A method for detecting nucleotide variants in a nucleic acid sequence

Abstract

Methods for detecting polynucleotide variants comprising one or more nucleotide mutation in a polynucleotide sequence are provided. The methods comprise providing a primer having a ddNTP (dideoxynucleotide triphosphate) at the 3' terminal, which is configured to anneal to the polynucleotide such that the one or more nucleotide mutations align with nucleotides within the six 3' terminal nucleotides of the primer, and performing a nucleic acid amplification to synthesise a specific product indicative of the presence or absence of the variant sequence. Kits and uses associated with the methods are also provided.

Description

[0001] A method for detecting nucleotide variants in a nucleic acid sequence

[0002] FIELD OF INVENTION

[0003] The present invention is concerned with a method for detecting variants in a nucleic acid sequence, as well as kits and uses associated with such a method. In particular, the present invention relates to a method employing primers suitable for loop-mediated isothermal amplification (LAMP) methods. In particular, the invention is useful in diagnostic applications, such as in identifying diseases caused by point mutations.

[0004] BACKGROUND OF THE INVENTION

[0005] It can be highly advantageous to be able to detect nucleotide variants in polynucleotide sequences (e.g. a ‘variant polynucleotide’) for use in various assays. In some instances, a variant polynucleotide may be a mutated genetic or gene sequence. A gene variant, for example, may be a stable modification in the DNA sequence that constitutes a gene. A gene variant may involve alterations in one or more nucleotides within the gene sequence. Gene variants may either be inherited from parental organisms or acquired during the lifespan of an individual. While many common variants are benign, some may influence disease susceptibility or drug metabolism, and so could affect treatment decisions in patients. In other organisms, gene variants play roles in traits such as antibiotic resistance or resistance to pesticides, impacting survival and adaptation. Given the potential for some variants to cause life-threatening conditions, it would be beneficial to be able to perform accurate and rapid polynucleotide diagnostics to identify variant polynucleotides.

[0006] Current standard methods to detect a polynucleotide variant involve DNA sequencing techniques, and may employ various Nucleic Acid Amplification Tests (NAATs), including PCR and real-time PCR. While a wide range of real-time PCR-based tests are commercially available, they remain relatively expensive, require specialised equipment with limited availability in an advanced laboratory setting, or require sophisticated equipment and / or the isolation of genetic material from the patient's sample. Additionally, the process involves cyclic heating and cooling of the reaction mixture, making the method time-consuming and energy intensive.

[0007] Loop-mediated isothermal amplification (LAMP) is an isothermal DNA amplification technique that employs a nucleic acid chain replacement reaction using at least four primers. The LAMP technique has been described, for example, in W00028082A1 and W00224902A1. A reverse transcription loop-mediated isothermal amplification method (RT-LAMP) has similarly been described, for example, in WO0177317A1 , CN103146847B, US8389221B2, and CN102286637B. Nucleic acid amplification using LAMP allows for a limited quantity of target DNA in the startingmaterial. Other advantages of LAMP include: its isothermal reaction conditions, i.e. it operates at a constant temperature of around 60-65°C; and its rapid amplification using the loop structure.

[0008] One limitation of conventional LAMP techniques relates to the potential for non-specific binding and amplification of non-target nucleic acid sequences. The multi-primer design of the LAMP process makes it potentially susceptible to the risk of non-specific amplification if primers are not perfectly optimised. It is common to design and use more than four primers to perform LAMP; for instance, US10364458B2 discloses the use of additional STEM oligonucleotides for SNP detection. The risk of non-specific amplification increases in a point-of-care diagnostic context, wherein extensive purification of biological samples is not available. Use of biological samples without extensive purification can significantly reduce sensitivity and increase the likelihood of nonspecific amplification due to impurities such as proteins, polysaccharides, lipids and other contaminants in the sample.

[0009] Many conventional LAMP techniques for nucleotide and / or gene variant detection are not suitable for point-of-care diagnostics, as these employ multiple step sample processing (CN104561247A) to maintain the sensitivity and specificity of the test. Such approaches are time consuming, labour-intensive, and may increase chances for cross-contamination. Other conventional lamp techniques involve complex experimental setup and data analysis processes, requiring precise time measurement for exponential amplicon increase, or additional interpretation of a negative result. For example, a LAMP based gene variant detection method (Yang et al., 2022) relies on execution of two gene amplification reactions in parallel and data analysis based on the calculation of difference between the two assays.

[0010] Existing LAMP methods that may be compatible with point-of-care applications are limited to a detection of a single nucleotide variant, or detection of a specific virus. For example, the LAMP-SNP assay is limited to detection of the C580Y mutation in the Pfkelch13 gene from dried blood spot samples (Khammanee T et al. 2021). Another method relates to S168T detection in Haemonchus contortus based on loop-primer endonuclease (Antonopoulos et al., 2024). US7638280B2 presents a method of detecting SARS-CoV-2, and WO0134838A1 details the detection of SNPs specifically near intron-exon junctions.

[0011] Therefore, there is a need to develop a method that increases sensitivity and specificity to a target variant that is not limited to a single nucleotide variant, while retaining rapid turnaround suitable for use in point-of-care diagnostic methods in laboratory-independent healthcare facilities.

[0012] SUMMARY OF THE INVENTIONThe present invention addresses deficiencies in the art and provides a novel point-of-care solution for rapidly detecting a nucleotide and / or gene variant, including substitutions, deletions and additions of multiple sequences, in a target polynucleotide from a biological sample. Furthermore, accurate result interpretation is important, particularly in oncology, where genetic mosaicism is common, rendering traditional variant detection methods less effective. Thus, the present invention provides rapid and accurate methods, compositions and uses for detecting nucleotide variants and / or diagnosing gene variants.

[0013] These and other uses, features and advantages of the invention should be apparent to those skilled in the art from the teachings provided herein.

[0014] In an aspect, the invention provides a method for detecting a nucleotide variant comprising one or more nucleotide mutations in a target polynucleotide from a sample. The invention also comprises a method for diagnosing a disease or condition, determining a risk of developing a disease or condition disease prognosis, tracking disease inheritance, predicting susceptibility to environmental factors, predicting responsiveness to pharmaceutical drugs or other agents, or differentiating between biological samples or organisms.

[0015] The method comprises providing a sample comprising a plurality of polynucleotide molecules comprising the target polynucleotide, wherein the target polynucleotide includes at least a first polynucleotide strand including a nucleic acid sequence comprising the nucleotide variant and optionally a second polynucleotide strand complementary to the first polynucleotide strand. Thus, the sample may initially be single-stranded or double-stranded. The method also comprises the step of contacting the sample with a DNA polymerase having exonuclease activity and a set of nucleic acid primers. The set of nucleic acid primers comprises at least a first primer (FIP) and a second primer (BIP). The first primer comprises a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c). The second sequence region is located 3’ of the first sequence region of the first polynucleotide strand. The second primer (BIP) comprises a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2), said fourth sequence region being located 5’ of the third sequence region.

[0016] In some aspects and embodiments, the second sequence region comprises the one or more nucleotide mutations of the variant polynucleotide, and the first primer has a ddNTP(dideoxynucleotide triphosphate) at the 3’ terminal, and is configured to anneal to the second sequence region of the first polynucleotide such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the variant polynucleotide, align with nucleotides within the six 3’ terminal nucleotides of the first primer.

[0017] In some aspects and embodiments, the fourth sequence region comprises the one or more nucleotide mutations of the variant polynucleotide, and the second primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and is configured to anneal to the complementary sequence to that of the fourth sequence region of the first polynucleotide (e.g. the second polynucleotide strand) such that the one or more nucleotide mutations, or one or more wildtype nucleotides at corresponding positions to those of the one or more nucleotide mutations in the variant polynucleotide, align with nucleotides within the six 3’ terminal nucleotides of the second primer

[0018] In various embodiments, the one or more nucleotide mutations of the nucleotide variant comprises one or more insertions, deletions or substitutions in comparison to the corresponding wild-type nucleotide sequence or a single nucleotide polymorphism (SNP). The method may additionally comprise obtaining a biological sample and extracting polynucleotides from the biological sample to obtain the sample comprising the plurality of polynucleotide molecules comprising the target polynucleotide. In embodiments, the one or more nucleotide mutations comprises upto 6 nucleotide mutations, upto 5 nucleotide mutations, upto 4 nucleotide mutations, up to 3 nucleotide mutations, or up to 2 nucleotide mutations; for example, 1 nucleotide mutation, 2 nucleotide mutations, 3 nucleotide mutations, 4 nucleotide mutations, 5 nucleotide mutations, or 6 nucleotide mutations.

[0019] The method further comprises performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers and the DNA polymerase to synthesise a specific product having a sequence comprising a portion of the target polynucleotide. The method also comprises detecting the presence or absence of the specific product of the nucleic acid amplification step, wherein the presence or absence of the specific product is indicative of the presence or absence of a nucleotide variant.

[0020] In another aspect, a kit for detecting a nucleotide and / or variant in a target polynucleotide sequence in a sample, the kit comprising a primer set as described herein, optionally one or more reagents, and optionally instructions for use.In aspects and embodiments the primer set of the methods and kits may comprise a third primer (FOP) that is complementary or substantially complementary to a fifth sequence region of the first polynucleotide strand (F3c), said fifth sequence region being located 3’ of the second sequence region.

[0021] In aspects and embodiments the primer set of the methods and kits may comprise a fourth primer (BOP) that is homologous or substantially homologous to a sixth sequence region of the first polynucleotide strand (B3), said sixth sequence region (B3) being located 5’ of the fourth sequence region.

[0022] In aspects and embodiments the primer set of the methods and kits may comprise a fifth primer (loop forward primer) that is homologous or substantially homologous to a seventh sequence region of the first polynucleotide strand, said seventh sequence region being located between the first and second sequence regions of the first polynucleotide strand (F2).

[0023] In aspects and embodiments the primer set of the methods and kits may comprise a sixth primer (loop backward primer) that is complementary or substantially complementary to an eighth sequence region of the first polynucleotide strand, said eighth sequence region being located between the third and fourth sequence regions of the first polynucleotide strand (B2).

[0024] BRIEF DESCRIPTION OF THE DRAWINGS

[0025] The invention is further illustrated by the accompanying drawings.

[0026] Figure 1. Detection of EGFR T790M SNP using LAMP assay with DNA polymerases possessing 3'^5' exonuclease activity. (A) LAMP amplification was performed using synthetic gBIock containing the T790M mutation as a template, yielding amplification products within 19.6-36.4 minutes. (B) No amplification was observed when human DNA extracted from A549 cell line was used as the template. TTR: Time to response.

[0027] Figure 2. Amplification plots for EGFR T790M SNP detection via LAMP assay using DNA polymerases with 3'^5' exonuclease activity. Exponential amplification curves were observed when synthetic gBIock containing the T790M mutation was used as the template. No amplification was detected when human DNA extracted from A549 cell line or water (H2O) was used as a template.

[0028] Figure 3. Melt curve analysis for EGFR T790M SNP detection via LAMP assay with DNA polymerases having 3'^5' exonuclease activity. A melting peak at ~87 °C was observed foramplification products derived from synthetic gBIock containing the T790M mutation. Non-specific primer-derived signals (primer clouds) were noted when using human DNA extracted from A549 cell line or H2O as the template.

[0029] Figure 4. Specificity of LAMP amplification for EGFR T790M SNP detection. LAMP reactions using synthetic gBIock as the template with Q5 DNA polymerase produced amplification products within 20.1-28.3 minutes. No amplification was observed with human DNA extracted from A549 cell line as the template. TTR: Time to response.

[0030] Figure 5. Temperature dependence of LAMP detection for EGFR T790M SNP. LAMP reactions using synthetic gBIock as the template and Q5 DNA polymerase were performed under a temperature gradient to determine optimal amplification conditions. TTR: Time to response.

[0031] Figure 6. Limit of detection (LOD) for EGFRT790M SNP amplification using LAMP. LAMP assays with Q5 DNA polymerase were performed using serial dilutions of synthetic gBIock as the template to assess the LOD. TTR: Time to response.

[0032] Figure 7. Detection of EGFR T790M SNP in mixed template populations. LAMP assays with Q5 DNA polymerase were conducted using 100 copies of synthetic gBIock and varying amounts of human DNA as templates to simulate different variant allele frequencies (VAF). TTR: Time to response.

[0033] Figure 8. Influence of ddNTP modification and SNP distance from primer 3'-end on LAMP amplification of EGFR T790M SNP. LAMP reactions were performed using 104copies of synthetic gBIock and Q5 DNA polymerase, with differently modified first primers (FIP). The first primers (FIP) were terminated with dideoxynucleotide (ddNTP) at the 3'-end, with the number in parentheses indicating the distance of the SNP from the primer’s 3'-end. TTR: Time to response.

[0034] DETAILED DESCRIPTION

[0035] As used herein, the term “substantially complementary” refers to a primer that is configured to anneal to a target sequence wherein one or more of the targeted nucleotides may be mutated to non-target nucleotides that are not complementary to the primer. By way of example, where a particular gene variant sequence is targeted by a primer, a primer that is fully complementary to the variant sequence may be considered to be substantially complementary to the corresponding wild-type sequence, and vice versa. Thus, in accordance with this disclosure, in embodiments wherein a variant polynucleotide or gene variant has from 1 to 6 mutated nucleotide positions, a primer that is configured to anneal to all such variant positions may be fully complementary to thevariant sequence, but is only substantially complementary to the corresponding wild-type sequence. Where there is only one mutated nucleotide in the variant polynucleotide or gene variant, a substantially complementary primer may be misaligned at that one position with respect either to the mutant sequence or the corresponding wild-type sequence, as the case may be.

[0036] Provided herein is a method for detecting a nucleotide and / or gene variant comprising one or more nucleotide mutations in a target polynucleotide from a sample, the method comprising the steps of providing a sample comprising a plurality of polynucleotide molecules comprising the target polynucleotide, wherein the target polynucleotide includes at least a first polynucleotide strand including a nucleic acid sequence comprising the nucleotide or gene variant, contacting the sample with DNA polymerase with 3’ to 5’ exonuclease activity, DNA polymerase having strand displacement activity and a set of nucleic acid primers; and performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers to synthesise a specific product having a sequence comprising a portion of the target polynucleotide. The method further comprises detecting the presence or absence of the specific product of the nucleic acid amplification cycle, wherein the presence or absence of the specific product is indicative of the presence or absence of a nucleotide or gene variant.

[0037] The nucleic acid primers of the method include a first primer comprising a 5’ portion that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand, and a 3' end portion that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand, said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand. The second primer comprises a 5' portion that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand, said third sequence region being located 5’ of the first sequence region, and a 3' end portion that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand, said fourth sequence region being located 5’ of the third sequence region. Either the first primer or the second primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal.

[0038] In embodiments wherein the second sequence region comprises the one or more nucleotide mutations the first primer includes a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal. Furthermore, in embodiments, the 3’ binding / annealing portion of the first primer is designed such that at least one of the six 3’ terminal nucleotides of the first primer anneals to the one or more nucleotide mutations, or to a wild-type sequence at the position of the nucleotide mutations in the first polynucleotide strand. In other embodiments, wherein the fourth sequence region comprises the one or more nucleotide mutations wherein the second primer includes a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and is configured to bind / anneal to apolynucleotide strand complementary to the first polynucleotide strand (e.g. a ‘second polynucleotide strand’) in the region complementary to the fourth sequence region, such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the variant polynucleotide, align with nucleotides within the six 3’ terminal nucleotides of the second primer.

[0039] In embodiments, the first primer includes a TTTT polynucleotide bridge between the 5’ portion and the 3’ portion. In embodiments, the second primer includes a TTTT polynucleotide bridge between the 5’ portion and the 3’ portion.

[0040] In some embodiments, the nucleotide variant represents a genetic mutation. In further embodiments, the one or more nucleotide mutations of the nucleotide variant comprises one or more insertion, deletion or substitution in comparison to the corresponding wild-type nucleotide sequence. In some embodiments, the nucleotide variant is a single nucleotide polymorphism (SNP) having a single nucleotide mutation.

[0041] According to the disclosure, the primer comprising a 3’ terminal ddNTP is configured to anneal at a sequence of the target polynucleotide comprising the nucleotide variant, or at the wildtype nucleotide sequence at the position of the nucleotide variant in the target polynucleotide. The inventors have discovered that if the primer comprising a 3’ terminal ddNTP is misaligned with or not complementary to its target sequence at one or more nucleotide positions in the six 3’ terminal nucleotides, a DNA polymerase with exonuclease activity may be capable of cleaving / removing the ddNTP including any nucleotides within the last six 3’ nucleotides up to and including any nonannealed nucleotides in the terminal six nucleotides at the 3’ end of the primer. Subsequently, the DNA polymerase can then proceed to extend the strand complementary to its target polynucleotide strand from the remaining portion of the annealed primer and thus begin the process of amplifying the target polynucleotide sequence. On the other hand, if the six 3’ terminal residues of the first or second primer, including its respective 3’ terminal ddNTP is fully complementary to its target polynucleotide sequence, the primer would be precisely aligned and annealed and, due to the full complementarity of the 3’ end portion of the primer, the ddNTP cannot be removed by the exonuclease activity of the DNA polymerase, resulting in the inhibition of chain extension and amplification. The invention therefore provides a novel method that may improve either or both of sensitivity and selectivity in the detection of a target polynucleotide sequence potentially comprising one or more nucleotide mutation, by increasing signal-to-noise ratio through ddNTP mediated amplification inhibition. Therefore, the invention also provides a novel method with high selectivity towards a target sequence over a closely related non-target sequence by generating a binary outcome according to the presence or absence of a specific amplification product which is indicative of the presence of absence of a specific nucleotide or gene variant.Optionally, third and fourth primers are provided for performing the amplification reaction. The third primer is complementary or substantially complementary to a fifth sequence region of the first polynucleotide strand (F3c), said fifth sequence region being located 3’ of the second sequence region. The fourth primer is homologous or substantially homologous to a sixth sequence region of the first polynucleotide strand (B3), said sixth sequence region (B3) being located 5’ of the fourth sequence region.

[0042] Optionally, fifth and sixth primers are provided for performing the amplification reaction. The fifth primer (loop forward primer) is homologous or substantially homologous to a seventh sequence region of the first polynucleotide strand, said seventh sequence region being located between the first and second sequence regions of the first polynucleotide strand. The sixth primer (loop backward primer) is complementary or substantially complementary to an eighth sequence region of the first polynucleotide strand, said eighth sequence region being located between the third and fourth sequence regions of the first polynucleotide strand. In embodiments, the use of at least third and fourth primers and optionally fifth and sixth primers may facilitate the initial nucleotide amplification reaction, e.g. LAMP, and / or sustain the amplification with higher efficiency.

[0043] Typically, at least one of the last six nucleotides at the 3’ terminal of either the first primer or the second primer is configured to anneal to the nucleotide variant of the target polynucleotide. Suitably, the first or second primer is configured such that the 3’ terminal ddNTP is aligned with the position of the relevant nucleotide variant.

[0044] In embodiments, the presence of the specific amplification product indicates the presence of the nucleotide or gene variant in the initial sample. In embodiments, the presence of the specific amplification product indicates presence of the nucleotide variant when at least one of the six 3’ terminal nucleotides of the first primer is not complementary to one of the one or more nucleotide mutations of the target polynucleotide sequence. In embodiments, the presence of the specific amplification product indicates presence of the nucleotide variant, when the six 3’ terminal nucleotides of the first primer are complementary to the wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the target polynucleotide sequence.

[0045] In different embodiments, the presence of the specific amplification product indicates presence of the nucleotide variant, when at least one of the six 3’ terminal nucleotides of the second primer is not homologous to the one or more nucleotide mutations of the target polynucleotide sequence. In embodiments, the presence of the specific amplification product indicates presence of the nucleotide variant, when the six 3’ terminal nucleotides of the second primer are homologousto the wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the target polynucleotide sequence.

[0046] In further embodiments, the presence of the specific amplification product indicates presence of the gene variant when the nucleotide base of the ddNTP is not complementary to the nucleotide base of the gene variant or the complement thereof in the target polynucleotide sequence, and the gene variant is a single nucleotide polymorphism. In further embodiments, the presence of the specific amplification product indicates presence of the gene variant, when the nucleotide base of the ddNTP is complementary to the wild-type nucleotide base at the position of the gene variant in the target polynucleotide sequence or the complement thereof, and the gene variant is a single nucleotide polymorphism. For example, the wild-type target sequence comprises AAATTTTTTTTGGG and the nucleotide variant sequence comprises AAAGGG, wherein TTTTTTTT is removed as a deletion. In such an example, either the first or the second primer is designed / configured to anneal to the nucleotide variant sequence AAAGGG and the 3’ terminal position of the corresponding first or second primer is a ddNTP. For example, the primer may comprise a sequence AAA-ddTTP.

[0047] In embodiments, the presence or lack of the specific amplification product may indicate presence of the wild-type sequence. In embodiments, the lack of the specific amplification product may indicate presence of the wild-type sequence when the six 3’ terminal nucleotides of the first primer are complementary to wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the target polynucleotide sequence. In other embodiments, the lack of the specific amplification product may indicate presence of the wild-type sequence when the six 3’ terminal nucleotides of the first primer are homologous to the wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the target polynucleotide sequence. For example, a wild-type target sequence comprises AAATTTTTTTTGGG and a nucleotide variant sequence comprises AAAGGG, wherein TTTTTTTT is removed as a deletion. In such an example, either the first or the second primers is designed / configured to anneal to the wild-type sequence AAATTTTTTTTGGG. For example, the primer may comprise a sequence AAA-ddGTP.

[0048] In further embodiments, the specific product is not synthesised when the target polynucleotide comprises the one or more nucleotide mutations, wherein the six 3’ terminal nucleotides of the first primer are complementary to the one or more nucleotide mutations of the target polynucleotide sequence.

[0049] In further embodiments, the lack of the specific amplification product may indicate presence of the nucleotide variant sequence, when the six 3’ terminal nucleotides of the second primer are homologous to the one or more nucleotide mutations of the target polynucleotide sequence.In embodiments, the 3’ end portion of the first primer anneals to the first polynucleotide such that at least one of the last six nucleotides at the 3’ terminal aligns with the nucleotide variant in the first target polynucleotide strand. In other embodiments, at least one of the last five nucleotides at the 3’ terminal aligns with the nucleotide variant in the first target polynucleotide strand, at least one of the last four nucleotides at the 3’ terminal aligns with the nucleotide variant in the first target polynucleotide strand, at least one of the last three nucleotides at the 3’ terminal aligns with the nucleotide variant in the first target polynucleotide strand, at least one of the last two nucleotides at the 3’ terminal aligns with the nucleotide variant in the first target polynucleotide strand. In particularly suitable embodiments, the 3’ end portion of the first primer anneals to its target sequence such that the ddNTP at the 3’ terminal aligns with the nucleotide variant in the first polynucleotide strand. In these embodiments, the ddNTP is provided at the 3’ terminal of the first primer.

[0050] Alternatively, the ddNTP is provided at the 3’ terminal of the second primer and the 3’ end portion of the second primer anneals to its target site on the second polynucleotide strand that is complementary to the first polynucleotide strand such that at least one of the last six nucleotides at the 3’ terminal aligns with a nucleotide base complementary to the nucleotide variant in the first polynucleotide strand. In embodiments, at least one of the last five nucleotides at the 3’ terminal aligns with a nucleotide base complementary to the nucleotide variant in the first polynucleotide strand, at least one of the last four nucleotides at the 3’ terminal aligns with a nucleotide base complementary to the nucleotide variant in the first polynucleotide strand, at least one of the last three nucleotides at the 3’ terminal aligns with a nucleotide base complementary to the nucleotide variant in the first polynucleotide strand, or at least one of the last two nucleotides at the 3’ terminal aligns with a nucleotide base complementary to the nucleotide variant in the first polynucleotide strand. In particularly suitable embodiments, the 3’ end portion of the second primer anneals to a second polynucleotide strand complementary to the first polynucleotide strand such that the ddNTP at the 3’ terminal aligns with a nucleotide base complementary to the nucleotide variant in the first polynucleotide strand.

[0051] In embodiments, the one or more nucleotide mutations of the polynucleotide of gene variant may have 1 , 2, 3, 4, 5 or 6 nucleotide mutations. Suitably, the one or more nucleotide mutations may be from 1 to 5 nucleotide mutations, from 1 to 4 nucleotide mutations or from 1 to 3 nucleotide mutations. In some embodiments, there are 1 or 2 nucleotide mutations; and suitably, there is 1 nucleotide mutation

[0052] In aspects and embodiments performing at least one nucleic acid amplification step on the target polynucleotide comprises contacting the sample with a reaction mixture containing the set ofprimers with the DNA polymerase under conditions suitable to perform DNA chain extension and / or amplification. Suitably, the exonuclease activity is a 3’ to 5’ exonuclease activity. In embodiments, at least one nucleic acid amplification step is performed. In further embodiments, the at least one nucleic acid amplification step is performed in the presence of the DNA polymerase with exonuclease activity. In embodiments, the at least one nucleic acid amplification step comprises a loop-mediated amplification reaction (LAMP). In embodiments, the at least one nucleic acid amplification step is performed in the presence of a DNA polymerase lacking exonuclease activity and / or a DNA polymerase having strand displacement activity. In embodiments, the DNA polymerase having strand displacement activity is selected from: Bst polymerase, Bst Large Fragment polymerase, Bsm polymerase, and GspSSD polymerase. In embodiments, the activity of the 3’ to 5’ exonuclease may vary depending on the choice of the DNA polymerase. In embodiments, the DNA polymerase having exonuclease activity may be selected from: Phusion polymerase, Q5 polymerase KOD polymerase, SuperFi polymerase, Vent polymerase, DeepVent polymerase, Pfu DNA Polymerase, PfuUltra II polymerase, KAPPA HiFi HotStart polymerase, and TH DNA Polymerase.

[0053] In aspects and embodiments, a sample may comprise a plurality of polynucleotide molecules comprising the target polynucleotide. The sample may be obtained from a biological sample. In embodiments, the sample may comprise a plurality of polynucleotide molecules including the target polynucleotide, which sample may be obtained by extracting polynucleotides from a biological sample, wherein extracting polynucleotide involves heat-based lysis, Chelex-based extraction or lab-on-chip approach with fully integrated and automated sample processing. The biological sample may comprise a human bodily fluid or human cells. In embodiments, human cells may comprise human cancer cells, human stem cells, or human fibroblast cells. In embodiments, the sample is obtained from a biological sample from a subject, wherein the subject is selected from the group consisting of: mammal, rodent, primate, human, monkey, rabbit, sheep, rat, or mouse. Particularly, the sample is a human sample.

[0054] In embodiments, the target polynucleotide may comprise one or more synthetic nucleotides. In embodiments, the target polynucleotide may comprise the sequence of a gene. Suitably, the gene may be associated with a disease or condition. The disease or condition may be selected from: B-thalassemia, sickle cell disease, hereditary spherocytosis, Fanconi anaemia, and Haemophilia A and B, and cancer. In embodiments, the sequence variant is on the epidermal growth factor receptor (EGFR) gene. In embodiments, the sequence variant is T790M in the EGFR gene.

[0055] Thus, in aspects and embodiments, this disclosure provides a method for diagnosing a disease or condition, determining a risk of developing a disease or condition disease prognosis,tracking disease inheritance, predicting susceptibility to environmental factors, predicting responsiveness to pharmaceutical drugs or other agents, or differentiating between biological samples or organisms (e.g. bacterial strains), the method comprising:

[0056] a. providing a sample comprising at least one target polynucleotide, wherein the target polynucleotide includes at least a first polynucleotide strand and optionally a second polynucleotide strand complementary to the first polynucleotide strand, and wherein the first polynucleotide strand includes a nucleic acid sequence which has, is expected to have, or may have a sequence portion comprising one or more nucleotide mutations characteristic of the disease or condition;

[0057] b. contacting the sample with a DNA polymerase having exonuclease activity and a set of nucleic acid primers, the set of nucleic acid primers comprising:

[0058] a first primer (FIR) comprising

[0059] (i) a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and

[0060] (ii) a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c), said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand, and wherein the second sequence region comprises the sequence portion that has, is expected to have, or may have the one or more nucleotide mutations; and

[0061] a second primer (BIP) comprising

[0062] (i) a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and

[0063] (ii) a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2), said fourth sequence region being located 5’ of the third sequence region,

[0064] wherein the first primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and wherein the first primer is configured to anneal to the second sequence region such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the first polynucleotide strand, align with nucleotides within the six 3’ terminal nucleotides of the first primer;

[0065] c. performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers and the DNA polymerase to synthesise a specific product having a sequence comprising a portion of the target polynucleotide; and

[0066] d. detecting the presence or absence of the specific product of the nucleic acid amplification step, wherein the presence or absence of the specific product is indicative of the presence or absence of the sequence portion comprising one or more nucleotide mutations characteristic of the disease or condition.In other aspects and embodiments, the disclosure provides a method for diagnosing a disease or condition, determining a risk of developing a disease or condition disease prognosis, tracking disease inheritance, predicting susceptibility to environmental factors, predicting responsiveness to pharmaceutical drugs or other agents, or differentiating between biological samples or organisms (e.g. bacterial strains), the method comprising:

[0067] a. providing a sample comprising at least one target polynucleotide, wherein the target polynucleotide includes at least a first polynucleotide strand and optionally a second polynucleotide strand complementary to the first polynucleotide strand, and wherein the first polynucleotide strand includes a nucleic acid sequence which has, is expected to have or may have a sequence portion comprising one or more nucleotide mutations characteristic of the disease or condition;

[0068] b. contacting the sample with a DNA polymerase having exonuclease activity and a set of nucleic acid primers, the set of nucleic acid primers comprising:

[0069] a first primer (FIR) comprising

[0070] (i) a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and

[0071] (ii) a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c), said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand; and

[0072] a second primer (BIP) comprising

[0073] (i) a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and

[0074] (ii) a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2) so as to anneal to a second polynucleotide strand at the sequence complementary to the fourth sequence region, said fourth sequence region being located 5’ of the third sequence region, and wherein the fourth sequence region comprises the one or more nucleotide mutations;

[0075] wherein the second primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and wherein the second primer is configured to anneal to the second polynucleotide strand at the sequence complementary to the fourth sequence region such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the first polynucleotide strand, align with nucleotides within the six 3’ terminal nucleotides of the second primer;c. performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers and the DNA polymerase to synthesise a specific product having a sequence comprising a portion of the target polynucleotide; and

[0076] d. detecting the presence or absence of the specific product of the nucleic acid amplification step, wherein the presence or absence of the specific product is indicative of the presence or absence of the sequence portion comprising one or more nucleotide mutations characteristic of the disease or condition.

[0077] In further aspects and embodiments, the disclosure provides a kit for detecting a nucleotide or gene variant in a target nucleic acid sequence in a sample. The kit may comprise a primer set according to the disclosure, optionally one or more reagents, and optionally instructions for use. The kit may further comprise one or more reagents and / or enzymes for amplifying a nucleic acid in a sample, for example, using a LAMP technique. The reagents or primers of the kit may be dried or lyophilised. The kit may be suitable for one or more of the following: identifying a gene mutation (e.g. a pathogenic gene), diagnosing a disease or condition, determining a risk of developing a disease or condition, disease prognosis, disease prediction, tracking disease inheritance, predicting susceptibility to environmental factors, predicting responsiveness to pharmaceutical drugs or other agents, and differentiating between biological samples or organisms (e.g. bacterial strains). In particular, the kit may be useful for diagnosing a disease or condition. Examples of suitable diseases or conditions may be selected from: B-thalassemia, sickle cell disease, hereditary spherocytosis, Fanconi anaemia, and Haemophilia A and B, and cancer.

[0078] Particular benefits of the methods and kits of this disclosure lie in their suitability for use in highly sensitive and / or specific detection of one or more mutations (e.g. a point mutation) in a target nucleotide sequence. Beyond the detection of a single mutation, the methods enable identifying multiple mutations within the target sequence or across different sequences. This multiplexing capability significantly enhances applicability, particularly in scenarios requiring the comprehensive analysis of genetic variations, such as in cancer genomics, inherited disease screening, or pathogen identification.

[0079] The method may beneficially be suitable for use in a point-of-care laboratory-independent medical diagnostic setting. The methods and kits of the disclosure may provide rapid outcome of a point mutation detection. For example, in embodiments, the initial chain extension and / or amplification reaction may yield detectable results when carried out for between about 5 and 60 minutes, between about 10 and 45 minutes, or between about 15 and 30 minutes. In embodiments, the methods and kits may be compatible with the use of a portable genetic analyzer.Beneficially, the methods do not require complex experimental setup nor additional data analysis, due to the advantageous binary outcome of the LAMP process, i.e. depending on the presence or the absence of the specific amplification product. Conventional LAMP techniques engaged in SNP detection typically require complex and time-consuming data analysis and multiple or parallel runs to interpret negative results. For example, a gene variant detection method (Yang et al., 2022) requires running two amplification reactions in parallel and calculating the difference. Similarly, several LAMP methods involve use and detection of fluorescent probes, which require additional equipment to analyse and interpret the results. For example, as in the method for detecting SNPs using competitive fluorescent probes across the human genome and SARS-CoV-2 (Hyman et al., 2022) variants. Some prior art techniques employ the combination of these approach, which makes the use of the technology even more challenging in the absence of laboratory grade experimental setup. For example, JP6408447B2 involves an additional set of primers coupled with fluorescent labelling.

[0080] Current LAMP methods designed for point-of-care use are highly limited, focusing primarily on detecting single nucleotide variants. For example, the LAMP-SNP assay is confined to identifying the C580Y mutation in the Pfkelch13 gene from dried blood spots (Khammanee T et al., 2021). Another method targets the S168T mutation in Haemonchus contortus through loop-primer endonuclease (Antonopoulos et al., 2024). US7638280B2 outlines a process for detecting SARS-CoV-2, while WO0134838A1 only covers SNP detection near intron-exon junctions.

[0081] The invention therefore provides novel methods and corresponding kits that improve both sensitivity and selectivity in detecting potentially a wide variety of nucleotide and / or gene variants; particularly due to increasing signal-to-noise ratio through ddNTP mediated amplification inhibition. Therefore, the invention also provides novel methods with high selectivity towards the target sequence by generating a binary outcome according to the presence or absence of a target polynucleotide or gene variant.

[0082] Examples

[0083] Primer set sequences

[0084] Detection of T790M gene variant in EGFR gene:

[0085] First primer (FIP) TTCCCGGACATAGTCCAGGAGGTCCACCGTGCAGCTCATCA-ddC (SEQ ID NO: 7)

[0086] Second primer (BIP) ATTGGCTCCCAGTACCTGCTCACCGTATCTCCCTTCCCTGA (SEQ ID NO: 2)

[0087] Third primer (FOP) ATGGCCAGCGTGGACAA (SEQ ID NO: 3)Fourth primer (BOP) TGGCTCCTTATCTCCCCTC (SEQ ID NO: 4)

[0088] Fifth primer (LF) AGCCGAAGGGCATGAGCTG (SEQ ID NO: 5)

[0089] Sixth primer (LB) ACTGGTGTGTGCAGATCGC (SEQ ID NO: 6)

[0090] The first primer is configured so that the ddCTP is positioned precisely at the T790M site of the EGFR gene variant. In this example, ddCTP is not complementary to the mutated nucleotide in the T790M gene sequence, resulting in mis-annealing of the 3’ end. In the presence of a DNA polymerase with 3’ to 5’ exonuclease activity, the non-annealed ddCTP is cleaved off and, as a result, amplification from the first primer is no longer inhibited by the presence of a ddCTP nucleotide, and DNA synthesis takes place to form a specific polynucleotide product.

[0091] Importantly, the ddCTP of the first primer is complementary to the corresponding wild-type gene sequence at the position of alignment of the first primer. In this case, due to full complementarity of the first primer with the target wild-type nucleotide strand, the 3’ terminal ddCTP cannot be removed by the high-fidelity DNA polymerase (DNA polymerase with 3’ to 5’ exonuclease activity) and chain extension and amplification is inhibited.

[0092] Unless otherwise stated, following reagents and condition has been used throughout all experiments.

[0093] Material

[0094] As a template for the T790M SNP mutation, a synthetic gene fragment (gBIock T790M Hi Fi DNA control NG_007726.3_EGFR EXON 20_-c.2369 C_T; IDT) was used. As a control material for wild-type EGFR gene without the T790M mutation, human DNA extracted from human fibroblasts (A543) with a commercially available extraction kit (Qiagen) was used. Various amounts of mutant gBIock T790M polynucleotides (up to 10"4copies per reaction) and wild-type human DNA (up to 10'6copies per reaction) per reaction were used throughout the experiments.

[0095] LAMP Amplification

[0096] 10 pL reaction mix comprises the following: 0.6 pL of primer mix (FIP / BIP 13.3 mM, FOP / BOP 1.67 mM, LF / LB 3.34 mM), 5 pL master mix (WarmStart® LAMP 2X Master Mix, NEB), 0.25 pL DNA polymerase was used at 2 U / pL and selected from: KOD DNA Polymerase (Merc), Phusion High-Fidelity DNA Polymerase (NEB), or Q5 High-Fidelity DNA Polymerase (NEB), 0.5 pL EvaGreen® Dye (Biotium), and 1 pL DNA selected from: EGFR synthetic gene with T790M mutation or wild-type EGFR gene. Molecular Biology grade water (Thermo Scientific) was added up to 10 pL.Amplifications were conducted at 64°C for 40 minutes using either QuantStudio™ 7 Pro Real-Time PCR System (Thermo Scientific) or CFX96 Dx Real-Time PCR Detection Systems (BioRad), and the fluorescence signal was monitored in real-time. As a measure of reaction amplification, time to response (TTR) was automatically calculated using each system’s proprietary software.

[0097] Table 1. Amplification parameters.

[0098]

[0099] Example 1

[0100] Discrimination of T790M nucleotide variant from wild-type DNA

[0101] For the initial assay of T790M SNP detection with LAMP, 104copies of T790M gBIock were used in the reaction with the addition of various DNA polymerases with 3’ to 5’ exonuclease activity. Two technical replicates were performed for each experimental condition. Efficient amplification could be observed when supplementing the LAMP reaction with either Phusion or Q5 polymerase, while very late or no amplification could be seen when using KOD or no polymerase (Figure 1A). Wild-type human DNA from fibroblast cells was used as the control (250 genome copies per reaction) showing no unspecific amplification in the absence of the T790M SNP (Figure 1B).

[0102] Specificity measurements

[0103] To assay LAMP T790M SNP specificity, reactions were performed with 104copies of T790M gBIock and approx. 2,000,000 copies of human DNA per reaction. Ten technical replicates were performed for each experimental condition. Amplification could be observed when using EGFR T790M as the template, while no amplification could be observed when using wild-type human DNA as the template (Figure 2). A melting peak at ~87 °C was observed for amplification products derived from synthetic gBIock containing the T790M mutation (Figure 3).

[0104] The LAMP reaction with the addition of Q5 DNA polymerase performed using synthetic gBIock as a template, yielded an amplification product that was observable between 20.1 and 28.3 minutes across all reactions (Figure 4). Contrastingly, no amplification was observed when using wild-type human DNA as a template (Figure 4). These data indicate that the method is highly specific for the detection of the T790M SNP mutation according to this Example.More generally, the data obtained indicates that the method of this disclosure can beneficially be highly specific for detection of pre-defined polynucleotide / genetic variants.

[0105] Temperature tolerance

[0106] T790M SNP detection by the described polynucleotide amplification technique was then characterised in the context of temperature tolerance using 104copies of T790M gBIock per reaction, and the data is displayed in Figure 5. Three amplification temperature were tested: 62°C, 64°C and 66.4°C. Three technical replicates were performed for each experimental condition. The obtained data showed overall good temperature tolerance with specific product / DNA amplification at all tested temperatures, but with a slightly decreasing amplification efficiency towards lower temperatures (Figure 5).

[0107] Example 2

[0108] Establishing assay sensitivity - limit of detection of LAMP assay towards T790M SNP For the analysis of LAMP T790M SNP limit of detection, reactions were performed using serial dilutions of T790M gBIock. Three technical replicates were performed for each experimental condition. These assays were performed as before, except that the primer mix volume in the reaction was increased to 0.75 pl. The obtained data demonstrated amplification of T790M gBIock when there was a little as 5 polynucleotide target copies per reaction (see Figure 6). The data further demonstrates the specificity of the method at all such copy numbers down to 5 copies per reaction.

[0109] Example 3

[0110] Detecting the presence of the T790M gene variant in a mixed DNA sample - VAF

[0111] For the analysis of LAMP T790M SNP in a mixed DNA sample, reactions were performed with 100 copies of T790M gBIock and an increasing copy number of wild-type human DNA per reaction. Three technical replicates were performed for each experimental condition. Obtained data were used to calculate variant allele frequency (VAF). As shown in Figure 7, efficient amplification could be observed regardless of the presence of increasing amounts of human DNA in the sample, down to 0.005% VAF (Figure 7).

[0112] Example 4

[0113] LAMP amplification using primers terminated with ddATP, ddGTP, ddTTP in the increasing distance from T790M SNP

[0114] To demonstrate the applicability of any ddNTPs (e.g. ddCTP, ddATP, ddGTP, ddTTP) for use in polynucleotide variant detection, reactions were performed with 104copies of T790M gBIock, with one of the following FIP primers:FIP_20.1_ddC (0 bp) TTCCCGGACATAGTCCAGGAGGTCCACCGTGCAGCTCATCA-ddC (SEQ ID NO: 7)

[0115] FIP_20.1_ddG (-2 bp) TTCCCGGACATAGTCCAGGAGGTCCACCGTGCAGCTCATCAC-ddG (SEQ ID NO: 8)

[0116] FIP_20.1_ddA (-4 bp) TTCCCGGACATAGTCCAGGAGGTCCACCGTGCAGCTCATCACGC-ddA (SEQ ID NO: 9)

[0117] FIP_20.1_ddT (-7 bp) TTCCCGGACATAGTCCAGGAGGTCCACCGTGCAGCTCATCACGCAGC-ddT (SEQ ID NO: 10).

[0118] With reference to Figure 8, the number in brackets indicates the distance of the SNP from a suitably aligned primer terminated with each of the ddNTPs. Two technical replicates were performed for each experimental condition. As shown by the data, a specific amplification product could be observed when using ddCTP, ddGTP and ddATP as a terminating nucleotide in the FIP primer (Figure 8). No amplification was observed when using ddTTP at the 3’ end of the FIP primer, which sequence correlated with the mutated sequence, thus, giving this primer full complementarity to the target sequence at the 3’ end of the primer.

[0119] Furthermore, these experiments allowed determination of amplification dependence on SNP distance from the 3’end of the FIP primer terminated with each ddNTP. In these assays, the presence of the T790M mutation at least 4 bp upstream of the 3’ end of the FIP primer allowed primer cleavage by the exonuclease activity of the DNA polymerase and consequently specific polynucleotide product amplification in the assay. When the T790M mutation was located 7 bp upstream of the 3’ end of FIP primer amplification did not occur, presumably because the primer was annealed sufficiently at the 3’ end to prevent the DNA polymerase from removing the terminal ddNTP.

[0120] The invention is further defined with reference to the following clauses.

[0121] CLAUSES:

[0122] 1. A method for detecting a variant polynucleotide comprising one or more nucleotide mutations in a target polynucleotide from a sample, the method comprising the steps of:

[0123] a. providing a sample comprising a plurality of polynucleotide molecules comprising the target polynucleotide, wherein the target polynucleotide includes at least a first polynucleotide strand including a nucleic acid sequence comprising the one or more nucleotide mutations and optionally a second polynucleotide strand complementary to the first polynucleotide strand;

[0124] b. contacting the sample with DNA polymerase having exonuclease activity and a set of nucleic acid primers, the set of nucleic acid primers comprising:a first primer (FIR) comprising

[0125] (i) a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and

[0126] (ii) a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c), said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand, and wherein the second sequence region comprises the one or more nucleotide mutations; and,

[0127] a second primer (BIP) comprising

[0128] (i) a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and

[0129] (ii) a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2), said fourth sequence region being located 5’ of the third sequence region,

[0130] wherein the first primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and wherein the first primer is configured to anneal to the second sequence region such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the variant polynucleotide, align with nucleotides within the six 3’ terminal nucleotides of the first primer;

[0131] c. performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers and the DNA polymerase to synthesise a specific product having a sequence comprising a portion of the target polynucleotide; and

[0132] d. detecting the presence or absence of the specific product of the nucleic acid amplification step, wherein the presence or absence of the specific product is indicative of the presence or absence of the variant polynucleotide.

[0133] 1A. A method for detecting a variant polynucleotide comprising one or more nucleotide mutations in a target polynucleotide from a sample, the method comprising the steps of:

[0134] a. providing a sample comprising a plurality of polynucleotide molecules comprising the target polynucleotide, wherein the target polynucleotide includes at least a first polynucleotide strand including a nucleic acid sequence comprising the one or more nucleotide mutations and optionally a second polynucleotide strand complementary to the first polynucleotide strand;

[0135] b. contacting the sample with DNA polymerase having exonuclease activity and a set of nucleic acid primers, the set of nucleic acid primers comprising:

[0136] a first primer (FIP) comprising

[0137] (i) a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and(ii) a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c), said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand; and,

[0138] a second primer (BIP) comprising

[0139] (i) a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and

[0140] (ii) a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2) so as to anneal to a second polynucleotide strand at the sequence complementary to the fourth sequence region, said fourth sequence region being located 5’ of the third sequence region, and wherein the fourth sequence region comprises the one or more nucleotide mutations;

[0141] wherein the second primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and wherein the second primer is configured to anneal to the second polynucleotide strand at the sequence complementary to the fourth sequence region such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the variant polynucleotide, align with nucleotides within the six 3’ terminal nucleotides of the second primer;

[0142] c. performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers and the DNA polymerase to synthesise a specific product having a sequence comprising a portion of the target polynucleotide; and

[0143] d. detecting the presence or absence of the specific product of the nucleic acid amplification step, wherein the presence or absence of the specific product is indicative of the presence or absence of the variant polynucleotide.

[0144] I B. The method of clause 1 , wherein:

[0145] when at least one of the six 3’ terminal nucleotides of the first primer is not complementary to one of the one or more nucleotide mutations of the target polynucleotide sequence, the presence of the synthesised specific product indicates that the target polynucleotide comprises the one or more nucleotide mutation.

[0146] I C. The method of clause 1 , wherein:

[0147] when the six 3’ terminal nucleotides of the first primer are complementary to the one or more nucleotide mutations of the target polynucleotide sequence, the specific product is not synthesised when the target polynucleotide comprises the one or more nucleotide mutation.I D. The method of clause 1 , wherein:

[0148] when the six 3’ terminal nucleotides of the first primer are complementary to the wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the target polynucleotide sequence, the presence of the synthesised specific product indicates that the target polynucleotide comprises one or more nucleotide mutations.

[0149] I E. The method of clause 1 , wherein:

[0150] when the six 3’ terminal nucleotides of the first primer are complementary to wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the target polynucleotide sequence, the specific product is not synthesised when the target polynucleotide comprises the wild-type sequence.

[0151] I F. The method of clause 1 A, wherein:

[0152] when at least one of the six 3’ terminal nucleotides of the second primer is not homologous to the one or more nucleotide mutations of the target polynucleotide sequence, the presence of the synthesised specific product indicates that the target polynucleotide comprises the one or more nucleotide mutation.

[0153] IG. The method of clause 1 A, wherein:

[0154] when the six 3’ terminal nucleotides of the second primer are homologous to the one or more nucleotide mutations of the target polynucleotide sequence, the specific product is not synthesised when the target polynucleotide comprises the one or more nucleotide mutation.

[0155] IH. The method of clause 1 A, wherein:

[0156] when the six 3’ terminal nucleotides of the second primer are homologous to the wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the target polynucleotide sequence, the presence of the synthesised specific product indicates that the target polynucleotide comprises one or more nucleotide mutations.

[0157] 1J. The method of clause 1 A, wherein:

[0158] when the six 3’ terminal nucleotides of the first primer are homologous to the wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the target polynucleotide sequence, the specific product is not synthesised when the target polynucleotide comprises the wild-type sequence.

[0159] 2. The method of any of clauses 1 to 1 J, wherein the set of nucleic acid primers further comprises a third primer (FOP) that is complementary or substantially complementary to a fifthsequence region of the first polynucleotide strand (F3), said fifth sequence region being located 3’ of the second sequence region.

[0160] 3. The method of any of clauses 1 to 2, wherein the set of nucleic acid primers further comprises a fourth primer (BOP) that is homologous or substantially homologous to a sixth sequence region of the first polynucleotide strand (B3), said sixth sequence region (B3) being located 5’ of the fourth sequence region.

[0161] 4. The method of any of the preceding clauses, wherein the target polynucleotide comprises a sequence of a gene.

[0162] 5. The method of any of the preceding clauses, wherein the one or more nucleotide mutation represents a genetic mutation.

[0163] 5A. The method of any of the preceding clauses, wherein the one or more nucleotide mutations comprises one or more insertion, deletion or substitution in comparison to the corresponding wildtype nucleotide sequence.

[0164] 5B. The method of any of the preceding clauses, wherein the one or more nucleotide mutations comprises upto 6 nucleotide mutations, upto 5 nucleotide mutations, upto 4 nucleotide mutations, up to 3 nucleotide mutations, or up to 2 nucleotide mutations; for example, 1 nucleotide mutation, 2 nucleotide mutations, 3 nucleotide mutations, 4 nucleotide mutations, 5 nucleotide mutations, or 6 nucleotide mutations.

[0165] 6. The method of any of the preceding clauses, wherein the variant polynucleotide encompasses a single nucleotide polymorphism (SNP).

[0166] 7. The method of any of the preceding clauses, wherein providing a sample comprising a plurality of polynucleotide molecules comprising the target polynucleotide of step a comprises obtaining a biological sample and extracting polynucleotides from the biological sample to obtain the sample comprising the plurality of polynucleotide molecules comprising the target polynucleotide.

[0167] 8. The method of any of clauses 1 , 1 B to 1 E, or 2 to 7 when dependent on any of clauses 1 or 1B to 1E, wherein the first primer is configured to anneal to the first polynucleotide strand such that the ddNTP at the 3’ terminal aligns with a nucleotide mutation in the first polynucleotide strand.8A. The method of any of clauses 1A, 1F to 1 J, or 2 to 7 when dependent on any of clauses 1A or 1F to 1 J, wherein the second primer is configured to anneal to a second polynucleotide strand complementary to the first polynucleotide strand such that the ddNTP at the 3’ terminal aligns with a nucleotide of the second polynucleotide strand at the position complementary to a nucleotide mutation in the first polynucleotide strand.

[0168] 9. The method of any of clauses 1 , 1 B to 1 E, or 2 to 8A when dependent on any of clauses 1 or 1B to 1E, wherein the first primer is configured to anneal to the first polynucleotide strand such that the ddNTP at the 3’ terminal is aligned with the first polynucleotide strand:

[0169] within 6 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 5 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 4 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 3 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 2 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 1 nucleotide 5’ of at least one nucleotide mutation of the variant polynucleotide; or at a nucleotide mutation of the variant polynucleotide.

[0170] 9A. The method of any of clauses 1A, 1F to 1 J, or 2 to 8A when dependent on any of clauses 1 A or 1 F to 1 J, wherein the second primer is configured to anneal to a second polynucleotide strand complementary to the first polynucleotide strand such that the ddNTP at the 3’ terminal is aligned with a nucleotide of the second polynucleotide strand:

[0171] within 6 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;

[0172] within 5 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;

[0173] within 4 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;

[0174] within 3 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;

[0175] within 2 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;

[0176] within 1 nucleotide 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand; or

[0177] at the position complementary to a nucleotide mutation in the first polynucleotide strand.

[0178] 10. The method of any of clauses 1 , 1A, 1B, 1D, 1E, 1F, 1H and 1 J, or any of clauses 2 to 9A when dependent on any of clauses 1 , 1A, 1B, 1D, 1F, 1H or 1 J, wherein the ddNTP inhibits thesynthesis of a specific product comprising the wild-type polynucleotide sequence lacking the one or more nucleotide mutation.

[0179] 10A. The method of any of clauses 1 , 1 A, 1 C and 1 G or any of clauses 2 to 9A when dependent on any of clauses 1 , 1A, 1C or 1G, wherein the ddNTP inhibits the synthesis of a specific product comprising the one or more nucleotide mutation.

[0180] 11. The method of any of the preceding clauses, wherein:

[0181] the first primer has a TTTT polynucleotide bridge between the 5’ portion and the 3’ portion, and / or the second primer has a TTTT polynucleotide bridge between the 5’ portion and the 3’ portion.

[0182] 12. The method of any of the preceding clauses, wherein performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers and the DNA polymerase having exonuclease activity, comprises contacting the sample with a reaction mixture containing the set of primers with the DNA polymerase under conditions suitable to perform DNA synthesis and / or amplification.

[0183] 13. The method of any of the preceding clauses, wherein the ddNTP at the 3’ end of the first primer or the second primer is removed by an exonuclease activity of the DNA polymerase.

[0184] 14. The method of any of the preceding clauses, wherein the exonuclease activity of the DNA polymerase with exonuclease activity is a 3’ to 5’ exonuclease activity.

[0185] 15. The method of any of the preceding clauses, wherein the at least one nucleic acid amplification step is performed in the presence of the DNA polymerase with exonuclease activity.

[0186] 16. The method of any of the preceding clauses, wherein the at least one nucleic acid amplification step comprises a loop-mediated amplification reaction (LAMP).

[0187] 17. The method of any preceding clauses, wherein the at least one nucleic acid amplification step is performed in the presence of a DNA polymerase lacking exonuclease activity.

[0188] 17A. The method of any preceding clauses, wherein the at least one nucleic acid amplification step is performed in the presence of a DNA polymerase having strand displacement activity.17B. The method of clause 17 or clause 17A, wherein the DNA polymerase having strand displacement activity is selected from: Bst polymerase, Bst Large Fragment polymerase, Bsm polymerase, and GspSSD polymerase.

[0189] 18. The method of any of the preceding clauses, wherein the DNA polymerase with exonuclease activity is selected from: Phusion polymerase, Q5 polymerase, KOD polymerase, SuperFi polymerase, Vent polymerase, DeepVent polymerase, Pfu DNA Polymerase, Pfu Ultra II polymerase, KAPPA HiFi HotStart polymerase, and Tli DNA Polymerase.

[0190] 19. The method of clause 17A or 17B, wherein the DNA polymerase lacking exonuclease activity is a low-fidelity DNA polymerase.

[0191] 20. The method of any of the preceding clauses, wherein the specific product of step c. is a pre-exponential amplification product.

[0192] 21. The method of clause 20, wherein the pre-exponential amplification product is subjected to a loop-mediated amplification reaction (LAMP).

[0193] 22. The method of clause 16 or clause 21 , or any of clauses 17 to 20 when dependent on clause 16, wherein the loop mediated amplification reaction (LAMP) comprises:

[0194] contacting the specific product of step c. with a pair of nucleic acid primers comprising: (i) a fifth primer (loop forward primer) that is homologous or substantially homologous to a seventh sequence region of the first polynucleotide strand, said seventh sequence region being located between the first and the second sequence regions of the first polynucleotide strand (F2); and / or

[0195] (ii) a sixth primer (loop backward primer) that is complementary or substantially complementary to an eighth sequence region of the first polynucleotide strand, said eighth sequence region being located between the third and the fourth sequence regions of the first polynucleotide strand (B2).

[0196] 23. The method of any of the preceding clauses, wherein the distance between the second sequence region and the fourth sequence region of the first polynucleotide strand is between about 60 and 250 nucleotides, between about 100 and 200 nucleotides, or between about 130 and 170 nucleotides.

[0197] 24. The method of any of the preceding clauses, wherein performing the at least one nucleic acid amplification step on the target polynucleotide is performed over a time period of betweenabout 10 and 60 minutes, between about 12 and 50 minutes, between about 15 and 40 minutes, or between about 18 and 30 minutes.

[0198] 24A. The method of any of the preceding clauses, wherein the target polynucleotide comprises synthetic nucleotides.

[0199] 25. The method of any of the preceding clauses, wherein the sample is obtained from a biological sample obtained from a subject.

[0200] 25A. The method of clause 25, wherein the subject is selected from the group consisting of: mammal, rodent, primate, human, monkey, rabbit, sheep, rat, or mouse.

[0201] 26. The method of clause 25 or clause 25A, wherein the biological sample comprises a human bodily fluid.

[0202] 27. The method of clause 26, wherein the biological sample comprises human cells.

[0203] 27A. The method of any of the preceding clauses, wherein the target polynucleotide comprises a sequence of a gene, and optionally wherein the gene is associated with a disease or condition.

[0204] 27C. The method of clause 27A, wherein the disease or condition is selected from: B-thalassemia, sickle cell disease, hereditary spherocytosis, Fanconi anaemia, and Haemophilia A and B, and cancer.

[0205] 28. The method of any of the preceding clauses, wherein the biological sample comprises human fibroblast cells.

[0206] 29. The method of any of the preceding clauses, wherein the biological sample comprises human cancer cells.

[0207] 30. The method of any of the preceding clauses, wherein the variant polynucleotide comprises at least a portion of the epidermal growth factor receptor (EGFR) gene.

[0208] 31. The method of clause 30, wherein the one or more nucleotide mutation is T790M in the EGFR gene.32. The method of any of the preceding clauses, wherein the ddNTP is dideoxycytosine triphosphate (ddCTP), dideoxyguanosine triphosphate (ddGTP) or dideoxyadenosine triphosphate (ddATP).

[0209] 33. The method of any of the preceding clauses, wherein the melting point of the first primer is within approx. 6°C of the melting point of the second primer, within approx. 5°C of the melting point of the second primer, within approx. 4°C of the melting point of the second primer, within approx.

[0210] 3°C of the melting point of the second primer, within approx. 2°C of the melting point of the second primer, within approx. 1°C of the melting point of the second primer, or is approx, the same as the melting point of the second primer.

[0211] 33A. The method of clause 3, or of any of clauses 4 to 33 when dependent on clause 3, wherein the melting point of the third primer is within approx. 6°C of the melting point of the fourth primer, within approx. 5°C of the melting point of the fourth primer, within approx. 4°C of the melting point of the fourth primer, within approx. 3°C of the melting point of the fourth primer, within approx. 2°C of the melting point of the fourth primer, within approx. 1°C of the melting point of the fourth primer, or is approx, the same as the melting point of the fourth primer.

[0212] 33B. The method of clause 22, or of any of clauses 23 to 33A when dependent on clause 22, wherein the melting point of the fifth primer is within approx. 6°C of the melting point of the sixth primer, within approx. 5°C of the melting point of the sixth primer, within approx. 4°C of the melting point of the sixth primer, within approx. 3°C of the melting point of the sixth primer, within approx.

[0213] 2°C of the melting point of the sixth primer, within approx. 1°C of the melting point of the sixth primer, or is approx, the same as the melting point of the sixth primer.

[0214] 33C. The method of any of clauses 33 to 33B, wherein the melting points of all of the primers are within a range of approx. 6°C, within a range of approx. 5°C, within a range of approx. 4°C, within a range of approx. 3°C, within a range of approx. 2°C, within a range of approx. 1°C, or are approx, the same.

[0215] 33D. The method of any of the preceding clauses, wherein the nucleic acid amplification step comprises an incubation at about 20 to 80°C, about 25 to 72°C, about 30 to 70°C, or about 40 to 60°C.

[0216] 34. The method of any of the preceding clauses, wherein the amplification step is carried out for between about 5 and 60 minutes, between about 10 and 45 minutes, or between about 15 and 30 minutes.35. The method of any of the preceding clauses, wherein performing at least one nucleic acid amplification step comprises a final step of incubating the reaction mixture at a temperature of between 55 and 75 °C, or between about 60 and 70°C.

[0217] 36. The method of clause 35, wherein the final step of incubating the reaction mixture is carried out for a period of between about 5 and 60 minutes, between about 10 and 45 minutes, or between about 15 and 30 minutes.

[0218] 37. The method according to any of the preceding clauses, wherein the primers are used at a concentration in the reaction mixture of between:

[0219] about 250 to 2000 nM, about 500 to 1500 nM, or about 750 to 1000 nM for the first primer; and / or

[0220] about 250 to 2000 nM, about 500 to 1500 nM, or about 750 to 1000 nM for the second primer.

[0221] 37A. The method according to clause 2 or clause 3, or any of clauses 4 to 37, when dependent on clause 2 or clause 3, wherein the primers are used at a concentration in the reaction mixture of between:

[0222] about 20 to 300 nM, about 100 to 250 nM, or about 150 to 200 nM for the third primer; and / or

[0223] about 20 to 300 nM, about 100 to 250 nM, or about 150 to 200 nM for the fourth primer.

[0224] 37B. The method according to clause 22, or any of clauses 23 to 37A, when dependent on clause 22, wherein the primers are used at a concentration in the reaction mixture of between:

[0225] about 80 to 600 nM, about 200 to 500 nM, or about 300 to 400 nM forthe fifth primer; and / or about 80 to 600 nM, about 200 to 500 nM, or about 300 to 400 nM for the sixth primer.

[0226] 38. The method of any of the preceding clauses, which is for any one or more of: identifying a gene mutation (e.g. a pathogenic gene), diagnosing a disease or condition, determining a risk of developing a disease or condition, disease prognosis, disease prediction, tracking disease inheritance, predicting susceptibility to environmental factors, predicting responsiveness to pharmaceutical drugs or other agents, and differentiating between biological samples or organisms (e.g. bacterial strains).

[0227] 39. A method for diagnosing a disease or condition, determining a risk of developing a disease or condition disease prognosis, tracking disease inheritance, predicting susceptibility to environmental factors, predicting responsiveness to pharmaceutical drugs or other agents, ordifferentiating between biological samples or organisms (e.g. bacterial strains), the method comprising:

[0228] a. providing a sample comprising at least one target polynucleotide, wherein the target polynucleotide includes at least a first polynucleotide strand and optionally a second polynucleotide strand complementary to the first polynucleotide strand, and wherein the first polynucleotide strand includes a nucleic acid sequence which has, is expected to have, or may have a sequence portion comprising one or more nucleotide mutations characteristic of the disease or condition;

[0229] b. contacting the sample with a DNA polymerase having exonuclease activity and a set of nucleic acid primers, the set of nucleic acid primers comprising:

[0230] a first primer (FIR) comprising

[0231] (i) a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and

[0232] (ii) a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c), said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand, and wherein the second sequence region comprises the sequence portion that has, is expected to have, or may have the one or more nucleotide mutations; and

[0233] a second primer (BIP) comprising

[0234] (i) a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and

[0235] (ii) a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2), said fourth sequence region being located 5’ of the third sequence region,

[0236] wherein the first primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and wherein the first primer is configured to anneal to the second sequence region such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the first polynucleotide strand, align with nucleotides within the six 3’ terminal nucleotides of the first primer;

[0237] c. performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers and the DNA polymerase to synthesise a specific product having a sequence comprising a portion of the target polynucleotide; and

[0238] d. detecting the presence or absence of the specific product of the nucleic acid amplification step, wherein the presence or absence of the specific product is indicative of the presence or absence of the sequence portion comprising one or more nucleotide mutations characteristic of the disease or condition.39A. A method for diagnosing a disease or condition, determining a risk of developing a disease or condition disease prognosis, tracking disease inheritance, predicting susceptibility to environmental factors, predicting responsiveness to pharmaceutical drugs or other agents, or differentiating between biological samples or organisms (e.g. bacterial strains), the method comprising:

[0239] a. providing a sample comprising at least one target polynucleotide, wherein the target polynucleotide includes at least a first polynucleotide strand and optionally a second polynucleotide strand complementary to the first polynucleotide strand, and wherein the first polynucleotide strand includes a nucleic acid sequence which has, is expected to have or may have a sequence portion comprising one or more nucleotide mutations characteristic of the disease or condition;

[0240] b. contacting the sample with a DNA polymerase having exonuclease activity and a set of nucleic acid primers, the set of nucleic acid primers comprising:

[0241] a first primer (FIR) comprising

[0242] (i) a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and

[0243] (ii) a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c), said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand; and

[0244] a second primer (BIP) comprising

[0245] (i) a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and

[0246] (ii) a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2) so as to anneal to a second polynucleotide strand at the sequence complementary to the fourth sequence region, said fourth sequence region being located 5’ of the third sequence region, and wherein the fourth sequence region comprises the one or more nucleotide mutations;

[0247] wherein the second primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and wherein the second primer is configured to anneal to the second polynucleotide strand at the sequence complementary to the fourth sequence region such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the first polynucleotide strand, align with nucleotides within the six 3’ terminal nucleotides of the second primer;

[0248] c. performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers and the DNA polymerase to synthesise a specific product having a sequence comprising a portion of the target polynucleotide; andd. detecting the presence or absence of the specific product of the nucleic acid amplification step, wherein the presence or absence of the specific product is indicative of the presence or absence of the sequence portion comprising one or more nucleotide mutations characteristic of the disease or condition.

[0249] 40. The method of clause 39 or clause 39A, wherein the disease or condition is selected from: B-thalassemia, sickle cell disease, hereditary spherocytosis, Fanconi anaemia, and Haemophilia A and B, and cancer.

[0250] 41. The method of any of the preceding clauses, wherein the method is performed in vitro.

[0251] 42. The method of any of clauses 39 to 41 , further comprising the features of any of clauses 1B to 38.

[0252] 42A. The method of any of the preceding clauses, wherein the first primer (FIP) comprises a sequence comprising, consisting of, or consisting essentially of:

[0253] (i) TTCCCGGACATAGTCCAGGAGGTCCACCGTGCAGCTCATCA (SEQ ID NO: 1); (ii) a sequence at least 90%, at least 95%, at least 98% or 100% identical to SEQ ID NO:

[0254] 1 ; and / or

[0255] (iii) a sequence comprising at least 30, at least 32, at least 34, at least 36, at least 38, or at least 40 consecutive nucleotides of the polynucleotide of (i) or (ii).

[0256] 42B. The method of any of the preceding clauses, wherein the second primer (BIP) comprises a sequence comprising, consisting of, or consisting essentially of:

[0257] (i) ATTGGCTCCCAGTACCTGCTCACCGTATCTCCCTTCCCTGA (SEQ ID NO: 2); (ii) a sequence at least 90%, at least 95%, at least 98% or 100% identical to SEQ ID NO:

[0258] 2; and / or

[0259] (iii) a sequence comprising at least 30, at least 32, at least 34, at least 36, at least 38, or at least 40 consecutive nucleotides of the polynucleotide of (i) or (ii).

[0260] 42C. The method of any of the preceding clauses, wherein the primer set comprises a third primer (FOP), wherein the third primer comprises a sequence comprising, consisting of, or consisting essentially of:

[0261] (i) ATGGCCAGCGTGGACAA (SEQ ID NO: 3);

[0262] (ii) a sequence at least 90%, at least 95%, at least 98% or 100% identical to SEQ ID NO:

[0263] 3; and / or

[0264] (iii) a sequence comprising at least 12, at least 13, at least 14, at least 15, or at least 16 consecutive nucleotides of the polynucleotide of (i) or (ii).42D. The method of any of the preceding clauses, wherein the primer set comprises a fourth primer (BOP), wherein the fourth primer comprises a sequence comprising, consisting of, or consisting essentially of:

[0265] (i) TGGCTCCTTATCTCCCCTC (SEQ ID NO: 4);

[0266] (ii) a sequence at least 90%, at least 95%, at least 98% or 100% identical to SEQ ID NO:

[0267] 4; and / or

[0268] (iii) a sequence comprising at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleotides of the polynucleotide of (i) or (ii).

[0269] 42E. The method of any of the preceding clauses, wherein the primer set comprises a fifth primer (LF), wherein the fifth primer comprises a sequence comprising, consisting of, or consisting essentially of:

[0270] (i) AGCCGAAGGGCATGAGCTG (SEQ ID NO: 5);

[0271] (ii) a sequence at least 90%, at least 95%, at least 98% or 100% identical to SEQ ID NO:

[0272] 5; and / or

[0273] (iii) a sequence comprising at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleotides of the polynucleotide of (i) or (ii).

[0274] 42F. The method of any of the preceding clauses, wherein the primer set comprises a sixth primer (LB), wherein the sixth primer comprises a sequence comprising, consisting of, or consisting essentially of:

[0275] (i) ACTGGTGTGTGCAGATCGC (SEQ ID NO: 6);

[0276] (ii) a sequence at least 90%, at least 95%, at least 98% or 100% identical to SEQ ID NO:

[0277] 6; and / or

[0278] (iii) a sequence comprising at least 14, at least 15, at least 16, at least 17, or at least 18 consecutive nucleotides of the polynucleotide of (i) or (ii).

[0279] 42G. The method of any of clauses 1 to 42, wherein the first primer (FIP) comprises a sequence comprising, consisting of, or consisting essentially of:

[0280] (i) TTCCCGGACATAGTCCAGGAGGTCCACCGTGCAGCTCATCA-ddC (SEQ ID NO:

[0281] 7);

[0282] (ii) a sequence at least 90%, at least 95%, at least 98% or 100% identical to SEQ ID NO:

[0283] 7; and / or

[0284] (iii) a sequence comprising at least 30, at least 32, at least 34, at least 36, at least 38, or at least 40 consecutive nucleotides of the polynucleotide of (i) or (ii).42H. The method of any of clauses 1 to 42, wherein the first primer (FIR) comprises a sequence comprising, consisting of, or consisting essentially of:

[0285] (i) TTCCCGGACATAGTCCAGGAGGTCCACCGTGCAGCTCATCAC-ddG (SEQ ID NO:

[0286] 8);

[0287] (ii) a sequence at least 90%, at least 95%, at least 98% or 100% identical to SEQ ID NO:

[0288] 8; and / or

[0289] (iii) a sequence comprising at least 30, at least 32, at least 34, at least 36, at least 38, at least 40, or at least 42 consecutive nucleotides of the polynucleotide of (i) or (ii).

[0290] 42J. The method of any of clauses 1 to 42, wherein the first primer (FIP) comprises a sequence comprising, consisting of, or consisting essentially of:

[0291] (i) TTCCCGGACATAGTCCAGGAGGTCCACCGTGCAGCTCATCACGC-ddA (SEQ ID NO: 9);

[0292] (ii) a sequence at least 90%, at least 95%, at least 98% or 100% identical to SEQ ID NO:

[0293] 9; and / or

[0294] (iii) a sequence comprising at least 30, at least 32, at least 34, at least 36, at least 38, at least 40, at least 42 or at least 44 consecutive nucleotides of the polynucleotide of (i) or (ii).

[0295] 42K. The method of any of clauses 1 to 42, wherein the first primer (FIP) comprises a sequence comprising, consisting of, or consisting essentially of:

[0296] (i) TTCCCGGACATAGTCCAGGAGGTCCACCGTGCAGCTCATCACGCAGC-ddT (SEQ ID NO: 10);

[0297] (ii) a sequence at least 90%, at least 95%, at least 98% or 100% identical to SEQ ID NO:

[0298] 10; and / or

[0299] (iii) a sequence comprising at least 30, at least 32, at least 34, at least 36, at least 38, at least 40, at least 42, at least 44 or at least 46 consecutive nucleotides of the polynucleotide of (i) or (ii).

[0300] 43. A kit for detecting a nucleotide variant in a target nucleic acid sequence in a sample, the kit comprising a primer set as defined in any of clauses 1 to 42K or 50 to 66, optionally one or more reagents, and optionally instructions for use.

[0301] 44. The kit of clause 43, further comprising one or more reagents and / or enzymes for amplifying a polynucleotide in a sample, for example, using a LAMP technique.

[0302] 45. The kit of clause 43 or clause 44, wherein one or more of the reagents or primers is dried or lyophilised; preferably wherein each of the primers are dried or lyophilised.46. The kit of any of clauses 43 to 45, wherein the nucleotide variant is a single nucleotide polymorphism (SNP).

[0303] M . The kit of any of clauses 43 to 46, wherein the kit is for any one or more of identifying a gene mutation (e.g. a pathogenic gene), diagnosing a disease or condition, determining a risk of developing a disease or condition, disease prognosis, disease prediction, tracking disease inheritance, predicting susceptibility to environmental factors, predicting responsiveness to pharmaceutical drugs or other agents, and differentiating between biological samples or organisms (e.g. bacterial strains).

[0304] 48. The kit of any of clauses 43 to 47, wherein the kit is for diagnosing a disease or condition.

[0305] 49. The kit of clause 47 or clause 48, wherein the disease or condition is selected from: B-thalassemia, sickle cell disease, hereditary spherocytosis, Fanconi anaemia, and Haemophilia A and B, and cancer.

[0306] 50. A primer set for detecting a variant polynucleotide comprising one or more nucleotide mutations, wherein the variant polynucleotide includes at least a first polynucleotide strand including a nucleic acid sequence comprising the one or more nucleotide mutations and optionally a second polynucleotide strand complementary to the first polynucleotide strand, the primer set comprising:

[0307] a first primer (FIP) comprising

[0308] (i) a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and

[0309] (ii) a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c), said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand, and wherein the second sequence region comprises the one or more nucleotide mutations; and

[0310] a second primer (BIP) comprising

[0311] (i) a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and

[0312] (ii) a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2), said fourth sequence region being located 5’ of the third sequence region,wherein the first primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and wherein the first primer is configured to anneal to the second sequence region such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the variant polynucleotide, align with nucleotides within the six 3’ terminal nucleotides of the first primer.

[0313] 50A. A primer set for detecting a variant polynucleotide comprising one or more nucleotide mutations in a target polynucleotide, wherein the target polynucleotide includes at least a first polynucleotide strand including a nucleic acid sequence comprising the one or more nucleotide mutations and optionally a second polynucleotide strand complementary to the first polynucleotide strand, the primer set comprising:

[0314] a first primer (FIP) comprising

[0315] (i) a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and

[0316] (ii) a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c), said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand; and

[0317] a second primer (BIP) comprising

[0318] (i) a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and

[0319] (ii) a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2) so as to anneal to a second polynucleotide strand at the sequence complementary to the fourth sequence region, said fourth sequence region being located 5’ of the third sequence region, and wherein the fourth sequence region comprises the one or more nucleotide mutations;

[0320] wherein the second primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and wherein the second primer is configured to anneal to the second polynucleotide strand at the sequence complementary to the fourth sequence region such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the variant polynucleotide, align with nucleotides within the six 3’ terminal nucleotides of the second primer.

[0321] 51. The primer set of clauses 50 or clause 50A, wherein the set of nucleic acid primers further comprises a third primer (FOP) that is complementary or substantially complementary to a fifthsequence region of the first polynucleotide strand (F3c), said fifth sequence region being located 3’ of the second sequence region.

[0322] 52. The primer set of any of clauses 50 to 51 , wherein the set of nucleic acid primers further comprises a fourth primer (BOP) that is homologous or substantially homologous to a sixth sequence region of the first polynucleotide strand (B3), said sixth sequence region (B3) being located 5’ of the fourth sequence region.

[0323] 53. The primer set of any of clauses 50 to 52, wherein the set of nucleic acid primers further comprises:

[0324] a fifth primer (loop forward primer) that is homologous or substantially homologous to a seventh sequence region of the first polynucleotide strand, said seventh sequence region being located between the first and the second sequence regions of the first polynucleotide strand (F2).

[0325] 54. The primer set of any of clauses 50 to 53, wherein the set of nucleic acid primers further comprises:

[0326] a sixth primer (loop backward primer) that is complementary or substantially complementary to an eighth sequence region of the first polynucleotide strand, said eighth sequence region being located between the third and the fourth sequence regions of the first polynucleotide strand (B2).

[0327] 55. The primer set of any of clauses 50 to 54, wherein the one or more nucleotide mutations comprises upto 6 nucleotide mutations, upto 5 nucleotide mutations, upto 4 nucleotide mutations, up to 3 nucleotide mutations, or up to 2 nucleotide mutations; for example, 1 nucleotide mutation, 2 nucleotide mutations, 3 nucleotide mutations, 4 nucleotide mutations, 5 nucleotide mutations, or 6 nucleotide mutations.

[0328] 55A. The primer set of any of clauses 50 to 54, wherein the variant polynucleotide comprises a sequence of a gene.

[0329] 56. The primer set of any of clause 55, wherein the one or more nucleotide mutation represents a genetic mutation.

[0330] 57. The primer set of any of clauses 50 to 56, wherein the variant polynucleotide encompasses a single nucleotide polymorphism (SNP).58. The primer set of clause 50 or any of clauses 51 to 57 when dependent on clause 50, wherein the first primer is configured to anneal to the first polynucleotide strand such that the ddNTP at the 3’ terminal is aligned with the first polynucleotide strand:

[0331] within 6 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 5 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 4 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 3 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 2 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 1 nucleotide 5’ of at least one nucleotide mutation of the variant polynucleotide; or at a nucleotide mutation of the variant polynucleotide.

[0332] 59. The primer set of clause 50A or any of clauses 51 to 57 when dependent on clause 50A, wherein the second primer is configured to anneal to a second polynucleotide strand complementary to the first polynucleotide strand such that the ddNTP at the 3’ terminal is aligned with a nucleotide of the second polynucleotide strand:

[0333] within 6 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;

[0334] within 5 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;

[0335] within 4 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;

[0336] within 3 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;

[0337] within 2 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;

[0338] within 1 nucleotide 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand; or

[0339] at the position complementary to a nucleotide mutation in the first polynucleotide strand.

[0340] 60. The primer set of any of clauses 50 to 59, wherein the distance between the second sequence region and the fourth sequence region of the first polynucleotide strand is between about 80 and 400 nucleotides, between about 100 and 300 nucleotides, between about 110 and 280 nucleotides, between about 115 and 260 nucleotides, between about 120 and 240 nucleotides, between about 120 and 200 nucleotides, or between about 130 and 180 nucleotides.

[0341] 61. The primer set of any of clauses 50 to 60, wherein the ddNTP is dideoxycytosine triphosphate (ddCTP), dideoxyguanosine triphosphate (ddGTP) or dideoxyadenosine triphosphate (ddATP); optionally, wherein the ddNTP is dideoxycytosine triphosphate (ddCTP).62. The primer set of any of clauses 50 to 61 , wherein the melting point of the first primer is within approx. 6°C of the melting point of the second primer, within approx. 5°C of the melting point of the second primer, within approx. 4°C of the melting point of the second primer, within approx.

[0342] 3°C of the melting point of the second primer, within approx. 2°C of the melting point of the second primer, within approx. 1°C of the melting point of the second primer, or is approx, the same as the melting point of the second primer.

[0343] 63. The primer set of clause 52 when dependent on clause 51 , or of any of clauses 53 to 62 when dependent on clause 52, wherein the melting point of the third primer is within approx. 6°C of the melting point of the fourth primer, within approx. 5°C of the melting point of the fourth primer, within approx. 4°C of the melting point of the fourth primer, within approx. 3°C of the melting point of the fourth primer, within approx. 2°C of the melting point of the fourth primer, within approx. 1°C of the melting point of the fourth primer, or is approx, the same as the melting point of the fourth primer.

[0344] 64. The primer set of clause 54 when dependent on clause 53, or of any of clauses 55 to 63 when dependent on clause 54, wherein the melting point of the fifth primer is within approx. 6°C of the melting point of the sixth primer, within approx. 5°C of the melting point of the sixth primer, within approx. 4°C of the melting point of the sixth primer, within approx. 3°C of the melting point of the sixth primer, within approx. 2°C of the melting point of the sixth primer, within approx. 1°C of the melting point of the sixth primer, or is approx, the same as the melting point of the sixth primer.

[0345] 65. The primer set of any of clauses 50 to 64, wherein the melting points of all of the primers are within a range of approx. 6°C, within a range of approx. 5°C, within a range of approx. 4°C, within a range of approx. 3°C, within a range of approx. 2°C, within a range of approx. 1°C, or are approx, the same.

[0346] 66. The primer set of any of clauses 50 to 65, comprising one or more primer according to any of clauses 42A to 42K.

Claims

CLAIMS:

1. A method for detecting a variant polynucleotide comprising one or more nucleotide mutations in a target polynucleotide from a sample, the method comprising the steps of:a. providing a sample comprising a plurality of polynucleotide molecules comprising the target polynucleotide, wherein the target polynucleotide includes at least a first polynucleotide strand including a nucleic acid sequence comprising the one or more nucleotide mutations and optionally a second polynucleotide strand complementary to the first polynucleotide strand;b. contacting the sample with DNA polymerase having exonuclease activity and a set of nucleic acid primers, the set of nucleic acid primers comprising:a first primer (FIR) comprising(i) a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and(ii) a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c), said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand, and wherein the second sequence region comprises the one or more nucleotide mutations; and,a second primer (BIP) comprising(i) a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and(ii) a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2, said fourth sequence region being located 5’ of the third sequence region,wherein the first primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and wherein the first primer is configured to anneal to the second sequence region such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the variant polynucleotide, align with nucleotides within the six 3’ terminal nucleotides of the first primer;c. performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers and the DNA polymerase to synthesise a specific product having a sequence comprising a portion of the target polynucleotide; andd. detecting the presence or absence of the specific product of the nucleic acid amplification step, wherein the presence or absence of the specific product is indicative of the presence or absence of the variant polynucleotide.

2. The method of claim 1 , wherein the set of nucleic acid primers further comprises a third primer (FOP) that is complementary or substantially complementary to a fifth sequence region of the first polynucleotide strand (F3c), said fifth sequence region being located 3’ of the second sequence region.

3. The method of any of claims 1 to 2, wherein theset of nucleic acid primers further comprises a fourth primer (BOP) that is homologous or substantially homologous to a sixth sequence region of the first polynucleotide strand (B3), said sixth sequence region (B3) being located 5’ of the fourth sequence region.

4. The method of any of the preceding claims, wherein the target polynucleotide comprises a sequence of a gene.

5. The method of any of the preceding claims, wherein the one or more nucleotide mutations comprises one or more insertion, deletion or substitution in comparison to the corresponding wildtype nucleotide sequence.

6. The method of any of the preceding claims, wherein the variant polynucleotide encompasses a single nucleotide polymorphism (SNP).

7. The method of any of the preceding claims, wherein providing a sample comprising a plurality of polynucleotide molecules comprising the target polynucleotide of step a comprises obtaining a biological sample and extracting polynucleotides from the biological sample to obtain the sample comprising the plurality of polynucleotide molecules comprising the target polynucleotide.

8. The method of any of the preceding claims, wherein the first primer is configured to anneal to the first polynucleotide strand such that the ddNTP at the 3’ terminal is aligned with the first polynucleotide strand:within 6 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 5 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 4 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 3 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 2 nucleotides 5’ of at least one nucleotide mutation of the variant polynucleotide; within 1 nucleotide 5’ of at least one nucleotide mutation of the variant polynucleotide; or at a nucleotide mutation of the variant polynucleotide.

9. The method of any of the preceding claims, wherein the second primer is configured to anneal to a second polynucleotide strand complementary to the first polynucleotide strand such that the ddNTP at the 3’ terminal is aligned with a nucleotide of the second polynucleotide strand:within 6 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;within 5 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;within 4 nucleotides5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;within 3 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;within 2 nucleotides 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand;within 1 nucleotide 5’ of the position complementary to a nucleotide mutation in the first polynucleotide strand; orat the position complementary to a nucleotide mutation in the first polynucleotide strand.

10. The method of claim 8, wherein the ddNTP inhibits the synthesis of a specific product comprising the wild-type polynucleotide sequence lacking the one or more nucleotide mutation.

11. The method of claim 9, wherein the ddNTP inhibits the synthesis of a specific product comprising the one or more nucleotide mutation.

12. The method of any of the preceding claims, wherein performing at least one nucleic acid amplification step on the target polynucleotide in the presence of the set of nucleic acid primers and the DNA polymerase having exonuclease activity, comprises contacting the sample with a reaction mixture containing the set of primers with the DNA polymerase under conditions suitable to perform DNA synthesis and / or amplification.

13. The method of any of the preceding claims, wherein the exonuclease activity of the DNA polymerase with exonuclease activity is a 3’ to 5’ exonuclease activity.

14. The method of any of the preceding claims, wherein the at least one nucleic acid amplification step comprises a loop-mediated amplification reaction (LAMP).

15. The method of any of the preceding claims, wherein the loop mediated amplification reaction (LAMP) comprises:contacting the specific product of step c. with a pair of nucleic acid primers comprising:(i) a fifth primer (loop forward primer) that is homologous or substantially homologous to a seventh sequence region of the first polynucleotide strand, said seventh sequence region being located between the first and the second sequence regions of the first polynucleotide strand (F2); and / or(ii) a sixth primer (loop backward primer) that is complementary or substantially complementary to an eighth sequence region of the first polynucleotide strand, said eighth sequence region being located between the third and the fourth sequence regions of the first polynucleotide strand (B2).

16. The method of any of the preceding claims, wherein the sample is obtained from a biological sample obtained from a subject, wherein the subject is selected from the group consisting of: mammal, rodent, primate, human, monkey, rabbit, sheep, rat, or mouse.

17. The method of any of the preceding claims, wherein the target polynucleotide comprises a sequence of a gene, and optionally wherein the gene is associated with a disease or condition.

18. The method of claim 17, wherein the disease or condition is selected from: B-thalassemia, sickle cell disease, hereditary spherocytosis, Fanconi anaemia, and Haemophilia A and B, and cancer.

19. The method of any of the preceding claims, wherein the ddNTP is dideoxycytosine triphosphate (ddCTP), dideoxyguanosine triphosphate (ddGTP) or dideoxyadenosine triphosphate (ddATP).

20. The method of any of the preceding claims, which is for any one or more of: identifying a gene mutation (e.g. a pathogenic gene), diagnosing a disease or condition, determining a risk of developing a disease or condition, disease prognosis, disease prediction, tracking disease inheritance, predicting susceptibility to environmental factors, predicting responsiveness to pharmaceutical drugs or other agents, and differentiating between biological samples or organisms (e.g. bacterial strains).

21. A primer set for detecting a variant polynucleotide comprising one or more nucleotide mutations, wherein the variant polynucleotide includes at least a first polynucleotide strand including a nucleic acid sequence comprising the one or more nucleotide mutations and optionally a second polynucleotide strand complementary to the first polynucleotide strand, the primer set comprising:a first primer (FIP) comprising(i) a 5’ portion (F1c) that is homologous or substantially homologous to a first sequence region of the first polynucleotide strand (F1c), and(ii) a 3' end portion (F2) that is complementary or substantially complementary to a second sequence region of the first polynucleotide strand (F2c), said second sequence region being located 3’ of the first sequence region of the first polynucleotide strand, and wherein the second sequence region comprises the one or more nucleotide mutations; anda second primer (BIP) comprising(i) a 5' portion (B1c) that is complementary or substantially complementary to a third sequence region of the first polynucleotide strand (B1), said third sequence region being located 5’ of the first sequence region, and(ii) a 3' end portion (B2) that is homologous or substantially homologous to a fourth sequence region of the first polynucleotide strand (B2), said fourth sequence region being located 5’ of the third sequence region,wherein the first primer has a ddNTP (dideoxynucleotide triphosphate) at the 3’ terminal, and wherein the first primer is configured to anneal to the second sequence region such that the one or more nucleotide mutations, or one or more wild-type nucleotides at corresponding positions to those of the one or more nucleotide mutations in the variant polynucleotide, align with nucleotides within the six 3’ terminal nucleotides of the first primer.

22. The primer set of claim 21 , wherein the set of nucleic acid primers further comprises a third primer (FOP) that is complementary or substantially complementary to a fifth sequence region of the first polynucleotide strand (F3c), said fifth sequence region being located 3’ of the second sequence region.

23. The primer set of claim 21 , wherein the set of nucleic acid primers further comprises a fourth primer (BOP) that is homologous or substantially homologous to a sixth sequence region of the first polynucleotide strand (B3), said sixth sequence region (B3) being located 5’ of the fourth sequence region.

24. A kit for detecting a nucleotide variant in a target nucleic acid sequence in a sample, the kit comprising a primer set as defined in claim 21 , optionally one or more reagents, and optionally instructions for use.

25. The kit of claim 24, further comprising one or more reagents and / or enzymes for amplifying a polynucleotide in a sample, for example, using a LAMP technique.

Images