Ocular diseases

Abstract

The invention relates to RNA-cell delivery molecule complex, and its use in treating or preventing one or more ocular diseases or disorders. More particularly, the invention relates to a cell-penetrating peptide complexed with mRNA encoding decorin and / or siRNA targeting vascular endothelial growth factor (VEGF), and its use in treating or 5 preventing one or more ocular diseases or disorders. To be published with Figure 10.

Description

[0001] OCULAR DISEASES

[0002] FIELD OF INVENTION

[0003] The invention relates to RNA-cell delivery molecule complex, and its use in treating or preventing one or more ocular diseases or disorders. More particularly, the invention relates to a cell-penetrating peptide complexed with mRNA encoding decorin and / or siRNA targeting vascular endothelial growth factor (VEGF), and its use in treating or preventing one or more ocular diseases or disorders.

[0004] BACKGROUND

[0005] Ocular disease is a collective term for disorders affecting the eye and can include all types of age-related macular degeneration (AMD), glaucoma, diabetic retinopathy and proliferative vitreoretinopathy (PVR). Other diseases may include dry eye disease (DED), ocular surface disease, conjunctival scarring, corneal scarring, keratoconus, Fuchs Endothelial Corneal Dystrophy, retinopathies, and meibomian gland disease. The pathophysiology for each disease can be unique but often share common pathologies including fibrosis, cellular dysfunction, inflammation and, loss of tissue homeostatic mechanisms including autophagy and oxidative stress [1], [2],

[0006] For example, approximately 196 million people worldwide are affected with AMD which is predicted to dramatically rise to 288 million by 2040 [3], In the UK, AMD has a socio-economic cost of £16bn / year with 600,000 patients. AMD can be categorised into early, dry (non-vascular) AMD, geographic atrophy (GA) and advanced neovascular AMD (nAMD). Dry AMD is progressive and characterised by chronic low-level inflammation and subretinal drusen depositions [4], Dry AMD can progress to widespread irreversible retinal pigment epithelium (RPE) and photoreceptor degeneration, which is defined as GA. Unfortunately, there are currently no approved treatments for dry AMD and an urgent need for novel therapeutics. In ~10% of patients, dry AMD can progress to the more aggressive form called nAMD, where abnormal choroidal blood vessels grow into the macula, resulting in choroidal neovascularisation (CNV), oedema and retinal fibrosis with rapid loss of central vision. At present, nAMD patients are treated with long-term, frequent (often monthly) intraocular injections of therapies targeting vascular endothelial growth factor (VEGF) (i.e. bevacizumab, antibody targeting VEGF-A; aflibercept, VEGF cytokine trap; ranibizumab, antibody targeting all VEGF isoforms) [5] or laser photocoagulation therapy, which aim toprevent angiogenesis and stabilise vision loss. Crucially, these treatments do not restore lost vision due to targeting pathophysiology late in the disease progression. Moreover, most patients become unresponsive with long-term anti-VEGF treatment after 7 years and develop retinal atrophy [6], Furthermore, regular intraocular injections can be unpleasant for the patient and pose complication risks including uveitis, endophthalmitis, subconjunctival haemorrhage, elevated intraocular pressure and retinal detachment alongside compliance issues [7], [8], For the ~90% of patients presenting with dry AMD, there are currently no therapeutic agents wherein only lifestyle modifications may slow the progression of the disease, but this is not capable of mitigating or reversing further damage [9], The prevalence of early and intermediate AMD is ~20% in people aged over 65 years; treatment of the early dry disease would prevent the progression to the more aggressive and debilitating nAMD.

[0007] Glaucoma is the leading cause of irreversible blindness, affecting >50 million people worldwide

[0010] , The main risk factor for primary open angle glaucoma (POAG), the most prevalent form of glaucoma, is a sustained increase in intraocular pressure (IOP) leading to irreversible damage to the optic nerve head and visual loss. Pressure builds within the eye due to reduced drainage of fluid (aqueous humour; AqH), usually resulting from scarring of the trabecular meshwork (TM), the eye’s main drainage site. Ultimately, increased IOP irreversibly damages retinal cells (retinal ganglion cells; RGC) causing blindness. People with POAG need lifelong care in order to monitor the progression of visual damage. In the UK, the total annual cost of glaucoma is £520 million (Association of Optometrists (aop.org.uk; accessed 9thJanuary 2025)). The most common treatments for glaucoma are eye drops used to lower IOP by either attempting to increase drainage (e.g. prostaglandin analogues) or decrease AqH production (e.g. beta-blockers). However, current therapies do not target the underlying cause (TM scarring), and hence only provide limited symptomatic relief. Often these, eye drop therapies fail as the disease progresses, and at this point patients require surgical interventions to either remove the scarred TM from the eye or to have a shunt put in the eye to artificially drain AqH. Surgery can exacerbate the disease leading to further ocular inflammation and worse scarring. There is extensive literature supporting the role of excessive extracellular matrix (ECM) deposition and dysfunctional TM cells in patients with POAG

[0011] ,

[0012] , and has been linked to higher levels of transforming growth factor β (TGF-β)

[0013] , Despite all this evidence, standard eye drop treatments currently do not target the diseased TM, they act on altering the production of AqH orby increasing outflow through the uveoscleral pathways. Sadly, over time these therapies often fail to control IOP and surgical interventions are required. More recently, Rho Kinase inhibitors have been approved for patient use as a first-in-class medication to target TM cell contractility

[0014] ,

[0008] Diabetic retinopathy is the most common microvascular complication associated with diabetes

[0015] , Globally, around one-third of people with diabetes are affected by diabetic retinopathy. Projections indicate that the number of individuals with this condition will rise from 127 million in 2010 to 191 million by 2030

[0016] , In the UK alone, 144,000 patients present with clinical diabetic retinopathy. After two decades of living with type 1 diabetes, nearly all patients develop some form of retinopathy, as do over 80% of type 2 diabetes patients on insulin and about half of those who are not insulin-dependent

[0017] ,

[0018] , According to the World Health Organization (WHO), diabetic retinopathy is responsible for 15–17% of blindness cases in both Europe and the USA

[0019] , This condition can generally be divided into two stages based on the severity of microvascular deterioration and ischemic damage: non-proliferative diabetic retinopathy (NPDR) and the more severe proliferative diabetic retinopathy (PDR). Elevated VEGF levels in the eye fluids of diabetic patients have been observed

[0020] , and anti-VEGF medications have shown success in treating complications like diabetic macular oedema (DMO)

[0021] , Additionally, diabetic retinopathy is associated with ECM dysfunction and fibrosis, where high glucose levels commonly seen in diabetes contribute to fibrosis in retinal cells and tissues

[0021] ,

[0009] Proliferative vitreoretinopathy (PVR) is the leading cause of failure in repairing rhegmatogenous retinal detachment (RRD). This condition is marked by the formation and contraction of cellular membranes within the vitreous cavity and on both sides of the retina, along with intraretinal fibrosis. The intraretinal fibrosis may hinder the retina from properly flattening, even if all membranes are removed. PVR is estimated to occur in 5–10% of all retinal detachment cases

[0022] , Approximately 77% of postoperative cases of proliferative vitreoretinopathy (PVR) occur within one month following retinal detachment surgery, with 95% appearing within 45 days

[0022] , Several risk factors have been identified for PVR development, most of which are linked to the dispersion of RPE cells into the vitreous or disruption of the blood-ocular barrier. Preoperative risk factors include extended intraocular inflammation, previous infectious retinitis, reduced intraocular pressure due to inflammation, and vitreous haemorrhage

[0022] , Proliferativevitreoretinopathy (PVR) manifests through a series of inflammatory and fibrotic processes. After RRD, ECM components, including proteoglycans, collagen, and fibronectin, accumulate, resulting in the formation of PVR epiretinal membranes. This ECM and fibrotic profile in PVR appears distinct from that observed in PDR and cases of penetrating ocular trauma. For example, PVR membranes have notably higher levels of fibronectin than those in PDR, with more pronounced proliferation of retinal and immune cells. Additionally, eyes with either pre-existing or established PVR face a significantly increased risk of heightened retinal inflammation and fibrosis after subsequent vitreoretinal surgeries, further setting PVR apart in its clinical progression and response to surgical intervention

[0023] ,

[0010] Delivery of therapeutics to the retina at efficacious doses is essential for the treatment of retinal diseases such as those described above (AMD, diabetic retinopathy, PVR). However, the eye has complex barriers to maintain its immune privilege and prevent infection. These same barriers also pose difficulties for delivering therapeutic agents to the posterior segment of the eye. Non-invasive delivery by topical administration is a favourable alternative to intravitreal injections, but penetration of these ocular barriers remains a huge obstacle in the successful development of new treatments. Topically administered therapeutic agents can become diluted in the tear film and cleared through conjunctival blood vessels

[0038] , These compounds need to transverse multiple corneal layers and there are tight junctions between the corneal epithelium which prevents hydrophilic molecules from penetrating the tissue. The stromal layer has highly organised and intertwined collagen fibres with a narrow pore size which prevents the penetration of larger molecules. Less than 5% of topically delivered treatments reach the anterior segment and considerably less reaches the retina

[0038] , Additionally, there are drug transporters within the iris-ciliary body which actively eliminate the drug and reduce its bioavailability. The drug must then diffuse through the vitreous and penetrate the multiple retinal layers to reach the RPE and the choroid at a therapeutic dose. The physical and biochemical barriers in the eye are massive hurdles to overcome but knowledge surrounding the features and interactions with drug delivery agents aid their development and successful translation.

[0011] Therapeutic agents delivered systemically must pass through the blood–retinal barrier (BRB). The outer BRB is formed from tight junctions between RPE, fenestrated choroid endothelial cells and Bruch's membrane and prevents invading pathogens, circulatingcells and molecules from freely entering the retina as well as retinal antigens from entering into the circulation and activating the adaptive immune response. The inner BRB is composed of tight junctions between retinal capillary endothelial cells and regulates the movement of molecules into the inner retina. In normal tissue, the BRB is intact and endogenous ‘alarmins’ are unlikely to be detected by circulating or choroidal antigen presenting cells (APCs), but, in AMD the outer BRB can become disrupted and leaky as the RPE degenerate, allowing antigen movement and activation of the immune response

[0038] , This barrier breakdown may also potentially allow access of systemically delivered therapeutic agents into the eye.

[0012] Delivering topical therapeutic agents is highly advantageous from a patient wellbeing and compliance perspective but also permits self-administration thus reduced healthcare costs and opportunities for greater dosing regimens.

[0013] There is therefore a need for new and improved treatments for these ocular diseases, and improved methods of delivery of therapeutics to the eye to treat such ocular diseases.

[0014] SUMMARY OF INVENTION

[0015] In a first aspect, the invention provides an RNA-cell delivery molecule complex for use in treating or preventing one or more ocular diseases or disorders. The complex may comprise one or more RNA molecule.

[0016] The cell delivery molecule may be a peptide or a liposome.

[0017] In another aspect, there is provided a method of treating or preventing one or more ocular diseases or disorders, comprising administering a therapeutically effective amount of an RNA-cell delivery molecule complex described in the first aspect of the invention, to a subject in need thereof.

[0018] In another aspect, there is provided the use of an RNA-cell delivery molecule complex described in the first aspect of the invention for the manufacture of a medicament for treating or preventing one or more ocular diseases or disorders in a subject.The RNA-cell delivery molecule complex may be provided as a nanoparticle, and / or in a composition. A composition may be a pharmaceutical composition, which may optionally include one or more pharmaceutically acceptable excipients, such as trehalose.

[0019] Peptide

[0020] The peptide of the complex may be a cell-penetrating peptide.

[0021] The peptide may comprise or consist of the amino acid sequence:

[0022] (Xl)a-(X2)b-LYRLFRKS-(X3)c-(X4)d-(X5)e-NLKPFERHARAC, in which

[0023] a is 0 or 1 and, if a is 1, XI is selected from an alanine residue, a valine residue or a glycine residue;

[0024] b is independently 0 or 1 and, if b is 1, X2 is selected from an alanine residue, a valine residue or a glycine residue;

[0025] c is independently 0 or 1 and, if c is 1, then X3 is an aromatic residue selected from a histidine or a tryptophan residue;

[0026] d is 1 and X4 is an aromatic residue selected from a tryptophan or a histidine residue;

[0027] e is 1 and X5 is a histidine or a tryptophan residue.

[0028] The peptide comprises a consensus sequence of two parts, ‘LYRLFRKS’ and ‘NLKPFER’, separated by other amino acids for functionality as a cell-penetrating peptide.

[0029] The peptide may comprise a minimum of four alanine residues. This improves hydrophobicity and allows the peptide to readily pass the cell membrane.

[0030] The inclusion of a minimum of three aromatic residues improves hydrophobic interaction with cell membranes.

[0031] The inclusion of a minimum of two histidine residues to enhance conditional endosomal escape.

[0032] The inclusion of one cysteine residue at the C-terminus helps to enhance stability and cargo release once inside a cell.The inclusion of a proline residue enhances cellular entry and safety.

[0033] In an embodiment, X3 is a tryptophan and X4 is a histidine. Alternatively or additionally, c is 0 and X3 is absent.

[0034] The peptide may comprise or consist of the amino acid sequence AALYRLFRKSWHNLKPFERHARAC (SEQ ID NO: 1), or a salt or amide thereof. This peptide is also referred to as HAWC herein.

[0035] RNA molecules

[0036] The one or more RNA molecule of the complex may encode a protein which is known to provide a therapeutic benefit to one or more ocular diseases.

[0037] The one or more RNA molecule may encode all or part of the human decorin protein.

[0038] The one or more RNA molecule may comprise or consist of the sequence AUGAAGGCCACUAUCAUCCUCCUUCUGCUUGCACAAGUUUCCUGGGCUGG ACCGUUUCAACAGAGAGGCUUAUUUGACUUUAUGCUAGAAGAUGAGGCUU CUGGGAUAGGCCCAGAAGUUCCUGAUGACCGCGACUUCGAGCCCUCCCUA GGCCCAGUGUGCCCCUUCCGCUGUCAAUGCCAUCUUCGAGUGGUCCAGUG UUCUGAUUUGGGUCUGGACAAAGUGCCAAAGGAUCUUCCCCCUGACACAA CUCUGCUAGACCUGCAAAACAACAAAAUAACCGAAAUCAAAGAUGGAGAC UUUAAGAACCUGAAGAACCUUCACGCAUUGAUUCUUGUCAACAAUAAAAU UAGCAAAGUUAGUCCUGGAGCAUUUACACCUUUGGUGAAGUUGGAACGAC UUUAUCUGUCCAAGAAUCAGCUGAAGGAAUUGCCAGAAAAAAUGCCCAAA ACUCUUCAGGAGCUGCGUGCCCAUGAGAAUGAGAUCACCAAAGUGCGAAA AGUUACUUUCAAUGGACUGAACCAGAUGAUUGUCAUAGAACUGGGCACCA AUCCGCUGAAGAGCUCAGGAAUUGAAAAUGGGGCUUUCCAGGGAAUGAAG AAGCUCUCCUACAUCCGCAUUGCUGAUACCAAUAUCACCAGCAUUCCUCA AGGUCUUCCUCCUUCCCUUACGGAAUUACAUCUUGAUGGCAACAAAAUCA GCAGAGUUGAUGCAGCUAGCCUGAAAGGACUGAAUAAUUUGGCUAAGUUG GGAUUGAGUUUCAACAGCAUCUCUGCUGUUGACAAUGGCUCUCUGGCCAA CACGCCUCAUCUGAGGGAGCUUCACUUGGACAACAACAAGCUUACCAGAG UACCUGGUGGGCUGGCAGAGCAUAAGUACAUCCAGGUUGUCUACCUUCAU AACAACAAUAUCUCUGUAGUUGGAUCAAGUGACUUCUGCCCACCUGGACA CAACACCAAAAAGGCUUCUUAUUCGGGUGUGAGUCUUUUCAGCAACCCGGUCCAGUACUGGGAGAUACAGCCAUCCACCUUCAGAUGUGUCUACGUGCGC UCUGCCAUUCAACUCGGAAACUAUAAGUAA (SEQ ID NO: 2), or a sequence with at least 90%, such as at least 95%, at least 98%, or at least 99%, homology thereto.

[0039] The one or more RNA may be isolated, engineered and / or synthetically produced.

[0040] The one or more RNA molecule may comprise or consist of one or more siRNA. The one or more siRNA may target human VEGF. The one or more siRNA may comprise or consist of the sequence AUGUGAAUGCAGACCAAAGAA (SEQ ID NO: 3) and / or UUCUUUGGUCUGCAUUCACAU (SEQ ID NO: 4).

[0041] The peptide may be complexed with all of SEQ ID NOs: 2-4.

[0042] There is provided a peptide of SEQ ID NO: 1 in complex with one or more RNA molecule of SEQ ID NO: 2.

[0043] There is also provided a peptide of SEQ ID NO:1 in complex with one or more RNA molecule of each of SEQ ID NOs: 3 and 4.

[0044] There is also provided a peptide of SEQ ID NO:1 in complex with one or more RNA molecule of each of SEQ ID NOs: 2-4.

[0045] Ocular diseases

[0046] The one or more ocular diseases or disorders may be any which is associated with fibrosis, extracellular matrix dysfunction, and / or which is associated with oxidative stress.

[0047] The one or more ocular diseases or disorders may be selected from age-related macular degeneration (AMD), glaucoma, diabetic retinopathy, proliferative vitreoretinopathy (PVR), or ocular surface disease such as corneal scarring, dry eye disease (DED), conjunctival scarring, keratoconus, Fuchs Endothelial Corneal Dystrophy, retinopathies, and meibomian gland disease.

[0048] The AMD can be any type of AMD, such as wet AMD or dry AMD.In another aspect, the invention provides a complex comprising an RNA sequence of SEQ ID NO: 3 and / or SEQ ID NO: 4, and a peptide of SEQ ID NO: 1, or a salt or amide thereof.

[0049] In another aspect, the invention provides a complex comprising an RNA sequence of SEQ ID NO: 2, and a peptide of SEQ ID NO: 1, or a salt or amide thereof.

[0050] In another aspect, the invention provides a complex comprising an RNA sequence of SEQ ID NO: 3 and / or SEQ ID NO: 4, an RNA sequence of SEQ ID NO: 2, and a peptide of SEQ ID NO: 1, or a salt or amide thereof.

[0051] The complex of the above three aspects may be provided in a composition,

[0052] In another aspect, there is provided a method of delivering an anionic cargo, such as one or more RNA molecule, to a cell, comprising administering an RNA-cell delivery molecule complex described in the first aspect of the invention to a cell.

[0053] In another aspect, there is provided a provided a method of inducing an immune response in a subject in need thereof, comprising administering an RNA-cell delivery molecule complex described in the first aspect of the invention to the subject.

[0054] In another aspect, there is provided an RNA-cell delivery molecule complex described in the first aspect of the invention for use in inducing an immune response in a subject in need thereof.

[0055] The invention is based on the finding that a cell delivery molecule such as a peptide complexed with certain RNA molecules is effective in treating or preventing key cellular activities resulting in ocular diseases.

[0056] More specifically, the inventors have exemplified that they are unexpectedly able to deliver therapeutic amounts of mRNA encoding decorin and / or siRNA targeting VEGF to target cells, resulting in high efficacy of reducing key cellular mechanisms contributing to ocular diseases such as those mentioned herein.Decorin is a naturally occurring, pleiotropic, small leucine-rich proteoglycan that is naturally present at high levels bound to collagen in the corneal stroma and which, when released, tightly regulates TGF-β activity by binding the growth factor and sequestering it within the ECM. Decorin regulates cell proliferation, survival, and differentiation by modulating numerous growth factors, including TGF-β as well as directly interfering with collagen fibrillogenesis, amongst others. It has important roles in maintaining cellular and ECM homeostasis within the retina and its downregulation has been associated with the development of various forms of retinopathy. Decorin based treatments for ocular disease including corneal disease and trabecular meshwork dysfunction in glaucoma have recently emerged. Interestingly, decorin levels are lower within the retina of people with AMD and previous experiments have shown that decorin can restore cell health and reduce inflammation

[0025] ,

[0026] - both key aspects of dry AMD disease. Decorin is an excellent candidate therapy for AMD and, importantly, has the potential to treat the disease during early stages.

[0057] Decorin is able to help regulate ECM turnover and sequester inflammatory cytokines

[0030] ,

[0031] ,

[0032] ,

[0058] VEGF is implicated in many ocular diseases including nAMD, glaucoma and diabetic retinopathy

[0034] , Anti -VEGF therapeutics are widely implemented clinically against ocular diseases and are frontline treatments in nAMD, for example

[0035] , These are commonly antibody-based treatments which are large molecules incapable of penetrating the ocular barriers and thus are not amenable to topical treatment. Intravitreal injections are the most common methodology for delivery of large anti-VEGF molecules which have significant complications including poor patient adherence and compliance (thus sub-optimal therapeutic dosing), off-target adverse events such as retinal detachment and the requirement for specialist administration of the injection, using time, money and resources from the NHS

[0036] ,

[0059] In any aspect, the RNA-cell delivery molecule complex of the invention may be administered to a subject topically. This non-invasive methodology improves patient compliance and comfort. The RNA-cell delivery molecule complex of the invention may be administered to a subject via intraocular injection.The RNA-cell delivery molecule complex of the invention may be administered by injection (systemically or locally). The intraocular injection may be an intracameral injection, an intravitreal injection, or a sub-retinal injection. The systemic injection maybe by intravenous injection.

[0060] Any sequence referred to herein may also encompass a sequence which has at least 90% identity, such as 90%, 95%, 96%, 97%, 98%, 99% or 100% identity to the specific SEQ ID NO referred to.

[0061] " Identity" as known in the art is the relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. While there exist a number of methods to measure identity between two polypeptide or two polynucleotide sequences, methods commonly employed to determine identity are codified in computer programs. Preferred computer programs to determine identity between two sequences include, but are not limited to, GCG program package (Devereux, et al., Nucleic Acids Research, 12, 387 (1984), BLASTP, BLASTN, and FASTA (Atschul et al., J. Molec. Biol. 215, 403 (1990)).

[0062] A program such as the CLUSTAL program can be used to compare amino acid sequences. This program compares amino acid sequences and finds the optimal alignment by inserting spaces in either sequence as appropriate. It is possible to calculate amino acid identity or similarity (identity plus conservation of amino acid type) for an optimal alignment. A program like BLASTx will align the longest stretch of similar sequences and assign a value to the fit. It is thus possible to obtain a comparison where several regions of similarity are found, each having a different score. Both types of identity analysis are suitable.

[0063] The percent identity of two amino acid sequences or of two nucleic acid sequences is determined by aligning the sequences for optimal comparison purposes (e.g., gaps can be introduced in the first sequence for best alignment with the sequence) and comparing the amino acid residues or nucleotides at corresponding positions. The "best alignment" is an alignment of two sequences which results in the highest percent identity. Thepercent identity is determined by the number of identical amino acid residues or nucleotides in the sequences being compared (i.e., % identity = number of identical positions / total number of positions x 100).

[0064] The determination of percent identity between two sequences can be accomplished using a mathematical algorithm known to those of skill in the art. An example of a mathematical algorithm for comparing two sequences is the algorithm of Karlin and Altschul (1990) Proc. Natl. Acad. Sci. USA 87:2264-2268, modified as in Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA 90:5873- 5877. The NBLAST and XBLAST programs of Altschul, et al. (1990) J. Mol. Biol. 2 15:403-410 have incorporated such an algorithm. BLAST nucleotide searches can be performed with the NBLAST program, score = 100, wordlength = 12 to obtain nucleotide sequences homologous to nucleic acid molecules. BLAST protein searches can be performed with the XBLAST program, score = 50, wordlength = 3 to obtain amino acid sequences homologous to protein molecules for use in the invention. To obtain gapped alignments for comparison purposes, Gapped BLAST can be utilised as described in Altschul et al. (1997) Nucleic Acids Res. 25:3389-3402. Alternatively, PSI-Blast can be used to perform an iterated search which detects distant relationships between molecules (Id.). When utilising BLAST, Gapped BLAST, and PSI-Blast programs, the default parameters of the respective programs (e.g., XBLAST and NBLAST) can be used. See http: / / www.ncbi.nlm.nih.gov. Another example of a mathematical algorithm utilised for the comparison of sequences is the algorithm of Myers and Miller, CABIOS (1989). The ALIGN program (version 2.0) which is part of the CGC sequence alignment software package has incorporated such an algorithm. Other algorithms for sequence analysis known in the art include ADVANCE and ADAM as described in Torellis and Robotti (1994) Comput. Appl. Biosci., 10:3-5; and FASTA described in Pearson and Lipman (1988) Proc. Natl. Acad. Sci. 85:2444-8. Within FASTA, ktup is a control option that sets the sensitivity and speed of the search.

[0065] Where more than one agent is to be administered, the agents may be formulated together in the same formulation or may be formulated into separate pharmaceutical compositions. The separate compositions may be administered concurrently, sequentially, or separately.As used herein, the term “therapeutically effective amount” refers to the total amount of the agent or each active component of the pharmaceutical composition or method that is sufficient to provide patient benefit, i.e., prevention or amelioration of the condition to be treated, a reduction in symptoms, an increase in rate of healing, or a detectable change in the levels of a substance in the treated or surrounding tissue. When applied to an individual active ingredient, administered alone, the term refers to that ingredient alone. When applied to a combination, the term refers to combined amounts of the active ingredients that result in the therapeutic effect, whether administered in concurrently, sequentially, or separately.

[0066] The complex, nanoparticles or composition may be delivered at intervals ranging from about 3 hours to about 24 hours, to about 2 days, to about 1 week, to about 2 weeks, to about 3 weeks, to about 1 month, to about 2 months, to about 3 months, to about 4 months, to about 5 months, to about 6 months, to about 12 months, or more. The scheduling of such dosage regimens can be optimized by the practitioner.

[0067] The complex, nanoparticles or composition may be administered using a treatment regimen comprising one or more doses, wherein the treatment regimen is administered over 2 days, 3 days, 4 days, 5 days, 6 days or 7 days, 14 days, 30 days, 1 month, 2 months, 3 months, 6 months, 12 months or more.

[0068] The term “patient” or “subject,” as used interchangeably herein, refers to any mammal, preferably a human.

[0069] The method of any aspect of the invention may be in vivo, ex vivo or in vitro.

[0070] A complex referred to herein may be formed by any technique known to the skilled person, such as that described in the materials and methods and / or examples disclosed herein.

[0071] A complex referred to herein may be formed with any N: P ratio giving the desired effect, such as any of those from Table 1 or Table 2 (or variations within around 10% or to the nearest significant figure), which is easily obtainable by the skilled personThe N: P ratio referred to herein denotes the ratio of positively-chargeable polymer amine (N = nitrogen) groups to negatively-charged nucleic acid phosphate (P) groups.

[0072] The skilled person will appreciate that preferred features of any one embodiment and / or aspect of the invention may be applied to all other embodiments and / or aspects of the invention.

[0073] The invention will now be described with reference to the accompanying drawings.

[0074] BRIEF DESCRIPTION OF THE DRAWINGS

[0075] Figure 1: Physiochemical characterisation of the nucleotide-HAWC complexions. A-C) Z-average (nanoparticle size; grey bars) and zeta potential (charge; grey points) of EGFP mRNA-, decorin mRNA- and VEGF siRNA-HAWC complexions, respectively, at N: P ratios of 6-14. D-F) Dynamic light scattering (DLS) spectra of EGFP mRNA-, decorin mRNA- and VEGF siRNA-HAWC complexions, respectively, at N: P ratios of 6-14.

[0076] Figure 2: In vitro transfection of murine NCTC-929 fibroblasts and human ARPE-19 cells with EGFP mRNA-HAWC at multiple N: P ratios. A-B) Representative images of NCTC-929 and ARPE-19 cells, respectively, 24 h post -transfection with EGFP mRNA-HAWC at 1 pg (green represented as white in images). Cells were seeded at 2xl04cells / well in 96-well plates. C) Quantitative analysis of NCTC-929 transfection efficiency using flow cytometry. Cells were trypsinised and resuspended in FACS buffer, followed by analysis on an Accuri C6 plus flow cytometer. D) NCTC-929 cell viability 24 h following transfections determined by Alamar Blue assay. E) Quantitative analysis of ARPE-19 transfection efficiency using flow cytometry. F) ARPE-19 cell viability 24 h following transfections determined by Alamar Blue assay. All results show N=3 ± SEM.

[0077] Figure 3: EGFP mRNA-HAWC nanoparticle (N: P 8) transfections in ARPE-19 cells over 4 days. A) Representative images of cells every 24 h for 96 h post-transfection following delivery of 0.5 or 1 pg EGFP mRNA-HAWC (green represented as white in images). B) Quantitative analysis of cell numbers expressing EGFP using Incucyte inbuilt software. C) Transfection efficiency determined by number of EGFP-expressingcells as a percentage of total cell counts. D) Green fluorescence intensity per image in green calibrated units (GCU) per pm2. Results show N=3 ± SEM.

[0078] Figure 4: EGFP mRNA-HAWC nanoparticle (N: P 8) transfections in human trabecular meshwork cells over 4 days. A) Representative images of cells every 24 h for 96 h post-transfection following delivery of 0.5 or 1 pg EGFP mRNA-HAWC (green represented as white in images). B) Quantitative analysis of cell numbers expressing EGFP using Incucyte in-built software. C) Transfection efficiency determined by number of EGFP-expressing cells as a percentage of total cell counts. D) Green fluorescence intensity per image in green calibrated units (GCU) per pm2. Results show N=3 ± SEM.

[0079] Figure 5: Generation of decorin protein from the decorin mRNA sequence using liposome nanoparticle (LNP). ARPE-19 cells were transfected with decorin mRNA-LNP for 6 h. Cells and media supernatant were harvested 40 h post-transfection. Protein concentration was determined by ELISA with reference to a decorin protein standard curve. Significantly greater decorin protein was observed in the cells and media supernatant (secreted from the cells) in the decorin mRNA-LNP treated cells compared to liposome only, *p<0.05, ****p<0.000I. Results show N=5 ± SEM.

[0080] Figure 6: Generation of decorin protein following decorin mRNA-HAWC transfections in ARPE-19 cells. (A) ARPE-19 cells were transfected with decorin mRNA-HAWC for 5 h (2xl04cells / well, 400 pL / well in 24-well plates). Cells and media supernatant were harvested 24 h post-transfection. Protein concentration was determined by ELISA with reference to a human decorin protein standard curve. Significantly greater decorin protein was measured in the cells and media supernatant (secreted from the cells) in the decorin mRNA-HAWC treated cells compared to untreated, **p<0.01, ****p<0.000I. Results show N=3 ± SEM.

[0081] Figure 7: Inhibition of VEGF protein following VEGF siRNA-HAWC transfections in ARPE-19 cells. ARPE-19 cells were transfected with VEGF siRNA-HAWC for 5 h (2xl04cells / well). A) Cells and B) media supernatant were harvested 72 h posttransfection. Protein concentration was determined by ELISA with reference to a VEGF protein standard curve. Less VEGF protein was observed in the cells in the 1.5 pg VEGF siRNA-HAWC treated cells compared to untreated. Results show N=3 ± SD.Figure 8: Cell viability of NP1 complexed with IL-33 mRNA or EGFP mRNA in ARPE-19 cells. Human ARPE-19 cells were treated with media (control), IL-33 mRNA-NP1, EGFP mRNA-NPl or the noncomplexed mRNAs and cell viability measured via MTT assays. Cell viability was normalised to media-treated cells. Results show N>2 ± SEM. No significant differences were measured following a one-way ANOVA with Tukey’s post-hoc analysis.

[0082] Figure 9: Efficacy of decorin mRNA-NPl in in vitro ocular fibrosis model. Human trabecular meshwork cells were treated with control (vehicle), TGFpi or TGFpi + decorin mRNA-NPl for 48 h and the levels of ECM deposition (fibronectin) assessed by immunofluorescence. Decorin mRNA-NPl prevented the significant deposition of fibronectin induced by TGFpi. ****P < 0.0001. Results show N=4 ± SEM.

[0083] Figure 10: Efficacy of decorin mRNA-HAWC in in vitro ocular fibrosis model. A) Representative images of fibronectin levels in ARPE-19 cells treated with media (vehicle) control or decorin mRNA-HAWC. Images acquired using 5x objective lens. Scale bar indicates 200 pm. B) Quantification of fibronectin levels normalised to DAPI levels following immunofluorescence in ARPE-19 cells. Decorin mRNA-HAWC inhibited the deposition of fibronectin. **P<0.01, ***P<0.001, ****P<0.0001 following one-way ANOVA with Dunnett’s post-hoc analysis. Data are N=3 ± SEM.

[0084] Figure 11: Efficacy of decorin mRNA-HAWC in in vitro oxidative stress model.

[0085] ARPE-19 cells were pre-treated for 48 h before H2O2 treatment. A) Cell viability was measured via CCK-8 assays and normalised to untreated control cells. H2O2 reduced cell viability; decorin mRNA-HAWC inhibited the H2O2 effects. B) ARPE-19 cellular glutathione concentrations in response to decorin mRNA-HAWC were measured via the GSH-Glo assay; decorin mRNA-HAWC increased GSH concentrations. C) H2O2 reduced cellular GSH concentrations measured via the GSH-Glo assay and normalised to untreated control cells; decorin mRNA-HAWC inhibited the H2O2 effects. *P<0.05, **P<0.01, ***P<0.001 following one-way ANOVA with Tukey’s post-hoc analysis. Results show N=3 ± SEM

[0086] Figure 12: Efficacy of decorin mRNA-HAWC in in vitro autophagy model. Primary mouse RPE cells were pre-treated for 24 h with decorin mRNA-HAWC before theaddition of LC3B tandem tracker (LC3B-GFP-RFP). Cells were co-stained with Lysotracker and Hoechst to label lysosomes and nuclei, respectively. A) Representative single-channel images of primary RPE cells either untreated or treated with decorin mRNA-HAWC. Arrows indicate example regions of high RFP / Lysotracker colocalisation. B) Quantification of the number of GFP+ vacuoles / nucleus, indicating autophagosomes. C) Quantification of the number of RFP+ vacuoles / nucleus, indicating autolysosomes. *P<0.05 following two-way, unpaired Student’s t-test. Data are N=3 ± SEM.

[0087] Figure 13: Ex vivo distribution of mRNA in porcine eyes. One hour after topical administration to a porcine eye, EGFP mRNA could be detected in the A) vitreous and B) retina when it was combined with NP1 following qRT-PCR analysis. C) 15 min after topical administration of EGFP mRNA-HAWC to a porcine corneal biopsy in a transwell assay, EGFP mRNA could be detected in the corneal flowthrough, measured following qRT-PCR. **P<0.01 following a two-way, unpaired Student’s t-test. Results show N>2 ± SEM.

[0088] Figure 14: NP efficacy in an in vivo model of glaucoma. Twice weekly intracameral (IC) injections of TGFpi increased intraocular pressure (IOP) and models glaucoma. A) IC injections of decorin mRNA-NPl (starting from day 14; arrow) significantly reduced IOP to normal levels by the end of the experiment at 28 days (the normal IOP range in these rats is 10-13 mmHg). *P<0.05; **p<0.01; ***P < 0.001 following a 2 way ANOVA.

[0089] MATERIALS AND METHODS

[0090] Generation of peptides

[0091] All peptides were produced commercially by Shanghai RoyoBiotech Co. Ltd (China) and supplied as a lyophilised powder which required reconstitution before use. Peptides were supplied in the acetate salt form and were of >95% purity. Lyophilised peptides were reconstituted in Ultrapure DNAse / RNAse free water (Invitrogen, UK) and stored in aliquots at -80°C.Generation of nucleic acid cargo

[0092] Messenger RNA (mRNA)

[0093] An in vitro transcription (IVT) plasmid encoding enhanced green fluorescent protein (EEGFP) was procured from Vector builder Inc. (USA). mRNA was synthesized using an HiScribe® T7 High Yield RNA Synthesis Kit (New England Biolabs, UK) following the manufacturer’s protocol. The synthesized RNA was purified using a Monarch® RNA Cleanup Kit (New England Biolabs, UK) and quantified using a Nanodrop spectrophotometer (Thermo Scientific, MA, USA) at 260 nm. The IVT mRNA was stored at -80°C until further use.

[0094] N: P Ratio Calculation for Peptide / Nucleic Acid Nanoparticles

[0095] N: P ratio is widely used to describe the contents of peptide- / protein-based nucleic acid nanoparticles. It is defined as the molar ratio of positively-charged nitrogen atoms in the amino acids of the peptide / protein to the negatively-charged phosphates within the nucleic acid backbone, or more simply the mass of peptide required to neutralise 1 pg of Nucleic Acid (NA). N: P ratio can be calculated as follows:

[0096] N: P ratio=

[0097]

[0098] where Mpeptide is the mass of the peptide in the nanoparticle, MNucleic acid is the mass of the NA cargo in the nanoparticle and CN:P is the N: P constant. The N: P constant is the ratio of the positive charge density of the amino acid chain to the negative charge density of the NA, where charge density can be calculated as the net charge divided by the molecular mass.

[0099] Based on the presence of the positively-charged amino acids and the knowledge that the mass and charge of the bases in the NA backbone are constant, the N: P constant can be calculated with only the mass and the charge of the peptide / protein as variables. CNP is calculated as follows:

[0100]

[0101] Where QNucleic acid is the charge of the nucleic acid molecule, Qpeptide is the net charge of the peptide molecule, MWNucleic acid is the average molecular weight of the nucleic acid molecule, and MWPeptide is the molecular mass of peptide. This can be simplified as following for mRNA cargo and HAWC peptide as:No. of strands in mRNA x MW HAWC 1 x 2971.45

[0102]

[0103] Av MW 1μg mRNA x Charge HAWC = 340 x 5

[0104] Formulation of Peptide / EGFP mRNA / decorin mRNA / VEGF siRNA Nanoparticles Nucleic acid cargo was complexed by peptide using a range of N: P ratios via electrostatic interactions. Depending upon N: P ratio, an appropriate quantity of peptide was added to 1 pg of nucleic acid cargo in Ultrapure water to a final volume of 50 pL. Peptide nanoparticle formulations are presented in Table 1 and Table 2.

[0105] Table 1 - Decorin mRNA-HAWC

[0106] Cargo pL HAWC pl [10 Water pL (Total N: P ratio [Ipg / pL] HAWC pg pg / pL] volume 50 pL)

[0107] 1.00

[0108] 6 10.26 1.03 47.97

[0109] 1.00

[0110] 8 13.68 1.37 47.63

[0111] 1.00

[0112] 10 17.10 1.71 47.29

[0113] 1.00

[0114] 12 20.52 2.05 46.95

[0115] 1.00

[0116] 14 23.94 2.39 46.61

[0117]

[0118] Table 2 - VEGF siRNA-HAWC

[0119] Cargo pL HAWC pl [10 Water pL (Total N: P ratio [1 pg / pL] HAWC pg pg / pL] volume 50 pL)

[0120] 1.00

[0121] 6 10.98 1.10 47.90

[0122] 1.00

[0123] 8 14.64 1.46 47.54

[0124] 1.00

[0125] 10 18.30 1.83 47.17

[0126]

[0127] 1.00

[0128] 12 21.96 2.20 46.80

[0129] 1.00

[0130] 14 25.62 2.56 46.44

[0131]

[0132] Nanoparticle Size Measurement using Malvern Zetasizer

[0133] Peptide complexes were prepared at a range of N: P ratios. A Malvern Zetasizer Nano ZS instrument with DLS software (Malvern Instruments, UK) was used to measure the mean hydrodynamic particle size of nanoparticles. A volume of 50 pL was used in a disposable microcuvette to measure the mean size by intensity of nanoparticles formed by Dynamic Light Scattering (DLS) at 25°C. Results were reported as mean ± SEM, and all measurements were performed in triplicate.

[0134] Determination of Nanoparticle Zeta Potential using Malvern Zetasizer Following size measurement, 50 pL of the nanoparticles sample was subsequently made up to 1000 pL with Ultrapure water and added to a folded capillary zeta cell (Malvern Instruments, UK). Zeta potential was measured by Laser Doppler Velocimetry using a Malvern Zetasizer Nano ZS instrument at 25°C. Results were reported as mean ± SEM and measured in triplicate.

[0135] Ion Exchange Chromatography

[0136] 10 mL of IM NaCl was added to 0.5 g of SP-Sephadex (Sigma-Aldrich, SPC25120, GER), which was incubated overnight at room temperature (1g requires >7 mL NaCl for swelling volume). To remove residual ionic solvent, the supernatant was discarded, and the resin was rinsed three times in 10 mL ultrapure (DNase / RNase free) water. A frit column was filled under pressure with 2 mL of washed resin. 20 pL of free cargo solution or Peptide: cargo complex at >20 mg / mL was loaded onto the column and eluted with 3 mL of ultrapure (DNase / RNase free) H2O. The eluted fractions were collected in 0.5 mL centrifuge tubes and analysed using a Nanodrop spectrophotometer (ThermoScientific, MA, USA) at 260 nm.

[0137] Complexation Efficiency

[0138] Peptide complexes were prepared at a range of N: P ratios. Quant-iT™RiboGreen® Reagent or PicoGreen® Reagent (Life Technologies, UK) was diluted 1:200 in TAE buffer, and 50 pL was added to each sample. Sample fluorescence was analysed byexcitation at 480 nm, and the fluorescence emission intensity measured at 520 nm using a FLUOstar Omega Multimode Plate Reader (BMG Labtech, UK). Fluorescence intensity of a naked cargo control was taken as 100% fluorescence and 0% complexed, and any fluorescence detected from samples was taken to be un-complexed. The percentage of un-complexed nucleic acid in each sample was then used to calculate the percentage of complexed mRNA.

[0139] Cell lines

[0140] Human ARPE-19 retinal epithelial cells (ATCC, UK), human trabecular meshwork (TM) cells (Tebubio, UK) and murine NCTC-929 fibroblasts (Merck, Germany) were maintained as monolayers in Dulbecco's Modified Eagle's Medium / nutrient mixture F-12 (DMEM / F-12) (Gibco, UK), supplemented with 10% foetal bovine serum (FBS) (human cells) or foetal calf serum (FCS) (murine cells), 100 U / mL penicillin and 100 pg / mL streptomycin antibiotics. ARPE-19 cells were passaged after reaching 80% confluency; TM cells were replenished with fresh media every 48 h upon reaching 60% confluency and passaged after 80% confluency. Both ARPE-19 and TM cell lines were utilised in experimental protocols up to a passage number of 10. Cells were maintained in an incubator at 37°C with 5% CO2 atmosphere and subjected to mycoplasma testing routinely. All cell lines were authenticated by short tandem repeat (STR) profiling carried out by the suppliers.

[0141] Primary mouse RPE isolation and culture

[0142] C57BL / 6J male mice (Charles River Laboratories, UK) were housed in the Animal Services Unit at the University of Bristol, in accordance with the Home Office guidelines set out in the 1986 Animal Act (UK), adhering to the ARRIVE guidelines and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Eyes were enucleated and excess extraocular tissue removed using angled scissors. The cornea, lens and vitreous were subsequently removed; the resulting eyecups were incubated in hyaluronidase (Sigma, UK) for 45 min then HBSS buffer + 10 mM HEPES for a further 30 min, all at 37°C. Retinas were hereafter removed with incisions and the eyecups incubated at 37°C firstly in 0.05% trypsin / EDTA for 45 min then HBSS + 20% FBS. RPE sheets were detached using gentle shaking then incubated for 1 min in 0.05% trypsin / EDTA to create single-cell suspensions. Cells were resuspended in cell culture medium for cultivation and downstream experiments; RPE medium was a-MEM (Sigma, UK) supplemented with 1% N1 medium supplement (Sigma, UK), 1% L-glutamine(Sigma, UK), 100 U / mL penicillin and 100 pg / mL streptomycin antibiotics, 20 pg / L hydrocortisone (Sigma, UK), 250 mg / U taurine (Sigma, UK) and 0.013 pg / U triiodo-thyronin (Sigma, UK) ± 5% FBS (HyClone, USA).

[0143] Transfections with Peptide Delivering Nucleic Acid Cargo

[0144] Cells were seeded at a density optimised for each tissue culture vessel for example 0.5-2xl04cells / well or 5-10xl04cells / well into 96-well or 24-well tissue culture plates, respectively and allowed to adhere overnight. Medium was replaced with OptiMEM (Invitrogen, UK) 2 h prior to transfection and the cells returned to the incubator. Nanoparticles + EGFP mRNA, decorin mRNA or siVEGF (herein referred to as nanoparticles + nucleic acid) were re-constituted from their lyophilised form in sterile, 0.22 pm-filtered Ultrapure water (Invitrogen, UK) before being added to the appropriate wells. Cells were incubated with the nanoparticles + nucleic acid for 5 h before being replaced with complete media. Untreated cells will be used as negative controls.

[0145] Flow Cytometry Analysis of Transfection Efficiency

[0146] Transfected cells were washed with phosphate buffered saline (PBS) and 2x trypsin used to detach cells at 37°C in 5% CO2 atmosphere. Complete media was then added, and the cells were centrifuged at 2300 g for 10 min. An Accuri C6 Plus (BD Bioscience, UK) was used for the detection of green fluorescent protein (EGFP) expressing cells using Flow cytometry buffer (eBioscience™, Thermofisher, UK). 10 pL of Propidium iodide at a concentration of 0.01 mg / mL was added to the cells to assess cell viability. Results are reported as mean ± SEM, n=3.

[0147] Cell viability in response to nanoparticles

[0148] The in vitro cytotoxicity of peptide nucleic acid NPs cells was analysed using the alamarBlue™ Cell Viability Reagent. 24 h following transfection, Alamar Blue was added to the cells to a final concentration of 10% and incubated for 2 h. The absorbance of the samples was then measured at 570 nm using a FLUOstar Omega microplate reader (BMG Labtech, Germany) or Tecan Infinite M nano microplate reader (Tecan Life Sciences, UK). Cell viability was calculated as a relative percentage to the untreated control.Analysis of EGFP expression by fluorescence microscopy

[0149] To facilitate qualitative analysis of EGFP expression correlating to transfection efficiency, cells were visualised and imaged 24 h following transfection under fluorescent light using an EVOS FL Cell Imaging System (Life Technologies).

[0150] Analysis of EGFP expression in live cells

[0151] To qualitatively analyse EGFP expression in a live environment, cells were visualised and imaged every hour following transfection using green channel acquisition (300 ms) and phase contrast imaging with a lOx objective within the Incucyte S3 system (Sartorius, UK). Images were analysed using the Incucyte proprietary software. Experiments were performed in 96-well plates with three technical replicates per condition and three biological repeats. Results are reported as mean ± SEM, n=3.

[0152] Protein quantification via ELISA

[0153] Quantification of decorin and VEGF protein was undertaken using an ELISA (Human Decorin DuoSet ELISA, R& D Systems, UK, human VEGF ELISA, Abeam, UK) according to the manufacturer’s protocols. Both cell lysates and media were analysed to measure cellular and secreted protein, respectively. Briefly, cells were transfected as described above and the media mixed with reagent diluent at a 1:1 ratio. Cells were lysed using 2% Triton-X 100 in PBS with protease and phosphatase inhibitor cocktail (1%). Media and cell lysates were subsequently compared to kit standards for decorin or VEGF.

[0154] Cytotoxicity in response to nanoparticles using MTT

[0155] Cytotoxicity of NP1 was analysed using MTT colorimetric assays (Vybrant® MTT Cell Proliferation Assay Kit; Molecular Probes, ThermoFisher, UK). After transfection, 10 pl of 12 mM MTT stock was reconstituted in PBS and added to each well and incubated for 4 h at 37°C. The absorbance of the samples was then measured at 570 nm using a Tecan Infinite M nano microplate reader (Tecan Life Sciences, UK). Cell viability was calculated as a relative percentage to the untreated control.

[0156] Analysis of ECM deposition via immunocytochemistry (ICC)

[0157] Cells were seeded into 8-chamber tissue culture glass slides (Corning, UK) and allowed to adhere overnight. Complete medium was replaced with serum-free medium and the cells returned to the incubator. Following an incubation period, cells were challenged ±ECM deposition modifiers. Subsequently, cells were fixed in 4% PFA (Sigma, UK) in PBS for 10 min at room temperature, washed with PBS then permeabilised in PBS + 0.1% Triton X100 at room temperature before blocking with PBS + 0.1% Triton X100, 3% BSA at room temperature. Cells were then immunostained against specific targets such as with rabbit anti-human Fibronectin primary antibody (F3648, Sigma, UK). Subsequently, secondary antibody (e.g. Alexa Fluor™ 488 Al 1034, ThermoFisher, UK) incubation was performed for 1 h at room temperature before mounting with Vectashield Plus Antifade Mounting Medium with DAPI (H-2000, Vector Laboratories, UK). Cells were then visualised on a fluorescent microscope such as an Axioplan 2 epifluorescent microscope (Carl Zeiss, Germany). Media-treated cells served as negative controls. Control cells incubated with secondary antibody alone were utilised to ensure negative staining.

[0158] Cell viability in response to oxidative stress and autophagy modifiers in vitro ARPE-19 cells were plated into 96-well tissue culture plates and seeded at 0.5xl04cells per well with overnight adhesion. Cells were then transfected with nanoparticles + nucleic acid prior to treatment with H2O2 or pharmacological autophagy modifiers delivered in serum-free DMEM / F-12. Cell viability was measured using alamarBlue™ Cell Viability Reagent, as above, or via the cell counting kit-8 (CCK-8) (Abbkine, USA). Briefly, this entailed adding fresh serum-free media supplemented with 10% CCK-8 reagent and incubated for 2 h at 37°C. The absorbance of the samples was then measured at 450 nm using a Tecan Infinite M nano microplate reader (Tecan Life Sciences, UK). Cell viability was calculated as a relative percentage to the untreated control. Cytotoxicity was also calculated based upon a loss of cell confluency, determined via phase contrast imaging using Incucyte S3 system. Quantification of cell confluency was performed using the in-built Al confluency tool within the Incucyte software (Sartorius, UK).

[0159] GSH-Glo™ glutathione assay

[0160] Cells were plated into white 96-well tissue culture plates and permitted to adhere overnight. Following transfection with nanoparticles + nucleic acid, cells were exposed to H2O2 (delivered in serum-free DMEM / F12) to induce oxidative stress. After this, media was removed and replaced with 100 pL / well of freshly prepared IX GSH-Glo™ reagent (Promega, UK) and incubated at room temperature for 30 min before adding 100 pL / well re-constituted Luciferin Detection Reagent with a further 15 minincubation. Following this, luminescence was measured using a PHERAstar® FS (BMG Labtech, Germany).

[0161] Autophagy flux measurement

[0162] In primary murine RPE cells, LC3B localisation was monitored to measure autophagosome and autolysosome formation using the Premo™ Autophagy Tandem sensor Kit (ThermoFisher, UK). Briefly, this kit can detect LC3B+autophagosomes which have a neutral pH with green (GFP) fluorescence whereas LC3B+autolysosomes which have acidic pH with red (RFP) fluorescence. RPE cells were transfected with decorin mRNA-HAWC as above 24 h after seeding then given 40 particles / cell of the autophagy tandem kit after a further 24 h. LysoTracker Deep Red (ThermoFisher, UK) was added at 50 nM 30 min prior to imaging for lysosomal staining. Cells were then counterstained with Hoescht 33342 (ThermoFisher, UK) 5 min before imaging using a Lecia SP5II confocal laser scanning microscope. Image acquisition involved Z-stack images using 1 pm step size and visualized using maximal intensity projections. LC3B-positive vacuoles were quantified using Fiji.

[0163] Ex vivo nanoparticle penetration study

[0164] Fresh, adult unscalded porcine eyes were used within 24 h of enucleation. Excess extraocular tissue was removed from the eyes prior to the addition of nanoparticles + nucleic acid pipetted onto the cornea. Following this, eyes were incubated at 37°C and 5% CO2 for 1 h before dissection. The aqueous humour, vitreous and retina / choroid were collected and stored at -80°C. Samples were processed and levels of EGFP mRNA via qRT-PCR, as above. For a porcine corneal penetration assay, a 5 mm diameter punch biopsy was utilised to generate uniform circular corneal discs which were subsequently transferred onto sterile CellCrown™ 96-well inserts (Sigma, UK) with the corneal epithelial layer facing upwards. Inserts were then placed into a 96-well plate containing HBSS in the lower chamber for hydration of the corneal biopsy. Nucleic acid + nanoparticle formulation were then applied to the corneal epithelium and flow-through harvested after a desired period. Spiked controls of a known nucleic acid + nanoparticle amount were used as positive controls.

[0165] Real-Time PCR

[0166] RNA extraction and reverse transcription were performed using a Monarch Total RNA Miniprep Kit (NEB, UK) and LunaScript RT SuperMix Kit (NEB, UK), respectivelyaccording to the manufacturer’s protocols. Reverse transcription was conducted in a thermal cycler using the following parameters: 25°C for 2 min, 55°C for 10 min, 95°C for 1 min, hold at 4°C.

[0167] qRT-PCR was conducted in transparent 384-well plates (Starlab, UK). Reactions were prepared for each set of probes according to manufacturer’s protocols (Luna Universal qPCR Master Mix, NEB, UK). Briefly, 5 μL of Luna Universal qPCR Master Mix; 2 pL of nuclease-free H2O; 2 pL cDNA (diluted from RT reaction, giving 1.5 ng cDNA in total per reaction); 0.5 pL of forward and reverse primers (10 pM) were prepared to give a total reaction volume of 10 pL / well. qRT-PCR was conducted using a QuantStudio™ 5 Real-Time PCR System (ThermoFisher, UK) using the following cycling parameters: 95°C for 10 min, then 40 X cycles of 95°C for 15 s, and 60°C for 60 s. The CT values generated were used to quantify target expression relative to housekeeping gene using the ΔΔCTmethod. Results are reported as fold change relative to control.

[0168] In vivo nanoparticle penetration study

[0169] The ocular penetration of nanoparticles + nucleic acid was analysed in intact C57BL / 6J murine eyes. An eye drop containing nanoparticles + nucleic acid was added to the ocular surface and left for 1 h before culling the mouse by cervical dislocation. Eyes were subsequently enucleated and placed in ice-cold PBS. Dissection of the anterior segment and lens was performed with the posterior segment eyecups (vitreous / retina / choroid / sclera) harvested for RNA extraction (following by qRT-PCR) or Western blotting, both described above.

[0170] In vivo glaucoma model

[0171] Eight- to 10-week-old Sprague Dawley rats were anaesthetised with inhaled 2% to 5% isofluorane / 95% O2. At 0 days, one self-sealing incision was made through the cornea into the anterior chamber using a 15° disposable blade enabling repeat twice a week (biweekly) 3.5 pL intracameral injections through the tunnel generated using self-made disposable sterile glass micropipettes (Harvard Apparatus, UK) for 28 days of either PBS or TGFpi (5 ng / pL; Peprotech, UK). Intraocular pressure (IOP) was also measured twice weekly throughout the 28-day experiment, immediately prior to intracameral injections. At 14 days, non-responders to TGFpi (no IOP increase above baseline at any time point) were excluded from further analysis. After 14 days, rats received eye dropscontaining nanoparticles + nucleic acid until 28 days or an equivalent eye drop containing vehicle. Optical coherence tomography (OCT) measurements of the retinal nerve fibre layer (RNFL) were taken at 28 days as a surrogate for retinal ganglion cell (RGC) density and ocular tissues from both groups were processed for immunohistochemistry to assess levels of TM fibrosis and RGC survival. The in vivo glaucoma study was performed at the Biomedical Services Unit at the University of Birmingham (UK) in accordance with the Home Office guidelines set out in the 1986 Animal Act (UK), adhering to the ARRIVE guidelines and the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research. Intraocular injections, OCT and IOP measurements were all taken post-inhalation anaesthesia using 2-5% isofluorane / 98— 95% O2 (National Veterinary Services, UK).

[0172] IOP Measurements

[0173] IOP measurements were recorded twice weekly throughout the 28-day experiment using an iCare Tonolab tonometer (ICare, Finland), calibrated for rats; confounding circadian IOP variabilities were mitigated through consistent timing of measurements. Immediately after the induction of anaesthesia, six rebound measurements were taken using the tonometer from the central cornea and averaged to give a single reading (mmHg). Each graphical data point represents the mean ± SEM of three readings (6 rebounds) taken from each rat sequentially to ensure accurate measurements.

[0174] EXAMPLES

[0175] Example 1- different types of RNA can be successfully complexed with the cell delivery peptide

[0176] The three nucleic acid sequences for EGFP mRNA, decorin mRNA and siVEGF were all successfully complexed with HAWC nanoparticles (Figure 1). N: P ratio was optimised between 6-14 to generate variant z-average (nanoparticle size) and zeta potential (nanoparticle charge) (Figure 1A-C). This demonstrates that HAWC nanoparticles could be synthesised in complexion with nucleic acids.

[0177] Example 2 - RNA complexed with the delivery peptide is functional

[0178] To measure the functionality of mRNA sequences and nanoparticle delivery, murine NCTC-929 fibroblasts and human ARPE-19 retinal epithelial cells were transfected with EGFP mRNA-HAWC at N: P ratios between 6-14 using 1 pg mRNA / well. All N: P ratios showed EGFP expression by 24 h in NCTC-929 (Figure 2A) and ARPE-19 (Figure 2B)cells. This demonstrates that the nucleic acid-HAWC nanoparticles successfully delivered EGFP mRNA within multiple cell types derived from multiple species. Moreover, the EGFP mRNA was translationally functional as protein was synthesised from the mRNA. As EGFP is not endogenous within humans or mice, EGFP detection could only have been possible through successful delivery of the mRNA with the HAWC peptide.

[0179] Transfection efficiency was >57.0% in NCTC-929 cells across all N: P ratios, peaking with N: P 8 at 76.8% (Figure 2C); cell viability was unaffected by transfections with EGFP mRNA-HAWC in NCTC-929 cells after 24 h (Figure 2D). This demonstrates that EGFP mRNA-HAWC nanoparticles could successfully induce EGFP protein expression in a large proportion of cells in vitro without negative impacts on cell viability.

[0180] Transfection efficiency after 24 h in ARPE-19 cells ranged between 30.0-40.3%, with the highest efficiency at N: P 8 (Figure 2E). Cell viability was unaffected by EGFP mRNA-HAWC transfection after 24 h in ARPE-19 cells (Figure 2F). This demonstrates that human ocular cells could also be transfected with EGFP mRNA-HAWC nanoparticles at a high proportion in vitro without negative impacts on cell viability.

[0181] The time-dependent transfection of EGFP mRNA-HAWC and subsequent translation into EGFP protein was measured in ARPE-19 (Figure 3) and human trabecular meshwork (hTM) cells (Figure 4). This demonstrates that HAWC peptide was not only able to penetrate cell membranes but deliver intact mRNA to enable translation into protein in multiple human ocular cell types of both anterior and posterior (retinal) locations within the eye.

[0182] The number of EGFP-expressing cells, transfection efficiency and overall fluorescence intensity per image were all analysed using Incucyte S3 and in-built software. In ARPE-19 cells, EGFP expression was measured after 4 h, peaking at 24 h and remained greater than untreated control cells for 96 h post-transfection (Figure 3). In hTM cells, EGFP fluorescence peaked at 24-48 h and was also maintained across 96 h post-transfection (Figure 4). This demonstrates that HAWC peptide delivered mRNA rapidly for EGFP translation to occur at detectable levels after just 4 h in ARPE-19. Furthermore, this rapid induction, whilst mildly slower in hTM cells, was proven across multiple human ocular cell types.To assess the functionality of decorin mRNA sequence, liposome nanoparticles (LNP) were utilised to transfect decorin mRNA into ARPE-19 cells; cell lysates and media supernatant were harvested 40 h post-transfection. In both cells and media, decorin protein expression was significantly increased following decorin mRNA-LNP treatment relative to LNP-only treated cells (Figure 5). This demonstrates that the decorin mRNA sequence is functional with respect to permitting protein translation. Moreover, the mRNA can form nanoparticles with LNP and is delivered into human ocular cells in vitro.

[0183] Similarly, decorin mRNA-HAWC was transfected into ARPE-19 cells with lysates and media harvested 24 h post-transfection. Significantly increased decorin protein was measured in cells treated with decorin mRNA-HAWC at N: P 8 than untreated cells (Figure 6A); no significant increases were measured in media (Figure 6B). This demonstrates that decorin mRNA-HAWC nanoparticles successfully delivered decorin mRNA into human ocular cells in vitro and the mRNA was successfully translated into protein.

[0184] Example 3 - delivery of therapeutic RNAs to target cells results in clinically relevant activity

[0185] ARPE-19 cell viability in response to NP1 was assessed via MTT assay (Figure 8). Firstly, two exemplar mRNAs were complexed to NP1: interleukin-33 (IL-33) mRNA and EGFP mRNA. Cell viability was unperturbed by treatment with NP1 nanoparticles or the uncomplexed mRNAs (Figure 8). This demonstrates that ocular cells could be transfected with different mRNA and NP1 without compromising cell viability.

[0186] Decorin mRNA complexed with NP1 showed efficacy in an ocular fibrosis model in vitro wherein hTM cells were treated with TGFpi for 48 h (Figure 9). Increased fibronectin expression was measured in TGFpi -treated cells which was prevented by treatment with decorin mRNA-NPl transfection (Figure 9). This demonstrates firstly that we can successfully model TGFpi -induced fibrosis and ECM deposition in vitro, that NP1 can successfully deliver decorin mRNA into hTM cells and that decorin mRNA (and thus translation into decorin protein) has significant efficacy in preventing / inhibiting ECM deposition (a key factor in glaucoma) in vitro (Figure 9).The efficacy of decorin mRNA following delivery via HAWC peptide was subsequently assessed in ARPE-19 (Figure 10A-B) using an ECM deposition assay. In ARPE-19 cells, decorin mRNA-HAWC induced dose-dependent inhibition of fibronectin expression (Figure 910A) which was statistically significant at three concentrations (P<0.05 at 1.25 ng / pL, P<0.001 at 2.5 ng / pl, P<0.0001 at 5 ng / pL) (Figure 10B). As fibrosis contributes to AMD development, this demonstrates efficacy for decorin mRNA as a therapeutic against AMD. Moreover, these experiments further highlight the suitability of HAWC as a delivery peptide for ocular therapeutic mRNAs.

[0187] Efficacy of decorin mRNA-HAWC in AMD was further assessed using an in vitro model of oxidative stress, a major pathogenic cause for AMD. H2O2 treatment significantly inhibited ARPE-19 cell viability measured via CCK-8 assay (P<0.001, Figure 11A). Treatment with decorin mRNA-HAWC alone did not impact cell viability but was able to ablate and prevent the negative effects on cell viability induced by H2O2. To further explore the oxidative stress mechanisms, the GSH-Glo assay was utilised wherein GSH is a major antioxidant molecule which is used in the detoxification of H2O2 into H2O and alcohols. GSH can also react with multiple other reactive oxygen species (ROS). Decorin mRNA-HAWC treatment significantly increased total cellular GSH concentrations in ARPE-19 cells, demonstrating a direct relationship between decorin and increased cytoprotective GSH (Figure 1 IB). Moreover, H2O2 reduced GSH levels in ARPE-19 cells, an effect which was completely ablated by treatment with decorin mRNA-HAWC (Figure 11C). As such, this demonstrates efficacy of decorin mRNA against oxidative stress in AMD and of the HAWC peptide to successfully deliver and protect therapeutic mRNAs in ocular cells.

[0188] Efficacy of decorin mRNA-HAWC was also validated using a model of autophagy dysregulation which is a pathway known to contribute to AMD pathology. Primary mouse RPE cells were transfected with decorin mRNA-HAWC and the tandem LC3B autophagy sensor kit (GFP / RFP). In primary mouse RPE cells, treatment with decorin mRNA-HAWC stimulated autophagy flux as shown by a significant increase in autolysosomes (Figure 12C) with no effect on autophagosomes (Figure 12B). This demonstrates that decorin mRNA can increase autophagy therefore provides another mechanism for efficacy in AMD.The corneal penetration of topical mRNA when combined with NP1 was assessed using an ex vivo porcine eye which is of comparable size and anatomy to a human eye. GFP mRNA was unable to penetrate through the cornea after topical administration. Penetration to the vitreous was significantly increased when GFP mRNA was combined with NP1 (Fig. 13A) and increased in the retina relative to naked GFP mRNA (Fig.

[0189] 13B). Using a porcine corneal biopsy assay, EGFP mRNA-HAWC was detected by qRT-PCR 15 min after topical administration in the flowthrough, suggesting successful penetration (Fig. 13C).

[0190] Rats were administered intracameral (IC) injection of decorin mRNA-NPl and TGFpi from day 14 in a 28-day TGFpi model of glaucoma showed significantly reduced IOP when measured on days 17 (p<0.01), 21 (p<0.05), 24 (p<0.001) and 28 (p<0.01), in contrast to TGFpi-only treated animals (Figure 14A). This demonstrates the efficacy of NP1 for the delivery of decorin mRNA and the efficacy of decorin mRNA for reduction of IOP in vivo, a major cause of glaucoma

[0191] REFERENCES

[0192] [1] F. Mallone et al., ‘Understanding drivers of ocular fibrosis: Current and future therapeutic perspectives’, 2021. doi: 10.3390 / ijms222111748.

[0193] [2] J. Zhang, J. Tuo, Z. Wang, A. Zhu, A. Machalihska, and Q. Long, ‘Pathogenesis of common ocular diseases’, 2015. doi: 10.1155 / 2015 / 734527.

[0194] [3] W. L. Wong et al., ‘Global prevalence of age-related macular degeneration and disease burden projection for 2020 and 2040: A systematic review and meta-analysis’, Lancet Glob Health, vol. 2, no. 2, 2014, doi: 10.1016 / S2214- 109X( 13)70145- 1.

[0195] [4] P. X. Shaw et al., ‘Oxidative Stress, Innate Immunity and Age-related Macular Degeneration’, AIMS Mol Sci, vol. 3, no. 2, 2016.

[0196] [5] S. D. Solomon, K. Lindsley, S. S. Vedula, M. G. Krzystolik, and B. S. Hawkins, ‘Anti-vascular endothelial growth factor for neovascular age-related macular degeneration’, 2014. doi: 10.1002 / 14651858. CD005139.pub3.

[0197] [6] S. Rofagha, R. B. Bhisitkul, D. S. Boyer, S. R. Sadda, and K. Zhang, ‘Seven-year outcomes in ranibizumab -treated patients in ANCHOR, MARINA, and HORIZON: A multicenter cohort study (SEVEN-UP)’, Ophthalmology, vol. 120, no. 11, 2013, doi: 10.1016 / j.ophtha.2013.03.046.[7] K. G. Falavarjani and Q. D. Nguyen, ‘Adverse events and complications associated with intravitreal injection of anti-VEGF agents: A review of literature’, 2013. doi: 10.1038 / eye.2013.107.

[0198] [8] A. R. Bhavsar et al., ‘Risk of endophthalmitis after intravitreal drug injection when topical antibiotics are not required: The diabetic retinopathy clinical research network laser-ranibizumab-triamcinolone clinical trials’, Archives of Ophthalmology, vol. 127, no. 12, 2009, doi: 10.1001 / archophthalmol.2009.304.

[0199] [9] D. Spiewak, L. Drzyzga, M. Dorecka, and D. Wyglqdowska-Promieriska, ‘Summary of the Therapeutic Options for Patients with Dry and Neovascular AMD’, J Clin Med, vol. 13, no. 14, p. 4227, Jul. 2024, doi: 10.3390 / jcml3144227.

[0200]

[0010] K. Allison, D. Patel, and O. Alabi, ‘Epidemiology of Glaucoma: The Past, Present, and Predictions for the Future’, Cureus, vol. 12, no. 11, Nov. 2020, doi: 10.7759 / CUREUS.11686.

[0201]

[0011] O. Y. Tektas and E. Lutjen-Drecoll, ‘Structural changes of the trabecular meshwork in different kinds of glaucoma’, Exp Eye Res, vol. 88, no. 4, pp. 769-775, Apr. 2009, doi: 10.1016 / J. EXER.2008.11.025.

[0202]

[0012] K. E. Keller and D. M. Peters, ‘Pathogenesis of glaucoma: Extracellular matrix dysfunction in the trabecular meshwork -A review’, Clin Exp Ophthalmol, vol. 50, no.

[0203] 2, pp. 163-182, Mar. 2022, doi: 10.1111 / CEO.14027.

[0204]

[0013] J. C. Tan, M. H. K. Ko, J. I. Woo, K. L. Lu, and J. A. Keiber, ‘Aqueous humor TGF[3 and fibrillin-1 in Tsk mice reveal clues to POAG pathogenesis’, Sci Rep, vol. 14, no. 1, Dec. 2024, doi: 10.1038 / S41598-024-53659-Z.

[0205]

[0014] J. Wang, H. Wang, and Y. Dang, ‘Rho-Kinase Inhibitors as Emerging Targets for Glaucoma Therapy’, Ophthalmol Ther, vol. 12, no. 6, p. 2943, Dec. 2023, doi: 10.1007 / S40123-023-00820-Y.

[0206]

[0015] D. A. Antonetti, P. S. Silva, and A. W. Stitt, ‘Current understanding of the molecular and cellular pathology of diabetic retinopathy’, Nature Reviews Endocrinology 2021 17:4, vol. 17, no. 4, pp. 195-206, Jan. 2021, doi: 10.1038 / s41574-020-00451-4.

[0207]

[0016] Y. Zheng, M. He, and N. Congdon, ‘The worldwide epidemic of diabetic retinopathy’, Indian J Ophthalmol, vol. 60, no. 5, pp. 428-431, Sep. 2012, doi: 10.4103 / 0301-4738.100542.

[0208]

[0017] R. Klein, B. E. K. Klein, and S. E. Moss, ‘The Wisconsin epidemiological study of diabetic retinopathy: a review.’, Diabetes Metab Rev, vol. 5, no. 7, pp. 559-570, Nov. 1989, doi: 10.1002 / DMR.5610050703.

[0018] P. Romero-Aroca, R. Sagarra-Alamo, J. Basora-Gallisa, T. Basora-Gallisa, M. Baget-Bernaldiz, and A. Bautista-Perez, ‘Prospective comparison of two methods of screening for diabetic retinopathy by nonmydriatic fundus camera’, Clin Ophthalmol, vol. 4, no. 1, p. 1481, 2010, doi: 10.2147 / OPTH. S14521.

[0209]

[0019] S. Resnikoff et al., ‘Global data on visual impairment in the year 2002’, Bull World Health Organ, vol. 82, no. 11, p. 844, Nov. 2004, doi: / S0042-96862004001100009.

[0210]

[0020] L. P. Aiello et al., ‘Vascular Endothelial Growth Factor in Ocular Fluid of Patients with Diabetic Retinopathy and Other Retinal Disorders’, New England Journal of Medicine, vol. 331, no. 22, 1994, doi: 10.1056 / nejml99412013312203.

[0211]

[0021] A. W. Stitt et al., ‘The progress in understanding and treatment of diabetic retinopathy’, Prog Retin Eye Res, vol. 51, pp. 156-186, Mar. 2016, doi: 10.1016 / J. PRETEYERES.2015.08.001.

[0212]

[0022] S. Idrees, J. Sridhar, and A. E. Kuriyan, ‘Proliferative Vitreoretinopathy: A Review’, Int Ophthalmol Clin, vol. 59, no. 1, p. 221, Dec. 2019, doi: 10.1097 / 110.0000000000000258.

[0213]

[0023] R. Chaudhary, R. A. H. Scott, G. Wallace, M. Berry, A. Logan, and R. J. Blanch, ‘Inflammatory and Fibrogenic Factors in Proliferative Vitreoretinopathy Development’, Transl Vis Sci Technol, vol. 9, no. 3, p. 23, 2020, doi: 10.1167 / TVST.9.3.23.

[0214]

[0025] M. Wu, L. E. Downie, L. J. Hill, and H. R. Chinnery, ‘The effect of topical decorin on temporal changes to corneal immune cells after epithelial abrasion’, J Neuroinflammation, vol. 19, no. 1, p. 90, Dec. 2022, doi: 10.1186 / sl2974-022-02444-8.

[0215]

[0026] M. Wu et al., ‘The neuroregenerative effects of topical decorin on the injured mouse cornea’, J Neuroinflammation, vol. 17, no. 1, p. 142, Dec. 2020, doi: 10.1186 / S12974-020-01812-6.

[0216]

[0030] T. Neill, L. Schaefer, and R. V. lozzo, ‘Decorin: a guardian from the matrix’, Am J Pathol, vol. 181, no. 2, pp. 380-387, 2012, doi: 10.1016 / J. AJPATH.2012.04.029.

[0217]

[0031] T. Neill, L. Schaefer, and R. V. lozzo, ‘Decorin as a multivalent therapeutic agent against cancer’, Adv Drug Deliv Rev, vol. 97, pp. 174-185, Feb. 2016, doi: 10.1016 / J. ADDR.2015.10.016.

[0218]

[0032] H. Botfield et al., ‘Decorin prevents the development of juvenile communicating hydrocephalus’, Brain, vol. 136, no. Pt 9, pp. 2842-2858, 2013, doi: 10.1093 / BRAIN / AWT203.

[0034] R. S. Apte, D. S. Chen, andN. Ferrara, ‘VEGF in Signaling and Disease: Beyond Discovery and Development’, Cell, vol. 176, no. 6, pp. 1248-1264, Mar. 2019, doi: 10.1016 / J. CELL.2019.01.021.

[0219]

[0035] M. Amadio, S. Govoni, and A. Pascale, ‘Targeting VEGF in eye neovascularization: What’s new?’, Pharmacol Res, vol. 103, pp. 253-269, Jan. 2016, doi: 10.1016 / j.phrs.2015.11.027.

[0220]

[0036] H. Shahzad et al., ‘Non-adherence and non-persistence to intravitreal anti-vascular endothelial growth factor (anti-VEGF) therapy: a systematic review and metaanalysis’, Syst Rev, vol. 12, no. 1, p. 92, Dec. 2023, doi: 10.1186 / S 13643 -023 -02261 -X.

[0221]

[0038] C. N. Thomas et al., ‘Emerging therapies and their delivery for treating age-related macular degeneration’, Br J Pharmacol, vol. 179, no. 9, pp. 1908-1937, May 2022, doi: 10.1111 / BPH.15459.

[0222]

[0039] H. Patel et al., ‘Izervay versus Syfovre: Two Rivals Recently Approved for Management of Geographic Atrophy’, Ann Afr Med, vol. 23, no. 3, pp. 523-524, 2024, doi: 10.4103 / AAM. AAM_186_23.

[0223]

[0040] J. Enoch, A. Ghulakhszian, M. Sekhon, D. P. Crabb, D. J. Taylor, and C. Dinah, ‘Exploring patient acceptability of emerging intravitreal therapies for geographic atrophy: A mixed-methods study’, Eye, vol. 37, no. 17, pp. 3634-3642, Dec. 2023, doi: 10.1038 / s41433-023-02571-3.

[0224]

[0041] B. Jacobs et al., ‘Patient preferences in retinal drug delivery’, Sci Rep, vol. 11, no. 1, p. 18996, Sep. 2021, doi: 10.1038 / s41598-021 -98568-7.

[0225]

[0042] U. Chakravarthy, B. G. Armendariz, and S. Fauser, ‘15 years of anti-VEGF treatment for nAMD: success or failure or something in between?’, 2022. doi: 10.1038 / s41433-022-02153-9.

[0226]

[0043] M. G. Maguire et al., ‘Five-Year Outcomes with Anti-Vascular Endothelial Growth Factor Treatment of Neovascular Age-Related Macular Degeneration: The Comparison of Age-Related Macular Degeneration Treatments Trials’, in Ophthalmology, 2016. doi: 10.1016 / j. ophtha.2016.03.045.

[0227]

[0044] I. Bachmeier et al., ‘Fibrosis in neovascular age-related macular degeneration: A review of definitions based on clinical imaging’, Surv Ophthalmol, vol. 68, no. 5, pp.

[0228] 835-848, Sep. 2023, doi: 10.1016 / j. survophthal.2023.03.004.

[0229]

[0045] Y. Ruan, S. Jiang, and A. Gericke, ‘Age-Related Macular Degeneration: Role of Oxidative Stress and Blood Vessels’, Int J Mol Sci, vol. 22, no. 3, p. 1296, Feb. 2021, doi: 10.3390 / IJMS22031296.

[0046] N. Nagai et al., ‘Non-responsiveness to intravitreal aflibercept treatment in neovascular age-related macular degeneration: implications of serous pigment epithelial detachment’, Sci Rep, vol. 6, no. 1, p. 29619, Jul. 2016, doi: 10.1038 / srep29619.

[0230]

[0047] G. Bontzos et al., ‘Nonresponders to Ranibizumab Anti-VEGF Treatment Are Actually Short-term Responders: A Prospective Spectral-Domain OCT Study’, Ophthalmol Retina, vol. 4, no. 12, pp. 1138-1145, Dec. 2020, doi: 10.1016 / j.oret.2019.11.004.

[0231]

[0048] P. A. Campochiaro et al., ‘Gene therapy for neovascular age-related macular degeneration by subretinal delivery of RGX-314: a phase l / 2a dose-escalation study’, The Lancet, vol. 403, no. 10436, pp. 1563-1573, Apr. 2024, doi: 10.1016 / S0140-6736(24)00310-6.

[0232]

[0049] D. S. Pereira et al., ‘Clinical proof of concept for anti-FGF2 therapy in exudative age-related macular degeneration (nAMD): phase 2 trials in treatment-naive and anti-VEGF pretreated patients’, Eye (Basingstoke), vol. 38, no. 6, 2024, doi: 10.1038 / s41433-023-02848-7.

[0233]

[0050] L. Zhou, W. Zhan, and X. Wei, ‘Clinical pharmacology and pharmacogenetics of prostaglandin analogues in glaucoma’, 2022. doi: 10.3389 / fphar.2022.1015338.

[0234]

[0051] G. A. Rodrigues et al., ‘Topical Drug Delivery to the Posterior Segment of the Eye: Addressing the Challenge of Preclinical to Clinical Translation’, Pharm Res, vol.

[0235] 35, no. 12, p. 245, Dec. 2018, doi: 10.1007 / S 11095-018-2519-X.

[0236]

[0052] D. J. Sidjanin, C. A. McCarty, R. Patchett, E. Smith, and R. A. Wilke, ‘Pharmacogenetics of Ophthalmic Topical [3-Blockers’, Per Med, vol. 5, no. 4, pp. 377-385, Jul. 2008, doi: 10.2217 / 17410541.5.4.377.

[0237]

[0053] H. Y. Chen, W. C. Huang, C. L. Lin, and C. H. Kao, ‘Association between topical beta-blockers and risks of cardiovascular and respiratory disease in patients with glaucoma: a retrospective cohort study’, BMJ Open, vol. 10, no. 7, 2020, doi: 10.1136 / bmjopen-2019-034361.

[0238]

[0054] P. M. Jedlowski and M. F. Jedlowski, ‘Topical ophthalmic beta-blockers are associated with ocular pseudopemphigoid: A pharmacovigilance study of antiglaucoma medications utilising the FDA adverse event reporting system’, Australasian Journal of Dermatology, vol. 63, no. 2, 2022, doi: 10.1111 / ajd.l3828.

[0239]

[0055] M. Moshirfar et al., ‘Use of Rho kinase Inhibitors in Ophthalmology: A Review of the Literature’, Medical Hypothesis, Discovery and Innovation in Ophthalmology, vol. 7, no. 3, p. 101, 2018, Accessed: Nov. 19, 2024. [Online]. Available: https: / / pmc.ncbi.nlm.nih.gov / articles / PMC6205677 /

[0056] L.-C. Liu, Y.-H. Chen, and D.-W. Lu, ‘The Application of Rho Kinase Inhibitors in the Management of Glaucoma’, Int J Mol Sci, vol. 25, no. 11, p. 5576, May 2024, doi: 10.3390 / ijms25115576.

[0240]

[0057] T. Sarenac, A. B. Turkanovic, P. Ferme, and T. Gracner, ‘A Review of Selective Laser Trabeculoplasty: “The Hype Is Real’”, J Clin Med, vol. 11, no. 13, p. 3879, Jul.

[0241] 2022, doi: 10.3390 / JCM11133879 / S1.

[0242]

[0058] T. Sarenac, A. B. Turkanovic, P. Ferme, and T. Gracner, ‘A Review of Selective Laser Trabeculoplasty: “The Hype Is Real’”, J Clin Med, vol. 11, no. 13, p. 3879, Jul.

[0243] 2022, doi: 10.3390 / JCM11133879 / S1.

[0244]

[0059] G. S. Pande, P. Tidake, G. S. Pande, and P. Tidake, ‘Laser Treatment Modalities for Diabetic Retinopathy’, Cureus, vol. 14, no. 10, Oct. 2022, doi: 10.7759 / CUREUS.30024.

[0245]

[0060] D. W. Hutton, A. R. Glassman, J. D. Stein, N. M. Bressler, and J. K. Sun, ‘Costs of Managing Diabetic Macular Edema With Good Visual Acuity With Aflibercept, Laser, or Observation: DRCR Retina Network Protocol V’, Am J Ophthalmol, vol. 230, pp. 297-302, Oct. 2021, doi: 10.1016 / J. AJ0.2021.02.033.

[0246]

[0061] A. S. Al Sakini et al., ‘Diabetic macular edema (DME): dissecting pathogenesis, prognostication, diagnostic modalities along with current and futuristic therapeutic insights’, Int J Retina Vitreous, vol. 10, no. 1, p. 83, Oct. 2024, doi: 10.1186 / s40942-024-00603-y.

[0247]

[0062] P. U. Dugel, F. Bandello, and A. Loewenstein, ‘Dexamethasone intravitreal implant in the treatment of diabetic macular edema’, Clin Ophthalmol, vol. 9, p. 1321, Jul. 2015, doi: 10.2147 / OPTH. S79948.

[0248]

[0063] A. Petersen, T. Carlsson, J. O. Karlsson, S. Jonhede, and M. Zetterberg, ‘Effects of dexamethasone on human lens epithelial cells in culture’, Mol Vis, vol. 14, p. 1344, Jul. 2008, Accessed: Nov. 19, 2024. [Online]. Available: https: / / pmc.ncbi.nlm.nih.gov / articles / PMC2480483 /

[0249]

[0064] J. H. Lee, J. Y. Park, J. S. Kim, and J. H. Hwang, ‘Rapid progression of cataract to mature stage after intravitreal dexamethasone implant injection: A case report’, BMC Ophthalmol, vol. 19, no. 1, pp. 1-4, Jan. 2019, doi: 10.1186 / S 12886-018-1008-7 / FIGURES / 3.

[0250]

[0065] M. L. Salvetat et al., ‘The Treatment of Diabetic Retinal Edema with Intravitreal Steroids: How and When’, 2024. doi: 10.3390 / jcml3051327.

[0066] R. E. Coffee, L. Jiang, and S. A. Rahman, ‘Proliferative vitreoretinopathy: Advances in surgical management’, Int Ophthalmol Clin, vol. 54, no. 2, pp. 91-109, 2014, doi: 10.1097 / 110.0000000000000023.

[0251]

[0067] A. Ullah, C. A. Toth, H. W. Burnett, J. W. Butler, J. H. Levy, and J. D. Benner, ‘Low-Dose Intravitreal Methotrexate for Proliferative Vitreoretinopathy’, Ophthalmic Surg Lasers Imaging Retina, vol. 54, no. 3, 2023, doi: 10.3928 / 23258160-20230220-01.

[0252]

[0068] J. D. Benner, D. Dao, J. W. Butler, and K. I. Hamill, ‘Intravitreal methotrexate for the treatment of proliferative vitreoretinopathy’, BMJ Open Ophthalmol, vol. 4, no.

[0253] 1, 2019, doi: 10.1136 / bmjophth-2019-000293.

Claims

CLAIMS1. An RNA-cell delivery molecule complex for use in treating or preventing one or more ocular diseases or disorders.

2. The RNA-cell delivery molecule complex for use according to claim 1, wherein the cell delivery molecule is a peptide or a liposome.

3. The RNA-cell delivery molecule complex for use according to claim 2, wherein the peptide is a cell-penetrating peptide.

4. The RNA-cell delivery molecule complex for use according to claim 2 or claim 3, wherein the peptide comprises or consists of the amino acid sequence:(Xl)a-(X2)b-LYRLFRKS-(X3)c-(X4)d-(X5)e-NLKPFERHARAC, in which a is 0 or 1 and, if a is 1, XI is selected from an alanine residue, a valine residue or a glycine residue;b is independently 0 or 1 and, if b is 1, X2 is selected from an alanine residue, a valine residue or a glycine residue;c is independently 0 or 1 and, if c is 1, then X3 is an aromatic residue selected from a histidine or a tryptophan residue;d is 1 and X4 is an aromatic residue selected from a tryptophan or a histidine residue; ande is 1 and X5 is a histidine or a tryptophan residue.

5. The RNA-cell delivery molecule complex for use according to claim 4, wherein the peptide comprises or consists of the amino acid sequence AALYRLFRKSWHNLKPFERHARAC (SEQ ID NO: 1), or a salt or amide thereof.

6. The RNA-cell delivery molecule complex for use according to any of claims 1-5, wherein the RNA encodes a protein which is known to provide a therapeutic benefit to one or more ocular diseases.

7. The RNA-cell delivery molecule complex for use according to claim 6, wherein the complex comprises one or more RNA molecule.

8. The RNA-cell delivery molecule complex for use according to claim 7, wherein the one or more RNA molecule encodes all of part of the human decorin protein.

9. The RNA-cell delivery molecule complex for use according to claim 7 or claim 8, wherein the one or more RNA molecule comprises or consists of the sequence of SEQ ID NO: 2, or a sequence with at least 90% homology thereto.

10. The RNA-cell delivery molecule complex for use according to claim 7, wherein the one or more RNA molecule comprises or consists of one or more siRNA.

11. The RNA-cell delivery molecule complex for use according to claim 10, wherein the one or more siRNA comprises or consist of SEQ ID NO: 3 and / or SEQ ID NO: 4.

12. The RNA-cell delivery molecule complex for use according to any of claims 1-11, wherein the one or more ocular diseases or disorders is associated with fibrosis, extracellular matrix dysfunction, oxidative stress, and / or autophagy.

13. The RNA-cell delivery molecule complex for use according to any of claims 1-12, wherein the one or more ocular diseases or disorders is selected from AMD such as dry AMD or wet AMD, glaucoma, diabetic retinopathy and proliferative vitreoretinopathy (PVR), ocular surface disease such as corneal scarring, dry eye disease (DED), conjunctival scarring, keratoconus, Fuchs Endothelial Corneal Dystrophy, retinopathies, and meibomian gland disease.

14. The RNA-cell delivery molecule complex for use according to any of claims 1-13, wherein the RNA-peptide complex is provided as a nanoparticle, and / or in a composition, optionally wherein the composition is a pharmaceutical composition.

15. The RNA-cell delivery molecule complex for use according to any of claims 1-13, wherein the RNA-peptide complex is to be administered topically, via transscleral route, via transepithelial route, systemically or via intraocular injection.

16. A method of treating or preventing one or more ocular diseases or disorders, comprising administering a therapeutically effective amount of a RNA-cell delivery molecule complex of any of claims 1-11 to a subject in need thereof.

17. Use of a RNA-peptide complex of any of claims 1-11 in the manufacture of a medicament for treating or preventing one or more ocular diseases or disorders in a subject.

18. A method of delivering an anionic cargo to a cell, comprising administering a RNA-peptide complex of any of claims 1-11 to a cell.

19. A method of inducing an immune response in a subject in need thereof, comprising administering a RNA-peptide complex of any of claims 1-10 to the subject.

20. A complex comprising an RNA sequence of SEQ ID NO: 3 and / or SEQ ID NO: 4, and a peptide of SEQ ID NO: 1, or a salt or amide thereof.

21. A complex comprising an RNA sequence of SEQ ID NO: 2, and a peptide of SEQ ID NO: 1, or a salt or amide thereof.

22. A complex comprising an RNA sequence of SEQ ID NO: 3 and / or SEQ ID NO: 4, an RNA sequence of SEQ ID NO: 2, and a peptide of SEQ ID NO: 1, or a salt or amide thereof.

Images