Fibroblast cell line isolated from male breast carcinoma

Abstract

The present invention relates to a fibroblast cell line isolated from male breast carcinoma (MBCAF-1), a method for isolating, culturing, and immortalizing said cell line, and the use of said cell line as an experimental model in vitro.

Description

[0001] FIBROBLAST CELL LINE ISOLATED FROM MALE BREAST CARCINOMA

[0002] The present invention relates to a fibroblast cell line isolated from male breast carcinoma, a method for preparing said cell line, and the in vitro use of said cell line as an experimental model.

[0003] STATE OF THE ART

[0004] Male breast carcinoma is a rare tumor, with an incidence rate in Italy and the Western world of approximately one case per 100,000. In recent years, the incidence has been increasing and, although the symptoms and signs may be early due to the scarcity of glandular tissue in men, diagnosis is almost always late because patients underestimate the problem [Khan NAJ, Tirona M. An updated review of epidemiology, risk factors, and management of male breast cancer. Med Oncol. 2021; 38(4):39.; Co M, Lee A, Kwong A. Delayed presentation, diagnosis, and psychosocial aspects of male breast cancer. Cancer Med. 2020;9(10):3305-3309],

[0005] Multiple experimental evidence has confirmed the fundamental role played by the tumor microenvironment during neoplastic development and progression. Cancer-associated fibroblasts (CAFs) are one of the most abundant cell populations in the tumor microenvironment. Numerous studies have shown that CAFs promote the growth, survival, migration, and invasion of tumor cells through the secretion of multiple factors, including hormones, growth factors, and pro-inflammatory molecules such as cytokines and chemokines. CAFs are also responsible for the deposition of collagen and various components of the extracellular matrix (ECM) in the tumor microenvironment. Many solid tumors, in fact, have a different protein profile than their normal ECM counterparts, and many of these proteins (including metalloproteases, MMPs) interact directly with tumor cells through integrins or surface receptors, thus influencing not only cell proliferation and migration, but also invasion and metastasis processes [Chen X, Song E. Turning foes to friends: targeting cancer-associated fibroblasts. Nat Rev Drug Discov. 2019; 18(2):99-115].

[0006] In this context, it is important to note that, to date, there are no cell lines derived from male breast cancer, either epithelial or belonging to the tumor microenvironment. This is due to the fact that only 0.5-1% of all breast cancer cases affect men, limiting the pool of tissue available for the isolation of tumor cells and adjacent stroma. The isolation of CAFs (tumor-associated fibroblasts) is a more complex operation than the isolation of normal fibroblasts (healthy tissue-associated fibroblasts) due to the biological characteristics assumed by CAFs in the context of the tumormicroenvironment. In particular, CAFs show high phenotypic and molecular heterogeneity compared to normal fibroblasts, as a result of their exposure to biochemical and mechanical stimuli specific to the tumor microenvironment. CAFs can derive from normal fibroblasts, mesenchymal or epithelial cells (through epithelial-mesenchymal transition), therefore their isolation is particularly laborious. Furthermore, the activation and phenotype of CAFs can vary over time and space, depending on the stage of the tumor and local conditions such as physical and functional interaction with tumor cells, immune cells, and the extracellular matrix. This makes it difficult to isolate them without contamination from other cell populations and without altering their unique properties during the isolation process.

[0007] The problems highlighted above limit the isolation and culture of CAFs derived from male breast tumors and, consequently, omic studies aimed at characterizing tumor phenotypes.

[0008] SUMMARY OF THE INVENTION

[0009] The authors of the present invention have obtained a fibroblast cell line (CAFs) isolated from male breast cancer (MBCAF-1). Although, as mentioned above, there are many problems associated with obtaining a fibroblast cell line from a tumor or male breast tumor sample, the authors have succeeded in obtaining a cell culture of fibroblasts associated with and isolated from male breast cancer (Figure 1A), also demonstrating, following experimental characterization, that the cells themselves retain their mesenchymal characteristics (Figure 1B).

[0010] Moreover, the cell line has been immortalized, through stable silencing of the gene encoding the p16 protein and stable overexpression of the catalytic subunit of the telomerase enzyme (Figures 1C and 1D). Numerous experimental findings demonstrate that the tumor microenvironment represents the entire ecosystem surrounding tumor cells and that it significantly influences their growth and tendency to metastasize. In this context, this fibroblast cell line (MBCAF-1) provides a fundamental experimental model for multiple molecular and omic studies aimed at evaluating the transcriptomic, proteomic, metabolic, secretomic, and biological profile that characterizes the male breast tumor microenvironment. The immortalized CAF cell line obtained from male breast cancer (MBCAF-1) represents a unique experimental model of surprising usefulness in the study of the pathogenesis of breast cancer in males, as well as in the evaluation of the efficacy of personalized anticancer compounds or therapies. CAFs isolated from male breast cancer (MBCAF-1) represent a unique model for use in multiple in vitro and in vivo studies aimed at understanding themolecular mechanisms involved in the development and progression of breast cancer in males. In addition, these cells can be used to identify specific markers of the male breast tumor microenvironment to be evaluated as new targets in the treatment of this neoplasm.

[0011] Therefore, object of the invention are.

[0012] - A fibroblast cell line isolated from male breast carcinoma

[0013] - A method for the in vitro preparation of a fibroblast cell line isolated from male breast carcinoma comprising the following steps:

[0014] a) mechanically dissecting a sample of male breast tumor isolated from a patient in order to obtain a fragmented sample;

[0015] b) enzymatically digesting said fragmented sample;

[0016] c) performing cell fractionation of the digestion product by differential centrifugation in order to obtain a fibroblast cell suspension;

[0017] d) culturing the fibroblast cell suspension obtained in step c);

[0018] e) optionally characterizing the cells for the evaluation of the mesenchymal phenotype.

[0019] - In vitro use of the fibroblast cell line isolated from male breast carcinoma as an experimental model.

[0020] GLOSSARY

[0021] Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings commonly understood by those skilled in the art. In addition, unless otherwise required by the context, singular terms shall include plurals and plural terms shall include the singular.

[0022] Generally, the nomenclature used in connection with, and techniques of, cell and tissue cultures, molecular biology, immunology, microbiology, genetics, and chemistry, and hybridization of proteins and nucleic acids described herein are those well known and commonly used in the art. The methods and techniques of the present invention are generally conducted according to conventional methods well known in the art and as described in various general and more specific sources that are cited and discussed throughout this description unless otherwise indicated.

[0023] At any point in this description or in the claims, the expression “comprising” or ‘comprises’ may be replaced by “consisting of’ or “consists of.”

[0024] DETAILED DESCRIPTION OF FIGURESFigure 1: (A) Representative optical microscopy images of immortalized cancer-associated fibroblasts (CAFs) isolated from a male breast cancer sample (MBCAF-1). Scale bars: 650 pm. (B) Representative fluorescence microscopy images of FAP and cytokeratin 14 protein expression in MBCAF-1 cells; DAPI is used for nuclear staining. Scale bar: 100 pm. (C) Protein levels of p16 in primary non-immortalized CAFs and MBCAF-1 cells, with densitometric analysis of blots normalized to p-actin protein expression. (*) indicates p < 0.05. (D) Evaluation of telomerase activity in primary nonimmortalized CAFs and MBCAF-1 cells. (*) indicates p < 0.05.

[0025] DESCRIPTION OF THE SEQUENCES SEQ ID NO: 1 of a short hairpin RNA fragment

[0026] actcgggaaacttagatcatca

[0027] DETAILED DESCRIPTION OF THE INVENTION

[0028] The present invention relates to a fibroblast cell line isolated from male breast cancer (MBCAF-1) (Figure 1A).

[0029] In one embodiment, said cell line has a mesenchymal phenotype. In fact, the authors have demonstrated that fibroblasts isolated from a male breast tumor or tumor sample retain the mesenchymal characteristics (Figure 1B).

[0030] In one embodiment, said cell line is an immortalized cell line. The term “immortalized cell line” refers to a population of cells that has been genetically modified to grow indefinitely in culture, overcoming the normal process of cell senescence and limited division.

[0031] In the present description, the expression “immortalized fibroblast cell line” refers to a fibroblast cell line as described above and genetically modified to grow indefinitely in culture.

[0032] In one embodiment, said line is immortalized by overexpression of an enzyme with telomerase activity and silencing of the expression of one or more proteins that regulate the cell cycle.

[0033] In a preferred embodiment, said telomerase enzyme is the catalytic subunit of telomerase, in particular human telomerase identified as hTERT (human Telomerase reverse transcriptase), and said cell cycle-regulating protein is the p16 protein.

[0034] In one embodiment, the cell line has the following cellular marker expression profile: CK14+, FAP+, p16-, hTERT+.

[0035] In a preferred embodiment, said cell line is the immortalized fibroblast cell line isolated from male breast cancer deposited at the Leibniz-lnstitut DMSZ - German Collection ofMicroorganisms and Cell Cultures GmbH under deposit number DSM ACC3378 on behalf of the University of Calabria.

[0036] The present invention also relates to a method for the in vitro preparation of a fibroblast cell line isolated from male breast cancer comprising the following steps

[0037] a) mechanically dissecting a sample of male breast tumor isolated from a patient in order to obtain a fragmented sample;

[0038] b) enzymatically digesting said fragmented sample;

[0039] c) performing cell fractionation of the digestion product by differential centrifugation in order to obtain a fibroblast cell suspension;

[0040] d) culturing the fibroblast cell suspension obtained in step c);

[0041] e) optionally characterizing the cells for the evaluation of the mesenchymal phenotype. The term “differential centrifugation” refers to a technique used to separate distinct cell populations or other cells from a mixed sample. The process involves the use of centrifuges at progressive speeds: cells with greater weight and size are the first to settle, while cells with lower weight and size remain in suspension. Each cell type can then be isolated into separate fractions for further analysis.

[0042] In one embodiment, said method is implemented for the production of said cell line wherein said cell line is immortalized, further comprising the steps of

[0043] f) transforming the cells to obtain immortalized cells

[0044] g) culturing the suspension of immortalized cells

[0045] In one embodiment, said transformation of the cells is carried out by infecting the cells with retroviruses comprising a plasmid encoding a telomerase enzyme, a sequence that allows gene silencing of one or more proteins that regulate the cell cycle, and an antibiotic selection marker.

[0046] In a preferred embodiment, said retrovirus is recombinant murine stem cell virus (MSCV).

[0047] In a preferred embodiment, said plasmid is MSCVpic2neo-hTERT-p16 shRNA.

[0048] In one embodiment, said sequence that allows gene silencing of one or more proteins that regulate the cell cycle is a short hairpin RNA (shRNA).

[0049] In a preferred embodiment, said short hairpin RNA (shRNA) sequence is the sequence having SEQ ID NO:1

[0050] In a preferred embodiment, said enzyme with telomerase activity is the catalytic subunit of telomerase identified as hTERT, and said protein that regulates the cell cycle is the p16 protein

[0051] In one embodiment, the method further comprises a step of characterizing the treated cells to evaluate the immortalization that has occurred, and preferably saidcharacterization is conducted through immunoblotting techniques and enzyme activity assays.

[0052] In one embodiment, said mechanical dissection may be conducted by manual dissection, ultrasonic dissection, mechanical grinding dissection, or laser. The list provided is illustrative and not limiting; those skilled in the art are familiar with the methods commonly used for this purpose and will therefore be able to select the most suitable technique.

[0053] In one embodiment, the enzymes in said enzymatic digestion are selected from trypsin, collagenase, DNase, and hyaluronidase.

[0054] In a preferred embodiment, said enzymes are present in an enzyme mixture comprising 400 III of collagenase, 100 IU of hyaluronidase, 10% fetal bovine serum, 1% penicillin / streptomycin, and 1% amphotericin B, and said enzymatic digestion is performed by incubating the tissue fragments with the enzyme mixture for 18 hours at 37°C with agitation.

[0055] In one embodiment of the method as described above, differential centrifugation comprises the following steps

[0056] h) performing centrifugation at least at 90 x g for at least 2 minutes

[0057] i) recovering the supernatant

[0058] and in a preferred embodiment, differential centrifugation further comprises the following steps

[0059] j) performing centrifugation at least at 485 x g for at least 5, preferably at least 8 minutes

[0060] k) recovering the sediment.

[0061] In fact, as described in detail in the examples section, the tumor pieces were placed in a centrifuge tube for low-speed centrifugation (90 x g for 2 minutes), after which the larger cells (epithelial cells) formed a sediment (or pellet) that was removed, while the supernatant (liquid containing smaller cells) was subjected to a subsequent centrifugation at a higher speed (485 x g for 8 minutes), allowing the smaller cells (fibroblasts) to sediment.

[0062] In one embodiment, a fibroblast cell line is maintained in culture with DMEM / F-12 comprising 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin.

[0063] The authors demonstrated that fibroblasts isolated from male breast cancer retain the characteristic mesenchymal phenotype (Figure 1B).

[0064] In one embodiment, the characterization performed in step e) of the method described above consists of cell phenotyping conducted through immunofluorescenceexperiments, wherein the markers used in said immunofluorescence experiments are mesenchymal protein (FAP) and epithelial protein cytokeratin 14 (CK14).

[0065] In one embodiment, said immortalized fibroblast cell line is maintained in culture with DMEM / F-12 comprising 10% fetal bovine serum (FBS), 1% penicillin / streptomycin, and an antibiotic for the selection of immortalized cells (neomycin 50ng / ml).

[0066] The invention also relates to the in vitro use of the cell line as an experimental model. In particular, in one embodiment, said experimental model is used for the study of the pathogenesis, diagnosis, treatment, or prevention of recurrence of male breast cancer. In one embodiment, said study is aimed at evaluating the transcriptomic, proteomic, metabolic, secretomic, and biological profile that characterizes the microenvironment of male breast cancer.

[0067] In one embodiment, the use is aimed at identifying specific markers of the microenvironment of male breast cancer, preferably wherein said markers are used as diagnostic markers of male breast cancer.

[0068] In a further embodiment, the use is aimed at identifying new molecular targets in the treatment of male breast cancer.

[0069] DECLARATION PURSUANT TO ART. 170 OF THE ITALIAN C.P.I With reference to the cell line of CAFs isolated from male breast cancer (MBCAF-1), we declare that the aforementioned cells were obtained following the express informed consent, for their collection and use, of the person from whom the material was collected, in accordance with current legislation.

[0070] In compliance with Article 170bis, paragraph 4 of the Italian C.P.I., we declare that: with reference to the biological material containing genetically modified microorganisms or organisms that are the subject of or used in this application, the obligations arising from national or EU regulations have been complied with, and in particular, the provisions of paragraph 6 of Legislative Decrees No. 206 of April 12, 2001, and No.

[0071] 224 of July 8, 2003, concerning such modifications.

[0072] EXAMPLES

[0073] The immortalized CAF cell line (MBCAF-1) was isolated from a male breast tumor through mechanical dissection and enzymatic digestion of the tissue sample.

[0074] The isolation of CAFs was achieved as detailed below. The male breast tumor sample was cut into pieces 1-2 mm in diameter using sterilized scissors and scalpels. The tumor pieces were then placed in a digestion solution containing 400 IU of collagenase (cat. no. C5894, Merck Life Science), 100 IU of hyaluronidase (cat. no. H3506, MerckLife Science), 10% fetal bovine serum (cat. no. 26140079, Thermo Fisher Scientific), 1% penicillin / streptomycin (cat. no. PO781, Thermo Fisher Scientific), 1% amphotericin B (cat. no. A2411, Merck Life Science) and incubated for 18 hours at 37 °C with agitation. Each tumor piece was then subjected to differential centrifugation: a technique used to separate cells of different sizes or cellular components or particles suspended in a liquid based on their density, size, and shape. Differential centrifugation is based on the application of centrifugal force, which accelerates the sedimentation of different particles (such as cell organelles, biomolecules, or cells) moving in the liquid medium according to their mass and density: larger, denser particles sediment faster to the bottom of the container, while smaller ones remain in suspension longer. In this specific case, the tumor pieces were placed in a centrifuge tube for low-speed centrifugation (90 x g for 2 minutes), after which the larger cells (epithelial cells) formed a sediment (or pellet) that was removed, while the supernatant (liquid containing smaller cells) was subjected to a subsequent centrifugation at a higher speed (485 x g for 8 minutes), allowing the smaller cells (fibroblasts) to settle. This sediment was then suspended and cultured in DMEM / F-12 medium (containing 10% fetal bovine serum and 1% penicillin / streptomycin) (Fig. 1A).

[0075] The cells thus obtained were characterized through immunofluorescence experiments in order to evaluate their mesenchymal nature (Fig. 1B). The markers used in these experiments were: the mesenchymal protein FAP and the epithelial protein cytokeratin 14 (CK14) (Fig. 1B). The CAFs were then subjected to experimental procedures that allowed their immortalization. In particular, they were infected with Recombinant murine stem cell virus (MSCV) retroviruses containing a plasmid encoding: the catalytic subunit of the telomerase enzyme (hTERT, NM_001193376.3); a short hairpin RNA (shRNA) sequence actcgggaaacttagatcatca (SEQ ID NO:1) that allows the silencing of p16 protein expression (cell cycle regulator); an antibiotic selection marker (neomycin). Specifically, the plasmid (MSCVpic2neo-hTERT-p16 shRNA) was initially transformed into NEB® Stable Competent E. coli (High Efficiency) bacterial cells (New England Biolabs, #C3040H) through the induction of a heat shock. These cells were maintained in LB Broth Base (Lennox) in the presence of 100 pg / ml of Ampicillin, necessary for the selection of transformed bacterial colonies. Subsequently, the amplified plasmid was isolated and purified using the QIAGEN Plasmid Maxi Kit. Following evaluation of plasmid integrity and quality by agarose gel electrophoresis, the plasmid was transfected using Lipofectamine™ LTX Reagent into the 293T Platinum-A (Plat-A) cell line, engineered for high-efficiency retroviral packaging and increased stability (Cell Biolabs, Inc #RV-102), maintained in DMEM high glucose culture medium containing10% fetal bovine serum and free of antibiotics. After 48 hours of transfection, the supernatant of the 293T Platinum-A (Plat-A) cells, containing the retroviral titre, was collected, centrifuged at 3000 rpm for 15 minutes and filtered using sterile cellulose acetate syringe filters with 0.45 pm pores. This medium, to which 3 pg / ml of the cationic polymer polybrene was added, was placed in contact for 24 hours with the male mammary CAFs to be immortalized (MBCAF-1). The MBCAF-1 cells were then transferred to DMEM / F-12 (containing 10% fetal bovine serum and 1% penicillin / streptomycin) for 72 hours, after which selection was initiated with 3 mg / ml neomycin for 14 days.

[0076] Treatment with the antibiotic neomycin for 14 days allowed only infected and therefore immortalized cells to be selected. The effective immortalization of CAFs was validated through immunoblotting experiments (which confirmed the effective silencing of p16) (Fig. 1C) and telomerase activity assessment assays (which confirmed high enzyme activity compared to primary CAFs) (Fig. 1D). The immortalized CAFs (MBCAF-1) thus obtained are maintained in culture in DMEM / F-12 (containing 10% fetal bovine serum, 1% penicillin / streptomycin, and 50ng / ml neomycin). The cell line obtained was deposited under the Budapest Treaty at the LEIBNIZ-INSTITUT DSMZ, on behalf of the University of Calabria, on April 10, 2024, with deposit number: DSM ACC3378.

Claims

CLAIMS1. A fibroblast cell line isolated from male breast carcinoma.

2. The cell line according to claim 1, wherein said cell line has a mesenchymal phenotype.

3. The cell line according to any one of claims 1 or 2, wherein said cell line is an immortalized cell line.

4. The cell line according to claim 3, wherein said cell line is immortalized by overexpression of an enzyme with telomerase activity and silencing of the expression of one or more proteins that regulate the cell cycle.

5. The cell line according to any one of claims 1 to 4, wherein said telomerase-active enzyme is the catalytic subunit of human telomerase identified as hTERT6. The cell line according to any one of claims 1 to 5, wherein said cell cycle-regulating protein is the p16 protein7. The cell line according to any one of claims 1 to 6, wherein said cell line has the following cell marker expression profile: CK14+, FAP+, p16-, hTERT+.

8. The cell line according to any one of claims 1 to 7, wherein said cell line is the immortalized fibroblast cell line isolated from male breast carcinoma deposited at the Leibniz-lnstitut DSMZ - German Collection of Microorganisms and Cell Cultures GmbH under deposit number DSM ACC33789. A method for the in vitro preparation of a fibroblast cell line isolated from male breast carcinoma comprising the following stepsa) mechanically dissecting a sample of male breast tumor isolated from a patient in order to obtain a fragmented sample;b) enzymatically digesting said fragmented sample;c) performing cell fractionation of the digestion product by differential centrifugation in order to obtain a fibroblast cell suspension;d) culturing the fibroblast cell suspension obtained in step c);e) optionally characterizing the cells for the evaluation of the mesenchymal phenotype10. The method according to claim 9, wherein said cell line is immortalized, further comprising the steps off) transforming the cells to obtain immortalized cellsg) culturing the suspension of immortalized cells11. The method according to any one of claims 9 or 10, wherein said transformation of the cells is carried out by infecting the cells with a retrovirus comprising a plasmid encoding an enzyme with telomerase activity, a sequence that allows gene silencing of one or more proteins that regulate the cell cycle, and an antibiotic selection marker.

12. The method according to any one of claims 9 to 11, wherein said retrovirus is recombinant murine stem cell virus (MSCV).

13. The method according to any one of claims 9 to 12, wherein said plasmid is MSCVpic2neo-hTERT-p16 shRNA.

14. The method according to any one of claims 9 to 13, wherein said sequence that allows gene silencing of one or more proteins that regulate the cell cycle is a short hairpin RNA for the p16 protein (shRNA)15. The method according to any one of claims 9 to 14, wherein said short hairpin RNA (shRNA) sequence is the sequence having SEQ ID NO:

116. The method according to any one of claims 9 to 15, wherein said enzyme with telomerase activity is the catalytic subunit of human telomerase identified as hTERT17. The method according to any one of claims 9 to 16, wherein said cell cycle regulating protein is the p16 protein18. The method according to any one of claims 9 to 17, further comprising a step of characterizing the treated cells to assess the occurrence of immortalization19. The method according to any one of claims 9 to 18, wherein said characterization is conducted through immunoblotting techniques and enzyme activity assays.

20. The method according to any one of claims 9 to 19, wherein said mechanical dissection may be conducted by manual dissection, ultrasonic dissection, mechanical grinding dissection, or laser.

21. The method according to any one of claims 9 to 20, wherein the enzymes in said enzymatic digestion are selected from trypsin, collagenase, DNase, hyaluronidase.

22. The method according to any one of claims 9 to 21, wherein said enzymes are present in an enzyme mixture comprising 400 III of collagenase, 100 IU of hyaluronidase, 10% fetal bovine serum, 1% penicillin / streptomycin, and 1% amphotericin B.

23. The method according to any one of claims 9 to 22, wherein said enzymatic digestion is performed by incubating the tissue fragments with the enzyme mixture for at least 10 hours, preferably 18 hours at 37°C, preferably with agitation.

24. The method according to any one of claims 9 to 23, wherein said differential centrifugation comprisesh) performing centrifugation at least at 90 x g for at least 2 minutesi) recovering the supernatant25. The method according to any one of claims 9 to 24, wherein said differential centrifugation comprises :h) performing centrifugation at least at 90 x g for at least 2 minutesi) recovering the supernatantj) performing a second centrifugation at least at 485 x g for at least 8 minutes k) recovering the sediment26. The method according to any one of claims 9 to 25, wherein said fibroblast cell line is maintained in culture with DMEM / F-12 comprising 10% fetal bovine serum (FBS) and 1% penicillin / streptomycin.

27. The method according to any one of claims 9 to 26, wherein said characterization performed in step e) consists of a phenotyping of the cells conducted through immunofluorescence experiments.

28. The method according to any one of claims 9 to 27, wherein the markers used in said immunofluorescence experiments are mesenchymal protein (FAP) and epithelial protein cytokeratin 14 (CK14).

29. The method according to any one of claims 9 to 28, wherein said immortalized fibroblast cell line is maintained in culture with DMEM / F-12 comprising 10% fetal bovine serum (FBS), 1% penicillin / streptomycin, and an antibiotic, preferably 50 ng / mL neomycin, for the selection of immortalized cells.

30. Use in vitro of the cell line according to any one of claims 1 to 8 as an experimental model.

31. Use according to claim 30, wherein said experimental model is used for the study of the pathogenesis, diagnosis, treatment, or prevention of recurrence of male breast carcinoma.

32. Use according to any one of claims 30 or 31, wherein said study is aimed at evaluating the transcriptomic, proteomic, metabolic, secretomic, and biological profile characterizing the microenvironment of male breast cancer.

33. Use according to any one of claims 30 to 32 for the identification of specific markers of the microenvironment of male breast carcinoma.

34. Use according to any one of claims 30 to 33 wherein said markers are used as diagnostic markers of male breast carcinoma.

35. Use according to any one of claims 30 to 34 for the identification of new molecular targets in the treatment of male breast carcinoma.

Images