CASSETTE DNA FOR PRODUCING TEMPLATE DNA USED FOR sgRNA PRODUCTION, OLIGO DNA COMBINATION FOR PRODUCING CASSETTE DNA, AND METHOD FOR PRODUCING CASSETTE DNA

WO2026159990A1PCT designated stage Publication Date: 2026-07-30HIROSHIMA UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
HIROSHIMA UNIVERSITY
Filing Date
2025-11-10
Publication Date
2026-07-30

Smart Images

  • Figure JP2025039299_30072026_PF_FP_ABST
    Figure JP2025039299_30072026_PF_FP_ABST
Patent Text Reader

Abstract

The present disclosure is cassette DNA for use in a method in which a cell-free cloning system is used to produce template DNA for obtaining sgRNA by in vitro transcription. The cassette DNA comprises the nucleotide sequence of SEQ ID NO: 1 or 2 and includes a support sequence, an sgRNA scaffold sequence, and a promoter sequence for RNA polymerase.
Need to check novelty before this filing date? Find Prior Art

Description

Cassette DNA for preparing template DNA used for preparing sgRNA, combination of oligo DNAs for producing cassette DNA, and method for producing cassette DNA

[0001] The present invention relates to cassette DNA for preparing template DNA used for preparing sgRNA, combination of oligo DNAs for producing cassette DNA, and method for producing cassette DNA.

[0002] The CRISPR / Cas9 system enables genetic manipulation of various biological species and has influenced not only basic research but also applied research including medicine. Particularly in recent years, not only genome editing but also applied uses such as detection of SARS-CoV-2 (COVID-19) have been carried out.

[0003] To use the CRISPR / Cas9 system, it is necessary to use sgRNA (single-guide RNA) in which crRNA (Synthetic CRISPR RNA) and tracrRNA (Trans-activating crRNA) are combined. When this sgRNA is prepared by in vitro transcription using RNA polymerase, it is necessary to prepare template DNA for each target sequence.

[0004] Currently, as a method for preparing this template DNA, a method of preparing by cloning into a plasmid vector or by PCR is known.

[0005] Non-Patent Document 1 discloses a method for preparing template DNA for obtaining gRNA (guide RNA) by cloning into a plasmid vector. Non-Patent Document 2 discloses a method for preparing template DNA for sgRNA by PCR. Also, template DNA is sometimes synthesized using the gBlocks (registered trademark) artificial gene synthesis consignment service of Integrated DNA Technologies Co., Ltd. (Non-Patent Document 3).

[0006] However, the methods described in Non-Patent Documents 1 to 3 above require several days to several weeks to prepare the template DNA, and some of them have the problem of lacking accuracy in the base sequence of the synthesized template DNA. Furthermore, these methods require many steps, resulting in high costs for template DNA synthesis. Moreover, none of these methods are suitable for high-throughput sgRNA production.

[0007] Therefore, the present inventors have developed a novel method for producing template DNA that allows for the rapid, inexpensive, and simple preparation of a large quantity of template DNA for obtaining sgRNA simply by preparing an oligonucleotide having a target sequence contained in the target DNA (Patent Document 1). According to this method, a cassette DNA having the base sequence of the common region in sgRNA transcription is prepared in advance, and a target sequence-containing cyclic nucleotide is prepared by linking this cassette DNA with an oligonucleotide having a target sequence prepared from the target DNA targeted by the sgRNA. By amplifying this target sequence-containing cyclic nucleotide as a template, template DNA for obtaining sgRNA by in vitro transcription can be easily produced. Accordingly, by transcribing this template DNA in vitro, a large quantity of sgRNA having the desired target recognition sequence can be provided rapidly. Furthermore, this method for producing template DNA is more versatile than the PCR method for producing template DNA because it can provide many types of template DNA in a short time using a pre-prepared cassette DNA, and it can be performed in a cell-free system, making it suitable for high-throughput template DNA production.

[0008] Japanese Patent Publication No. 2023-071073

[0009] "Genome Editing | 2020," Funakoshi Co., Ltd., Funakoshi News, May 15, 2020 issue (No. 703), pp. 1-40 (right column of p. 16) "Guide RNA Synthesis Kit CUGA (registered trademark) 7 gRNA Synthesis Kit Supplementary "Reference Materials"," Nippon Gene Publishing Co., Ltd., Product Manual, Revised Edition R302, pp. 1-11 (pp. 3, 4) Satoshi Tsukamoto, "No Cloning Required! Creation of Knockout Mice by gBlocks (registered trademark) - based CRISPR / Cas9," Medical & Biological Laboratories, Inc., IDT Technical Report, vol. 1, pp. 1-6 (Figure 1 on p. 3)

[0010] However, the method described in Patent Document 1 requires time, effort, and cost to purify the cassette DNA. This is because, when amplifying the cassette DNA, the MPRCA (Multiply-primed RCA) method, which uses random primers, is employed. Unlike PCR, which only amplifies DNA of the target size, when the amplified DNA is cut with restriction enzymes, shorter sequences (byproducts) than the target length are always produced, requiring time and effort to remove them. In particular, removing byproducts of a length close to the target size using HPLC or gel excision is time-consuming.

[0011] This invention has been made in view of the above-mentioned problems, and aims to make it easier to produce and purify cassette DNA for creating template DNA to obtain sgRNA, and as a result, to make it easier to produce template DNA for obtaining sgRNA.

[0012] To achieve the above objective, the inventors, through diligent research, discovered a nucleotide sequence for cassette DNA that reduces the size of the by-products generated during the cassette DNA production process to approximately half or less the size of the target cassette DNA, thereby completing the present invention.

[0013] Specifically, the cassette DNA used in the method for producing template DNA for obtaining sgRNA according to this disclosure by in vitro transcription using a cell-free cloning system is characterized by comprising a support sequence, an sgRNA scaffold sequence, and an RNA polymerase promoter sequence, and consisting of the nucleotide sequence of SEQ ID NO: 1 or 2.

[0014] According to the cassette DNA described herein, by using the nucleotide sequence of SEQ ID NO: 1 or 2 as the sequence of the cassette DNA, the by-products generated during the cassette DNA production process can be made to be about half the size of the target cassette DNA or less. This allows for easy separation and purification of the target cassette DNA using gel filtration spin columns or the like, without the need for separation by agarose gel electrophoresis or the like. As a result, cassette DNA can be produced and purified more easily and in a shorter time.

[0015] The oligoDNA combinations relating to this disclosure are combinations of oligoDNA used to produce the cassette DNA according to the present invention, and are characterized by being a combination of five core oligoDNAs of SEQ ID NOs. 5 to 9, or a combination of five core oligoDNAs of SEQ ID NOs. 5 and 7 to 10 and sprint oligoDNAs of SEQ ID NOs. 11 to 15.

[0016] The combination of oligoDNAs described herein allows for the easy production of cassette DNA according to the present invention using the CAIOS method.

[0017] The method for producing cassette DNA used in a method for producing template DNA for obtaining sgRNA by in vitro transcription according to the present disclosure is characterized by comprising the steps of: preparing five types of core oligoDNAs of SEQ ID NOs. 5 to 9 or five types of core oligoDNAs of SEQ ID NOs. 5 and 7 to 10; preparing sprint oligoDNAs of SEQ ID NOs. 11 to 15; using SEQ ID NOs. 11 to 15 as sprint oligoDNAs, the five types of core oligoDNAs of SEQ ID NOs. 5 to 9 or five types of core oligoDNAs of SEQ ID NOs. 5 and 7 to 10 to ring together using the CAIOS method, thereby obtaining circular DNA containing a support sequence, an sgRNA scaffold sequence, an RNA polymerase promoter sequence, and a removal region; and performing rolling circle amplification of the circular DNA using two or more primers, followed by removing the removal region with a restriction enzyme, thereby obtaining cassette DNA consisting of the nucleotide sequence of SEQ ID NO. 1 or 2.

[0018] According to the method for producing cassette DNA described herein, five types of oligoDNAs, each having a portion of the sequence of the cassette DNA according to the present invention, or five types of oligoDNAs, each having a portion of the sequence of the cassette DNA according to the present invention, can be bound and amplified by the CAIOS method to obtain cassette DNA consisting of the nucleotide sequence of SEQ ID NO: 1 or 2 in a simple and short time.

[0019] According to the cassette DNA for preparing template DNA used in sgRNA production, the combination of oligo DNA for manufacturing the cassette DNA, and the method for manufacturing the cassette DNA, the cassette DNA can be produced and purified more easily and quickly.

[0020] Figure 1 is a schematic diagram illustrating manufacturing steps a to e in a method for producing template DNA from cassette DNA according to one embodiment of the present invention. Figure 2 is a schematic diagram illustrating a method for producing cassette DNA according to one embodiment of the present invention. Figure 3 is a schematic diagram illustrating manufacturing steps a and b in a method for producing template DNA from cassette DNA according to a modified example of one embodiment of the present invention. (a) is a diagram illustrating step a, and (b) is a diagram illustrating step b. Figure 4 shows a DNA map when the core oligonucleotides according to Example 1 are linked and circularized, where (a) is a circular nucleotide containing a support sequence (Type-D_New) for creating cassette DNA in which the target sequence is introduced in double-stranded DNA, and (b) is a circular nucleotide containing a support sequence (Type-S_New) for creating cassette DNA in which the target sequence is introduced in single-stranded DNA. Figure 5 is a photograph of the electrophoresis results of the sample after cutting or purification of the circularized core oligonucleotide produced in Example 1, where (a) is the result for Type-D_New, and (b) is the result for Type-S_New. Figure 6 shows the DNA map when conventional core oligonucleotides are linked and circularized, where (a) is a circular nucleotide containing a support sequence (Type-D_old) for creating cassette DNA in which the target sequence is introduced in double-stranded DNA, and (b) is a circular nucleotide containing a support sequence (Type-S_old) for creating cassette DNA in which the target sequence is introduced in single-stranded DNA. Figure 7 is a photograph of the electrophoresis results of the samples after cleavage of the conventionally circularized core oligonucleotides, where (a) is the result for Type-D_old and (b) is the result for Type-S_old. Figure 8 is a photograph of the electrophoresis results of the template DNA prepared in Example 2.

[0021] The following descriptions of embodiments for carrying out the present invention will be based on the drawings. The following descriptions of preferred embodiments are essentially illustrative and are not intended to limit the present invention, its application methods, or its uses.

[0022] A cassette DNA according to one embodiment of the present invention is a cassette DNA used in a method for producing template DNA for obtaining sgRNA by in vitro transcription using a cell-free cloning system, and is characterized by comprising a support sequence, an sgRNA scaffold sequence, and an RNA polymerase promoter sequence, and consisting of the nucleotide sequence of SEQ ID NO: 1 or 2. The nucleotide sequences of SEQ ID NO: 1 and 2 are as follows. SEQ ID NO: 1 is the sequence of cassette DNA into which the target sequence is introduced in double-stranded DNA, and SEQ ID NO: 2 is the sequence of cassette DNA into which the target sequence is introduced in single-stranded DNA. The nucleotide sequences of SEQ ID NO: 3 and 4 each include the nucleotide sequences of SEQ ID NO: 1 and 2, respectively, as well as the removal region described later, and are sequences of cyclic nucleotides containing support sequences (cyclic nucleotides formed by linking core oligonucleotides) for the production of the cassette DNA of SEQ ID NO: 1 and 2. Sequence number 1: GTTTTAGAGCTAGAAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAA AGTGGCACCGAGTCGGTGCTTTTAAAGGGTCCTCATCGCATATGCATGGTGCACCTGCAGGATC CTCGAGGTACCGTCATAGCTGTTTCCTGTGTGAGAGATTCTTGTAAAACGACGGCCAGTGACTCT AGACTAGTTAATTAAGCTTGAGCTCCCGGGCGGCCGCGAAGAGCGAAGCTAATACGACTCACTA SEQ ID NO: 2: GAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAAGTGG CACCGAGTCGGTGCTTTTAAAGGGTCCTCCATCGCATATGCATGGTGCACCTGCAGGATCCTC GAGGTACCGTCATAGCTGTTTCCTGTGTGAGAGATTCTTGTAAAACGACGGCCAGTGACTCTA GACTAGTTAATTAAGCTTGAGCTCCCGGGCGGCCGCGAAGAGCGAAGCTAATACGACTCACTASEQ ID NO: 3: GAAGCTAATACGACTCACTATAGGCGAGACCCCCaatattaggcctagtactggaggagtttcaGATATCattgagtagcgag atctagtactagcctaatttccggatggCGTCTCgGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACT TGAAAAAGTGGCACCGAGTCGGTGCTTTTAAAGGGTCCTCATCGCATATGGTGCACCTGCAGGATCCTCGAGGTACCGTCATAGC TGTTTCCTGTGTGAGAATTCTTGTAAAACGACGGCCAGTGACTCTAGACTAGTTAATTAAGCTTGAGCTCCCGGGCGGCCGCGAAGAGC SEQ ID NO: 4: GAAGCTAATACGACTCACTATAGGCGAGACCCCCaatattaggcctagtactggaggagtttcaGATATCattgagtagcgag atctagtactaggcctaatattTCCGGATGAGCGAGAGCTTTTTAGAGCTAGAAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACT TGAAAAAGTGGCACCGAGTCGGTGCTTTTAAAGGGTCCTCATCGCATATGGTGCACCTGCAGGATCCTCGAGGTACCGTCATAGC TGTTTCCTGTGTGAGAATTCTTGTAAAACGACGGCCAGTGACTCTAGACTAGTTAATTAAGCTTGAGCTCCCGGGCGGCCGCGAAGAGC

[0023] In this specification, the sgRNA scaffold sequence refers to the sequence that serves as the scaffold for the sgRNA, and the RNA polymerase promoter sequence is the sequence required for the transcription reaction with the template DNA. In this embodiment, the RNA polymerase promoter sequence is the T7 RNA polymerase sequence. In this specification, the support sequence refers to a sequence that is not necessary for the function of the sgRNA.

[0024] As described above, the cassette DNA according to this embodiment is used in a method for producing template DNA for obtaining sgRNA by in vitro transcription using a cell-free cloning system. The method for producing template DNA for obtaining sgRNA by in vitro transcription using the cassette DNA will be described below.

[0025] Figure 1 shows an overview of a method for producing template DNA (1) according to one embodiment of the present invention. As shown in Figure 1, the method for producing template DNA (1) according to this embodiment includes steps a to e, which will be described in detail below, and is a method for producing template DNA (1) for obtaining sgRNA by in vitro transcription using a cell-free cloning system. In particular, the method for producing template DNA (1) according to this embodiment is characterized by the use of a double-stranded target sequence-containing oligonucleotide (7A).

[0026] As shown in the middle left of Figure 1 (including the enlarged view), step a is a step of preparing a cassette DNA (2A) consisting of a fragment containing an sgRNA scaffold sequence (3), a support sequence (5), and an RNA polymerase promoter sequence (4), having protruding sequences (6A, 6B) at both ends and containing a phosphate group at the 5' end of at least one strand of the fragment. In particular, in this embodiment, the cassette DNA (2A) is characterized by having protruding sequences (6A, 6B) at the 5' end of each strand.

[0027] The example in Figure 1 illustrates the case where the protruding sequence (6A) is the sequence "ATCC" and the protruding sequence (6B) is the sequence "GTTT".

[0028] In this embodiment, the cassette DNA (2A) preferably uses a cassette DNA in which a phosphate group is present at the 5' end of at least one strand of the fragment. Therefore, a cassette DNA (2A) having a phosphate group at the 5' end of each strand can be used, or a cassette DNA (not shown) having a phosphate group at the 5' end of only one strand can be used.

[0029] As shown in the upper left of Figure 1, step b is a step of preparing a target sequence-containing oligonucleotide (7A) having a cassette DNA binding sequence (9A, 9B) having a sequence complementary to the protruding sequences (6A, 6B) of the cassette DNA (2A), and a target sequence (8) of a desired sgRNA, with the 5' end phosphorylated. In particular, in this embodiment, the target sequence-containing oligonucleotide (7A) in step b is double-stranded, and only the 5' end of one strand is phosphorylated (only the 5' end of the antisense oligonucleotide (Antisense-ON) is phosphorylated). Here, in Figure 1, the 5' ends of both strands of the cassette DNA (2A) are phosphorylated, but if only one strand is phosphorylated, the target sequence-containing oligonucleotide will have only the 5' end of the oligonucleotide strand that binds to the phosphorylated strand of the cassette DNA (2A) phosphorylated so that the one strand later becomes perfectly circular without nicks. In this embodiment, the method of preparing the target sequence-containing oligonucleotide (7A) in step b is not particularly limited.

[0030] Referring to the upper left panel of Figure 1, a preferred method for preparing the target sequence-containing oligonucleotide (7A) in this embodiment will be described. First, a sense oligonucleotide (Sense-ON) is prepared, having a cassette DNA binding sequence (9A) at the 5' end that is complementary to the overhang sequence (6A) of one strand of the cassette DNA (2A), and a target sequence (8) of the desired sgRNA at the 3' end. Next, an antisense oligonucleotide (Antisense-ON) is prepared, having a cassette DNA binding sequence (9B) at the 5' end that is complementary to the overhang sequence (6B) of the other strand of the cassette DNA (2A), a target sequence (8) of the desired sgRNA at the 3' end, and a phosphorylated 5' end. It is preferable that the sense oligonucleotide and antisense oligonucleotide are synthetic oligonucleotides that are accurately synthesized one base at a time by a conventional method according to the desired sequence. Next, the sense oligonucleotide and antisense oligonucleotide are annealed to form a double-stranded molecule, thereby suitably preparing an oligonucleotide (7A) containing the target sequence.

[0031] In this embodiment, the cassette DNA binding sequences (9A, 9B) can be selected according to the protruding sequences (6A, 6B) of the cassette DNA (2A). For example, as shown in the upper part of Figure 1, the sequence "TAGG" can be used as the cassette DNA binding sequence (9A) and the sequence "CAAA" can be used as the cassette DNA binding sequence (9B).

[0032] As shown in the lower left of Figure 1, step c is a step in which a cassette DNA (2A) and a target sequence-containing oligonucleotide (7A) are linked together with a DNA-binding enzyme (DNA Ligase) to obtain a target sequence-containing cyclic nucleotide (10). More specifically, initially, the protruding sequences (6A, 6B) of the cassette DNA (2A) complementarily bind to the cassette DNA-binding sequences (9A, 9B) of the target sequence-containing oligonucleotide (7A). In this state, the target sequence-containing cyclic nucleotide (10) can be obtained by linking both ends of the cassette DNA (2A) and the target sequence-containing oligonucleotide (7A) with a DNA-binding enzyme. The target sequence-containing cyclic nucleotide (10) obtained in this way has one nick in the outer ring formed by the chain of the target sequence-containing oligonucleotide (7A) whose 5' end was not phosphorylated, for example, in the example of Figure 1. In this case, if the oligonucleotide is prone to forming a secondary structure, the nick may be a gap of one or more bases.

[0033] In this embodiment, the target sequence-containing cyclic nucleotide (10) refers to a cyclic nucleotide formed by linking a cassette DNA (2A) and a target sequence-containing oligonucleotide (7A).

[0034] In the example shown in Figure 1, the case where the target sequence-containing cyclic nucleotide (10) has one nick on the outer ring is described, but the number of nicks in the target sequence-containing cyclic nucleotide (10) is not particularly limited.

[0035] In this embodiment, the DNA-binding enzyme used in step c can preferably be, for example, E. coli DNA ligase (manufactured by New England Biolabs). However, the type of DNA-binding enzyme is not particularly limited, and any DNA-binding enzyme well known to those skilled in the art can be appropriately selected. Furthermore, the conditions for the ligation reaction using the DNA-binding enzyme can also be appropriately set.

[0036] As shown in the upper and middle right panels of Figure 1, step d is a step in which a target sequence-containing cyclic nucleotide (10) is amplified using a strand-displacement DNA polymerase (11) as a template to obtain a target sequence-containing double-stranded DNA (12) which is an identical sequence concatemer having a repeat sequence consisting of a support sequence (5), an RNA polymerase promoter sequence (4), a target sequence (8), and an sgRNA scaffold sequence (3). More specifically, the outer cyclic nucleotide containing the nick of the target sequence-containing cyclic nucleotide (10) is used as a template, and amplification is started from the nick using a strand-displacement DNA polymerase (11) to obtain a target sequence-containing double-stranded DNA (12).

[0037] In this embodiment, the strand-displacement DNA polymerase (11) preferably has exonuclease activity. Using such a strand-displacement DNA polymerase (11) is preferable because it allows for the acquisition of double-stranded DNA (12) containing the target sequence by rolling-circle amplification using a target sequence-containing cyclic nucleotide (10) as a template. For example, φ29 DNA polymerase can be suitably used as such a strand-displacement DNA polymerase (11).

[0038] In this embodiment, the target sequence-containing double-stranded DNA (12) in step d is preferably obtained by rolling-circle amplification using two or more primers that bind to the promoter sequence (4) and the sgRNA scaffold sequence (3) of the cassette DNA (2A), respectively. This method is preferable because it allows for the simultaneous synthesis of multiple target sequence-containing double-stranded DNA (12) starting from multiple primer recognition sequences (not shown) in the target sequence-containing cyclic nucleotide (10). Random primers such as 6R5S primers can be used. Furthermore, it is preferable that such primers are resistant to the exonuclease activity of strand-displacement DNA polymerase (11). If the primers are not resistant to the exonuclease activity of strand-displacement DNA polymerase (11), simultaneous synthesis starting from multiple primer recognition sequences cannot be performed.

[0039] As shown in the lower right panel of Figure 1, step e is a step in which a double-stranded DNA (12) containing the target sequence is cleaved between identical sequences to obtain a template DNA (1) having a sequence consisting of a support sequence (5), an RNA polymerase promoter sequence (4), a target sequence (8), and an sgRNA scaffold sequence (3). Here, for example, if a restriction enzyme DraI site or a restriction enzyme BtgZI site is provided at the end of the sgRNA scaffold sequence (3), step e can be performed using the restriction enzyme DraI or BtgZI.

[0040] The template DNA (1) obtained in this embodiment can be suitably used as template DNA (1) for obtaining sgRNA by in vitro transcription. Furthermore, template DNA (1) can be suitably used as template DNA (1) for obtaining sgRNA for use in the CRISPR / Cas system by in vitro transcription, and is most suitably used as sgRNA for use in the CRISPR / Cas9 system, but the type of CRISPR / Cas system is not particularly limited.

[0041] The method for producing template DNA (1) according to this embodiment allows steps a to e to be carried out in a cell-free system. Therefore, the production method of this embodiment does not require handling cells, and the effort involved in producing template DNA (1) can be greatly reduced. Furthermore, since the production method of this embodiment can be carried out in a cell-free system, it is suitable for high-throughput production. As a result, it is possible to provide a large quantity of template DNA (1) for obtaining the desired sgRNA by in vitro transcription in a rapid manner.

[0042] Figure 2 shows the method for producing the cassette DNA (2A) used in step a of the method for producing the template DNA (1) according to this embodiment. As shown in Figure 2, the method for producing the cassette DNA (2A) includes, for example, steps a1 and a2 which are described in detail below.

[0043] As shown in the upper right panel of Figure 2, step a1 is a step of preparing a base sequence-containing double-stranded DNA (19A) including a support sequence (5) and a base sequence (17), wherein the base sequence (17) consists of an sgRNA scaffold sequence (3), an RNA polymerase promoter sequence (4), and a removal region (18) located between the sgRNA scaffold sequence (3) and the RNA polymerase promoter sequence (4) and having restriction enzyme sites at both ends. In this embodiment, the removal region (18) further has an EcoRV site.

[0044] Referring to Figure 2, a preferred method for preparing the base sequence-containing double-stranded DNA (19A) in step a1 of this embodiment will be described. First, as shown in the upper left of Figure 2, core oligonucleotides (13A to 13E) are prepared, each having an sgRNA scaffold sequence (3), an RNA polymerase promoter sequence (4), and a removal region (18). Furthermore, sprint oligonucleotides (15A to 15E) are prepared, each having a sequence complementary to the end sequence of each core oligonucleotide (13A to 13E) and a sequence that can anneal across the end of the core oligonucleotide. Here, the nucleotide sequences of the core oligonucleotides (13A to 13E) are the sequences of SEQ ID NOs. 5 to 9 below. However, the sequence of SEQ ID NO. 10 may be used instead of the sequence of SEQ ID NO. 6 is used when creating a cassette DNA (SEQ ID NO. 1) into which the target sequence is introduced in double-stranded DNA, and the sequence of SEQ ID NO. 10 is used when creating a cassette DNA (SEQ ID NO. 2) into which the target sequence is introduced in single-stranded DNA. Furthermore, the nucleotide sequences of the sprint oligonucleotides (15A-15E) are the sequences of sequence numbers 11-15 below.SEQ ID NO. 5 (13A): GAAGCTAATACGACTACTATAGGCGAGACCCCCCaataattaggcctagtactggaggagtttc aGATATC SEQ ID NO. 6 (13B): attgagtaggagatctagtactaggcctaatatttccggatggCGTCTCGgGTTTTAGAGCTAGAAATAG SEQ ID NO. 7 (13C): CAAGTTAAAAATAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGA GTCGG TGCTTTTAAAGGGTCC SEQ ID NO. 8 (13D): TCATCGCATATGCATGGTGCACCTGCAGGATCCTCGAGG TACCGTCATAGCTGTTTCC TG TGTGAGAA TT SEQ ID NO. 9 (13E): CTTGTAAAAACGACGGCCAGTGACTCTAGACTAGTTAA TTAAGCTTGAGCTCCCCGGGCGGCCGCGAAGAGC SEQ ID NO. 10 (13B): attgagtaggagatctagtactaggcctaatat tTCCGGATGAGCGAGAGCTTTTAGAGCTAGAAATAG SEQ ID NO. 11 (15A): cgctactcaatGATATC tgaaaact SEQ ID NO. 12 (15B): CTTATTTTAACTTGCTATTTC TAGCT C SEQ ID NO. 13 (15C): ATATGCGATGAGGACCCCTTTA A SEQ ID NO. 14 (15D): TCGTTTTACA A G AATTC TCACACA SEQ ID NO. 15 (15E): CG TATTAGCTTCGCTCTTCGC。

[0045] Next, as shown in the middle left of Figure 2, the core oligonucleotides (13A-13E) and sprint oligonucleotides (15A-15E) are annealed and then ligated using a DNA-binding enzyme to prepare a support sequence-containing cyclic nucleotide (16), which is a single-stranded cyclic nucleotide containing a base sequence. This method is called the circular assembling into ordered sequence (CAIOS) method. Also, the sprint oligonucleotides (15A-15E) are not shown in the single-stranded support sequence-containing cyclic nucleotide (16) in the middle left of Figure 2. Next, as shown in the lower left panel of Figure 2, the obtained support sequence-containing cyclic nucleotide (16) can be used as a template, and a base sequence-containing double-stranded DNA (19A) can be suitably prepared by rolling-circle amplification using two or more primers that bind to at least one of the support sequence (5) and the base sequence (17) and a strand-displacing DNA polymerase (11), starting from the site where the sprint oligonucleotide is bound. Random primers such as 6R5S primers can be used as primers. This method is called the MPRCA (Multiply-primed RCA) method.

[0046] In this embodiment, two or more primers that bind to at least one of the support sequence (5) and the base sequence (17) can be appropriately selected from primers well known to those skilled in the art. Furthermore, the strand-displacing DNA polymerase (11) used in rolling circle amplification preferably has exonuclease activity. As such a strand-displacing DNA polymerase (11), for example, φ29 DNA polymerase can be suitably used.

[0047] As shown on the right side of FIG. 2, step a2 is a step of cleaving the restriction enzyme site of the removal region with a restriction enzyme to obtain cassette DNA (2A). In the example of FIG. 2, the case where the restriction enzyme site of the removal region is a BcoDI site is described. More specifically, by allowing the restriction enzyme BcoDI to act on the double-stranded DNA (19A) containing the base sequence and simultaneously cleaving both ends of the sequence (18) of the removal region at two positions, cassette DNA (2A) having protruding sequences (6A, 6B) on the 5'-sides of the respective strands and having phosphate groups at the 5'-ends of the respective strands can be obtained (see the enlarged view at the lower part of FIG. 2).

[0048] A method for producing template DNA (1) according to a modification of an embodiment of the present invention will be described while referring to FIG. 3. In particular, the method for producing template DNA (1) according to this modification is characterized in that a single-stranded target sequence-containing oligonucleotide (7B) is used.

[0049] The production method according to the modification of the embodiment is different from the production method according to the above-described embodiment in the following two points. The first point is that in step a, cassette DNA (2B) having protruding sequences (6A, 6C) at both ends of one strand of the fragment is used. The second point is that in step b, a single-stranded target sequence-containing oligonucleotide (7B) having a first cassette DNA binding sequence (23) complementary to the protruding sequence (6A) of the cassette DNA (2B) and a second cassette DNA binding sequence (24) complementary to the protruding sequence (6C) of the cassette DNA (2B) at both ends of the target sequence (8) is used. The other steps are the same as the method for producing template DNA (1) according to the embodiment of the present invention described above.

[0050] An overview of steps a and b of the method for producing template DNA (1) according to a modification of an embodiment of the present invention is shown in FIG. 3. Note that FIG. 3a shows step a, and FIG. 3b shows step b.

[0051] In this modified example, step a is basically the same as step a in the embodiment described above. In particular, in this modified example, as shown in Figure 3a, step a is a step of preparing a cassette DNA (2B) consisting of a fragment containing an sgRNA scaffold sequence (3) and an RNA polymerase promoter sequence (4), having protruding sequences (6A, 6C) at both ends of one strand of the fragment, and containing a phosphate group at the 5' end of at least one strand of the fragment. In this modified example, the method of preparing the cassette DNA (2B) in step a is not particularly limited.

[0052] Referring to Figure 3a, a preferred method for preparing the cassette DNA (2B) in step a of this modified example will be described in more detail. As shown in Figure 3a, first, a base sequence-containing double-stranded DNA (19B) is prepared. This base sequence-containing double-stranded DNA (19B) is a double-stranded DNA having a base sequence (17) consisting of an RNA polymerase promoter sequence (4), a removal region sequence (18), and an sgRNA scaffold sequence (3), and a support sequence (5) which is not shown. In the example of Figure 3, the removal region sequence (18) of the base sequence-containing double-stranded DNA consists of a BcoDI site (20), an MwoI site (21), and a removal sequence (22) positioned between the BcoDI site (20) and the MwoI site (21). First, the base sequence-containing double-stranded DNA (19B) is treated with the restriction enzyme MwoI to cleave it so that the sgRNA scaffold sequence (3) has a protruding sequence (6C) at its 3' end and the other strand has a phosphate group at its 5' end. Subsequently, the resulting fragment is treated with the restriction enzyme BcoDI to cleave it so that the RNA polymerase promoter sequence (4) has a protruding sequence (6A) at its 5' end and the protruding sequence has a phosphate group at its 5' end. This allows for the suitable preparation of cassette DNA (2B) having protruding sequences (6A, 6C) at both ends of one strand and phosphate groups at the 5' ends of both strands.

[0053] In this modified example, step b is basically the same as step b in the above-described embodiment. In particular, in this modified example, as shown in Figure 3b, step b is a step of preparing a single-stranded target sequence-containing oligonucleotide (7B) having a first cassette DNA binding sequence (23) complementary to the overhang sequence (6A) of cassette DNA (2B) and a second cassette DNA binding sequence (24) complementary to the overhang sequence (6C) of cassette DNA (2B) at both ends of the target sequence (8), and having a phosphorylated 5' end. In this modified example, the method for preparing the single-stranded target sequence-containing oligonucleotide (7B) in step b is not particularly limited, but it is preferable that it be a synthetic oligonucleotide that is accurately synthesized one base at a time by a conventional method according to the desired sequence.

[0054] Although not shown in the diagram, in this modified example, step c is a step of ligating a cassette DNA (2B) and a single-stranded target sequence-containing oligonucleotide (7B) with a DNA-binding enzyme to obtain a target sequence-containing cyclic nucleotide. More specifically, initially, the protruding sequences (6A, 6C) of the cassette DNA (2B) complementarily bind to the first cassette DNA binding sequence (23) and the second cassette DNA binding sequence (24) of the single-stranded target sequence-containing oligonucleotide (7B). In this state, a target sequence-containing cyclic nucleotide can be obtained by ligating the cassette DNA (2B) and the single-stranded target sequence-containing oligonucleotide (7B) with a DNA-binding enzyme.

[0055] In this modified example, step c is the same as step c of the manufacturing method according to the above embodiment, except that the structure of the cassette DNA (2B) and the single-stranded target sequence-containing oligonucleotide (7B) used are different, and the manner of their binding and linking is different. Therefore, the number of nicks, the type of DNA-binding enzyme, and the conditions for the linking reaction using the DNA-binding enzyme are not particularly limited and can be the same as, for example, step c of the manufacturing method according to the above embodiment.

[0056] Although not shown in the figures, in this modified example, steps d and e are the same as steps d and e in the manufacturing method according to the above embodiment. In this way, template DNA (1) can be prepared.

[0057] In this embodiment and its modifications, either cassette DNA (2A) or cassette DNA (2B) can be suitably used. Furthermore, the DNA-binding enzyme and strand-displacing DNA polymerase (11) are not particularly limited, but those described above can be suitably used.

[0058] In this embodiment and its modifications, the buffer for strand-displacement DNA synthesis, the amplification primers, and the four types of deoxyribonucleotides are not particularly limited and can be appropriately selected from those well known to those skilled in the art.

[0059] The following examples illustrate in detail the cassette DNA for preparing the template DNA used in sgRNA production according to the present invention, the combination of oligonucleotides for producing the cassette DNA, and the method for producing the cassette DNA.

[0060] [Example 1: Preparation of Cassette DNA] In Example 1, cassette DNA having a protruding sequence on the 5' side of each strand and containing a phosphate group at the 5' end of each strand was prepared using the CAIOS method as follows.

[0061] (Preparation of Oligonucleotides) In this embodiment 1, five core oligonucleotide combinations were prepared, each having either the sequences of SEQ ID NOs. 3 to 7 or the sequences of SEQ ID NOs. 3, 5 to 8. The DNA map when these core oligonucleotides were linked together to form a ring is shown in Figure 4. The one using the sequences of SEQ ID NOs. 5 to 9 is (a) "Type-D_New", and the one using the sequences of SEQ ID NOs. 5, 7 to 10 is (b) "Type-S_New". In addition, five oligoDNAs having the sequences of SEQ ID NOs. 11 to 15 were prepared as sprint oligonucleotides.

[0062] (Preparation of buffer solutions) 10× phosphorylation buffer is prepared by mixing 2 mL of 1 M tris acetate (pH 7.9), 1 mL of 1 M magnesium acetate, 1 mL of 1 mg bovine serum-derived albumin, and 6 mL of distilled water. 10× annealing buffer is prepared by mixing 2 mL of 1 M tris acetate (pH 7.8), 1 mL of 1 M magnesium acetate, 2.5 mL of 4 M potassium glutamate, 0.2 mL of 50 mM NAD, 1 mL of 1 M ammonium sulfate, and 3.3 mL of distilled water. 10× RCA buffer is prepared by mixing 2 mL of 1 M tris acetate (pH 7.5), 0.625 mL of 4 M potassium glutamate, 2 mL of 1 M magnesium acetate, 4 mL of 1 M ammonium sulfate, and 1.375 mL of distilled water.

[0063] (Phosphorylation of Core Oligonucleotides) To link the core oligonucleotides after the reaction, the 5' end of each core oligonucleotide of SEQ ID NOs. 5-9 or SEQ ID NOs. 5, 7-10 was phosphorylated as follows. First, 4 μL of a solution was prepared by mixing each core oligonucleotide of SEQ ID NOs. 5-9 or SEQ ID NOs. 5, 7-10 in a single container so that the concentration of each oligonucleotide was 10 pmol / μL. In addition to this solution, 5 μL of 10× phosphorylation buffer, 5 μL of 10 mM ATP, 0.5 μL of 100 mM dithiothreitol, 2 μL of T4 polynucleotide kinase (New England Biolabs), and 33.5 μL of distilled water were added to make a total volume of 50 μL. This mixture was treated at 37°C for 30 minutes to phosphorylate the oligonucleotides, then treated at 65°C for 20 minutes to inactivate the enzyme, and then cooled to 12°C. The concentration of each oligonucleotide in the resulting phosphate-containing oligonucleotide mixture was 0.8 pmol / μL.

[0064] (Annealing) After the phosphorylation treatment described above, the following procedure was performed to anneal the phosphate-containing oligonucleotide mixture with the splint oligonucleotides of SEQ ID NOs. 11-15. Before the procedure, 1 μL of a splint oligonucleotide mixture was prepared by mixing each splint oligonucleotide in a separate container to a concentration of 5 pmol / μL. First, 1 μL of 10× annealing buffer and 1.8 μL of distilled water were added to a 0.2 mL tube and stirred. Next, 6.3 μL of the 0.8 pmol / μL phosphate-containing oligonucleotide mixture was added to the tube, followed by 1 μL of the 5 pmol / μL splint oligonucleotide mixture to make a total volume of 10 μL. This mixture was heated at 95°C for 1 minute, then rapidly cooled to 4°C and maintained for 10 minutes, and then maintained at 12°C for an extended period to complete the annealing process between the core oligonucleotide and the splint oligonucleotide.

[0065] (Linking Reaction) Next, the following procedure was performed to link the core oligonucleotides that had been annealed to the sprint oligonucleotides to form a ring. 1 μL of 10× annealing buffer and 1 μL of E. coli DNA ligase (New England Biolabs) were added to the tube after the annealing treatment, and then 8 μL of distilled water was added to make a total volume of 10 μL. This mixture was then mixed to make a total volume of 20 μL. This mixture was treated at 37°C for 30 minutes to complete the linking reaction, then treated at 65°C for 20 minutes to inactivate the enzyme, and then cooled to 12°C to obtain a linking reaction solution containing a cyclic nucleotide with a support sequence.

[0066] (Amplification Reaction) To perform the amplification reaction using the MPRCA (Multiply-primed RCA) method, 2 μL of 100 μM 6R5S primer, 2 μL of 10× RCA buffer, 2 μL of 10 mM dNTPs, 1 μL of 100 mM DTT, 0.1 μL of pyrophosphatase (New England Biolabs), 1 μL of φ29 DNA polymerase (Kanto Chemical Co., Ltd.), and 9.9 μL of distilled water were added to a new 0.2 mL tube and mixed. Then, 2 μL of the above coupling reaction solution was added to the tube to make a total volume of 20 μL. This mixture was reacted at 30°C for 16 hours, then treated at 65°C for 10 minutes to inactivate the enzyme, cooled to 12°C, and the amplification reaction was completed. As a result of this reaction, a base sequence-containing double-stranded DNA, which is an identical sequence concatemer consisting of a support sequence and a base sequence, was obtained as the amplification product. Next, 180 μL of distilled water was added to the amplified product to dilute it to an appropriate concentration, and the diluted product was obtained.

[0067] (Size confirmation by cleavage of amplified product) The following procedure was performed to confirm the size by cleavage at the EcoRV site established in the core oligonucleotide. 5 μL of 10×CutSmart buffer (New England Biolabs), 1 μL of restriction enzyme EcoRV, and 20 μL of distilled water were added to a new 0.2 mL tube and mixed. Subsequently, 25 μL of the diluted product was added to the tube. This mixture was treated at 37°C for 30 minutes, and then cooled to 12°C to complete the cleavage reaction at the EcoRV site. The oligonucleotide after the cleavage reaction was purified by gel filtration using a spin column (Sephacryl-S400). Conventional agarose gel electrophoresis was performed on the sample after the cleavage reaction and the sample after gel filtration purification. The results are shown in Figure 5. Figure 5(a) shows the results for "Type-D_New," and (b) shows the results for "Type-S_New," where M is the 100 bp ladder size marker, 1 is the unpurified sample after cleavage, and 2 is the sample after cleavage and purification. As shown in Figure 5, after cleavage, in addition to the target 350 bp oligoDNA (white arrow in the figure), the formation of byproducts (black arrow in the figure) is observed, but it can be seen that only the target oligoDNA remains after gel filtration purification. In other words, with the cassette DNA according to the present invention, because the size of the target oligoDNA and the byproducts are significantly different, purification can be performed easily and quickly by gel filtration purification, etc., without using HPLC or gel excision.

[0068] [Comparative Example: Conventional Cassette DNA] (Preparation of Oligonucleotides) Table 1 shows the core oligonucleotides for creating cassette DNA into which the target sequence is introduced using double-stranded DNA as a comparative example, and Table 2 shows the sprint oligonucleotides. Table 3 shows the core oligonucleotides for creating cassette DNA into which the target sequence is introduced using single-stranded DNA as a comparative example, and Table 4 shows the sprint oligonucleotides. Figure 6(a) shows the DNA map when the core oligonucleotides in Table 1 are linked and circularized (Type-D_old), and Figure 6(b) shows the DNA map when the core oligonucleotides in Table 3 are linked and circularized (Type-S_old). In the nucleotide in question, the T7 promoter sequence refers to the sequence "TAATACGACTCACTATAGG" in nucleotide bv2.1_1 and "TAATACGACTCACTATAGG" in bv4_1, and the sgRNA scaffold sequence refers to "GTTTTAGAGCTAGAAAATAGCA" in nucleotide bv2.1_1 and bv4_2 This refers to the sequence "AGTTAAAAAATAAGGCTAGTCCGTTATCACATGAAAAAGTGGCACCGAGTCGGTGCTTTT" and the sequence "TTAGAGCTAGAAATAGCAAGTTAAAAAATAAGGCTAGTCCGTTATCACATGAAAAAGTGGCACCGAGTCGGTGCTTTT" in bv4_1 and bv4.1_2. In addition, in the core GND in Table 1, the BcoDI site refers to the sequence "GAGAC" and "GTCTC" in GNDbv2.1_1. On the other hand, in the core oligonucleotides shown in Table 3, the BcoDI site refers to the "GAGAC" sequence in oligonucleotide bv4_1, and the MwoI site refers to the "GCTTTTTAGAGC" sequence in oligonucleotide bv4_1.

[0069]

[0070]

[0071]

[0072]

[0073] Using each of the above-mentioned oligonucleotides, the core oligonucleotide and the sprint oligonucleotide were annealed in the same manner as in Example 1, and the ligation and amplification reactions were carried out.

[0074] (Size confirmation by cleavage of amplified product) The following procedure was performed to confirm the size by cleavage at the BcoDI site established in the core oligonucleotide. 5 μL of 10×CutSmart buffer (New England Biolabs), 1 μL of restriction enzyme BcoDI, and 20 μL of distilled water were added to a new 0.2 mL tube and mixed. Subsequently, 25 μL of the diluted product was added to the tube. This mixture was treated at 37°C for 30 minutes, and then cooled to 12°C to complete the cleavage reaction at the BcoDI site. Conventional agarose gel electrophoresis was performed on the samples after the cleavage reaction. The results are shown in Figure 7. Figure 7(a) shows the results for "Type-D_old", and (b) shows the results for "Type-S_old". As shown in Figure 7, in addition to the target double-cleaved oligoDNA (white arrow), fragments with only one cut (gray arrow in (a)) and the formation of by-products (gray arrow in (b)) were also observed, all of which were similar in size to the target oligoDNA. Therefore, when using conventional oligonucleotides, separating and purifying the target oligoDNA from unintended oligoDNA such as by-products cannot be done simply by gel filtration purification as in Example 1 above, making the purification process complicated and time-consuming. Furthermore, excision from the agarose gel is also difficult due to the similar sizes of the fragments. For these reasons, Example 1 above is more advantageous.

[0075] [Example 2: Preparation of Template DNA] In Example 2, template DNA for obtaining sgRNA by in vitro transcription was prepared using the cassette DNA prepared in Example 1. In this example, the template DNA was prepared using "Type-D_New" from Example 1. The method for preparing target sequence-containing oligonucleotides and template DNA containing them is described below.

[0076] <Preparation of oligonucleotides containing the target sequence> Double-stranded oligonucleotides containing the target sequence were prepared as follows.

[0077] (Preparation of oligonucleotides) The sense oligonucleotides and antisense oligonucleotides used in this example are shown in Table 3. In these sense oligonucleotides and antisense oligonucleotides, the target sequences refer to the sequences "CATTACTGGATCTATCAAC" and "TTGATAGATCCAGTAATATA," and are complementary sequences. The cassette double-stranded DNA binding sequences refer to the sequences "TAGG" and "AAAC."

[0078]

[0079] (Phosphorylation of Antisense Oligonucleotides) The 5' end of an antisense oligonucleotide (sgRNA for lambda_1 AS) was phosphorylated as follows. First, 6 μL of a 50 pmol / μL oligonucleotide solution (consisting of a cassette double-stranded DNA binding sequence and a target sequence), 5 μL of 10× phosphorylation buffer, 5 μL of 10 mM ATP, 0.5 μL of 100 mM dithiothreitol, 2 μL of T4 polynucleotide kinase (New England Biolabs), and 31.5 μL of distilled water were added to a new tube to a total volume of 50 μL. This mixture was treated at 37°C for 30 minutes to phosphorylate the oligonucleotide, then treated at 65°C for 20 minutes to inactivate the enzyme, and then cooled to 12°C to obtain a phosphate-containing antisense oligonucleotide solution. The concentration of the phosphate-containing antisense oligonucleotide in this solution was 6 pmol / μL.

[0080] (Annealing) After the phosphorylation treatment described above, the following annealing treatment was performed to double-chain the sense oligonucleotide and the phosphate-containing antisense oligonucleotide. First, 10 μL of 6 pmol / μL phosphate-containing antisense oligonucleotide solution, 1.2 μL of 50 pmol / μL sense oligonucleotide, 2 μL of 10× annealing buffer, and 6.8 μL of distilled water were added to a 0.2 mL tube to make a total volume of 20 μL. This mixture was heated at 95°C for 1 minute, then slowly cooled to 25°C and maintained for a long period of time to complete the annealing process. The concentration of the target sequence-containing oligonucleotide in the obtained target sequence-containing oligonucleotide solution was 3 pmol / μL. 180 μL of distilled water was added to 20 μL of this target sequence-containing oligonucleotide solution and mixed to prepare a 0.3 pmol / μL target sequence-containing oligonucleotide solution.

[0081] <Preparation of template DNA> Using a cassette double-stranded DNA solution having protruding sequences on the 5' end of each strand and containing a phosphate group at the 5' end of each strand, and a double-stranded oligonucleotide solution containing the target sequence, template DNA was prepared as follows.

[0082] (Luplation Reaction) The following procedure was performed to ligate the cassette double-stranded DNA with the target sequence-containing oligonucleotide. In a new tube, 2 μL of 0.1 pmol / μL cassette double-stranded DNA solution, 2 μL of 0.3 pmol / μL target sequence-containing oligonucleotide solution, 2 μL of 10× annealing buffer, 1 μL of E. coli DNA ligase (New England Biolabs), and 13 μL of distilled water were added to make a total volume of 20 μL. This mixture was treated at 16°C for 30 minutes to complete the ligation reaction between the cassette double-stranded DNA and the target sequence-containing oligonucleotide, then treated at 65°C for 20 minutes to inactivate the enzyme, and then cooled to 25°C. 180 μL of distilled water was added to the resulting solution and mixed to obtain a target sequence-containing cyclic nucleotide solution.

[0083] (Amplification Reaction) To perform the amplification reaction by MPRCA, 2 μL of 100 μM 6R5S primer, 2 μL of 10× RCA buffer, 2 μL of 10 mM dNTPs, 1 μL of 100 mM DTT, 0.1 μL of pyrophosphatase (New England Biolabs), 1 μL of φ29 DNA polymerase (Kanto Chemical Co., Ltd.), and 9.9 μL of distilled water were added to a new 0.2 mL tube and mixed. Then, 2 μL of the target sequence-containing cyclic nucleotide solution was added to the tube to make a total volume of 20 μL. This mixture was reacted at 30°C for 16 hours to obtain a target sequence-containing double-stranded DNA, which is an identical sequence concatemer consisting of the support sequence, T7 promoter sequence, target sequence, and sgRNA scaffold sequence, as the amplification product. After the reaction, the enzyme was inactivated by treating at 65°C for 10 minutes, and the mixture was cooled to 12°C to complete the amplification reaction. Next, the amplified product was transferred to a separate tube containing 62.5 μL of distilled water and diluted to an appropriate concentration to obtain the diluted product.

[0084] (Restriction Enzyme Cutting) The following procedure was performed to cut the sgRNA scaffold sequence at the DraI site in the double-stranded DNA containing the target sequence. 10 μL of 10×M buffer (Nippon Gene), 1 μL of restriction enzyme DraI (Nippon Gene), and 39 μL of distilled water were added to a new 0.2 mL tube and mixed. Subsequently, 50 μL of the diluted product was added to the tube to make a total volume of 100 μL. This mixture was reacted at 37°C for 30 minutes to complete the cutting reaction at the DraI site, and then cooled to 12°C. The size confirmation cutting reaction solution and the BcoDI cutting reaction solution obtained in this step were confirmed to have been cut by conventional agarose gel electrophoresis (not shown). As a result, the presence of a product of the desired length, consisting of the support sequence, T7 promoter sequence, target sequence, and sgRNA scaffold sequence, was confirmed. Therefore, we were able to confirm the generation of template DNA by cleaving the target sequence-containing double-stranded DNA at the restriction enzyme DraI site at the end of the sgRNA scaffold sequence. Finally, the DraI cleavage reaction mixture was purified using the Monarch® PCR & DNA Cleanup Kit to obtain a 1 pmol / μL template DNA solution. The concentration of this template DNA was determined using the Qubit® assay.

[0085] The above procedure demonstrated that a template DNA having a sequence consisting of a support sequence, a T7 promoter sequence, a target sequence, and an sgRNA scaffold sequence could be prepared.

[0086] (Confirmation of template DNA size) To confirm the size of the obtained template DNA, it was cut at the EcoRV site in the same manner as in Example 1 and subjected to conventional agarose gel electrophoresis. In addition to EcoRV treatment, double cuts and other preparations were also subjected to agarose gel electrophoresis simultaneously. The results are shown in Figure 8. In Figure 8, M indicates a 100 bp ladder size marker, 1 shows the obtained template DNA cut with EcoRV, 2 shows the template DNA double cut with BcoDI, 3-6 show the template DNA containing the sgRNA target sequence cut with EcoRI, and 7 shows the product without the sgRNA target sequence.

[0087] As shown in Figure 8, when comparing 1 and 2, there is a size difference of about 100 bp, which makes them easy to distinguish and therefore preferable.

[0088] As described above, the combination of cassette DNA for preparing template DNA used in sgRNA production, oligo DNA for manufacturing cassette DNA, and the method for manufacturing cassette DNA are beneficial because they allow for the simpler and faster production and purification of cassette DNA.

[0089] 1. Template DNA 2A, 2B Cassette DNA 3. sgRNA scaffold sequence 4. RNA polymerase promoter sequence 5. Support sequences 6A, 6B, 6C Overhang sequences 7A, 7B Target sequence-containing oligonucleotide 8. Target sequence 9A, 9B Cassette DNA binding sequence 10. Target sequence-containing cyclic nucleotide 11. DNA polymerase 12. Target sequence-containing double-stranded DNA 13A, 13B, 13C, 13D 13E Core oligonucleotide 15A, 15B, 15C, 15D 15E Sprint oligonucleotide 16. Support sequence-containing cyclic nucleotide 17. Base sequence 18. Removal region sequence 19A, 19B Base sequence-containing double-stranded DNA 20. BcoDI site 21. MwoI site 22. Removal sequence 23. First cassette DNA binding sequence 24. Second cassette DNA binding sequence

Claims

1. A cassette DNA used in a method for producing template DNA for obtaining sgRNA by in vitro transcription using a cell-free cloning system, comprising a support sequence, an sgRNA scaffold sequence, and an RNA polymerase promoter sequence, and consisting of the nucleotide sequence of SEQ ID NO: 1 or 2.

2. A combination of five core oligoDNAs of sequence numbers 5 to 9, or a combination of five core oligoDNAs of sequence numbers 5 and 7 to 10 and sprint oligoDNAs of sequence numbers 11 to 15, used to produce the cassette DNA described in claim 1.

3. A method for producing cassette DNA for use in a method for producing template DNA for obtaining sgRNA by in vitro transcription using a cell-free cloning system, comprising the steps of: preparing five types of core oligoDNAs of sequence numbers 5 to 9 or five types of core oligoDNAs of sequence numbers 5 and 7 to 10; preparing sprint oligoDNAs of sequence numbers 11 to 15; ringing together five types of core oligoDNAs of sequence numbers 5 to 9 or five types of core oligoDNAs of sequence numbers 5 and 7 to 10 using the CAIOS method with the sprint oligoDNAs of sequence numbers 11 to 15 to obtain circular DNA containing a support sequence, an sgRNA scaffold sequence, an RNA polymerase promoter sequence, and a removal region; and performing rolling circle amplification of the circular DNA using two or more primers, and then removing the removal region with a restriction enzyme to obtain cassette DNA consisting of the nucleotide sequence of sequence number 1 or 2.