Regulatory element for increasing RNA stability or mRNA translation and construct comprising same

Abstract

The present invention relates to a novel regulatory element. The regulatory element according to one embodiment is capable of increasing RNA stability or mRNA translation of a transcription product of a target gene, thereby increasing the expression level of the target protein, and can be effectively used in systems requiring precise control of gene expression, such as gene therapy, vaccine development, production of protein therapeutics, and the like.

Description

[0001] specification

[0002] Title of Invention: Regulatory element for increasing RNA stability or mRNA translation and construct comprising the same

[0003] Technology field

[0004] The present invention relates to a regulatory element for RNA stability or mRNA translation increase and the use of the same for RNA stability or mRNA increase.

[0005] Background alcohol

[0006] Nucleic acid-based therapeutics are attracting attention as innovative platforms across various fields. In particular, following the successful commercialization of COVID-19 vaccines, messenger RNA (mRNA) technology is garnering interest as an innovative platform extending beyond infectious disease prevention to diverse areas such as cancer treatments, protein replacement therapy, and gene editing. While mRNA-based therapeutics possess the powerful advantage of being able to directly generate target proteins within the body, the inherent chemical instability of RNA molecules and their short half-lives remain technical challenges that need to be addressed. Furthermore, viral vectors are widely applied in cell and gene therapy; technologies that increase protein production and expression duration are crucial for enhancing therapeutic efficacy and reducing dosage and side effects.

[0007] The degradation rate and translation efficiency of mRNA within cells serve as critical steps determining the total amount of protein produced and are primarily controlled by the deadenylation process, in which the poly(A) tail at the 3' end is shortened. The rate of deadenylation is mainly determined by the untranslated region (UTR). Therefore, to ensure therapeutic efficacy, strategies to optimize UTRs to improve mRNA stability and sustain protein expression within cells are critically required.

[0008] The size of the regulatory element is a critical factor in the design of genetic information-based therapeutics. If the element is excessively long, the overall size of the mRNA construct increases, which can reduce loading efficiency within carriers such as lipid nanoparticles (LNPs) and lead to complexity in the manufacturing process. Furthermore, if the regulatory element contains sequences not directly related to gene expansion, most of the redundant sequences have a negative impact on gene expansion; therefore, it is important to remove redundant sequences from the regulatory element and include only the sequences essential for gene expansion. Particularly when delivering mRNA using viral vectors such as adeno-associated viruses (AAVs), miniaturization of the regulatory element is an essential technical challenge due to the vector's limited cargo capacity.

[0009] Therefore, there is a need to discover regulatory elements of the smallest functional unit that can maximize the efficiency of nucleic acid-based therapeutics by minimizing the length of the insertion sequence while maintaining high-impact characteristics even in various cellular environments. Prior Art Literature

[0010] Non-patent literature

[0011] Kim, D., Lee, Ys. , Jung, S.J. et al. Viral hi jacking of the TENT4-ZCCHC14 complex protects viral RNAs via mixed tai 1 ing. Nat Struct Mol Biol 27, 581-588 (2020). https: / / doi.org / 10.1038 / s41594-020-0427-3

[0012] Detailed description of the invention

[0013] Technical challenges

[0014] One aspect is to provide regulatory elements for RNA stability and / or increased translation of mRNA.

[0015] Another aspect is providing regulatory elements derived from fragments of the viral genome.

[0016] Another aspect is to provide a control element containing a base sequence of sequence number 1; or a base sequence having at least 80% identity with it.

[0017] Another aspect is to provide a construct, vector, or recombinant host cell comprising a target gene; and the regulatory element.

[0018] Another aspect is to provide a composition comprising the above-mentioned construct, vector, or recombinant host cell.

[0019] Another aspect is to provide a method for preparing the above construct, vector, recombinant host cell, or composition.

[0020] Another aspect provides a method for increasing RNA stability and / or mRNA translation of a target gene, comprising the step of inserting or linking the above regulatory element to a UTR of the target gene.

[0021] Another aspect is to provide a use for increasing RNA stability and / or mRNA translation of the above construct, vector, recombinant host cell, or composition.

[0022] Another aspect is to provide a use for the production of the mRNA construct or target protein of the above construct, vector, recombinant host cell, or composition.

[0023] Another aspect is to provide a method for preventing, improving, or treating a disease comprising the step of administering the above construct, vector, recombinant host cell, or composition to an individual in need thereof.

[0024] Another aspect is to provide the above-mentioned construct, vector, recombinant host cell, or composition for the prevention or treatment of disease.

[0025] technical solution

[0026] Each description and embodiment disclosed in this application may be applied to each other description and embodiment. That is, all combinations of the various elements disclosed in this application fall within the scope of this application. Furthermore, the scope of this application is not to be limited by the specific descriptions provided below. Additionally, a person skilled in the art can recognize or identify numerous equivalents to the specific embodiments of this application described herein using only ordinary experimentation. Moreover, such equivalents are intended to be included in this application.

[0027] One aspect provides a regulatory element that can increase RNA stability and / or mRNA translation. Since the regulatory element can increase RNA stability and / or mRNA translation, it may be suitable for increasing protein production in a construct containing a target gene.

[0028] The regulatory element of the present application may be derived from a viral genome or a fragment thereof.

[0029] The above virus genome may be a Safold virus or a Cardiovirus.

[0030] The control element of the present application may comprise a fragment of a safold virus or a cardiovirus; or a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identity with the same. The sequence of the virus used in the present application may be obtained from known databases (e.g., NCBI, etc.).

[0031] The regulatory element of the present application may be a fragment consisting of a sequence of 1 to 130 or fewer bases derived from the viral genome. Specifically, the regulatory elements are fragments of the viral genome, comprising 130, 129, 128, 127, 126, 125, 124, 123, 122, 121, 120, 119, 118, 117, 116, 115, 114, 113, 112, 111, 110, 109, 108, 107, 106, 105, 104, 103, 102, 1()1, 100, 99, 98, 97 , 96 , 95 , 94 , 93 , 92 , 91 , 90 / fl , 89 / fl , 88 / fl , 87 / fl , 86 / fl , 85 / fl , 84 / fl , 83 / fl , 82 / fl , 81 / fl , 80 / fl , 79 / fl , 78 , 77 , 76 , 75 , 74 , 73 , 72 , , 70 , 69 , 68 , 67 , 66 , 65 / fl , 64 / fl , 63 / fl , 62 / fl , 61 / fl , 60 / fl , 59 / fl , 58 / fl , 57 / fl , 56 / fl , 55 / fl , 54 / fl , 53 7fl , 52 / fl , 5171] , 50 / fl , 49 / fl , 48 / fl , 47 / fl , 46 / fl , 45 / fl , 44 / fl , 43 / fl , 42 / fl , 41 / fl , 40 , 39 , 38 , 37 , 36 , 35 , 34 , 33 , 32 , 31 , or may contain a fragment consisting of a sequence of 30 bases or may be composed of this.

[0032] The control element of the present application may comprise or be composed of a base sequence of sequence number 1; or a base sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 99.5% identity with the same.

[0033] The control element of the present application may comprise or be composed of any one of sequence numbers 2 to 9; or a sequence having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identity with the same.

[0034] In one specific example, the control element is a fragment of a sequence of nucleotides of a Saffold virus (NC_009448.2), and the fragment may include the sequence of nucleotides of sequence number 1, or may include a sequence of nucleotides having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identity with the sequence of nucleotides of sequence number 1, or may be composed of this.

[0035] In one specific example, the control element is a fragment of a sequence of nucleotides of a cardiovirus (NC_038305.1), and the fragment may include the sequence of nucleotides of sequence number 1, or may include a sequence of nucleotides having at least 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 99.5% identity with the sequence of nucleotides of sequence number 1, or may be composed of this.

[0036] In one specific example, the control element may include a sequence of nucleotides containing at least one and up to 70 nucleotides in the 3' direction from the 7991st nucleotide in the sequence of Saffold virus (NC_009448.2) at the end of the sequence of sequence of sequence No. 1; or a sequence of nucleotides having at least 80% identity with this.

[0037] Specifically, the nucleotides added in the above may comprise a sequence of nucleotides including 1 to 70 consecutive nucleotides, 1 to 60 consecutive nucleotides, 1 to 50 consecutive nucleotides, 1 to 40 consecutive nucleotides, 1 to 30 nucleotides, 1 to 20 nucleotides, 1 to 10 nucleotides, 1 to 8 nucleotides, or 1 to 4 nucleotides in the 3' direction from the 7991st nucleotide in the sequence of Saffold virus (NC_009448.2); or may comprise or be composed of a sequence of nucleotides having at least 80% identity therewith. The added nucleotides may be connected to the 5' end and / or 3' end, preferably the 3' end, of the sequence of sequence No. 1.

[0038] Specifically, the nucleotides added above may comprise a sequence of nucleotides further comprising 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 20, 30, 40, 50, 60, 65, 69, or 70 nucleotides consecutive in the 3' direction from the 7991st nucleotide in the sequence of Saffold virus (NC_009448.2); or a sequence of nucleotides having at least 80% identity with the above. The nucleotides added above may be connected to the 5' end and / or 3' end, preferably the 3' end, of the sequence of sequence number 1.

[0039] In one specific example, the control element may include a sequence of nucleotides containing at least one and at least 20 nucleotides in the 5' direction from the 7950th nucleotide in the sequence of Saffold virus (NC_009448.2) at the end of the sequence of sequence of sequence number 1; or a sequence of nucleotides having at least 80% identity with this.

[0040] Specifically, the nucleotides added in the above may comprise a sequence of nucleotides further comprising 1 to 20, 1 to 15, 1 to 10, 1 to 8, or 1 to 5 nucleotides consecutive in the 5' direction from the 7950th nucleotide in the sequence of Saffold virus (NC_009448.2); or a sequence of nucleotides having at least 80% identity with the above. The added nucleotides may be connected to the 5' end and / or 3' end, preferably the 5' end, of the sequence of sequence No. 1.

[0041] Specifically, the nucleotides added in the above may comprise a sequence of nucleotides that additionally include 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotides that are continuous in the 5' direction from the 7950th nucleotide in the sequence of Saffold virus (NC_009448.2); or a sequence of nucleotides having at least 80% identity with the above. The added nucleotides may be connected to the 5' end and / or 3' end, preferably the 5' end, of the sequence of sequence number 1.

[0042] Even if the present application describes a "regulatory element comprising a sequence of nucleotides of a specific sequence number" or a "regulatory element having a sequence of nucleotides of a specific sequence number," it is obvious that a regulatory element having a nucleotide sequence in which some sequences are mutated may also be used in the present application if it has the same or equivalent function as the regulatory element composed of the nucleotide sequence of the said sequence number. The above "mutation" means, but is not limited to, substitution, deletion, and / or insertion of nucleotides.

[0043] For example, it is obvious that a control element having the same or equivalent function as the control element above, in which a meaningless sequence is added to the inside or end of the control element sequence of the corresponding sequence number, or in which a part of the sequence inside or end of the control element sequence of the corresponding sequence number is deleted, also falls within the scope of the present invention.

[0044] In one embodiment, the control element of the present application may comprise a base sequence in which one or more nucleotides are mutated in any one of the base sequences of SEQ ID NOs 1 to 9. Specifically, the control element of the present application may comprise a base sequence in which 20 or fewer, 19 or fewer, 18 or fewer, 17 or fewer, 16 or fewer, 15 or fewer, 14 or fewer, 13 or fewer, 12 or fewer, 11 or fewer, 10 or fewer, 9 or fewer, 8 or fewer, 7 or fewer, 6 or fewer, 5 or fewer, 4 or fewer, 3 or fewer, 2 or fewer, or 1 or fewer nucleotides are mutated in any one of the base sequences of SEQ ID NOs 1 to 9.

[0045] Homology and identity refer to the degree of relationship between two given base sequences and can be expressed as a percentage. The terms homology and identity are often used interchangeably.

[0046] Whether any two sequences have homology, similarity, or identity can be determined using known computer algorithms, such as the "FASTA" program, using default parameters as in, for example, Pearson et al. (1988) [Proc. Nat l. Acad. Sci. USA 85]: 2444. Alternatively, the Needleman-Wunsch algorithm (Needleman and Wunsch, 1970, J. Mol. Biol.), as performed in the Needleman program of the EMBOSS package (EMBOSS: The European Molecular Biology Open Software Suite, Rice et al., 2000, Trends Genet. 16: 276-277) (version 5.0.0 or later) (Needleman and Wunsch, 1970, J. Mol. Biol.

[0047] 48: 443-453) can be used to determine this (including GCG program packages (Devereux, J., et al, Nucleic Acids Research 12: 387 (1984)), BLASTP, BLASTN, FASTA (Atschul, [S.] [F.] [ET AL, J MOLEC BIOL 215]: 403 (1990); Guide to Huge Computers, Martin J. Bishop, [ED.] Academic Press, San Diego, 1994, and [CARILLO ETA / .] (1988) SIAM J Applied Math 48: 1073). For example, homology, similarity, or identity of sequences can be determined using BLAST from the National Center for Biotechnology Information Database, or ClustalW.

[0048] In one specific example, the control element may include at least one stem-loop structure.

[0049] In one specific example, the base sequence of sequence number 1 can be represented by the following Formula 1. [Formula 1]

[0050] GCWACGYGTTRN 1 N 2 N 3 N 4 N 5 N 6 VNNCCAN 7 N 8 N 9 N 10 N 11 N 12 YGTACDCGGYC

[0051] In the above sequence of bases, N can be selected independently from each of A, U, T, G, and C or from their nucleotide analogs. num be ris a nucleotide selected from A, U, T, G and or a nucleotide analog thereof, and said N 1 and N 12 , N 2 and N 11 , N 3 and N 10 , N 4 and N 9 , N 5 and N 8 and N 6 Y and D can each form a base pair. Y is a pyrimidine or its analog (i.e., C or T (or U)), R is a purine or its analog (i.e., A or G), W is A or T (or U), its nucleotide analog, and D can be A, G or T (or U), or its nucleotide analog.

[0052] In one embodiment, the control element of the present application may comprise one or more modified nucleotides or nucleotide analogs. The modification may be made at the base, sugar, or inter-nucleoside binding site of the nucleotide, but is not limited thereto. Specifically, the modified nucleoside may comprise the structure of ☐ (pseudouridine), ml☐ (N1-methylpseudouridine), m5C (5-methylcytidine), or mo5U (5-methoxyuridine), but is not limited thereto, and may comprise various other chemically modified nucleosides. The modification of the sugar and backbone may be phosphorothioate, LNA (locked nucleotide), or PMO (phosphodiamide morphol ino ol igomer), but is not limited thereto, and may comprise various other chemical modifications.

[0053] Unless otherwise specifically stated, the nucleotide sequences described in this specification refer to DNA nucleotide sequences (notated T), but it is obvious that the RNA form of the sequence (notated U) is also included within the scope of the present invention. The regulatory element of the present invention is a sequence derived from an RNA virus genome and can be synthesized and implemented in DNA form for use.

[0054] The control element of the present application can induce an increase in the length of the poly(A)tail, an increase in the stability of the poly(A)tail by mixed tailing, or both.

[0055] Another aspect provides a construct comprising a target gene and the regulatory element. The regulatory element is as described above.

[0056] As used in this application, the term "construct" may be understood as DNA or RNA that does not occur naturally. That is, the construct may be understood as an artificial nucleic acid molecule or a non-natural nucleic acid molecule, and may be planned or / or generated by genetic engineering methods or chemical synthesis methods. The construct may comprise at least one of the aforementioned regulatory elements and at least one open reading frame. The construct may be a DNA molecule, an RNA molecule, or a hybrid molecule comprising DNA and RNA portions.

[0057] In one specific example, the construct may be a construct comprising a UTR of a target gene and a regulatory element. Within the construct, the regulatory element may be inserted into the UTR of the target gene or linked to the UTR of the target gene in the 5' or 3' direction, and the manner of insertion or linkage is not limited. Specifically, the insertion may be positioning the regulatory element in the 5' UTR or 3' UTR region of the target gene, but is not limited thereto. The linkage may include the regulatory element being directly linked to the UTR of the target gene or being linked by including an additional sequence of nucleotides between the regulatory element and the UTR, but is not limited thereto. The target gene and the regulatory element within the construct may be of heterologous origin. The target gene may be derived from a gene different from the regulatory element and may not naturally combine.

[0058] In one specific example, the regulatory element may increase the stability or translation efficiency of RNA or mRNA containing one or more modified nucleotides or nucleotide analogs. The modification may occur at the base, sugar, or binding site between nucleosides of the nucleotide, but is not limited thereto. Specifically, the modified nucleoside may include structures such as ☐ (pseudouridine), ml☐ (N1-methylpseudouridine), m5C (5-methylcytidine), or mo5U (5-methoxyuridine), but is not limited thereto and may include various other chemically modified nucleosides. The modification of the sugar and backbone may be phosphorothioate, LNA (locked nucleotide), or PMO (phosphodiamide morphol ionol igomer), but is not limited thereto and may include various other chemical modifications.

[0059] The regulatory element of the present application can increase the stability of RNA or induce an improvement in the translation efficiency of mRNA even when applied to RNA or mRNA into which the above-mentioned modified nucleotide has been introduced.

[0060] In one specific example, the construct may additionally include one or more barcode sequences, forward adapter sequences, reverse adapter sequences, poly(A)tail sequences, or combinations thereof, but is not limited thereto.

[0061] In one specific example, the construct may additionally include a promoter sequence, wherein the target gene may be operablely linked to the promoter sequence, but is not limited thereto. The term "operably linked" above means that the gene sequence is functionally linked to the promoter sequence that initiates and mediates the transcription of the target gene.

[0062] In one specific example, the construct may include, but is not limited to, a 5' repeat sequence and a 3' repeat sequence of a virus selected from the group consisting of adeno-associated viruses, adenoviruses, alphaviruses, retroviruses (e.g., gamma retroviruses, and lentiviruses), parvoviruses, herpesviruses, and SV40.

[0063] In one specific example, the construct may be an mRNA construct. The mRNA construct may additionally include a 5' UTR, a 3' UTR, a sequence of a poly(A)tail, or a combination thereof, but is not limited thereto.

[0064] In this application, the target gene may be a gene of a reporter, protein, physiologically active peptide, antigen, or antibody or a fragment thereof; or one or more selected from the group consisting of oligonucleotides, antisense oligonucleotides, mRNA, dsRNA, shRNA, miRNA, siRNA, gRNA, saRNA, IncRNA, t aRNA, ribozymes, ncRNA, exosoma 1RNA, and aptamers, but the type is not limited as long as RNA stability and / or translation of mRNA can be increased by the regulatory element of this application.

[0065] In one specific example, the reporter may be, but is not limited to, luciferase, fluorescent protein, beta-galactosidase, chloramphenicol acetyltransferase, or equorin.

[0066] In one specific example, the physiologically active polypeptide may be a hormone, cytokine, cytokine binding protein, enzyme, growth factor, or insulin, but is not limited thereto.

[0067] In one specific example, the antigen may be a vaccine antigen, a cancer-related antigen, or an allergy antigen, but is not limited thereto.

[0068] Another aspect provides a vector containing the above construct or a pool of the above vector.

[0069] As used in this application, the term “vector” means a gene product containing a base sequence encoding a target protein or a target gene operably linked to a suitable regulatory sequence to enable the expression of the target protein within a suitable host. The regulatory sequence may include, but is not limited to, a promoter capable of initiating transcription, any operator sequence for regulating such transcription, a sequence coding for a suitable mRNA ribosome binding site, and a sequence regulating the termination of transcription and translation. After being introduced into a suitable host cell, the vector may be replicated or function independently of the host genome, or may be incorporated into the genome itself.

[0070] The vector used in this application is not particularly limited as long as it is expressible within a host cell, and any vector known in the art can be introduced into a host cell. Examples of commonly used vectors include plasmids, cosmids, viruses, and bacteriophages in their natural or recombinant state.

[0071] In one specific example, the vector may be an AAV (Adeno-Assisted Virus) vector.

[0072] AAV is divided into several serotypes based on differences in capsid proteins, including AAV1, AAV2, AAV5, AAV8, AAV9, and AAV-DJ, but is not limited to these.

[0073] Structural differences in capsid proteins between AAV serotypes determine binding affinity with specific cell receptors, which can ultimately have a decisive impact on tissue-specific transduction efficiency. Therefore, by selecting the optimal serotype, off-target effects can be minimized while maximizing gene delivery efficiency to target tissues. Another aspect provides recombinant host cells containing the above construct or vector.

[0074] The term "host cell" as used in this application includes all cells capable of expressing a target protein and encompasses cells that have undergone natural or artificial genetic modification. Furthermore, the host cell includes eukaryotic cells and prokaryotic cells, and specifically may be eukaryotic cells or cells derived from mammals (e.g., humans), but is not limited thereto.

[0075] In this application, the method of introducing a construct or vector into a cell includes any method of introducing nucleic acid into a cell (e.g., transfection or transformation), and depending on the cell, a suitable standard technique as known in the art may be selected and performed. Examples include, but are not limited to, electroporation, calcium phosphate (CaPO4) precipitation, calcium chloride (CaCl2) precipitation, microinjection, polyethylene glycol (PEG) method, DEAE-dextran method, cationic liposome method, lipid nanoparticle method, and lithium acetate-DMSO method.

[0076] Another aspect provides a composition comprising the above-mentioned construct, vector, or recombinant host cell. The construct, vector, recombinant host cell, or composition comprising these of the present application can express a target protein in vitro, in vivo, or ex vivo.

[0077] In one specific example, when the above composition is administered to an individual, the target protein can be provided to the individual by the above construct, vector, or recombinant host cell, and thus, depending on the use of the provided target protein, it may exhibit a preventive or therapeutic effect against a disease (e.g., an infectious disease). Accordingly, the above composition may be a pharmaceutical composition, but is not limited thereto.

[0078] In one specific example, the construct or target protein of the present application may be produced in vitro or in vitro using the construct, vector, or recombinant host cell. Accordingly, the composition may be a composition for the production of the construct or target protein of the present application, but is not limited thereto.

[0079] For example, if the target protein is a vaccine antigen, the construct, vector, recombinant host cell, or composition itself may be used as a vaccine, or a vaccine antigen may be manufactured using these.

[0080] Another aspect provides a method for preventing, improving, or treating a disease comprising the step of administering the above construct, vector, recombinant host cell, or composition to an individual in need thereof.

[0081] Another aspect provides the use of the above construct, vector, recombinant host cell, or composition for the prevention or treatment of disease.

[0082] Another aspect provides a method for producing a target protein comprising the steps of: culturing the recombinant host cell; and recovering the target protein.

[0083] The method for producing a target protein using the recombinant host cell in the present application can be carried out using methods widely known in the art. Specifically, the above culture may be cultured continuously in a batch process, a fed batch, or a repeated fed batch process, but is not limited thereto. The culture medium used for the culture can be appropriately selected by a person skilled in the art depending on the host cell. Specifically, the recombinant host cell of the present application may be cultured in a conventional medium containing a suitable carbon source, nitrogen source, phosphorus source, inorganic compound, amino acid, and / or vitamin, etc., under aerobic or anaerobic conditions while controlling the temperature, pH, etc.

[0084] The method for preparing the target protein described above may further include additional processes after the culture step. The additional processes may be appropriately selected depending on the intended use of the target protein.

[0085] Specifically, the method for producing the target protein may include a step of recovering the target protein from one or more substances selected from the recombinant host cell, the dried product of the recombinant host cell, the extract of the recombinant host cell, the culture of the recombinant host cell, the supernatant of the culture, and the lysate of the recombinant host cell after the culture step. The method may additionally include a step of lysing the recombinant host cell prior to or simultaneously with the recovery step. The lysing of the recombinant host cell may be carried out by methods commonly used in the art to which this application belongs, for example, by a lysis buffer solution, a sonicator, heat treatment, and a flux presser. Furthermore, the lysis step may include, but is not limited to, enzymatic reactions such as cell wall / membrane degrading enzymes, nucleases, nucleotransferases, and / or proteolytic enzymes.

[0086] In the present application, the dried product of the recombinant host cell may be prepared by drying the cell that has accumulated the target substance, but is not limited thereto.

[0087] In the present application, the extract of a recombinant host cell may refer to the material remaining after separating the cell wall / cell membrane from the cell. Specifically, it may refer to the remaining components excluding the cell wall / cell membrane from the components obtained by lysing the cell. The cell extract contains a target protein, and components other than the target protein may include one or more components selected from cell proteins, carbohydrates, nucleic acids, and fibers, but are not limited thereto.

[0088] In the present application, the recovery step may recover the target protein using a suitable method known in the art (e.g., centrifugation, filtration, anion exchange chromatography, crystallization, and HPLC, etc.).

[0089] In the present application, the recovery step may include a purification process. The purification process may involve separating only the target protein from cells and purifying it. Through the purification process, a purely purified target protein may be produced.

[0090] Another aspect provides use for the preparation of the mRNA construct or target protein of the above construct, vector, recombinant host cell, or composition.

[0091] Another aspect provides a method for increasing RNA stability and / or mRNA translation of a target gene, comprising the step of inserting or linking the above regulatory element to a UTR of the target gene.

[0092] Another aspect provides use for increasing RNA stability and / or mRNA translation of the above construct, vector, recombinant host cell, or composition.

[0093] Another aspect is a method for preparing an mRNA construct, comprising the steps of: transcribing the above construct or vector in vitro; and recovering the transcribed mRNA construct.

[0094] The above transfer method and recovery method may utilize suitable methods known in the art. In one specific example, the method may additionally include, but is not limited to, a step of treating with DNase I after transfer to remove the contents of the construct or vector used as a template; and / or a washing step.

[0095] Effects of the invention

[0096] A regulatory element according to one specific example can increase RNA stability or mRNA translation, which are transcription products of a target gene, thereby increasing the expression level of a target protein. Accordingly, the regulatory element of the present invention can be usefully utilized in systems requiring precise control of gene expression, such as gene therapy, vaccine development, and the production of protein therapeutics.

[0097] Brief explanation of the drawing

[0098] Figure 1 is a figure showing the luciferase activity of IVT mRNA containing the K4 element.

[0099] Figure 2 shows the luciferase activity of ml-IBT mRNA containing a combination of the K4 element, IE element, K3 element, and fragments thereof.

[0100] Figure 3 is a schematic diagram of K4 and its fragment luciferase structures and the luciferase analysis of said structures.

[0101] Figure 4 is a schematic diagram of the mutagenic MPRA of the K4 variant.

[0102] Figure 5 is a figure showing the average effect on the expression of a reporter protein by a mutation (top) in which a base at each position in K4 is deleted by 1-nt or 2-nt, or a mutation (bottom) in which a base is substituted.

[0103] Figure 6 shows the luciferase activity of firef ly mRNA constructs transcribed in vitro with K4, K4_60nt (11-70), and K4_56nt (13-68) inserted. Figure 7 shows the luciferase activity of firef ly mRNA constructs transcribed in vitro with K4, K4_48nt_vl, K4_48nt_v2, and K4_40nt inserted. In the dual-luciferase reporter plasmid system, the activity of firef ly luciferase was normalized to the activity of reni l la luciferase.

[0104] Figure 8 shows the second-order structure prediction results of K4_56nt. The parts corresponding to K4_56nt, K4_48nt, and K4_40nt are indicated by arrows, respectively.

[0105] Figure 9 is a diagram showing the alignment of the sequences used in Example 5. The 48nt core sequence is indicated by a dotted line, and the 40nt core sequence is indicated by a solid line. Sequences derived from K4 are indicated by uppercase letters, and other surrounding sequences are indicated by lowercase letters. The numbers at the top indicate the positions on the genome of the Saffold virus (NC_009448.2).

[0106] Figures 10 to 12 are a heat map (Figure 10) and bar graphs (Figures 11 and 12) showing the effect of individual base substitution mutations within the K4 element on the expression score, analyzed at the single base level. Figure 13 is a figure showing the predicted secondary structure of the K4_40nt_core region. The intensity of the color of the base at each position indicates how much the protein expression enhancement effect decreased when the base at that position was substituted with another base, and the thickness of the solid line is structural information regarding whether it is important for the bases at each position to form a base pair.

[0107] Form for carrying out the invention

[0108] The present invention will be described in more detail below through experimental examples and embodiments. These are merely illustrative of the present invention, and the scope of the present invention is not to be interpreted as being limited by these experimental examples and embodiments.

[0109] Example 1. Identification of the K4 element derived from Saffold virus. We intended to identify a regulatory element that can improve the expression efficiency and stability of mRNA from a viral genome. Specifically, we designed an oligonucleotide containing nucleotides 7931 through 8060 of the full-length sequence of the Saffold virus genome (NC_009448.2) and named it the 'K4 (sequence number 10)' element.

[0110] Example 2. Evaluation of the expression-enhancing efficacy of K4 elements and combination synergy for application to mRNA therapeutic platforms

[0111] To evaluate the therapeutic potential of the K4 element in mRNA-based therapeutics, the effect of the K4 element on in vitro transcribed (IVT) mRNA was verified. Specifically, luciferase activity was quantitatively analyzed after transfecting IVT mRNA with and without the K4 element into HCT116 cells.

[0112] As a result, IVT mRNA with the K4 element inserted showed significantly higher expression efficiency compared to the control group, and in particular, showed an expression enhancement effect of up to 10 times at 96 hours after transfusion (Fig. 1).

[0113] In addition, for the practical optimization of mRNA-based therapeutics, the activity of modified mRNA in ml was evaluated in combination with previously known stabilization elements (1E: derived from human cytomegalovirus lncRNA2.7, K3: derived from norovirus GII, [Kim et al. 2020; Seo et al. 2023]).

[0114] As a result, expression was significantly increased even when K4 was administered alone, but it was confirmed that the expression level increased dramatically when K4 was established as a combination system with 1E and K3 elements (Fig. 2).

[0115] The above results suggest that the K4 element has excellent efficacy in inducing long-term protein expression in mRNA delivery systems, and demonstrate that it can be utilized as a key component for the development of high-efficiency mRNA therapeutics by creating complementary synergistic effects with existing expression regulators.

[0116] Example 3. Identification of the minimum functional unit for maintaining the activity of the K4 element

[0117] We explored the minimum sequence range essential for maintaining the function of the K4 element. To this end, we constructed variants in which the K4 element was truncated and performed a dual-luciferase assay.

[0118] As a result, it was confirmed that the 11th to 70th nucleotide region (sequence number 3, K4_60nt) of the total 130nt-long K4 element maintained original activity. On the other hand, in the case of a variant (sequence number 11, K4trL) containing only the 11th to 50th nucleotides after further cleavage of the region, luciferase activity decreased sharply (Fig. 3). The above results indicate that the functional core of the K4 element is within the 11-70 segment, and that activity disappears when the 51-70 segment is removed.

[0119] Example 4. Identification of Core Bases and Structural Determinants of K4 Elements via Deep Mutagenesis Analysis

[0120] High-throughput mutation analysis was performed to precisely analyze the sequence characteristics and secondary structural correlations determining the activity of the K4 element. A library of 925 mutants was constructed across the entire K4 region, including single nucleotide substitutions and single and consecutive deletions. In particular, compensatory mutations in complementary pairs were included to evaluate the impact of maintaining the secondary structure. The oligo-pool was cloned into a plasmid containing GFP and an integrase region designed to fit into the cell genome, and then integrated into the genome of HEK293T cells. Cells were classified into four regions based on GFP expression levels using FACS, and elements were amplified and sequenced from the genome of each region. The expression level (Expression score or Exp score) was calculated by assigning the region's average FITC-A value as a weight to the number of reads in each region. To ensure comparability, expression was normalized by setting the weighted sum of negative controls (those without the element) to 1. A higher expression measurement indicates a higher expression level of GFP. The expression measurements showed consistency among independent replicate experiments (Fig. 4).

[0121] As a result of the analysis, mutations outside the K4_40nt (21-60) region identified in Example 3 generally did not have a significant effect on expression levels; however, it was confirmed that when mutations occurred in specific highly conserved sequences within K4_40nt and in bases involved in maintaining the stem structure, the expression score decreased significantly (Fig. 5). The numbers on the X-axis represent the relative positions of the corresponding bases in the K4C1-130) tile, and the numbers in parentheses represent the positions within the entire viral genome. The expression score on the Y-axis represents the effect of protein expression enhancement following the corresponding mutation, and WT expression represents the degree of protein expression from a reporter containing K4 (1-130) without deletion. The horizontal line below indicates the positions of the K4 fragments used in subsequent experiments. A greater drop in the expression score suggests that the base at the corresponding position is important for K4 to exhibit an expression enhancement effect. The above results suggest that while the region outside K4_40nt has a relatively small effect on K4 activity even if it is deleted, the region inside K4_40nt has a large effect on K4 activity.

[0122] Example 5. Fabrication and activation verification of the optimized K4 minimization element

[0123] Based on the deep mutagenesis data of Example 4, small elements K4_60nt(11-70) (Sequence No. 3) and K4_56nt(13-68) (Sequence No. 4) were designed to preserve core nucleotide sequences sensitive to activity reduction. Each element was inserted into the 3' UTR of the Firefly gene in a luciferase reporter construct, and in vitro transcription (IVT) of reporter mRNA was prepared using this. The mRNA was then transfected into three different human cell lines (HCT116, HEK293T, HepG2), and luciferase activity was measured after 72 hours. Each value was normalized to the luciferase activity of the co-transfected reni lla mRNA.

[0124] As a result of the experiment, in all cell lines, the K4_60nt( 11-70) and K4_56nt( 13-68) fragments showed gene expression enhancement effects equivalent to or rather superior to the original K4 element (Fig. 6).

[0125] Additionally, variants were constructed by artificially substituting the stem sequences at the bottom while maintaining the sequences of the core conserved regions, K4_48nt_core (SEQ No. 5) or K4_40nt_core (SEQ No. 6), and their activity was evaluated (Table 1, Figures 8 and 9). Specifically, Firefly and reni lla luciferases are expressed in the same plasmid, and each element was inserted into the 3' UTR of the Firefly luciferase. The experiment was conducted in HCT116 cells. Luciferase activity was measured 72 hours after transfection. K4_48nt_vl, v2, and K4_40nt have the 48nt and 40nt sequences derived from K4 at their centers, respectively, but differ in the sequences surrounding the 48nt. In the table below, preserved core sequences are indicated in bold and underlined.

[0126] 【Table 11

[0127] order

[0128] Number sequence Name sequence

[0129] 7 K4_48ntvl ATTGTGATCGCAACGTGTTACCCAGGAATCCACTTGGGTGTACGGCGGCCGTTCGC

[0130]

[0131] AG8 K4_48nt_v2 ATCTGATCGCAACGTGTTACCCAGGAATCCACTTGGGTGTACGGCGGCCGTTCAG

[0132] AG

[0133]

[0134] 9 K4_40nt CCCGGGCAACGTGTTACCCAGGAATCCACTTGGGTGTACGCGGCCTCGGG Double Luciferase analysis confirmed that expression-enhancing activity is preserved when the core sequence and structural framework are maintained despite changes in the stem sequence (Fig. 7). Even when the surrounding sequences change, the effects of the K4 48nt and K4 40nt sequences are maintained, and K4_40nt also showed a protein expression increase effect of about 2 times compared to the control group (ctrl) without the element.

[0135] The above results demonstrate that the K4-based minimization elements of the present invention operate universally in various cellular environments. In particular, it was confirmed that modification of surrounding sequences is possible as long as structural stability is ensured around the core sequence.

[0136] Example 6. Confirmation of importance for each base

[0137] Based on the deep mutagenesis data of Example 4, the effect of individual base substitutions within the K4 element on the expression score was precisely analyzed at the single base level. The results were visualized using a heat map and a bar graph (Figs. 10, 11, and 12).

[0138] In the heat map of Fig. 10, the structure at the top of the figure represents the predicted secondary structure of K4 using dot brackets. The numbers at the bottom of the X-axis indicate the relative position of the corresponding base in K4 (1-130), and the numbers in parentheses indicate the actual position within the virus's entire genome. The Exp score indicates the effect of enhancing protein expression when the base is substituted. Darker colors and smaller values ​​indicate that K4 is not functioning properly, meaning that substitution mutations are not allowed at that location. WT expression indicates the level of expression of K4 (1-130).

[0139] The bar graphs in Figures 11 and 12 illustrate the effect of substitution with each base (X-axis) on the Expression score (Y-axis). At the top of each panel, the relative position at K4 (1-130) and the base sequence of " are indicated. The gray dashed line indicates the expression score of K4 (1-130).

[0140] Analysis results showed that base substitutions at specific positions exhibited substitution tolerance, whereas functional loss was observed in specific core regions with only a single base change. In particular, for the 5'-CCA-3' sequence located at the 41st to 43rd nucleotides, the expression score decreased sharply upon substitution with other bases, confirming that the sequence is an essential functional site of the K4 element.

[0141] In addition, compensatory mutation experiments were performed to evaluate the necessity of base pair binding and the importance of secondary structures in the stem region. Base pairs at the corresponding positions were substituted in various combinations, and the effect of each mutation on reporter expression was measured. The change in expression (AExpression) based on the presence or absence of base pair binding in the stem region was calculated (Fig. 13). AExpression was calculated as (average expression of K4 variants forming base pairs) - (average expression of K4 variants not forming base pairs). The thickness of the gray line indicates the importance of the base pair. The thicker the line, the more the corresponding base pair structure is required for K4 activity.

[0142] As a result of mapping analysis across the entire sequence, it was found that a stem structure forming six base pairs symmetrically around the VNNCCA motif plays a key role in determining overall expression efficiency.

[0143] Based on the results of the functional analysis and structural conservation tests described above, an optimized K4 core sequence of 40 nt length was established that secures sequence flexibility while maintaining expression-enhancing activity. The sequence was designed to enable the design of various variants by introducing hybrid bases at specific positions, and its composition is as shown in Sequence No. 1 below.

[0144] Ranking Bunhi:

[0145] GCWACGYGTTRN 1 N 2 N 3 N 4 N 5 N 6 VNNCCAN 7 N 8 N 9 N 10 N 11 N 12 YGTACDCGGYC

[0146] — W=A / T, Y=C / T, R=A / G, V=A / C / G, N=A / C / G / T, D=A / G / T.

[0147] - N number : [One of A / T / G and a base that forms a base pair. N 1 - N 12 ' N 2 - N ii, N 3 — N io, N 4 _ 퍠, N 5 - N 8 , N 6 - N 7 They form base pairs with each other.

[0148] From the foregoing description, those skilled in the art to which the present invention pertains will understand that the present invention may be implemented in other specific forms without altering its technical concept or essential features. In this regard, the experimental examples and embodiments described above should be understood as illustrative in all respects and not restrictive. The scope of the present invention should be interpreted as including all modifications or variations derived from the meaning and scope of the claims set forth below and their equivalents, rather than from the detailed description above.

Claims

Scope of the claim

1. A control element comprising the base sequence of sequence number 1; or a base sequence having at least 80% identity with it.

2. In Claim 1, (a) a sequence of nucleotides further comprising one to twenty nucleotides consecutive at the 5' end of the sequence of nucleotides; or a sequence of nucleotides having at least 80% identity with respect to this; (b) a sequence of nucleotides further comprising 1 to 70 nucleotides consecutive at the 3' end of the sequence of nucleotides; or a sequence of nucleotides having at least 80% identity with respect to this; or (c) a sequence of nucleotides further comprising 1 to 20 nucleotides consecutive at the 5' end of the sequence of nucleotides and 1 to 70 nucleotides consecutive at the 3' end of the sequence of nucleotides; or a sequence of nucleotides having at least 80% identity with the above. A control element including

3. In Claim 1, As a fragment of a nucleotide sequence of the Saffold virus (NC_009448.2), said fragment is composed of 40 to 130 nucleotide sequences, and The above fragment is a control element comprising the base sequence of sequence number 1 or a base sequence having at least 80% identity therewith.

4. In claim 1, a control element wherein the base sequence of sequence number 1 is represented by the following formula 1: [Equation 1] GCWACGYGTTRN 1 N 2 N 3 N 4 N 5 N 6 VNNCCAN 7 N 8 N 9 N 10 N 11 N 12 YGTACDCGGYC Here, , W is A or T, Y is C or T, R is A or G, V is A, C, or G, Nieun A, C, G, or T, N1 is A, G, or T, and N1 and N12, N2 and Nil, N3 and N10, N4 and N9, N5 and N8, and N6 and N7 each form base pairs.

5. A control element according to claim 1, wherein the base sequence comprises one or more base sequences of any one of sequence numbers 2 to 9.

6. In claim 1, the regulating element is a regulating element that induces an increase in the length of the poly (A)tail, an increase in the stability of the poly (A)tail, or both.

7. A regulatory element according to claim 1 that increases RNA stability or mRNA translation.

8. A regulatory element according to claim 7, wherein the RNA or mRNA is an RNA or mRNA comprising one or more modified nucleotides.

9. A construct comprising a target gene; and a regulatory element of any one of claims 1 to 8.

10. A construct according to claim 9, wherein the target gene is a gene of a reporter, protein, physiologically active peptide, antigen, or antibody or a fragment thereof; or one or more selected from the group consisting of oligonucleotides, mRNA, dsRNA, shRNA, miRNA, siRNA, gRNA, saRNA, IncRNA, taRNA, ribozymes, ncRNA, exosoma 1 RNA, and aptamers.

11. In claim 9, the construct is an mRNA construct.

12. Vector including the construct of claim 9.

13. The vector of Claim 12, wherein the vector is an AAV (Adeno-Associated Virus) vector.

14. A recombinant host cell comprising the construct of claim 9 or a vector comprising said construct.

15. A composition comprising: a construct of claim 9; a vector comprising said construct; or a recombinant host cell comprising said construct or vector.

16. The composition of Claim 15, wherein the composition is for the prevention or treatment of a disease; or for the manufacture of an mRNA construct or a protein coding for a target gene.

17. A method for increasing RNA stability or mRNA translation of a target gene, comprising the step of inserting or linking a regulatory element of any one of claims 1 to 8 to a UTR of the target gene.

Images