Therapeutic or prophylactic agent targeting complement activation pathway in HTLV-1-associated myelopathy (HAM)

Abstract

The present disclosure provides a therapeutic or prophylactic agent for HAM. The present disclosure provides a therapeutic or prophylactic agent for HTLV-1-associated myelopathy (HAM), the agent containing a substance that inhibits a complement activation pathway.

Description

Therapeutic or prophylactic agents targeting the complement activation pathway in HTLV-1-associated myelopathy (HAM)

[0001] The present invention relates to therapeutic or prophylactic agents, etc., that target the complement activation pathway in HTLV-1-associated myelopathy (HAM).

[0002] Human T-cell leukemia virus type 1 (HTLV-1) is a virus that infects T cells (mainly CD4-positive T cells), which are a type of white blood cell in the blood. T cells infected with HTLV-1 cause chronic inflammation in the spinal cord. As a result, damage and degeneration of spinal nerve cells occur, leading to spastic spinal paralysis and other conditions. Spastic spinal paralysis caused by cells infected with HTLV-1 is called HTLV-1-associated myelopathy (hereinafter also referred to as "HAM").

[0003] Symptoms of HAM include paralysis and pain in both legs, as well as urinary and bowel dysfunction, due to nerve tissue damage. As these symptoms progress, patients may become wheelchair-bound or bedridden. HAM is one of the diseases designated as an intractable disease in Japan, but currently there is no established effective treatment for HAM, and treatment is mainly symptomatic.

[0004] As a treatment method for HAM, methods using RGMa inhibitors such as anti-RGMa antibodies are known (see, for example, Patent Document 1).

[0005] International Publication No. 2020 / 017629

[0006] There is a strong desire for the establishment of a treatment method for HAM. Furthermore, spinal cord autopsies of HAM patients are extremely rare, and because the spinal cord has a complex tissue structure, it is very difficult to analyze the lesions of HAM patients at the single-cell level. In addition, because only minute amounts of HTLV-1 infected cells infiltrating the spinal cord can be collected, comprehensive gene expression analysis is difficult.

[0007] The problem that this invention aims to solve is to provide a novel therapeutic or preventive agent for HAM.

[0008] To elucidate the fundamental mechanism by which HAM-specific inflammatory pathology occurs, the inventors focused on spatial transcriptome analysis (Visium), which allows for comprehensive gene expression analysis while preserving spatial information; proteome analysis (SOMAscan (Slow Off-rate Modified Aptamer scan)), which measures approximately 7,000 types of proteins at once using aptamers; and single-cell RNA sequencing, which performs gene analysis at the single-cell level, and integrated these analyses. As a result, they found that complement-related genes were highly expressed in HAM lesion sites and in cerebrospinal fluid (CSF). They then discovered that inhibiting the complement activation pathway may be effective in treating or preventing HAM, leading to the completion of the present invention.

[0009] In other words, the present disclosure includes the following embodiments: [1] A therapeutic or prophylactic agent for HTLV-1-associated myelopathy (HAM), comprising a substance that inhibits the complement activation pathway. [2] The therapeutic or prophylactic agent according to [1], wherein the inhibitory substance inhibits the activation of complement factor C3. [3] The therapeutic or prophylactic agent according to [1] or [2], wherein the inhibitory substance suppresses the formation of complement complex C5b6. [4] The therapeutic or prophylactic agent according to any one of [1] to [3], wherein the inhibition of the complement activation pathway is performed in a lesion of HTLV-1-associated myelopathy. [5] The therapeutic or prophylactic agent according to any one of [1] to [4], wherein the inhibitory substance is at least one selected from the group consisting of a substance that inhibits the expression of a gene encoding a complement factor or a fragment thereof, a substance that binds to a complement factor or a fragment thereof, a substance that binds to a complement factor convertase or a fragment thereof, a substance that inhibits the activity of a complement factor or a fragment thereof, and a substance that inhibits the activity of a complement factor convertase or a fragment thereof. [6] The therapeutic or prophylactic agent according to any one of [1] to [4], wherein the inhibitory substance is (A) siRNA, shRNA, or antisense oligonucleotide of a gene encoding a complement factor or a fragment thereof; (B) an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof; (C) a small molecule compound that inhibits the activity of at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof; and (D) a peptide that binds to at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof; and (E) at least one selected from the group consisting of a nucleic acid aptamer that binds to at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof.[7] The inhibitory substance is an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of (A) complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, complement factor constituting C3 convertase or a fragment thereof, and complement factor constituting C5 convertase or a fragment thereof; (B) an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, C3 convertase or a fragment thereof, complement factor constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factor constituting C5 convertase or a fragment thereof; (C) Small molecule compounds that inhibit the activity of at least one selected from the group consisting of complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factor or its fragment constituting C3 convertase, C5 convertase or its fragment, and complement factor or its fragment constituting C5 convertase; and (D) Peptides that bind to at least one selected from the group consisting of complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factor or its fragment constituting C3 convertase, C5 convertase or its fragment, and complement factor or its fragment constituting C5 convertase. (E) A therapeutic or prophylactic agent according to any one of [1] to [4], wherein the therapeutic or prophylactic agent is selected from the group consisting of a nucleic acid aptamer that binds to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, C3 convertase or a fragment thereof, a complement factor constituting C3 convertase or a fragment thereof, and a complement factor constituting C5 convertase or a fragment thereof.[8] The inhibitory substance is: (A) siRNA, shRNA, or antisense oligonucleotide of a gene expressing at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, complement factors constituting C3 convertase or a fragment thereof, and complement factors constituting C5 convertase or a fragment thereof; (B) an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, complement factors constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factors constituting C5 convertase; (C) a small molecule compound that inhibits the activity of at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, and C5 convertase or a fragment thereof; and (D) A peptide that binds to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, a complement factor constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and a complement factor constituting C5 convertase. (E) At least one selected from the group consisting of nucleic acid aptamers that bind to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, a complement factor constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and a complement factor constituting C5 convertase, according to any one of [1] to [4]. [9] The therapeutic or prophylactic agent according to any one of [1] to [4], wherein the inhibitory substance is at least one selected from the group consisting of compstatin, pegcetacoplan, Cp40 / AMY-101, danicopan, iptacopan, eculizumab, ravulizumab, Coversin, zircoplan, tesidolumab, lamparizumab, narsoplimab, ALN-CC5, clobarimab, and abasincaptadopegol.

[10] An auxiliary method for determining the severity of HAM, comprising: measuring the concentration of a target complement factor or a fragment thereof; and determining that the higher the measured concentration is than the normal value, the greater the severity of HAM.

[11] The method according to

[10] , wherein the complement factor is at least one selected from the group consisting of complement factor C5, complement factor C6, and complement complex C5b6.

[12] The method according to

[10] or

[11] , further comprising: measuring the concentration of the target CXCL10; and determining that the higher the measured concentration is than the normal value, the greater the severity of HAM.

[0010] The disclosure also includes the following embodiments: [A1] A method for treating or preventing HTLV-1-associated myelopathy (HAM), comprising administering a therapeutically effective amount of a substance that inhibits the complement activation pathway to a patient in need thereof.

[0011] [B1] A substance that inhibits the complement activation pathway for the treatment or prevention of HTLV-1-associated myelopathy (HAM).

[0012] [C1] Use of substances that inhibit the complement activation pathway for the treatment or prevention of HTLV-1-associated myelopathy (HAM).

[0013] [D1] Use of substances that inhibit the complement activation pathway in the manufacture of therapeutic or prophylactic agents for HTLV-1-associated myelopathy (HAM).

[0014] [E1] A therapeutic or prophylactic agent for use in the treatment of HTLV-1-associated myelopathy (HAM), comprising a substance that inhibits the complement activation pathway.

[0015] In [X1] [A1] to [E1], it is preferable that the substance inhibits the complement activation pathway in the lesion. In [A1] to [E1], it is preferable that the substance inhibits the complement activation pathway in at least one of microglia, astrocytes, and fibroblasts.

[0016] [X2] In [A1] to [E1], the substance may inhibit the activation of complement factor C3. In [A1] to [E1], the substance may suppress the formation of complement complex C5b6. In [A1] to [E1], the inhibiting substance may be at least one selected from the group consisting of a substance that inhibits the expression of a gene encoding a complement factor or a fragment thereof, a substance that binds to a complement factor or a fragment thereof, a substance that binds to a complement factor convertase or a fragment thereof, a substance that inhibits the activity of a complement factor or a fragment thereof, and a substance that inhibits the activity of a complement factor convertase or a fragment thereof.

[0017] [X3] In [A1] to [E1], the inhibitory substance may be at least one selected from the group consisting of: (A) siRNA, shRNA, or antisense oligonucleotide of a gene encoding a complement factor or a fragment thereof; (B) an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof; (C) a small molecule compound that inhibits the activity of at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof; and (D) a peptide that binds to at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof; and (E) a nucleic acid aptamer that binds to at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof.

[0018] [X4] In [A1] to [E1], the inhibitory substance is: (A) siRNA, shRNA, or antisense oligonucleotide of a gene encoding at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, complement factor constituting C3 convertase or a fragment thereof, and complement factor constituting C5 convertase or a fragment thereof; (B) an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, C3 convertase or a fragment thereof, complement factor constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factor constituting C5 convertase or a fragment thereof; (C) Small molecule compounds that inhibit the activity of at least one selected from the group consisting of complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factor or its fragment constituting C3 convertase, C5 convertase or its fragment, and complement factor or its fragment constituting C5 convertase; and (D) Peptides that bind to at least one selected from the group consisting of complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factor or its fragment constituting C3 convertase, C5 convertase or its fragment, and complement factor or its fragment constituting C5 convertase. (E) At least one selected from the group consisting of a nucleic acid aptamer that binds to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, C3 convertase or a fragment thereof, a complement factor or a fragment thereof that constitutes C3 convertase, C5 convertase or a fragment thereof, and a complement factor or a fragment thereof that constitutes C5 convertase.

[0019] [X5] In [A1] to [E1], the inhibitory substance is: (A) siRNA, shRNA, or antisense oligonucleotide of a gene expressing at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, complement factors constituting C3 convertase or a fragment thereof, and complement factors constituting C5 convertase or a fragment thereof; (B) an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, complement factors constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factors constituting C5 convertase; (C) a small molecule compound that inhibits the activity of at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, and C5 convertase or a fragment thereof; and (D) A peptide that binds to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, complement factors constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factors constituting C5 convertase. (E) At least one selected from the group consisting of nucleic acid aptamers that bind to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, complement factors constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factors constituting C5 convertase.

[0020] [X6] In [A1] to [E1], the inhibitory substance may be at least one selected from the group consisting of compstatin, pegcetacoplan, Cp40 / AMY-101, danicopan, iptacopan, eculizumab, ravulizumab, Coversin, zircoplan, tesidolumab, lamparizumab, narsoplimab, ALN-CC5, clobarimab, and abasincaptadopegol.

[0021] In the invention described in any of [X7] [1] to

[12] , [A1] to [E1], or [X1] to [X6], the configuration of the invention, such as a substance that inhibits the complement activation pathway, may be any of the preferred embodiments described below. Furthermore, in the invention described in any of [1] to

[12] , [A1] to [E1], or [X1] to [X6], the configuration of the invention may be any combination of preferred embodiments described below. Preferred embodiments include more preferred embodiments, even more preferred embodiments, and even more preferred embodiments.

[0022] According to the present invention, a therapeutic or preventive agent for HAM can be provided.

[0023] This figure shows the localization information of gene expression overlaid on a HE-stained image of the thoracic spinal cord. This is the result of KEGG pathway analysis of gene groups highly expressed in the HAM lesion area. This figure shows the upregulation of complement pathway-related gene expression, as well as the localization of microglia and infiltrating macrophages in the HAM lesion area. Upregulation of expression is shown throughout the lesion area for all genes shown in the figure. This is the result of KEGG pathway analysis of gene groups highly expressed in CD14-positive cells in cerebrospinal fluid (CSF). This is the result of KEGG pathway analysis of gene groups highly expressed in the cerebrospinal fluid (CSF) of HAM patients. This figure compares the relative concentrations of complement factors C3, C3a, C3b, and C3d in the cerebrospinal fluid (CSF) of HAM patients by group based on disease activity. This figure shows that complement factor C4d is specifically deposited in the axons and anterior columns, which are the lesion areas of HAM patients. This figure shows a strong correlation between the amount of complement complex C5b6 and the amount of NF-L (neurofilament light chain), a common marker for neurological disorders. (a) The relative concentrations of C5a and (b) C5b6 were compared for each group based on disease activity. (c) The correlation between C5a and C5b6, and (d) the correlation between NF-L and C5b6 are shown. This figure shows the correlation between OMDS scores and markers. (a) The method of grouping. (b) The results when C5b6, NF-L, and NF-H were used, respectively. This figure shows the correlation between OMDS scores and markers. (a) The method of grouping. (b) The results when C5 and C5b6 were used, respectively. (A) This figure shows that the NF-L concentration was significantly increased in NB-1 cells (neuronal cell line) to which PBMCs (peripheral blood mononuclear cells) from HAM patients were added, compared to PBMCs from healthy individuals. (B) This figure shows that the NF-L concentration was significantly increased in NB-1 cells to which the culture supernatant of PBMCs from HAM patients was added, compared to the culture supernatant of PBMCs from healthy individuals.(A) This figure shows that, compared to the culture supernatant of PBMCs from healthy individuals, the culture supernatant of PBMCs from HAM patients induced increased expression of M1 microglia-related genes (CXCL10, NOS2, CXCL2, IL-6, STAT1, COX2) in HMC3 cells (microglia cell line), but did not induce increased expression of M2 microglia-related genes (PPARγ, CD206, IL-4). (B) This figure shows that when the culture supernatant of PBMCs from HAM patients was added to HMC3 cells, NF-L was not detected, but when it was added to NB-1 cells, the NF-L concentration increased, and when NB-1 cells and HMC3 cells were co-cultured, the NF-L concentration increased further. This figure shows that the culture supernatant of PBMCs from HAM patients induced the expression of the complement factor C3 gene in NB-1 cells, HMC3 cells, and U251 cells (glial cell line). This figure shows that the C3-related inhibitors Cp40 and Danicopan suppressed the spontaneous proliferation activity of PBMCs in HAM patients. This figure shows that Cp40 suppressed the gene expression of IFNγ and TNFα in PBMCs of HAM patients (3 cases) in a concentration-dependent manner. This figure shows that the NF-L concentration, which was elevated in NB-1 cells to which PBMCs from HAM patients were added, was significantly reduced by the addition of Danicopan. This figure shows that the expression level of the CXCL10 gene was reduced in U251 cells and HMC3 cells to which the culture supernatant of PBMCs from HAM patients (3 cases) to which Cp40 was added was added. This figure shows factors (R > 0.4) in the complement activation pathway that have a high correlation with the quantitative value of NF-L. This figure shows that the different cell types were distinguished by integrating analysis of 3 HAM patients and 1 healthy control case, visualizing the data using UMAP, and evaluating the expression of each cell type marker gene. This figure shows the identification of a C3-ITGB2 axis showing high evaluation values ​​through cell-cell interaction analysis using the NicheNet program. It also shows that the complement factor C3 gene was highly expressed in microglia, astrocytes, and fibroblasts, and the ITGB2 gene, which is the receptor for the C3 cleavage factor, was highly expressed in microglia.

[0024] The following describes embodiments of the present invention (hereinafter referred to as "these embodiments"), but the present invention is not limited by the following examples.

[0025] This disclosure includes the treatment or prevention of HTLV-1-associated myelopathy (HAM) by inhibiting the complement activation pathway. As shown in the examples below, the inventors have found that complement-related genes are specifically highly expressed in the lesions and cerebrospinal fluid (CSF) of HAM patients, and that inhibiting the complement activation pathway may lead to the treatment or prevention of HAM. First, substances that inhibit the complement activation pathway will be described below.

[0026] (Substances that inhibit the complement activation pathway) The complement activation pathway refers to the pathway by which the complement system, a part of the immune system, recognizes foreign substances and is activated in a chain reaction. In the complement activation pathway, complement factors are broken down and activated, ultimately forming membrane invasion complexes (MACs) that bind to target cell membranes. The complement system consists of a group of proteins that play an important role in defending against infection and removing damaged tissue, and is mainly found in the blood and tissues. Complement factors can be activated via three different pathways (classical pathway, lectin pathway, and secondary pathway). The main activation event common to all three pathways is that C3 convertases cleave C3 into C3a (anaphylatoxin) and C3b (opsonin), producing activated products. By creating these fragments, opsonization (promotion of phagocytosis) occurs, followed by activation of immune cells through interaction with complement receptors. C3b can form new C3 convertases, thereby initiating a self-amplification loop. The C3b molecule forms C5 convertase in the late pathway of the complement activation pathway, promoting C5 activation. C5 convertase cleaves C5 into C5a (anaphylatoxin) and C5b. C5b complexes with other complement factors C6, C7, C8, and C9 to form MACs, which create holes in the target cell membrane and cause lysis. In this way, the fragments produced by the activation of the complement activation pathway induce the migration and activation of immune cells.

[0027] In this specification, “complement activation pathway” includes pathways that produce reactions resulting in the cleavage of complement factors C3 and / or C5, pathways that produce reactions resulting in the production of C3 convertase and / or C5 convertase, and pathways that involve C5b after the cleavage of complement factor C5. Furthermore, in this specification, “complement activation pathway” includes not only the activation reactions of complement factors themselves, but also the amplification, persistence, and excessive activation states of the complement system resulting from impaired complement activity. In this specification, “complement factor” also includes complement complexes formed by the complexation of multiple complement factors or their fragments.

[0028] In the complement system, complement factors are produced by complement-related genes, and the complement system is activated when the complement activation pathway is activated. Therefore, in this specification, "inhibiting the complement activation pathway" may mean (1) inhibiting the activation of the complement system by inhibiting the function of substances involved in the complement activation pathway, or (2) inhibiting the production of complement factors and thus inhibiting the activation of the complement system by inhibiting the expression of complement-related genes. Here, "complement-related genes" are genes involved in the production of complement factors or fragments thereof, for example, genes that encode complement factors or fragments thereof. Furthermore, by inhibiting the complement activation pathway, (1) the function of substances involved in the complement activation pathway may be suppressed, or (2) the expression of complement-related genes may be suppressed.

[0029] In this specification, "inhibition" includes reducing or eliminating the function, expression, and / or reaction of a substance compared to a state without inhibition. In this specification, "inhibiting the complement activation pathway in the lesion" means that the inhibition described in (1) and / or (2) above occurs at least in the lesion, and the inhibition described in (1) and / or (2) above may occur in areas other than the lesion. In this embodiment, HAM may be treated or prevented by inhibiting the complement activation pathway, including the inhibition described in (1) and / or (2) above.

[0030] In this specification, “lesion” includes not only the lesion in a HAM patient, but also the portion corresponding to the lesion in a HAM pre-symptomatic individual who has HTLV-1 infected cells (i.e., the portion that is potentially lesion). The lesion may be, for example, the spinal cord, the thoracic spinal cord, the white matter region of the thoracic spinal cord, the anterior and lateral columns, or the region where neurological damage is occurring.

[0031] In this specification, inhibiting the complement activation pathway means that the activation of the complement system is inhibited compared to when the therapeutic or prophylactic agent according to this embodiment is not administered, or compared to when the therapeutic or prophylactic method according to this embodiment is not performed. Inhibiting the activation of the complement system may mean inhibiting the expression of complement-related genes; inhibiting the cleavage reaction of complement factors C3 and / or C5 by complement factor convertases; inhibiting the reaction in which fragments of complement factors C3 and / or C5 are complexed with other complement factors or their fragments; and / or inhibiting the reaction produced by C3 convertases and / or C5 convertases, and may mean that the concentration and / or activity of at least one selected from the group consisting of complement factors and complement factor convertases, including complement factor C3, complement factor C5, C3 convertase, and C5 convertase, is reduced. Furthermore, inhibiting the activation of the complement system may involve suppressing the formation of complement complex C5b6 compared to before administration of the therapeutic or preventive agent according to this embodiment, or compared to before implementing the therapeutic or preventive method according to this embodiment.

[0032] C3 convertase is composed of a complex formed by multiple complement factors or their fragments. In the classical and lectin pathways, C3 convertase may be mainly composed of a complex formed by C4b, a fragment of complement factor C4, and C2a, a fragment of complement factor C2. In the second pathway, C3 convertase may be mainly composed of a complex formed by C3b, a fragment of complement factor C3, and Bb, a fragment of complement factor B (also called factor B). In the production of Bb, a fragment of factor B, in the second pathway, complement factor D (also called factor D) may be involved.

[0033] C5 convertase is composed of a complex formed by multiple complement factors or their fragments. C5 convertase may be composed of a complex formed by C3 convertase and C3b, which is a fragment of complement factor C3. That is, C5 convertase may be composed of a complex formed by C4b, C2a, and C3b, or by a complex formed by C3b, Bb, and C3b.

[0034] Therefore, if the complement activation pathway is inhibited, the production of at least one selected from the group consisting of complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factor or its fragment constituting C3 convertase, C5 convertase or its fragment, and complement factor or its fragment constituting C5 convertase may be inhibited or suppressed; complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or The function of at least one selected from the group consisting of a fragment thereof, C3 convertase or a fragment thereof, and C5 convertase or a fragment thereof may be inhibited or suppressed; the expression of a gene involved in the production of at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, C3 convertase or a fragment thereof, complement factors or fragments thereof that constitute C3 convertase, C5 convertase or a fragment thereof, and complement factors or fragments thereof that constitute C5 convertase may be inhibited or suppressed.

[0035] The complement factor to be inhibited in this embodiment may be at least one selected from the group consisting of C3 or a fragment thereof, C4 or a fragment thereof, factor B or a fragment thereof, factor D or a fragment thereof, C5 or a fragment thereof, C6 or a fragment thereof, a complement factor or a fragment thereof constituting a C3 convertase, and a complement factor or a fragment thereof constituting a C5 convertase. For example, a fragment of complement factor C3 is C3b. For example, a fragment of complement factor C5 is C5b. For example, a fragment of complement factor B is Bb. For complement factors or fragments thereof constituting a C3 convertase, C4b, C2a, C3b, and Bb are examples. For complement factors or fragments thereof constituting a C5 convertase, C4b, C2a, C3b, and Bb are examples. Furthermore, complement complexes formed by the complexation of multiple complement factors or their fragments, such as C5b6, in which complement factor C6 is complexed with complement factor C5b, may also be inhibited.

[0036] In this embodiment, the substance that inhibits the complement activation pathway may be at least one selected from the group consisting of a substance that inhibits the expression of a gene encoding a complement factor or a fragment thereof, a substance that binds to a complement factor or a fragment thereof, a substance that binds to a complement factor convertase or a fragment thereof, a substance that inhibits the activity of a complement factor or a fragment thereof, and a substance that inhibits the activity of a complement factor convertase or a fragment thereof. A substance that inhibits the expression of a gene encoding a complement factor or a fragment thereof can inhibit or suppress the production of complement factors and thereby inhibit or suppress the activation of the complement system by inhibiting or suppressing the expression of complement-related genes. A substance that binds to a complement factor or a fragment thereof, a substance that binds to a complement factor convertase or a fragment thereof, a substance that inhibits the activity of a complement factor or a fragment thereof, and a substance that inhibits the activity of a complement factor convertase or a fragment thereof can inhibit or suppress the activation of the complement system by inhibiting or suppressing the function of substances involved in the complement activation pathway.

[0037] The following are specific examples of substances that inhibit the complement activation pathway: (A) siRNA, shRNA, or antisense oligonucleotides of genes encoding complement factors or fragments thereof; (B) antibodies or antigen-binding fragments thereof that recognize at least one selected from the group consisting of complement factors or fragments thereof and complement factor convertase or fragments thereof; (C) small molecule compounds that inhibit the activity of at least one selected from the group consisting of complement factors or fragments thereof and complement factor convertase or fragments thereof; (D) peptides that bind to at least one selected from the group consisting of complement factors or fragments thereof and complement factor convertase or fragments thereof; and (E) nucleic acid aptamers that bind to at least one selected from the group consisting of complement factors or fragments thereof and complement factor convertase or fragments thereof. Furthermore, (A) siRNA, shRNA, and antisense oligonucleotides suppress the production of complement factors by inhibiting the expression of complement-related genes, (B) antibodies or their antigen-binding fragments, (C) small molecule compounds, (D) peptide inhibitors, and (E) nucleic acid aptamers suppress the activation of complement factors and / or complement factor convertases by binding to at least one of the active site, binding site, and surface region of complement factors and / or complement factor convertases.

[0038] (A) siRNA, shRNA, and antisense oligonucleotides of genes encoding complement factors or fragments thereof. Examples of complement activation pathway inhibitors include substances that inhibit the expression of complement-related genes such as siRNA (short interfering RNA), shRNA (short hairpin RNA), and antisense oligonucleotides of genes encoding complement factors or fragments thereof.

[0039] Examples of genes encoding complement factors whose expression is inhibited by the inhibitor include, but are not limited to, the human C3 gene, human C5 gene, human C6 gene, human factor B gene, human factor D gene, human C2 gene, and human C4 gene. The nucleotide sequences of these genes can be obtained from databases such as GenBank. The mRNA corresponding to the human C3 gene is shown in SEQ ID NO: 1, the mRNA corresponding to the human C5 gene is shown in SEQ ID NO: 2, the mRNA corresponding to the human C6 gene is shown in SEQ ID NO: 3, the mRNA corresponding to the human factor B gene is shown in SEQ ID NO: 4, the mRNA corresponding to the human factor D gene is shown in SEQ ID NO: 5, the mRNA corresponding to the human C2 gene is shown in SEQ ID NO: 6, and the mRNA corresponding to the human C4 gene is shown in SEQ ID NO: 7 or SEQ ID NO: 67. The human C4 gene has two genetic polymorphisms, C4A and C4B, and the expression of either gene may be inhibited. The nucleotide sequences of SEQ ID NO: 7 and SEQ ID NO: 67 correspond to the mRNA corresponding to the C4A and C4B genes, respectively. The inhibitor may inhibit the expression of a gene encoding any of these complement factor fragments. For example, the inhibitor may inhibit the expression of a gene encoding at least one selected from the group consisting of complement factor C3a, C3b, and C3d (complement factor C3 fragments), complement factor C5a and C5b (complement factor C5 fragments), complement factor B fragments Ba and Bb, complement factor C2a and C2b (complement factor C2 fragments), and complement factor C4a and C4b. The inhibitor may inhibit the expression of a gene encoding at least one selected from the group consisting of complement factor C3 or its fragments, complement factor D or its fragments, complement factor B or its fragments, complement factor C5 or its fragments, complement factor C6 or its fragments, complement factors or their fragments that constitute C3 convertase, and complement factors or their fragments that constitute C5 convertase. The inhibitor may inhibit the expression of a gene encoding at least one selected from the group consisting of complement factor C3, complement factor D, complement factor B, complement factor C5, complement factor C6, a fragment of a complement factor constituting C3 convertase, and a fragment of a complement factor constituting C5 convertase.Sequence information for genes encoding complement factors or complement factor convertases of various biological origins can be obtained from databases such as GenBank.

[0040] siRNA is a double-stranded RNA that can inhibit the expression of genes encoding target complement factors or fragments thereof. The length of the base sequence (base length) of siRNA is not particularly limited, but is preferably less than about 30 bases, more preferably about 19 to 27 bases, and even more preferably about 21 to 25 bases. shRNA refers to a molecule of about 20 base pairs or more that has a double-stranded structure within the molecule due to the inclusion of a partially palindromic base sequence in single-stranded RNA, and consists of a short hairpin structure with a protrusion at the 3' end. After being introduced into a cell, shRNA is degraded into lengths of about 20 bases within the cell and can inhibit the expression of target complement-related genes, similar to siRNA.

[0041] siRNA and shRNA can be artificially chemically synthesized. Furthermore, siRNA and shRNA can be synthesized in vitro from template DNA, for example, using T7 RNA polymerase and a T7 promoter, to produce antisense and sense RNA.

[0042] Antisense oligonucleotides are nucleotides that are complementary to or hybridize to a sequence of less than approximately 30 consecutive bases in the DNA sequence of a gene encoding a complement factor or a fragment thereof, and may be either DNA or RNA. They may also be modified as long as it does not impair their function. Antisense oligonucleotides can be synthesized by conventional methods, for example, they can be easily synthesized using commercially available DNA synthesizers.

[0043] The siRNAs, shRNAs, and antisense oligonucleotides of genes encoding complement factors or fragments thereof are not particularly limited. For example, dsRNAs (double-stranded RNAs) described in International Publication 2014 / 160129 are used as inhibitors targeting complement factor C5. Specifically, the following dsRNAs are used: A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement factor C5, wherein the dsRNA comprises a sense strand and an antisense strand, the sense strand comprises at least 15 consecutive nucleotides that differ by three or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 8, and the antisense strand comprises at least 15 consecutive nucleotides that differ by three or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 9; A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement factor C5, wherein the dsRNA comprises a sense strand and an antisense strand, the antisense strand comprises a complementary region comprising at least 15 consecutive nucleotides from the nucleotide sequence of SEQ ID NO: 10; A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement factor C5, wherein the dsRNA comprises a sense strand and an antisense strand forming a double-stranded region, the antisense strand comprises at least 15 consecutive nucleotides that differ by three or fewer nucleotides from the nucleotide sequence 5'-UUAUAGUGAGUUAUUUGUCAAU-3' (SEQ ID NO: 11), and substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides.

[0044] Examples of complement factor C3-targeting inhibitors include dsRNA (double-stranded RNA) described in International Publication Nos. 2015 / 089368, 2020 / 104669, 2021 / 081026, 2022 / 226127, or 2023 / 044370.Specifically, the following dsRNAs and oligonucleotides are mentioned: A double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of complement factor C3 in cells, wherein the dsRNA comprises a sense strand and an antisense strand forming a double-stranded region, the sense strand comprising at least 19 consecutive nucleotides from the nucleotide sequence 5'-CGUGGUCAAGGUCUUCUCUCUCU-3' (SEQ ID NO: 12), and the antisense strand comprising at least 18 consecutive nucleotides from the nucleotide sequence 5'-AGAGAGACCUUGACCACGUA-3' (SEQ ID NO: 13), and the dsRNA having a sense chain of 19 to 21 nucleotides in length, an antisense chain of 18 to 23 nucleotides in length, all of the nucleotides in the sense chain and all of the nucleotides in the antisense chain being modified nucleotides, at least one of which is a 2'-O-methyl modified nucleotide or a 2'-fluoro modified nucleotide, and at least one chain being conjugated to one or more ligands which are N-acetylgalactosamine (GalNAc) derivatives; A double-stranded ribonucleic acid (dsRNA) agent for inhibiting the expression of complement factor C3 in cells, wherein the dsRNA agent comprises a sense strand and an antisense strand forming a double-stranded region, wherein the sense strand comprises at least 15 consecutive nucleotides that differ by 3 or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 14, and the antisense strand comprises at least 15 consecutive nucleotides that differ by 3 or fewer nucleotides from the nucleotide sequence of SEQ ID NO: 15; an RNAi oligonucleotide or a pharmaceutically acceptable salt thereof for reducing complement factor C3 expression, wherein the oligonucleotide comprises a sense strand and an antisense strand, wherein the sense strand and the antisense strand form a double-helix region, and the antisense strand comprises a region complementary to the C3 mRNA target sequence of SEQ ID NO: 16 or 17, and the complementary region has a length of at least 15 consecutive nucleotides;

[0045] Examples of complement factor B-targeting inhibitors include dsRNA (double-stranded RNA) described in International Publication No. 2015 / 089368, International Publication No. 2021 / 222549, or International Publication No. 2023 / 076451.

[0046] ((B) An antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of complement factor or a fragment thereof, and complement factor convertase or a fragment thereof.)

[0047] Examples of inhibitors of the complement activation pathway include antibodies or antibody fragments that recognize at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments. The antibody in this embodiment is any antibody that binds to at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments, and inhibits its activity. For example, an antibody in this embodiment is an antibody that, by binding to at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments, inhibits the interaction between complement factors and complement factor convertase, inhibits the complexation of complement factors or their fragments, or inhibits the formation of complement factor convertase. The antibody in this embodiment is any antibody that recognizes at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments. The antibody in this embodiment may recognize complement factors or their fragments in the complement complex.

[0048] In this specification, the term "antibody" refers to a molecule having a structure in which two heavy chains (H chains) and two light chains (L chains) stabilized by a pair of disulfide bonds are associated. The two heavy chains each consist of a heavy chain variable region VH, heavy chain constant regions CH1, CH2, CH3, and a hinge region located between CH1 and CH2, respectively, while the light chain consists of a light chain variable region VL and a light chain constant region CL. In antibodies, the variable region fragment (Fv) consisting of VH and VL is the region directly involved in binding to the antigen. Furthermore, the antigen-binding region consisting of VL, CL, VH, and CH1 is called the Fab region, and the region consisting of the hinge region, CH2, and CH3 is called the Fc region.

[0049] In this specification, the term "antibody fragment" means a molecule that includes a part of an antibody and can bind to the same antigen as the antibody. Examples of antibody fragments are not particularly limited, but include Fab, F(ab')2, Fv, Fab', single-chain antibody molecules (e.g., scFv), disulfide-stabilized antibodies (dsFv), dimerized V-region fragments (Diabody), and peptides containing CDRs.

[0050] Of the variable regions, the region that directly contacts the antigen undergoes particularly significant changes and is called the complementarity-determinating region (CDR). The region other than the CDR, which undergoes relatively few mutations, is called the framework region (FR). There are three CDRs in the variable regions of the light chain and heavy chain, respectively (heavy chain CDR1-3 and light chain CDR1-3).

[0051] The antibody according to this embodiment may be a monoclonal antibody or a polyclonal antibody. Furthermore, the antibody in this invention may be any of the isotypes of IgG, IgM, IgA, IgD, or IgE. IgG is an immunoglobulin with a γ heavy chain and is produced as part of a secondary immune response to an antigen. IgM is an immunoglobulin with a μ heavy chain and exists as a pentamer in mammals. IgA is an immunoglobulin with an α heavy chain, IgD is an immunoglobulin with an ε heavy chain, and IgE is an immunoglobulin with a δ heavy chain.

[0052] In this specification, the term "monoclonal antibody" means an antibody obtained from a substantially homogeneous population of antibodies. Monoclonal antibodies are produced, but are not limited to, hybridoma, recombinant DNA, phage display, or by methods utilizing genetically modified animals containing all or part of a human immunoglobulin locus, or a combination thereof.

[0053] In this specification, the term "polyclonal antibody" means a mixture of different antibodies that recognize multiple epitopes on a single antigen. Polyclonal antibodies are not particularly limited, but can be produced, for example, by administering an immunogen containing the target antigen to mammals (e.g., rats, mice, rabbits, cattle, monkeys, etc.) or birds (e.g., chickens, etc.).

[0054] The antibody in this embodiment may be, for example, a mouse antibody, a human CDR-transplanted antibody, a human chimeric antibody, a humanized antibody, or a fully human antibody, or it may be a small molecule antibody. These antibodies may be used individually or in combination of two or more.

[0055] Humanized CDR-transplanted antibodies are antibodies in which the CDR of an antibody from a non-human animal has been replaced with the CDR of a human antibody. Humanized chimeric antibodies are antibodies consisting of a variable region derived from an antibody from a non-human animal and a constant region derived from a human antibody. Furthermore, humanized antibodies refer to antibodies from non-human animals in which a portion derived from a human antibody has been incorporated while retaining a portion with high safety. This concept includes humanized chimeric antibodies and humanized CDR-transplanted antibodies.

[0056] In this specification, "small molecule antibody" means an antibody fragment or an antibody fragment to which any molecule has been conjugated, and which recognizes the same epitope as the original antibody. Specifically, this includes, but is not limited to, Fab consisting of VL, VH, CL, and CH1 regions; F(ab')2 in which two Fabs are linked by a disulfide bond at a hinge region; Fv consisting of VL and VH; scFv, a single-chain antibody in which VL and VH are linked by an artificial polypeptide linker; as well as sdFv, Diabody, and sc(Fv)2.

[0057] The antibody according to this embodiment can be prepared by referring to a known method using at least one selected from the group consisting of complement factor or its fragment and complement factor convertase or its fragment as an immunogen. The binding of the obtained antibody to at least one selected from the group consisting of complement factor or its fragment and complement factor convertase or its fragment can be confirmed by the binding affinity to at least one selected from the group consisting of complement factor or its fragment and complement factor convertase or its fragment.

[0058] The substances to which the antibody according to this embodiment binds or recognizes are not particularly limited, but examples include complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C4 or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factors or their fragments that constitute C3 convertase, C5 convertase or its fragment, and complement factors or their fragments that constitute C5 convertase; or complement factor C3, complement factor D, complement factor B, complement factor C4, complement factor C5, complement factor C6, C3 convertase, fragments of complement factors that constitute C3 convertase, C5 convertase, and fragments of complement factors that constitute C5 convertase. Various biologically derived complement factors can be used as immunogens. The amino acid sequences of complement factors and complement factor convertases can be obtained from known databases such as the Protein Data Bank.

[0059] When the antibody according to this embodiment is a polyclonal antibody, it can be produced, for example, as follows. First, at least one selected from the group consisting of complement factor or a fragment thereof, and complement factor convertase or a fragment thereof, is dissolved in phosphate-buffered saline (also referred to as PBS) as an antigen, and if necessary, an appropriate amount of a common adjuvant, such as Freund's complete adjuvant, is mixed in, and this mixture is used as an immunogen to immunize mammals such as mice, rats, rabbits, goats, and horses. The immunization method is not particularly limited, but examples include subcutaneous injection or intraperitoneal injection once or twice or more at appropriate intervals. Next, blood is collected from the immunized animals according to a conventional method, serum is separated, and the polyclonal antibody fraction is purified to obtain the antibody.

[0060] When the antibody according to this embodiment is a monoclonal antibody, it can be obtained by fusing immune cells obtained from the immunized mammal, for example, splenocytes and myeloma cells, to obtain a hybridoma, and then collecting the antibody from the culture of the hybridoma. Alternatively, the monoclonal antibody can also be produced by cloning the antibody gene from the hybridoma, incorporating it into a suitable vector, introducing it into host cells, and using genetic recombination technology to produce a recombinant monoclonal antibody. Furthermore, the monoclonal antibody can also be produced using phage display.

[0061] The antibody or antigen-binding fragment that recognizes at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments, is not particularly limited, and known or commercially available antibodies or their antigen-binding fragments may be used. For example, the following antibodies, or antibodies that compete with these antibodies, can be used as antibodies that recognize complement factor C5: 1) Eculizumab (product name: Soliris) manufactured by Alexion Pharma 2) Labulizumab (product name: Ultomiris) manufactured by Alexion Pharma 3) Tesidorumab (research and development number: LFG316) manufactured by Novartis 4) Clovalimab (product name: Piersky) manufactured by Chugai Pharmaceutical Co., Ltd.

[0062] The antibody that recognizes complement factor C5 may be, for example, an antibody described in International Publication No. 2007 / 106585, and specifically, an isolated and purified humanized monoclonal antibody comprising a VH domain containing the amino acid sequence of SEQ ID NO: 18 and a VL domain containing the amino acid sequence of SEQ ID NO: 19, and may be an antibody that binds to C5 comprising a heavy chain consisting of SEQ ID NO: 20 and a light chain consisting of SEQ ID NO: 21.

[0063] An antibody that recognizes complement factor C5 may be an antibody described in International Publication No. 2015 / 134894, and specifically, for example, may be the following isolated antibody or its antigen-binding fragment: an isolated antibody or its antigen-binding fragment comprising (a) binding to human complement factor C5, (b) inhibiting the cleavage of C5 into fragments C5a and C5b, and (c) a heavy chain CDR1 comprising (i) the amino acid sequence shown in SEQ ID NO: 22, (ii) a heavy chain CDR2 comprising the amino acid sequence shown in SEQ ID NO: 23, (iii) a heavy chain CDR3 comprising the amino acid sequence shown in SEQ ID NO: 24, (iv) a light chain CDR1 comprising the amino acid sequence shown in SEQ ID NO: 25, (v) a light chain CDR2 comprising the amino acid sequence shown in SEQ ID NO: 26, and (vi) a light chain CDR3 comprising the amino acid sequence shown in SEQ ID NO: 27; An isolated antibody or its antigen-binding fragment, wherein (a) it binds to human complement factor C5, (b) it inhibits the cleavage of C5 into fragments C5a and C5b, and (c) it comprises a heavy chain variable region shown in SEQ ID NO: 28 and a light chain variable region shown in SEQ ID NO: 29.

[0064] An antibody that recognizes complement factor C5 may be an antibody described in International Publication No. 2010 / 015608, and specifically, for example, may be the following isolated antibody or antigen-binding fragment: an isolated monoclonal antibody or its antigen-binding fragment comprising a heavy chain variable region comprising the amino acid sequence of SEQ ID NO: 30 or 32; and a light chain variable region comprising the amino acid sequence of SEQ ID NO: 31 or 33; an isolated monoclonal antibody or its antigen-binding fragment comprising (i) a heavy chain CDR1 comprising the sequence of SEQ ID NO: 34; a heavy chain CDR2 comprising the sequence of SEQ ID NO: 35; and a heavy chain CDR3 comprising the sequence of SEQ ID NO: 36; and (ii) a light chain CDR1 comprising the sequence of SEQ ID NO: 37; a light chain CDR2 comprising the sequence of SEQ ID NO: 38; and a light chain CDR3 comprising the sequence of SEQ ID NO: 39, wherein the antibody binds to a human C5 protein, and wherein the antibody or its antigen-binding fragment binds to human and cynomolgus monkey C5 proteins with a KD of less than 100 pM.

[0065] The antibody that recognizes complement factor C5 may be an antibody described in International Publication 2016 / 098356, and specifically, for example, may be the following isolated antibody or its antigen-binding fragment: Competing with antibodies comprising a VH and VL pair selected from the following: (a) VH of SEQ ID NO: 74 and VL of SEQ ID NO: 84; (b) VH of SEQ ID NO: 78 and VL of SEQ ID NO: 88; (c) VH of SEQ ID NO: 77 and VL of SEQ ID NO: 87; (d) VH of SEQ ID NO: 79 and VL of SEQ ID NO: 89; (e) VH of SEQ ID NO: 75 and VL of SEQ ID NO: 85; (f) (g) VH of SEQ ID NO: 76 and VL of SEQ ID NO: 86; (h) VH of SEQ ID NO: 82 and VL of SEQ ID NO: 92; (i) VH of SEQ ID NO: 81 and VL of SEQ ID NO: 91; and (j) VH of SEQ ID NO: 83 and VL of SEQ ID NO: 93; an antibody that binds to an epitope in the MG1-MG2 domain (SEQ ID NO: 94) of the β-chain of C5 with higher affinity at pH 7.4 than at pH 5.8; an isolated monoclonal antibody that binds to C5, and which binds to an epitope in a fragment consisting of amino acids 33-124 of the β-chain of C5 (SEQ ID NO: 95) with higher affinity at pH 7.4 than at pH 5.8, wherein the epitope comprises at least one fragment selected from the group consisting of amino acids 47-57, 70-76, and 107-110.

[0066] Furthermore, examples of antibodies that recognize complement factor D include lampalizumab (research and development number: RG7417) manufactured by Gentec, or antibodies that compete with these antibodies. The antibody that recognizes complement factor D may be, for example, an antibody described in International Publication No. 2017 / 075259.

[0067] An antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of complement factors or fragments thereof, and complement factor convertase or fragments thereof, may contain an amino acid sequence that has 80% or more, 85% or more, 90% or more, or 95% or more identity with the amino acid sequence of an antibody (including those described above) that recognizes at least one selected from the group consisting of known complement factors or fragments thereof, and complement factor convertase or fragments thereof. Furthermore, the amino acid sequence of such a known antibody may contain one or more amino acid deletions, substitutions, additions, or insertions (1 to 20, 1 to 10, or 1 to 5). Such substitutions, deletions, or additions may be introduced in the CDR, but it is preferable that they be introduced in a region other than the CDR or a region other than the variable region. It may be a mouse / human chimeric antibody with a human-derived constant region, or a humanized antibody with a human-derived region other than the CDR.

[0068] ((C) Small molecule compounds that inhibit the activity of at least one selected from the group consisting of complement factor or a fragment thereof, and complement factor convertase or a fragment thereof.)

[0069] The inhibitor of the complement activation pathway may be, for example, a small molecule compound that inhibits the activity of at least one selected from the group consisting of complement factors or fragments thereof, and complement factor convertases or fragments thereof.

[0070] In this specification, "small molecule compound" means a carbon-containing small molecule having a molecular weight of 2500 Daltons or less. The molecular weight of the small molecule compound may be in the range of 50 to 500, 50 to 750, 50 to 1000, 50 to 1500, 50 to 2000, or 50 to 2500.

[0071] The small molecule compounds according to this embodiment are not particularly limited, but may inhibit the activity of at least one selected from the group consisting of complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C4 or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, and C5 convertase or its fragment; may inhibit the activity of at least one selected from the group consisting of complement factor C3, complement factor D, complement factor B, complement factor C4, complement factor C5, complement factor C6, C3 convertase, and C5 convertase; or may inhibit the activity of at least one selected from the group consisting of complement factor D and complement factor B. The small molecule compounds according to this embodiment may inhibit the activity of complement factors or their fragments in the complement complex. The small molecule compound according to this embodiment may inhibit the reaction in which complement factor C3 is cleaved, the reaction in which complement factor C5 is cleaved, the reaction in which complement factor B is cleaved, the reaction in which C3 convertase is formed, the reaction in which C5 convertase is formed, and the reaction in which a C5b6 complex is formed.

[0072] The small molecule compounds that inhibit the activity of at least one selected from the group consisting of complement factors or their fragments, and complement factor convertases or their fragments, are not particularly limited, and known or commercially available small molecule compounds may be used. For example, as a small molecule compound targeting complement factor D, there are the small molecule compounds described in International Publication 2015 / 130795, specifically Danicopan (product name: Boideya) manufactured by Alexion Pharma. Also, as a small molecule compound targeting complement factor B, there are the small molecule compounds described in International Publication 2015 / 009616, specifically Iptacopan (product name: Fabiharta) manufactured by Novartis Pharma. Among these, Danicopan is preferably used. It is intended that all stereoisomers, geometric isomers, tautomers, and isotopes of the structure shown below are included.

[0073]

[0074] The small molecule compound targeting complement factor D may be a compound represented by any of the following structures or a pharmaceutically acceptable salt thereof. Here, R ３ , ６ is a pyrimidine group optionally substituted with one substituent (which may be selected from halogen, C1-C6 alkyl, cyano, and C1-C6 alkoxy groups), and R ３３ is halogen.

[0075] The small molecule compound targeting complement factor B may be a compound represented by the following structure or a pharmaceutically acceptable salt thereof.

[0076] Here, in the formula, n is 0, 1, or 2, R is hydrogen, C １ -C ４ alkyl or hydroxy C １ -C ４ alkyl, and R １ is halogen, hydroxy, C １ -C ６ alkyl, C ２ -C ６ alkenyl, C ３ -C ６ cycloalkyl, C １ -C ６ [[ID=​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​​Alkyl, -CH ２ NHC(O)C １ ~C ４ Alkyl or -OCH ２ C(O)R ７ And p is 0, 1 or 2, R ２ C １ ~C ６ Alkyl, C １ ~C ６ Alkoxy, hydroxy C １ ~C ６ It is an alkyl or halogen, R ３ is hydrogen, halogen, cyano, C １ ~C ４ Alkyl, Halo C １ ~C ４ Alkyl, -CH ２ C(O)R ７ , phenyl, or a 5 or 6-membered heteroaryl having one, two or three ring heteroatoms independently selected from N, O or S (where the phenyl or heteroaryl has 0, 1 or 2 C １ ~C ４ (Optionally substituted with alkyl groups, and alkyl and haloalkyl groups are optionally substituted with 0 or 1 hydroxyl group), R ４ is phenyl, naphthyl, or heteroaryl, wherein the heteroaryl is a 5 or 6-membered heteroaryl having one, two, or three ring heteroatoms independently selected from N, O, or S (where the phenyl or heteroaryl is R ５ It is arbitrarily substituted by, and halogen, C １ ~C ４ Alkyl, C １ ~C ４ Alkoxy, hydroxy C １ ~C ４ (Further substituted with 0 or 1 substituent selected from alkyl, hydroxy, and cyanomethyl), R ５ is -C(O)R ８ ien-CH ２ C(O)R ８ , R ９ , -C(O)NHSO ２ C１ -C ４ alkyl, -SO ２ NH C(O)C １ -C ４ alkyl, -SO ２ N(H) ｍ (C １ -C ４ alkyl) ２－ｍ , -SO ２ C １ -C ４ alkyl, cyano, halogen, hydroxy C １ -C ４ alkyl, and a 5-membered heteroaryl having 1 to 4 ring nitrogen atoms and 0 or 1 ring sulfur atom or ring oxygen atom, m is 0, 1 or 2, W is O or C(R ６ ) ２ and R ６ is hydrogen, hydroxy, amino, mono- and di-C １ -C ４ alkylamino, C １ -C ４ alkyl, hydroxy C １ -C[[ID=], ４ alkyl, cyano C １ -C ４ alkyl or C １ -C ４ alkoxy selected independently from the group consisting of, or C(R ６ )<-- ２ )]]is combined to form a spirocyclic carbocyclic ring having 3 to 6 ring atoms, and R ７ is hydroxy, C １ -C ４ alkoxy, amino, or mono- and di-C １ -C ４ alkylamino, and R ８ is hydroxy, C １ -C ４ [[ID=], ８ alkoxy, amino, or a 5- to 7-membered saturated heterocycle having 1, 2 or 3 ring heteroatoms selected independently from N, O or S, or R ８ is unsubstituted, or halogen, hydroxy or C １ -C ４Alkyl-substituted mono and di-C １ ~C ４ It is an alkylamino, R ９ It is a five-membered heteroaryl having 1 to 4 ring nitrogen atoms and 0 or 1 ring oxygen or ring sulfur atoms (where the heterocycle has 0 to 2 C atoms). １ ~C ４ (Optionally substituted with alkyl groups.)

[0077] Furthermore, the small molecule compound that inhibits the activity of at least one selected from the group consisting of complement factors or fragments thereof, and complement factor convertase or fragments thereof, may be a pharmaceutically acceptable salt of a known small molecule compound that inhibits the activity of complement factors or fragments thereof, and complement factor convertase or fragments thereof.

[0078] In this specification, “pharmaceutically acceptable salt” may be an acid addition salt or a base addition salt. Examples of acid addition salts include lower alkanesulfonates such as camphorate (camphor sulfonate), mesylate (methanesulfonate), trifluoromethanesulfonate, and ethanesulfonate; arylsulfonates such as tosylate (p-toluenesulfonate) and benzenesulfonate; inorganic salts such as phosphate, nitrate, perchlorate, and sulfate; hydrohalides such as hydrochloride, hydrobromide, hydroiodide, and hydrofluoric acid; organic salts such as acetate, malate, fumarate, succinate, citrate, tartrate, oxalate, and maleate; and amino acid salts such as ornithine, glutamate, and aspartate. Examples of base addition salts include alkali metal salts such as sodium salts, potassium salts, and lithium salts; alkaline earth metal salts such as calcium salts and magnesium salts; inorganic salts such as ammonium salts; organic amine salts such as dibenzylamine salt, morpholine salt, phenylglycine alkyl ester salt, ethylenediamine salt, N-methylglucamine salt, diethylamine salt, triethylamine salt, cyclohexylamine salt, dicyclohexylamine salt, N,N'-dibenzylethylenediamine salt, diethanolamine salt, N-benzyl-N-(2-phenylethoxy)amine salt, piperazine salt, tetramethylammonium salt, and tris(hydroxymethyl)aminomethane salt; and amino acid salts such as arginine salt.

[0079] ((D) A peptide that binds to at least one selected from the group consisting of complement factor or a fragment thereof, and complement factor convertase or a fragment thereof.)

[0080] The inhibitor of the complement activation pathway may be, for example, a peptide that binds to at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments. The peptide according to this embodiment may be any peptide that binds to at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments, and inhibits its activity. For example, the peptide according to this embodiment may be a peptide that, by binding to at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments, inhibits the interaction between complement factors and complement factor convertase, inhibits the complexation of complement factors or their fragments, or inhibits the formation of complement factor convertase. The peptide according to this embodiment may be a peptide that recognizes at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments. The peptide according to this embodiment may recognize complement factors or their fragments in the complement complex.

[0081] The peptide according to this embodiment may have a structure in which multiple amino acids are linked together. In this specification, amino acids include not only naturally occurring amino acids but also artificial amino acid variants and amino acid derivatives. The amino acids are not particularly limited, but examples include natural amino acids, including proteinogenic amino acids, and unnatural amino acids.

[0082] When protein amino acids are represented by the three-letter abbreviations commonly used in this industry, they are Arg, His, Lys, Asp, Glu, Ser, Thr, Asn, Gln, Cys, Gly, Pro, Ala, Ile, Leu, Met, Phe, Trp, Tyr, and Val. Alternatively, when protein amino acids are represented by the single-letter abbreviations commonly used in this industry, they are R, H, K, D, E, S, T, N, Q, C, G, P, A, I, L, M, F, W, Y, and V. These 19 protein amino acids, excluding glycine, are L-amino acids; however, in this specification, amino acids also include D-amino acids corresponding to these 19 L-amino acids.

[0083] Furthermore, in this specification, amino acids include non-proteinogenic amino acids. Non-proteinogenic amino acids include natural amino acids other than proteinogenic amino acids, and unnatural amino acids. Unnatural amino acids are amino acids other than natural amino acids, and include, for example, chemically synthesized compounds that have properties known in the industry as characteristics of amino acids.

[0084] Non-proteinogenic amino acids are not particularly limited, but include, for example, amino acids whose main chain structure differs from that of proteinogenic amino acids (α,α-disubstituted amino acids (e.g., α-methylalanine, cycloleucine, etc.), N-alkyl amino acids (e.g., N-methyl amino acids, etc.), D-amino acids, β-amino acids, γ-amino acids, δ-amino acids, long-chain amino acids, α-hydroxy acids, α-thio acids, and cyclic amino acids (cyclic α-amino acids, cyclic β-amino acids, cyclic δ-amino acids, and aromatic amino acids, etc.)); amino acids whose side chain structure differs from that of proteinogenic amino acids (selenocysteine, norleucine, spinacine, nitrophenylalanine, tetrahydroisoquinoline carboxylic acid, tetrahydroisoquinoline carboxylic acid having substituents (e.g., hydroxyl groups, C1-C3 alkyl groups, halogen groups, etc.) (e.g., hydroxytetrahydroisoquinoline carboxylic acid, etc.), hydroxytryptophan, pentafluorophenylalanine, methoxyphenylalanine, γ Ｓ，ＬExamples include homoglutamine, amino acids having a structure consisting of multiple rings (e.g., bicycloamino acids), azide group-containing amino acids, alkyne group-containing amino acids, alkene group-containing amino acids, chloroacetamide group-containing amino acids, photoreactive group-containing amino acids, fluorescent amino acids, ε-alkylated lysine, biotin group-containing amino acids, citrulline, ester group-containing amino acids, amino acids having an additional methylene group in the side chain ("homo" amino acids; e.g., homophenylalanine, homoglutamine, and homohistidine), and amino acids in which the carboxylic acid functional group in the side chain is replaced with a sulfonic acid group (e.g., cysteic acid); and combinations thereof. Examples of these combinations include amino acids whose main chain structure and side chain structure differ from those of proteinaceous amino acids, N-methylated forms of the above amino acids in which the main chain amino group is methylated, and D amino acids of the above amino acids.

[0085] The number of amino acid residues contained in the peptide according to this embodiment is, for example, 3 to 50, more preferably 5 to 30, even more preferably 8 to 25, and even more preferably 10 to 20.

[0086] The peptide according to this embodiment may be linear or cyclic. The cyclic ring-closing structure is not particularly limited, but is formed by the covalent bonding of two amino acids via a linker or the like, as needed. While not particularly limited, examples of covalent bonds between two amino acids include disulfide bonds, peptide bonds, alkyl bonds, alkenyl bonds, ester bonds, thioester bonds, ether bonds, thioether bonds, phosphonate ether bonds, azo bonds, and N-CO-CH ２ Examples of covalent bonds include S-bonds, C-S-C bonds, C-N-C bonds, C=N-C bonds, amide bonds, lactam crosslinks, carbamoyl bonds, urea bonds, thiourea bonds, amine bonds, and thioamide bonds. When two amino acids are bonded in the main chain of an amino acid, a ring-closing structure is typically formed by a peptide bond. In addition, covalent bonds between two amino acids may be formed by the bonding of the side chains of the two amino acids, or by the bonding of the side chains of the two amino acids to the main chain, etc.

[0087] The peptide according to this embodiment may have a portion other than the peptide chain consisting of amino acids attached. In the peptide according to this embodiment, multiple peptides may be linked together by an appropriate linker. The linker is not particularly limited as long as it is pharmaceutically acceptable, such as a polyalkylene oxide chain, alkylene chain, or long-chain fatty acid.

[0088] The substances to which the peptide according to this embodiment binds or recognizes are not particularly limited, but examples include complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C4 or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factors or their fragments that constitute C3 convertase, C5 convertase or its fragment, and complement factors or their fragments that constitute C5 convertase; or complement factor C3, complement factor D, complement factor B, complement factor C4, complement factor C5, complement factor C6, C3 convertase, fragments of complement factors that constitute C3 convertase, C5 convertase, and fragments of complement factors that constitute C5 convertase.

[0089] The peptide that binds to at least one selected from the group consisting of complement factors or fragments thereof, and complement factor convertases or fragments thereof, is not particularly limited, and known or commercially available peptides or substances containing peptides may be used. For example, the following substances can be used as peptides that bind to complement factor C3: 1) Compstatin (CAS# 206645-99-0) (SEQ ID NO: 40) and its analogues 2) Pegcetacoplan (product name: Mpavelly) manufactured by Aperis Pharmaceuticals 3) Cp40 (product name: AMY-101) manufactured by Amyndas Pharmaceuticals

[0090] The peptide that binds to complement factor C3 may be a compound described in International Publication No. 2007 / 062249, specifically, for example, the following compound: Xaa1-Cys-Val-Xaa2-Gln-Asp-Xaa3-Gly-Xaa4-His-Arg-Cys-Xaa5 (SEQ ID NO: 41) [wherein Xaa1 is a dipeptide containing Ile, Val, Leu, Ac-Ile, Ac-Val, Ac-Leu, or Gly-Ile, Xaa2 is Trp or an analog of Trp, where the analog of Trp is more hydrophobic than Trp, however, if Xaa3 is Trp, then Xaa2 is an analog of Trp, and Xaa3 is ing A Trp or Trp analogue containing a chemical modification to the dole ring, where the chemical modification enhances the hydrogen bonding ability of the indole ring, where Xaa4 is His, Al, Phe or Trp, and Xaa5 is a dipeptide containing L-Thr, D-Thr, Ile, Val, Gly, or Thr-Asn or Thr-Ala, or a tripeptide containing Thr-Ala-Asn, where the OH group at the carboxyl terminus of any of L-Thr, D-Thr, Ile, Val, Gly or Asn is NH ２A compound characterized by inhibiting complement activation, comprising a peptide having [which may be optionally substituted with a group and two Cys residues linked by a disulfide bond]; Xaa1-Cys-Val-Xaa2-Gln-Asp-Xaa3-Gly-Xaa4-His-Arg-Cys-Xaa5 (SEQ ID NO: 41) [wherein Xaa1 is a dipeptide comprising Ile, Val, Leu, Ac-Ile, Ac-Val, Ac-Leu or Gly-Ile, and Xaa2 is Trp or an analog of Trp, where the analog of Trp is selected from (a) 5-fluoro-l-tryptophan or 6-fluoro-l-tryptophan, (b) 5-methoxytryptophan or 5-methyltryptophan, or (c) 1-methyltryptophan, provided that Xaa A compound characterized by inhibiting complement activation, comprising a peptide having [when 3 is Trp, Xaa2 is an analog of said Trp, Xaa3 is Trp or an analog of Trp selected from 5-fluoro-l-tryptophan or 6-fluoro-l-tryptophan, Xaa4 is His, Ala, Phe or Trp, and Xaa5 is a dipeptide containing L-Thr, D-Thr, Ile, Val, Gly, Thr-Asn or Thr-Ala, or a tripeptide containing Thr-Ala-Asn, and two Cys residues are linked by a disulfide bond].

[0091] The peptide that binds to complement factor C3 may be a compound described in International Publication 2014 / 078731, specifically, for example, the following compound: A long-acting compstatin analog comprising clearance-reducing moieties bound to two compstatin analog moieties, each compstatin analog moiety comprising a cyclic peptide extended by a lysine residue or a sequence containing lysine residues at the N-terminus, C-terminus, or both ends, wherein the lysine residues are separated from the cyclic moiety of the peptide by a rigid or flexible spacer comprising an oligo(ethylene) glycol moiety; the clearance-reducing moiety comprising a linear polymer, each end of which is bonded to one of the compstatin analog moieties by a carbamate, wherein (i) the spacer is a covalently bonded -(CH₂) with m being 1 to 10 and n being 1 to 10. ２ ) ｍ - and - (O-CH ２ -CH ２ -) ｎA long-acting compstatin analog comprising; and / or (ii) a spacer comprising 8-amino-3,6-dioxaoctanoic acid (AEEAc) or 11-amino-3,6,9-trioxaundecanoic acid; a long-acting compstatin analog comprising clearance-reducing moieties bound to two compstatin analog moieties, each compstatin analog moiety comprising a cyclic peptide having the amino acid sequence shown in SEQ ID NO: 42, where the lysine residues are separated from the cyclic moiety of the peptide by an 8-amino-3,6-dioxaoctanoic acid (AEEAc) spacer, and the clearance-reducing moiety comprising a PEG polymer having an average molecular weight of about 40 kD, where each end of the polymer is linked to one of the compstatin analog moieties by a linker moiety that is or contains a carbamate; A long-acting compstatin analog having a molecular weight of 40 kD and containing linear PEG moieties attached to each of two compstatin analogs, wherein i) each compstatin analog is a CA28-AEEAc-Lys moiety; ii) the linear PEG is attached to the lysine side chain of CA28-AEEAc-Lys via an amide bond; and iii) each CA28-AEEAc-Lys moiety is an Ac-Ile-Cys*-Val-(1Me)Trp-Gln-Asp-Trp-Gly-Ala-His-Arg-Cys*-Thr-[NH-CH ２ CH ２ OCH ２ CH ２ OCH ２ -C(=O)]-Lys-NH ２ This is (SEQ ID NO: 43), a long-acting compstatin analog in which Cys* is bonded by a disulfide bond.

[0092] The peptide that binds to complement factor C3 may be a compound described in International Publication No. 2013 / 036778, and specifically, for example, may be the following compound: a modified compstatin peptide having the sequence of any of SEQ ID NOs: 44 to 65, wherein a ring is formed by a disulfide bond between C2 and C12.

[0093] For example, Zircoplan (product name: Zirbisc), manufactured by UCSB Japan Inc., is an example of a peptide that binds to complement factor C5. The core amino acid sequence of Zircoplan is [cyclo(1,6)]Ac-K-V-E-R-F-D-(N-Me)D-Tbg-Y-azaTrp-E-Y-P-Chg-K (SEQ ID NO: 66). It contains 15 amino acids (total L-amino acids) including four unnatural amino acids [N-methyl-aspartic acid i.e. "(N-Me)D", tert-butylglycine i.e. "Tbg", 7-azatryptophan i.e. "azaTrp", and cyclohexylglycine i.e. "Chg"]; a lactam bridge between K1 and D6 of the polypeptide sequence; and a C-terminal lysine residue having a modified side chain that forms an N-ε-(PEG24-γ-glutamic acid-N-α-hexadecanoyl)lysine residue. The C-terminal lysine side chain modification includes a polyethylene glycol (PEG) spacer (PEG24), which is bound to an L-γ-glutamic acid residue derivatized by a palmitoyl group. The peptide that binds to complement factor C5 may be a compound described in International Publication 2015 / 191951.

[0094] The peptide according to this embodiment may include an amino acid sequence having 80% or more, 85% or more, 90% or more, or 95% or more identity with at least one amino acid sequence selected from the group consisting of known complement factors or fragments thereof, and complement factor convertases or fragments thereof (including those described above). Furthermore, the amino acid sequence of such known peptide may have one or more amino acids (1 to 20, 1 to 10, or 1 to 5) deleted, substituted, added, or inserted.

[0095] Furthermore, the peptide that binds to at least one selected from the group consisting of complement factors or fragments thereof, and complement factor convertases or fragments thereof, may be a pharmaceutically acceptable salt of a peptide that binds to at least one selected from the group consisting of known complement factors or fragments thereof, and complement factor convertases or fragments thereof. The pharmaceutically acceptable salts are as described above.

[0096] ((E) A nucleic acid aptamer that binds to at least one selected from the group consisting of complement factors or fragments thereof, and complement factor convertases or fragments thereof.)

[0097] The inhibitor of the complement activation pathway may be, for example, a nucleic acid aptamer selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments. The nucleic acid aptamer according to this embodiment may be any nucleic acid aptamer that binds to and inhibits the activity of at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments. For example, the nucleic acid aptamer according to this embodiment may be a nucleic acid aptamer that, by binding to at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments, inhibits the interaction between complement factors and complement factor convertase, inhibits the complexation of complement factors or their fragments, or inhibits the formation of complement factor convertase. The nucleic acid aptamer according to this embodiment may be a nucleic acid aptamer that recognizes at least one selected from the group consisting of complement factors or their fragments, and complement factor convertase or its fragments. The nucleic acid aptamer according to this embodiment may recognize complement factors or their fragments in the complement complex.

[0098] In this specification, "nucleic acid aptamer" means a nucleic acid molecule that binds to a target complement factor or a fragment thereof. The nucleic acids constituting the nucleic acid aptamer are not particularly limited and may be, for example, DNA, RNA, or modified nucleic acids, and two or more types may be combined to constitute the nucleic acid aptamer.

[0099] In this specification, modified nucleic acids are nucleic acids consisting of non-natural nucleotides or non-natural nucleic acids. Non-natural nucleotides are nucleotides containing bases or sugars into which artificial chemical modifications not found in nature have been introduced, and which have properties and / or structure similar to natural nucleotides. Examples of non-natural nucleotides include debased nucleosides, arabino nucleosides, 2'-deoxyuridine, α-deoxyribonucleosides, β-L-deoxyribonucleosides, and non-natural nucleotides containing nucleosides with other sugar modifications (e.g., substituted pentamonosaccharides (2'-O-methylribose, 2'-deoxy-2'-fluororibose, 3'-O-methylribose, 1',2'-deoxyribose), arabinose, substituted arabinose sugars, substituted hexanosaccharides, α-anomeric sugars, etc.). Non-natural nucleotides may also contain base analogs or modified bases. Examples of base analogs include 2-oxo(1H)-pyridine-3-yl group, 5-substituted-2-oxo(1H)-pyridine-3-yl group, 2-amino-6-(2-thiazolyl)purine-9-yl group, 2-amino-6-(2-thiazolyl)purine-9-yl group, and 2-amino-6-(2-oxazolyl)purine-9-yl group. Examples of modified bases include modified pyrimidines (e.g., 5-hydroxycytosine, 5-fluorouracil, 4-thiouracil), modified purines (e.g., 6-methyladenine, 6-thioguanosine), and other heterocyclic bases. Furthermore, in this specification, non-natural nucleic acids refer to nucleic acid analogs in which artificial chemical modifications have been introduced to the backbone, and which have properties and / or structures similar to natural nucleic acids. Examples of non-natural nucleic acids include peptide nucleic acids (PNA), peptide nucleic acids with phosphate groups (PHONA), cross-linked nucleic acids, morpholino nucleic acids, triazole-linked nucleic acids, methylphosphonate-type DNA / RNA, phosphorothioate-type DNA / RNA, phosphoramidate-type DNA / RNA, and 2'-O-methyl-type DNA / RNA.

[0100] The substances to which the nucleic acid aptamer of this embodiment binds or recognizes are not particularly limited, but examples include complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C4 or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factors or their fragments that constitute C3 convertase, C5 convertase or its fragment, and complement factors or their fragments that constitute C5 convertase; or complement factor C3, complement factor D, complement factor B, complement factor C4, complement factor C5, complement factor C6, C3 convertase, fragments of complement factors that constitute C3 convertase, C5 convertase, and fragments of complement factors that constitute C5 convertase.

[0101] The nucleic acid aptamer that binds to at least one selected from the group consisting of complement factors or fragments thereof, and complement factor convertases or fragments thereof, is not particularly limited, and known or commercially available nucleic acid aptamers or substances containing nucleic acid aptamers may be used.

[0102] Substances that inhibit the complement activation pathway may include nucleic acid aptamers that bind to complement factors or fragments thereof. An example of a nucleic acid aptamer that binds to complement factor C5 is abasincapta dopegol (product name: Izabay) manufactured by Astellas Pharma Inc. The abasincapta dopegol aptamer contains the nucleotide sequence described in Sequence ID No. 96 and is bound to polyethylene glycol (PEG). The nucleic acid aptamer may be, for example, an aptamer / PEG conjugate or salt thereof having the nucleotide sequence described in Sequence ID No. 96, and further having a 40 kDa branched PEG portion conjugated to the 5' end of the sequence via a linker, and may be the aptamer described in International Publication No. 2006 / 088888.

[0103] Other substances that inhibit the complement activation pathway include Coversin, narsoprimab, and ALN-CC5.

[0104] Therefore, substances that inhibit the complement activation pathway include: (A) siRNA, shRNA, or antisense oligonucleotides of a gene encoding at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, complement factors or fragments thereof that constitute C3 convertase, and complement factors or fragments thereof that constitute C5 convertase; (B) antibodies or antigen-binding fragments thereof that recognize at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, C3 convertase or a fragment thereof, complement factors or fragments thereof that constitute C3 convertase, C5 convertase or a fragment thereof, and complement factors or fragments thereof that constitute C5 convertase; (C) Small molecule compounds that inhibit the activity of at least one selected from the group consisting of complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factor or its fragment constituting C3 convertase, C5 convertase or its fragment, and complement factor or its fragment constituting C5 convertase; and (D) Peptides that bind to at least one selected from the group consisting of complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factor or its fragment constituting C3 convertase, C5 convertase or its fragment, and complement factor or its fragment constituting C5 convertase. (E) may be at least one selected from the group consisting of a nucleic acid aptamer that binds to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, C3 convertase or a fragment thereof, complement factor constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factor constituting C5 convertase or a fragment thereof, where the nuclear material of (A) to (E) may be any of the above-mentioned substances;(A) siRNA, shRNA, or antisense oligonucleotide of a gene expressing at least one selected from the group consisting of complement factor C3 or its fragment, complement factor C5 or its fragment, complement factor D or its fragment, complement factors constituting C3 convertase or their fragments, and complement factors constituting C5 convertase or their fragments; (B) an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of complement factor C3 or its fragment, complement factor C5 or its fragment, complement factor D or its fragment, C3 convertase or its fragment, complement factors constituting C3 convertase or their fragments, C5 convertase or its fragments, and complement factors constituting C5 convertase; (C) a small molecule compound that inhibits the activity of at least one selected from the group consisting of complement factor C3 or its fragment, complement factor C5 or its fragment, complement factor D or its fragment, C3 convertase or its fragment, and C5 convertase or its fragment; and (D) A peptide that binds to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, complement factors constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factors constituting C5 convertase. (E) There may be at least one selected from the group consisting of nucleic acid aptamers that bind to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, complement factors constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factors constituting C5 convertase, where the nuclear material of (A) to (E) may be any of the above-mentioned substances; It may be at least one selected from the group consisting of Compstatin, Pegcetacoplan, Cp40 / AMY-101, Danicopan, Iptacopan, Eculizumab, Laburizumab, Coversin, Zircoplan, Tesidolumab, Lamparizumab, Narsoprimab, ALN-CC5, Clobarimab, and Abasincaptadopegol.

[0105] These substances may inhibit the complement activation pathway in at least the lesion site and cerebrospinal fluid (CSF) of HAM patients, and may inhibit complement activation in at least one of microglia, astrocytes, and fibroblasts. These substances may inhibit the expression or activation of complement factor C3 in at least one of microglia, astrocytes, and fibroblasts in the lesion site of HAM patients.

[0106] Furthermore, in this embodiment, the complement factor fragment may be a fragment having the function of the complement factor, and the complement factor convertase fragment may be a fragment having the function of the complement factor convertase. In addition, it is preferable that the inhibitor described above inhibits the complement factor or complement factor convertase itself, rather than a fragment of the complement factor or complement factor convertase.

[0107] (Therapeutic or prophylactic agent) The therapeutic or prophylactic agent for HAM according to this embodiment includes a substance that inhibits the complement activation pathway. Here, the substance that inhibits the complement activation pathway may be the same as those described above, and the preferred embodiment may also be the same.

[0108] In this specification, the term “treatment or prevention” means therapeutic and / or prophylactic measures. The term “therapeutic or prophylactic measures” may include the administration of therapeutic or prophylactic agents approved in the Art to a subject. A therapeutic measure may mean administration after the onset of an undesirable condition (e.g., the disease of the subject or another undesirable condition) and may be intended to reduce, suppress, restore, alleviate or stabilize an existing undesirable condition or its side effects. It may also include preventing the attenuation of any direct or indirect pathological effects of the disease. It may also mean measures to delay the onset of the disease or slow the progression of the disease. A prophylactic measure may mean administration prior to the onset of a clinical finding of an undesirable condition and may be intended to suppress and / or prevent the recurrence of the undesirable condition.

[0109] In this specification, the term "therapeutic or prophylactic agent" means a pharmaceutical composition for therapeutic or prophylactic purposes comprising an active ingredient and excipients (such as pharmaceutically acceptable ingredients), and may also mean a pharmaceutical formulation (pharmaceutical formulation or pharmaceutical preparation) as commonly used in the industry. In this embodiment, the therapeutic or prophylactic agent comprises at least a substance that inhibits the complement activation pathway as an active ingredient.

[0110] In this embodiment, a therapeutic agent for HAM may be provided. The treatment of HAM is not particularly limited, but may mean that monotherapy or combination therapy of the therapeutic agent according to this embodiment reduces the number of target HTLV-1 infected cells, eliminates HTLV-1 infected cells, suppresses the proliferation of HTLV-1 infected cells, or suppresses or improves various symptoms caused by HAM (e.g., neuronal damage and inflammation). The treatment of HAM may involve suppressing the activation of the complement activity pathway, suppressing the spontaneous proliferation activity of HTLV-1 infected cells, suppressing M1 microglia-like functional changes in microglia, or suppressing the production of inflammatory substances (e.g., CXCL10 and inflammatory cytokines such as IFNγ and TNFα).

[0111] In this embodiment, a prophylactic agent for HAM may be provided. Prevention of HAM is not particularly limited, but may mean preventing the onset of HAM in asymptomatic HTLV-1 infected individuals or suppressing the recurrence of HAM by monotherapy or combination therapy with the prophylactic agent according to this embodiment. Preferably, it means preventing an increase in the number of HTLV-1 infected cells due to the re-proliferation of reduced HTLV-1 infected cells, preventing the recurrence of various symptoms caused by improved HAM, or preventing the onset of HAM in asymptomatic HTLV-1 infected individuals. Prevention of HAM may mean preventing the activation of the complement activity pathway, preventing the spontaneous proliferation activity of HTLV-1 infected cells, preventing M1 microglia-like functional changes in microglia, or preventing the production of inflammatory substances (e.g., CXCL10 and inflammatory cytokines such as IFNγ and TNFα).

[0112] The therapeutic or prophylactic agent according to this embodiment contains a substance that inhibits the complement activation pathway and may further contain pharmaceutically acceptable carriers and / or additives. The proportion of carriers or additives should be appropriately determined based on the range commonly used in the pharmaceutical field. Carriers are not particularly limited, but examples include water, physiological saline, other aqueous solvents, and aqueous or oily bases. Additives are not particularly limited, but examples include excipients, binders, pH adjusters, disintegrants, absorption enhancers, lubricants, colorants, flavoring agents, and fragrances.

[0113] There are no particular limitations on the form in which therapeutic or prophylactic agents are formulated, but examples include oral preparations such as tablets, coated tablets, pills, powders, granules, capsules, liquids, suspensions, and emulsions, and parenteral preparations such as injections, infusions, suppositories, ointments, and patches.

[0114] There are no particular restrictions on the method of administering therapeutic or prophylactic agents, but it is preferable to administer them as injections or infusions via parenteral administration routes, such as intravenously, intramuscularly, intracutaneously, intraperitoneally, subcutaneously, or locally, and local administration is more preferable. Injections or infusions containing substances that inhibit the complement activation pathway can be used as solutions, suspensions, or emulsions. Examples of solvents include distilled water for injection, physiological saline, glucose solution, and isotonic solutions (for example, solutions of sodium chloride, potassium chloride, glycerin, mannitol, sorbitol, boric acid, borax, propylene glycol, etc.). These solvents may be used individually or in combination of two or more.

[0115] Furthermore, the above-mentioned injectable or intravenous solution may contain additives such as stabilizers, solubilizers, suspending agents, emulsifiers, analgesics, buffers, preservatives, antiseptics, and pH adjusters. Stabilizers are not particularly limited, but examples include albumin, globulin, gelatin, mannitol, glucose, dextran, ethylene glycol, propylene glycol, ascorbic acid, sodium bisulfite, sodium thiosulfate, sodium EDTA, sodium citrate, and dibutylhydroxytoluene. Solubilizers are not particularly limited, but examples include alcohols (e.g., ethanol), polyalcohols (e.g., propylene glycol, polyethylene glycol), and nonionic surfactants (e.g., polysorbate 80®, HCO-50). Suspending agents are not particularly limited, but examples include glyceryl monostearate, aluminum monostearate, methylcellulose, carboxymethylcellulose, hydroxymethylcellulose, and sodium lauryl sulfate. There are no particular restrictions on emulsifiers, but examples include gum arabic, sodium alginate, and tragacanth. There are no particular restrictions on analgesics, but examples include benzyl alcohol, chlorobutanol, and sorbitol. There are no particular restrictions on buffers, but examples include phosphate buffer, acetate buffer, borate buffer, carbonate buffer, citrate buffer, and Tris buffer. There are no particular restrictions on preservatives, but examples include methyl parahydroxybenzoate, ethyl parahydroxybenzoate, propyl parahydroxybenzoate, butyl parahydroxybenzoate, chlorobutanol, benzyl alcohol, benzalkonium chloride, sodium dehydroacetate, sodium edetate, boric acid, and borax. There are no particular restrictions on preservatives, but examples include benzalkonium chloride, parahydroxybenzoic acid, and chlorobutanol. There are no particular restrictions on pH adjusters, but examples include hydrochloric acid, sodium hydroxide, phosphoric acid, and acetic acid.

[0116] The dosage and administration interval of the active ingredient of the therapeutic or prophylactic agent according to this embodiment can be appropriately selected depending on the target recipient, route of administration, disease, age, weight, and symptoms of the recipient. For example, in the case of oral administration, although not particularly limited, for example, for adults, the dosage of the active ingredient per day may be 0.01 mg to 10 g, 100 mg to 6 g, or 50 mg to 500 mg. The administration interval of the therapeutic or prophylactic agent may be once a day, or divided into several doses.

[0117] The target of the therapeutic or prophylactic agent according to this embodiment is a mammal. While not particularly limited, mammals include, for example, humans, non-human primates, domesticated animals, laboratory animals, and livestock, with humans being preferred.

[0118] The therapeutic or prophylactic agent according to this embodiment may be administered in combination with one or more other agents. Other agents are not particularly limited, but include, for example, known HAM therapeutic agents. Existing HAM therapeutic agents are not particularly limited, but include, for example, interferon α, mogamulizumab, teriflunomide, humanized anti-RGMa antibodies, etc.

[0119] In concomitant administration, the therapeutic or prophylactic agent according to this embodiment may be administered separately from the other agent. When administered simultaneously, the two or more active ingredients may be in the same formulation or administered as separate formulations. When administered separately, the two or more active ingredients should be administered according to the desired administration regimen. The dosage and administration interval of the other active ingredients should follow the prescribed administration regimen.

[0120] Under unstimulated conditions, peripheral blood mononuclear cells (PBMCs) from HAM patients spontaneously proliferate due to the proliferation of HTLV-1 infected cells and the immune cell response to them. This phenomenon is known as a useful model that reflects the pathogenesis of HAM. The therapeutic or prophylactic agent according to this embodiment can inhibit the spontaneous proliferation activity of HTLV-1 infected T cells. The therapeutic or prophylactic agent according to this embodiment can suppress HAM-specific inflammatory pathology. The therapeutic or prophylactic agent according to this embodiment can suppress the expression of inflammatory cytokines, such as IFNγ and TNFα. The therapeutic or prophylactic agent according to this embodiment can suppress the upregulation of HAM-specific inflammatory cytokines, such as IFNγ and TNFα. The therapeutic or prophylactic agent according to this embodiment can suppress the expression of CXCL10. The therapeutic or prophylactic agent according to this embodiment can suppress the upregulation of HAM-specific CXCL10. The therapeutic or prophylactic agent according to this embodiment can suppress neuropathy caused by HTLV-1 infected T cells in lesions. The therapeutic or prophylactic agent according to this embodiment can suppress HAM-specific neurological disorders.

[0121] As described above, the therapeutic or prophylactic agent according to this embodiment can treat or prevent HAM because it inhibits the spontaneous proliferation activity of HTLV-1 infected T cells, suppresses the induction of the inflammatory pathology of HAM, and / or suppresses the inflammatory response by HTLV-1 infected cells. Furthermore, the therapeutic or prophylactic agent according to this embodiment can not only suppress the inflammatory response specific to HAM, but also suppress nerve damage caused by HTLV-1 infected cells, thus enabling the treatment or prevention of HAM.

[0122] This disclosure includes the following embodiments: a method for treating or preventing HTLV-1-associated myelopathy (HAM), comprising administering a therapeutically effective amount of a complement activation pathway inhibitor to a patient in need; a complement activation pathway inhibitor for treating or preventing HTLV-1-associated myelopathy (HAM); the use of a complement activation pathway inhibitor for treating or preventing HTLV-1-associated myelopathy (HAM); the use of a complement activation pathway inhibitor in the manufacture of a therapeutic or prophylactic agent for HTLV-1-associated myelopathy (HAM); and a therapeutic or prophylactic agent for use in the treatment of HTLV-1-associated myelopathy (HAM), comprising a complement activation pathway inhibitor. Here, the substance may be any of the above-mentioned substances, and preferred embodiments are as described above.

[0123] (Auxiliary method for determining the severity of HAM) This disclosure provides an auxiliary method for determining the severity of HAM, which includes measuring the concentration of a target complement factor or fragment thereof, and determining that the higher the measured value of said concentration is compared to a normal value, the more severe the HAM.

[0124] Symptoms of HAM include paralysis and pain in both legs, urinary dysfunction, and persistent constipation due to nerve tissue damage. As these symptoms progress, nerve damage occurs, leading to wheelchair use and bedriddenness. Therefore, when determining the severity of HAM and the effectiveness of treatment, it is effective to use markers that indicate the degree of nerve damage in addition to the inflammatory marker CXCL10. Examples of nerve damage markers include NF-L (neurofilament light chain) and NF-H (neurofilament heavy chain). In this embodiment, complement factors are used as markers to determine the severity of HAM and the effectiveness of treatment. As shown in the examples described later, as the symptoms of HAM progress, complement-related genes are highly expressed in the lesion site, and complement factors are activated. Therefore, complement factors can be used as markers to provide supplementary information when determining the severity of HAM.

[0125] The severity of HAM determined in the method according to this embodiment may be the degree of neurological damage or the degree of motor impairment. The degree of neurological damage can also be evaluated by NF-L (Neurofilament light chain) or NF-H (Neurofilament Heavy chain). The degree of motor impairment can be classified by the Osame Motor Disability Score (OMDS).

[0126] The complement factors or fragments thereof whose concentration is measured are not particularly limited, and include, for example, complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, complement complex C5b6, complement complex C5b67, complement complex C5b678, and complement complex C5b6789. Complement complex C5b6 is a complex formed by the binding of complement factors C5b and C6, and is an intermediate product produced during the formation of MAC. Similarly, complement complexes C5b67, C5b678, and C5b6789 are complexes formed by the binding of C6 and C7, C6, C7 and C8, and C6, C7, C8 and C9 to complement factor C5b, respectively. Preferred complement factors or fragments thereof for measuring concentration are complement factor C5 or its fragment, complement factor C6 or its fragment, and complement complex C5b6. Preferably complement factors or fragments thereof for measuring concentration are C3, C3a, C3b, C3d, C4d, C5, C5a, C5b6, and C6.

[0127] In an auxiliary method for determining the severity of HAM, the higher the concentration of complement factors or their fragments measured in a subject is compared to the normal value, the higher the severity of HAM is determined. Here, the normal value may be, for example, a measurement in a healthy control group, a measurement taken before the subject developed HAM, or a value recognized as a normal value in this industry.

[0128] If the concentration of complement factors or their fragments measured in a subject is higher than the normal value, the severity of HAM may be determined according to the difference from the normal value. For example, multiple ranks may be set according to the difference from the normal value, and the expected severity of HAM may be determined by the difference between the measured value and the normal value. Such ranks include, for example, the Osame Motor Disability Score (OMDS). Alternatively, if the concentration of complement factors or their fragments measured in a subject is higher than the normal value, the probability of a high severity of HAM may be calculated according to the difference from the normal value.

[0129] In this disclosure, instead of measuring the concentration of the target complement factor or its fragment, the concentration of at least one selected from the group consisting of angiostatin, FSAP, coagulation factor XI, alpha-1B glycoprotein, CPN2, coagulation factor IXab, ITI heavy chain H1, α2 antiplasmin, prekallikrein, FHR1.1, ITI heavy chain H4, properzine, α1 antitrypsin, plasminogen, HMW kininogen, calistatin, calistatin 1, and coagulation factor XIII.B may be measured, and supplementary information for determining the severity of HAM may be provided based on the said concentration. The normal values ​​and the method for determining when the concentration is higher than normal may be the same as when measuring the concentration of the complement factor or its fragment.

[0130] The sample used to measure the concentration of complement factors or the above-mentioned substances is not particularly limited, but examples include peripheral blood or cerebrospinal fluid (CSF), with cerebrospinal fluid being preferred. Alternatively, the sample may be collected from the lesion site, and may be collected from at least one location selected from the group consisting of the spinal cord, thoracic spinal cord, white matter region of the thoracic spinal cord, anterior column, and lateral column.

[0131] The subjects to whom the auxiliary methods for determining the severity of HAM are applied are not particularly limited, and mammals can be included, for example. Mammals are not particularly limited, but examples include humans, non-human primates, domesticated animals, laboratory animals, and livestock, with humans being preferred. Furthermore, the subjects may be HAM patients diagnosed with HAM, individuals who are potentially at risk of developing HAM, or subjects for whom information regarding whether or not they have HAM has not been provided.

[0132] In an auxiliary method for determining the severity of HAM, in addition to complement factors or their fragments, or the other markers mentioned above, CXCL10 concentration may be measured as an inflammatory marker, and the severity may be determined by considering this information. That is, an auxiliary method for determining the severity of HAM may further include measuring the target CXCL10 concentration and determining that the higher the measured CXCL10 concentration is compared to the normal value, the higher the severity of HAM.

[0133] In an auxiliary method for determining the severity of HAM, in addition to complement factors or their fragments, or the other markers mentioned above, NF-L concentration and / or NF-H concentration may be measured as inflammatory markers, and the severity may be determined by considering this information. That is, an auxiliary method for determining the severity of HAM may further include measuring the target NF-L concentration and / or NF-H concentration, and determining that the higher the measured NF-L concentration and / or NF-H concentration is compared to the normal value, the higher the severity of HAM.

[0134] When measuring the concentration of CXCL10, NF-L, or NF-H, the severity of HAM may be determined to be higher if both the concentration of complement factor or its fragments, or the other markers mentioned above, and the concentration of any of the CXCL10, NF-L, or NF-H concentrations are higher than normal.

[0135] The specimen for measuring CXCL10 concentration, NF-L concentration, and NF-H concentration is not particularly limited, but examples include peripheral blood or cerebrospinal fluid (CSF), with cerebrospinal fluid being preferred. Alternatively, the specimen may be collected from the lesion site, and may be collected from at least one location selected from the group consisting of the spinal cord, thoracic spinal cord, white matter region of the thoracic spinal cord, anterior column, and lateral column.

[0136] In an auxiliary method for determining the severity of HAM, the concentration of complement factors or their fragments, or other markers, can be measured using known methods depending on the substance being measured. The concentration may also be measured using commercially available kits.

[0137] In any of the embodiments described herein, the substance inhibiting the complement activation pathway may be any of the embodiments described herein, as well as any of the embodiments described herein as preferred, more preferred, and particularly preferred (all of these embodiments are collectively referred to below as the "preferred embodiments"). Alternatively, any combination of the preferred embodiments may be used.

[0138] [Example 1: Pathway analysis of HAM lesion area using spatial transcriptome] Spatial transcriptome analysis of the HAM lesion area, analysis of the gene expression profile of the HAM lesion area, and comparative analysis of the HAM lesion area and the counterpart area of ​​a healthy person were performed.

[0139] (Spatial transcriptome analysis of HAM lesion areas) Spatial transcriptome analysis was performed as follows: Five thin sections containing lesion areas were prepared from paraffin-embedded autopsy thoracic spinal cords of three HAM patients. Following the Visium Spatial Gene Expression for FFPE Reagent Kits (10X GENOMICS), the thin sections were deparaffinized and then stained with hematoxylin-eosin (HE). High-resolution images of the HE-stained images were obtained using an all-in-one fluorescence microscope (Olympus). As a control experiment, one thin section was prepared from paraffin-embedded autopsy thoracic spinal cord of one healthy individual and processed similarly. Subsequently, the cells were destained for HE staining, formaldehyde decrosslinking was performed, and probes designed to correspond to all genes (Human WT Probes v2-RHS, Human WT Probes v2-LHS, both from 10X GENOMICS) were added to the thin sections and reacted at 50°C for 24 hours. Each probe was designed to be positioned adjacent to a specific region of mRNA, and only probes that could be linked to each other by ligase could proceed to the next reaction. Using a Visium CytAssist (10X GENOMICS), the probes linked within the cells in the thin sections were transferred to a Visium slide (10X GENOMICS). The Visium slides contain nucleotide sequences, each consisting of a nucleotide barcode for spatial information and a Unique molecular Identifier (UMI), arranged within 55 μm diameter spots, with 5000 spots arranged in a 6.5 mm square area. The linked probe binds to the nucleotide sequences within the spots during the transfer process to the Visium slide, and the extension reaction adds spatial information and UMI, purifying the library. Furthermore, by attaching adapters (Dual Index Plate TS Set A, 10X GENOMICS) to both ends, the library was sequenced using NovaSeq6000 (illumina).

[0140] (Analysis of gene expression profiles in HAM lesion regions) The gene expression profiles in HAM lesion regions were analyzed as follows: The base sequence data obtained by sequencing was analyzed (sequence read mapping and alignment) using the analysis software pipeline Space Ranger (10X GENOMICS) on the supercomputer SHIROKANE (Institute of Medical Science, University of Tokyo), and spot-level gene expression information and spatial information were obtained on Visium slides (15,484 spots). After integrating the data obtained using Seurat (https: / / satijalab.org / seurat / ), an R package for single-cell RNA-seq analysis, spot clustering was performed using Uniform Manifold Application and Projection (UMAP). As a result, analysis of the stained images from healthy individuals revealed that clusters 0 and 1 were distributed throughout the white matter, while analysis of HAM patients showed that cluster 5 was distributed in the anterior and lateral columns. Figure 1 shows a diagram overlaid with the localization information of each cluster (clusters 0, 1, and 5) onto the HE stained image (top: healthy individuals, bottom: HAM patients).

[0141] (Comparative analysis of HAM lesion regions and healthy counterpart regions) A comparative analysis of HAM lesion regions and healthy counterpart regions was performed as follows. Using Seurat, the gene expression profiles of cluster 5 and clusters 0 and 1 were compared, and 588 genes that showed significant variation in cluster 5 compared to clusters 0 and 1 were extracted (Fold Change > 1.5, adjust p-value < 0.05). To explore the functional characteristics of these 588 genes, KEGG pathway analysis was performed using DAVID (Database for Annotation, Visualization, and Integrated Discovery; https: / / davidbioinformatics.nih.gov / ), a comprehensive online tool for functional gene annotation. The results are shown in Figure 2. High expression of complement pathway-related genes was observed in the HAM lesion sites. Since microglia and invasive macrophages are found in this region, it is suggested that the expression of complement pathway-related genes is based on these cells. Figure 3 shows the localization of microglia and invasive macrophages.

[0142] [Example 2: Pathway analysis of CD14+ cells in cerebrospinal fluid (CSF)] Cerebrospinal fluid (CSF) and peripheral blood were extracted from HAM patients (3 cases), and cells contained in the cerebrospinal fluid (CSF) were recovered by centrifugation (500 x g, 10 min). PBMCs were separated and recovered using Pancoll Human (PAN BIOTECH). Each recovered cell was mixed with Gel Beads (Single Cell VDJ 5' Gel Bead) that had a base barcode (10x Barcode) and Unique molecular identifier (UMI) attached to them in the wells of a Chromium Next GEM Chip K, following the protocol of the Chromium Single Cell 5' Reagent Kit (10X GENOMICS). A Chromium Controller (10X GENOMICS) was then used to form oil drops (Gel Beads-in-emulsion: GEM) containing only one cell and one Gel Bead. Cells were lysed enzymatically in a GEM, mRNA was reverse transcribed, and the reverse transcript (cDNA) was captured on the base sequence extending from the Gel Bead. After washing the Gel Beads, the cDNA, to which 10x Barcode and UMI had been added, was amplified by Polymerase Chain Reaction (PCR) to purify a cellular cDNA library. The obtained cDNA library was fitted with an adapter using the Chromium Dual Index Kit TT set A (10X GENOMICS) and sequenced using NovaSeq 6000 (illumina). The base sequence data obtained by sequencing was analyzed (sequence read mapping and alignment) using the Cell Ranger analysis software pipeline (10X GENOMICS) on the supercomputer SHIROKANE (Institute of Medical Science, University of Tokyo), and cell-level gene expression information was obtained.Furthermore, using Seulat, an R package for single-cell RNA-seq analysis, data from CSF cells and PBMCs derived from the same HAM patient were integrated. Cell clustering was then performed using Uniform Manifold Application and Projection (UMAP), and cell annotation was carried out for various clusters. The results showed that CD14-positive cells in CSF and CD14-positive cells in PBMCs differed significantly in their characteristics. In particular, KEGG pathway analysis using DAVID was performed on 371 genes highly expressed in CD14-positive cells in CSF (Log2 Fold Change > 4, adverse p-value < 0.05), revealing a characteristic high expression of complement pathway-related genes. The results are shown in Figure 4.

[0143] [Example 3: Integrated analysis of cerebrospinal fluid (CSF) proteome (SOMAscan) and spatial transcriptome (Visium)] SOMAscan was performed using cerebrospinal fluid (CSF) from 183 HAM patients (based on disease activity: Rapid group: 91 patients, Slow group: 74 patients, Very Slow group: 18 patients) and 17 asymptomatic carriers (ACs). SOMAscan (Slow Off-rate Modified Aptamer scan) is a highly sensitive and specific proteomics technology that uses synthetic oligonucleotides called aptamers, and is capable of measuring approximately 7,000 types of proteins at once. CSF samples were incubated with SOMAmers bound to streptavidin beads, unbound proteins were removed by washing, and bound proteins were tagged with biotin. Next, UV (Ultraviolet) light irradiation was used to cleave the photocleavable linker, releasing the biotin-tagged protein-SOMAmer complex from the streptavidin beads and dissociating the nonspecific complex. Subsequently, a polyanionic competitive inhibitor was added to prevent nonspecific recombination, and the biotin-tagged protein-SOMAmer complex was captured using new streptavidin beads, removing the nonspecifically bound SOMAmer. Finally, the protein was denatured to dissociate SOMAmer from the complex, and SOMAmer was hybridized into a complementary sequence on a microarray chip. The fluorescence intensity (relative fluorescence intensity units [RFU]) was then measured using a microarray scanner. Based on the obtained values, the amounts of 7000 types of proteins contained in the CSF of the Rapid, Slow, Very Slow, and AC groups were compared. By analyzing the gene expression ratios of HAM lesion regions (cluster 5) and counterpart regions (clusters 0 and 1) obtained by spatial transcriptome analysis, and the protein expression ratios of the Rapid group and AC group obtained by SOMAscan, 215 factors that were expressed more than 1.2 times higher in cluster 5 and the Rapid group were identified. KEGG pathway analysis of these 215 factors using DAVID revealed that high expression of complement pathway-related factors was a characteristic feature. The results are shown in Figure 5.

[0144] Furthermore, to confirm that the complement pathway is activated in the CSF of HAM patients, the relative concentrations of C3a, C3b, and C3d (fragments of complement factor C3), which indicate cleavage of complement factor C3, were compared. As a result, it was found that C3a, C3b, and C3d tended to increase in a disease activity-dependent manner. The results are shown in Figure 6.

[0145] [Example 4: Complement factor C4d staining of spinal cord lesions in HAM patients] Complement factor C4d is an inactive fragment produced when complement factor C4b is cleaved by factor I upon activation of the classical complement pathway, and is a characteristic molecule that is deposited in target cells and tissues. Thin sections of spinal cord autopsies from three HAM patients and one healthy control were prepared, deparaffinized, treated with hydrogen peroxide, and subjected to antigen retrieval. Then, they were reacted with anti-human C4d antibody (BIOMEDICA) at room temperature for 90 minutes. After washing with PBS, they were reacted with a secondary antibody (Histofine Simple Stain MAX-PO (MULTI), Nichirei Bioscience) at room temperature for 30 minutes. After washing with PBS, ImmPACT DAB (Vector Laboratories) was added and substrate color development was performed. As a positive control, paraffin samples from kidney biopsies of transplanted individuals and lupus nephritis patients, both of which were found to be C4d-positive, were used. As a negative control, paraffin samples from spinal cord biopsies of healthy individuals were used (BioChain). As a result, deposition of complement factor C4d was observed only in the lateral and anterior columns, which are the lesional areas of HAM patients. The results are shown in Figure 7.

[0146] [Example 5: Examination of the complement activation pathway in the HAM lesion area] As a process preceding the formation of C5b-9 (MAC), the final product of complement activation, the relative amounts of C5a, a fragment of complement factor C5, and C5b6, a complex of C5b and C6, were evaluated using SOMAscan data. The relative amounts of complement factor C5a and complement complex C5b6 were suggested to have a low correlation with the disease activity of HAM. On the other hand, the amounts of C5a and C5b6 in CSF in HAM patients showed a strong correlation, and furthermore, the amount of C5b6 also showed a strong correlation with NF-L (neurofilament light chain), which has been reported in many diseases as a marker of neurological damage. The results are shown in Figure 8. The statistical software R version 4.3 was used to calculate the correlation coefficient (https: / / www.r-project.org / ).

[0147] [Example 6: Examination of the correlation between OMDS score and markers] Using data from 84 HAM patients, the relationship between the amount of C5b6 in CSF and the severity of motor impairment (Osame Motor Disability Score; OMDS) in HAM patients was evaluated. The x-axis represented the amount of CXCL10, which reflects disease activity, and the y-axis represented C5b6, NF-L, and NF-H (Neurofilament Heavy Chain). The patients were divided into four groups according to the following criteria: For CXCL10, 4400 pg / ml was used as the threshold value, which divides disease activity into Rapid and Slow. For C5b6, NF-L, and NF-H, the upper limit was set as the threshold value for patients with AC disease activity. Group 1: C5b6 low, CXCL10 low Group 2: C5b6 low, CXCL10 high Group 3: C5b6 high, CXCL10 low Group 4: C5b6 high, CXCL10 high NF-L and NF-H were also grouped in the same way as Groups 1 to 4 above.

[0148] When comparing OMDS scores, groups 3 and 4, where C5b6 was high, showed significantly higher results compared to groups 1 and 2, where C5b6 was low. This suggests that C5b6 better reflects the severity of HAM than NF-L and NF-H, which are generally known as neurological markers. Statistical significance was determined using the Kruskal-Wallis test with statistical software R version 4.3. The results are shown in Figure 9.

[0149] Next, we searched for alternative markers for complement complex C5b6. Among the approximately 7000 molecules obtained by SOMAscan, complement factor C5 was identified as the molecule with the strongest correlation to C5b6 values. Statistical software R version 4.3 was used to calculate the correlation coefficient (https: / / www.r-project.org / ). The following table shows the substances with the highest correlation coefficients to C5b6.

[0150]

[0151] The relationship between C5 levels in CSF and OMDS was evaluated using data from 84 HAM patients. Similar to the results for C5b6, OMDS was significantly higher in groups 3 and 4 (high C5 levels) compared to groups 1 and 2 (low C5 levels). Grouping was performed in the same manner as with C5b6 and CXCL10. Statistical significance was determined using the Kruskal-Wallis test with statistical software R version 4.3. The results are shown in Figure 10.

[0152] [Example 7: Neuronal cell damage by HAM immune cells] NB-1 cells, a neuronal cell line, were suspended in a culture medium (10% FBS (GIBCO), 45% MEMα (Wako), 45% RPMI1640 (Wako)), and 4.4 × 10⁻⁶ cells were used. ４ Cells were sown one by one on a collagen-coated 24-well plate and cultured for 24 hours. After that, 1 x 10 ５Seven healthy cell groups (PBMCs from HD-PBMCs) or seven HAM patients (PBMCs from HAM-PBMCs) were added to cells, and the NF-L concentration in the culture supernatant after 72 hours of incubation was measured using the Neurofilament Light Polypeptide High Sensitive ELISA Kit (Cloud-Clonee Corp.). As a result, a significant increase in NF-L was observed in NB-1 cells treated with HAM-PBMCs compared to HD-PBMCs. This suggests that HAM-PBMCs damage nerve cells. The results are shown in Figure 11(A).

[0153] HD-PBMC (4 cases) or HAM-PBMC (6 cases) 1 × 10 ６ Cells were seeded individually into 24-well plates and cultured in 1 mL of medium for 72 hours. The cell suspension was then centrifuged to collect either HD-PBMC culture supernatant (HD-Supp) or HAM-PBMC culture supernatant (HAM-Supp). The collected PBMC culture supernatant was 4.4 × 10⁶. ４ NB-1 cells were seeded in 24-well collagen-coated plates and cultured for 24 hours, then the HAM-supplement was added. The amount of culture supernatant added was 2 / 3 of the volume of the NB-1 cell culture medium. Subsequently, the NF-L concentration in the culture supernatant after 72 hours of culture was measured using the Neurofilament Light Polypeptide High Sensitive ELISA Kit. As a result, a significant increase in NF-L was observed in NB-1 cells treated with HAM-supplement compared to those treated with HD-supplement. This suggests that HAM-supplement damages nerve cells. The results are shown in Figure 11(B).

[0154] [Example 8: Induction of M1 microglia-related gene expression and promotion of neurotoxic effects by HAM-PBMC culture supernatant] (Induction of M1 microglia-related gene expression by HAM-PBMC culture supernatant) HD-PBMC (7 cases) or HAM-PBMC (9 cases) were divided into 1 × 10⁻¹⁶ ６Cells were seeded individually into 24-well plates and cultured for 72 hours in 1 mL of medium (RPMI1640 containing 10% FBS). The cell suspension was then centrifuged to collect the PBMC culture supernatant (HD-Supp and HAM-Supp, respectively). The collected PBMC culture supernatant was added to HMC3 cells, a microglia cell line cultured for 24 hours after seeding (medium: E-MEM with L-Glutamine, Phenol Red, Sodium Pyruvate, Non-essential Amino Acids and 1,500 mg / L Sodium Bicarboneate containing 10% FBS). The amount of culture supernatant added was 1 / 3 of the HMC3 cell culture medium. HMC3 cells without PBMC culture supernatant were used as a negative control.

[0155] Twenty-four hours after adding the PBMC culture supernatant, total RNA was recovered, and cDNA was synthesized using RiverTra Ace (Toyobo). The differences in gene expression between cell populations treated with HD-Supp and HAM-Supp were analyzed using real-time PCR with the synthesized cDNA. The analysis included FastStart Universal Probe Master (ROX) (Roche Applied Science) and FAM-labeled TaqMan gene expression primers (Applied Biosystems): CXCL10 (Hs00171042_m1), NOS2 (Hs01075529), CXCL2 (Hs00601975_m1), IL-6 (Hs00174131_m1), STAT 1 (Hs01013996_m1), COX2 (Hs00153133_m1), and PPARγ. (Hs01115513_m1), CD206 (Hs00267207_m1), and IL4 (Hs00174122_m1) were used. 18s rRNA (Applied Biosystems, Thermo Fisher Scientific) was used for internal correction. Target gene expression was determined by the following formula: target gene expression = 2-(Ct[target]-Ct[18s rRNA])

[0156] As a result, HMC3 cells treated with HAM-Supp showed increased expression of M1 microglia-related genes (CXCL10, NOS2, CXCL2, IL-6, STAT1, COX2) compared to HMC3 cells treated with HD-Supp. On the other hand, no change was observed in the expression of M2 microglia-related genes (PPARγ, CD206, IL-4) between HMC3 cells treated with HD-Supp and those treated with HAM-Supp. Therefore, it was predicted that HAM-Supp induces M1 microglia-like functional changes in HMC3 cells. The results are shown in Figure 12(A).

[0157] (Promotion of neurotoxic effects) 1 x 10 ５ NB-1 cells of cells, and 4 × 10 ３ HMC3 cells from cells were seeded in collagen-coated 12-well plates and cultured for 24 hours, after which HD-Supp (5 cases) or HAM-Supp (6 cases) was added. The amount of culture supernatant added was half the volume of the culture medium. After 72 hours of culture, the NF-L concentration in the supernatant was measured using Neurofilament, Light Polypeptide High Sensitive ELISA Kit. As a result, NF-L was not detected in the culture of HMC3 cells with HAM-Supp, but an increase in NF-L was observed when HAM-Supp was added to NB-1 cells. Furthermore, when HMC3 cells were co-cultured, a further increase in NF-L concentration was observed compared to when HAM-Supp was added to NB-1 cells. No such changes were observed with HD-Supp. Therefore, it was predicted that HMC3 cells would synergistically activate HAM-Sup-induced neuronal damage. The results are shown in Figure 12(B).

[0158] [Example 9: Induction of C3 gene expression in neuronal and glial cell lines using HAM-PBMC culture supernatant] HD-PBMC or HAM-PBMC is divided into 1 × 10⁻¹⁶ cells. ６Cells were seeded individually into 24-well plates and cultured in 1 mL of medium for 72 hours. The cell suspension was then centrifuged to collect the PBMC culture supernatant. The collected PBMC culture supernatant was added to NB-1 cells (4 HD, 8 HAM), HMC3 cells (8 HD, 11 HAM), and the glial cell line U251 cells (7 HD, 9 HAM), which had been cultured for 24 hours after seeding. The amount of culture supernatant added was 1 / 3 of the culture medium volume for each cell line. Cells that did not receive PBMC culture supernatant were used as negative controls. 24 hours after adding PBMC culture supernatant, total RNA was collected, and cDNA was synthesized using RiverTra Ace. The difference in C3 gene expression between cells treated with HD-Supp and HAM-Supp was analyzed by real-time PCR using the synthesized cDNA. For the analysis, we used FastStart Universal Probe Master (ROX) and FAM-labeled TaqMan gene expression primers C3 (Hs00163811_m1). 18s rRNA was used for internal correction. Target gene expression was determined by the following formula: target gene expression = 2-(Ct[target]-Ct[18s rRNA]). As a result, in NB-1, HMC3, and U251 cells, increased C3 gene expression was observed in the cell groups treated with HAM-Supp compared to those treated with HD-Supp. The results are shown in Figure 13.

[0159] [Example 10: Investigation of the effect of C3-related inhibitors on the spontaneous proliferation activity of HAM-PBMCs] Eight HAM-PBMCs were subjected to 1 × 10⁶ ５ Seeds were sown in 96 well-round bottom plates, each containing a C3-related inhibitor, and then incubated at 37°C in 5% CO2. ２The cells were cultured under the specified conditions. Cp40 (Med ChemExpress) and Danicopan (CAYMAN CHEMICAL) were used as C3-related inhibitors. The C3-related inhibitors were added to achieve final concentrations of 1, 3, 10, and 30 nM. A group with the same amount of DMSO added instead of the C3-related inhibitor (DMSO) was used as the negative control. A group with prednisolone (PSL: LKT Laboratories, Inc.), a known steroid treatment drug, added at a final concentration of 1 μg / mL, was used as the positive control. Six days after the start of culture, 1 μCi 3H-Thymidine was added to each well, and the cells were cultured at 37°C and 5% CO2. ２ The cells were cultured for 16 hours under the specified conditions. Afterward, the cultured cells were adsorbed onto a glass filter (Printed Filtermat A PerkinElmer) using a cell harvester (Tomtec MH3 PerkinElmer) and dried. Next, a solid scintillator, Meltilex-A (PerkinElmer), was impregnated into the glass filter, and the amount of 3H-thymidine taken up by the cells was measured using MicroBeta (WALLAC MicroBeta TriLux 1450-021). The results showed that, similar to the positive control, the addition of 10 and 30 μM Cp40, and 3–30 μM Danicopan suppressed the spontaneous proliferation activity of HAM-PBMCs. The results are shown in Figure 14.

[0160] [Example 11: Effect of C3 inhibitor on inflammatory cytokine gene expression in HAM-PBMCs] Three HAM-PBMCs were subjected to 1 × 10⁻⁶ ６Cells were seeded in 24-well plates, and Cp40 was added to a final concentration of 1.10 μM and cultured for 3 days. A group to which the same amount of DMSO was added instead of Cp40 was used as the negative control. A group to which 1 μg / mL PSL was added was used as the positive control. After culturing, total RNA was collected, and cDNA was constructed using RiverTra Ace. The gene expression changes of IFNγ and TNFα were analyzed using the constructed cDNA by real-time PCR. For the analysis, THUNDERBIRD Next SYBR qPCR Mix (Toyobo) was used, and gene expression was detected using the following primers. 18s rRNA was used for internal correction. IFNγ-F: GGCATTTTTGAAAGAATTGGAAAAAG (Sequence ID 68) IFNγ-R: TTTGGATGCCTCTGGGTCATCTT (Sequence ID 69) TNFα-F: CTCTTCTGCCTGCCAACTTTG (Sequence ID 70) TNFα-R: ATGGGCTACAGGCTTTGTTCACTC (Sequence ID 71)

[0161] The expression of the target gene was determined by the following formula: target gene expression = 2-(Ct[target]-Ct[18s rRNA]). As a result, similar to the positive control, Cp40 showed a concentration-dependent suppression effect on the gene expression of IFNγ and TNFα in HAM-PBMCs. The results are shown in Figure 15.

[0162] [Example 12: Investigation of the effect of C3-related inhibitors on HAM-PBMC-induced neurological damage] NB-1 cells 4 × 10 ４ Cells were sown one by one on a collagen-coated 24-well plate and cultured for 24 hours. After that, 1 x 10 ５HAM-PBMCs (6 cases) from cells were co-cultured. Danicopan was added at final concentrations of 1, 3, 10, and 30 μM and cultured for 72 hours. A group receiving the same amount of DMSO instead of Danicopan was used as a negative control. A group receiving 1 μg / mL PSL was used as a positive control. NF-L concentration in the culture supernatant after culture was measured using the Human NEFL ELISA Kit (Abcam). The results showed that the NF-L concentration, which increased with the addition of HAM-PBMCs to NB-1 cells, was significantly reduced by the addition of 10 and 30 μM Danicopan, similar to the positive control. Therefore, it was suggested that the neurotoxic effect of HAM-PBMCs is suppressed by Danicopan. The results are shown in Figure 16.

[0163] [Example 13: Changes in CXCL10 gene expression in U251 and HMC3 cells using culture supernatant of HAM-PBMCs treated with C3 inhibitor] Three HAM-PBMCs were subjected to 1 × 10⁶ ６ Cells were seeded in 24-well plates, and Cp40 was added to a final concentration of 1.10 μM. The cells were cultured for 3 days (D3) or 7 days (D7). A group treated with the same amount of DMSO instead of Cp40 was used as the negative control. A group treated with a final concentration of 1 μg / mL PSL was used as the positive control. After culturing, the cell suspension was centrifuged and the PBMC culture supernatant was collected. HMC3 or U251 cells were cultured in 3 × 10⁶ cells. ４Cells were seeded in 24-well plates and cultured for 24 hours. Then, the culture supernatant of PBMC cells cultured with Cp40, DMSO, or PSL was added. The amount of culture supernatant added was 1 / 3 of the culture medium volume for each cell line. After 24 hours of culture, total RNA was collected, and cDNA was constructed using RiverTra Ace. Changes in CXCL10 gene expression were analyzed using the constructed cDNA by real-time PCR. For the analysis, THUNDERBIRD Next SYBR qPCR Mix was used, and gene expression was detected using the following primers. 18s rRNA was used for internal correction. CXCL10-F: GGTGAGAAGAGATGTCTGAATCC (Sequence ID 72) CXCL10-R: GTCCATCCTTGGGAAGCAACTGCA (Sequence ID 73)

[0164] The expression of the target gene was determined by the following formula: target gene expression = 2-(Ct[target]-Ct[18s rRNA]). In both cell lines, adding PBMC culture supernatant with DMSO to the negative control induced an increase in CXCL10 gene expression compared to cells without the culture supernatant. In contrast, when PBMC culture supernatant with Cp40 added, similar to the positive control, was added, a decrease in CXCL10 gene expression was observed. Similar results were obtained regardless of whether the PBMC culture supernatant was prepared for 3 days or 7 days. The results are shown in Figure 17.

[0165] [Example 14: Identification of Factors Correlating with NF-L (Neurofilament Light Chain) by Proteome Analysis (SOMAscan) of Cerebrospinal Fluid (CSF) from HAM Patients] SOMAscan was performed using CSF samples from 183 HAM patients as described in Example 3. The quantitative values ​​(relative values) of NF-L obtained by SOMAscan in various samples were compared with the quantitative values ​​of approximately 7000 other factors, and factors showing a positive correlation (R > 0.4) were extracted. As a result, 1014 factors were found, and KEGG pathway analysis was performed on these 1014 factors using DAVID. The complement activation pathway was calculated as the pathway with the highest statistical significance. Figure 18 shows the factors in the complement activation pathway that showed a high correlation with the quantitative value of NF-L.

[0166] [Example 15: Identification of complement activation pathway factor C3-producing cells in HAM spinal cord lesions by single-cell level spatial gene expression analysis (Xenium Prime platform)] Xenium Prime is an imaging-based spatial gene analysis method developed by 10X GENOMICS. By binding a fluorescent probe to RNA targets on tissue sections and continuously capturing the fluorescence signal with a high-resolution camera, individual RNA molecules are decoded as optical barcodes. This platform allows simultaneous analysis of approximately 5,000 genes at the single-cell level. Three HAM patients and one healthy individual were analyzed using this platform, and 162,499 cells that passed quality checks were selected for analysis. Low-dimensional visualization using Uniform Manifold Application and Projection (UMAP) revealed that the cells were separated into 43 clusters. Verification based on marker gene expression in each cluster allowed for the differentiation of various cell types constituting nerve tissue: astrocytes, oligodendrocytes, microglia, and neurons. The results are shown in Figure 19.

[0167] Based on these analysis data, intercellular interaction analysis was performed using the NicheNet program. The results are shown in Figure 20. As shown in Figure 20, the C3-ITGB2 axis was predicted as one of the strong intercellular interaction factors (Figure 20A). In addition, the C3 gene, a major factor in the complement activation pathway, was highly expressed in microglia, astrocytes, and fibroblasts (Figure 20B). Furthermore, the ITGB2 gene, a receptor for the C3 cleavage factor, was highly expressed in microglia (Figure 20B).

Claims

1. A therapeutic or prophylactic agent for HTLV-1-associated myelopathy (HAM) containing a substance that inhibits the complement activation pathway.

2. The therapeutic or prophylactic agent according to claim 1, wherein the inhibitory substance inhibits the activation of complement factor C3.

3. The therapeutic or prophylactic agent according to claim 1, wherein the inhibitory substance suppresses the formation of complement complex C5b6.

4. The therapeutic or prophylactic agent according to any one of claims 1 to 3, wherein the inhibition of the complement activation pathway is performed at the lesion site of HTLV-1-associated myelopathy.

5. The therapeutic or prophylactic agent according to any one of claims 1 to 3, wherein the inhibitory substance is at least one selected from the group consisting of a substance that inhibits the expression of a gene encoding a complement factor or a fragment thereof, a substance that binds to a complement factor or a fragment thereof, a substance that binds to a complement factor convertase or a fragment thereof, a substance that inhibits the activity of a complement factor or a fragment thereof, and a substance that inhibits the activity of a complement factor convertase or a fragment thereof.

6. The therapeutic or prophylactic agent according to any one of claims 1 to 3, wherein the inhibitory substance is: (A) siRNA, shRNA, or antisense oligonucleotide of a gene encoding a complement factor or a fragment thereof; (B) an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof; (C) a small molecule compound that inhibits the activity of at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof; and (D) a peptide that binds to at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof; and (E) at least one selected from the group consisting of a nucleic acid aptamer that binds to at least one selected from the group consisting of a complement factor or a fragment thereof and a complement factor convertase or a fragment thereof.

7. The inhibitory substance is an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, complement factor or a fragment thereof constituting C3 convertase, and complement factor or a fragment thereof constituting C5 convertase; or an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, C3 convertase or a fragment thereof, complement factor or a fragment thereof constituting C3 convertase, C5 convertase or a fragment thereof, and complement factor or a fragment thereof constituting C5 convertase. (C) Small molecule compounds that inhibit the activity of at least one selected from the group consisting of complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, and C5 convertase or its fragment; and (D) Peptides that bind to at least one selected from the group consisting of complement factor C3 or its fragment, complement factor D or its fragment, complement factor B or its fragment, complement factor C5 or its fragment, complement factor C6 or its fragment, C3 convertase or its fragment, complement factor or its fragment constituting C3 convertase, C5 convertase or its fragment, and complement factor or its fragment constituting C5 convertase. (E) A therapeutic or prophylactic agent according to any one of claims 1 to 3, wherein the agent is at least one selected from the group consisting of a nucleic acid aptamer that binds to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor D or a fragment thereof, complement factor B or a fragment thereof, complement factor C5 or a fragment thereof, complement factor C6 or a fragment thereof, C3 convertase or a fragment thereof, a complement factor constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and a complement factor constituting C5 convertase or a fragment thereof.

8. The inhibitory substance is: (A) siRNA, shRNA, or antisense oligonucleotide of a gene expressing at least one selected from the group consisting of complement factor C3 or its fragment, complement factor C5 or its fragment, complement factor D or its fragment, complement factor constituting C3 convertase or its fragment, and complement factor constituting C5 convertase or its fragment; (B) an antibody or antigen-binding fragment thereof that recognizes at least one selected from the group consisting of complement factor C3 or its fragment, complement factor C5 or its fragment, complement factor D or its fragment, C3 convertase or its fragment, complement factor constituting C3 convertase or its fragment, C5 convertase or its fragment, and complement factor constituting C5 convertase; (C) a small molecule compound that inhibits the activity of at least one selected from the group consisting of complement factor C3 or its fragment, complement factor C5 or its fragment, complement factor D or its fragment, C3 convertase or its fragment, and C5 convertase or its fragment; and (D) A peptide that binds to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, complement factors constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factors constituting C5 convertase. (D) At least one selected from the group consisting of nucleic acid aptamers that bind to at least one selected from the group consisting of complement factor C3 or a fragment thereof, complement factor C5 or a fragment thereof, complement factor D or a fragment thereof, C3 convertase or a fragment thereof, complement factors constituting C3 convertase or a fragment thereof, C5 convertase or a fragment thereof, and complement factors constituting C5 convertase. The therapeutic or prophylactic agent according to any one of claims 1 to 3.

9. The therapeutic or prophylactic agent according to any one of claims 1 to 3, wherein the inhibitory substance is at least one selected from the group consisting of compstatin, pegcetacoplan, Cp40 / AMY-101, danicopan, iptacopan, eculizumab, ravulizumab, Coversin, zircoplan, tesidolumab, lamparizumab, narsoprimab, ALN-CC5, clobarimab, and abasincaptadopegol.

10. An auxiliary method for determining the severity of HAM, comprising: measuring the concentration of a target complement factor or a fragment thereof; and determining that the higher the measured concentration is compared to the normal value, the greater the severity of HAM.

11. The method according to claim 10, wherein the complement factor is at least one selected from the group consisting of complement factor C5, complement factor C6, and complement complex C5b6.

12. The method according to claim 10 or 11, further comprising measuring the CXCL10 concentration of the subject and determining that the higher the measured CXCL10 concentration is compared to the normal value, the greater the severity of HAM.

Images