Primer set for amplifying butyryl-coa: acetate coa-transferase (BUT) gene and use thereof
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- YAKULT HONSHA KK
- Filing Date
- 2026-01-22
- Publication Date
- 2026-07-30
Smart Images

Figure JP2026001951_30072026_PF_FP_ABST
Abstract
Description
butyryl-CoA:acetate CoA-transferase (but) gene amplification primer set and its use
[0001] The present invention relates to a primer set for amplifying the butt gene and its use, and more specifically to a primer set for amplifying the butt gene, a method for detecting microorganisms possessing the butt gene using the same, a method for measuring the amount of butt gene expression in feces, a method for predicting the amount of butyrate produced in the intestines, a method for screening test substances that increase the amount of butyrate produced in the intestines, a method for evaluating the butyrate-producing ability of test substances in the intestines, and a detection kit for microorganisms possessing the butt gene.
[0002] Butyrate, produced by intestinal bacteria, is important for maintaining the host's health, and accurately quantifying the butyrate-producing bacteria in the gut is crucial for understanding the host's intestinal environment and health status.
[0003] One example of a functional gene involved in butyrate production is the butyryl-CoA:acetate CoA-transferase gene (hereinafter referred to as the "but gene"), which is known to be the major butyrate-producing enzyme gene in the human gut.
[0004] Although several primers specific to the but gene are already known (Non-Patent Documents 1-3), quantitative PCR evaluation of their performance revealed that all of them exhibited insufficient specificity.
[0005] Wang LL, Guo HH, Huang S, Feng CL, Han YX, Jiang JD. Comprehensive evaluation of SCFA production in the intestinal bacteria regulated by berberine using gas-chromatography combined with polymerase chain reaction. J Chromatogr B Analyt Technol Biomed Life Sci. 2017;1057:70-80.Louis P, Flint HJ. Development of a semiquantitative degenerate real-time pcr-based assay for estimation of numbers of butyryl-coenzyme A (CoA) CoA transferase genes in complex bacterial samples. Appl Environ Microbiol. 2007;73(6):2009-2012.Trachsel J, Bayles DO, Looft T, Levine UY, Allen HK. Function and Phylogeny of Bacterial Butyryl Coenzyme A:Acetate Transferases and Their Diversity in the Proximal Colon of Swine. Appl Environ Microbiol. 2016;82(22):6788-6798.
[0006] Therefore, the objective of the present invention was to provide a primer with high specificity for the but gene and to enable reliable measurement of various types of data using this primer.
[0007] The inventors diligently conducted research to solve the above problems and, as a result, obtained primers with high specificity for the butt gene. They found that by using these primers, various measurements can be performed with high reliability, thus completing the present invention. Furthermore, the inventors found that the amount of butyrate produced in the intestines can be predicted by the correlation between the amount of butt gene expression measured with the butt gene amplification primer set of the present invention and the amount of butyrate produced in the intestines, thus completing the present invention.
[0008] In other words, the present invention is as follows: [1] A primer set for amplifying the but gene, characterized by comprising oligonucleotides represented by the nucleotide sequences described in SEQ ID NOs: 1 and 2. [2] A method for detecting microorganisms possessing the but gene, characterized by detecting the microorganisms possessing the but gene using the but gene amplification primer set described in [1]. [3] A method for measuring the amount of but gene expression in feces, characterized by measuring the amount of but gene expression in feces using the but gene amplification primer set described in [1]. [4] A method for predicting butyrate production in the intestines, characterized by measuring the amount of but gene expression in the feces of a test animal using the but gene amplification primer set described in [1] and predicting the amount of butyrate production in the intestines based on the amount of but gene expression. [5] A method for predicting butyrate production in the intestines, characterized by measuring the amount of but gene expression in feces before and after administering a test substance to a test animal using the but gene amplification primer set described in [1] and predicting the amount of butyrate production in the intestines based on the amount of but gene expression. [6] A method for predicting intestinal butyrate production, characterized by comprising the following steps (a) to (c): Step (a) measuring the amount of but gene expression in a test sample containing a microorganism possessing the but gene using the but gene amplification primer set described in [1]; Step (b) measuring the amount of but gene expression in a test sample containing a microorganism possessing the but gene and a test substance using the but gene amplification primer set described in [1]; and Step (c) predicting the amount of butyrate produced in the intestines based on the amount of but gene expression measured in steps (a) and (b). [7] A method for screening test substances that increase intestinal butyrate production, characterized by measuring the amount of but gene expression in feces before and after administration of the test substance to a test animal using the but gene amplification primer set described in [1], and selecting a test substance that increases intestinal butyrate production if the amount of but gene expression after administration of the test substance increases compared to before administration of the test substance.[8] A method for screening test substances that increase butyrate production in the intestines, comprising the following steps (d) to (f): Step (d) measuring the amount of but gene expression in a test sample containing a microorganism possessing the but gene using the but gene amplification primer set described in [1]; Step (e) measuring the amount of but gene expression in a test sample containing a microorganism possessing the but gene and a test substance using the but gene amplification primer set described in [1]; Step (f) selecting a test substance that increases the amount of but gene expression after administration of the test substance, as measured in steps (d) and (e), compared to before administration of the test substance, as a test substance that increases butyrate production in the intestines. [9] A method for evaluating the butyrate production ability of a test substance in the intestines, comprising measuring the amount of but gene expression in the feces before and after administration of the test substance to a test animal using the but gene amplification primer set described in [1], and evaluating the butyrate production ability of the test substance in the intestines based on the amount of but gene expression.
[10] A method for evaluating the butyrate-producing ability of a test substance in the intestines, characterized by comprising the following steps (g) to (i): Step (g) measuring the amount of butyrate-producing ability of a test sample containing a microorganism possessing the butyrate-producing ability of a test substance in the intestines, using
[0009] The primer set for amplifying the BUT gene of the present invention has higher specificity than conventional primer sets for the BUT gene, allowing for reliable measurement of various BUT gene-related measurements.
[0010] Therefore, by using the primer set for but gene amplification of the present invention, detection of microorganisms carrying the but gene, measurement of the expression level of the but gene in feces, prediction of the amount of butyric acid production in the intestine, screening of test substances that increase the amount of butyric acid production in the intestine, evaluation of the butyric acid production ability of test substances in the intestine, etc. can be carried out with high reliability.
[0011] It is a figure showing the detection sensitivity using the novel primer of Example 2. It is a figure showing the correlation between the number of but gene-carrying bacteria in the fecal sample of Example 3 and the butyric acid concentration in feces. It is a figure showing the comparison of detection sensitivity and amplification efficiency by 1-step RT-qPCR and 2-step RT-qPCR of Example 4 (mean value ± standard deviation). It is a figure showing the change in the number of but gene-carrying bacteria per hour (Figure 4A) and expression level (Figure 4B) in the in vitro culture system of Example 5. It is a figure showing the change in the amount of butyric acid production per hour in the in vitro culture system of Example 5. It is a figure showing the correlation between the Δ butyric acid production amount and the but gene expression level in the in vitro culture system of Example 5. It is a figure showing the test schedule of Example 6. It is a figure showing the change in the expression level of the but gene in feces for each of 10 subjects (ID: 1 to 10) measured in Example 6 (Pre: before taking Symprotech, 1w: 1 week after taking, 2w: 2 weeks after taking, Pos: 2 weeks after discontinuation of taking).
[0012] The primer set for but gene amplification of the present invention (hereinafter referred to as "the present invention set") consists of oligonucleotides represented by the base sequences set forth in SEQ ID NOs: 1 and 2. SEQ ID NO: 1: but-652F3 (forward primer): CARCTBGGHATYGGBGGWATGCCHAAYGC SEQ ID NO: 2: but-1025R3 (reverse primer): GCDCCBADVACRAARTCN * ARCTGWCCRCC In the above sequence, N * represents "a" or "c" or "g" or "t".
[0013] Incidentally, each of the above primers can be obtained by a conventional DNA synthesis method well known to those skilled in the art, for example, using a DNA synthesizer, or by commissioning a DNA synthesizer such as Sigma-Aldrich Japan or Life Technologies Japan.
[0014] Here, "for but gene amplification" means that at least a part of the base sequence complementary to the but (butyryl-CoA: acetate CoA-transferase) gene, preferably only the sequence sandwiched between two primers, is amplified, and the base sequences complementary to other genes are not amplified specifically. Further, since the set of the present invention is for but gene amplification, if it is the set of the present invention, a base sequence complementary to the but gene can be specifically amplified if it is 0.5 μM or more, preferably 1.0 μM, in the sample. In addition, the base sequence complementary to the but gene includes those obtained by further reverse transcription reaction of the base sequence complementary to the but gene.
[0015] Incidentally, the but gene is usually present in butyric acid-producing bacteria and the like. Examples of such butyric acid-producing bacteria include those in which the but gene in Table 3 and the but item in Table 5 described later are "+", etc.
[0016] The set of the present invention can also be used as a detection kit for microorganisms carrying the but gene including this. In addition to the set of the present invention, this detection kit may include enzyme reagents, controls, etc. as necessary.
[0017] In addition to the amplification of the base sequence complementary to the above-described but gene, the set of the present invention can be used for detection of microorganisms carrying the but gene, measurement of the expression level of the but gene in feces, prediction of the butyric acid production amount in the intestine, screening of test substances for increasing the butyric acid production amount in the intestine, evaluation of the butyric acid production ability of the test substance in the intestine, etc.
[0018] A method for detecting microorganisms carrying the but gene using the set of the present invention (hereinafter referred to as "the detection method of the present invention") will be described.
[0019] The detection method of the present invention can be carried out in the same manner as conventionally known methods for detecting microorganisms using primer sets, except that the set of the present invention is used. Examples of samples that can be targeted by the detection method of the present invention include culture media and feces that are thought to contain microorganisms possessing the but gene. The feces are not particularly limited as long as they are excreted by a test animal, and humans are preferred as test animals. It is preferable to extract RNA from these samples in advance according to conventionally known methods. Furthermore, when creating a base sequence complementary to the extracted RNA, this can be done using conventionally known methods with reverse transcriptase.
[0020] The amplification reaction using the present invention set and the RNA prepared above can be performed using conventionally known primer methods such as PCR and qPCR. Furthermore, conventionally known conditions can be used for these amplification reactions. In addition, commercially available PCR kits may be used for these amplification reactions. Alternatively, RT-PCR and RT-qPCR, which perform RNA extraction and amplification reactions together, may be used. Among conventionally known primer methods such as PCR, qPCR and RT-qPCR, which allow for real-time detection of the amplified product, are preferred, with RT-qPCR being preferred.
[0021] The above-mentioned RT-qPCR includes so-called 1-step RT-qPCR, in which the reverse transcription reaction is followed by the amplification reaction in the same system, and 2-step RT-qPCR, in which the reverse transcription reaction is followed by the amplification reaction in a different system. 2-step RT-qPCR is preferred because it has a higher amplification efficiency.
[0022] Specifically, for the amplification reaction of qPCR, using the extracted RNA as a template and a commercially available qPCR reagent, first heat at 94-95°C for 1-15 minutes, then use 94-95°C for 5-30 seconds, 55-63°C for 10-30 seconds, and 72°C for 10-60 seconds as one cycle, and repeat this for 40-45 cycles. More specifically, after heating at 94°C for 5 minutes, use 94°C for 20 seconds, 63°C for 20 seconds, and 72°C for 34 seconds as one cycle, and repeat this for 40 cycles. The amplification reaction of RT-qPCR can be performed under the same conditions as qPCR after the reverse transcription reaction of RNA. In addition, in order to enhance the specificity for the but gene-carrying strain, the annealing temperature is preferably 60°C or higher.
[0023] By confirming the amplified product amplified by the set of the present invention in this way, microorganisms carrying the but gene can be detected with high sensitivity. If the set of the present invention is used, 10 1 ~10 6 cells, preferably 10 1 ~10 2 cells of microorganisms carrying the but gene, or 10 1 ~10 6 copies, preferably 10 1 ~10 2 copies of the but gene can be detected.
[0024] The method for measuring the expression level of the but gene in feces using the set of the present invention (hereinafter referred to as "the measurement method of the present invention") will be described.
[0025] The measurement method of the present invention measures the expression level of the but gene in feces, but the amount of the amplified product amplified by the set of the present invention may be measured in the same manner as the detection method of the present invention.
[0026] The method for predicting the butyric acid production amount in the intestine using the set of the present invention (hereinafter referred to as "the prediction method of the present invention") will be described.
[0027] The prediction method of the present invention measures the amount of BUT gene expression in the feces of test animals using the set of the present invention in the same manner as the detection method and measurement method of the present invention. Since BUT gene expression and butyrate production show a positive correlation in vitro, the amount of butyrate produced in the intestines can be predicted by applying the amount of BUT gene expression to this correlation.
[0028] Furthermore, the prediction method of the present invention allows for the prediction of how the test substance affects butyrate production in the intestines by measuring the expression level of the butt gene in the feces before and after administration of the test substance to the test animal using the set of the present invention in the same manner as the detection method and measurement method of the present invention, and comparing the expression levels. The test substance is not particularly limited and can be, for example, sugars, vitamins, enzymes, various foods and beverages, etc.
[0029] Furthermore, a more preferred embodiment of the prediction method of the present invention includes the following steps (a) to (c): Step (a) measuring the amount of butyrate expression in a test sample containing a microorganism possessing the butyrate using the set of the present invention; Step (b) measuring the amount of butyrate expression in a test sample containing a microorganism possessing the butyrate and a test substance using the set of the present invention; and Step (c) predicting the amount of butyrate produced in the intestines based on the amount of butyrate expression measured in Step (a) and Step (b).
[0030] This document describes a screening method for test substances that increase butyrate production in the intestines using the present invention set (hereinafter referred to as the "present invention screening method").
[0031] The screening method of the present invention involves measuring the amount of butyrate gene expression in the feces of an animal before and after administering the test substance to the animal, using the set of the present invention in the same manner as the detection method and measurement method of the present invention. Substances in which the amount of butyrate gene expression after administration of the test substance increases compared to before administration of the test substance are selected as test substances that increase butyrate production in the intestines.
[0032] Furthermore, preferred embodiments of the screening method of the present invention include the following steps (d) to (f): Step (d) measuring the amount of but gene expression in a test sample containing a microorganism possessing the but gene using the set of the present invention; Step (e) measuring the amount of but gene expression in a test sample containing a microorganism possessing the but gene and a test substance using the set of the present invention; Step (f) selecting a test substance that increases the amount of but gene expression after administration of the test substance, as measured in steps (d) and (e), compared to before administration of the test substance, as a test substance that increases butyrate production in the intestines.
[0033] Specific test substances found to increase butyrate production in the intestines using the screening method of the present invention include Synprotec (manufactured by Yakult Honsha Co., Ltd.), which is a set containing two types of live bacteria (powder) – Lactobacillus casei strain Shirota and Bifidobacterium BY strain – and galactooligosaccharide (Oligomate 55N) (liquid sugar).
[0034] This document describes a method for evaluating the butyrate production capacity of a test substance in the intestines using the present invention set (hereinafter referred to as the "present invention evaluation method").
[0035] The evaluation method of the present invention involves measuring the expression level of the butyrate gene in the feces of an animal before and after administering the test substance to the animal using the set of the present invention, and evaluating the butyrate production capacity of the test substance in the intestines based on the butyrate gene expression level.
[0036] In the above, butyrate production capacity refers to cases where the test substance directly increases butyrate production, as administration of the test substance may increase the production of butyrate derived from the test substance and butyrate derived from endogenous butyrate-producing bacteria. Therefore, it includes both cases where the test substance directly increases butyrate production and cases where it indirectly increases butyrate production.
[0037] Furthermore, preferred embodiments of the evaluation method of the present invention include the following steps (g) to (i): Step (g) measuring the amount of but gene expression in a test sample containing a microorganism possessing the but gene using the set of the present invention; Step (h) measuring the amount of but gene expression in a test sample containing a microorganism possessing the but gene and the test substance using the set of the present invention; and Step (i) evaluating the butyrate production ability of the test substance in the intestines based on the amount of but gene expression measured in Step (g) and Step (h).
[0038] The present invention will be described in detail below with reference to examples of the present invention, but the present invention is not limited in any way to these examples. In the examples, the T in the upper right corner of the strain name indicates that the strain is a type strain. Each type strain can be easily obtained by those skilled in the art from ATCC (American Type Culture Collection), JCM (Japan Collection of Microorganisms), DSMZ (Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH), IFO (Institute for Fermentation, Osaka), etc.
[0039] Comparative Example 1 Specificity of Previously Reported Primer Sets: Three previously reported primer sets that have been reported as but gene-specific primer sets ((BUT-F / BUT-R: No. 1: SEQ ID NOs. 3-4: Non-Patent Literature 1), (BCoATscrF / BCoATscrR: No. 2: SEQ ID NOs. 5-6: Non-Patent Literature 2), (funbut-FWD / funbut-REV: No. 3: SEQ ID NOs. 7-8: Non-Patent Literature 3)) were synthesized according to standard methods. Using these primer sets, cross-reactivity between but gene-carrying bacteria (21 strains) and but gene-non-carrying bacteria (10 strains) was investigated by qPCR (real-time PCR) under the reaction conditions described in each paper. The sequences of each primer set and the annealing temperatures described in the literature are shown in Table 1. The results of the cross-reactivity investigation by qPCR using each strain are shown in Table 3. The culture and qPCR of each strain were performed under the following conditions.
[0040]
[0041] <Culturing of Each Strain> For the culture medium of each strain, a known culture medium (200 μL) suitable for culturing each strain was used, and DNA was extracted using the method described in the paper (Matsuda K, Tsuji H, Asahara T, Kado Y, Nomoto K. Sensitive quantitative detection of commensal bacteria by rRNA-targeted reverse transcription-PCR. Appl Environ Microbiol. 2007;73(1):32-39.). Based on the number of bacteria measured by DAPI staining (Matsuki T, et al. Quantitative PCR with 16S rRNA-gene-targeted species-specific primers for analysis of human intestinal bifidobacteria. Appl Environ Microbiol. 2004;70(1):167-173.), the obtained DNA was divided into 2 × 10⁻¹⁶ units. 8 The DNA was diluted to a concentration equivalent to cells / mL and used as a standard DNA sample in the experiment.
[0042] <qPCR> For qPCR, TaKaRa Taq (Takara) was used, and the reaction mixture containing each solution listed in Table 2 was used with an ABI PRISM 7900HT. After heating the reaction mixture at 94 °C for 5 minutes, qPCR was performed under the reaction conditions described in each paper.
[0043]
[0044]
[0045] BUT-F / BUT-R and BCoATscrF / BCoATscrR showed low coverage of but gene-carrying bacteria, consistent with predictions based on alignment analysis results. Furthermore, in the funbut-FWD / funbut-REV group, F. prausnitzii YIT 10067 was identified. TF. mortiferum YIT 10361 T In addition to showing weak reactivity to Anaerotruncus colihominis JCM 15631 (Ct values: 26.0, 36.9, and 34.6 respectively), it was also confirmed that the drug reacted nonspecifically to bacteria that did not possess the but gene.
[0046] Example 1: Design and specificity of a novel primer set: Comparative Example 1 revealed that previously reported primer sets had low comprehensiveness against bacteria carrying the but gene and reacted nonspecifically to bacteria without the but gene. Therefore, based on the alignment results of the full-length sequence of the but gene, a novel but gene-specific primer set (but_652F3 / but_1025R3) (No. 4) was synthesized according to a standard method, targeting a common sequence. The sequences of these primer sets and the optimal annealing temperature (the annealing temperature that maintains specificity and detection sensitivity was determined by preliminary testing) are shown in Table 4. Subsequently, the cross-reactivity between representative but gene-carrying bacteria (21 strains) and but gene-non-carrying bacteria (66 strains) and the novel primers (but_652F3 / but_1025R3) was investigated in the same manner as in Comparative Example 1, and the results are shown in Table 5. For qPCR, the reaction mixture was heated at 94°C for 5 minutes, followed by 40 cycles of heating at 94°C for 20 seconds, 63°C for 20 seconds, and 72°C for 34 seconds.
[0047] Furthermore, the expression level of butyrate in each strain was measured by HPLC according to the method described in the paper (Asahara T, Takahashi A, Yuki N, Kaji R, Takahashi T, Nomoto K. Protective Effect of a Synbiotic against Multidrug-Resistant Acinetobacter baumannii in a Murine Infection Model. Antimicrob Agents Chemother. 2016; 60(5):3041-3050.). The results are also shown in Table 5. In addition, Table 5 also shows whether each strain produces butyrate via the but gene or other genes.
[0048]
[0049]
[0050] The new primer set (but_652F3 / but_1025R3) was selected from among the 21 strains of but gene-carrying bacteria tested, specifically F. mortiferum YIT 10361. T F. plautii YIT 12796 T , Hungatella hathewayi YIT 12259 T , Coprococcus catus YIT 11484 T It showed high specificity for 16 strains of A. colihominis, excluding JCM 15631 (C of the 16 strains). T Average value: 21.7). C. catus YIT 11484 T It responded weakly to (C T Average value: 26.3). On the other hand, no cross-reactivity was observed with 66 strains that do not possess the but gene (C of the 66 strains). T Value: 33.4-40 (C) between target and non-target bacterial species. T The difference in values suggested a reactivity difference of more than 1000 times between these (Tables 5-1 to 5-3). The novel but gene-specific amplification primer set was confirmed to have a higher coverage rate of but gene-carrying bacteria and higher specificity compared to previously reported primer sets.
[0051] Of the 21 strains possessing the but gene, butyrate production was observed in 20 strains, excluding Hungatella hathewayi, and the but gene possession information and butyrate production ability were generally consistent (Table 5-1). Butyrate production was also observed in the other 10 strains, but these were confirmed to be strains possessing butyrate-producing genes other than the but gene (buk, Ato, 4Hbt).
[0052] Example 2 Detection sensitivity of the new primer set: Of the 16 strains whose specificity was confirmed with the new primer set (but_652F3 / but_1025R3), C T C is closest to the average value (21.7) T The value of A. hallii YIT 10064 was recognized. T The detection sensitivity of the primer was investigated for Anaerobutyricum hallii YIT 10064. T DNA 2 × 10 8 Adjust the concentration to the equivalent of cells / mL, serially dilute the DNA solution 10-fold, and use 10 per well. 5 ~10 0 Cell equivalents were used, and PCR reactions were performed (mean ± standard deviation of 5 series are shown).
[0053] As a result, the new primer set designed this time has 10 per reaction. 1 It was found that this method can detect bacteria carrying the but gene in cells and has high detection sensitivity (Figure 1).
[0054] Example 3 Measurement of the number of but gene-carrying bacteria and butyrate concentration in fecal samples: Sixty fecal samples obtained from subjects (collected three times at two-month intervals from 20 subjects) were used as fecal samples. Based on the weight information, DNA was extracted from the fecal samples using a conventional method after adding 9 times the amount of PBS, using 200 μL. The number of but gene-carrying bacteria in the aforementioned fecal samples derived from healthy adults was measured by qPCR using a novel primer set in the same manner as in Example 1, and the but gene was detected in all samples. Furthermore, the number of but gene-carrying bacteria detected with the novel primers was converted to a standard strain and ranged from 7.48 to 10.0 (Log 10 The average value (cells / g feces) is 9.09 (Log 10 The values were cells / g (fecal matter). Pearson's correlation coefficient was calculated to compare the correlation between the number of bacteria carrying the butyrate gene and butyrate concentration.
[0055] By using a novel primer set, we were able to measure the number of bacteria carrying the but gene in fecal samples.
[0056] Furthermore, when we examined the correlation between the number of bacteria carrying the but gene, measured with a novel primer set, and the butyrate concentration, measured by HPLC according to the method described in the paper (Asahara T, Takahashi A, Yuki N, Kaji R, Takahashi T, Nomoto K. Protective Effect of a Synbiotic against Multidrug-Resistant Acinetobacter baumannii in a Murine Infection Model. Antimicrob Agents Chemother. 2016; 60(5):3041-3050.), we found no significant correlation between the two (Figure 2, P = 0.165, R (= 0.18). However, no samples were found that showed high butyrate concentrations despite a low number of bacteria carrying the but gene. On the other hand, a certain number of samples were found that had high numbers of bacteria carrying the but gene, but significantly low butyrate concentrations.
[0057] While examining intestinal butyrate production is extremely important, it was considered possible that measuring butyrate concentration in feces did not necessarily reflect the actual amount of butyrate produced in the intestines.
[0058] Example 4 Measurement of but gene expression levels: but gene expression levels were measured by 1-step RT-qPCR or 2-step RT-qPCR using a novel primer set. For 1-step RT-qPCR, One Step TB Green PrimeScript was used. TM Using the PLUS RT-PCR Kit (Takara), a reaction mixture containing each solution listed in Table 6 was used with QuantStudio TM RT-qPCR was performed using 12K Flex. The reaction mixture was heated at 42°C for 30 minutes and then at 95°C for 10 minutes. After heating, the mixture was incubated at 95°C for 10 seconds, 63°C for 20 seconds, and 72°C for 34 seconds for 40 cycles.
[0059]
[0060] <Preparation of standard RNA> A. hallii YIT 10064 T DNA extracted from the pure culture medium was measured using DAPI staining to determine the bacterial count (Matsuki T, et al. Quantitative PCR with 16S rRNA-gene-targeted species-specific primers for analysis of human intestinal bifidobacteria. Appl Environ Microbiol. 2004; 70(1): 167-173.), resulting in a count of 2 × 10⁶. 7 The sample was diluted to a concentration equivalent to cells / mL. Using this as a template, the target DNA was amplified by PCR using novel primers (but_652F3 / but_1025R3). For the forward primer, the T7 promoter sequence (TAATACGACTCACTATAGGGAGA: SEQ ID NO: 9) was added to the 5' end. Agarose gel electrophoresis confirmed the presence of a single band at the desired size. Next, the obtained PCR amplification product was purified using the HP PCR Product Purification Kit (Genetics Japan) according to the specified method, and then OD (Oxygen Disorder) was used. 260 The DNA concentration was calculated by measuring [a specific value]. Next, 0.2 μg of DNA was used as a template for MEGAscript. TM In vitro transcription and DNase treatment were performed using the T7 Transcription Kit (invitrogen). TM After purifying the RNA obtained using the Transcription Clean-Up Kit (invitrogen), OD 260 The concentration was calculated by measuring 2 × 10⁻⁶. 10 A sample was prepared to achieve a copy / mL concentration and used as the standard RNA. DNA and RNA concentrations were calculated using the following formulas.
[0061] [Math 1] Concentration (pmol / ml) = OD 260 ×100 / (1.5N) A +0.71NC +1.20N G +0.84N T(U) * ) *N A : 126, N C : 56, N G : 104, N T(U) : 115
[0062] For the 2-step RT-qPCR, first, the RNA was subjected to genomic DNA removal and reverse transcription reactions using the PrimeScript RT reagent Kit with gDNA Eraser (Takara). For the standard RNA, 2 × 10⁻¹⁶ RNA was used. 10 RNA equivalent to copies / mL was subjected to the reaction, followed by the use of TaKaRa Taq (Takara) and QuantStudio with the reaction mixture containing each solution listed in Table 7. TM qPCR was performed using 12K Flex. The reaction mixture was heated at 94°C for 5 minutes, followed by 40 cycles of heating at 94°C for 20 seconds, 63°C for 20 seconds, and 72°C for 34 seconds.
[0063]
[0064] For both 1-step RT-qPCR and 2-step RT-qPCR, 10 units of standard RNA per reaction are used to create a calibration curve. 2 ~10 7 A copy equivalent was used in the test.
[0065] We compared the detection sensitivity and amplification efficiency of 1-step and 2-step RT-qPCR using a novel primer set. When 1-step RT-qPCR was performed using standard RNA as a template, the detection sensitivity was 10 per reaction. 3 It was possible to detect but gene expression levels of more than 10 copies per reaction (Figure 3). Next, when 2-step RT-qPCR was performed, 10 2It was possible to detect but gene expression levels exceeding copies (Figure 3). Furthermore, the slope of the calibration curve confirmed that 2-step RT-qPCR had higher amplification efficiency than 1-step RT-qPCR (Figure 3). In conclusion, although but gene expression levels can be measured using either 1-step RT-qPCR or 2-step RT-qPCR, 2-step RT-qPCR was found to be preferable.
[0066] Example 5 Verification of the number of bacteria possessing the but gene, expression level, and butyrate production in an in vitro culture system: <Bacterial strains used and mixed culture experiment> Anaerostipes hadrus YIT 13225 (Sato T, et al. Prebiotic potential of L-sorbose and xylitol in promoting the growth and metabolic activity of specific butyrate-producing bacteria in human fecal culture. FEMS Microbiol Ecol. 2017 ;93(1):fiw227.), Anaerobutyricum hallii YIT 10064 T , Roseburia intestinalis YIT 10172 T (The above is a strain possessing the but gene), Prevotella copri YIT 12933 T Frozen stocks of the (but gene-free strain) were inoculated into 1 mL of modified GAM liquid medium with 1% glucose and cultured at 37°C for 18 hours (pre-culture 1). The culture solution from pre-culture 1 (15 μL) was subcultured in the same medium (3 mL) and cultured for 24 hours (pre-culture 2).
[0067] Each bacterial suspension from pre-culture 2 was dispensed into 1.5 mL tubes (1 mL each), centrifuged at 7,740 × g for 10 minutes, and the supernatant was removed. An equal volume of 1% glucose-supplemented modified GAM liquid medium was added and mixed. The washed bacterial suspension was diluted 10-fold with 1% glucose-supplemented modified GAM liquid medium, and then OD (Oxygen-Dose) was added. 600The solution was prepared to have an OD value of 0.1. 100 μL each of bacterial suspensions from four strains with equal OD values was added to 10 mL of 1% glucose-supplemented modified GAM liquid medium, and the cultures were incubated at 37°C for 24 hours. Culture samples were taken at 0, 6, 8, 10, 12, 14, and 24 hours of incubation and subjected to various analyses. All of these procedures were performed in an anaerobic glove box. The experiment was conducted with n=4.
[0068] <Measurement of Butyrate Concentration> The culture medium (450 μL) sampled in the mixed culture experiment was stored at -80°C until use. It was thawed at the time of measurement, 50 μL of 10% perchloric acid was added, and the mixture was stirred using a vortex. The mixture was then allowed to stand overnight at 4°C. After centrifugation at 12,000 rpm for 10 minutes at 4°C, the supernatant was filtered through a 0.45 μm membrane filter and subjected to HPLC analysis (Asahara T, Takahashi A, Yuki N, Kaji R, Takahashi T, Nomoto K. Protective Effect of a Synbiotic against Multidrug-Resistant Acinetobacter baumannii in a Murine Infection Model. Antimicrob Agents Chemother. 2016; 60(5): 3041-3050.). An Alliance 2695 HPLC system (Waters) was used, a 432 conductivity detector (Waters Co.) was used as the detector, and two Shodex RSpak KC-811 columns (8.0 mm ID × 300 mm) (Showa Denko K.K.) were connected together. The change in butyrate concentration per unit time was calculated by (butyrate concentration at sampling - butyrate concentration at the previous sampling) ÷ (culture time at sampling - culture time at the previous sampling), and in this example, this concentration change was defined as the butyrate production per unit time (Δbutyrate production).
[0069] <RNA Extraction> The culture medium (100 μL) sampled in the mixed culture experiment was added to twice the volume of RNAprotect bacteria reagent (Qiagen) and allowed to stand at room temperature for 10 minutes. The mixture was centrifuged at 4°C and 15,000 × g for 10 minutes, the supernatant was removed, and the mixture was stored at -80°C. Total RNA was extracted by the hot phenol method (Matsuda K, Tsuji H, Asahara T, Matsumoto K, Takada T, Nomoto K. Establishment of an analytical system for the human fecal microbiota, based on reverse transcription-quantitative PCR targeting of multicopy rRNA molecules. Appl Environ Microbiol. 2009; 75(7): 1961-1969.) and dissolved in 100 μL of NFW.
[0070] <Measurement of the number of bacteria carrying the but gene> Using RNA extracted from the bacterial suspension after mixed culture as a template, One Step TB Green PrimeScript TM Using the PLUS RT-PCR Kit (Takara), a reaction mixture containing each solution listed in Table 8 was used with QuantStudio TMRT-qPCR was performed using 12K Flex. Using primers specific to the Clostridium coccoides group and Prevotella, which encompass all but gene-carrying strains used (Matsuda K, Tsuji H, Asahara T, Matsumoto K, Takada T, Nomoto K. Establishment of an analytical system for the human fecal microbiota, based on reverse transcription-quantitative PCR targeting of multicopy rRNA molecules. Appl Environ Microbiol. 2009; 75(7): 1961-1969.), the reaction mixture was heated at 42 °C for 30 minutes and then at 95 °C for 10 minutes. The reaction was then carried out for 40 cycles, with each cycle consisting of 95 °C for 10 seconds, 55 °C for 20 seconds, and 72 °C for 34 seconds. The combined number of C. coccoides group and Prevotella bacteria was calculated as the viable cell count.
[0071]
[0072] <Measurement of but gene expression levels> This was carried out in the same manner as in Example 4.
[0073] Statistical analysis was performed using R (version 4.0.5). Pearson's correlation coefficient was used to analyze the relationships between the analysis items.
[0074] The number of bacteria carrying the but gene, measured by qPCR in the same manner as in Example 3, increased over time up to 12 hours of culture, and then reached a steady state (Figure 4A). On the other hand, the but gene expression level, measured by RT-qPCR in the same manner as in Example 3, increased up to 12 hours of culture, and then decreased up to 24 hours of culture (Figure 4B). It was confirmed that the behavior of Δbutyrate production was more similar to that of but gene expression than to the number of bacteria carrying the but gene (Figure 5). Furthermore, when the correlation between Δbutyrate production and but gene expression was examined, Δbutyrate production showed a high positive correlation with but gene expression (Figure 6, P < 0.001, R (= 0.821).
[0075] These results show that butyrate production in the gut can be predicted based on the expression level of the but gene.
[0076] Example 6 Application of the but gene expression quantification system to human feces: Forty fecal samples (collected four times from 10 subjects) were used as fecal specimens. The but gene expression levels in the 40 fecal samples were measured by RT-qPCR in the same manner as in Example 4. The detection rate was 100%, and the detected but gene expression levels ranged from 8.65 to 10.36 (Log 10 It was within the range of copy / g feces.
[0077] These results demonstrate that the but gene expression quantification system in Example 5 can be applied to human feces.
[0078] Example 7 Screening of test substances that increase butyrate production in the intestines: Ten subjects were given one packet each of powder and liquid sugar of Synprotec (manufactured by Yakult Honsha Co., Ltd.), which contains two types of live bacteria (powder) of Lactobacillus casei Shirota strain and Bifidobacterium BY strain, and galactooligosaccharide (Oligomate 55N) (liquid sugar), three times a day according to the schedule in Figure 7. Then, the amount of but gene expression in the feces was measured before Synprotec intake, 1 week after intake, 2 weeks after intake, and Pos (2 weeks after discontinuation of intake) in the same manner as in Example 5. The results are shown in Figure 8.
[0079] The expression levels of the butyrate gene in the feces of all 10 subjects increased during at least one period of intake, with particularly significant increases observed in 7 subjects (IDs: 3-7, 9-10). This result suggests that Synprotec increases butyrate production in the gut.
[0080] The primer set for amplifying the but gene of the present invention can be used for detecting microorganisms possessing the but gene, measuring the amount of but gene expression in feces, predicting butyrate production in the intestines, screening test substances that increase butyrate production in the intestines, and evaluating the butyrate production capacity of test substances in the intestines.
Claims
1. A primer set for amplifying the but gene, characterized by comprising oligonucleotides represented by the nucleotide sequences described in SEQ ID NOs: 1 and 2.
2. A method for detecting microorganisms possessing the but gene, characterized by detecting the microorganisms possessing the but gene using the but gene amplification primer set described in claim 1.
3. A method for measuring the amount of the but gene expression in feces, characterized by measuring the amount of but gene expression in feces using the but gene amplification primer set described in claim 1.
4. A method for predicting butyrate production in the intestines, characterized by measuring the amount of but gene expression in the feces of test animals using the but gene amplification primer set described in claim 1, and predicting the amount of butyrate produced in the intestines based on the amount of but gene expression.
5. A method for predicting butyrate production in the intestines, characterized by measuring the amount of but gene expression in the feces before and after administering a test substance to a test animal using the but gene amplification primer set described in claim 1, and predicting the amount of butyrate produced in the intestines based on the amount of but gene expression.
6. A method for predicting butyrate production in the intestines, comprising the following steps (a) to (c): Step (a) measuring the amount of butyrate expression in a test sample containing a microorganism possessing the butyrate using the butyrate amplification primer set described in claim 1; Step (b) measuring the amount of butyrate expression in a test sample containing a microorganism possessing the butyrate and a test substance using the butyrate amplification primer set described in claim 1; and Step (c) predicting the amount of butyrate production in the intestines based on the amount of butyrate expression measured in steps (a) and (b).
7. A method for screening test substances that increase butyrate production in the intestines, characterized by measuring the amount of but gene expression in the feces before and after administration of the test substance to a test animal using the but gene amplification primer set described in claim 1, and selecting test substances that increase but gene expression after administration of the test substance compared to before administration of the test substance.
8. A method for screening test substances that increase butyrate production in the intestines, comprising the following steps (d) to (f): Step (d) measuring the amount of butyrate expression in a test sample containing a microorganism possessing the butyrate using the butyrate amplification primer set described in claim 1; Step (e) measuring the amount of butyrate expression in a test sample containing a microorganism possessing the butyrate and a test substance using the butyrate amplification primer set described in claim 1; Step (f) selecting a test substance that increases the amount of butyrate expression after administration of the test substance, as measured in steps (d) and (e), compared to before administration of the test substance, as a test substance that increases butyrate production in the intestines.
9. A method for evaluating the butyrate-producing ability of a test substance in the intestines, characterized by measuring the amount of but gene expression in the feces before and after administration of the test substance to a test animal using the but gene amplification primer set described in claim 1, and evaluating the butyrate-producing ability of the test substance in the intestines based on the amount of but gene expression.
10. A method for evaluating the butyrate production ability of a test substance in the intestines, characterized by comprising the following steps (g) to (i): Step (g) measuring the amount of but gene expression of a test sample containing a microorganism possessing the but gene using the but gene amplification primer set described in claim 1; Step (h) measuring the amount of but gene expression of a test sample containing a microorganism possessing the but gene and a test substance using the but gene amplification primer set described in claim 1; and Step (i) evaluating the butyrate production ability of the test substance in the intestines based on the but gene expression levels measured in steps (g) and (h).
11. A detection kit for microorganisms possessing the but gene, characterized by comprising the but gene amplification primer set described in claim 1.