Nepenthesin-2 derived resistance to fungal pathogens in ZEA mays
Genetically modified Zea mays plants with enhanced NEP-2 protein expression provide resistance to fungal pathogens, addressing yield and quality losses and enabling safe food and feed production.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- HEALTHYCROP APS
- Filing Date
- 2026-01-26
- Publication Date
- 2026-07-30
AI Technical Summary
Fungal pathogens such as Fusarium, Septoria, and Blumeria cause significant yield and quality losses in crops like Zea mays, with existing chemical pesticides posing environmental risks and inadequate resistance in plants.
Genetically modify Zea mays plants to express cereal NEP-2 proteins with enhanced expression through targeted gene editing or integration, increasing resistance to fungal diseases.
The modified Zea mays plants exhibit increased resistance to fungal pathogens, reducing yield loss and mycotoxin contamination, and can be used in food and feed compositions.
Smart Images

Figure IMGF000038_0001 
Figure IMGF000042_0001 
Figure IMGF000044_0001
Abstract
Description
[0001] TITLE: Nepenthesin-2 derived resistance to microbial pathogens in Zea mays Field of the invention
[0002] The invention provides a genetically modified Zea mays plant expressing a cereal NEP-2 protein whose increased expression confers enhanced fungal disease resistance as compared to a parent crop plant from which said genetically modified crop plant was derived. Further provided is the use of said genetically modified Zea mays plant in the manufacture of a feed or food composition comprising flour, silage, or hay.
[0003] Background of the Invention
[0004] Fungal pathogens cause considerable yield and quality losses of economically important crops. Fusarium head blight (FHB) or scab is one of the major fungal diseases of the Poaceae family in temperate, and warm humid regions of the world. The disease is linked to several Fusarium species, where F. verticillioides and F. graminearum are economically the most relevant. FHB infection causes a significant reduction in crop yield and quality due to shrivelled grains and their contamination with mycotoxins. In the 1990s, FHB epidemics caused an estimated economic loss of 2.7 billion USD in the US alone. Fusarium species, causing FHB, produce toxins that belong to the trichothecenes such as Deoxynivalenol (DON), nivalenol (NIV) and their derivatives including 3-acetyldeoxynivalenol (3-ADON), 15-ADON and 4-acetylnivalenol. They also produce mycotoxins such as zearalenone (ZEA), moniliformin, fumonisins and butenolide. Most of these mycotoxins are associated with fungal virulence and cause toxicosis in humans and animals.
[0005] Septoria is another major emerging fungal pathogen of diverse plant families, including members of the Poaceae family. Septoria passerinii is a known pathogen of Hordeum species. Septoria is the cause of major foliar disease which infects the shoot system and growing stages of plants. The life cycle of this fungal pathogen starts with spores landing on leaves which on germinating colonize the leaf apoplast, forming lesions comprising fruiting bodies from which fungal spores rapidly spread to healthy leaves. The infection causes defoliation such that infected leaves are weakened, rendering them unable to support kernel maturation, with consequent reduction in crop yield.
[0006] Powdery mildew (PM) is another fungal pathogen that is among the most prevalent crop diseases worldwide. In cereals, the causative agent of PM is the Ascomycete fungus Blumeria graminis (DC.) speer (Bg), which is capable of inflicting severe grain yield loss (> 20%) and quality reduction in cereals.Nepenthesins are a group of proteases belonging to the family of nepenthesin-like plant aspartic proteases (PAPs). They were initially isolated from the pitcher fluid of carnivorous plants, where their biological function was linked to the degradation of insect proteins as a nitrogen source. Related nepenthesin-like PAPs have been shown to catalyze proteolysis of fungal phytases in vitro.
[0007] Although a range of chemical pesticides have been developed for crop protection, their damaging effect on the environment is documented. Furthermore, despite their widespread use, farmers still experience yield losses caused by fungal infections. The present invention addresses the problem of providing antifungal genes of plant origin that are capable of conferring resistance to fungal diseases (e.g. those caused by Fusarium, Septoria and Blumeria) when expressed in Zea mays plants.
[0008] Summary of the invention
[0009] A first embodiment of the invention provides a genetically modified Zea mays plant that may be one of the following:
[0010] • A genetically modified Zea mays plant comprising one or more nucleic acid molecules integrated into the genome of the plant, wherein each of the one or more integrated nucleic acid molecules comprises a gene encoding a cereal NEP-2 protein, wherein the protein comprises an amino acid sequence having at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4, wherein coding sequences of said gene are operably-linked to a native promoter of said gene or to a heterologous promoter; or
[0011] • a genetically modified Zea mays plant (referred to as NG Zea mays plant) that is a product of targeted gene-editing used to edit a ZmNEP-2 gene of a parent plant, wherein at least one nucleotide in one or more cis-regulatory motifs of at least one endogenous ZmNEP-2 gene is changed (i.e. a nucleotide is substituted, or added, or deleted) by said edit, wherein the one or more cis- regulatory motifs are selected from among motifs 1 - 11 located at nucleotide positions -287 to -280, -271 to -264, -261 to -254, and -4 to +4 of the start codon of an endogenous ZmNEP-2.1 gene; and at nucleotide positions -502 to -497, -472 to -465, -319 to -312, -294 to -287, -192 to -185, -15 to -7, and -4 to +4 of the start codon of an endogenous ZmNEP-2.2 gene; whereby expression of a ZmNEP-2 encoded by said at least one endogenous ZmNEP-2 gene is increased,
[0012] wherein the amino acid sequence encoded by said ZmNEP-2 gene has at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4, andwherein said genetically modified Zea mays plant of (a) and (b) exhibits increased resistance to a microbial pathogen disease as compared to a parent plant from which said Zea mays plant was derived.
[0013] A second embodiment of the invention provides a use of a genetically modified Zea mays plant of the first embodiment, for the manufacture of a non-viable composition, wherein said composition is any one of: flour, silage, and hay.
[0014] A third embodiment of the invention provides a method of producing a food or feed composition, comprising:
[0015] • providing kernels of the genetically modified Zea mays plant of the first embodiment,
[0016] • conditioning the kernels in a damper,
[0017] • peeling and degerming the conditioned kernels, and
[0018] • milling and sifting product of the previous step.
[0019] A fourth embodiment of the invention provides a food or feed composition comprising a non-viable genetically modified plant part of a Zea mays plant of the first embodiment, wherein DNA recovered from said food or feed composition comprises either:
[0020] • detectable levels of one or more nucleic acid molecules each comprising a cis- gene or a transgene encoding a cereal NEP-2 protein, wherein the encoded protein comprises an amino acid sequence having at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4, or
[0021] • detectable levels of a gene-edited ZmNEP-2 gene, wherein at least 1 nucleotide of one or more cis-regulatory motifs in a 5' UTR. of said ZmNEP-2 gene is changed with respect to one or more cis-regulatory motifs of an endogenous ZmNEP-2 gene in the parent plant from which a Zea mays plant was derived, wherein the one or more cis-regulatory motifs are selected from among motifs 1 - 11 located at positions -287 to -280, -271 to -264, -261 to - 254, and -4 to +4 of the start codon of a ZmNEP-2.1 gene; and a positions - 502 to -497, -472 to -465, -319 to -312, -294 to -287, -192 to -185, -15 to - 7, and -4 to +4 of the start codon of a ZmNEP-2.2 gene; wherein the aminoacid sequence encoded by said ZmNEP-2 gene has at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4.
[0022] A fifith embodiment of the invention provides a method for detecting a genetically modified Zea mays plant with increased resistance to a microbial pathogen disease, as defined in the first embodiment comprising:
[0023] o PCR amplifying and sequencing DNA from genomic DNA isolated from a candidate transgenic or intragenic genetically modified Zea mays plant so as to distinguish the transgene or intragene in the integrated nucleic acid molecule from a corresponding native gene encoding a Zea mays nepenthesin-2 protein; or
[0024] o PCR amplifying and sequencing DNA from genomic DNA isolated from a candidate genetically modified Zea mays plant obtained by endogenous Zea mays nepenthesin-2 gene-editing to distinguish the gene-edited endogenous nepenthesin-2 gene from a corresponding native endogenous gene in a parent Zea mays plant from which the genetically modified Zea mays plant was derived;
[0025] or
[0026] o performing iPCR or Southern Blot analysis on DNA derived from genomic DNA isolated from a candidate cisgenic genetically modified Zea mays plant to distinguish the cisgene from a corresponding native Zea mays nepenthesin-2 gene.
[0027] A sixth embodiment of the invention provides a method for producing a genetically modified Zea mays plant with increased resistance to a microbial pathogen disease, as defined in of the first embodiment comprising:
[0028] a. transforming one or more cells of the wild type Zea mays plant with the recombinant DNA construct encoding a ZmNEP-2 protein comprises an amino acid sequence having at least 80% sequence identity to SEQ ID No: 2 or SEQ ID No: 4 using transgenesis, intragenesis and / or cisgenesis;
[0029] b. selecting transformed cells obtained in step (a), wherein the genome of said cells comprises an integrated copy of said gene in said recombinant DNA construct; and c. regenerating a genetically modified plant from cells obtained in step (b).
[0030] A seventh embodiment of the invention provides method for producing a genetically modified Zea mays plant with increased resistance to a microbial pathogen disease, as defined in the first embodiment comprising:
[0031] a. gene-editing an endogenous Zea mays nepenthesin-2 gene in a cell of a Zea mays parent plant, wherein the nucleotide sequence of one or more cis-regulatory motifs in a 5' UTR of said at least one endogenous Zea mays nepenthesin-2 gene is therebychanged with respect to the one or more cis-regulatory motifs of the endogenous Zea mays nepenthesin-2 gene in a parent plant from which the genetically modified plant was derived, wherein the one or more cis-regulatory motifs are selected from among motifs 1 - 11 located at nucleotide positions -287 to -280, -271 to -264, -261 to -254, and -4 to +4 of the start codon of an endogenous Zea mays nepenthesin-2.1 gene having SEQ ID No.: 1; and at nucleotide positions -502 to -497, -472 to -465, -319 to -312, -294 to -287, -192 to -185, -15 to -7, and -4 to +4 of the start codon of an endogenous Zea mays nepenthesin-2.2 gene having SEQ ID No.: 3; wherein the amino acid sequence encoded by said Zea mays nepenthesin-2.2 gene has at least 80% or 100% sequence identity to SEQ ID No: 2 or SEQ ID No: 4,
[0032] b. selecting cells obtained in step (a), wherein the nucleotide sequence of one or more cis-regulatory motifs in a 5' UTR. of said at least one endogenous Zea mays nepenthesin-2 gene in the genome of said cells is changed; and
[0033] c. regenerating a genetically modified plant from cells selected in step (b), wherein the resulting plant is a New Genomic Techniques plant, and
[0034] wherein expression of the Zea mays nepenthesin-2 protein encoded by said endogenous Zea mays nepenthesin-2 gene is increased, and
[0035] whereby said genetically modified Zea mays plant exhibits increased resistance to a microbial pathogen disease as compared to a parent plant from which said Zea mays plant was derived.
[0036] Description of the invention
[0037] FIGURES
[0038] Figure 1. Table showing the frequency (sites) with which each conserved amino acid sequence motif (logo) was identified in the annotated sequences of [A] 68 putative ZmNEP as compared to the annotated sequences of [B] 74 predicted HvNEPs.
[0039] Figure 2. Cartoon and tables showing the level of expression of 7 selected Zea mays genes encoding putative ZmNEPs detected in Zea mays plants sampled at 8 different stages of plant development. The cartoon shows the number of plants sampled at each stage of plant development and the table shows the percent of expression potential based on the Iog2 scale provided. The selected 7 genes are: Zm00001d004734, Zm00001d006525, Zm00001d037153, Zm00001d017869, Zm00001d011599, Zm00001d006330 and Zm00001d022600.
[0040] Figure 3. Table showing expression levels of 7 selected Zea mays genes encoding putative ZmNEPs detected in selected target tissues of Zea mays plants in response to pathogen attack, in particular in response to: Fusarium graminearum; Fusariumverticiiiioides; Ustilago may dis; Setosphaeria turcica; Rhopalosiphum maidis (Aphids); and Tetranychus urticae (Red spider mites). The expression levels, provided in a Iog2-ratio scale (based on the difference between the average gene expression level in pathogen infected experimental plant samples as compared to non-infected control plant samples) encompass both down-regulation and up-regulation of gene expression.
[0041] Figure 4. Cartoon showing a phylogenetic tree encompassing HvNEP-1 (UNIPROT: M0W9B2 [SEQ ID NO: 5]) and ZmNEP-2.1 [SEQ ID NO.: 2] encoded by Zm00001d006330 [Gene ID: 103647650] and ZmNEP-2.2 [SEQ ID NO.: 4] encoded by Zm00001d022078 [Gene ID: 100272542]; HvNEP-2.1 (Gen Bank XP_044961805.1) [SEQ ID No.: 7]; HvNEP-2.2 (XP_044957839.1) [SEQ ID No.: 9], The tree was constructed from the annotated sequences of the 68 putative ZmNEPs (black circles) and 74 predicted HvNEPs (black triangles) proteins (figure 1) after cleaning of aligned sequences with the Block Mapping and Gathering using Entropy (BMGE) program (https: / / test.galaxyproject.org / ). Neighbor-end joining tree was constructed with bootstrap value of 1000 substitutions using MEGA11 software. The two ZmNEP-2 proteins are denoted by white squares; the two HvNEP-2 proteins are denoted by white triangles.
[0042] Figure 5. A: Sequence alignment of two candidate ZmNEP-2's: ZmNEP-2.1 [SEQ ID NO.: 2] encoded by Zm00001d006330 [Gene ID: 103647650]; ZmNEP-2.2 [SEQ ID NO.: 4] encoded by Zm00001d022078 [Gene ID: 100272542]; and HvNEP-1 [UNIPROT: M0W9B2; SEQ ID NO.: 5] performed using the Clustal Omega software (https: / / www.ebi.ac.uk / jdispatcher / msa / clustalo). B: Percent amino acid sequence identify matrix is shown between each putative ZmNEP-2 and the HvNEP-1 protein. Figure 6. A: Sequence alignment of two candidate ZmNEP-2's: ZmNEP-2.1 [SEQ ID NO.: 2] encoded by Zm00001d006330 (Gene ID: 103647650 [SEQ ID No.: 1]); ZmNEP-2.2 [SEQ ID NO.: 4] encoded by Zm00001d022078 (Gene ID: 100272542[SEQ ID No.: 3]); and two candidate HvNEP-2's: HvNEP2.1 (XP_044961805.1 [SEQ ID NO.: 7]) HvNEP2.2 (XP_044957839.1 [SEQ ID NO.: 9]) performed using the Clustal Omega software (https: / / www.ebi.ac.uk / jdispatcher / msa / clustalo). B: Percent amino acid sequence identify matrix is shown between each putative ZmNEP-2 protein and HvNEP-2 protein.
[0043] Figure 7. A: Percent amino acid sequence identify matrix is shown between 2 putative ZmNEP-2 proteins and 7 TaNEP-2 proteins. B: Sequence alignment of two candidate ZmNEP-2's: ZmNEP-2.1 [SEQ ID NO.: 2] encoded by Zm00001d006330 (Gene ID: 103647650 [SEQ ID No.: 1]); ZmNEP-2.2 [SEQ ID NO.: 4] encoded by Zm00001d022078 [Gene ID: 100272542 [SEQ ID No.: 3]); and 7 candidate TaNEP-2's: TaNEP-2.1 [SEQ ID No.: 11] encoded by NCBI: XM_044576517.1 [SEQ ID No.:10] ); TaNEP-2.2 [SEQ ID No.: 13] encoded by NCBI: XM_044572764.1 [SEQ ID No.: 12]); TaNEP-2.3 [SEQ ID No.: 15] encoded by NCBI: XM_044586931.1 [SEQ ID No.: 14]), TaNEP-2.4 [SEQ ID No.: 17] encoded by NCBI: XM_044587349.1 [SEQ ID No.: 16]); TaNEP-2.5 [SEQ ID No.: 19] encoded by NCBI: XM_044580202.1 [SEQ ID No.: 18]); TaNEP-2.6 [SEQ ID No.: 21] encoded by NCBI: AK458446.1 [SEQ ID No.: 20]); and TaNEP-2.7 [SEQ ID No.: 23] (NCBI: XM_044569305.1 [SEQ ID No.: 22]) performed using the Clustal Omega software (https: / / www.ebi.ac.uk / jdispatcher / msa / clustalo).
[0044] Figure 8. The co-expression pattern of genes in the Zea mays genome with the gene Zm00001d006330 [SEQ ID NO.: 1], encoding the ZmNEP-2.1; and the gene Zm00001d022078 [SEQ ID NO.: 3] encoding the ZmNEP-2.2, as identified using STRING database.
[0045] Figure 9A, B and C: Diagram identifying the Zea mays genes that are predominantly co-expressed with the genes: Zm00001d006330 [SEQ ID NO.: 1] and Zm00001d022078 [SEQ ID NO.: 3], encoding the two ZmNEP-2's, are WRKY2533, WRKY33, ACS6 and CaMCM, and whose expression is linked to plant defense responses in the KEGG map (denoted with black stars).
[0046] Figure 10: [A] Image of PCR amplification products comprising the full-length genes Zm2078 (1586 bp) (Zm00001d022078; Gene ID: 100272542) encoding ZmNEP-2.2 [SEQ ID NO.: 4]; and Zm6330 (1598 bp) (Zm00001d006330; Gene ID: 103647650 encoding ZmNEP-2.1 [SEQ ID NO.: 2] respectively separated on an agarose gel. Lane 1 comprises DNA size markers (from 10000 bp to 250 bp). [B] Image of PCR amplification products comprising AZm2078 (1491 bp) and AZm6330 (1491 bp) fragments (encoding the mature ZmNEP proteins) for in-fusion into the pPICz alpha A vector. The fragments used for In-Fusion cloning are indicated with an arrow.
[0047] Figure 11. Image of plasmids from four selected clones of pPICz alpha A-Zm2078 / Zm6330 each linearized with Dral restriction enzyme and separated on an agarose gel. Lane 1 comprises DNA size markers (from 10000 bp to 250 bp).
[0048] Figure 12. Graphs showing FPLC elution profile of secreted recombinant two ZmNEP-2's, where the X-axis denotes the FPLF fraction number, and the Y-axis denotes absorbance (mAU)); where in [A] ZmNEP2.2 [SEQ ID NO.: 4] is shown to elute at 50-70 min; and in [B] ZmNEP2.1 [SEQ ID NO.: 2] eluted at 50-60 min. The two ZmNEP-2's loaded onto the FPLC, were recovered from the supernatant of the recombinant Pichia cultures and adjusted to pH 8. [C] Image of the rZmNEP-2 proteins separatedby SDS-PAGE derived from the FPLC peak fractions; concentrated with 10 kDa cutoff and. Lane 1 comprises protein molecular mass markers (from 250 kD to 10 kD).
[0049] Figure 13. Histogram showing fungal biomass accumulation of F. verticilliodes during multiwell incubation in a growth medium supplemented with either of each rZmNEP-2 solution or with buffer. Individual multiwell samples were collected at 4 different time points and the dry weight of accumulated fungal biomass measured. The individual treatments of the analysis were performed in three biological replicates, and the data presented as mean+sd. Two-way ANOVA followed by the Fisher's LSD test (p<0.05) was performed for determining the significant differences. The 'ns' denotes insignificant differences, and the asterisks represent the level of significant differences, *p<0.05, **p<0.01, **p<0.001.
[0050] Figure 14. Histogram showing fungal biomass accumulation of Setospheria turcica during multiwell incubation in a growth medium supplemented with a solution of either: Zm2078 protein corresponding to ZmNEP-2.2 [SEQ ID NO.: 4] or Zm6330 protein corresponding to ZmNEP-2.1 [SEQ ID NO.: 2]; or with buffer. Three individual multiwell samples were collected at 4 different time points and the average dry weight of accumulated fungal biomass was measured. The individual treatments of the analysis were performed in three biological replicates, and the data presented as mean+sd. Two-way ANOVA followed by the Fisher's LSD test (p<0.05) was performed for determining the significant differences. The asterisks represent the level of significant differences, *p<0.05, **p<0.01, **p<0.001.
[0051] Figure 15. Histogram showing the relative level of expression of 4 different genes by Setospheria turcica following 6 days of incubation in the presence of a solution of either: Zm2078 protein corresponding to ZmNEP-2.2 [SEQ ID NO.: 4], or Zm6330 protein corresponding to ZmNEP-2.1 [SEQ ID NO.: 2]; as compared to a buffer control, measured by qPCR. The individual treatments of the analysis were performed in three biological replicates, and the data presented as mean+sd. Two-way ANOVA followed by the Fisher's LSD test (p<0.05) was performed for determining the significant differences. The asterisks represent the level of significant differences, *p<0.05, **p<0.01, **p<0.001.
[0052] Figure 16. [A] Image of PCR amplification products comprising the genes Zm6300 (1379 bp [SEQ ID No: 52]) (NCBI GenelD: 100284558; NCBI Protein coding sequence: Zm00001ebl06300 / Zm00001d006525) encoding Zm6300 (NCBI ref: NP_001150925.2 [SEQ ID No: 53]). [B] Image of PCR amplification products comprising AZm6300 (1303 bp fragment (encoding the mature Zm6300 protein) for infusion into the pPICz alpha A vector. The fragment used for In-Fusion cloning is indicated with arrow.Figure 17. [A] Image of Zm6300 expression vector for expression in Pichia. [B] Image of plasmids from six selected clones of pPICz alpha A-Zm2078 / Zm6330 each linearized with Dral restriction enzyme and separated on an agarose gel. Lane 1 comprises DNA size markers (from 10000 bp to 250 bp).
[0053] Figure 18. [A] Graph showing FPLC elution profile of secreted recombinant Zm6300, where the X-axis denotes the FPLF fraction number, and the Y-axis denotes absorbance (mAU)); where Zm6300 [SEQ ID NO.: 53] is shown to elute at 25-30 min. The Zm6300 loaded onto the FPLC was recovered from the supernatant of the recombinant Pichia cultures and adjusted to pH 8. [B] Image of the rZm6300 protein separated by SDS-PAGE derived from the FPLC peak fractions; concentrated with 10 kDa cutoff and. Lane 1 comprises protein molecular mass markers (from 250 kD to 10 kD).
[0054] Figure 19. Histogram showing fungal biomass accumulation of f. graminearum during multiwell incubation in a growth medium supplemented with either the rZm6300 protein solution or with buffer. Individual multiwell samples were collected at 4 different time points and the dry weight of accumulated fungal biomass measured. The individual treatments of the analysis were performed in three biological replicates, and the data presented as mean+sd. Two-way ANOVA followed by the Fisher's LSD test (p<0.05) was performed for determining the significant differences. The 'ns' denotes insignificant differences, and the asterisks represent the level of significant differences, *p<0.05, **p<0.01, ***p<0.001.
[0055] Figure 20. Histogram showing fungal biomass accumulation of F. verticilliodes during multiwell incubation in a growth medium supplemented with either the rZm6300 protein solution or with buffer. Individual multiwell samples were collected at 4 different time points and the dry weight of accumulated fungal biomass measured. The individual treatments of the analysis were performed in three biological replicates, and the data presented as mean+sd. Two-way ANOVA followed by the Fisher's LSD test (p<0.05) was performed for determining the significant differences. The 'ns' denotes insignificant differences, and the asterisks represent the level of significant differences, *p<0.05, **p<0.01, ***p<0.001.
[0056] Figure 21. Histogram showing fungal biomass accumulation of S. turcica during multiwell incubation in a growth medium supplemented with either of the rZm6300 protein solution or with buffer. Individual multiwell samples were collected at 4 different time points and the dry weight of accumulated fungal biomass measured. The individual treatments of the analysis were performed in three biological replicates, and the data presented as mean+sd. Two-way ANOVA followed by the Fisher's LSD test (p<0.05) was performed for determining the significant differences. The 'ns' denotesinsignificant differences, and the asterisks represent the level of significant differences, *p<0.05, **p<0.01, ***p<0.001.
[0057] Figure 22. Column diagram showing the relative expression of ZmNEP2.1 and ZmNEP2.2 genes driven by a kernel-specific D hordein promoter in To Zm6330 (A) and Zm2078 (B) regenerated barley plants, respectively. Relative expression is normalized in relation to the average Ct value of housekeeping genes (18s and GAPDH) and the expression of a Golden Promise wild type barley (-AACt).
[0058] Figure 23. Column diagram showing the relative expression of ZmNEP2.1 and ZmNEP2.2 genes driven by a pFBPA leaf-specific promoter in TO Zm6330 (A) and Zm2078 (B) regenerated barley plants, respectively. Relative expression is normalized to the Ct value of housekeeping gene GAPDH and the expression of a Golden Promise wild type barley (-AACt).
[0059] Figure 24. Box plot showing Fusarium graminearum (Fg) infection of barley kernels in plants specifically expressing either ZmNEP2.1 or ZmNEP2.2 genes (pHOR promoter-driven) in the kernels or in barley kernels of wild type barley plants (control). The Y axis shows the percentage of Fg infected kernels per spike 23 days after infection. Figure 25. Box plot showing number of pustules formed on leaves after powdery mildew (Blumeria graminis) infection of three weeks old plants specifically expressing either ZmNEP2.1 or ZmNEP2.2 genes (pFBPA driven) in the leaves, or formed on leaves of wild type barley plants (control). Eight days after infection, the number of pustules were counted on individual leaves, n = number of leaves counted for pustule formation.
[0060] Figure 26. Box plots indicating the translational efficiency of the modified uORFs and Kozak sequences in the ZmNEPs promoters. (A) The signal ratio (mCherry / GFP) for the three uORFs and one Kozak modified targets iin the Zm6330 promoter. (B) The signal ratio (mCherry / GFP) for the six uORFs and one Kozak modified targets. Unmodified promoter was included and designated as wild type.
[0061] Figure 27. Disease severity of S. turcica on leaves of B104 wildtype and the Zm6330 and Zm2078 cis-genic lines.
[0062] Abbreviations and terms:
[0063] Amino acid sequence identity: The term "sequence identity" as used herein, indicates a quantitative measure of the degree of homology between two amino acid sequences of substantially equal length. The two sequences to be compared must be aligned to give a best possible fit, by means of the insertion of gaps or alternatively,truncation at the ends of the protein sequences. The sequence identity can be calculated as ((Nref-Ndif)100) / (Nref), wherein Ndif is the total number of non-identical residues in the two sequences when aligned and wherein Nref is the number of residues in one of the sequences. Sequence identity can alternatively be calculated by the BLAST program e.g. the BLASTP program (Pearson W. R and D. J. Lipman (1988)) (www.ncbi.nlm.nih.gov / cgi-bin / BLAST). In one embodiment of the invention, alignment is performed with the sequence alignment method ClustalW with default parameters as described by Thompson J., et al 1994, available at http: / / www2. ebi.ac.uk / clustalw / .
[0064] Preferably, the numbers of substitutions, insertions, additions or deletions of one or more amino acid residues in the polypeptide as compared to its comparator polypeptide is limited, i.e. no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 substitutions, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 insertions, no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 additions, and no more than 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 deletions. Preferably the substitutions are conservative amino acid substitutions: limited to exchanges within members of group 1: Glycine, Alanine, Valine, Leucine, Isoleucine; group 2: Serine, Cysteine, Selenocysteine, Threonine, Methionine; group 3: proline; group 4: Phenylalanine, Tyrosine, Tryptophan; Group 5: Aspartate, Glutamate, Asparagine, Glutamine.
[0065] Cereal plant is any one of a rice (Oryza sp; e.g.: Oryza sativa), wheat (Triticale sp: e.g. Triticale aestivum), rye Secale sp. e.g. Secale cereaie), oats (Avena sp., e.g. Avena sativa), barley (Hordeum sp. e.g. Hordeum vulgare), Sorghum sp e.g. Sorghum bicolar, and maize plant (Zea sp., e.g. Zea mays).
[0066] CRISPR-Cas9 is a genetic engineering technique in molecular biology by which the genomes of living organisms may be modified, that is based on a simplified version of the bacterial CRISPR-Cas9 antiviral defense system. By delivering the Cas9 nuclease complexed with a synthetic guide RIMA (gRNA) into a cell, the cell's genome can be cut at a desired location, allowing existing genes, individual nucleotides or nucleotide sequences to be removed, substituted or new ones added in vivo. The term CRISPR stands for "clustered regularly interspaced short palindromic repeats".
[0067] Gene ID number: (gi number: geninfo identifier) is a unique integer which identifies a particular sequence, independent of the database source, which is assigned by NCBI to all sequences processed into Entrez, including nucleotide sequences from DDBJ / EMBL / GenBank, protein sequences from SWISS-PROT, PIR and many others. Heterologous promoter: a promoter is a region of DNA that initiates transcription of an operatively-linked coding sequence of a gene. A heterologous promoter is apromoter of heterologous origin with respect to the coding sequence of the gene to which it is operatively linked, which is a promoter having a nucleic acid sequence and function that is different (heterologous in origin) from the promoter that is operatively-linked to the coding sequence of the respective gene in nature. A heterologous promoter (such as a kernel- or leaf-specific promoter) may be said to modify the expression of an operatively-linked cereal ZmNEP-2 coding sequence by causing its expression in a different tissue of a host Zea mays plant than the native ZmNEP-2 genes.
[0068] A heterologous promoter and the coding sequence of a gene to which it is operably-linked may originate from the genome of a common plant of origin. In this case, when an individual member of the plant of origin is transformed with a DNA fragment comprising said heterologous promoter operably-linked to said coding sequence of the gene, the resulting transformed plant is defined as an intragenic plant.
[0069] Homologous promoter: is a promoter that is homologous in origin to the coding sequence of gene to which it is operably-linked; such that a contiguous nucleic acid sequence comprising said promoter and its operatively-linked coding sequence of gene is present at a locus within the genome of a plant of origin. When an individual member of the plant of origin is transformed with a DNA fragment comprising said promoter operably-linked to said coding sequence of said gene, the resulting transformed plant is defined as a cisgenic plant.
[0070] Native gene: is an endogenous gene present in the genome of a plant found in nature.
[0071] New Genomic Techniques (NGT) are techniques used to edit the nucleic acid sequence of the genome of a living organism. These techniques can for example be used to engineer 1 - 20 nucleotide modifications by one or more of the insertion, deletion or substitution of nucleotide(s) in the genome. One example of such targeted gene editing techniques is facilitated by CRISPR-Cas9 gene editing techniques. In the context of the present invention NG Zea mays plants, obtained by targeted gene editing, are characterized by an enhanced expression of a ZmNEP-2 protein.
[0072] Room temperature (RT) is 20 - 25°C.
[0073] Detailed description of the invention
[0074] In view of the known properties of nepenthesin-like PAPs, such as their ability to catalyze proteolysis of fungal phytases, a search was made for candidate fungal resistance genes in the Zea mays genome. The search revealed a total of 99 genes encoding putative nepenthesins in the maize genome (example 1).Identification of putative nepenthesins was initially based on structural homology between the encoded polypeptide and nepenthesin-1 and nepenthesin-2 found in the pitcher fluid of carnivorous plants, in particular the presence of the catalytic pocket formed by the catalytic triads (DAS and DPG) and possession of a nepenthesin-specific insert sequence (NAP-I).
[0075] Among the 99 genes, 68 encoded proteins comprised sequence motifs (logos) that are also commonly found amongst 74 putative nepenthesins encoded by the Hordeum vulgare genome. Based on a combination of each gene's expression profile and the structural characteristics of their encoded protein, a single gene cluster encoding four putative nepenthesins were identified (figure 4), of which two Zea mays genes were selected for further analysis (example 1). The NEP-2 members of this cluster are only remotely related to a Hordeum vulgare gene HvNEP-1 that encodes a nepenthesin-1 like protein, since their respective amino acid sequences show as little as 27% sequence identity (figure 5). Members of this single gene cluster encompass genes found in other cereal genomes, that encode NEP-2 proteins having a highly conserved amino acid sequence (figures 6 and 7). As a result of these analyses, the present invention identifies a novel sub-class of nepenthesin-2 protein in cereals, who's increased and / or modified expression in genetically modified Zea mays plants enhances their fungal resistance in comparison to the parent Zea mays plant from which they were derived, and thereby solves the problem addressed by the invention.
[0076] I A genetically modified Zea mays plant of the invention
[0077] The invention provides a genetically modified Zea mays plant, wherein the expression of one or more cereal NEP-2 proteins is modified so as confer on the plant an increased resistance to a microbial pathogen disease as compared to a parent plant from which said Zea mays plant was derived.
[0078] li The genetically modified Zea mays plant of the invention
[0079] The genetically modified Zea mays plant may be one of the following:
[0080] • A genetically modified Zea mays plant comprising one or more nucleic acid molecules integrated into a genome of the plant, wherein each of the one or more integrated nucleic acid molecules comprises a gene encoding a cereal NEP-2 protein, wherein the amino acid sequence of the protein has at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4, and
[0081] wherein coding sequences of said gene are operably-linked to a native promoter of said gene or to a heterologous promoter.• A genetically modified Zea mays plant that is a product (referred to as NG Zea mays plant) of targeted gene editing (or mutagenesis), wherein at least one nucleotide in one or more cis-regulatory motifs of at least one endogenous ZmNEP-2 gene of a parent Zea mays plant from which the genetically modified plant was derived is changed (i.e. a nucleotide is substituted, or added, or deleted), wherein the one or more cis-regulatory motifs are selected from among motifs 1 - 11 located at nucleotide positions -287 to -280, -271 to - 264, -261 to -254, and -4 to +4 of the start codon of an endogenous ZmNEP- 2.1 gene; and at nucleotide positions -502 to -497, -472 to -465, -319 to - 312, -294 to -287, -192 to -185, -15 to -7, and -4 to +4 of the start codon of an endogenous ZmNEP-2.2 gene; wherein the amino acid sequence encoded by said at least one endogenous ZmNEP-2 gene has at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4,
[0082] whereby expression of the ZmNEP-2 protein encoded by said at least one endogenous ZmNEP-2 gene is increased, and
[0083] wherein said genetically modified Zea mays plant of (a) and (b) exhibits increased resistance to a microbial pathogen disease as compared to a parent plant from which said Zea mays plant was derived.
[0084] lii Cereal NEP-2 proteins of a genetically modified Zea mays plant
[0085] The invention provides a new sub-class of cereal nepenthesin-type 2 protein (comprising ZmNEP-2 proteins), whose increased expression in genetically modified Zea mays plants increases their resistance to fungal resistance.
[0086] In one embodiment the genetically modified Zea mays plant comprises one or more integrated nucleic acid molecules, where each molecule comprises a gene encoding a cereal NEP-2 protein, where the amino acid sequence of the protein has at least 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99 or 100 % sequence identity to ZmNEP-2.1 (NP_001306683.1 [SEQ ID No.: 2]) or to ZmNEP-2.2 (NM_001147010.1 [SEQ ID No.: 4]).
[0087] The cereal NEP-2 protein may be a ZmNEP-2 protein that is native to a Zea mays plant, or it may be an ortholog thereof that is heterologous in origin. By way of example, said cereal protein, encoded by said gene can be selected from among ZmNEP-2.1 (NP_001306683.1 [SEQ ID No.: 2]); ZmNEP-2.2 (NM_001147010.1 [SEQ ID No.: 4]); HvNEP-2.1 (Gen Bank XP_044961805.1) [SEQ ID No.: 7]; HvNEP-2.2 (XP_044957839.1) [SEQ ID No.: 9]; TaNEP-2.1 (Gen Bank XP_044432452.1 [SEQ IDNo.: 11]); TaNEP-2.2 (Gen Bank XP_044428699.1 [SEQ ID No.:13]); TaNEP-2.3 (Gen Bank XP_044442866.1 [SEQ ID No.: 15]), TaNEP-2.4 (Gen Bank XP_044443284.1 [SEQ ID No.: 17]); TaNEP-2.5 (Gen Bank XP_044436137.1 [SEQ ID No.: 19]); TaNEP-2.6 (Gen Bank XP_037463595.1 [SEQ ID No.: 21]); and TaNEP-2.7 (Gen Bank XP_044425240.1 [SEQ ID No.: 23]), as shown in figure 7A and B.
[0088] The Zea mays genes Zm00001d006330 Gene ID: 103647650 [SEQ ID NO.: 1] encoding ZmNEP-2.1 [accession NP_001306683.1; SEQ ID NO.: 2] and Zm00001d022078 Gene ID: 100272542 [SEQ ID NO.:3] encoding ZmNEP-2.2 [accession NM_001147010.1; SEQ ID NO.:4], are operatively linked to their native promoters that direct expression in kernel and leaf tissue respectively.
[0089] The cereal NEP-2 proteins, encoded by said genes, comprise a signal peptide (such as N terminal amino acids 1-21), facilitating entry of the proteins into the secretory pathway of cells of the Zea mays plant that express the protein(s).
[0090] liii Trans-gene, cis-gene or intragene encoding a cereal NEP-2 protein
[0091] The invention provides genes encoding members of said sub-class of cereal nepenthesin-type 2 proteins (comprising ZmNEP-2 proteins, as defined in lii), whose expression in genetically modified Zea mays plants increases their resistance to fungal disease, compared to a parent plant from which they were derived.
[0092] In one embodiment, the gene integrated into the genome of a Zea mays plant is a cis-gene because it shares nucleotide sequence identity to the sequence of an endogenous gene in the genome of said Zea mays plant, and wherein said cis-gene encodes a member of said sub-class of nepenthesin-type 2 proteins (as defined in lii). Preferably the amino acid sequence of the protein encoded by the cis-gene has at least 70, 80, 90, or 100% sequence identity to a ZmNEP-2.1 [SEQ ID NO.: 2] or ZmNEP-2.2 [SEQ ID NO.: 2]. A genetically modified Zea mays plant comprising one or more integrated copies of said cis-gene, expresses increased levels of a ZmNEP-2 protein (as defined in lii) encoded by the cis-gene, as compared to a parent plant from which the genetically modified Zea mays plant was derived.
[0093] In an alternative embodiment, the gene integrated into the genome of a Zea mays plant is a transgene because it encodes an orthologous member of said sub-class of nepenthesin-type 2 proteins not found in the Zea mays genome, such that the integrated gene is heterologous with respect to the Zea mays plant in which it is integrated. Similarly, the gene is a transgene when it has a synthetic nucleotide sequence encoding either a native or orthologous nepenthesin-type 2 proteins (as defined in lii), such that the transgene is heterologous with respect to the Zea mays plant in which it is integrated.In a further alternative embodiment, the gene integrated into the genome of a Zea mays plant is an intragene because it comprises both a promoter sequence and an operably-linked NEP-2 protein coding sequence found in the genome of the Zea mays plant into which it is integrated, where the intragene encodes a member of said subclass of nepenthesin-type 2 proteins (as defined in lii), but where the promoter is heterologous with respect to the coding sequence. Preferably the amino acid sequence of the protein encoded by the intragene has at least 70, 80, 90, or 100% sequence identity to a ZmNEP-2.1 [SEQ ID NO.: 2] or ZmNEP-2.2 [SEQ ID NO.: 2],
[0094] When the promoter operatively linked to the coding sequence of the respective gene, is heterologous in origin with respect to the origin of the coding sequence, a suitable heterologous promoter may be one that directs the expression of the respective cereal NEP-2 protein to a target tissue of the Zea mays plant, such as kernel tissue (preferably endosperm tissue) or leaf tissue. By way of example, a suitable heterologous endosperm-specific promoter is a Zea mays a-Zein gene promoter (nt.
[0095] 1...1097) of GenBank: M86591.1: [SEQ ID No.: 24]), or a glutelin GluB-1 promoter (nt. 1...2340) of GenBank: X54314.1: [SEQ ID No.: 25]). A suitable leaf-specific promoter is a Zea mays maize phosphoenolpyruvate carboxylase (ZmPEPCl) promoter (nt. 1...1766) of GenBank: NM_001161348.2: [SEQ ID No.: 26], or a Brachypodium distachyon FBPA promoter (nt. 1...2081) of [SEQ ID No.: 27]).
[0096] In another embodiment the promoter of said genes is homologous in origin with respect to the origin of the coding sequence to which it is operatively linked. By way of example, the genes ZmNEP-2.1 (Gene ID: 103647650 [SEQ ID No.: 1]), and ZmNEP-2.2 (Gene ID: 100272542 [SEQ ID No.: 3]) encode a cereal NEP-2 protein and whose coding sequence is operatively linked to its respective homologous promoter.
[0097] liv Genetically modified endogenous gene encoding a ZmNEP-2 protein
[0098] In another embodiment, an endogenous gene in the genome of the genetically modified Zea mays plant, that encodes a member of said sub-class of nepenthesintype 2 proteins, is genetically modified by one or more targeted nucleic acid sequence modifications (i.e. a nucleotide is substituted, or added, or deleted) with respect to the corresponding endogenous gene in the genome of the parent Zea mays plant from which it was derived, such as to increase the level of the encoded protein in the genetically modified Zea mays plant compared to the parent plant. Such one or more targeted nucleic acid sequence modifications can be obtained by use of methods based on CRISPR-Cas9, as described in example 7. Preferably said modifications result in at least one nucleotide in one or more cis-regulatory motifs of at least one endogenous ZmNEP-2 gene of a parent Zea mays plant being changed (i.e. a nucleotide is substituted, or added, or deleted), wherein the one or more cis-regulatory motifs areselected from among motifs 1 - 11 located at nucleotide positions: -287 to -280, -271 to -264, -261 to -254, and -4 to +4 of the start codon of an endogenous ZmNEP-2.1 gene; and / or at nucleotide positions -502 to -497, -472 to -465, -319 to -312, -294 to -287, -192 to -185, -15 to -7, and -4 to +4 of the start codon of an endogenous ZmNEP-2.2 gene, whereby expression of the ZmNEP-2 protein encoded by said at least one endogenous ZmNEP-2 gene is increased, and
[0099] wherein the amino acid sequence of said protein has at least 70, 80, 90 or 100% sequence identity to SEQ ID No: 2 or SEQ ID No: 4.
[0100] The nucleotide sequence of the endogenous gene in the genome of the parent Zea mays plant from which the genetically modified Zea mays plant was derived by means of said targeted nucleic acid sequence modifications, may be SEQ ID NO.: 1 or 3. In a preferred embodiment, the cis-modified motif in the 5'UTR of the endogenous ZmNEP-2.1 gene is located in uORF4 (e.g. SEQ ID No.: 121); while the cis-modified motifs in the 5'UTR of the endogenous ZmNEP-2.2 gene are located in any one of uORF's 1 - 6 and the kozak sequence (e.g. SEQ ID No.: 123 - 129], (Example 7, figure 26).
[0101] II Fungal resistance of a genetically modified Zea mays plant of the invention A genetically modified Zea mays plant of the invention comprises a gene that directs increased or modified expression of a cereal NEP-2 protein in developing kernels or leaves of the plant, such that the plant is more resistant to fungal disease than the parent plant from which it was derived by genetic modification.
[0102] Hi The antifungal properties of members of the cereal NEP-2 proteins The antifungal properties of cereal NEP-2 proteins are demonstrated herein by the antifungal properties of ZmNEP-2 proteins against fungal pathogens (example 3). As seen in figure 13 the accumulation of F. verticilliodes fungal biomass was significantly reduced by contact with ZmNEP-2.2 protein. Similarly, as seen in figure 14, the growth of S. Turcica was substantially reduced by contact with both ZmNEP-2.1 and ZmNEP-2.2 proteins. Furthermore, as seen in figure 15, contact with both ZmNEP-2.1 and ZmNEP-2.2 proteins significantly suppress the expression of S. turcica genes that are essential for fungal growth and pathogenicity.
[0103] liii The fungal resistance of a genetically modified H. vulgare lines expressing cereal NEP-2 proteins
[0104] Transgenic, cis-genic, intragenic, or NGT engineered expression of ZmNEP-2.1 or ZmNEP2.2 proteins in a Zea mays plant will confer greater fungal pathogen resistancewhen compared to the parent plant from which it was derived. This is documented by the observed increase in resistance to the pathogens F. graminearum (Fg) and Powdery mildew (Blumeria graminis) of host cereal plants (H. vulgare) genetically engineered to express ZmNEP-2.1 or ZmNEP-2.2 in either endosperm or leaf tissue when compared to the parent host plant (Example 5, figures 24 and 25)..
[0105] Ill Methods for producing and detecting a genetically modified Zea mays plant of the invention
[0106] A nucleic acid molecule having a nucleic acid sequence encoding a cereal NEP-2 protein, to be expressed in Zea mays plant of the invention (see section I), may be derived by sequence specific amplification of the corresponding sequence of the native cereal NEP-2 gene from genomic DNA extracted from the respective cereal plant. The nucleic acid molecule can also be produced synthetically, to comprise a coding sequence for the respective cereal NEP-2 protein; and whose nucleotide sequence is preferably optimised for expression in a Zea mays plant. Examples of suitable nucleic acid molecules encoding polypeptides having nepenthesin-2-type aspartic proteinase activity for expression in a Zea mays plant according to the invention is provided in the sequence listing. The nucleic acid molecule, encoding a cereal NEP-2 protein, may comprise its native promoter and terminator, or the cereal NEP-2 coding sequence can be operably linked (fused) to cis-regulatory regions comprising a heterologous promoter and terminator. The promoter may be constitutive; or preferably a tissuespecific promoter that directs tissue-specific expression in developing kernels (such as an endosperm-specific promoter) or in leaves of the Zea mays plant. A heterologous terminator (SEQ ID No.: 28) can be derived from the nopaline synthase gene, isolated from Agrobacterium tumefaciens.
[0107] A nucleic acid molecule, comprising a gene encoding a cereal NEP-2 protein, operably linked to cis-regulatory regions, is introduced into a nucleic acid construct (pWBVec8 vector; Gynheung et al., 1988) to ensure efficient cloning in both E. coli and an Agrobacterium strain, suitable for stable transformation of Zea mays. Such vectors include various binary and co-integrated vector systems, which are suitable for the T-DNA-mediated transformation. The vector systems are generally characterized by having at least the vir genes, which are required for Agrobacterium-mediated transformation, and T-DNA border sequences.
[0108] Agrobacterium transformation typically involves the transfer of the binary vector carrying the one or more nucleic acid molecules comprising a cereal ZmNEP-2 gene (e.g., pWBVec8 vector) to an appropriate Agrobacterium strain, and may be performed as described by Gynheung et al., (1988). For example, transformation of a parent Zeamays plant by recombinant Agrobacterium may be performed by co-cultivation of a suspension of transformed Agrobacterium cells with isolated immature Zea mays embryos on a solid selective growth medium following the procedure described by Bartlett et al., (2008) and Holme, et al. (2017). Transformed tissue is regenerated on selectable medium carrying an antibiotic or herbicide resistance marker present between the T-DNA borders of the binary vector.
[0109] Positive transformants can be identified by PCR using a 5' primer with a binding site located in the promoter region upstream of the NEP-2 coding sequence and a 3' primer located inside the coding sequence for the cereal NEP-2 gene; so as to distinguish the inserted gene from a native gene encoding a ZmNEP-2 protein.
[0110] Similarly, a NGT genetically modified Zea mays plant, comprising nucleotide conversions in a cis-regulatory region of a native ZmNEP-2.1 or ZmNEP-2.2 gene, can be detected by PCR using a 5' primer with a binding site located in the 5'UTR region upstream of the NEP-2 coding sequence and a 3' primer located inside the coding sequence for the ZmNEP-2 gene, and whose cis-regulatory region nucleotide sequence can be distinguished from the corresponding nucleotide sequence of the parent Zea mays plant from which it was derived.
[0111] Cisgenes in cisgenic plants can be identified using standard southern blot analysis or by means of inverse PCR (iPCR) (Jong et al., 2002), where one or more copies of a gene and their respective flanking regions in the genome are amplified, and then compared. The iPCR technique involves the digestion of source DNA, circularisation of restriction fragments, and amplification using oligonucleotides that prime the DNA synthesis directed away from the core region of a known sequence, i.e., opposite of the direction of primers used in normal or standard PCR. Selection and characterization of relevant transgenic inserts from the extracted and digested Zea mays genomic DNA can be performed by Xdrop™ Indirect sequence capture (Blondal et al., 2021).
[0112] In this manner iPCR can be used to distinguish and identify a cis-ZmNEP-2 gene inserted into the genome of a genetically modified Zea mays plant of the invention from a native copy of the ZmNEP-2 gene in the genome.
[0113] IV Use of genetically modified Zea mays plants of the invention Genetically modified kernels, leaves, and shoots produced by genetically modified Zea mays plants of the invention have a lower risk of contamination with toxins and mycotoxins due to their enhanced resistance to infection by fungal diseases, in particular Fusarium infections. Infection by these fungal diseases is accompanied by the production of toxins belonging to the trichothecenes (e.g. Deoxynivalenol (DON),nivalenol (NIV) and their derivatives including 3-acetyldeoxynivalenol (3-ADON), 15-ADON and 4-acetylnivalenol) and mycotoxins (e.g. zearalenone, moniliformin, fumonisins and butenolide) Since both toxins and mycotoxins carry a health risk when used as feed for animals or for human consumption, there is an advantage in using plant material derived from genetically modified Zea mays plants of the invention. Accordingly, kernels, stalks and leaves produced by genetically modified Zea mays plant of the invention can be used in the production of animal fodder (silage or hay); processed for human consumption or used for fibre / thread manufacture.
[0114] Traditional processing steps performed when using genetically modified Zea mays kernels of the invention include one or more of the following processing steps that can be divided into 5 sections: cleaning, conditioning, degerminating, milling and sifting, packing:
[0115] 1. Cleaning / conditioning Zea mays kernels: First the genetically modified kernels are cleaned. For example, the kernels may be passed through magnets and / or metal detectors to remove any metal contamination.
[0116] 2. Conditioning section (Moisture damper): The purpose of using a moisture-proof device to adjust kernels is to reduce the binding force between corn skin and endosperm, reduce endosperm strength, and be more conducive to grinding.
[0117] 3. Peeling and degerming of Zea mays: The purpose of peeling and degerming of kernels is to obtain more products suitable for different food requirements. However, there are also many nutrients in Zea mays husks and germs, such as cellulose, and peeling the husks means that we lose some of them.
[0118] 4. Milling and sifting: The processed raw materials are ready to enter roller mills. Through the reciprocating grinding of the milling machine, the kernels are ground into flour. Milled kernels are sieved with high square, a double bin sieve, or a single square sieve to obtain meal and corn grits of different fineness. And the rest that is not passed though the sieve will be milled again.
[0119] 5. Packaging
[0120] Examples
[0121] Example 1: Identification of the ZmNEP-2 candidates
[0122] 1.1 In silico analysis
[0123] 1.1.1 Database search for the nepenthesins in the maize genomeFor the search of nepenthesin homologues in maize, protein sequences annotated as nepenthesins in the maize genome were collected from plant genome sequence databases Phytozyme (https: / / phytozome-next.jgi.doe.gov / ), Ensemble Plants (http: / / plants.ensembl.org / index.html) and NCBI (https: / / www.ncbi.nlm.nih.gov / ) were searched using the standard search settings (restricted to the maize protein sequences). A total of 99 genes annotated as encoding putative nepenthesins were found in the maize genome.
[0124] 1.1.2 Sequence filtering and MEME conserved motif search
[0125] The 99 maize protein sequences found in the various databases (1.1.1) were extracted, merged and aligned, and fragmented and redundant sequences were discarded manually. Sequences were further examined for the presence of the aspartic protease signature motifs (Asp-Thr-Gly (DTG) or Asp-Ser-Gly (DSG)) (Simoes, I etai., 2004), of which 68 putative Zea mays NEP proteins and 74 predicted Hordeum vulgare NEP proteins comprising these motifs were selected for further analysis. Multiple sequence alignments, sequences visualization and editing were done using the Jalview program (https: / / www.jalview.org / ). After sequence filtering, selected maize nepenthesins (ZmNEPs) were searched for conserved motifs and compared with the motifs identified in the barley nepenthesins (HvNEPs) (https: / / meme- suite.org / meme / ). As seen in figure 1, ten different sequence motifs (logos) identified in HvNEP proteins were also found within individual members of the selected putative maize proteins; suggesting a related functionality within cereals.
[0126] 1.1.3 Baseline and differential expression analysis of the ZmNEPs
[0127] Baseline and differential expression of each of the 68 ZmNEPs was analyzed using the Gene Investigator, Expression Atlas (https: / / www.ebi.ac.uk / gxa / home), MaizeGDB (https: / / www.maizegdb.org / ) and Plant Public RNA-seq (https: / / www.plantrnadb.com / ) databases. The baseline expression of the subsequently selected 7 ZmNEP genes detected at different stages of Zea mays development is shown in figure 2. Based on this tissue-specific expression analysis, 7 ZmNEP genes were selected for further analysis. These 7 ZmNEP genes were all expressed in preferred target plant tissue (kernel and leaf tissue) of Zea mays plants and showed strong specific expression in response to pathogen attack; preferentially in response to: Fusarium graminearum; Fusarium verticillioides; Ustilago maydis; Setosphaeria turcica; Rhopalosiphum maidis (Aphids); and Tetranychus urticae (Red spider mites)], as shown in figure 3.
[0128] The differential expression of ZmNEPs was analysed with respect to two specific pathogens, Fusarium and Ustiiago, using the Expression Atlas database. This analysisrevealed that the expression of Zm00001d004734, Zm00001d006525, Zm00001d006330 [SEQ ID NO.: 1] and Zm00001d022600 was up-regulated and consistent with the previous analysis.
[0129] Based on a combination of both the protein structural characteristics and the significant disease response expression of the gene encoding ZmNEP-2.1 [Zm00001d006330: SEQ ID NO.: 1] in kernel tissue, this encoded protein was selected as a preferred ZmNEP candidate, while the gene encoding the ZmNEP-2.1 protein [Zm00001d022078: SEQ ID NO.: 3] was included in view of its leaf specific expression and the clustering of the two ZmNEPs proteins in the phylogenetic tree (see below and figure 4).
[0130] 1.1.4 Construction of a phylogenetic tree of HvNEPs and ZmNEPs
[0131] A protein sequence-based phylogenetic tree of the annotated 68 putative ZmNEPs and 74 predicted HvNEPs was constructed after cleaning of aligned sequences with the Block Mapping and Gathering using Entropy (BMGE) program (https: / / test.galaxyproject.org / ). Neighbor-end joining tree was constructed with bootstrap value of 1000 substitutions using MEGA11 software. The phylogenetic tree reveals four major clades (families) of NEPs, where HvNEP-1 and ZmNEP-2 proteins belong to different clades. The two ZmNEPs, ZmNEP-2.1 and ZmNEP-2.2 belong to the same clade, together with two NEP-2s encoded by the H. vulgare genome.
[0132] 1.1.5 Characterization of selected ZmNEP-2 candidates
[0133] The amino acid sequences of ZmNEP-2.1, [NP_001306683.1: SEQ ID NO.: 2]; ZmNEP-2.2 [NP_001140482.1: SEQ ID NO.: 4] and HvNEP-1 [UNIPROT: M0W9B2: SEQ ID NO.: 5] were aligned using the Clustal Omega software (https: / / www.ebi.ac.uk / jdispatcher / msa / clustalo). Sequence alignment and percent identity to HvNEP-1. The alignment shown in figure 5A and B, reveals that the two candidate ZmNEP-2 proteins share a high level of sequence identity (about 85%). However, the two candidate ZmNEP-2 proteins share low sequence identity to HvNEP-1, even though they share some sequence motifs in common.
[0134] Alignment of the amino acid sequences of ZmNEP-2.1, [NP_001306683.1: SEQ ID NO.: 2]; ZmNEP-2.2 [NP_001140482.1: SEQ ID NO.: 4] with other candidate cereal NEP-2s reveals that closed orthologs are found in both Hordeum vulgare and Triticum aestivum (figures 6 and 7), where the each of the identified candidate NEP-2 orthologs comprised an amino acid sequence having at least 70% sequence identity with the amino acid sequences of both ZmNEP-2.1 and ZmNEP-2.2.
[0135] 1.1.6 Co-expression network analysis of the ZmNEP-2Following the above procedures, two ZmNEP-2 candidates were selected for coexpression network analysis. The ZmNEP-2 co-expression networks and clusters, and possible pathways involvements were investigated using STRING (http: / / versionlO.string-db.org / ) and plant expression database (https: / / atted.j / ). As shown in figures 8 and 9, the genes that are co-expressed in Zea mays plants with the two ZmNEP-2 candidates are WRKY2533, WRKY33, ACS6 and CaMCM. As denoted in figure 9, these four genes all play a role in various branches of the plant defense pathway.
[0136] Example 2. Synthesis of recombinant ZmNEP-2s
[0137] The two candidate ZmNEP-2 genes were cloned and expressed in the Pichia pastoris expression system using In-Fusion cloning, accordingly (Takara Bio, Japan), to produce sufficient amounts of extracellular recombinant ZmNEP-2 (rZmNEP-2) to characterize their antifungal properties.
[0138] 2.1 Cloning candidate ZmNEP-2 genes
[0139] K DNA polynucleotide comprising the full-length gene (1598bp), Zm00001d006330 [SEQ ID NO.: 1] encoding ZmNEP-2.1, was amplified by PCR using PCR primers (Fw: TCCGTCGGTCCACTTCTCA [SEQ ID NO.: 29] and Rv: GTTCGTCCTCTCAGTCTCA [SEQ ID NO.: 30]) and Herculase II Fusion DNA Polymerase (Agilent, CA, USA) from genomic DNA derived from leaves of B104 maize seedlings (derived from kernels obtained from USDA Agricultural Research Service seed repository) using the phenolchloroform (Moller, M. G et al., 2003). A DNA polynucleotide comprising the full-length gene (1586bp), Zm00001d022078 [SEQ ID NO.:3], encoding ZmNEP-2.2 was similarly amplified using PCR primers: (Fw: TGCCTCAGCTATGTTGCAGCTCG [SEQ ID NO.: 31] and Rv: GAATTGTTGGTCCTCTCGGGCAG [SEQ ID NO.: 32). PCR conditions for both targets include 96°C for 2 min, initial denaturation; 96°C for 1 min, denaturation; 57°C for 20 sec, annealing; 72°C for 2 min, elongation); and final 72°C for 2.30 min, final extension. PCR products (figure 8A) were gel purified and cloned into chemical competent E. coli cells, and transformant bacterial cells were verified by Sanger sequencing. Positive plasmids were isolated and used for constructing the Pichia expression plasmid.
[0140] The cloned PCR products were re-amplified with in-fusion primers that selectively amplified the sequence encoding the respective mature ZmNEP-2.1 and 2.2 polypeptides devoid of their signal peptide (Figure 8B). The in-fusion primers used to produce PCR product Zm6330 derived from the full-length gene Zm00001d006330 [SEQ ID NO.: 1] were (Fw:
[0141] GAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTTCACCTGGTATTGTGAAGCTCAA CTCGTCGTC [SEQ ID NO.: 33] and Rv:GATGATGATGATGGTCGACCTAATGATGATGATGATGATGTGGCACCTCGGCGCACCGCCGC GGCGCG [SEQ ID NO.: 34]); while the in-fusion primers used to produce PCR product Zm2078 derived from full-length gene Zm00001d022078 [SEQ ID NO.: 3] were (Fw: GAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTGGCATCGCGAAGCTCAACTCCTC GTCGCCCCT [SEQ ID NO.: 35] and Rv:
[0142] GATGATGATGATGGTCGACCTAATGATGATGATGATGATGTGGCACCTCGGCGCACCGGCGC GGCGCG [SEQ ID NO.: 36]).
[0143] The resulting PCR amplified DNA polynucleotides were inserted into the pPICzoA vector digested with Xhol and Sall-digested and transformed into E. coli. The resulting sequence-positive clones, pPICzaA-Zm2078 and pPICzaA-Zm6330, were used for Pichia transformation. The resulting Pichia expression plasmids each comprise an SP-lacking ZmNEP-2 (AZmNEP-2) coding sequence fused downstream of the alpha-mating SP coding sequence in the pPICz alpha A expression vector, according to the manufacturer (Invitrogen, USA). SP sequences for the ZmNEP-2 genes were predicted using SignalP 6.0 software (https: / / services. healthtech. dtu.dk / services / SignalP-6.0 / ).
[0144] 2.2 Pichia transformation and rZmNEP-2 production
[0145] Intact pPICzaA-AZm2078 and pPICzaA-AZm6330 plasmids were Dral-linearized and used for transformation into electrocompetent Pichia cells. Briefly, 10 pg of plasmid DNA was linearized using Dral restriction enzyme, according to the manufacturer (NEB, UK). After overnight digestion, the DNA was desalted and transformed into electrocompetent cells of Pichia X-33 strain, as described in Bekalu et al., (2021). The transformant Pichia clones were selected on YPD agar plates supplemented with 100, 200 and 300 ug / L Zeocin. Selected Pichia clones were investigated for the expression of the recombinant protein using SDS-PAGE (figure 11). Since the pPICz alpha A vector contains methanol-inducible AOX1 promoter, induction of protein production was performed by supplement 2% methanol into the growth media for 4 consecutive days by shaking (28°C, 170 rpm). Proteins produced from the 400 mL induction media were collected by centrifugation (4600g, 4°C, 5 min), and the pH was adjusted to 8 NaOH for FPLC purification.
[0146] 2.3 FPLC purification of the rZmNEP-2 and verification by SDS-PAGE
[0147] The rZmNEP-2 proteins, Zm2078 [SEQ ID NO.: 4] and Zm6330 [SEQ ID NO.: 2] were purified using the AKTA fast protein liquid chromatography (FPLC) device equipped with Ni affinity IMAC FF16 / 10 column (figure 12A, B). Eluted fractions were collected, concentrated and examined by Bradford and SDS-PAGE (figure 12C).
[0148] Example 3. In vitro characterization of the recombinant ZmNEP-2sThe antifungal properties of the rZmNEP-2 proteins were examined against F. verticilliodes and Setospheria turcica.
[0149] 3.1 Antifungal effect of rZmNEP-2 on F. verticilliodes
[0150] For the in vitro assay, three mycelial plugs of F. verticilliodes were inoculated into 50 mL CMC media (Carboxymethyl cellulose (CMC) media containing 1.5% CMC-Na, 0.1% NH4NO3, 0.1% KH2PO4, 0.1% YE and 0.05% MgSC heptahydrate) and grown and allowed to sporulate for 3 days by shaking 125 rpm @22°C. The resulting spores were filtered through Miracloth and collected by centrifugation (4500g, RT, 15 min). Then, the spores were resuspend in 1 mL sterile MilliQ water and centrifugated at 7500g, room temperature for 5 min. The supernatant was discarded and spores were resuspended with 500 uL of MQ water. The 50x diluted suspension spore was used to measure the spore concentration using a hemocytometer plate. For the in vitro study, 50 uL of 107spores / ml were inoculated into 50 mL GY40 media (2% (w / v) glucose, 0.5% (w / v) yeast extract) and cultured overnight (250 rpm, RT), whereafter 100 uL of the resulting GY40 culture was added to 100 mL SY40 media (6% sucrose, 0.1% yeast extract). The resulting SY40 culture (1 mL) was distributed into 24 well-plates and either a solution of purified ZmNEP-2.2 (2 ug) in 50mM acetate buffer, pH 5.0 or just buffer was added to the culture in all wells. The cultures were left to grow by shaking at 250 rpm and room temperature and the 'DAY-2' cultures were collected after 24 hr incubation. 2 ug of the rHvNEP-2 or buffer was added to the remaining cultures and left to grow by shaking for overnight using the same setup as described above. On day 3, the DAY-3 cultures were collected; and 2 ug of ZmNEP-2.2, or buffer was added into the remaining cultures. Similar procedures were applied to cultures collected at DAY-4 and DAY-6. The collected mycelial masses were collected by centrifuged, freeze dried and the dry weight of the mycelial biomass was determined. As seen in figure 13 the presence of the purified ZmNEP-2.2 significantly reduced the accumulation of fungal biomass in F. verticilliodes.
[0151] 3.2 Antifungal effect of rZmNEP-2 on S. turcica
[0152] The fungal isolate of S. turcica was grown on V8 plates for 2 weeks at room temperature (12 h of light); and a suspension of spore derived from the plates was used to inoculate potato dextrose broth (PDB). Fungal cultures were grown in 50 mL of PDB in a 250 mL flask for 5 days by shaking at 120 rpm, RT. The mycelium was harvested using sterile Miracloth in a Buchner funnel and rinsed with sterile MQ water. For in vitro tests, spore concentrations were determined by plating serial dilutions on PDA plates, followed by enumeration. The spore concentration was adjusted to the required concentration with sterile Milli-Q water before use or stored in 15-50% glycerol at -80°C for a longer period. For the in vitro assay, the spores wereresuspended in PDB to a final concentration of lx 105 / mL and 1 mL of the spore suspension was transferred into each well of a sterile 24-well plates. A solution of 2 ug purified ZmNEP-2.2 protein (Zm2078 [SEQ ID NO.: 4] or ZmNEP-2.2 protein [Zm6330: SEQ ID NO.: 2]) in 20 uL 50mM acetate buffer, pH 5.0, or 20 uL of buffer alone were added to the wells. The plates were sealed with an optically clear seal and incubated for 6 days at RT; and the OD620 of the samples was recorded at DAY-2, DAY-3, DAY-4 and DAY-6 using microplate reader. The addition of either ZmNEP-2 or buffer into the cultures and sample collection, and determination of mycelial biomass were performed as described above for F. graminearum and F. verticilliodes. The OD620 measurement and fungal biomass determinations were used to evaluate the performance of each rZmNEP-2 on the growth of S. turcica.
[0153] As seen in figure 14, both ZmNEP2.1 and ZmNEP-2.2 proteins substantially reduced the growth of S. Turcica.
[0154] 3.3 Impact of rZmNEP-2 on S. turcica gene expression
[0155] Spores of the fungal isolate of S. turcica, were cultured for 6 days in PDB media in the presence of a 20 ul solution of 2 ug purified ZmNEP-2.2 protein (Zm2078: SEQ ID NO.: 4) or ZmNEP-2.2 protein (Zm6330: SEQ ID NO.: 2) in 50mM acetate buffer, pH 5.0, or 20 uL of the buffer alone added each day utill day-6, and the accumulated fungal biomass harvested by centrifugation as described in 3.2. For gene expression analysis, total RNA was isolated from the mycelial mass accumulated under each treatment using the Analytik Jena kit, according to the manufacturer (Analytik Jena, Germany). Following treatment of RNA samples with DNase I (DNASE70) (Merck, Darmstadt, Germany), a reverse transcription reaction was performed on 200 uL of RNA, using the oligo (dT)18 and Superscript IV RT (Invitrogen, USA). The amplification of cDNA was performed using SYBR Green master mix, and the qPCR reaction was detected using the AB7900HT sequence detection system (Applied Biosystem, USA). The expression of STK1 (zebe_141: CGTAGAGACGTAGCCCGTCATCTGG [SEQ ID NO.: 37] and zebe_142: CTCTACCAGATTTTGCGTGGGCTGA [SEQ ID NO.: 38]), SRE1 (zebe_143: AACACCTGCTACTCGTCGAA [SEQ ID NO.: 39]and zebe_144:
[0156] AGTGTGTGTAATCTCTCCAGC [SEQ ID NO.: 40]), StSTE12 (zebe_145:
[0157] TCAACACGGTAGAGGAGAGCC [SEQ ID NO.: 41] and zebe_146:
[0158] TCGTCACCCTCGAGATCTTCC [SEQ ID NO.: 42]) and PKC (Protein kinase C) (zebe_149: AGCGACCCAACTACAGCAAG [SEQ ID NO.: 43] and zebe_150:
[0159] TGCGTCATGGTTAGTATCCG [SEQ ID NO.: 44]) in the S. turcica samples cultured in the presence of a solution of 2 ug purified ZmNEP-2.2 protein (Zm2078: [SEQ ID NO.: 4]) or ZmNEP-2.2 protein (Zm6330: [SEQ ID NO.: 2]) in 50mM acetate buffer, pH 5.0, or 20 uL of the buffer alone was analysed by qPCR. The p-tubulin gene (zebe_147:
[0160] GGGAACTCCTCACGGATGTTG [SEQ ID NO.: 45] and zebe_148:TAACAACTGGGCAAAGGGTCA [SEQ ID NO.: 46]) expression was used as an internal reference gene.
[0161] As seen in figure 15, both ZmNEP2.1 and ZmNEP-2.2 proteins significantly suppressed the expression of S. turcica genes involved in growth and pathogenicity.
[0162] Example 4. Transgenic ZmNEP-2 overexpressing Hordeum vulgare lines Hordeum vulgare plants expressing genes encoding ZmNEP-2 proteins were engineered by transformation with the respective genes.
[0163] 4.1 ZmNEP-2 gene transformation vector construction
[0164] Hordeum vulgare cv. Golden Promise was transformed with a gene encoding ZmNEP2.1 (Zm6330) [SEQ ID NO.: 2]; or a gene encoding ZmNEP2.2 (Zm2078) [SEQ ID NO.:4] where each gene was engineered for expression in either endosperm (kernel) or in leaf tissue.
[0165] The ZmNEP-2 gene constructs were as follows:
[0166] • Endosperm expression of ZmNEP-2.1: HorD promoter [SEQ ID NO.: 47]: a ZmNEP-2.1 coding sequence [2813...4342 of SEQ ID NO.: 1]: NOS terminator [SEQ ID NO.: 28];
[0167] • Leaf expression of ZmNEP-2.1: FBPA promoter [SEQ ID NO.: 27]: ZmNEP-2.1 coding sequence [2813...4342 of SEQ ID NO.: 1]: NOS terminator [SEQ ID NO.: 28];
[0168] • Endosperm expression of ZmNEP-2.2: HorD promoter [SEQ ID NO.: 47]: ZmNEP-2.2 coding sequence [3003..4538 of SEQ ID NO.:3]: NOS terminator [SEQ ID NO.: 28]; and
[0169] • Leaf expression of ZmNEP-2.2: FBPA promoter [SEQ ID NO.: 27]: ZmNEP-2.2 coding sequence [3003..4538 of SEQ ID NO.:3]: NOS terminator [SEQ ID NO.: 28],
[0170] The HorD promoter is the D-hordein promoter derived from the Hordeum vulgare gene HORVU. MOREX. r3.1HG0068040.
[0171] The kernel-specific ZmNEP-2.1 and ZmNEP2.2 expression constructs were assembled using the pD-hordein promoter amplified from genomic DNA isolated from the barley cv. Golden promise, used as template. A pVec8-pD-hordein:: USER:: NOS vector was prepared and each respective ZmNEP genes was individually inserted using In-Fusion reaction (Takara Bio, Japan). The coding sequences for the ZmNEPs were PCR amplified using In-Fusion Primers Fw: TGACAGTCCACCGAGATGGCGCAGCTCGCGG [SEQ ID No.: 54] and Rv: TTAGCTGAGGCATTAATTAACTACACCTCGGCGCACCG [SEQ ID No.: 55] for Zm6330 and Fw: TGACAGTCCACCGAGATGTTGCAGCTCGCGGCGCGGTC [SEQ ID No.: 56] and Rv: TTAGCTGAGGCATTAATTAACTACACCTCGGCGCACCGGCGCG [SEQ ID No.: 57] for Zm2078. The amplified fragments are inserted into the pVec8 vector digested BstXI and Pad accordingly.The FBPA promoter is the fructose-1, 6-bisphosphate aldolase (FBPA) promoter derived from Brachypodium distachyon gene Bradi4g24367. The promoter (pFBPA) was amplified from Brachypodium distachyon cultivar Bd21-3. PCR amplification was performed using the primer pairs (pFBPA fwd: TCATTGGACGTGTTGATGTGC [SEQ ID
[0172] No.: 58] and pFBPA rev: TGTTTCTGGCTCCAAAGG [SEQ ID No.: 59]) and Herculase II Fusion DNA Polymerase. The 2081 bp pFBPA PCR product was TOPO cloned and sequenced (Macrogene Europe, The Netherlands).
[0173] The leaf-specific ZmNEP-2.1 and ZmNEP2.2 expression vectors were constructed by
[0174] first digesting pVec8-Ubi:: USER:: NOS vector with Notl. For. The following three
[0175] fragments, for each expression vector, were prepared for the In-Fusion reaction: 1)
[0176] the pFBPA promoter 2) the ZmNEP-2.1 or Zm-2.2 gene and 3) the NOS terminator.
[0177] The intact pFBPA TOPO clone was used as PCR template for the promoter, sequenced
[0178] TOPO clones of the ZmNEPs genes were used to amplify the respective ZmNEP genes
[0179] and the NOS terminator was amplified from pVec8-Ubi:: USER:: NOS vector as
[0180] template. The In-Fusion primers used for amplification of the fragments are listed
[0181] below (Table 1).
[0182] Table 1. In-Fusion primers used for generating the overexpression constructs
[0183] In-Fusion Primer ID Primer sequence (5' to 3')
[0184] Zm6330 / Zm2078 Fw (promoter) CTTATGCATGCGGCCGCTCATTGGACGTGTTGATGTGCTG [SEQ ID No.: 60]
[0185] Zm6330 Rv (promoter) TGCGCCATTG I 1 1 C 1 GGCTCCAAAGGCAAG [SEQ ID No.: 61] Zm6330 Fw (gene) AGAAACAATGGCGCAGCTCGCGG [SEQ ID No.: 62] Zm6330 Rv (gene) GCATTAATCTACACCTCGGCGCACCG [SEQ ID No.: 63] Zm6330 Fw (terminator) GGTGTAGATTAATGCCTCAGCATTAATGCCTCAGCG [SEQ ID No.:
[0186] 64]
[0187] Zm6330 / Zm2078 Rv CCTCTAGATGCGGCCGCGCTGAGGCATTAATC [SEQ ID No.: 65] (terminator)
[0188] Zm2078 Rv (promoter) TGCAACATTG 1 1 1 C 1 GGCTCCAAAGGCAAG [SEQ ID No.: 66] Zm2078 Fw (gene) AGAAACAATGTTGCAGCTCGCGGCGCGGTC [SEQ ID No.: 67] Zm2078 Rv (gene) GCATTAATCTACACCTCGGCGCACCGGCGC [SEQ ID No.: 68] Zm2078 Fw (terminator) GGTGTAGATTAATGCCTCAGCATTAATGCCTCAGCGATCGTTCAAAC [SEQ ID No.: 69]
[0189]
[0190] Following the In-Fusion reaction, the kernel-specific and the leaf-specific ZmNEP gene expression vectors were transformed into chemically competent E. coli cells and thebacterial plasmids isolated therefrom were verified for assembly of the intact expression cassette, by restriction digestion and Sanger sequencing. The resulting ZmNEP gene expression vectors were introduced into competent Agrobacterium strain AGLO, as described Gynheung et al., (1988). Transformants were selected by growth on LB plates containing 100 pg / ml spectinomycin and 25 pg / ml Rifampicin for 72 h at 28°C; and positive colonies were identified by PCR. Positive clones were cultured in MG / L medium ((5 g / l Mannitol, 1 g / l L-glutamic acid, 0.25 g / I KH2PO4, 0.1 g / l NaCI, 0.1 g / I MgSO4*7H2O, Ing / I Biotin, 5 g / l Tryptone, 2.5 g / l Yeast extract) containing 100 pg / ml spectinomycin and 25 pg / ml Rifampicin and then used for immature barley embryo transformation following the procedure described by Bartlett et aL, (2008) and Holme, et al. (2012).
[0191] 4.2 Agrobacterium-mediated transformation of Hordeum vulgare
[0192] The donor plants Hordeum vulgare cv. Golden Promise) used for transformation were grown in a growth chamber with a 16 h light period with 350 p E m-2s-1and 15°C / 10°C (day / night) temperature. Immature barley embryos were used as explant for transformation. Briefly, twelve- to fourteen-day old embryos were isolated and transformed as previously described (Holme etai., 2017). The axis was cut away from the scutellum using a scalpel dipped in an overnight Agrobacterium culture without antibiotics. Transformed embryos were sub-cultured on callus induction, regeneration and rooting media containing appropriate antibiotic for selection of transformed Hordeum vulgare lines.
[0193] 4.3 Detection of transformed H. vulgare lines comprising ZmNEP-2 genes
[0194] Leaf pieces (derived from each of the TO generation of Hordeum vulgare lines) of approximately 10 cm were cut and put in 2 ml screw cap tubes with two glass beads. The samples were frozen in liquid nitrogen and homogenized in a FastPrep-24 5G homogenizer (MP Biomedicals) at speed 6 m / s for 10 seconds. Genomic DNA (gDNA) was isolated from the homogenized leaf tissue using the phenol / chloroform method (Moller et aL, 2003). PCR reactions for detection of T-DNA inserted heterologous ZmNEP-2 genes were performed using gDNA as template and construct specific primers: Hygromycin forward primer: 5'- AATACGAGGTCGCCAACA [SEQ ID NO.: 48] and reverse primer: 5'- TTCTACACAGCCATCGGTCC [SEQ ID NO.: 49], Herculase II polymerase was used for the PCR reaction using the reaction condition: 95°C for 2 min, then 38 cycles with 95°C for 30 sec, 66°C for 30 sec, 72°C for 40 sec, and a final extension at 72°C for 3 min.
[0195] PCR products having a length and nucleotide sequence consistent with the presence of each of the respective ZmNEP-2 genes in the transformed Hordeum vulgare plants was determined by nucleotide sequencing.Transgenic Hordeum vulgare lines comprising each of the ZmNEP-2.1 (Zm6330) and ZmNEP-2.2 (Zm2078) encoding gene constructs (as defined in 4.1.) were detected.
[0196] 4.4 Detection of ZmNEP-2.1 and ZmNEP-2.2 gene expression in transformed H. vulgare lines.
[0197] Transgenic lines were subsequently analyzed for the transgene expression in the relevant tissue. The relative expression (-AACt) value was determined by subtracting the ACt of the wild type control plants from the ACt of the gene of interest (AACt). For kernel-specific overexpression, 16 and 10 regenerated lines were analysed for Zm6330 gene or Zm2078 gene expression, respectively (Figure 22 A and B). Likewise, seventeen Zm6330 and nine Zm2078 regenerated lines were analysed the transgene expression analysis in leaf tissue (Figure 23 A and B). In the kernel-overexpressing transgenic lines, the relative expression of Zm6330 was ranged from -10.3 (plant # 22) to 6.7 (plant #1) (Figure 22A) and, for the Zm2078, the relative expression was ranged from 1.3 (plant # 10) to 21. 5 (plant # 9) (Figure 22B). In the case of leaf-overexpressing lines, the expression levels of Zm6330 were between -1 (plant # 14) and 16.9 (plant # 20) (Figure 23A), whereas the expression levels of Zm2078 were ranged between -5.3 (plant # 1) and 17.6 (plant # 7) (Figure 23B).
[0198] Example 5. Pathogen resistance of ZmNEP-2.1 (Zm6330) and ZmNEP-2.2 (Zm2078) overexpressing Hordeum vulgare lines
[0199] Hordeum vulgare plants expressing genes encoding ZmNEP-2 proteins were evaluated for their resistance to both seed-borne pathogens and leaf pathogens.
[0200] 5.1 Seed borne pathogens
[0201] 5.1.1 Method of infection by kernel borne pathogens of genetically modified H. vulgare tines comprising an endosperm-specific (HorD promoter) expressed ZmNEP-2.1-, or ZmNEP-2.2-, or HvNEP-1 gene.
[0202] H. vulgare plant tissues were infected with the kernel-borne pathogen, Fusarium graminearum isolate Fg7775 by a procedure described in (Bekalu et al., 2020), with few modifications. Briefly, instead of spray-on infection, of H. vulgare spikes at early anthesis using 10 pl of F. graminearum spore suspension (1000 spores), were point inoculated in the middle of the spikelets. The infected spikes were then sprayed with Milli Q water (MQ) and covered for 3 days.
[0203] 5.1.2 Disease severity / disease resistance of genetically modified H. vulgare lines comprising a transgene expressing kernel-specific ZmNEP-2.1-, or ZmNEP-2.2genes.Selected kernel-specific ZmNEPs overexpressing lines were investigated for the resistance to Fusarium head blight disease, caused by Fusarium graminearum (Fg). For the analysis, developing spikes were infected with Fg spores by point inoculation. Following the inoculation, infected spikes were covered with plastic bags for 3 days and the number of symptomatic kernels in the spikes were scored 23 days after infection (DAI). Based on the Fg infection analysis, the percent infection was significantly reduced in transgenic lines overexpressing Zm6330 (8.8%) and Zm2078 (7.4%) compared to the wildtype control (23.1 %) (Figure 24).
[0204] In summary, genetically modified H. vuigare lines that express genes encoding ZmNEP-2.1 or ZmNEP-2.2 proteins under the control of an endosperm-specific (HorD) promoter exhibit greater resistance to F. graminarium disease when compared to wildtype H. vuigare cv. Golden Promise control plants.
[0205] 5.1.3 Methods of detection of mycotoxin in genetically modified H. vuigare lines comprising an endosperm-specific (HorD promoter) expressed ZmNEP-2.1-, or ZmNEP2.2-, or HvNEPl- gene.
[0206] For mycotoxin analysis, mature kernels from the infected and control spikes were collected. The concentrations of mycotoxins (deoxynivalenol (DON), nivalenol (NIV) and zearalenone (ZEA) in the grains were determined as described in Etzerodt et al., (2016). Briefly, Barley grain sample (100 mg) was extracted with 800 pL of 84% acetonitrile by 10 min sonication followed by shaking for 2 h and centrifuged at room temperature for 10 min at 3800g. The extracts were diluted 5 times with water and samples were then filtered through syringe microfilters before analysis by liquid chromatography interfaced with MS / MS (AB Sciex 4500, Naerum, Denmark). Filtered extract (10 uL) was chromatographed on a BDS Hypersil C18 column, 250 mm x 2.1 mm i.d., 5 pm (Fischer Scientific, Roskilde, Denmark) equipped with a 10 mm x 2.1 mm guard column of the same material. Flow rate was 0.2 mL / min using eluents (A) 1% MeOH and (B) 90% MeOH by gradient elution with 0.2 mL / min flow rate: 0-1 min at 0% B, 1-10 min at 0-100% B, 10-14 min at 100% B, 14-14.5 min at 100-0% B, and 14.5-23 min at 0% B. Analytes were ionized by ESI in negative polarity (capillary voltage 4500 V, curtain gas 20 psi, ion source gas-1 50 psi, ion source gas-2 50 psi, drying gas temperature 475 °C) and analyzed by MSMS (fragmentation parameters: declustering potential 30 V, entrance potential 11 V, collisional cell entrance potential 15 V, collisional energy 15 V and collisional cell exit potential 15 V). DON (retention time 9.1 min) was analyzed for using m / z pairs 295 / 265 and 295 / 138, respectively, with a dwell time of 200 ms. For NIV (retention time 6.3 min) the m / z pairs were 371 / 281 and 371 / 311. For ZEA (retention time 13.6) the m / z pairs were 317 / 131 and 317 / 175. Analyst 1.7.2 software was used for quantitation from an external calibration curve of the pure compounds in the range 0.78 - 200 ng / mL in 25% acetonitrile.Genetically modified H. vulgare lines that express ZmNEP-2.1 or ZmNEP-2.2 proteins under the control of an endosperm-specific (HorD) promoter are expected to exhibit lower levels of mycotoxin accumulation compared to that of wildtype H. vulgare cv. Golden Promise control plants.
[0207] 5.2 Leaf pathogens
[0208] 5.2.1 Method of infection by leaf-borne pathogens (septoria or powdery mildew) of genetically modified H. vulgare tines comprising a leaf-expressed (FBPA promoter) ZmNEP-2.1, or ZmNEP-2.2gene.
[0209] Septoria: plant tissues of the genetically modified and wild type H. vulgare lines can be infected with Septoria passerinii spores which were sprayed onto plants at the three-leaf stage, approximately 14 days after sowing, as described in (Bellameche et al., 2020).
[0210] Powdery mildew: 2-week-old leaves of the genetically modified and wildtype H. vulgare lines can be infected with Blumeria graminis f. sp. hordei isolate A6, by either spore transfer from host plants or spreading spores on leaf segments on 0.5% Phytoagar plates with 25 mg / L benzimidazole (senescence inhibitor) using a settling tower (Ingvardsen et al., 2019, 2023).
[0211] 5.2.2 Method to evaluate disease severity / disease resistance of genetically modified H. vulgare tines comprising a leaf-expressed (FBPA promoter) ZmNEP-2.1-, or ZmNEP2.2-gene.
[0212] Disease severity after Septoria infection can be determined at 21-28 days after inoculation. Visual scoring of disease progression was performed using scale from 0 (immune) to 5 (highly susceptible) (Mergoum et al., 2007).
[0213] Disease severity after Powdery mildew infection can be determined ten days after inoculation and scored on a scale from 0-4 (using wild-type infected plants as reference). Range of infection: very few pustules (0), less than 10% (1), 10-30% (2), 30-60% (3), 60-100% (4). Visual scoring of disease progression on leaf segments incubated on Phytoagar is done 6-7 days after inoculation.
[0214] More specifically, the transgenic lines of leaf-specific expressing ZmNEPs (Zm2078 or Zm6330) and wild type plants were divided into three groups with three pots in each group. Eight kernels were sown in each pot. All three groups are infected simultaneously in a fume hood at the same time with powdery mildew spores from two donor plants. The leaves of the donor plants are gently brushed against the leaves of the plants to be infected. After infection the plants are carefully sprayed with water to increase the humidity. Each group is kept in separate small trays overnight at 12 °C.The day after infection, the plants were moved to a cabinet for isolation. Thirteen days after infection, the number of pustules was counted on individual leaves of each plant. For the wild type and Zm6330 expressing lines, 19 leaves were counted and 22 leaves were counted for Zm2078. On average, 12.5 pustules / leaf were counted for the wild type plants and 4.6 pustules / leaf for both transgenic Zm2078 and Zm6330 lines (Figure 25).
[0215] In summary, genetically modified H. vulgare lines that express genes encoding ZmNEP-2.1 or ZmNEP2.2 proteins under the control of an leaf-specific (FBPA promoter) exhibit greater resistance to Powdery mildew in leaves compared to wildtype H. vulgare cv. Golden Promise control plants (figure 25).
[0216] Example 6. Cloning and cisgenic expression of ZmNEP-2 in Zea mays
[0217] Zea mays plants expressing genes encoding ZmNEP-2 proteins were engineered by transformation with the respective genes.
[0218] 6.1 ZmNEP-2 gene transformation vector construction
[0219] Zea mays inbred line B104 was transformed with the native ZmNEP-2 genes:
[0220] Zm00001d006330 Gene ID: 103647650 [SEQ ID NO.: 1] encoding ZmNEP-2.1 [accession NP_001306683.1; SEQ ID NO.: 2] and Zm00001d022078 Gene ID:
[0221] 100272542 [SEQ ID NO.: 3] encoding ZmNEP-2.2 [accession NM_001147010.1; SEQ ID NO.: 4], whose native promoters direct expression in kernel and leaf tissue respectively.
[0222] Each ZmNEP-2 gene construct was individually cloned into the monocot transformation vector pBb7m24GW multisite Gateway vector (gateway.psb.ugent.be) and electroporated into the hypervirulent A. tumefaciens strain EHA101 (Hood et al., 1986).
[0223] 6.2 Agrobacterium-mediated transformation of Zea mays
[0224] The transformed A. tumefaciens strain were cultivated and then co-cultivated with immature Z. mays embryos of the maize inbred line B104 in cultivation medium (pH 5.2) for 3 days according to the method of Coussens et al., (2012). After 1 week growth on non-selective resting medium, transformed embryogenic calli were selected on medium containing phosphinothricin at increasing concentrations starting from 1.5 mg / l 2 weeks followed by 5 mg / l for 8 weeks with 100 mg / l cefotaximum and 100 mg / l vancomycin antibiotics against the agrobacteria. Subsequently, the selected calli were incubated on regeneration medium comprising 6 mg / l phosphinothricin, in darkness for 3 weeks; and then regeneration medium with no hormones, no selection, light (16 h / 8 h day / night), for 2 weeks for shoot production.6.3 Detection of transformed Zea mays lines comprising ZmNEP-2. genes Genomic DNA (gDNA) was extracted from leaf pieces (derived from each of the TO generation of Zea mays lines) as described for H. vulgare leaves in section 4.3. PCR reactions for detection of T-DNA inserted heterologous ZmNEP-2 genes were performed using gDNA as template and construct-specific BarR (bialaphos) resistance gene primers (BarR_fw: AAACCCACGTCATGCCAGTT [SEQ ID NO.: 50] and BarR_rv: ATCGAGACAAGCACGGTCA [SEQ ID NO.: 51]). PCR program with Herculase II polymerase: 96°C for 2 min, then 35 cycles with 96°C for 20 sec, 65°C for 30 sec, 72°C for 2 min, and a final extension at 72°C for 3 min.
[0225] Cis-genic Zea mays lines comprising each of the ZmNEP-2.1 and ZmNEP-2.2 encoding gene constructs (as defined in 6.1.1.) generated by the above methods are detectable.
[0226] Example 7. NG engineering over-expression of native ZmNEP-2 genes in Zea mays
[0227] Zea mays plants over-expressing endogenous encoding ZmNEP-2 proteins were engineered by using CRISPR / Cas9 genome editing tools to enhance the expression of one or both of the native ZmNEP-2 genes: Zm00001d006330 Gene ID: 103647650 [SEQ ID NO.: 1] encoding ZmNEP-2.1 [SEQ ID NO.: 2] and Zm00001d022078 100272542 [SEQ ID NO.: 3] encoding ZmNEP-2.2 [SEQ ID NO.: 4], whose native promoters direct expression in kernel and leaf tissue respectively. The CRISPR / Cas9 tools were used to introduce nucleotide sequence modifications of Cis-regulatory elements (CREs) of the above genes, namely in the promoter, 5 'UTR and Kozak region.
[0228] 7.1 Identification of target sites for enhancing ZmNEP gene expression:
[0229] Potential upstream open reading frame (uORF) targets in the 5' UTR of the ZmNEP-2 genes were searched using the NCBI Open Reading Frame Finder (ORFfinder Home -NCBI). The standard search parameters were used, " ATG and alternative initiation codons" setting. The uORFs in the forward orientation are listed in Table 2 for both ZmNEP-2 genes. The positions of the uORFs from the primary ORF (A from the ATG start codon as +1) are indicated. To disrupt the uORFs, nucleotide changes are introduced in the second or third nucleotide of the start codon to T or G, respectively. The second target is to optimize the Kozak sequence of both ZmNEP-2 to increase the rate of translation. The changes in Kozak sequence are introduced based on the optimal consensus sequence for monocots (Hernandez, Osnaya and Perez-Martinez, 2019). For higher protein expression, the Kozak sequence should contain a purine [A or G] and a G at the -3 and +4 positions, respectively. In addition, an A or C at position -2 and -4 will also increase the translation initiation potential (Li and Liu, 2020).Table 2
[0230] Target Position of Target sequence Target Target name / number targets from (5' - 3') type SEQ ID No. *
[0231] the start codon
[0232] Zm00001d006330
[0233] 1 -287 to -280 CTACTTGG uORF 1 Motif-1 [SEQ ID No.:
[0234] 118]
[0235] 2 -271 to -264 TTCGTTGG uORF 3 Motif-2 [SEQ ID No.:
[0236] 119]
[0237] 3 -261 to -254 AGCTCTGG uORF 4 Motif-3 [SEQ ID No.:
[0238] 120]
[0239] 4 -4 to +4 AGCTATGG Kozak Motif-4 [SEQ ID No.:
[0240] 121]
[0241] WT WT 5'UTR
[0242] [SEQ ID No.: 117] Zm00001d022078
[0243] 1 -502 to -497 TCCTGC uORF 1 Motif-5 [SEQ ID No.:
[0244] 123]
[0245] 2 -472 to -465 ACCTCTGG uORF 2 Motif-6 [SEQ ID No.:
[0246] 124]
[0247] 3 -319 to -312 GTACTTGG uORF 3 Motif-7 [SEQ ID No.:
[0248] 125]
[0249] 4 -294 to -287 AGCTCTGG uORF 4 Motif-8 [SEQ ID No.:
[0250] 126]
[0251] 5 -192 to -185 TTCAATGG uORF 5 Motif-9 [SEQ ID No.:
[0252] 127]
[0253] 6 -15 to -7 TCCACTGC uORF 6 Motif-10
[0254] [SEQ ID No.: 128] 7 -4 to +4 AGCTATGT Kozak Motif-11
[0255] [SEQ ID No.: 129] WT** WT 5'UTR
[0256] [SEQ ID No.: 122]
[0257]
[0258] * SEQ ID No's refer to the nucleotide sequence of 5' UTRs derived from the respective ZmNEP-2 genes comprising the listed modified motifs that were tested in example 7.2. WT** refers to the nucleotide sequence of the 5'UTR region of the respective wild type ZmNEP-2 genes.7.2 Reporter gene plasmid constructs for testing cis-region edited ZmNEP-2.1 and ZmNEP-2.2 promoters
[0259] To examine the impact of the nucleotide conversions in the target regions of the promoter of a ZmNEP-2 gene, a plasmid library is developed, containing the 2500 bp promoter region upstream of the translation start site comprising nucleotide changes in the 5'UTR and Kozak (Table 2) identified as being optimal for increasing ZmNEP-2 gene expression using the NCBI ORF finder program (https: / / www.ncbi.nlm.nih.gov / orffinder / ). Variant pZmNEP-2 promoters comprising the intended changes in the uORFs and Kozak sequences were synthesized by PCR using the following promoter-, In-Fusion- and the following Site-Directed Mutagenesis (SDM) primers (Table 3).
[0260] Table 3. List of primers used for PCR, In-Fusion and site-directed mutagenesis Primer ID Primer sequence (5’ to 3’)
[0261] TOPO clone primers
[0262] Zm6330 promoter Fw TACCTGATCTGCTTCGTTCCCGTG [SEQ ID No.: 70]
[0263] Zm6330 promoter Rv AGCTGAGAAGTGGACCGACGGAT [SEQ ID No.: 71 ]
[0264] Zm2078 promoter Fw GATCCCGTGGCTCTCGGCATC [SEQ ID No.: 72]
[0265] Zm2078 promoter Rv AGCTGAGGCAGTGGACCGATG [SEQ ID No.: 73]
[0266] In Fusion primers
[0267] mCherry IF Fw GGGGAAATTCGAGCTCctacttgtacagctcgtccatgccgc
[0268] [SEQ ID No.: 74]
[0269] mCherry IF Rv TAGACTCTTAATTAAatggtgagcaagggcgaggaggataac
[0270] [SEQ ID No.: 75]
[0271] eGFP NOS terminator Fw tcaccatTTAATTAAGAGTCTAGAGGAGCATGCGACGTC
[0272] [SEQ ID No.: 76]
[0273] eGFP NOS terminator Rv GCCGGGTACCGAGCTGAATTTCCCCGATCGTTCAAACATTTGGC [SEQ ID No.: 77]
[0274] Zm6330 IF Fw tgctcaccatTTAATAGCTGAGAAGTGGACCGACGGAT
[0275] [SEQ ID No.: 78]
[0276]
[0277] Zm6330 IF Rv TCCTCTAGACTCTTATACCTGATCTGCTTCGTTCCCGTG [SEQ ID No.: 79]
[0278] Zm2078 IF Fw tgctcaccatTTAATAGCTGAGGCAGTGGACCGATG
[0279] [SEQ ID No.: 80]
[0280] Zm2078 IF Rv TCCTCTAGACTCTTAGATCCCGTGGCTCTCGGCATC
[0281] [SEQ ID No.: 81]
[0282] Zm2078 uORF 5 IF Fw tgctcaccatTTAATAGCTGAGGaAGTGGACCGATG
[0283] [SEQ ID No.: 82]
[0284] Zm6330 Kozak IF Fw gcccttgctcaccatAtCTGAGAAGTGGACCGACGGAT
[0285] [SEQ ID No.: 83]
[0286] Zm2078 Kozak IF Fw gcccttgctcaccatAtCTGAGGCAGTGGACCGATG [SEQ ID No.: 84] Zm6330 Kozak (mCherry) GTCCACTTCTCAGaTatggtgagcaagggcgaggaggataac
[0287] IF Rv [SEQ ID No.: 85]
[0288] Zm2078 Kozak (mCherry) TCCACT GCCT CAGaT atggtgagcaagggcgaggaggataac
[0289] IF Rv [SEQ ID No.: 86]
[0290] Site-Directed Mutagenesis (SDM) primers
[0291] pZm6330 uORF1 Fw GGGTTCGTTtGGCAGCTCTG [SEQ ID No.: 87]
[0292] pZm6330 uORF1 Rv GCTGCCaAACGAACCCC I I 1 1 (J [SEQ ID No.: 88] pZm6330 uORF3 Fw GTTGGGCAGCTCTtGTCGTCTTCCC [SEQ ID No.: 89] pZm6330 uORF3 Rv GAAGACGACaAGAGCTGCCCAACGAAC [SEQ ID No.: 90] pZm6330 uORF4 Fw CAGACACGCTAGTACTACTTtGAAAAGGGGTTCG [SEQ ID No.:
[0293] 91]
[0294] pZm6330 uORF4 Rv CCCAACGAACCCCTTTTCaAAGTAGTACTAGCG [SEQ ID No.:
[0295] 92]
[0296] pZm6330 kozak Fw CACTTCTCAGaTATGGCGCAGC [SEQ ID No.: 93] pZm6330 kozak Rv CCATAtCTGAGAAGTGGACCGACG [SEQ ID No.: 94] pZm2078 uORF1 Fw CCGTCACCTCTtGATCCTTCCTTC [SEQ ID No.: 95]
[0297]
[0298] pZm2078 uORF1 Rv GGAAGGATCaAGAGGTGACGGATG [SEQ ID No.: 96] pZm2078 uORF2 Fw AGTACTACTAGTACTTtGAAAGGGGTTCGTTG [SEQ ID No.: 97] pZm2078 uORF2 Rv CGAACCCCTTTCaAAGTACTAGTAGTACTGTAC [SEQ ID No.: 98] pZm2078 uORF3 Fw ATGCTACAGCTCCTtCTCACGGGCTTC [SEQ ID No.: 99] pZm2078 uORF3 Rv GTGAGaAGGAGCTGTAGCATGACGCTG [SEQ ID No.: 100] pZm2078 uORF4 Fw GTTGGGCAGCTCTtGTCGTCTTC [SEQ ID No.: 101] pZm2078 uORF4 Rv CCGGGAAGACGACaAGAGCT [SEQ ID No.: 102] pZm2078 uORF5 Fw CATCGGTCCACTtCCTCAGCT [SEQ ID No.: 103] pZm2078 uORF5 Rv GAGGaAGTGGACCGATGGATTACTAG [SEQ ID No.: 104] pZm2078 uORF6 Fw CTTCCTTGTTCAATtGTCAAAACCCACAC [SEQ ID No.: 105] pZm2078 uORF6 Rv GTTTTGACaATTGAACAAGGAAGGGGG [SEQ ID No.: 106] pZm2078 kozak Fw GTCCACTGCCTCAGaTATGTTGC [SEQ ID No.: 107] pZm2078 kozak Rv CATAtCTGAGGCAGTGGACCGATG [SEQ ID No.: 108]
[0299]
[0300] The promoters of the ZmNEPs (2500 bp) were PCR amplified, TOPO cloned and sequenced. TOPO clone with the correct promoter sequence was used as template for Site-Directed Mutagenesis (SDM) and In-Fusion PCR templates. Since the base change in the Kozak regions of both genes and the uORF start site for Zm2078 (uORF 5) are too close to the start codon, the desired base changes for these targets were introduced in the In-Fusion primers (Table 3).
[0301] The promoters were then inserted into a plant dual expression vector comprising reporter genes encoding the fluorescent proteins (GFP and mCherry), driven by the constitutive pUBI promoter and variant pZmNEP-2 promoters respectively, and a NOS terminator as shown in the cartoon below.
[0302] pZmNEP mCherry
[0303]
[0304] In order to insert the mCherry reporter gene downstream of the ZmNEPs promoter, the modified bases in the Kozak were also included in the 15 bp overhang of theforward primer for amplifying mCherry gene (Table 3). For introducing the mutations using SDM, primers were designed with the base change (indicated with small letters in the primer sequences) and PCR amplification was done using the desired primer pairs and ZmNEPs promoter TOPO clones. After PCR amplification, the products were digested with Dpnl to remove the template plasmid. The PCR product was then transformed into chemically competent E. coli cells, and the produced bacterial plasmid DNA was isolated and sequenced. Positive PCR products for each modification in ZmNEPs promoter (2500 bp) were gel-purified and used for In-Fusion reaction. The dual reporter vector was constructed using the pVec8-eGFP vector in two steps. First, the pVec8-eGFP vector was digested with Sad, removing the hygromycin resistance gene, its promoter and the NOS terminator of the eGFP. Second, for the ease of cloning of ZmNEPs promoter variants, a Pad restriction site was introduced in the primer overhang upstream of the mCherry gene. The In-Fusion reaction contained the Sad-linearized pVec8-eGFP vector backbone, the Pad-mCherry gene and the reconstituted eGFP NOS terminator. The resulting pVec8-GFP-mCherry vector (without ZmNEPs promoter) was linearized using the Pad restriction enzyme and the IF primer-amplified promoters (wild type and mutants) of pZm2078 and pZm6330 was inserted using In-Fusion cloning. For the kozak mutations, their own mCherry IF primers were used. The Infusion reaction was then transformed into chemically competent E. coli cells, and bacterial plasmids were isolated from selected clones. Intact plasmids for the specific modification of the uORFs and Kozak regions were verified by restriction digestion and nanopore sequencing.
[0305] 7.3. Transient expression of cis-region edited ZmNEP-2-reporter gene constructs in Zea mays tissue
[0306] Sequence-verified plasmids constructed for each of the target mutated cis-regions, i.e. eight plasmids for Zm2078 and five plasmids for Zm6330, were used to transform young maize roots using particle bombardment. Briefly, B104 maize kernels were sterilized in 70% ethanol, incubated in 1.5 % hypochlorite acid for 10 min with shaking, and then washed 3 times with MQ water.
[0307] The sterilized kernels were soaked in sterile MQ water overnight and were then placed on wet germination paper in a Petri dish for a week, at room temperature. Prior to bombardment, young roots were cut into 2cm lengths and placed on the osmotic media overnight. For the biolistic-mediated delivery of constructs, a gold stock solution (10 mg / mL) was ultrasonicated until fully resuspended and 30 pl of the gold particle per shot was aliquoted. The aliquots were spun down at 4500 rpm for 1 minute, supernatant was removed and the same volume of sterile MQ water was added. Then, the gold particles were ultrasonicated and 1 pg of the transformation vector and 0.5 plTransIT-2020 (Mirus Bio, US) were added. Samples were then vortexed and spun down and the supernatant was discarded. Then, the samples were resuspended in 10 pl 100% ethanol / shot and ultrasonicated prior to loading onto the micro carrier. The particles were bombarded on the maize roots placed at 9 cm distance using 900 psi rupture discs with a vacuum of 27-28 Hg.
[0308] 7.4. Measurement of reporter gene expression
[0309] After bombardment, the bombarded roots were left on the osmotic media for hours and then transferred onto a maize callus induction media. The plates were left in the dark at room temperature overnight. The following day, the bombarded roots were examined for the GFP and mCherry fluorescence signals using Nikon Eclipse Ts2 inverted microscope. The respective images were taken for both fluorophores and the signal intensity for each image was determined using Image! software. Based on the analysis, several of the uORFs / Kozak edits were shown to significantly increase of the promoter strength / efficiency (Figure 26). In the Zm6330 promoter, a change in the nucleotide sequence of the uORF4 (motif 4) substantially increased the strength of the Zm6330 promoter resulting in enhanced mCherry protein expression (Figure 26A). In the Zm2078 promoter, changes in the nucleotide sequence of each of the targeted uORFs (1-6) as well as the Kozak significantly increased mCherry protein expression (Figure 26B).
[0310] 7.5. Genome editing of the ZmNEPs promoter-residing CREs by CRISPR-Cas9: genome editing construct assembly and plant transformation
[0311] CRISPR-Cas9 was used to create mutations in the promoter regions of the ZmNEP-2.1 or ZmNEP-2.2 genes. Target uORFs in the promoters of the genes Zm6330 and Zm2078 were selected based on the NCBI open reading frame finder software. In addition, the Kozak sequences of both genes were examined for the optimal translational enhancement and appropriate base modifications in the sequences were introduced according to the global Kozak sequence. Subsequently, to target and edit the selected uORFs and Kozak sequences, sgRNAs sequences were designed for each target based on the available genomic ZmNEP-2 gene sequences in the maize B104 genome. Then, the sgRNA sequences were synthesized as primers (Table 4), annealed and ligated into the Cas9 transformation vector, accordingly. The resulting CRISPR-Cas9-sgRNA transformation constructs were transformed into chemically competent E. coll cells; and bacterial plasmids were isolated and verified by restriction digestion and Sanger sequencing. Positive plasmids are then transformed into the immature embryos of maize B104 genotype via Agrobacterium-mediated transformation. Transformants are regenerated and viable plants are transferred into the soil. For verification of the genomic edits, genomic DNA is extracted from each TO plant, andthe target genomic region was PCR amplified and sequenced. For this purpose, one pair of primers for each ZmNEP gene was designed to amplify the entire target region. The primer pair for Zm6330 are Fw: TCGGTTCTTTGCCCGCATGGAC [SEQ ID No.: 109] and Rv: TTGAACGGCGGGAACTCGATGC [SEQ ID No.: 110], For the Zm2078 the primers are Fw: TCGCAGTTGAAGGTGCAGGCAG [SEQ ID No.: Ill] and Rv: ATGTGCAGCTTCAGCGACGAGG [SEQ ID No.: 112], Since each CRISPR-Cas9 construct generates variants of edits, the maize lines with the desired edits are examined for improved ZmNEPs protein accumulation in the grains and leaves.
[0312] Table 4. List of possible sgRNA targeting uORFs and Kozak region. In the sgRNA sequences, the PAM site is indicated in brackets and the target uORF start sites are underlined. For the Kozak sequences, the start codon is underlined.
[0313] Target Target sgRNA sequence Target number name type Zm00001d006330
[0314] 1 Motif-1 ACGCTAGTACTACIIGGAAA(AGG) uORF [Seq ID No: 131]
[0315] 2 Motif-2 AGGGGTTCGTTGGGCAGCTC(TGG) uORF [Seq ID No: 132]
[0316] 3 Motif-3 GGCAGCTCTGGTCGTCTTCC(CGG) uORF [Seq ID No: 133]
[0317] 4 Motif-4 CTCAGCTATGGCGCAGCTCG(CGG) kozak [Seq ID No: 134]
[0318] ZmOOOOl
[0319] d022078
[0320] 1 Motif-5 CATGCTACAGCTCCTGCTCA(CGG) uORF [Seq ID No: 135]
[0321] 2 Motif-6 (CCG)TCACCTCTGGATCCTTCCTT uORF [Seq ID No: 136]
[0322] 3 Motif-7 AGTACTACTAGTACTTGGAA(AGG) uORF [Seq ID No: 137]
[0323] 4 Motif-8 GGCAGCTCTGGTCGTCTTCC(CGG) uORF [Seq ID No: 138]
[0324] 5 Motif-9 (CCT)TGTTCAATGGTCAAAACCCA uORF [Seq ID No: 139]
[0325] 6 Motif-10 (CCA)TCGGTCCACTGCCTCAGCTA uORF [Seq ID No: 140
[0326] 7 Motif-11 (CCT)CAGCTATGTTGCAGCTCGCG kozak
[0327]
[0328] [Seq ID No: 141]
[0329]
[0330] Example 8. Pathogen resistance of transgenic and cis-genic Zea mays lines overexpressing ZmNEP-2
[0331] The genetically modified Zea mays lines comprising either kernel-specific (D-HOR promoter) ZmNEP-2.1, or ZmNEP-2.2, or HvNEP-1 transgenes, or alternatively native ZmNEP-2.1, or native ZmNEP-2.2 cis-genes are all tested for resistance to seed-borne pathogens.
[0332] 8.1 Methods of infection
[0333] Three hours after pollination, self-pollinated Zea mays plants of the genetically modified Zea mays lines are infected with 100 uL of lxlO5F. verticilliodes spores / mL introduced on each cob along the silk, or with 100 uL of water as control. Infected and mock-infected control cobs are sprayed with sterile MQ water to maintain high humidity for favoring fungal infection. Treated cobs are then covered with plastic bags for 3 days and disease severity was assessed on the mature / harvested cobs.
[0334] 8.2 Method to evaluate disease severity / disease resistance of genetically modified Zea mays lines.
[0335] After maturity, kernels of Fusarium-infected and water treated cobs of transgenic, cis- genic and wildtype Zea mays lines are harvested and dried separately. Each kernel is threshed, and 50 random kernels are scored for Fusarium infection, and disease severity is assessed as percentage of infected kernel (% kernels infected). To examine disease resistance in storage, harvested maize kernels from the infected and control cobs of transgenic, cis-genic and wildtype Zea mays lines are randomly selected and surface-washed with ethanol and water. On a petri dish, five kernels per treatment are left to grow on wet filter paper for 6 days and examined for the growth of Fusarium.
[0336] Genetically modified Zea mays transgenic lines that express the ZmNEP-2.1 gene under the control of an endosperm-specific (HorD) promoter; as well as cis-genic lines over-expressing ZmNEP-2.1 gene are expected to exhibit greater or at least equivalent resistance to F. verticilliodes disease when compared to genetically modified lines engineered to express the HvNEP-1 protein using the D_HOR promoter; their level of resistance being significantly greater than that of wildtype Zea mays control plants.
[0337] 8.3 Methods of detection of mycotoxin in genetically modified Zea mays lines.The content of mycotoxins such as DON, NIV, and ZER in the kernels of Fusarium-treated transgenic, cis-genic and wild type Zea mays lines is measured as described in example 5.1.3 according to the methods of Etzerodt et a!., 2016.
[0338] Genetically modified Zea mays transgenic lines that express the ZmNEP-2.1 gene under the control of an endosperm-specific (HorD) promoter; as well as cis-genic lines over-expressing ZmNEP-2.1 gene are expected to exhibit lower or at least equivalently low levels of mycotoxins when compared to genetically modified lines engineered to express the HvNEP-1 protein using the D_HOR promoter; their level of mycotoxins being significantly lower than that of wildtype Zea mays control plants.
[0339] Example 9. Use and detection of plant material derived from transgenic or cis-genic Zea mays lines overexpressing ZmNEP-2.1 or ZmNEP-2.2 in feed or food products
[0340] 9.1 Uses and advantages of Zea mays lines of the invention:
[0341] The kernels of Zea mays lines comprising transgenes or cis-genes expressing ZmNEP- 2.1 or ZmNEP-2.2, may be milled and provided as flour or corn starch, alternatively the kernels may be used as animal feed. The whole plant, or the leaves and stalks, may be chopped and converted into silage and used as animal feed, alternatively the stalks can be dried and used as animal feed in place of hay.
[0342] Cobs can be used as a feedstock for biofuel (e.g. ethanol) production.
[0343] Kernels and plant products derived from the Zea mays lines comprising transgenes or cis-genes expressing ZmNEP-2.1 or ZmNEP-2.2 are characterized by reduced levels of pathogens or the products of pathogens (e.g. mycotoxins) in comparison to wildtype Zea mays plants from which they are derived, and for this reason these products are safer for animal and human consumption.
[0344] 9.2 Detection of plant parts or plant-derived products of transgenic and cis-genic Zea mays lines
[0345] Genomic DNA from kernels and flour can be extracted using the method described in European Union Reference Laboratory for Genetically Modified Food and Feed (EURL GMFF, CRLVL04 / 05XP). The DNA extraction protocol is based on the CTAB method. Transgenes, cis-genes and NG genes expressing ZmNEP-2.1 or ZmNEP-2.2 present in gDNA extracted from kernels and milled kernels (flour) can be detected by PCR amplification using the BarR primers described in Examples 6.3 or by iPCR.PCR products having a length and nucleotide sequence consistent with the presence of each of the respective ZmNEP-2 genes in gDNA of the transformed Zea mays plants was determined by nucleotide sequencing.
[0346] 9.3 Methods of detection of mycotoxins in kernels or milled kernels derived from transgenic and cis-genic Zea mays lines.
[0347] The contents of mycotoxins such as DON, NIV, and ZER were measured in kernels and milled kernels (flour) of Fusarium-treated transgenic, cis-genic and wildtype Zea mays lines was measured as described in example 5.1.3 according to the methods of Etzerodt et al., 2016.
[0348] Example 10. Cloning and characterization of the ZmNEP gene (NCBI GeneID:100284558The properties of a nepenthesin protein encoded by a previously identified Zea mays ZmNEP gene (NCBI GenelD: 100284558) WO 2019 / 057845 Al, designated herein as Zm6300, were compared to the properties of the ZmNEP-2 proteins of the present invention.
[0349] The percent amino acid sequence identify matrix (Table 5) is shown between the 2 ZmNEP-2 proteins ZmNEP-2.1 [SEQ ID NO.: 2] encoded by Zm00001d006330 (Gene ID: 103647650 [SEQ ID No.: 1]) and ZmNEP-2.2 [SEQ ID NO.: 4] encoded by Zm00001d022078 (Gene ID: 100272542 [SEQ ID No.: 3]) and Zm6300 protein encoded by Zm00001ebl06300 [SEQ ID No.: 52],
[0350] Table 5
[0351] Pircent Ir.ent i t-, 'lat'”. -. created bs lt'ita.12. 1
[0352] 1; ZriWO j d IDO.00 2.21 29. ^
[0353] 2. ZirOTM LiWJm 29.? L! W. M 79. SB
[0354]
[0355] 9 7n.a fj
[0356] 10.1 Cloning of the Zm6300 gene
[0357] F DNA polynucleotide comprising the full-length gene (Zm00001ebl06300; SEQ ID No.: 52]) encoding a ZmNEP protein designated Zm6300 (NCBI ref: NP_001150925.2 [SEQ ID No: 53]) was amplified by PCR using PCR primers (Fw: CATAGCTCCATGTCGTCGTCGA [SEQ ID No: 113] and Rv: TCGCATCGTCAAAGAGTGCTGC [SEQ ID No: 114]) and Herculase II Fusion DNA Polymerase (Agilent, CA, USA) from genomic DNA derived from leaves of B104 maize seedlings (derived from kernels obtained from USDA Agricultural Research Service seed repository) using the phenol-chloroform protocol (Moller, M. G et al., 2003). PCR conditions for amplifying the target include 96°C for 2 min, initial denaturation; 96°Cfor 1 min, denaturation; 65°C for 30 sec, annealing; 72°C for 2 min, elongation); and then 72°C for 2.30 min for final extension. PCR products (Figure 16A) were gel-purified and cloned into chemically competent E. coli cells, and transformed bacterial cells were verified by Sanger sequencing. Positive plasmids were isolated and used for constructing the Pichia expression plasmid. The cloned PCR products were re-amplified with in-fusion primers that selectively amplified the sequence encoding the mature Zm6300 polypeptide devoid of its signal peptide (Figure IB). The in-fusion primers used to produce PCR product Zm6300 from the full-length gene Zm00001ebl06300 were:
[0358] Fw: GAAGAAGGGGTATCTCTCGAGAAAAGAGAGGCTGAAGCTGCCGCCAGCGTCCGCGTTGG GCTCACGCGCA [SEQ ID No: 115], and Rv: GATGATGATGATGGTCGACTCAATGATGATGATGATGATGAAGAGTGCTGCACTTGGCCG GAGC [SEQ ID No: 116],
[0359] The resulting PCR amplified DNA polynucleotides were inserted into the pPICzoA vector digested with Xhol and Sall-digested and transformed into E. coli. The resulting sequence-positive clones, pPICzaA-Zm6300 was used for Pichia transformation (Figure 17A). The resulting Pichia expression plasmid comprise an SP-lacking Zm6300 (AZm6300) coding sequence fused downstream of the alpha-mating SP coding sequence in the pPICz alpha A expression vector, according to the manufacturer (Invitrogen, USA). SP sequence for the Zm6300 was predicted using SignalP 6.0 software (https: / / services. healthtech. dtu.dk / services / SignalP-6.0 / ).
[0360] 10.2 Pichia transformation and rZm6300 production
[0361] Intact cloned pPICzaA-AZm6300 plasmids were Dral-linearized (figure 17B) and used for transformation into electrocompetent Pichia pastoris cells. Briefly, 10 pg of the plasmid DNA was linearized using Dral restriction enzyme, according to the manufacturer (NEB, UK). After overnight digestion, the DNA was desalted and transformed into electrocompetent cells of Pichia X-33 strain, as described in Bekalu et al., (2021). The transformant Pichia clones were selected on YPD agar plates supplemented with 100, 200 and 300 ug / L Zeocin. Selected Pichia clones were investigated for the expression of the recombinant protein using SDS-PAGE. Since the pPICz alpha A vector contains methanol-inducible AOX1 promoter, induction of protein production was performed by supplementing 2% methanol into the growth media every day for 4 consecutive days and shaking (28°C, 170 rpm). Proteins produced from the 400 mL induction media were collected by centrifugation (4600g, 4°C, 5 min), and the pH was adjusted to 8 NaOH for FPLC purification.
[0362] 10.3 FPLC purification and by SDS-PAGE verification of the rZm6300The rZm6300 protein was purified using the AKTA fast protein liquid chromatography (FPLC) device equipped with Ni affinity IMAC FF16 / 10 column (Figure 18A). Eluted fractions were collected, concentrated and the expressed rZm6300 protein was detected by Bradford and SDS-PAGE (Figure 18B).
[0363] 10.4 In vitro characterization of the recombinant Zm6300
[0364] The antifungal properties of the rZm6300 protein were examined against F. graminearum, F. verticilliodes and Setospheria turcica.
[0365] 10.4.1 Antifungal effect of rZm6300 on F. graminearum and F. verticilliodes
[0366] For the in vitro assay, three mycelial plugs of F. graminearum or F. verticilliodes were inoculated into 50 mL CMC media (Carboxymethyl cellulose (CMC) media containing 1.5% CMC-Na, 0.1% NH4NO3, 0.1% KH2PO4, 0.1% YE and 0.05% MgSO4heptahydrate) and grown and allowed to sporulate for 3 days by shaking at 125 rpm @22°C. The resulting spores were separately filtered through Miracloth and collected by centrifugation (4500g, RT, 15 min). Then, the spores of each Fusarium species were resuspended in 1 mL sterile MilliQ water and centrifugated at 7500g, room temperature for 5 min. The supernatant was discarded and spores were resuspended with 500 uL of MQ water. The 50x diluted suspension spore was used to measure the spore concentration using a hemocytometer plate. For the in vitro study, 50 uL of 107spores / ml were inoculated into 50 mL GY40 media (2% (w / v) glucose, 0.5% (w / v) yeast extract) and cultured overnight (250 rpm, RT), whereafter 100 uL of the resulting GY40 culture was added to 100 mL SY40 media (6% sucrose, 0.1% yeast extract). The resulting SY40 culture (1 mL) was distributed into 24 well-plates and either a solution of purified rZm6300 protein (2 ug) in 50mM acetate buffer, pH 5.5 or just buffer was added to the culture in all wells. The cultures were left to grow by shaking at 250 rpm and room temperature, and the 'DAY-2' cultures were collected after 24 hr incubation. 2 ug of the rZm6300 protein or buffer was added to the remaining cultures and left to grow by shaking overnight using the same setup as described above. On day 3, the DAY-3 cultures were collected; and 2 ug of rZm6300 protein, or buffer was added into the remaining cultures. Similar procedures were applied to cultures collected on DAY-4 and DAY-6. The collected mycelial masses for F. graminearum or F. verticilliodes were collected by centrifuged, freeze dried and the dry weight of the mycelial biomass was determined. As seen in Figure 19, the presence of the purified rZm6300 reduced the accumulation of fungal biomass of F. graminearum, but only after 6 days. Additionally, rZm6300, failed to reduce biomass accumulation of F. verticilliodes after 6-days of incubation (Figure 20).
[0367] 10.4.2 Antifungal effect of rZm6300 on S. turcicaThe fungal isolate of S. turcica was grown on V8 plates for 2 weeks at room temperature (12 h of light); and a suspension of spore derived from the plates was used to inoculate potato dextrose broth (PDB). Fungal cultures were grown in 50 mL of PDB in a 250 mL flask for 5 days by shaking at 120 rpm, at room temperature. The mycelium was harvested using sterile Miracloth in a Buchner funnel and rinsed with sterile MQ water. For in vitro tests, spore concentrations were determined by plating serial dilutions on PDA plates, followed by enumeration. The spore concentration was adjusted to the required concentration with sterile Milli-Q water before use or stored in 15-50% glycerol at -80°C for a longer period. For the in vitro assay, the spores were resuspended in PDB to a final concentration of lx 105 / mL and 1 mL of the spore suspension was transferred into each well of a sterile 24-well plates. A solution of 2 ug purified Zm6300 protein [SEQ ID NO.: 53] in 20 uL 50mM acetate buffer, pH 5.5, or 20 uL of buffer alone were added to the wells. The plates were sealed with an optically clear seal and incubated for 6 days at room temperature; and the OD620 of the samples was recorded at DAY-2, DAY-3, DAY-4 and DAY-6 using microplate reader. The addition of either rZm6300 protein or buffer into the cultures and sample collection, and determination of mycelial biomass were performed as described above for F. graminearum and F. verticilliodes. The OD620 measurement and fungal biomass determinations were used to evaluate the performance of rZm6300 protein on the growth of S. turcica. As seen in Figure 21, the rZm6300 protein failed to significantly inhibit the growth of S. Turcica over the 6 day period.
[0368] Example 11. Transient expression of the cis-genic ZmNEPs constructs in maize leaves
[0369] 11.1 Preparation of cis-genic ZmNEP-2s constructs
[0370] The cis-genic constructs for transient expression of Zm2078 and Zm6330 were derived from the pVec8-GFP vector. The ZmNEPs gene cassettes (including the promoter, gene and terminator region) were PCR amplified as three independent components for integrating into the pVec8-GFP vector digested with Hindlll restriction enzyme, using In-Fusion cloning. Promoter of 2500 bp upstream sequences for each ZmNEPs gene was PCR amplified from the dual reporter vector with the wild type promoters for either Zm6330 or Zm2078. The gene was amplified from the leaf-specific vectors used for expression of the genes in barley plants. The terminator sequences of 700 bp downstream of the ZmNEPs gene sequence were PCR amplified from the genomic DNA of the maize line B104. In-Fusion compatible primers used for amplification of the three fragments for each construct. After the assembly, the In-Fusion reactions were transformed into chemically competent E. coli cells and the isolated bacterial plasmidsfor each ZmNEP gene were verified for the intact expression cassette, by restriction digestion and whole plasmid sequencing (Macrogene Europe, The Netherlands).
[0371] 11.2 Transient expression of the cis-genic ZmNEPs constructs in maize leaves For transient expression of the cis-ZmNEPs, the leaves of two-weeks old young maize B104 seedlings were bombarded with the cis-genic ZmNEPs constructs. Bombardment of the expression plasmids was performed as described in section 7.3, with a few modifications. For this experiment, the 450 psi rupture discs were used, and the leaf tissue were placed at 3 cm distance. Bombarded plants were kept in a growth cabinet (22°C with 16 / 8 hr light / dark) overnight, before infected with Setosphaeria turcica. S. turcica spores. For the infection, the S. turcica spores were grown on PDA agar plates 12 / 12 hr light / dark conditions and the spores were washed from the plates with sterile MQ water. The collected spores were filtered with sterile mesh cloth and centrifuges at 5000 rpm for 5 min, and spore concentrations was adjusted to 105spores / mL in MQ water (containing 0.1% of Tween20). The sprayed transgenic and wild type plants were kept on closed trays, to maintain higher humidity. The disease development on the bombarded leaves was assessed 10 days after infection. The experiment was performed in two biological replicates and disease score on the leaves were scored based on the 1-9 scale scoring system, where 1 (no symptoms) to 9 (entire leaf infected or dead). Based on the analysis, the average scores for the leaves of the wildtype, cis-Zm6330 and cis-Zm2078 lines were 4, 3 and 2.5, respectively, where the ZmNEPs overexpressing lines had 10-14% less infection than the wildtype line (bombarded with empty gold particles) (Figure 27).
[0372] References
[0373] Bartlett, J. G., Alves, S. C., Smedley, M., Snape, J. W. & Harwood, W. A. (2008) High-throughput Agrobacterium-mediated barley transformation. Plant Methods 4
[0374] Bekalu, Z. E. et al. (2020) 'Overexpression of nepenthesin HvNEP-1 in barley endosperm reduces fusarium head blight and mycotoxin accumulation', Agronomy, 10(2). Available at: https: / / doi. Org / :10.3390 / agronomyl0020203.
[0375] Bekalu, Z. E.; Dionisio, G.; Madsen, C. K.; Etzerodt, T.; Fomsgaard, I. S.; Brinch-Pedersen, H. (2021) Barley Nepenthesin-Like Aspartic Protease HvNEP-1 Degrades Fusarium Phytase, Impairs Toxin Production, and Suppresses the Fungal Growth. Front Plant Sci., 12, 1458, doi: 10.3389 / FPLS.2021.702557 / BIBTEX.Bellameche, F. et al. (2020) 'Efficiency of biological and chemical inducers for controlling Septoria tritici leaf blotch (STB) on wheat (Triticum aestivum L.)', European Journal of Plant Pathology, 158(1), pp. 99-109. Available at: https: / / doi.org / 10.1007 / sl0658-020-02057-y.
[0376] Blondal, T et al., (2021) Verification of CRISPR editing and finding transgenic inserts by Xdrop™ Indirect sequence capture followed by short- and long- read sequencing. Methods 191(1) DOI: 10.1016 / j.ymeth.2021.02.003
[0377] Coussens, G. et al. (2012) 'Brachypodium distachyon promoters as efficient building blocks for transgenic research in maize', Journal of Experimental Botany, 63(11), pp.
[0378] 4263-4273. Available at: https: / / doi.org / 10.1093 / jxb / ersll3.
[0379] Etzerodt, T. et al. (2016) 'Correlation of Deoxynivalenol Accumulation in Fusarium-Infected Winter and Spring Wheat Cultivars with Secondary Metabolites at Different Growth Stages', Journal of Agricultural and Food Chemistry, 64(22), pp. 4545-4555. Available at: https: / / doi.org / 10.1021 / acs.jafc.6b01162.
[0380] Gynheung An, P. R. E., Amitava Mitra and Sam B. Ha Binary vectors. (1988) Plant molecular biology manual, Vol. 1.
[0381] Hernandez, G., Osnaya, V. G. and Perez-Martinez, X. (2019) 'Conservation and Variability of the AUG Initiation Codon Context in Eukaryotes', Trends in Biochemical Sciences, 44(12), pp. 1009-1021. Available at: https: / / doi. Org / https: / / doi.org / 10.1016 / j.tibs.2019.07.001.
[0382] Holme, I. B. et al. (2017) 'Barley HvPAPhy-a as transgene provides high and stable phytase activities in mature barley straw and in grains', Plant Biotechnology Journal, 15(4), pp. 415-422. Available at: https: / / doi. Org / https: / / doi.org / 10.llll / pbi.12636.
[0383] Ingvardsen, C. R. et al. (2019) 'Development of mlo-based resistance in tetrapioid wheat against wheat powdery mildew', Theoretical and Applied Genetics, 132(11), pp.
[0384] 3009-3022. Available at: https: / / doi.org / 10.1007 / s00122-019-03402-4.
[0385] Ingvardsen, C. R. et al. (2023) 'Highly effective mlo-based powdery mildew resistance in hexapioid wheat without pleiotropic effects', Plant Science, 335, p. 111785.
[0386] Available at: https: / / doi. Org / https: / / doi.org / 10.1016 / j.plantsci.2023.111785.Li, Y.-R. and Liu, M.-J. (2020) 'Prevalence of alternative AUG and non-AUG translation initiators and their regulatory effects across plants', Genome Research, 30(10), pp. 1418-1433. Available at: https: / / doi.org / 10.1101 / gr.261834.120.
[0387] Manoharan, M. and Dahleen, L. (2002) 'Genetic transformation of the commercial barley (Hordeum vulgare L.) cultivar Conlon by particle bombardment of callus', Plant Cell Reports, 21(1), pp. 76-80. Available at: https: / / doi.org / 10.1007 / s00299-002-0477-5.
[0388] Mergoum, M. et al. (2007) 'Reaction of Elite Wheat Genotypes from the Northern Great Plains of North America to Septoria Diseases', Plant Disease, 91(10), pp. 1310-1315. Available at: https: / / doi.org / 10.1094 / PDIS-91-10-1310.
[0389] Moller, M. G. et aL (2003) 'Molecular cloning and characterisation of two genes encoding asparagine synthetase in barley (Hordeum vulgare L.)', Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression, 1628(2), pp. 123-132.
[0390] Available at: https: / / doi. Org / https: / / doi.org / 10.1016 / S0167-4781(03)00137-4
[0391] Simoes, I.; Faro, C.; Simoes, I.; Faro, C. Structure and Function of Plant Aspartic Proteinases. Eur J Biochem 2004, 271, 2067-2075, doi: 10.1111 / j.l432-1033.2004.04136.x.
[0392] Jong, Ambrose Y., Anna T'ang, De-Pei Liu, Sheng-He Huang. 31 Inverse PCR
[0393] In Springer Protocols (2002)
[0394] Embodiments of the invention
[0395] In a first embodiment, the invention provides a genetically modified Zea mays plant comprising a modified genome, wherein said modified genome comprises:
[0396] (a) one or more nucleic acid molecules integrated into said genome, wherein each of the one or more integrated nucleic acid molecules comprises a gene encoding a cereal NEP-2 protein, wherein the cereal NEP-2 protein comprises an amino acid sequence having at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4; or
[0397] (b) at least one gene-edited endogenous ZmNEP-2 gene, wherein the nucleotide sequence of one or more cis-regulatory motifs in a 5' UTR of said at least one endogenous ZmNEP-2 gene is changed with respect to the one or more cis-regulatory motifs of the endogenous ZmNEP-2 gene in a parent plant from which the genetically modified plant was derived, wherein the one or more cis-regulatory motifs are selected from among motifs 1 - 11 located at nucleotide positions -287 to -280, -271 to -264,-261 to -254, and -4 to +4 of the start codon of an endogenous ZmNEP-2.1 gene; and at nucleotide positions -502 to -497, -472 to -465, -319 to -312, -294 to -287, -192 to -185, -15 to -7, and -4 to +4 of the start codon of an endogenous ZmNEP-2.2 gene; wherein the amino acid sequence encoded by said ZmNEP-2 gene has at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4,
[0398] whereby expression of the ZmNEP-2 protein encoded by said one or more endogenous ZmNEP-2 gene is increased, and
[0399] whereby said genetically modified Zea mays plant of (a) and (b) exhibits increased resistance to a microbial pathogen disease as compared to a parent plant from which said Zea mays plant was derived.
[0400] In a second embodiment of the genetically modified Zea mays plant of the first embodiment, the cereal NEP-2 protein comprises an amino acid sequence selected from among ZmNEP-2.1 [SEQ ID No.: 2]; ZmNEP-2.2 [SEQ ID No.: 4]; HvNEP-2.1 [SEQ ID No.: 7]; HvNEP-2.2 [SEQ ID No.: 9]; TaNEP-2.1 [SEQ ID No.: 11]; TaNEP-2.2 [SEQ ID No.: 13]); TaNEP-2.3 [SEQ ID No.: 15], TaNEP-2.4 [SEQ ID No.: 17];
[0401] TaNEP-2.5 [SEQ ID No.: 19]; TaNEP-2.6 [SEQ ID No.: 21]; and TaNEP-2.7 [SEQ ID No.: 23],
[0402] In a third embodiment of the genetically modified Zea mays plant of the first embodiment, the amino acid sequence of the cereal NEP-2 protein is ZmNEP-2.1 [SEQ ID No.: 2] or ZmNEP-2.2 [SEQ ID No.: 4],
[0403] In a fourth embodiment of the genetically modified Zea mays plant of any one of the first to third embodiments, the cereal NEP-2 protein coding sequence of said gene is operatively-linked to a native promoter of said gene.
[0404] In a fifth embodiment of the genetically modified Zea mays plant of any one of the first to third embodiments, the cereal NEP-2 protein coding sequence of said gene is operably-linked to a heterologous promoter.
[0405] In a sixth embodiment of the genetically modified Zea mays plant of the fourth or fifth embodiments, said promoter directs kernel-specific or leaf-specific expression of the cereal NEP-2 protein coding sequence to which it is operably-linked.
[0406] In a seventh embodiment of the genetically modified Zea mays plant of the third embodiment, the gene encoding said ZmNEP-2 protein is a native gene with respect to the genome of the parent Zea mays plant into which the one or more nucleic acid molecules is integrated.
[0407] In an eighth embodiment of the genetically modified Zea mays plant of any one of the first to seventh embodiments, said plant is selected from among:
[0408] a. a transgenic plant,
[0409] b. a cisgenic plant, or
[0410] c. a NG plant.In a ninth embodiment of the genetically modified Zea mays plant of any one of the first to eighth embodiments, the plant is a plant part.
[0411] In a tenth embodiment of the genetically modified Zea mays plant of the ninth embodiment, the plant part is a kernel or a cob.
[0412] In an eleventh embodiment the genetically modified Zea mays plant of any one of the first to tenth embodiments, the microbial pathogen is a fungal pathogen.
[0413] In a twelfth embodiment the genetically modified Zea mays plant of the eleventh embodiment, wherein the fungal pathogen is a species selected from among Fusarium, Septoria and Blumeria or any combination thereof.
[0414] A thirteenth embodiment provides for the use of a genetically modified Zea mays plant of any one of the first to twelfth embodiments, for the manufacture of a non-viable composition, wherein said composition is selected from any one of:
[0415] a) flour,
[0416] b) silage, and
[0417] c) hay.
[0418] A fourteenth embodiment provides a method of producing a food- or feed-composition, comprising the steps of:
[0419] a. providing kernels of the genetically modified Zea mays plant of any one of the first to twelfth embodiments,
[0420] b. conditioning the kernels in a damper,
[0421] c. peeling and degerming the conditioning kernels of (b), and
[0422] d. milling and sifting the product of step (c).
[0423] A fifteenth embodiment provides a food or feed composition comprising a non-viable genetically modified plant part of a Zea mays plant of any one of the first to twelfth embodiments, wherein DNA recovered from said food- or feed-composition comprises either:
[0424] a..detectable levels of said one or more integrated nucleic acid molecules comprising a gene encoding a cereal NEP-2 protein, wherein the protein comprises an amino acid sequence having at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4, or
[0425] b. detectable levels of at least one gene-edited ZmNEP-2 gene, wherein the nucleotide sequence of one or more cis-regulatory motifs in a 5' UTR. of said at least one ZmNEP-2 gene is changed with respect to the one or more cis-regulatory motifs of an endogenous ZmNEP-2 gene in a parent plant from which said Zea mays plant was derived, wherein the one or more cis-regulatory motifs are selected from among motifs 1 - 11 located at nucleotide positions -287 to -280, -271 to -264, -261 to -254, and -4 to +4 of a start codon of a ZmNEP-2.1 gene; and at nucleotide positions -502to -497, -472 to -465, -319 to -312, -294 to -287, -192 to -185, -15 to -7, and -4 to +4 of a start codon of a ZmNEP-2 gene; wherein the amino acid sequence encoded by said ZmNEP-2 gene has at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4.
Claims
Claims1. A genetically modified Zea mays plant comprising a modified genome, wherein said modified genome comprises:(a) one or more nucleic acid molecules integrated into said genome, wherein each of the one or more integrated nucleic acid molecules comprises a native Zea mays gene encoding a Zea mays nepenthesin-2 protein, wherein the Zea mays nepenthesin-2 protein comprises an amino acid sequence having at least 80% sequence identity to SEQ ID No: 2 or SEQ ID No: 4; or(b) one or more nucleic acid molecules integrated into said genome, wherein each of the one or more integrated nucleic acid molecules comprises a gene comprising a Zea mays nepenthesin-2 protein coding sequence operatively linked to a heterologous promoter wherein said promoter directs kernel-specific or leaf-specific expression,wherein the amino acid sequence of the Zea mays nepenthesin-2 protein has at least 80% sequence identity to SEQ ID No: 2 or SEQ ID No: 4, wherein the heterologous promoter and the coding sequence are found in a Zea mays genome;(c) at least one gene-edited endogenous Zea mays nepenthesin-2 gene, wherein the nucleotide sequence of one or more cis-regulatory motifs in a 5' UTR. of said at least one endogenous Zea mays nepenthesin-2 gene is changed with respect to the one or more cis-regulatory motifs of the endogenous Zea mays nepenthesin-2 gene in a parent plant from which the genetically modified plant was derived, wherein the one or more cis- regulatory motifs are selected from among motifs 1 - 11 located at nucleotide positions -287 to -280, -271 to -264, -261 to -254, and -4 to +4 of the start codon of an endogenous Zea mays nepenthesin-2.1 gene having SEQ ID NO.: 1; and at nucleotide positions -502 to -497, -472 to - 465, -319 to -312, -294 to -287, -192 to -185, -15 to -7, and -4 to +4 of the start codon of an endogenous Zea mays nepenthesin-2.2 gene having SEQ ID NO.: 3; wherein the amino acid sequence encoded by said ZmNEP- 2 gene has at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4,whereby expression of the Zea mays nepenthesin-2 protein encoded by said one or more endogenous Zea mays nepenthesin-2 gene is increased, andwhereby said genetically modified Zea mays plant of (a), (b) and (c)exhibits increased resistance to a fungal pathogen disease as compared to a parent plant from which said Zea mays plant was derived and wherein the plant is not produced exclusively by an essentially biological method.
2. The genetically modified Zea mays plant of claim 1, wherein the amino acid sequence of the Zea mays nepenthesin-2 protein is ZmNEP-2.1 [SEQ ID No.: 2] or ZmNEP-2.2 [SEQ ID No.: 4],3. The genetically modified Zea mays plant of claim 4 or 5, wherein said promoter directs selected from an a-Zein gene promoter [SEQ ID No.: 24]), a Zea mays glutelin GluB-1 promoter SEQ ID No.: 25, and a Zea mays maize phosphoenolpyruvate carboxylase promoter [SEQ ID No.: 26],.
4. The genetically modified Zea mays plant of claim 1 or 3, wherein the gene encoding said Zea mays nepenthesin-2 protein is a native gene with respect to the genome of the parent Zea mays plant into which the one or more nucleic acid molecules is integrated.
5. The genetically modified Zea mays plant of any one of claims 1 - 7, wherein said plant is selected from among:a. an intragenic plant,b. a cisgenic plant, andc. a New Genomic Techniques plant obtained by gene editing.
6. The genetically modified Zea mays plant of any one of claims 1 - 8, wherein the plant is a plant part.
7. The genetically modified Zea mays plant of claim 9, wherein the plant part is a kernel or a cob.
8. The genetically modified Zea mays plant of any one of claims 1 - 10, wherein the fungal pathogen is a species selected from among Fusarium, Septoria and Blumeria or any combination thereof.
9. The genetically modified Zea mays plant of claim 11, wherein the fungal pathogen is a species selected from among Fusarium verticillioides, Fusarium graminearum, Septoria passerinii and Blumeria graminis or any combination thereof.
10. Use of a genetically modified Zea mays plant of any one of claims 1 - 12, for the manufacture of a non-viable composition, wherein said composition is selected from any one of:a) flour,b) silage, andc) hay.
11. A method of producing a food- or feed-composition, comprising the steps of:a. providing kernels of the genetically modified Zea mays plant of any one of claims 1-12,b. conditioning the kernels in a damper,c. peeling and degerming the conditioning kernels of (b), andd. milling and sifting the product of step (c)wherein the level of mycotoxins in the kernels of the genetically modified Zea mays plant is lower than that of kernels of a wildtype Zea mays plant from which the genetically modified Zea mays plant was derived.
12. A food or feed composition comprising a non-viable genetically modified plant part derived from a Zea mays plant of any one of claims 1 - 12, wherein DNA recovered from said food- or feed-composition comprises either:a. detectable levels of said one or more integrated nucleic acid molecules comprising a gene encoding a Zea mays nepenthesin-2 protein, wherein the protein comprises an amino acid sequence having at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4, orb. detectable levels of at least one gene-edited Zea mays nepenthesin-2 gene, wherein the nucleotide sequence of one or more cis-regulatory motifs in a 5' UTR. of said at least one ZmNEP-2 gene is changed with respect to the one or more cis-regulatory motifs of an endogenous Zea mays nepenthesin-2 gene in a parent plant from which said Zea mays plant was derived, wherein the one or more cis-regulatory motifs are selected from among motifs 1 - 11 located at nucleotide positions - 287 to -280, -271 to -264, -261 to -254, and -4 to +4 of a start codon of a Zea mays nepenthesin-2.1 gene; and at nucleotide positions -502 to -497, -472 to -465, -319 to -312, -294 to -287, -192 to -185, -15 to -7, and -4 to +4 of a start codon of a Zea mays nepenthesin-2 gene; wherein the amino acid sequence encoded by said Zea maysnepenthesin-2 gene has at least 70% sequence identity to SEQ ID No: 2 or SEQ ID No: 4.
13. A method for detecting a genetically modified Zea mays plant with increased resistance to a microbial pathogen disease, as defined in any one of claims 1 to 3 comprising:a. PCR amplifying and sequencing DNA from genomic DNA isolated from a candidate transgenic or intragenic genetically modified Zea mays plant to distinguish the transgene or intragene in the integrated nucleic acid molecule from a corresponding native gene encoding a Zea mays nepenthesin-2 protein; orb. PCR amplifying and sequencing DNA from genomic DNA isolated from a candidate genetically modified Zea mays plant obtained by endogenous Zea mays nepenthesin-2 gene-editing to distinguish the gene-edited endogenous nepenthesin-2 gene from a corresponding native endogenous gene in a parent Zea mays plant from which the genetically modified Zea mays plant was derived;orc. Performing iPCR or Southern Blot analysis on DNA derived from genomic DNA isolated from a candidate cisgenic genetically modified Zea mays plant to distinguish the cisgene from a corresponding native Zea mays nepenthesin-2 gene.
14. The method for detecting a genetically modified Zea mays plant with increased resistance to a microbial pathogen disease, as defined in claim 13 comprising: a. PCR amplifying and sequencing DNA from genomic DNA isolated from a candidate transgenic or intragenic genetically modified Zea mays plant using a 5' primer having a binding site located in the promoter region upstream of the cereal nepenthesin-2 protein coding sequence of the integrated nucleic acid molecule and a 3' primer located inside the coding sequence of the corresponding cereal nepenthesin-2 protein coding sequence to distinguish the transgene or intragene in the integrated nucleic acid molecule from a corresponding native gene encoding a Zea mays nepenthesin-2 protein; or b. PCR amplifying and sequencing DNA from genomic DNA isolated from a candidate genetically modified Zea mays plant obtained by endogenous Zea mays nepenthesin-2 gene-editing, using a 5' primer having a binding site located in the promoter region upstream of at least one endogenous Zea maysnepenthesin-2 protein coding sequence and a 3' primer located inside the coding sequence of the corresponding nepenthesin-2 protein coding sequence; to distinguish the gene-edited endogenous nepenthesin-2 gene from a corresponding native endogenous gene in a parent Zea mays plant from which the genetically modified Zea mays plant was derived;orc. circularizing DNA fragments derived from genomic DNA isolated from a candidate cisgenic genetically modified Zea mays plant, and inverse PCR amplifying and sequencing the resulting circularized DNA using inverse primers to prime amplification of DNA flanking the integrated nucleic acid molecule comprising the Zea mays nepenthesin-2 cisgene to distinguish the cisgene from a corresponding native Zea mays nepenthesin-2 gene.
15. A method for producing a genetically modified Zea mays plant with increased resistance to a microbial pathogen disease, as defined in any one of claims 1-9 comprising:a. transforming one or more cells of the wild type Zea mays plant with the recombinant DNA construct encoding a Zea mays nepenthesin-2 protein comprises an amino acid sequence having at least 80% sequence identity to SEQ ID No: 2 or SEQ ID No: 4 using transgenesis, intragenesis and / or cisgenesis;b. selecting transformed cells obtained in step (a), wherein the genome of said cells comprises an integrated copy of said gene in said recombinant DNA construct; andc. regenerating a genetically modified plant from cells obtained in step (b).
16. A method for producing a genetically modified Zea mays plant with increased resistance to a microbial pathogen disease, as defined in any one of claims 1, 2 or 5 comprising:a. gene-editing an endogenous Zea mays nepenthesin-2 gene in a cell of a Zea mays parent plant, wherein the nucleotide sequence of one or more cis-regulatory motifs in a 5' UTR of said at least one endogenous Zea mays nepenthesin-2 gene is thereby changed with respect to the one or more cis-regulatory motifs of the endogenous Zea mays nepenthesin-2 gene in a parent plant from which the genetically modified plant was derived, wherein the one or more cis-regulatory motifs are selected from among motifs 1 - 11 located at nucleotide positions -287 to -280, -271 to -264, -261 to -254, and -4 to +4 of the start codon of an endogenous Zea mays nepenthesin-2.1 gene havingSEQ ID No.: 1; and at nucleotide positions -502 to -497, -472 to - 465, -319 to -312, -294 to -287, -192 to -185, -15 to -7, and -4 to +4 of the start codon of an endogenous Zea mays nepenthesin-2.2 gene having SEQ ID No.: 3; wherein the amino acid sequence encoded by said Zea mays nepenthesin-2.2 gene has at least 80% or 100% sequence identity to SEQ ID No: 2 or SEQ ID No: 4,b. selecting cells obtained in step (a), wherein the nucleotide sequence of one or more cis-regulatory motifs in a 5' UTR. of said at least one endogenous Zea mays nepenthesin-2 gene in the genome of said cells is changed; andc. regenerating a genetically modified plant from cells selected in step (b), wherein the resulting plant is a New Genomic Techniques plant, and wherein expression of the Zea mays nepenthesin-2 protein encoded by said endogenous Zea mays nepenthesin-2 gene is increased, andwhereby said genetically modified Zea mays plant exhibits increased resistance to a microbial pathogen disease as compared to a parent plant from which said Zea mays plant was derived.