sequencing.
[0078] Specifically, said direct sequencing is by direct RNA sequencing, in particular nanopore sequencing.
[0079] Specifically, said direct sequencing comprises measuring the current passing through the pore as the RNA moves with respect to the pore wherein the current passing is indicative of the RNA sequence.
[0080] Typically, each nucleoside or NA (either one or both of a nucleoside or NA is herein also referred to as “base”) results in a unique current, which is converted to sequence by an algorithm called “basecaller”. The basecaller uses a recurrent neural network (RNN) that has been trained to recognize patterns in the raw current signal that are associated with a particular base or a particular sequence. Basecalling models can be used, which can identify the specific bases on which they have been trained, e.g., one or more or all of adenine (A), guanine (G), cytosine (C), uracil (U), and / or one or more NAs, such as an NA as used in the polynucleotide NA tail.
[0081] According to a specific aspect, one or more NAs can be distinguished from other bases by the direct sequencing method described herein. Specifically, the basecalling model may employ an RNN that has been trained to recognize a respective signal or pattern that indicates the presence of said one or more specific NAs.
[0082] Depending on the basecalling model, said NAs may contribute to the base call (if the model has been trained to recognize said NAs), or not contribute to the base call (if the model has not been trained to recognize said NAs).
[0083] According to a specific aspect, a model is used which does not recognize one or more specific NAs such as used herein during base calling.
[0084] According to another specific aspect, a model, a model is used to identify one or more specific NAs such as used herein.LO019P -8- 260122
[0085] According to a specific aspect, one or more sequence characteristics are determined which are selected from the group consisting of: (i) the length of the RNA molecule, (ii) the identity of the RNA molecule, (iii) the sequence of the RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the RNA molecule, (v) the secondary structure of the RNA molecule, and (vi) whether or not the RNA molecule is modified, or whether or not the RNA molecule comprises a nucleoside analog.
[0086] Specifically, said one or more sequence characteristics are determined by direct sequencing of the of the RNA construct which comprises the polynucleotide NA tail.
[0087] Specifically, said direct sequencing comprises the following method steps: a) annealing and ligating a double-stranded reverse transcription adaptor to the RNA construct, wherein the reverse transcription adaptor comprises a single-stranded overhang at its 5'-end which specifically hybridizes with at least the 3’-terminal part of the polynucleotide NA tail;
[0088] b) reverse-transcription to produce an RNA-DNA hybrid duplex;
[0089] c) ligating a sequencing adaptor to the 3’-end of the reverse transcription adaptor, which sequencing adaptor comprises a motor protein that has the ability to control movement of the RNA strand of the hybrid duplex through a transmembrane pore; d) determining one or more sequence characteristics of the RNA strand by direct sequencing by measuring the current passing through the pore as the RNA moves with respect to the pore wherein the current is indicative of the RNA sequence, preferably wherein the current is indicative of the RNA sequence and discriminates between a natural nucleotide and the NA (in particular a nucleotide comprising the NA); and e) determining the respective sequence characteristics of the target RNA molecule.
[0090] According to a specific aspect, the invention further provides for a method for determining the integrity of a target RNA molecule preparation using the method of engineering an RNA molecule to incorporate a 3’-terminal polynucleotide tail as further described herein, wherein the distribution or proportion of said one or more sequence characteristics specific for said target RNA molecule is determined by said direct sequencing.
[0091] According to a specific aspect, the invention further provides for a method of comparing one or more sequence characteristics of RNA molecules using the method of engineering an RNA molecule to incorporate a 3’-terminal polynucleotide tail as furtherLO019P -9- 260122
[0092] described herein, wherein results of said direct sequencing that are specific for the RNA molecules are compared.
[0093] According to a specific aspect, the invention further provides for a method for determining degraded mRNAs with a shortened poly(A) tail or non-polyadenylated mRNAs in a preparation of mRNA molecules using the method of engineering an RNA molecule to incorporate a 3’-terminal polynucleotide tail as further described herein, wherein differences of the RNA molecules in the poly(A) tail are compared to a correct poly(A) tail, by said direct sequencing.
[0094] Specifically, said direct sequencing described for methods or uses as further described herein is nanopore sequencing.
[0095] According to a specific aspect, the invention further provides for a kit for engineering an RNA molecule to incorporate a 3’-terminal polynucleotide NA tail, which comprises at least one nucleoside analog (NA), comprising:
[0096] i) a poly(N) polymerase and a substrate for said poly(N) polymerase, wherein the substrate is a nucleoside triphosphate analog which comprises said at least one NA; or the nucleotide comprising the NA; or
[0097] ii) a ligase and a polynucleotide tail block which comprises said at least one NA; wherein the polynucleotide NA tail is characterized by the following:
[0098] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;
[0099] b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA;
[0100] wherein the NA is an adenosine analog which is of a compound selected from Formula (I), (II) (III), or (IV), as further described herein. Preferably, the adenosine analog is 7-deaza adenosine.
[0101] Preferably, the poly(N) polymerase is an E. coli poly(A) polymerase.
[0102] According to a specific aspect, the invention further provides for a new use of an RNA molecule comprising a 3’-terminal extension with a polynucleotide NA tail, which consists of nucleotides comprising a nucleoside analog (NA), in a method of direct sequencing to determine one or more sequence characteristics of the RNA molecule without the polynucleotide NA tail, wherein the NA is an adenosine analog which is of a compound selected from Formula (I), (II) (III), or (IV), as further described herein. Preferably, the adenosine analog is 7-deaza adenosine.LO019P -10- 260122
[0103] Preferably, the polynucleotide NA tail described herein for a method, product (in particular an RNA molecule, preferably mRNA), use or kit as further described herein, is characterized by one or more of the following:
[0104] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;
[0105] b) the polynucleotide NA tail consists of nucleotides with the same NA.
[0106] According to a specific aspect, the invention further provides for an RNA molecule comprising a 3’-terminal polynucleotide NA tail, which polynucleotide NA tail comprises at least one nucleoside analog (NA), wherein the NA is an adenosine analog which is of a compound selected from Formula (I), (II) (III), or (IV), as further described herein. Preferably, the adenosine analog is 7-deaza adenosine.
[0107] Specifically, the RNA molecule of the invention is characterized by one or more of the features described herein when further describing herein a method, product, use, or kit as described herein.
[0108] Preferably, the RNA molecule described herein comprises a polynucleotide NA tail as further described herein.
[0109] Preferably, the RNA molecule described herein in a method, product, use or kit as further described herein is an artificial RNA molecule, in particular an artificial mRNA molecule or an mRNA molecule in an in vitro preparation of mRNA molecules.
[0110] Preferably, the invention provides for a preparation of RNA molecules, in particular an mRNA preparation, wherein the RNA molecules are as further described herein. Specifically, the RNA preparation, in particular the mRNA preparation is an artificial and / or in vitro preparation.
[0111] Specifically, the preparation of RNA molecules, in particular the mRNA preparation, comprises RNA molecules with the same polynucleotide NA tail, or wherein at least any one of 50%, 60%, 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the RNA molecules comprise the same polynucleotide NA tail.
[0112] Specifically, the preparation of RNA molecules, in particular the mRNA preparation, comprises RNA molecules of the same coding sequence, which may or may not differ in the length or composition of the 3’-tail. Specific RNA preparations, in particular mRNA preparations, comprise a 3’-tail which may or may not comprise a poly(A)-sequence, or a variety of poly(A)-sequences of different length. Specifically, the RNA molecules, in particular the mRNA molecules, comprise a variety of poly(A)-LO019P -11- 260122
[0113] sequences of different length, or no poly(A)-sequence that is positioned 3’ to the coding sequence and 5’ to the polynucleotide NA tail.
[0114] Preferably, the polynucleotide NA tail of the RNA molecule (preferably, the mRNA molecule) is characterized by one or more of the following:
[0115] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;
[0116] b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
[0117] According to a specific aspect, the invention further provides for a method of engineering an RNA molecule to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA), thereby forming a polynucleotide NA tail, the method comprising in vitro enzymatic treatment of the RNA molecule withi) a nucleotidyltransferase using at least one nucleoside triphosphate analog as a substrate, wherein said at least one nucleoside triphosphate analog comprises said at least one NA; or
[0118] ii) a ligase and a polynucleotide tail block which comprises said at least one NA.
[0119] According to a specific aspect, the invention further provides for a method for determining one or more sequence characteristics of a target RNA molecule by direct sequencing, the method comprises:
[0120] a) engineering the target RNA molecule to incorporate a 3’-terminal polynucleotide tail, which comprises at least one nucleoside analog (NA), thereby obtaining an RNA construct comprising the target RNA molecule with a 3’-terminal polynucleotide NA tail,
[0121] preferably wherein said one or more sequence characteristics are selected from the group consisting of: (i) the length of the RNA molecule, (ii) the identity of the RNA molecule, (iii) the sequence of the RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the RNA molecule, (v) the secondary structure of the RNA molecule, and (vi) whether or not the RNA molecule is modified, or whether or not the RNA molecule comprises a nucleoside analog,
[0122] optionally wherein the method further comprises after step a) the following method steps:
[0123] b) annealing and ligating a double-stranded reverse transcription adaptor to the RNA construct, wherein the reverse transcription adaptor comprises a single-strandedLO019P -12- 260122
[0124] overhang at its 5'-end which specifically hybridizes with at least the 3’-terminal part of the polynucleotide NA tail;
[0125] c) reverse-transcription to produce an RNA-DNA hybrid duplex;
[0126] d) ligating a sequencing adaptor to the 3’-end of the reverse transcription adaptor, which sequencing adaptor comprises a motor protein that has the ability to control movement of the RNA strand of the hybrid duplex through a transmembrane pore; e) determining one or more sequence characteristics of the RNA strand by direct sequencing by measuring the current passing through the pore as the RNA moves with respect to the pore wherein the current is indicative of the RNA sequence, preferably wherein the current is indicative of the RNA sequence and discriminates between a natural nucleotide and the NA (in particular a nucleotide comprising the NA); and
[0127] f) determining the respective sequence characteristics of the target RNA molecule.
[0128] According to a specific aspect, the invention further provides for a method for determining the integrity of target RNA molecule preparation, which method comprises determining the distribution or proportion of one or more sequence characteristics specific for said target RNA molecule by direct sequencing, the method comprises method step a) engineering the target RNA molecules in said preparation, to incorporate a 3’-terminal polynucleotide tail, which comprises at least one nucleoside analog (NA), thereby obtaining RNA constructs comprising the target RNA molecule with a 3’-terminal polynucleotide NA tail;
[0129] preferably wherein said one or more sequence characteristics are selected from the group consisting of: (i) the length of the RNA molecule, (ii) the identity of the RNA molecule, (iii) the sequence of the RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the RNA molecule, (v) the secondary structure of the RNA molecule, and (vi) whether or not the RNA molecule is modified, or whether or not the RNA molecule comprises a nucleoside analog.
[0130] According to a specific aspect, the invention further provides for a method of comparing one or more sequence characteristics of RNA molecules, which method comprises
[0131] a) engineering the RNA molecules to incorporate a 3’-terminal polynucleotide tail, which comprises at least one nucleoside analog (NA), thereby obtaining RNA constructs comprising the RNA molecule with a 3’-terminal polynucleotide NA tail;LO019P -13- 260122
[0132] b) determining said one or more sequence characteristics by direct sequencing of the RNA constructs, and comparing results of said direct sequencing that are specific for the RNA molecules;
[0133] preferably wherein said one or more sequence characteristics are selected from the group consisting of: (i) the length of the target RNA molecule, (ii) the identity of the target RNA molecule, (iii) the sequence of the target RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the target RNA molecule, (v) the secondary structure of the target RNA molecule, and (vi) whether or not the target RNA molecule is modified, or whether or not the RNA molecule comprises a nucleoside analog.
[0134] According to a specific aspect, the invention further provides for a method for determining degraded mRNAs with a shortened poly(A) tail or non-polyadenylated mRNAs in a preparation of mRNA molecules, comprising:
[0135] a) engineering the mRNA molecules to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA); and
[0136] b) determining differences of the RNA molecules in the poly(A) tail compared to a correct poly(A) tail, by direct sequencing.
[0137] According to a specific aspect, the invention further provides for a kit for engineering an RNA molecule to incorporate a 3’-terminal polynucleotide NA tail, which comprises at least one nucleoside analog (NA), comprising:
[0138] i) a poly(N) polymerase and a substrate for said poly(N) polymerase, wherein the substrate is a nucleoside triphosphate analog which comprises said at least one NA; or the nucleotide comprising the NA; or
[0139] ii) a ligase and a polynucleotide tail block which comprises said at least one NA; preferably wherein the polynucleotide NA tail is characterized by one or more of the following:
[0140] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;
[0141] b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
[0142] According to a specific aspect, the invention further provides for a new use of an RNA molecule comprising a 3’-terminal extension with a polynucleotide NA tail, which comprises at least one nucleoside analog (NA), in a method of direct sequencing to determine one or more sequence characteristics of the RNA molecule without the polynucleotide NA tail.LO019P -14- 260122
[0143] Preferably, one or more sequence characteristics specific for an RNA molecule (herein also referred to as a “target” RNA molecule) is determined by direct sequencing, and methods described herein comprise method step a) before direct sequencing, wherein method step a) comprises engineering the target RNA molecule comprised in said preparation, to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA), thereby obtaining RNA constructs comprising the target RNA molecule with a 3’-terminal polynucleotide NA tail.
[0144] According to a specific aspect, a method described herein comprises:
[0145] a) engineering the target RNA molecule comprised in said preparation, to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA), thereby obtaining RNA constructs comprising the target RNA molecule with a 3’-terminal polynucleotide NA tail; and
[0146] b) determining one or more sequence characteristics specific for the target RNA (in particular the target RNA 3’-terminal polynucleotide NA tail) by direct sequencing.
[0147] Specifically, said at least one NA, said polynucleotide NA tail and / or said polynucleotide tail block are characterised as further described herein.
[0148] According to a preferred aspect, the polynucleotide NA tail is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing.
[0149] Specifically, the polynucleotide NA tail is complementary to a reverse transcription adaptor or sequencing adaptor as used for direct sequencing.
[0150] Specifically, the polynucleotide NA tail is hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing.
[0151] Specifically, the polynucleotide NA tail is complementary to and hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing.
[0152] Specifically, the NA is an adenosine analog and complementary to thymidine. In particular, the adenosine analog is functional to hybridize with a thymidine.
[0153] Specifically, the polynucleotide NA tail is a 3’-extension of the target RNA molecule.
[0154] Preferably, the nucleotide comprising the NA is a nucleoside analog triphosphate. Preferably, the NA is an adenosine analog such as further described herein. Specifically, the NA is a variant of naturally-occurring nucleotides, preferably NA comprises at least one modification in the sugar and / or base moieties.
[0155] Preferably, the NA is an adenosine analog such as further described herein.LO019P -15- 260122
[0156] In a preferred embodiment, the NA is an adenosine analog which is of a compound of Formula (I), (II), (III) or (IV), as further described herein.
[0157] Compounds of Formula (I), (II), (III) or (IV) are triphosphates.
[0158] It is well understood that the NA as used herein is an adenosine analog without the triphosphate residue. NA of a compound of any one of Formula (I), (II), (III) or (IV) as described herein are specifically understood as nucleoside analogs without the triphosphate residues. For example, the NA as used herein is composed of or comprises the structure of a compound of any one of Formula (I), (II), (III) or (IV), without the triphosphate residue.
[0159] Preferably, the NA is provided as a triphosphate. Specifically, the NA is a triphosphate of any one of Formulas (I) to (IV).
[0160] Preferably, the NA is comprised in the nucleotide (in particular in the respective polynucleotide NA tail) as a triphosphate. Specifically, the NA that is comprised in the nucleotide (in particular in the respective polynucleotide NA tail) is a triphosphate of any one of Formulas (I) to (IV).
[0161] Preferably, the NA is an adenosine analog. Preferably the NA is 7-deaza adenosine.
[0162] Specifically, the NA is an adenosine analog which is of a compound of any one of Formula (I), (II), (III) or (IV), preferably 7-deaza adenosine, and is complementary to thymidine. Specifically, the NA is complementary to thymidine of a single stranded (ss) DNA sequence.
[0163] In particular, the NA is an adenosine analog which is functional to hybridize with a thymidine or a respective ss DNA sequence comprising a thymidine (“T”, also referred to as deoxythymidine “dT”). Specifically, the polynucleotide NA tail is complementary to and / or functional to hybridize with a complementary ss DNA sequence such as comprised in a reverse transcription adaptor or sequencing adaptor as used for direct sequencing.
[0164] Specifically, the NA is an adenosine analog which is of a compound of any one of Formula (I), (II), (III) or (IV)., preferably 7-deaza adenosine, and is complementary to thymidine. Specifically, the NA is complementary to thymidine of a ss DNA sequence.
[0165] In particular, the NA is an adenosine analog which is functional to hybridize with a thymidine or a respective ss DNA sequence comprising a thymidine (“T”, also referred to as deoxythymidine “dT”). Specifically, the polynucleotide NA tail is complementary to and / or functional to hybridize with a complementary ss DNA sequence such asLO019P -16- 260122
[0166] comprised in a reverse transcription adaptor or sequencing adaptor as used for direct sequencing.
[0167] Preferably, the NA is an adenosine analog such as further described herein, and the complementary ss DNA sequence (e.g., the complementary ss DNA sequence of the reverse transcription adapter or sequencing adapter) comprises a thymidine (“T”, or “dT”) at a position to hybridize with the adenosine analog.
[0168] In a specific embodiment, the polynucleotide NA tail has a length of at least any one of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, e.g., up to any one of 20, 19, 18, 17, 16, 15, 14, 13, 12 11, or 10 nucleotides, preferably in the range of 10-20 nucleotides.
[0169] According to a specific aspect, the polynucleotide NA tail can be longer e.g., up to 100, 90, 80, 70, 60, 50, 40, 30, or 20 nt. Specifically, the length of the polynucleotide NA tail ranges between 10 and 100 nt, preferably 10 to 90 nt, 10 to 80 nt, 10 to 70 nt, 10 to 60 nt, 10 to 50 nt, 10 to 40 nt, 10 to 30 nt, or 10 to 20 nt.
[0170] Yet, in specific embodiments, the polynucleotide NA tail can be longer e.g., up to 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, or 5000 nt. Specifically, the length of the polynucleotide NA tail ranges between 10 and 5000 nt, preferably 10 to 4000 nt, 10 to 3000 nt, 10 to 2000 nt, 10 to 1000 nt, 10 to 900 nt, 10 to 800 nt, 10 to 700 nt, 10 to 600 nt, 10 to 500 nt, 10 to 400 nt, 10 to 300 nt, 10 to 200 nt, or 10 to 100 nt.
[0171] Specifically preferred ranges are 10 to 200 nt, or 10-100 nt.
[0172] Specifically, at least any one of 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% of the nucleotides comprised in the polynucleotide NA tail consists of NA, either the same NA or a variety of NA. Preferably, the polynucleotide NA tail comprises or consists of a plurality of the same NA.
[0173] According to a preferred embodiment, the polynucleotide NA tail consists of nucleotides with a NA, also referred to as nucleotide analogs comprising said NA. In particular, the polynucleotide NA tail consists of nucleotides with the same (or identical) NAs, in particular nucleotide analogs comprising the same (or identical) identical NAs.
[0174] Specifically, the polynucleotide NA tail comprises a 3’-terminal part e.g., a stretch of nucleotides including the 3’-terminus. The 3’-terminal part may have a length of at least any one of 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, or 100% of the nucleotides comprised in the polynucleotide NA tail. Preferably, the 3’-terminal part has a length of at least any one of 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19,LO019P -17- 260122
[0175] 20, e.g., up to any one of 20, 19, 18, 17, 16, 15, 14, 13, 12 11, 10, 9., 8, 7, or 6 nucleotides, preferably in the range of 6-20, or 10-20 nucleotides.
[0176] According to a specific aspect, the polynucleotide NA tail can be longer e.g., up to 100, 90, 80, 70, 60, 50, 40, 30, or 20 nt. Specifically, the length of the polynucleotide NA tail ranges between 10 and 100 nt, preferably 10 to 90 nt, 10 to 80 nt, 10 to 70 nt, 10 to 60 nt, 10 to 50 nt, 10 to 40 nt, 10 to 30 nt, or 10 to 20 nt.
[0177] Yet, in specific embodiments, the 3’-terminal part of the polynucleotide NA tail can be longer e.g., up to 100, 200, 300, 400, 500, 600, 700, 800, 900, 1000, 2000, 3000, 4000, or 5000 nt. Specifically, the length of the 3’-terminal part ranges between 10 and 5000 nt, preferably 10 to 4000 nt, 10 to 3000 nt, 10 to 2000 nt, 10 to 1000 nt, 10 to 900 nt, 10 to 800 nt, 10 to 700 nt, 10 to 600 nt, 10 to 500 nt, 10 to 400 nt, 10 to 300 nt, 10 to 200 nt, or 10 to 100 nt.
[0178] Specifically preferred ranges are 10 to 200 nt, or 10-100 nt.
[0179] Preferably, at least one of the nucleotides comprised in the 3’-terminal part comprises a NA. More preferably, at least the 5’-terminal nucleotide that is comprised in the 3’-terminal part comprises a NA. More preferably, the 3’-terminal part consists of nucleotides each comprising a NA, preferably the same NA.
[0180] In a specific embodiment, the polynucleotide NA tail or at least a 3’-terminal part of the polynucleotide NA tail comprises one or more of the nucleotides comprising the NA. Specifically, the polynucleotide NA tail or at least the 3’-terminal part of the polynucleotide NA tail comprises the NA at its 3’-terminus.
[0181] Specifically, the polynucleotide NA tail or at least the 3’-terminal part of the polynucleotide NA tail is complementary to a ss DNA sequence. Specifically, the polynucleotide NA tail or at least the 3’-terminal part of the polynucleotide NA tail is capable of hybridizing with a complementary ss DNA sequence.
[0182] Specifically, the complementary ss DNA sequence is capable of hybridizing with said hybridizing part of the polynucleotide NA tail. In a specific embodiment, a ds reverse transcription adaptor which comprises the complementary ss DNA sequence as an overhang can be used for annealing and ligating the reverse transcription adaptor to the RNA molecule.
[0183] Preferably, the polynucleotide NA tail or at least a 3’-terminal part of the polynucleotide NA tail consists of a plurality of the same nucleotides, in particular, nucleotides comprising the same NA. In a preferred embodiment, the NA is an adenosine analog such as further described herein, the polynucleotide NA tail or at leastLO019P -18- 260122
[0184] the 3’-terminal part of the polynucleotide NA tail consists of a plurality of the same nucleotides comprising the same (or identical) adenosine analog, and a ds reverse transcription adaptor which comprises an ss oligo(T) overhang can be used to anneal and ligate the reverse transcription adaptor to the polynucleotide NA tail.
[0185] Specifically, a polynucleotide NA tail which comprises or consists of a plurality of NA containing nucleotides, wherein the NAs are either the same (or identical) or different NAs, is conveniently engineered by an in vitro enzymatic treatment of the RNA molecule using a nucleotidyltransferase and the respective nucleoside triphosphates as a substrate. Preferably, the nucleotidyltransferase is a polymerase such as a poly(A) polymerase. Specifically, the polymerase is capable of adding one or more NA to the 3’-terminus of an RNA molecule. Preferably, the nucleotidyltransferase is a poly(A) polymerase such as a wild-type poly(A) polymerase of prokaryotic (such as bacterial e.g., E. coli) or eukaryotic (such as human or non-human mammalian, or yeast) origin. Preferably, the poly(A) polymerase is an E. coli poly(A) polymerase, such as commercially available (e.g., from New England Biolabs, M0276S or M0276L).
[0186] Specifically, a polynucleotide NA tail can be conveniently engineered by an in vitro enzymatic treatment of the RNA molecule using a ligase and a polynucleotide tail block as further described herein. Preferably, at least any one of 50, 60, 70, 80, 90, or 100% of the polynucleotide NA tail consists of the polynucleotide tail block.
[0187] Specifically, the polynucleotide tail block is composed of a stretch of nucleotides of any RNA sequence, which comprises at least one NA. For example, the polynucleotide tail block comprises a sequence that is complementary to or hybridizes with a complementary ss DNA sequence, e.g., the ss overhang of a reverse transcription adaptor such as described herein. Preferably, the polynucleotide tail block consists of a plurality of nucleotides comprising an NA, either the same or different NA. More preferably, the polynucleotide tail block consists of a plurality of the same nucleotides, in particular nucleotides comprising the same NA.
[0188] A suitable ligase is an RNA ligase, such as a ssRNA Ligase e.g., T4 RNA Ligase 1 (for example T4 RNA Ligase 1 or 2, such as available from New England Biolabs (NEB)), can be used to ligate the polynucleotide tail block to the 3’-end of target RNA molecule.
[0189] A first embodiment refers to RNA molecules engineered to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA) orLO019P -19- 260122
[0190] the respective nucleotide analogs, thereby forming a polynucleotide NA tail, wherein said polynucleotide NA tail is characterised as further described herein.
[0191] According to a specific aspect, one or more of the following methods can be combined with the first embodiment:
[0192] - method for determining one or more sequence characteristics of a target RNA molecule by direct sequencing;
[0193] - method for determining one or more sequence characteristics of a target RNA molecule comprising direct sequencing consisting of measuring the current passing through the pore as the RNA moves with respect to the pore wherein the current passing is indicative of the RNA sequence;
[0194] -method for determining the integrity of a preparation or sample comprising target RNA molecules, which method comprises determining the distribution or proportion of one or more sequence characteristics specific for the target RNA molecule by direct sequencing;
[0195] -method for determining the integrity of a preparation or sample comprising target RNA molecules, which method comprises determining the distribution or proportion of one or more sequence characteristics specific for the target RNA molecule in the respective preparation or sample, by direct sequencing;
[0196] - method for determining or calculating the integrity of RNA molecules in a mix of RNA molecules, wherein the RNA molecules mix comprises (i) identical RNA molecules in length and / or sequence (ii) RNA molecules of different nucleotide sequences and / or (iii) RNA molecules of different nucleotide chain lengths;
[0197] - method for comparing one or more sequence characteristics of any RNA molecules by direct sequencing;
[0198] - method for determining degraded mRNAs with a shortened poly(A) tail or nonpolyadenylated mRNAs in a preparation of mRNA molecules by direct sequencing.
[0199] Specifically, a method is provided, comprising:
[0200] a) engineering the target RNA molecule comprised in said preparation, to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA) (or the respective nucleotide analogs) thereby obtaining RNA constructs comprising the target RNA molecule with a 3’-terminal polynucleotide NA tail; and b) determining one or more sequence characteristics specific for the target RNA (in particular the target RNA 3’-terminal polynucleotide NA tail) by direct sequencing;
[0201] which method is characterized by one or more of the following features:LO019P -20- 260122
[0202] - said one or more sequence characteristics of the target RNA molecule is determined by direct sequencing consisting of measuring the current passing through the pore as the RNA moves with respect to the pore wherein the current passing is indicative of the RNA sequence;
[0203] - the integrity of a preparation or sample comprising target RNA molecules is determined by determining the distribution or proportion of said one or more sequence characteristics specific for the target RNA molecule;
[0204] - the integrity of a preparation or sample comprising target RNA molecules is determined by determining the distribution or proportion of one or more sequence characteristics specific for the target RNA molecule in the respective preparation or sample, by direct sequencing;
[0205] - the integrity of target RNA molecules in a RNA molecules mix is determined, wherein (i) identical RNA molecules in length and / or sequence, (ii) RNA molecules of different nucleotide sequences, and / or (iii) RNA molecules of different nucleotide chain lengths are determined;
[0206] - said one or more sequence characteristics are compared for RNA molecules comprised in a preparation of RNA target molecules;
[0207] - the target RNA molecule is an mRNA and degraded mRNAs with a shortened poly(A) tail or non-polyadenylated mRNAs are determined in a preparation of mRNA molecules.
[0208] According to preferred aspects, said one or more sequence characteristics are selected from the group consisting of: (i) the length of the RNA molecule, (ii) the identity of the RNA molecule, (iii) the sequence of the RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the RNA molecule, (v) the secondary structure of the RNA molecule, and (vi) whether or not the RNA molecule is modified.
[0209] In a preferred embodiment, the above methods comprise one or more of the steps:
[0210] a) engineering target RNA molecules to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA) (or the respective nucleotide analog), thereby obtaining RNA constructs comprising the RNA molecule with a 3’-terminal polynucleotide NA tail; and
[0211] b) determining said one or more sequence characteristics by direct sequencing of the RNA constructs, and comparing results of said direct sequencing that are specific for the RNA molecules.LO019P -21- 260122
[0212] In a preferred embodiment, the above methods comprise one or more of the steps a) engineering a target RNA molecule (or target RNA molecules) to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA) (or the respective nucleotide analog), thereby obtaining an RNA construct (or RNA constructs) comprising the RNA molecule with a 3’-terminal polynucleotide NA tail; and b) annealing and ligating a double-stranded reverse transcription adaptor to the RNA construct(s), wherein the reverse transcription adaptor comprises a singlestranded overhang at its 5'-end which is complementary to and / or specifically hybridizes with at least the 3’-terminal part of the polynucleotide NA tail;
[0213] c) reverse-transcription to produce an RNA-DNA hybrid duplex;
[0214] d) ligating a sequencing adaptor to the 3’-end of the reverse transcription adaptor, which sequencing adaptor comprises a motor protein that has the ability to control movement of the RNA strand of the hybrid duplex through a transmembrane pore; e) determining one or more sequence characteristics of the RNA strand by direct sequencing by measuring the current passing through the pore as the RNA moves with respect to the pore wherein the current is indicative of the RNA sequence, preferably wherein the current is indicative of the RNA sequence and discriminates between a natural nucleotide and the NA (in particular a nucleotide comprising the NA); and
[0215] f) determining the respective sequence characteristics of the target RNA molecule(s).
[0216] Target RNA molecules may comprise RNA molecules of (i) the same nucleotide sequence or different nucleotide sequences wherein optionally the nucleotide sequences show one or more identity variations and wherein such variations can be identified by the methods described herein; and / or (ii) the same nucleotide chain length or different nucleotide chain lengths.
[0217] Target RNA molecules can be capped at their 5’ end with a cap structure unit or cap analog such as known in the prior art e.g. guanine nucleotide connected to the mRNA via an unusual 5' to 5' triphosphate linkage, which may play an important role in protein translation.
[0218] The methods described herein apply to an RNA preparation such as an RNA composition or formulation, which may further comprise DNA, cationic lipids, other lipids such as PEG, cholesterol, dioleoylphosphatidylethanolamine (DOPE), Dioleoylphosphatidylcholine (DOPC), and diphytanoylphosphatidylethanolamine (DDhPE) fecosterol, sitosterol, ergosterol, campesterol, stigmasterol, or brassicasterol.LO019P -22- 260122
[0219] In a further embodiment, the invention provides for a kit for engineering an RNA molecule to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA) (or the respective nucleotide analog), comprising:
[0220] i) a nucleotidyltransferase using at least one nucleoside triphosphate analog as a substrate, wherein said at least one nucleoside triphosphate analog comprises said at least one NA; or
[0221] ii) a ligase and a polynucleotide tail block which comprises said at least one NA.
[0222] Specifically, the kit of the invention is characterized by one or more of the features as described herein for methods described herein.
[0223] In a further embodiment, the invention provides for the use of an RNA molecule comprising a 3’-terminal extension with a polynucleotide tail which tail comprises at least one nucleoside analog (NA) (or the respective nucleotide analog), in a method of direct sequencing to determine one or more sequence characteristics of the RNA molecule without the polynucleotide tail, in particular the RNA molecule without the polynucleotide NA tail.
[0224] Specifically, the use of the invention is characterized by one or more of the features as described herein for methods described herein.
[0225] Specific embodiments employ Oxford Nanopore sequencing technology (ONT), preferably without PCR amplification. Specifically, a technology (e.g., from ONT) is used which allows for generating sequence information of RNA molecules after transcription and ligation of a sequencing adaptor which comprises a suitable motor protein.
[0226] Specifically, direct sequencing may be performed according to a manual of a known (e.g., commercially available, such as from ONT) product. For example, a sample is loaded onto a MinlON flow cell which is a nanopore sequencing device of ONT. According to specific aspects, RNA integrity testing as described herein is characterized by any one or more (or all of) the following:
[0227] a) The measurement is performed from one sample analysis;
[0228] b) The integrity is quantitative and accurate.
[0229] c) The results take into account molecules that do not contain a poly(A) tail d) It is possible to characterize the size of the impurities.
[0230] The invention is based on the finding that RNA molecules can be engineered to incorporate a 3’-NA comprising tail (or a 3’-tail comprising an NA) that is capable of hybridizing with a DNA reverse transcription adaptor such as used in a method of directLO019P -23- 260122
[0231] sequencing. Annealing and ligating such transcription adaptor allows determining sequence characteristics of the RNA molecules irrespective of whether there is a poly(A) tail or not.
[0232] The advantage of the present invention is to provide fast and accurate methods for measuring RNA purity and integrity in terms of i) resolution (single molecule resolution), and ii) sensitivity (high number of read-outs per hour).
[0233] FIGURES
[0234] Figure 1: Process Overview / Job Process Flow. Abbreviations: RTA: reverse transcription adapter; RI_A: RNA Ligation adapter.
[0235] Figure 2: Updated workflow captures RNA fragments.
[0236] Figure 3: Sequences described herein
[0237] DETAILED DESCRIPTION OF THE INVENTION
[0238] Unless indicated or defined otherwise, all terms used herein have their usual meaning in the art, which will be clear to the skilled person. Reference is for example made to the standard handbooks, such as Sambrook et al., 2012, Molecular Cloning: A Laboratory Manual, volumes 1-4, Cold Spring Harbor Press, NY); Lewin, " Genes IV", Oxford University Press, New York, (1990), and Janeway et al., " Immunobiology" (5th Ed., or more recent editions), Garland Science, New York, 2001, Ausubel et al., Current Protocols in Molecular Biology, John Wiley and Sons, Baltimore, Md. (1989), Vega et al., Gene Targeting, CRC Press, Ann Arbor Mich. (1995), and Vectors: A Survey of Molecular Cloning Vectors and Their Uses, Butterworths, Boston Mass. (1988).
[0239] As used herein, the terms “a”, “an” and “the” are used herein to refer to one or more than one i.e., to at least one. The terms “comprise”, “contain”, “have” and “include” as used herein can be used synonymously and shall be understood as an open definition, allowing further members or parts or elements. “Consisting” is considered as a closest definition without further elements of the consisting definition feature. Thus “comprising” is broader and contains the “consisting” definition.
[0240] It is well understood that engineered RNA molecules as described herein are artificial molecules, which may or may not be derivatives of native (wild-type) RNA molecules. It is well understood that the engineered RNA molecules, e.g., specifically referring to those referring to modified or engineered RNA molecules, are non-naturally occurring, are “man-made” or synthetic, and are therefore not considered as a result of “law of nature”. It is also understood that methods and uses described herein are in vitroLO019P -24- 260122
[0241] methods and uses, thus, not carried out in a human body. Genetic modifications described herein may employ tools, methods and techniques known in the art, such as described in RNA Technologies (Jan Barciszewski, Nikolaus Rajewsky 2023, Springer, Switzerland) or Handbook of RNA Biochemistry: Second, Completely Revised and Enlarged Edition (Roland K. Hartmann et al. 2014, Wiley-VCH Verlag GmbH & Co. KGaA).
[0242] Specific terms as used throughout the specification have the following meaning. The term “hybridizing” and “annealing” are herein used interchangeably and refers pairing or annealing of complementary polynucleotides and / or nucleic acids by base-pairing interaction of one or more nucleobases of one polynucleotide with complementary nucleobase(s) of another polynucleotide, that results in formation of a duplex or other higher-ordered structure. The primary interaction is base specific, i.e., A / T and G / C, by Watson / Crick and Hoogsteen-type hydrogen bonding between corresponding nucleobases, or by alternative hydrogen bonding patterns where one or more of the nucleobase pairs comprises one or two nucleoside analogs.
[0243] The term “complementary" as used herein refers to a nucleobase of a polynucleotide which is capable of hybridizing to a corresponding nucleobase in a different polynucleotide. As used herein, the term "complementary" is not limited to canonical Watson-Crick base pairs with A / T, G / C and U / A. Thus, nucleobase pairs may be considered to be "complementary" if one or both of the nucleobases is a nucleobase other than A, G, C, or T, such as comprised in a nucleoside analog. A universal nucleobase that is "complementary" to two or more corresponding nucleobases is considered to hybridize non-selectively to the two or more corresponding nucleobases.
[0244] For example, in DNA, adenine (A) is complementary to thymine (T). For example, in RNA, adenine (A) is complementary to uracil (U). For example, in a target RNA molecule which comprises a 3’-extension with at least one adenosine analog as described herein, the adenosine analog is complementary to thymidine (T).
[0245] The term “nanopore sequencing” as used herein describes sequencing a nucleic acid molecule or sample with the aid of a nanopore, such as any sequencing that utilizes a transmembrane nanopore or nanopore-based system (e.g., a nanopore sensing platform). A nanopore sequencing method typically involves a sequencing device equipped with nanopores or a flow cell comprising nanopores. Techniques for manipulating, detecting, characterizing and / or determining the sequence of a molecule (e.g., a nucleic acid molecule) using a nanopore device are described herein.LO019P -25- 260122
[0246] As used herein, the term “nanopore” generally refers to a pore, channel or passage formed or otherwise provided in a membrane, which can be an organic membrane, such as a lipid bilayer, or a synthetic membrane, such as a membrane formed of a polymeric material. Typically, a nanopore has a characteristic width or diameter on the order of 0.1 nanometers (nm) to about 1000 nm.
[0247] A single stranded nucleic acid molecule (e.g., deoxyribonucleic acid (DNA) or ribonucleic acid (RNA)) is passed through a nanopore that is inserted in a membrane in proximity to an electrode and a sensing circuit. The nanopore can be disposed adjacent or in proximity to a sensing circuit or an electrode coupled to a sensing circuit, such as, for example, a complementary metal-oxide semiconductor (CMOS) or field effect transistor (FET) circuit. The electrode and circuit can monitor the current that passes through the nanopore. As various nucleotide bases (e.g., adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U), or non-canonical nucleobases) pass through the nanopore, the current passing through the nanopore can be affected. In some instances, each of the bases affects the current in a unique way (e.g., A differently from G, C, T, and U, or an adenosine analog differently from A), and the sequence or certain sequence characteristics of the nucleic acid molecule can be determined from the current.
[0248] The nanopore can be a solid state nanopore or a biological nanopore such as the protein alpha-hemolysin of Staphylococcus aureus.
[0249] In nanopore sequencing a single polynucleotide strand passes through a nanopore, wherein the identity of each consecutive nucleotide of a nucleic acid or polynucleotide, is determined, based on the characteristic change in the current flowing through the nanopore-comprising membrane.
[0250] Certain embodiments refer to preparing a nucleic acid direct (or nanopore) sequencing library generated from a nucleic acid containing sample, which library comprises a plurality of RNA (or other nucleic acid molecules or polynucleotides). As used herein, “library preparation” generally includes one or more of list end-repair, A-tailing, adaptor ligation, or any other preparation performed on the cell free DNA to permit subsequent sequencing of DNA. Optionally the library preparation comprises one or more washing or purification steps.
[0251] Library members are each ligated to a sequencing adaptor, which is configured to enable direct (or nanopore) sequencing. Sequencing adapter-ligated RNA (or DNALO019P -26- 260122
[0252] molecules, for respective RNA or DNA library) are then loaded onto the nanopore sequencer.
[0253] Nanopore sequencing typically involves a nucleotide handling protein (e.g., helicases), also referred to as “motor protein”, which is typically attached to the sequencing adapter or otherwise can reside at each nanopore during the sequencing process, which motor protein controls the stepwise movement of the polynucleotide through the nanopore, and optionally also a tether which controls the recruitment and attachment of the nucleic acid to the nanopore before the sequencing begins. The motor protein is typically pre-loaded on the sequencing adapter, which is attached to the molecules to be sequences e.g., via ligation or click chemistry. According to a specific aspect, the sequencing adapter (which is optionally preloaded with a motor protein) is attached to the nucleic acid to be sequenced. For RNA, this can be done via ligation. For DNA, this can be either via ligation or click chemistry.
[0254] The term “sequencing adapter” refers to one or more oligonucleotides that can be ligated to a target nucleic acid molecule or fragments thereof for sequencing. In some embodiments, a sequencing adapter includes two oligonucleotides that at least have a complementary portion, forming an adapter that is double stranded at the complementary portion. In some embodiments, the two oligonucleotides of the sequencing adapter further include at least one mismatched portion. In some embodiments, the mismatched portion has at least one overhang.
[0255] In specific cases, a sequencing adaptor is used which allows a motor protein to anneal and associate with a nanopore in a nanopore flow cell to control the nucleic acid strand movement through the nanopore. In some embodiments described herein, an RNA motor protein may be used. In some cases, a motor protein that can process both RNA and DNA can be used. In some cases, a motor protein comprises a helicase, a polymerase, an exonuclease, a topoisomerase, or a variant thereof.
[0256] The term “direct sequencing” as referred to herein is understood in the following way. An exemplary or preferred direct sequencing as described herein is nanopore sequencing. “Direct sequencing” refers to a technology that sequences one or more nucleic acid molecules directly without going through amplification. In specific embodiments, direct RNA sequencing can be performed without reverse transcription.
[0257] By direct sequencing, certain sequence characteristics can be directly determined for a certain RNA (or DNA) sequence, or directly be compared to comparable RNA (orLO019P -27- 260122
[0258] DNA) sequences. For example, sequence characteristics can be compared to the sequence of an RNA template, or compared to correct RNA sequence characteristics.
[0259] By direct sequencing, modifications of RNA and DNA molecules can be detected. Typically, a charge, conductivity, resistance, impedance, or change thereof is measured as a nucleic acid molecule interacts with a direct sequencing device such as a nanopore. A sequence of the single stranded nucleic acid molecule may be determined from the electric current measurements. Alternatively, or in addition to, modifications such as the presence of one or more nucleoside analogs, or other modifications such as the methylation level of the single stranded nucleic acid molecule can be determined from the electric current measurements.
[0260] Likewise, modifications through incorporation of one or more nucleotide analogs (or nucleoside analogs) can be determined or distinguished. Direct sequencing can, for example, identify RNA or DNA base modifications at nucleotide resolution, including nucleoside analogs as described herein. As nucleobase analogs comprise their own specific current signature in nanopore sequencing, specific base calling algorithms capable of identifying and classifying nucleotide modifications can be used in such approaches. Base calling is typically understood as the process of assigning nucleobases to electrical current changes resulting from nucleotides passing through a nanopore. In one embodiment base callers for nanopore sequencing use neural networks trained on current signals obtained from real sequencing data.
[0261] Taking advantage of the nature of unamplified direct sequencing, direct sequencing can directly observe base modifications such as modified nucleobases (e.g., analogs) or methylation.
[0262] In certain embodiments, direct sequencing of RNA sequencing can be achieved by reverse transcribing the RNA into DNA before sequencing.
[0263] Specifically, an RNA sequencing library may be prepared for direct RNA sequencing after isolation of RNA from a sample. During sequencing library preparation, depending on the amount of RNA available, an optional poly(A) based enrichment step can be performed. Isolated RNA can be ligated to a dsDNA adapter (herein also referred to as “reverse transcription adapter”) with a poly(T) or sequence-specific complementary single-stranded overhang to the 3'-ends of isolated RNA molecules. Afterwards, a reverse-transcription step can be performed to linearize and stabilize the template RNAs. This cDNA strand is not sequenced, it only serves to stabilize the RNA until sequencing in the pore is performed. Finally, a sequencing adapter can be ligated to theLO019P -28- 260122
[0264] ds DNA adapter. Subsequently, the library is loaded into a nanopore sequencer for sequencing. In direct RNA sequencing, as the RNA passes through a direct sequencing device (e.g. a nanopore sensor), the read length reflects the length of the RNA molecules in the sample.
[0265] According to specific embodiments, the RNA sequence to be tested includes the test sample RNA polynucleotide with a poly(A) sequence. The reverse transcription adapter captures the RNA sequence to be tested through the poly(T) sequence. The resulting hybrid structure can then be reverse-transcribed to form a hybrid duplex structure. The sequencing adapter can then be connected to the hybrid duplex structure. The direct sequencing is performed to obtain sequencing data of the original RNA molecule. The current signal data corresponding to the original sequencing data can be extracted.
[0266] The term “nucleoside” as used herein refers to any nucleobase (also termed a nitrogenous base) and a five-carbon sugar (ribose for RNA, or 2'-deoxyribose for DNA) whereas a nucleotide is composed of a nucleobase, a five-carbon sugar, and one or more phosphate groups. In a nucleoside, the anomeric carbon is linked through a glycosidic bond to the N9 of a purine or the N1 of a pyrimidine. Nucleotides are the molecular building blocks of DNA and RNA.
[0267] A “nucleobase” or “base” is herein understood as a nitrogen-containing heterocyclic moiety capable of forming Watson-Crick-type hydrogen bonds and stacking interactions in pairing with a complementary nucleobase or nucleobase analog ( / .e., derivatives of nucleobases) when that nucleobase is incorporated into a polymeric structure. “Heterocyclic” refers to a molecule with a ring system in which one or more ring atom is a heteroatom, e.g., nitrogen, oxygen, or sulfur ( / .e., not carbon).
[0268] The term “nucleoside analog” as used herein refers to a variant of naturally-occurring nucleosides, such as a modified nucleoside e.g., comprising modifications in the sugar and / or base moieties, or nucleoside comprising a respective nucleobase analog. Nucleotides comprising a nucleoside analog are herein also referred to as modified nucleotides.
[0269] Specifically, nucleoside analogs as used for the purpose described herein are nucleosides capable of hybridizing (or substantially hybridizing) to a complementary natural (or canonical) nucleoside, though their pairing behavior can be less specific or altered compared to the standard Watson-Crick base pairs (A-T, G-C). These analogs are typically chemically modified versions of the respective nucleosides A, T, C, G, or U,LO019P -29- 260122
[0270] and can substitute for the canonical nucleosides in nucleic acid molecules like RNA or DNA.
[0271] A canonical nucleoside (e.g., A, C, G, T or U) is herein understood as a nucleoside of a structure that is generally known in the art to be the structure referred to by the name of the respective nucleoside (e.g., the respective A, C, G, T or U).
[0272] Certain nucleoside analogs such as those described herein are modified nucleosides e.g., adenosine analogs, in particular 7-deaza adenosine. Preferred nucleosides are complementary to and / or specifically hybridizing with only one of the canonical (natural) nucleosides, thereby forming a base pair.
[0273] However, other nucleoside analogs may be used for the purpose described herein, which are universal nucleobases capable of hybridizing non-specifically and equivalently with any two or more of the natural (or canonical) nucleosides.
[0274] The structure of a nucleoside analog may differ from the structure of a canonical nucleoside due to one or more modifications in the sugar, nitrogenous base, or phosphate of the nucleotide. In some embodiments, the modified nucleotide comprises a modified nucleoside that is not the canonical structure of an adenine nucleoside, cytosine nucleoside, guanine nucleoside, or uracil nucleoside.
[0275] A series of different nucleotide analog sequences can be used for poly(A) polymerase-based extension or for polynucleotide tail block extension as described herein, to add the respective polynucleotide NA tail to the 3'-termini of one or more target RNA molecules.
[0276] Preferred nucleoside analogs as used for the purpose described herein, in particular for the 3’-extension of the target RNA, are analogs of adenosine, which are complementary to thymidine (T), and thus, capable of hybridizing with thymidine. Particularly preferred adenosine analogs are pyrimidine-like nucleoside analog or purine analogs.
[0277] Exemplary adenosine analogs which are complementary to thymidine comprise a structure of Formula (I), (II), (III), or (IV), as further described herein.
[0278] The nucleoside analogs can be used as respective nucleotides in the nucleoside triphosphate form.
[0279] Specific exemplary adenosine analogs are complementary to thymidine such that they hybridize with T or dT. A specifically preferred exemplary adenosine analog is 7-deaza adenosine. 7-deaza adenosine is an adenosine analog comprising or consisting of a structure of Formula (V), see CAS number 69-33-0.LO019P -30- 260122
[0280]
[0281] Synonyms: Tubercidine; sparsomycina; 4-amino-7-(D-ribofuranosyl)-7H-pyrrolo{2,3-d}pyrimidine; 7-Deazaadenosine; Sparsomycine A.
[0282] 7-deazaadenine is a type of nucleoside analog that is structurally similar to adenine but with a modification at the nitrogen position in the purine ring. Specifically, in 7-deazaadenine, the nitrogen atom at the 7-position of the purine ring is replaced with a carbon atom. This modification is referred to as a deazapurine substitution.
[0283] 7-deazaadenine is classified as a "pyrimidine-like" nucleoside analog because of the structural change that alters the base's hydrogen bonding properties. It can still form base pairs with thymine (in DNA) or uracil (in RNA), similar to normal adenine, but with altered pairing properties due to the structural modification. The modification can impact the stability of base pairing and cause distortions in the helix, which could be used to study DNA / RNA hybridization or to induce mutations in genetic material.
[0284] In particular, 7-deazaadenine is a purine analog and falls under the category of nucleoside analogs that can hybridize with canonical bases, but its altered structure can lead to different pairing characteristics and potential functional consequences in nucleic acids.
[0285] The term “ligase” as described herein refers to an enzyme capable of catalyzing the ligation of two substrate molecules. In particular, a ligase is capable of forming a covalent bond between two nucleotides, and the process of “ligation” refers to the formation of the covalent bond between the two nucleotides.
[0286] The terms “ligating”, “ligation” as used herein refer to the process for covalently linking two or more molecules together, for example covalently linking two or more nucleic acid molecules to each other.
[0287] The term “nucleotidyltransferase” as described herein refers to an enzyme that facilitates the transfer of nucleotidyl groups (nucleotides or parts of nucleotides) to other molecules. A nucleotidyltransferase specifically catalyzes the transfer of a nucleotide (orLO019P -SI- 260122
[0288] nucleotidyl group) from a donor molecule, usually a nucleoside triphosphate (such as ATP, GTP, CTP, or UTP, or a nucleoside triphosphate of an NA described herein, or the respective nucleoside triphosphate analog), to an acceptor molecule such as a nucleic acid molecule (RNA or DNA). The acceptor molecule can be modified by the addition of the nucleotidyl group.
[0289] Exemplary nucleotidyltransferases are polymerases such as RNA polymerases or DNA polymerases, or poly(A) polymerases.
[0290] The term “polymerase” as used herein, refers to an enzyme that is capable of adding one or more nucleotides or nucleotide analogs to the 3' terminus of a nucleic acid molecule e.g., an RNA molecule.
[0291] The substrate for a polymerase enzyme is typically a nucleoside triphosphate, but can also be a nucleoside triphosphate analog. Specifically, the polymerase as described herein can use a nucleoside triphosphate analog as a substrate, wherein said at least one nucleoside triphosphate analog comprises said a NA.
[0292] Specifically, the respective nucleoside triphosphate analogs be used as building blocks for the synthesis or extension of a nucleic acid molecule, in particular through the use of a polymerase (or ligase).
[0293] In some embodiments, a polymerase is an RNA polymerase. In some embodiments, the RNA polymerase is functional to catalyze poly(A) tailing of RNA. Specifically, the polymerase is a poly(A) polymerase which is functional to add one or more nucleotides comprising an adenine (A) base (or respective nucleotide analog) to the 3'-terminus of a nucleic acid molecule e.g. RNA molecule, thereby engineering the nucleic acid molecule to incorporate a 3’-extension. In some embodiments, a poly(A) polymerase is used which is capable of adding one or more nucleoside triphosphate analogs to the 3' terminus of a nucleic acid molecule e.g. RNA molecule. Specifically, a poly(A) polymerase is used which retains a high selectivity to nucleotides comprising an adenine (A) base.
[0294] Examples of poly(A) polymerase include but are not limited to bacterial poly(A) polymerase (such as E. coli poly(A) polymerase), yeast poly(A) polymerase, and mammalian poly(A) polymerase (such as calf thymus poly(A) polymerase).
[0295] An exemplary poly(A) polymerase is a wild type E. coli poly(A) polymerase (such as e.g., described in Cao, G. J. and Sarkar, N. (1992). Proc. Natl. Acad. Sci. USA. 89, 10380-10384.), or a mutant thereof, or a homolog thereof which is functional as a poly(A) polymerase. As used herein, the term “wild-type” means that the sequence is naturallyLO019P -32- 260122
[0296] occurring and is not artificially modified, including naturally occurring mutants. The term “homolog” refers to a polypeptide that exhibits certain sequence identity (e.g., at least any one of 85, 90, 95, 96, 97, 98, 99, or 100% sequence identity) with a reference or wild-type sequence and possess certain aspect of the reference or wild-type polypeptide's functionality.
[0297] The term “recombinant” indicates that the material (e g., a polynucleotide or a polypeptide) has been artificially or synthetically (non-naturally) altered by human intervention such as by in vitro processing or recombinant engineering.
[0298] The term “RNA” as used herein shall refer to a nucleic acid molecule which has a ribose sugar backbone. Nucleotide residues of an RNA may comprise or consist of ribonucleotide residues. The term shall encompass single stranded RNA, double stranded RNA, isolated RNA, synthetic RNA, recombinantly produced RNA, and modified RNA that differs from naturally occurring RNA by one or more modification such as substitution, insertion or deletion of one or more nucleotides. Such alterations may refer to addition of non-nucleotide material to internal RNA nucleotides or to the end(s) of RNA. Such modifications may refer to the addition of non-nucleotide material to internal RNA nucleotides or to the end(s) of RNA.
[0299] The term “RNA” as used herein particularly refers to single stranded RNA, preferably RNA molecules such as mRNA, self-amplifying RNA (saRNA), tRNA, ribosomal RNA (rRNA), microRNA (miRNA), small interfering RNA (siRNA), Long NonCoding RNA (IncRNA), small nuclear RNA (snRNA), Small Nucleolar RNA (snoRNA), inhibitory RNA (such as antisense ssRNA), activating RNA (such as small activating RNA) or immunostimulatory RNA (isRNA).
[0300] In particular, the term RNA shall include the following,
[0301] • Messenger RNA (mRNA): A single-stranded RNA molecule which carries genetic information from DNA to the ribosome, where proteins are synthesized.
[0302] • Transfer RNA (tRNA): Transfers specific amino acids to the ribosome during protein synthesis, matching the mRNA codons with the appropriate amino acids.
[0303] • Ribosomal RNA (rRNA): A key component of ribosomes, rRNA helps in the assembly of amino acids into proteins.
[0304] • MicroRNA (miRNA): Small RNA molecules that regulate gene expression by binding to mRNA and preventing translation.LO019P -33- 260122
[0305] • Small Interfering RNA (siRNA): Involved in the RNA interference pathway, siRNAs can degrade mRNA after transcription, regulating gene expression.
[0306] • Long Non-Coding RNA (IncRNA): Involved in a variety of cellular processes, including gene regulation and chromatin remodeling, but do not code for proteins.
[0307] • Small Nuclear RNA (snRNA): Plays a role in the splicing of pre-mRNA, forming part of the spliceosome.
[0308] • Small Nucleolar RNA (snoRNA): Involved in the modification and processing of rRNA.
[0309] According to specific embodiments, the target RNA is a ss RNA molecule of a predefined sequence. The length of a target RNA is not critical, but may be at least any one of 100 nt, 200 nt, 300 nt, 400 nt, 500 nt, 600 nt, 700 nt, 800 nt, 900 nt, 1000 nt, 1500 nt, 2000 nt, 2500 nt, 3000 nt, 3500 nt, 4000 nt, 4500 nt, 5000 nt, 5500 nt, or 6000 nt, preferably up to 7000 nt, or up to 6000 nt, preferably ranging between 100 and 7000 nt, or between 200 and 7000 nt, or between 100 and 6000 nt, or between 200 and 6000 nt, most preferred between 200 and 6000 nt.
[0310] A preferred RNA molecule described herein is an mRNA, in particular mRNA produced by in vitro transcription from a DNA template or vector.
[0311] Typically, nucleotides in RNA are standard nucleotides (A, U, C, G), and nonstandard nucleotides, such as naturally-occurring, modified or chemically synthesized nucleotides or ribonucleotides. RNA may be recombinantly produced or chemically synthesized.
[0312] The nucleotides are designated by their single letter name as follows: " A" is adenosine or deoxyadenosine (respectively corresponding to RNA or DNA), " C" represents cytidine or deoxycytidine, " G" represents guanosine or deoxyguanosine, " U" represents uridine, " T" represents deoxythymidine (“dT”), " R" represents purine (A or G), " Y" represents pyrimidine (C or T), " K" represents G or T, " H" represents A or C or T, " D" represents A, T or G, " I" represents inosine, and " N" represents any nucleotide.
[0313] Five naturally-occurring nucleobases, adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U), which are called canonical.
[0314] Non-canonical base pairs are planar hydrogen bonded pairs of nucleobases, having hydrogen bonding patterns which differ from the patterns observed in Watson-Crick base pairs. Non-canonical nucleobases can be nucleobases analogs such asLO019P -34- 260122
[0315] described herein, including e.g., naturally occurring nucleotides or modified forms of the canonical nucleotides. A vast number of nucleobase analogs exist.
[0316] Specific nucleobase analogs described herein are complementary to and / or hybridizing with canonical nucleobases.
[0317] Specific nucleoside analogs described herein are complementary to and / or hybridizing with canonical nucleosides.
[0318] For example, adenosine analogs as described herein are complementary to a thymidine or uridine, and can, thus, hybridize with a thymidine or uridine.
[0319] Preferred adenosine analogs as described herein, such as those of the structure (I), (II), (III), or (IV), or as further described herein (e.g., 7-deaza adenosine), are complementary to a thymidine, and can, thus, hybridize with a thymidine.
[0320] For example, thymine analogs as described herein are complementary to an adenine, and can, thus, hybridize with an adenine.
[0321] For example, uracil analogs as described herein are complementary to an adenine, and can, thus, hybridize with an adenine.
[0322] For example, cytosine analogs as described herein are complementary to a guanidine, and can, thus, hybridize with a guanidine.
[0323] For example, guanine analogs as described herein are complementary to a cytidine, and can, thus, hybridize with a cytidine.
[0324] A “messenger RNA”, abbreviated “mRNA”, as used herein, refers to a nucleic acid comprising an open reading frame (ORF) encoding a gene product and a poly(A) region that is 3' to the open reading frame. An mRNA may also comprise a 5' untranslated region (5' UTR) that is 5' to (upstream of) the open reading frame, and a 3' untranslated region that is 3' to (downstream of) the open reading frame. mRNA may also comprise a 5' cap at the 5' end of the mRNA.
[0325] The term “mRNA” particularly refers to artificial mRNA molecules (such as produced by in vitro transcription) and respective mRNA constructs. mRNA molecules can be produced by in vitro transcription of DNA molecules e.g., a vector, that serve as a template for transcription of the sequence.
[0326] Specifically, the mRNA molecule is herein understood as a single-stranded chain of ribonucleotides (standard and / or non-standard ribonucleotides) with a sugarphosphate backbone. It contains a coding sequence, and may additionally comprise one or more non-coding regions. mRNA typically comprises a 3' poly-A tail and optionally a 5' cap.LO019P -35- 260122
[0327] Specifically, mRNA is provided as a linear or circular mRNA construct. mRNA constructs typically comprise one or more untranslated regions (UTRs) and a coding sequence. Sequences of 5' and 3' UTRs (which are understood as being positioned 5’ or 3’ to the coding sequence) can be used to improve translational efficiency and stability of mRNA.
[0328] A 5’UTR typically serves as the entry point for the ribosome during translation, can adopt elaborate RNA secondary and tertiary structures that may regulate translation initiation in a cap-dependent or cap-independent manner.
[0329] A 3’UTR typically participates in processes of cleavage and polyadenylation, translation, and localization of mRNA, affecting mRNA stability.
[0330] Typically, mRNAs described herein comprise at least one poly(A) tail or poly(A) region at the 3' end. Specifically, mRNAs described herein comprise at least one poly(A) tail within a poly(A) region at the 3' end, and a 5' cap at the 5' end. Although each of these components protect the mRNA and help to recruit factors involved in protein translation, mRNAs are subject to degradation by exonucleases. Once exonucleases remove the poly(A) tail and / or 5' cap and begin removing nucleotides of the open reading frame, the mRNA is unable to be translated into an encoded protein. An increased length of the poly(A) tail and additional poly-A tails added to an mRNAs may also enhance translation efficiency.
[0331] According to a specific example, an mRNA molecule or construct comprises, in the 5’ to 3’ direction, a 5’-Cap, followed by a 5’-UTR, one or more a coding sequences (optionally with spacers between these), a 3’-UTR, and a poly(A) tail.
[0332] The term “poly(A) region” as used herein refers to a region of an mRNA that is 3' to (downstream of) the ORF and to the 3' untranslated region (UTR), which comprises one or more covalently linked poly(A) tails each comprising multiple, consecutive adenosine nucleotides ( / .e., any adenosine nucleotide that is covalently linked to at least one other adenosine nucleotide). The poly-A region typically comprises between 50 and 300 consecutive adenosine nucleotides and may encompass multiple non-adenosine nucleotides that are upstream of, downstream of, or interspersed between the consecutive adenosine nucleotides. A poly-A region may consist of nucleotides that are 25-100%, 30-100%, 40-100%, 50-100%, 60-100%, 70- 100%, 80-100%, 90-100%, 95-100%, 96-100%, 97-100%, 98-100%, or 99-100% adenosine nucleotides.
[0333] The term “poly(A) tail,” as used herein refers to a nucleic acid sequence, which poly(A) tail comprises or consists of multiple adenosine nucleotides. Typically, poly(A)LO019P -36- 260122
[0334] tail is attached to the 3' end of a nucleic acid, such as an RNA or mRNA. In specific embodiments described herein, the poly(A) tail has a length of at least any one of 50, 75, 100, 120, 150, 200 nt, or even longer. Specifically, the poly(A) tail has a length of from about 50 nt to about 200 nt, such as from about 75 nt to about 200 nt, from about 100 nt to about 200 nt, from about 120 nt to about 200 nt, or about 150 nt to about 200 nt.
[0335] The adenosine nucleotides comprised in a poly(A) tail described herein may be canonical adenosine nucleotides or adenosine analogs such as described herein. In specific embodiments described herein, the poly(A) tail of a target RNA (or mRNA) comprises a 3’-terminal extension with that comprises at least one adenosine analog. In some embodiments, the mRNA molecule does not contain any other nucleotide at the 3' end of its poly(A) tail.
[0336] Specifically, the RNA described herein is provided as isolated nucleic acid.
[0337] The term “isolated” or “isolation” as used herein with respect to a nucleic acid molecule shall refer to such compound that has been sufficiently separated from the environment with which it would naturally be associated, so as to exist in “purified” or “substantially pure” form. Yet, “isolated” does not necessarily mean the exclusion of artificial or synthetic mixtures with other compounds or materials, or the presence of impurities that do not interfere with the fundamental activity, and that may be present, for example, due to incomplete purification. Isolated compounds can be further formulated to produce preparations thereof, and still for practical purposes be isolated.
[0338] With reference to nucleic acids described herein, the term “isolated nucleic acid” is sometimes used. This term, when applied to RNA, refers primarily to an RNA molecule encoded by an isolated DNA molecule. Alternatively, the term may refer to an RNA molecule that has been sufficiently separated from other nucleic acids with which it would be associated in its natural state ( / .e., in cells or tissues). An “isolated nucleic acid” (e.g., RNA) may further represent a molecule produced directly by biological or synthetic means and separated from other components present during its production.
[0339] An isolated nucleic acid described herein can be produced by amplification or enrichment in vitro, for example via in vitro transcription for RNA. Isolated nucleic molecules can be produced recombinantly by cloning, or by purifying, for example, by cleavage and separation by gel electrophoresis, or by synthesizing e.g., by chemical synthesis.LO019P -37- 260122
[0340] Therefore, the present invention provides for improved methods of RNA engineering and direct sequencing which allows measuring certain sequence characteristics of RNA molecules irrespective of the presence or length of a poly(A) tail at the 3’-end of the RNA molecules. In particular, the integrity of mRNA molecules by direct sequencing independent of the absence or length of a poly(A) tail.
[0341] According to a specific example, a sample of an mRNA preparation undergoes a polyadenylation workflow, whereby a modified adenosine triphosphate is used (e.g., 7-deazaadenosine-5’-triphospate). Thereby, all RNA molecules present in the sample are polyadenylated with the modified nucleoside. This step allows for adaptor attachment and thereby enables the measurement.
[0342] Because a modified adenosine is used, a distinction to the native adenosine can be made. This allows for quantitation and characterization of the impurities and, thus, for an accurate integrity result, without modifying the measurement of the real poly(A) tail in the sample.
[0343] Embodiments of the invention are particularly described by one or more of the following items.
[0344] 1. A method of engineering a RNA molecule to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA), thereby forming a polynucleotide NA tail, the method comprising in vitro enzymatic treatment of the RNA molecule with
[0345] ii) a nucleotidyltransferase using at least one nucleoside triphosphate analog as a substrate, wherein said at least one nucleoside triphosphate analog comprises said at least one NA; or
[0346] ii) a ligase and a polynucleotide tail block which comprises said at least one NA.
[0347] 2. The method of item 1, wherein the polynucleotide NA tail characterized by one or more of the following:
[0348] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;
[0349] b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
[0350] 3. A method for determining one or more sequence characteristics of a target RNA molecule by direct sequencing, the method comprises method step a) before direct sequencing, wherein method step a) comprises engineering the target RNA molecule toLO019P -38- 260122
[0351] incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA), thereby obtaining an RNA construct comprising the target RNA molecule with a 3’-terminal polynucleotide NA tail,
[0352] preferably wherein said one or more sequence characteristics are selected from the group consisting of: (i) the length of the RNA molecule, (ii) the identity of the RNA molecule, (iii) the sequence of the RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the RNA molecule, (v) the secondary structure of the RNA molecule, and (vi) whether or not the RNA molecule is modified.
[0353] 4. The method of item 3, wherein the method further comprises after step a) the following method steps:
[0354] b) annealing and ligating a double-stranded reverse transcription adaptor to the RNA construct, wherein the reverse transcription adaptor comprises a single-stranded overhang at its 5'-end which specifically hybridizes with at least the 3’-terminal part of the polynucleotide NA tail;
[0355] c) reverse-transcription to produce an RNA-DNA hybrid duplex;
[0356] d) ligating a sequencing adaptor to the 3’-end of the reverse transcription adaptor, which sequencing adaptor comprises a motor protein that has the ability to control movement of the RNA strand of the hybrid duplex through a transmembrane pore; e) determining one or more sequence characteristics of the RNA strand by direct sequencing by measuring the current passing through the pore as the RNA moves with respect to the pore wherein the current is indicative of the RNA sequence; and
[0357] f) determining the respective sequence characteristics of the target RNA molecule.
[0358] 5. The method of item 3 or 4, wherein said engineering step a) is by in vitro enzymatic treatment of the RNA molecule with
[0359] i) a nucleotidyltransferase using at least one nucleoside triphosphate analog as a substrate, wherein said at least one nucleoside triphosphate analog comprises said at least one NA; or
[0360] ii) a ligase and a polynucleotide tail block which comprises said at least one NA;
[0361] preferably wherein the polynucleotide NA tail is characterized by one or more of the following:
[0362] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;LO019P -39- 260122
[0363] b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
[0364] 6. A method for determining the integrity of target RNA molecule preparation, which method comprises determining the distribution or proportion of one or more sequence characteristics specific for said target RNA molecule by direct sequencing, the method comprises method step a) before direct sequencing, wherein method step a) comprises engineering the target RNA molecules comprised in said preparation, to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA), thereby obtaining RNA constructs comprising the target RNA molecule with a 3’-terminal polynucleotide NA tail;
[0365] preferably wherein said one or more sequence characteristics are selected from the group consisting of: (i) the length of the RNA molecule, (ii) the identity of the RNA molecule, (iii) the sequence of the RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the RNA molecule, (v) the secondary structure of the RNA molecule, and (vi) whether or not the RNA molecule is modified.
[0366] 7. The method of item 6, wherein the method further comprises after step a) the following method steps:
[0367] b) annealing and ligating a double-stranded reverse transcription adaptor to the RNA constructs, which reverse transcription adaptor comprises a single-stranded DNA overhang at its 5'-end consisting of an oligonucleotide tail which is complementary to and hybridizes with at least the 3’-terminal part of the polynucleotide NA tail;
[0368] c) reverse-transcription to produce respective RNA-DNA hybrid duplexes; d) ligating a sequencing adaptor to the 3’-end of the reverse transcription adaptors, wherein each sequencing adaptor comprises a motor protein that has the ability to control movement of the RNA strands of the hybrid duplexes through a transmembrane pore;
[0369] e) direct sequencing of the RNA strands by measuring the current passing through the pore as the RNA moves with respect to the pore wherein the current is indicative of one or more sequence characteristics; and
[0370] f) determining the distribution or proportion of said one or more sequence characteristics specific for the target RNA molecules.
[0371] 8. The method of item 6 or 7, wherein said engineering step a) is by in vitro enzymatic treatment of the RNA molecule withLO019P -40- 260122
[0372] i) a nucleotidyltransferase using at least one nucleoside triphosphate analog as a substrate, wherein said at least one nucleoside triphosphate analog comprises said at least one NA; or
[0373] ii) a ligase and a polynucleotide tail block which comprises said at least one NA;
[0374] preferably wherein the polynucleotide NA tail is characterized by one or more of the following:
[0375] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;
[0376] b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
[0377] 9. A method of comparing one or more sequence characteristics of RNA molecules, which method comprises
[0378] a) engineering the RNA molecules to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA), thereby obtaining RNA constructs comprising the RNA molecule with a 3’-terminal polynucleotide NA tail;
[0379] b) determining said one or more sequence characteristics by direct sequencing of the RNA constructs, and comparing results of said direct sequencing that are specific for the RNA molecules;
[0380] preferably wherein said one or more sequence characteristics are selected from the group consisting of: (i) the length of the target RNA molecule, (ii) the identity of the target RNA molecule, (iii) the sequence of the target RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the target RNA molecule, (v) the secondary structure of the target RNA molecule, and (vi) whether or not the target RNA molecule is modified.
[0381] 10. The method of item 8, wherein said engineering is by in vitro enzymatic treatment of the RNA molecule with
[0382] i) a nucleotidyltransferase using at least one nucleoside triphosphate analog as a substrate, wherein said at least one nucleoside triphosphate analog comprises said at least one NA; or
[0383] ii) a ligase and a polynucleotide tail block which comprises said at least one NA;
[0384] preferably wherein the polynucleotide NA tail is characterized by one or more of the following:LO019P -41- 260122
[0385] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;
[0386] b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
[0387] 11. A method for determining degraded mRNAs with a shortened poly(A) tail or non-polyadenylated mRNAs in a preparation of mRNA molecules, comprising:
[0388] a) engineering the mRNA molecules to incorporate a 3’-terminal polynucleotide tail, which tail comprises at least one nucleoside analog (NA); and
[0389] b) determining differences of the RNA molecules in the poly(A) tail compared to a correct poly(A) tail, by direct sequencing.
[0390] 12. The method of item 11, wherein said engineering is by in vitro enzymatic treatment of the RNA molecule with
[0391] i) a nucleotidyltransferase using at least one nucleoside triphosphate analog as a substrate, wherein said at least one nucleoside triphosphate analog comprises said at least one NA; or
[0392] ii) a ligase and a polynucleotide tail block which comprises said at least one NA;
[0393] preferably wherein the polynucleotide NA tail is characterized by one or more of the following:
[0394] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;
[0395] b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
[0396] 13. The method of any one of items 1 to 12, wherein the NA is a variant of a naturally-occurring nucleoside, preferably wherein the NA comprises at least one modification in the sugar and / or base moieties.
[0397] 14. The method of any one of items 1 to 13, wherein the NA is an adenosine analog which is of a compound of Formula (I), (II) (III), or (IV) and is functional to hybridize with a thymidine,LO019P -42- 260122
[0398] Formula (I):
[0399]
[0400] RO is OH or NH2;
[0401] R1 is N or CH;
[0402] R2 is N or CH;
[0403] R3 is O, S, NH or CH2;
[0404] R4 is O, S, NH or CH2;
[0405] R5 is O, S, N or CH;
[0406] R6 is OH, H, N3, F, or Cl;
[0407] R7 is a triphosphate.
[0408] Formula (II)
[0409]
[0410] RO is OH or NH2;
[0411] R1,2,3,4, and 5 are independently selected from N or CH; R6 is OH, H, N3, F, or Cl;
[0412] R7 is a triphosphate.LO019P -43- 260122
[0413] Formula (III)
[0414]
[0415] RO is OH or NH2;
[0416] R1 is N or CH;
[0417] R2 is N or CH;
[0418] R3 is O, S, NH or CH2;
[0419] R4 is O, S, NH or CH2;
[0420] R5 is O, S, N or CH;
[0421] R6 is a triphosphate.
[0422] Formula (IV)
[0423]
[0424] RO is OH or NH2
[0425] R1,2,3,4, and 5 are independently selected from N or CH;
[0426] R6 is a triphosphate,
[0427] preferably wherein the adenosine analog is selected from the group consisting of 7-deaza adenosine.
[0428] 15. A kit for engineering an RNA molecule to incorporate a 3’-terminal polynucleotide NA tail, which polynucleotide NA tail comprises at least one nucleoside analog (NA), comprising:
[0429] i) a poly(N) polymerase and a substrate for said poly(N) polymerase, wherein the substrate is a nucleoside triphosphate analog which comprises said at least one NA; or the nucleotide comprising the NA; or
[0430] ii) a ligase and a polynucleotide tail block which comprises said at least one NA;LO019P -44- 260122
[0431] preferably wherein the polynucleotide NA tail is characterized by one or more of the following:
[0432] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;
[0433] b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
[0434] 16. The kit of item 15, wherein the NA is a variant of a naturally-occurring nucleoside, preferably wherein the NA comprises at least one modification in the sugar and / or base moieties.
[0435] 17. The kit of item 15 or 16, wherein the NA is an adenosine analog which is of a compound of Formula (I), (II) (III), or (IV) and is functional to hybridize with a thymidine, Formula (I):
[0436]
[0437] RO is OH or NH2;
[0438] R1 is N or CH;
[0439] R2 is N or CH;
[0440] R3 is O, S, NH or CH2;
[0441] R4 is O, S, NH or CH2;
[0442] R5 is O, S, N or CH;
[0443] R6 is OH, H, N3, F, or Cl;
[0444] R7 is a triphosphate.LO019P -45- 260122
[0445] Formula (II)
[0446]
[0447] RO is OH or NH2;
[0448] R1,2,3,4, and 5 are independently selected from N or CH; R6 is OH, H, N3, F, or Cl;
[0449] R7 is a triphosphate.
[0450] Formula (III)
[0451]
[0452] RO is OH or NH2;
[0453] R1 is N or CH;
[0454] R2 is N or CH;
[0455] R3 is O, S, NH or CH2;
[0456] R4 is O, S, NH or CH2;
[0457] R5 is O, S, N or CH;
[0458] R6 is a triphosphate.LO019P -46- 260122
[0459] Formula (IV)
[0460]
[0461] RO is OH or NH2
[0462] R1,2,3,4, and 5 are independently selected from N or CH;
[0463] R6 is a triphosphate,
[0464] preferably wherein the adenosine analog is selected from the group consisting of 7-deaza adenosine.
[0465] 18. Use of an RNA molecule comprising a 3’-terminal extension with a polynucleotide NA tail, which polynucleotide NA tail comprises at least one nucleoside analog (NA), in a method of direct sequencing to determine one or more sequence characteristics of the RNA molecule without the polynucleotide tail.
[0466] 19. The use according to item 18, wherein the polynucleotide NA tail is characterized by one or more of the following:
[0467] a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;
[0468] b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
[0469] 20. The use of item 18 or 19, wherein the NA is a variant of a naturally-occurring nucleoside, preferably wherein the NA comprises at least one modification in the sugar and / or base moieties.
[0470] 21. The use of any one of items 18 to 20, wherein the NA is an adenosine analog which is of a compound of Formula (I), (II) (III), or (IV) and is functional to hybridize with a thymidine,
[0471] Formula (I):LO019P 260122
[0472]
[0473] RO is OH or NH2;
[0474] R1 is N or CH;
[0475] R2 is N or CH;
[0476] R3 is O, S, NH or CH2;
[0477] R4 is O, S, NH or CH2;
[0478] R5 is O, S, N or CH;
[0479] R6 is OH, H, N3, F, or Cl;
[0480] R7 is a triphosphate.
[0481] Formula (II)
[0482]
[0483] RO is OH or NH2;
[0484] R1,2,3,4, and 5 are independently selected from N or CH; R6 is OH, H, N3, F, or Cl;
[0485] R7 is a triphosphate.
[0486] Formula (III)
[0487]
[0488] LO019P -48- 260122
[0489] RO is OH or NH2;
[0490] R1 is N or CH;
[0491] R2 is N or CH;
[0492] R3 is O, S, NH or CH2;
[0493] R4 is O, S, NH or CH2;
[0494] R5 is O, S, N or CH;
[0495] R6 is a triphosphate.
[0496] Formula (IV)
[0497]
[0498] RO is OH or NH2
[0499] R1,2,3,4, and 5 are independently selected from N or CH;
[0500] R6 is a triphosphate,
[0501] preferably wherein the adenosine analog is selected from the group consisting of 7-deaza adenosine.
[0502] 22. The method, kit or use of any one of the preceding items, wherein direct sequencing is nanopore sequencing.
[0503] EXAMPLES
[0504] Example 1: Nanopore sequencing of a target mRNA
[0505] In a preparation of target mRNA, mRNA molecules are comprised which differ from the target mRNA sequence in the presence or absence of a poly(A) tail, and / or in the length of the poly(A) tail.
[0506] Exemplary sequences:
[0507] Target mRNA sequence: firefly luciferase mRNA (fLuc mRNA, SEQ ID NO:3) Engineered mRNA include a 3’-extension with at least 10 7-deaza adenosine. Reverse transcription adaptor (single-stranded overhangs underlined):
[0508] Upper strand:
[0509] 5 ' Phos-GGCTTCTTCTTGCTCTTAGGTAGTAGGTTC (SEQ ID NO: 1 )LO019P -49- 260122
[0510] Lower strand:
[0511] TTTTTTTTTTCCGAAGAAGAACGAGAATCCTTTTAACTGGCGAGCGGAG ( SEQ I DNO: 2 )
[0512] Sequencing adaptor: ONT
[0513] The mRNA molecules are first engineered to add modified adenosines.
[0514] The engineered mRNA molecules are then reverse transcribed.
[0515] Integrity of the target mRNA preparation is determined by calculating the percent of all measured molecules that are integer i.e. 100% identical, or at least any one of 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identical to the target mRNA, in particular to the full-length sequence of the target RNA. To determine integrity, the number of reads that align to the full-length sequence can be divided by the total number of reads.
[0516] The distribution or proportion of the poly(A) tail length variants in the RNA preparation is determined by the ONT analysis workflow described below.
[0517] 1. Process Overview / Job Process Flow
[0518] see Fig. 1.
[0519] The exemplary process uses the sequencing transcription adapter from ONT, which comprises a suitable motor protein. The exemplary reverse transcription adapter sequence is shown in Figure 3.
[0520] 2. Procedure
[0521] 2.1 Equipment, Materials, Reagents
[0522] Materials and Reagents are purchased and used following the manufacturer's instructions.
[0523] Equipment
[0524] Equipment Vendor
[0525] Thermomixer Eppendorf
[0526] NanoDrop
[0527] Microvolume ThermoFisher
[0528] Spectrometer
[0529] ProFlex Applied Biosystems
[0530] MegaFuge ST Plus
[0531] ThermoFisher
[0532] Series
[0533] Pico 17 centrifuge ThermoScientific
[0534]
[0535] LO019P -50- 260122
[0536] Vortex Heidolph
[0537] Qubit Invitrogen
[0538] Grid-ION ONT
[0539] BSC Interflow
[0540] Single-channel 2.5 Eppendorf
[0541] pL pipette
[0542] Single-channel 20 Eppendorf
[0543] pL pipette
[0544] Single-channel 200 Eppendorf
[0545] pL pipette
[0546] Single-channel Eppendorf
[0547] 1000 pL pipette
[0548]
[0549] Materials
[0550] Consumable Vendor. Cat#
[0551] GridlON Flow Cell RNA ONT, FLQ-MIN004RA
[0552] 96 Deep-Well Plate Thermo Scientific, 95040450B 96 Tip Comb for Deep-Well Magnets Thermo Scientific, 97002534B MicroAmp 8-Tube Strip with
[0553] Applied Biosystems, A30589 Attached Domed Caps, 0.2 mL
[0554] 1.5 mL DNA LoBind Tube Eppendorf, 0030108051 15 mL Centrifuge Tube VWR International B. V., 188271 Qubit Assay Tubes Invitrogen, Q32856 Pipette tips dual filter (50-1000 pL) Fisher Emergo, 0030078578 Pipette tips dual filter (2-200 pL) Fisher Emergo, 0030078551 Pipette tips dual filter (0.5-20 pL) Fisher Emergo, 0030078527 Lab Armor® Beads Gibco
[0555]
[0556] Reagents
[0557] Reagents Vendor. Cat#
[0558] E. coli Poly(A) Polymerase NEB, M0276S
[0559] 10X Poly A Buffer NEB, M0276S
[0560] 7-Deazaadenosine-5'-O-triphosphate Sanbio, 38377-2.5 Qubit dsDNA HS Assay Kit Invitrogen, Q32851
[0561]
[0562] LO019P -SI- 260122
[0563] Direct RNA Sequencing Kit ONT, SQK-RNA004
[0564] T4 DNA Ligase 2M U / mL NEB, M0202M
[0565] NEBNext Quick Ligation Reaction Buffer NEB, B6058S
[0566] Induro Reverse Transcriptase NEB, M0681L
[0567] Murine RNase Inhibitor NEB, M0314S
[0568] dNTP Solution Mix 10 mM NEB, N0447S
[0569] Agencourt RNAClean XP beads Beckman Coulter, A63987
[0570] Ethanol, Absolute Merck, 1.00983.1000
[0571] Nuclease free water Invitrogen, AM9930
[0572]
[0573] The exemplary E. coli Poly(A) Polymerase catalyzes the template independent addition of AMP from ATP to the 3’-end of RNA (Cao, G. J. and Sarkar, N. (1992). Proc. Natl. Acad. Sci. USA. 89, 10380-10384).
[0574] Note: Place the flow cell at RT and thaw all reagents at RT. Spin down the reagents in vials for 5 seconds and place them on the pre-cold beads until use.
[0575] 2.2 Polyadenylation
[0576] 2.2.1 Calculate volume of mRNA(s) for 2 pg total, using formula below:
[0577] 2 μg Volume mRNA sample (μL) = ─────────────────────── mRNA sample concentration
[0578]
[0579] 2.2.2 Vortex 10X PolyA buffer for 10 seconds.
[0580] 2.2.3 Mix 7-deazaadenosine Murine RNase Inhibitor, and E.coli Poly(A) polymerase by flicking.
[0581] 2.2.4 Prepare polyadenylation reaction in 1.5 mL tubes, as in table below:
[0582] Reagent Volume (for 1 reaction)
[0583] mRNA Calculated in 2.2.1 Nuclease-free water Up to 14.5 pL
[0584] 10X PolyA Buffer 2 pL
[0585] 7-Deazaadenosine (10mM) 2 pL
[0586] Murine RNase Inhibitor 0.5 pL
[0587] E. coli Poly(A) Polymerase 1 pL
[0588]
[0589] LO019P -52- 260122
[0590] 2.2.5 Flick and spin down tubes.
[0591] 2.2.6 Incubate in 1.5 mL block of Thermomixer at 37°C for 30 minutes.
[0592] 2.2.7 Spin down samples.
[0593] 2.2.8 Stop reaction with 0.4 pL EDTA (5M).
[0594] 2.3 Sample purification
[0595] 2.3.1 Prepare 70% ethanol as in table below:
[0596] reagent Volume for 1 reaction ethanol 280 pL Nuclease-free water 120 pL
[0597]
[0598] 2.3.2 Add 1.8 vol (18 pL) RNA XP beads to sample.
[0599] 2.3.3 Rotate on IKA mixer at 50 rpm for 5 minutes.
[0600] 2.3.4 Place tubes on magnetic rack until solution clears.
[0601] 2.3.5 Pipette out supernatant from front of tube.
[0602] 2.3.6 Add 150 pL 70% ethanol to tube and rotate 180 degrees on magnetic rack.
[0603] 2.3.7 After beads collect at back of tube, rotate back to front and let beads collect at back again.
[0604] 2.3.8 Pipette out ethanol wash.
[0605] 2.3.9 Repeat ethanol wash (2.3.5 - 2.3.7).
[0606] 2.3.10 Dry beads by leaving the tube open for ~30-60 seconds.
[0607] 2.3.11 Resuspend beads in 25 pL nuclease-free water and incubate at room temperature for 5 minutes.
[0608] 2.3.12 Place tube on magnetic rack until solution clears.
[0609] 2.3.13 Collect eluant in fresh 1.5 mL tubes.
[0610] 2.3.14 Quantitate 1 pL via NanoDrop.
[0611] Confirm polyA addition via Fragment Analyzer.
[0612] 2.3.15 As NLGE-16652 v0.5
[0613] RT Adapter ligation
[0614] 2.3.16 Calculate the volume of mRNA to add 300 ng into the reaction following the formula below:LO019P -53- 260122
[0615] 300 ng
[0616] Volume mRNA sample (pL) = - mRNA sample concentration
[0617]
[0618] Note: mRNA volume cannot exceed 8 μL.
[0619] 2.3.17 Vortex NEBNext Quick Ligation Reaction buffer for 10 seconds.
[0620] Note: NEBNext Quick Ligation Reaction Buffer may have little precipitate that may be dissolved by pipetting up-and-down several times prior vortex.
[0621] 2.3.18 Mix RT Adapter, Murine RNase Inhibitor and T4 DNA Ligase by flicking.
[0622] 2.3.19 Prepare the RTA reaction by adding the following reagents in a PCR tube of the 8-tube strip as described on the table below:
[0623] Reagent Volume for 1 reaction (pL) mRNA Calculated in2.3.16 (300ng) NEBNext Quick Ligation Reaction Buffer 3
[0624] Murine RNase Inhibitor 1
[0625] RT Adapter (RTA) 1
[0626] Nuclease-free water Up to 15
[0627]
[0628] 2.3.20 Add 13.5 pL RTA master mix to a well of the 8-tube strip.
[0629] 2.3.21 Add 1.5 pL T4 DNA Ligase.
[0630] 2.3.22 Mix the content of the 8-tube strip by flicking and spin it down for 5 seconds.
[0631] 2.3.23 Incubate the reaction for 10 min at RT.
[0632] 2.3.24 Use the incubation time to prepare the reverse transcriptase reaction.
[0633] Reverse transcription (RevT)
[0634] 2.3.25 Vortex dNTP solution and 5X Induro RT reaction buffer for 5 seconds.
[0635] 2.3.26 Mix Induro RT by flicking.
[0636] 2.3.27 In a new 1,5mL tube, combine the following reagents to prepare the RevT mix:
[0637] Reagent Volume for 1 reaction (pL)
[0638] 10 mM dNTP solution 2
[0639] 5X Induro RT reaction buffer 8
[0640] Nuclease-free water 13
[0641]
[0642] LO019P -54- 260122
[0643] 2.3.28 Add 23 pL of RevT mix to the adapter-ligated RNA sample prepared before, and mix by pipetting up-and-down 5 times.
[0644] 2.3.29 Add 2 pL Induro RT into the RevT-RNA mix.
[0645] 2.3.30 Incubate this mix in the ProFlex following the protocol Reverse Transcription as below:.
[0646] 60°C 30 minutes
[0647] 70°C 10 minutes
[0648] 4°C hold
[0649]
[0650] 2.3.31 After ProFlex incubation, spin down the strip to collect the liquid at the bottom.
[0651] 2.4 Sample purification post Reverse Transcription reaction
[0652] 2.4.1 Prepare ethanol 70% by adding the reagents as described on the table below:
[0653] Reagent Volume for 1 reaction (pL)
[0654] Ethanol, Absolute 140
[0655] Nuclease-free water 60
[0656]
[0657] 2.4.2 Pipette 72 μL AMPure XP RNAClean beads to fresh 1.5 mL tubes and add the reverse transcribed RNA sample.
[0658] 2.4.3 Mix by pipetting up and down.
[0659] 2.4.4 Incubate on IKA roller for 5 min at 50 rpm, room temperature.
[0660] 2.4.5 Briefly spin down for ~2 seconds and place sample on magnetic rack until solution is clear (~1 min).
[0661] 2.4.6 Pipette out supernatant.
[0662] 2.4.7 Wash with 150 pL 70% ethanol, gently adding 70% ethanol to tube, then rotating the tube 180° till beads collect at back and then rotating 180° again.
[0663] 2.4.8 Once beads have collected at back, pipette out ethanol wash.
[0664] 2.4.9 Spin down ~2 seconds and place sample back on magnetic rack.
[0665] 2.4.10 Pipette off residual ethanol and let dry by leaving the tube open for ~30 seconds.
[0666] 2.4.11 Resuspend beads in 23 pL nuclease-free water and incubate at RT for 5 minutes.
[0667] 2.4.12 Place tube on magnetic rack until solution is clear.
[0668] 2.4.13 Collect elution in fresh 1.5 mL tube.LO019P -55- 260122
[0669] 2.5 RNA Ligation Adapter ligation
[0670] 2.5.1 Mix the RNA Ligation Adapter and T4 DNA Ligase by flicking.
[0671] 2.5.2 Vortex the NEBNext Quick Ligation Reaction Buffer for 5 seconds. 2.5.3 Prepare the Adapter ligation mix in a new 1.5 mL by mixing the reagents as described on the table below:
[0672] Reagent Volume for 1 mix (pL) NEBNext Quick Ligation Reaction Buffer 8
[0673] RNA Ligation Adapter (RLA) 6
[0674]
[0675] 2.5.4 Add 14 pL Adapter ligation mix to the sample tubes.
[0676] 2.5.5 Add 3 pL T4 DNA Ligase to each sample and pipette up and down to mix.
[0677] 2.5.6 Incubate at room temperature for 10 minutes.
[0678] 2.6 Library purification with AMPure XP RNAClean beads and ONT Wash buffer.
[0679] 2.6.1 After RLA ligation, add 16 μL AMPure XP RNAClean beads to the samples, mix by flicking.
[0680] 2.6.2 Incubate on IKA roller for 5 minutes at 50rpm, room temperature.
[0681] 2.6.3 Spin down the sample for 2 seconds and place it on magnetic rack until solution is clear (~5 min).
[0682] 2.6.4 Discard supernatant.
[0683] 2.6.5 Remove tubes from magnetic rack and add 150 pL wash buffer, inverting and flicking to resuspend.
[0684] 2.6.6 Spin down the sample for 2 seconds and place it on magnetic rack until solution is clear (~5 min).
[0685] 2.6.7 Remove wash buffer.
[0686] 2.6.8 Repeat wash steps (2.6.5 - 2.6.7).
[0687] 2.6.9 Spin down the tube for 2 seconds, and place back on magnetic rack. 2.6.10 Pipette off residual wash buffer.
[0688] 2.6.11 Remove tube from rack and add 13 pL RNA elution buffer, flicking to resuspend beads.
[0689] 2.6.12 Incubate at RT for 10 minutes.
[0690] 2.6.13 Spin down the tube for 2 seconds and place it on magnetic rack until solution is clear (~5 min).
[0691] 2.6.14 Collect elution in fresh 1.5 mL tube.LO019P -56- 260122
[0692] 2.7 Sample quantification via Qubit
[0693] 2.7.1 Make up Qubit dsDNA working solution, as in table below:
[0694] Reagent Volume for 1 mix (pL) Qubit dsDNA HS buffer 199
[0695] Qubit dsDNA HS reagent 1
[0696]
[0697] 2.7.2 Aliquot 199 pL of working solution to Qubit thin-wall 0.5 mL tubes per sample and 190 pL to 2 tubes for Standards.
[0698] 2.7.3 Add 10 pL Qubit Standard 1 to one Standard tube and 10 pL Qubit Standard 2 to other Standard tube.
[0699] 2.7.4 Add 1 pL sample to each sample tube.
[0700] 2.7.5 Vortex tubes and incubate at room temperature for 3-5 minutes.
[0701] 2.7.6 Select HS dsDNA assay on Qubit device.
[0702] 2.7.7 Select Read Standards.
[0703] 2.7.8 Place Standard 1 tube in tube holder of Qubit device, close lid, and select Read Standard.
[0704] 2.7.9 Place Standard 2 tube in tube holder of Qubit device, close lid, and select Read Standard.
[0705] 2.7.10 Select Run Samples.
[0706] 2.7.11 Select the sample volume of 1 pL, using the + / - buttons displayed on the wheel and the units of ng / pL in the Unit drop-down menu.
[0707] 2.7.12 Place sample tube in tube holder of Qubit device, close lid, and select Read tube.
[0708] 2.7.13 Record ng / pL measurements.
[0709] 2.7.14 Store sample on pre-cold beads until moment of use.
[0710] 2.8 Priming solution and Library mix preparation
[0711] 2.8.1 Prepare the priming solution:
[0712] 2.8.1.1 Vortex the RNA Flush Tether (RFT) and the Flow Cell Flush (FCF) for 10 seconds.
[0713] 2.8.1.2 Spin down the RFT for 5 seconds.
[0714] 2.8.1.3 In a 15 mL tube, mix the reagents as described on the table below:
[0715] Reagent Volume for 1 reaction (pL)
[0716] RNA Flush Tether (RFT) 30
[0717] Flow Cell Flush (FCF) 1170
[0718]
[0719] LO019P -57- 260122
[0720] 2.8.2 Prepare the library mix:
[0721] 2.8.2.1 Vortex the Sequencing Buffer (SB) and Library Solution (LIS) for 10 seconds and spin them down for 5 seconds.
[0722] 2.8.2.2 Add the reagents to the DNA sample prepared in 2.7.14 as described in the table below:
[0723] Reagent Volume for 1 reaction (pL) Sequencing Buffer 37.5
[0724] Library Beads 25.5
[0725]
[0726] 2.8.2.3 Vortex the library preparation for 5 seconds.
[0727] 2.8.2.4 Store the library preparation on pre-cold beads until moment of use.
[0728] 2.9 Instrument set-up
[0729] 2.9.1 Prepare the Sample sheet:
[0730] 2.9.1.1 Open Sample sheet template.csv file located in Documents folder.
[0731] Note: Sample sheet template.csv format is visualized in Appendix C.
[0732] 2.9.1.2 Edit the following fields according to the experiment specifications:
[0733] 2.9.1.2.1 libraryjd: describes type of experiment and date; e.g.
[0734] accuracy_test_16aug2024
[0735] 2.9.1.2.2 samplejd: describes construct used; e.g. fLuc_mRNA 2.9.1.2.3 reference: indicate the reference folder corresponding to the construct used in the experiment.
[0736] Note: this value must match the name of the specific reference folder. Critical!
[0737] Note: to generate a new reference folder, follow NLGE- 18781_ONT reference folder creation.
[0738] 2.9.1.3 Save the file by clicking save as option. Choose.csv format.
[0739] 2.9.2 Prepare the flow cell:
[0740] 2.9.2.1 Open the device lid and slide the flow cell under the clip, with the chip oriented towards the clip. Press down firmly on the flow cell to ensure correct thermal and electrical contact.
[0741] 2.9.2.2 Open the Sequencing Software and click on Set up run option under the flow cell section.
[0742] 2.9.2.3 On the next screen, click on mRNA Quality Control (n1mpU) option for samples containing modifications or mRNA Quality Control (canonical) for canonical RNA bases samples, and then click Continue.LO019P -58- 260122
[0743] 2.9.2.4 On the Flow cell check tab, click Check flow cell to start the flow cell check.
[0744] Note: If several flow cells have been inserted, a different position may be used by clicking on click Switch to this position.
[0745] Note: This kit is only compatible with RNA flow cells (FLO-MIN004RA); if other flow cell type is inserted, software will flag it as “Incompatible Flow Cell".
[0746] 2.9.2.5 Once flow cell check is completed, one of the following statuses will appear:
[0747] • Ready to use - the flow cell check has passed successfully, and the flow cell is ready to use.
[0748] • Check failed - the flow cell check has failed, and this flow cell should not be used. In this case, discard the flow cell and check a new one.
[0749] 2.9.2.6 Once your flow cell has passed the flow cell check, click Continue.
[0750] 2.9.3 On the next screen, select the Sample sheet for the library prepared:
[0751] 2.9.3.1 Import a sample sheet using the Import button to browse the computer and locate the sample sheet prepared in 2.9.1 and click Open.
[0752] Note: if sample sheet was previously used it may be loaded by using the search bar to filter for available sample sheets.
[0753] 2.9.3.2 Click Add sample sheet on the window that pops up.
[0754] 2.9.3.3 The sequencing software will confirm the sample sheet is in the correct format. Once this check is completed, the sample sheet details will return one of the following statuses:
[0755] • Pass - the sample is in the correct format and has the required information to proceed with sequencing.
[0756] • Fail - the sample sheet is missing information or has the incorrect format. Re-edit the sample sheet and repeat step 2.9.3.
[0757] 2.9.4 Prime the flow cell:
[0758] 2.9.4.1 Open the priming port by sliding 90° clockwise, using a singlechannel 1000 pL pipette, draw back a small volume (20-30 pl), until storage buffer is visible in the pipette tip.
[0759] Note: When drawing back buffer from the flow cell, do not remove more than 20-30 pl and make sure that the array of pores is always covered by buffer. Introducing air bubbles into the array can irreversibly damage pores.
[0760] 2.9.4.2 Using the single-channel 1000 pL pipette, carefully load 800 pl of the priming solution prepared in2.8.1 into the flow cell via the priming port, ensuring no air bubble is present in the tip before flushing.
[0761] 2.9.4.3 Incubate for five minutes.
[0762] 2.9.4.4 Once the flow cell incubation is complete, lift the SpotON sample port cover to expose the sample port.
[0763] 2.9.4.5 Using the single-channel 1000 pL pipette, flush 200 pl of the priming solution into the priming port, ensuring no air bubble is present in the tip before flushing.LO019P -59- 260122
[0764] Note: Flushing should be done with enough pressure to form a meniscus on the sample port.
[0765] 2.9.5 Load the flow cell:
[0766] 2.9.5.1 Mix the prepared library on 2.8.2 by pipetting up and down just prior to loading.
[0767] 2.9.5.2 Take 75 pl of the prepared library and add it to the SpotON sample port in a dropwise fashion, ensuring each drop flows into the port before adding the next.
[0768] 2.9.5.3 Closing the SpotON sample port cover and
[0769] 2.9.5.4 Close the priming port by rotating the cover 90° anti-clockwise. 2.9.5.5 Place the light shield onto the flow cell with the leading edge of shield against the clip.
[0770] Note: The light shield should sit around the SpotON cover, covering the entire top section of the flow cell.
[0771] Note: Do not force the light shield underneath the clip. Install the light shield on the flow cell as soon as library has been loaded for optimal sequencing output.
[0772] 2.9.6 Close the device lid and click Continue in the sequencing software. 2.9.7 Click Run assay to start sequencing the library.
[0773] 2.10 End of sequence
[0774] 2.11 Wash flow cell
[0775] 2.11.1 Thaw Wash diluent and storage buffer at room temperature and mix by vortexing.
[0776] 2.11.2 Per flow cell, combine wash mix (kept on ice) and wash diluent:
[0777] Reagent Volume per flow cell Wash diluent 398 pL
[0778] Wash mix 2 pL
[0779]
[0780] 2.11.3 With a 1000 pL pipette, remove waste from waste port 1. It is imperative that the sample SpotON port and priming port are closed!
[0781] 2.11.4 Open priming port and remove any bubbles by drawing ~20-30 pLfrom the priming port: place 1000 pL pipette tip in priming port and slowly turn dial.
[0782] 2.11.5 Carefully load 200 pL wash mix (2.11.2) into priming port with a 1000 pL pipette. Do not introduce air!
[0783] 2.11.6 Incubate at room temperature for 5 minutes.
[0784] 2.11.7 Carefully load the remaining 200 pL wash mix into the priming port with a 1000 pL pipette. Do not introduce air!
[0785] 2.11.8 Close the priming port and incubate at room temperature for 1 hour.LO019P -60- 260122
[0786] 2.11.9 With the SpotON sample and priming ports closed, remove waste from waste port 1 with a 1000 pL pipette.
[0787] 2.11.10 Open priming port and remove any bubbles by drawing ~20-30 pL from priming port: place 1000 pL pipette tip in priming port and slowly turn dial.
[0788] 2.11.11 Carefully load 500 pL storage buffer into priming port. Do not introduce air!
[0789] 2.11.12 Close priming port and remove waste from waste port 1.
[0790] 2.11.13 Run a flow cell check to confirm pore number QC.
[0791] 2.11.14 Store flow cell at 4-8°C.
Claims
LO019P -61- 260122CLAIMS1. A method of engineering an RNA molecule to incorporate a 3’-terminal polynucleotide tail, which consists of nucleotides comprising a nucleoside analog (NA), thereby forming a polynucleotide NA tail, and determining one or more sequence characteristics of the RNA molecule by direct sequencing, the method comprising a) in vitro enzymatic treatment of the RNA molecule withi) a nucleotidyltransferase using a nucleoside triphosphate analog as a substrate, wherein said nucleoside triphosphate analog comprises said NA; orii) a ligase and a polynucleotide NA tail block which consists of nucleotides comprising an NA,thereby obtaining an RNA construct comprising the RNA molecule with a 3’-terminal polynucleotide NA tail; andb) direct sequencing of the RNA construct to determine said one or more sequence characteristics;wherein the NA is an adenosine analog of a compound selected from Formula (I), (II) (III), or (IV),Formula (I):Ro is OH or NH2;Ri is N or CH;R2is N or CH;R3is O, S, NH or CH2;R4is O, S, NH or CH2;R5is O, S, N or CH;R6is OH, H, N3, F, or Cl;R7is a triphosphate.LO019P -62- 260122Formula (II)Ro is OH or NH2;R1,2,3,4, and 5are independently selected from N or CH; R6is OH, H, N3, F, or Cl;R7is a triphosphate.Formula (III)Ro is OH or NH2;RI is N or CH;R2is N or CH;R3is O, S, NH or CH2;R4is O, S, NH or CH2;R5is O, S, N or CH;Re is a triphosphate.LO019P -63- 260122Formula (IV)Ro is OH or NH2R1,2,3,4, and 5are independently selected from N or CH;Re is a triphosphate;preferably wherein the adenosine analog is 7-deaza adenosine.
2. The method of claim 1, wherein the polynucleotide NA tail consists of nucleotides with the same NA or a mix of NA set forth in claim 1, preferably the same NA.
3. The method of claim 1 or 2, wherein said one or more sequence characteristics are selected from the group consisting of: (i) the length of the RNA molecule, (ii) the identity of the RNA molecule, (iii) the sequence of the RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the RNA molecule, (v) the secondary structure of the RNA molecule, and (vi) whether or not the RNA molecule comprises a nucleoside analog.LO019P -64- 2601224. The method of any one of claims 1 to 3, wherein said direct sequencing comprises the following method steps:a) annealing and ligating a double-stranded reverse transcription adaptor to the RNA construct, wherein the reverse transcription adaptor comprises a single-stranded overhang at its 5'-end which specifically hybridizes with at least the 3’-terminal part of the polynucleotide NA tail;b) reverse-transcription to produce an RNA-DNA hybrid duplex;c) ligating a sequencing adaptor to the 3’-end of the reverse transcription adaptor, which sequencing adaptor comprises a motor protein that has the ability to control movement of the RNA strand of the hybrid duplex through a transmembrane pore; d) determining one or more sequence characteristics of the RNA strand by direct sequencing by measuring the current passing through the pore as the RNA moves with respect to the pore wherein the current is indicative of the RNA sequence and discriminates between a natural nucleotide and the NA; ande) determining the respective sequence characteristics of the target RNA molecule.
5. A method for determining the integrity of a target RNA molecule preparation using the method of any one of claims 1 to 4, wherein the distribution or proportion of said one or more sequence characteristics specific for said target RNA molecule is determined by said direct sequencing.
6. A method of comparing one or more sequence characteristics of RNA molecules using the method of any one of claims 1 to 4, wherein results of said direct sequencing that are specific for the RNA molecules are compared.
7. A method for determining degraded mRNAs with a shortened poly(A) tail or non-polyadenylated mRNAs in a preparation of mRNA molecules using the method of any one of claims 1 to 4, wherein differences of the RNA molecules in the poly(A) tail are compared to a correct poly(A) tail, by said direct sequencing.
8. The method of any one of claims 1 to 7, wherein said direct sequencing is nanopore sequencing.LO019P -65- 2601229. A kit for engineering an RNA molecule to incorporate a 3’-terminal polynucleotide NA tail, which comprises at least one nucleoside analog (NA), comprising:i) a poly(N) polymerase and a substrate for said poly(N) polymerase, wherein the substrate is a nucleoside triphosphate analog which comprises said at least one NA; or the nucleotide comprising the NA; orii) a ligase and a polynucleotide tail block which comprises said at least one NA; wherein the polynucleotide NA tail is characterized by the following:a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA;wherein the NA is an adenosine analog which is of a compound selected from Formula (I), (II) (III), or (IV),Formula (I):Ro is OH or NH2;Ri is N or CH;R2is N or CH;R3is O, S, NH or CH2;R4is O, S, NH or CH2;R5is O, S, N or CH;R6is OH, H, N3, F, or Cl;R7is a triphosphate.LO019P -66- 260122Formula (II)Ro is OH or NH2;R1,2,3,4, and 5are independently selected from N or CH; R6is OH, H, N3, F, or Cl;R7is a triphosphate.Formula (III)Ro is OH or NH2;RI is N or CH;R2is N or CH;R3is O, S, NH or CH2;R4is O, S, NH or CH2;R5is O, S, N or CH;Re is a triphosphate.LO019P -67- 260122Formula (IV)Ro is OH or NH2R1,2,3,4, and 5are independently selected from N or CH;Re is a triphosphate.
10. The kit of claim 9, wherein the adenosine analog is 7-deaza adenosine.
11. The kit of claim 9 or 10, wherein the poly(N) polymerase is an E. coli poly(A) polymerase.
12. Use of an RNA molecule comprising a 3’-terminal extension with a polynucleotide NA tail, which consists of nucleotides comprising a nucleoside analog (NA), in a method of direct sequencing to determine one or more sequence characteristics of the RNA molecule without the polynucleotide NA tail, wherein the NA is an adenosine analog which is of a compound selected from Formula (I), (II) (III), or (IV),LO019P -68- 260122Formula (I):Ro is OH or NH2;Ri is N or CH;R2is N or CH;R3is O, S, NH or CH2;R4is O, S, NH or CH2;R5is O, S, N or CH;R6is OH, H, N3, F, or Cl;R? is a triphosphate.Formula (II)Ro is OH or NH2;RR1,2,3,4, and 5are independently selected from N or CH; R6is OH, H, N3, F, or Cl;R7is a triphosphate.LO019P -69- 260122Formula (III)Ro is OH or NH2;Ri is N or CH;R2is N or CH;R3is O, S, NH or CH2;R4is O, S, NH or CH2;R5is O, S, N or CH;Re is a triphosphate.Formula (IV)Ro is OH or NH2Ri,2,3,4, and 5 are independently selected from N or CH;Re is a triphosphate.
13. The use of claim 12, wherein the adenosine analog is 7-deaza adenosine.
14. The use according to claim 12 or 13, wherein the polynucleotide NA tail is characterized by one or more of the following:a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;b) the polynucleotide NA tail consists of nucleotides with the same NA.LO019P -70- 26012215. The use of any one of claims 12 to 14, wherein said direct sequencing is nanopore sequencing.
16. An RNA molecule comprising a 3’-terminal polynucleotide NA tail, which polynucleotide NA tail comprises at least one nucleoside analog (NA), wherein the NA is an adenosine analog which is of a compound selected from Formula (I), (II) (III), or (IV),Formula (I):Ro is OH or NH2;Ri is N or CH;R2is N or CH;R3is O, S, NH or CH2;R4is O, S, NH or CH2;R5is O, S, N or CH;R6is OH, H, N3, F, or Cl;R7is a triphosphate.LO019P -71- 260122Formula (II)Ro is OH or NH2;R1,2,3,4, and 5are independently selected from N or CH; R6is OH, H, N3, F, or Cl;R7is a triphosphate.Formula (III)Ro is OH or NH2;RI is N or CH;R2is N or CH;R3is O, S, NH or CH2;R4is O, S, NH or CH2;R5is O, S, N or CH;R6is a triphosphate.LO019P -72- 260122Formula (IV)Ro is OH or NH2R1,2,3,4, and 5are independently selected from N or CH;R6is a triphosphate,preferably wherein the adenosine analog is 7-deaza adenosine.
17. The RNA molecule of claim 16, wherein the polynucleotide NA tail is characterized by one or more of the following:a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
18. A method of engineering an RNA molecule to incorporate a 3’-terminal polynucleotide tail, which comprises at least one nucleoside analog (NA), thereby forming a polynucleotide NA tail, the method comprising in vitro enzymatic treatment of the RNA molecule withii) a nucleotidyltransferase using at least one nucleoside triphosphate analog as a substrate, wherein said at least one nucleoside triphosphate analog comprises said at least one NA; orii) a ligase and a polynucleotide tail block which comprises said at least one NA.LO019P -73- 26012219. A method for determining one or more sequence characteristics of a target RNA molecule by direct sequencing, the method comprises:a) engineering the target RNA molecule to incorporate a 3’-terminal polynucleotide tail, which comprises at least one nucleoside analog (NA), thereby obtaining an RNA construct comprising the target RNA molecule with a 3’-terminal polynucleotide NA tail,preferably wherein said one or more sequence characteristics are selected from the group consisting of: (i) the length of the RNA molecule, (ii) the identity of the RNA molecule, (iii) the sequence of the RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the RNA molecule, (v) the secondary structure of the RNA molecule, and (vi) whether or not the RNA molecule comprises a nucleoside analog, optionally wherein the method further comprises after step a) the following method steps:b) annealing and ligating a double-stranded reverse transcription adaptor to the RNA construct, wherein the reverse transcription adaptor comprises a single-stranded overhang at its 5'-end which specifically hybridizes with at least the 3’-terminal part of the polynucleotide NA tail;c) reverse-transcription to produce an RNA-DNA hybrid duplex;d) ligating a sequencing adaptor to the 3’-end of the reverse transcription adaptor, which sequencing adaptor comprises a motor protein that has the ability to control movement of the RNA strand of the hybrid duplex through a transmembrane pore; e) determining one or more sequence characteristics of the RNA strand by direct sequencing by measuring the current passing through the pore as the RNA moves with respect to the pore wherein the current is indicative of the RNA sequence and discriminates between a natural nucleotide and the NA; andf) determining the respective sequence characteristics of the target RNA molecule.LO019P -74- 26012220. A method for determining the integrity of target RNA molecule preparation, which method comprises determining the distribution or proportion of one or more sequence characteristics specific for said target RNA molecule by direct sequencing, the method comprises:a) engineering the target RNA molecules in said preparation, to incorporate a 3’-terminal polynucleotide tail, which comprises at least one nucleoside analog (NA), thereby obtaining RNA constructs comprising the target RNA molecule with a 3’-terminal polynucleotide NA tail;preferably wherein said one or more sequence characteristics are selected from the group consisting of: (i) the length of the RNA molecule, (ii) the identity of the RNA molecule, (iii) the sequence of the RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the RNA molecule, (v) the secondary structure of the RNA molecule, and (vi) whether or not the RNA molecule comprises a nucleoside analog.
21. A method of comparing one or more sequence characteristics of RNA molecules, which method comprisesa) engineering the RNA molecules to incorporate a 3’-terminal polynucleotide tail, which comprises at least one nucleoside analog (NA), thereby obtaining RNA constructs comprising the RNA molecule with a 3’-terminal polynucleotide NA tail;b) determining said one or more sequence characteristics by direct sequencing of the RNA constructs, and comparing results of said direct sequencing that are specific for the RNA molecules;preferably wherein said one or more sequence characteristics are selected from the group consisting of: (i) the length of the target RNA molecule, (ii) the identity of the target RNA molecule, (iii) the sequence of the target RNA molecule, (iv) the presence or absence of a poly(A) tail comprised in the target RNA molecule, (v) the secondary structure of the target RNA molecule, and (vi) whether or not the target RNA molecule comprises a nucleoside analog.LO019P -75- 26012222. A method for determining degraded mRNAs with a shortened poly(A) tail or non-polyadenylated mRNAs in a preparation of mRNA molecules, comprising:a) engineering the mRNA molecules to incorporate a 3’-terminal polynucleotide tail, which comprises at least one nucleoside analog (NA); andb) determining differences of the RNA molecules in the poly(A) tail compared to a correct poly(A) tail, by direct sequencing.
23. A kit for engineering an RNA molecule to incorporate a 3’-terminal polynucleotide NA tail, which comprises at least one nucleoside analog (NA), comprising:i) a poly(N) polymerase and a substrate for said poly(N) polymerase, wherein the substrate is a nucleoside triphosphate analog which comprises said at least one NA; or the nucleotide comprising the NA; orii) a ligase and a polynucleotide tail block which comprises said at least one NA; preferably wherein the polynucleotide NA tail is characterized by one or more of the following:a) it is complementary to and / or hybridizing with a reverse transcription adaptor or sequencing adaptor as used for direct sequencing;b) it consists of nucleotides with an NA, preferably wherein the polynucleotide NA tail consists of nucleotides with the same NA.
24. Use of an RNA molecule comprising a 3’-terminal extension with a polynucleotide NA tail, which comprises at least one nucleoside analog (NA), in a method of direct sequencing to determine one or more sequence characteristics of the RNA molecule without the polynucleotide NA tail.