Cell activator, composition for activating cells, and method for producing cell activator
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- TOHOKU UNIV
- Filing Date
- 2026-01-23
- Publication Date
- 2026-07-30
Smart Images

Figure JP2026002287_30072026_PF_FP_ABST
Abstract
Description
Cell activator, cell activating composition, and method for producing a cell activator
[0001] The present invention relates to a cell activator, a cell activating composition, and a method for producing a cell activator. This application claims priority based on Japanese Patent Application No. 2025-010062, filed in Japan on January 23, 2025, the contents of which are incorporated herein by reference.
[0002] Placental tissue is primarily composed of trophoblast tissue. The inventors have developed a method for recovering CD49f antibody-positive cells from a cell suspension obtained from mammalian placental tissue and establishing trophoblast stem cells (TS cells) (Patent Document 1). The inventors have further developed a method for inducing TS cells from pluripotent stem cells (Patent Document 2), and a method for inducing TS cells from trophoblast cells derived from the placenta from the second trimester onward (Patent Document 3).
[0003] Japanese Patent No. 6400832, International Publication No. 2020 / 250438, International Publication No. 2022 / 014028
[0004] Transgenic stem cells (TS cells) are expected to have applications as research materials in basic research, such as the analysis of placental function and the study of early mammalian development. Further applications of TS cells can be expected as the functions of TS cells become clearer.
[0005] Therefore, this disclosure aims to provide a cell activator, a cell activating composition, and a method for producing the cell activator, based on the functions of newly discovered TS cells.
[0006] This disclosure includes the following embodiments: [1] A cell activator comprising at least one selected from the group consisting of trophoblast stem cells and the culture supernatant of trophoblast stem cells. [2] The cell activator according to [1], wherein the cells are vascular endothelial cells. [3] The cell activator according to [2], wherein the cell activator is an angiogenesis promoter. [4] The cell activator according to [1], wherein the cells are endometrial epithelial cells. [5] The cell activator according to [4], wherein the cell activator is an endometrial epithelial proliferation promoter. [6] The cell activator according to any one of [1] to [5], wherein the culture supernatant is the culture supernatant obtained from a culture obtained by culturing the trophoblast stem cells in serum-free medium. [7] The cell activator according to any one of [1] to [6], wherein the culture supernatant is the culture supernatant obtained from a culture obtained by culturing trophoblast stem cells for 1 to 10 days. [8] A cell activating composition comprising the cell activator according to any one of [1] to [7]. [9] The cell-activating composition according to [8], which is a cosmetic.
[10] The cell-activating composition according to [8], which is a hair growth product.
[11] The cell-activating composition according to [8], which is a supplement.
[12] A method for producing a cell activator, comprising the steps of (i) culturing trophoblast stem cells and (ii) obtaining a culture supernatant or the trophoblast stem cells from the culture obtained by the culturing.
[13] The method for producing a cell activator according to
[12] , wherein the culturing in step (i) is carried out in a serum-free medium.
[14] The method for producing a cell activator according to
[12] or
[13] , wherein the culturing in step (i) is carried out for 1 to 10 days.
[0007] This disclosure provides a cell activator, a cell activating composition, and a method for producing the cell activator, based on the functions of newly discovered TS cells.
[0008] This paper analyzes miRNAs contained in exosomes of transcytosis (TS) cells and compares them with miRNAs contained in exosomes of mesenchymal stem cells (MSCs). It shows the relative expression levels of the top 2% of miRNAs with high expression variability between TS cells and MSCs. It also shows the expression patterns of the chromosome 19 miRNA cluster in TS cells (TSCs) and mesenchymal stem cells (MSCs). The paper presents the results of calculating the Ki67 positivity rate of cells in contact with TS cells in endometrial epithelial organoids (EMOs) cultured in Matrigel with TS cells constitutively expressing EGFP (GFP-TS). Finally, it outlines a test schedule for investigating the effects of human TS cell culture supernatant (TS-CM) using a human endometrial model. The paper shows the results of Ki67 expression analysis in endometrial epithelial cells of a human endometrial model cultured with TS-CM. In the figures, "TS-CM" refers to the results in a human endometrial model cultured with TS-CM. In the figures, "EPC" indicates results from a human endometrial model cultured with hormone treatment agents (E2 (10 nM), MPA (1 μM), 8-Bromo-cAMP (50 μM), and prolactin (50 mg / mL)). In the figures, "Control" indicates results from a human endometrial model without hormone treatment agents. The same applies to subsequent figures. The figures show the results of gene expression analysis of genes (FOXA2, FOXO1, GPX3, HSD17B2) that are upexpressed during the implantation phase (meta-secretory phase) in endometrial epithelial cells of a human endometrial model cultured with TS-CM. The figures show the results of gene expression analysis of decidualization markers (PRL, IGFBP1, FOXO1) in endometrial stromal cells of a human endometrial model cultured with TS-CM. The following are fluorescence images of human umbilical vein endothelial cells (HUVECs) cultured in Matrigel with TS-CM added. In the figure, "VEGF" indicates fluorescence images of HUVECs cultured in Matrigel with VEGF added. In the figure, "Control" indicates fluorescence images of HUVECs cultured in Matrigel without the treatment agent added. The following are the results of the analysis of fluorescence images of human umbilical vein endothelial cells (HUVECs) cultured in Matrigel with TS-CM added.
[0009] A numerical range indicated using "~" signifies a range that includes the numbers before and after the "~" as the lower and upper limits, respectively. If multiple upper and lower limits are listed for a particular parameter, any combination of these upper and lower limits can be used to create a suitable numerical range.
[0010] Unless otherwise specified, "a," "an," and "the" encompass both singular and plural forms and are understood to mean "one or more."
[0011] The term "comprise" means that it may include components other than the component being discussed. The term "consist of" means that it does not include components other than the component being discussed. The term "consistently of" means that it does not include components other than the component being discussed in a manner that performs a special function (such as a manner that completely negates the effect of the invention). In this specification, when "comprise" is used, it includes the "consist of" and "consistently of" manners.
[0012] Cells may be isolated. "Isolated" means a state separated from other components. An "isolated" component may be a state separated from its natural state. An "isolated" component may be substantially free of other components. "Substantially free of other components" means that the content of other components in the isolated component is negligible. The content of other components in the isolated component may be, for example, 10% by mass or less, 5% by mass or less, 4% by mass or less, 3% by mass or less, 2% by mass or less, 1% by mass or less, 0.5% by mass or less, or 0.1% by mass or less. In this disclosure, cells may be isolated cells.
[0013] [Cell Activators] A first aspect of the present disclosure is a cell activator. In one embodiment, the cell activator comprises at least one selected from the group consisting of trophoblast stem cells and the culture supernatant of trophoblast stem cells.
[0014] <Trotrophoblast Stem Cells (TS Cells)> TS cells are cells that have the ability to differentiate into cells that make up the placenta. More specifically, TS cells have the ability to differentiate into extravillous trophoblast cells (EVT) and syncytiotrophoblast cells (ST). Differentiation induction tests for EVT and ST can be performed by known methods (for example, Japanese Patent No. 6400832, International Publication No. 2020 / 250438, International Publication No. 2022 / 014028, etc.).
[0015] Positive markers for TS cells include GATA2 (GATA binding protein 2), GATA3 (GATA binding protein 3), TFAP2 (transcription factor AP-2 alpha), ELF5 (E74-like ETS transcription factor 5), and ZNF750 (zinc finger protein 750). Negative markers for TS cells include CDX2 (caudal type homeobox 2). TS cells can be defined as cells that have the ability to differentiate into EVT and ST cells and are positive for at least one (preferably two or more, more preferably three or more, even more preferably four or more, and particularly preferably five) selected from the group consisting of GATA2, GATA3, TFAP2, ELF5, and ZNF750. Alternatively, TS cells can be defined as cells that, in addition to the above, are negative for CDX2. TS cells can also be defined as cells derived from blastocysts, cytotrophoblast cells (CT cells), or pluripotent stem cells that have the ability to differentiate into EVT and ST cells and are positive for at least one selected from the group consisting of GATA2, GATA3, TFAP2, ELF5, and ZNF750, and are negative for CDX2.
[0016] TS cells can be produced by known methods. TS cells may be derived from blastocysts, CT cells, or pluripotent stem cells (iPS cells, ES cells, etc.).
[0017] Methods for inducing TS cells from blastocysts include the following: For example, cells are isolated from placental tissue using appropriate mechanical and / or enzymatic treatments. Subsequently, the cells are cultured in a medium that induces TS cells (e.g., Okae et al. Derivation of Human Trophoblast Stem Cells. Cell Stem Cell (2018), 22(1), 50-63.e6.), and then TS cells can be established using the expression of TS cell markers (GATA2-positive, GATA3-positive, TFAP2-positive, ELF5-positive, ZNF750-positive, CDX2-negative, etc.) as indicators.
[0018] One method for inducing TS cells from CT cells is to culture CT cells in the presence of a growth factor (e.g., epidermal growth factor (EGF)) and a ROCK inhibitor (e.g., Y27632). A specific example of such a method is the method described in Japanese Patent No. 6400832.
[0019] Methods for inducing TS cells from pluripotent stem cells include, for example, culturing pluripotent stem cells in the presence of bone morphogenetic factor 4 (BMP4), and then culturing them in the presence of a growth factor (e.g., epidermal growth factor (EGF)) and a ROCK inhibitor (e.g., Y27632). Alternatively, methods include introducing at least one gene selected from the group consisting of GATA2, GATA3, and TFAP2A into pluripotent stem cells, and then culturing the gene-transformed cells in the presence of a growth factor (e.g., epidermal growth factor (EGF)) and a ROCK inhibitor (e.g., Y27632). Specific methods include, for example, the methods described in International Publication No. 2020 / 250438.
[0020] It is preferable that the species from which the TS cells originate is the same as the species to which the cell activator is applied. For example, when the cell activator is applied to humans or human cells, it is preferable that the TS cells are human TS cells.
[0021] <Culture Medium> The culture medium for TS cells can be any medium capable of maintaining TS cell culture. Examples of culture media include basal media commonly used for culturing animal cells. Basal media may contain components necessary for cell survival, such as amino acids, vitamins, and inorganic salts. Examples of amino acids include glycine, alanine, arginine, asparagine, aspartic acid, cysteine, glutamic acid, glutamine, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tryptophan, tyrosine, and valine. These amino acids may be in the form of salts such as hydrochloride or in the form of saline hydrates. Examples of vitamins include biotin, chorinchloride, calcium pantothenate, folic acid, nicotinamide, para-aminobenzoic acid, pyridoxine, riboflavin, thiamine, vitamin B12, and inositol. These vitamins may be in the form of salts such as hydrochloride or in the form of saline hydrates. Examples of inorganic salts include alkali metal salts such as potassium and sodium; alkaline earth metal salts such as calcium and magnesium; and transition metal salts such as iron, copper, and zinc. Examples of these salts include hydrochloride, nitrate, sulfate, phosphate, hydrogen phosphate, dihydrogen phosphate, carbonate, and bicarbonate. Specific examples of inorganic salts include, but are not limited to, calcium chloride, copper sulfate, iron nitrate, iron sulfate, magnesium chloride, magnesium sulfate, potassium chloride, sodium bicarbonate, sodium chloride, sodium hydrogen phosphate, dihydrogen phosphate, and zinc sulfate. These inorganic salts may also be in the form of hydrates. Other components contained in the basal medium include, for example, sugars such as glucose; peptides such as glutathione; purine derivatives such as hypoxanthine; fatty acids such as linoleic acid; pH indicators such as phenol red; lipoic acid; putrescine; pyruvate; and thymidine.
[0022] Specific examples of basal media include, for example, Doublebecko's modified Eagle's Medium (DMEM) medium, DMEM / F12 medium, Advanced DMEM / F12 medium, IMDM medium, Medium 199 medium, Eagle's Minimum Essential Medium (EMEM) medium, αMEM medium, Ham's F12 medium, RPMI 1640 medium, Fischer's medium, and mixed media of these. A preferred basal medium is, for example, DMEM / F12.
[0023] The culture medium may be a basal medium to which components have been added as appropriate. Examples of components that can be added to the basal medium include serum and serum substitutes. Preferably, the culture medium is a serum-free medium that does not contain serum. Preferably, the culture medium is a basal medium to which a serum substitute has been added. A serum substitute is a substance or composition that is added to the culture medium as a substitute for serum. Preferably, the serum substitute is composed of known components. Preferably, the serum substitute does not contain components derived from other animal species. Other animal species means an animal of a different species from the animal species to which the cell activator is applied. Examples of serum substitutes include albumin, transferrin, sodium selenite, ITS-X (Invitrogen), knockout serum substitute (KSR), N2 supplement (Invitrogen), B27 supplement (Invitrogen), fatty acids, insulin, collagen precursors, trace elements, 2-mercaptoethanol, 3'-thiolglycerol, L-ascorbic acid, and albumin. Serum substitutes may be used individually or in combination of two or more. Preferred serum substitutes include, for example, ITS-X supplement, KSR, L-ascorbic acid, and albumin (such as bovine serum albumin (BSA)).
[0024] The culture medium is preferably a basal medium to which a serum substitute has been added, more preferably a basal medium to which at least one selected from the group consisting of ITS-X supplement, KSR, L-ascorbic acid, and albumin (BSA, etc.) has been added as a serum substitute, and even more preferably a basal medium to which ITS-X supplement, KSR, L-ascorbic acid, and albumin (BSA, etc.) have been added. DMEM / F12 medium is preferably used as the basal medium.
[0025] In addition to the components mentioned above, the culture medium may also contain components such as lipids, Glutamax, growth factors (EGF, FGF, BMP, etc.), kinase inhibitors, signaling inhibitors, signaling activators, antibiotics (penicillin, streptomycin, etc.), antioxidants, pyruvate, and buffers. The culture medium may or may not contain components that induce differentiation of TS cells (e.g., growth factors, kinase inhibitors, signaling inhibitors, signaling activators, differentiation inducers, etc.). The differentiation medium for inducing differentiation from TS cells to EVT may contain growth factors such as Neuregulin (NRG) 1; TGFβ inhibitors such as A83-01; and ROCK inhibitors such as Y27632. The differentiation medium for inducing differentiation from TS cells to ST may contain 2-mercaptoethanol; ROCK inhibitors such as Y27632; and forskolin, etc. It is preferable that the culture medium does not contain components derived from other animals and is xenofree.
[0026] The culture medium may be a basal medium to which serum substitutes, growth factors, ROCK inhibitors, GSK3β inhibitors, p38 MAPK inhibitors, etc., have been added.
[0027] <<Growth Factors>> Growth factors are not particularly limited, but examples include epidermal growth factor (EGF), fibroblast growth factor (FGF), and bone morphogenetic protein (BMP).
[0028] EGF binds to EGF receptors (EGFRs) present on the cell surface, inducing EGF signaling and acting as a mitogenic factor. The organism from which EGF originates is not particularly limited, but human EGF is preferred. Human EGF may be recombinant produced by non-human cells. Commercially available EGF can be used. The concentration of EGF in the culture medium is not particularly limited, but can be, for example, 5 to 200 ng / mL. The concentration of EGF in the culture medium is preferably 10 to 150 ng / mL, more preferably 10 to 100 ng / mL, even more preferably 10 to 80 ng / mL, and particularly preferably 10 to 60 ng / mL.
[0029] FGF has a high affinity for heparan sulfate proteoglycans and, together with heparan sulfate proteoglycans, forms a complex with the cell surface FGF receptor (FFFR) to induce FGF signaling and act as a mitogenic factor. The organism from which FGF is derived is not particularly limited, but human FGF is preferred. Human FGF may be a recombinant produced by non-human cells. As FGF, FGF2 (also called bFGF) is preferred, and human FGF2 is more preferred. Commercially available FGF can be used. The concentration of FGF (e.g., FGF2) in the culture medium is not particularly limited, but can be, for example, 5 to 200 ng / mL. The concentration of FGF (e.g., FGF2) in the culture medium is preferably 10 to 150 ng / mL, more preferably 20 to 100 ng / mL, even more preferably 30 to 80 ng / mL, and particularly preferably 40 to 60 ng / mL.
[0030] If the culture medium contains FGF, it may also contain heparin. Heparin has the effect of promoting the activity of FGF. Heparin is preferably in the form of a salt. Examples of heparin salts include salts with alkali metals such as lithium, sodium, and potassium; salts with alkaline earth metals such as calcium, barium, and magnesium; salts with metals such as aluminum, zinc, copper, and iron; ammonium salts; salts with organic bases; and salts with amino acids. Commercially available heparin can be used. The concentration of heparin in the culture medium is not particularly limited, but can be, for example, 0.001 to 10 μg / mL. The concentration of heparin in the culture medium is preferably 0.005 to 5 μg / mL, more preferably 0.01 to 3 μg / mL, even more preferably 0.05 to 1 μg / mL, and particularly preferably 0.07 to 0.5 μg / mL.
[0031] BMP is a protein belonging to the transforming growth factor β (TGFβ) superfamily, which regulates the induction of cell death, cell differentiation, etc. The organism from which BMP originates is not particularly limited, but human BMP is preferred. Human BMP may be recombinant produced by non-human cells. BMP4 is preferred as the BMP, and human BMP4 is more preferred. Commercially available BMP can be used. The concentration of BMP (e.g., BMP4) in the culture medium is not particularly limited, but can be, for example, 5 to 200 ng / mL. The concentration of BMP (e.g., BMP4) in the culture medium is preferably 10 to 150 ng / mL, more preferably 20 to 100 ng / mL, even more preferably 30 to 80 ng / mL, and particularly preferably 40 to 60 ng / mL.
[0032] ≪ROCK Inhibitors≫ ROCK (Rho-associated coiled-coil containing protein kinase) inhibitors are substances that inhibit the function of Rho-binding kinase. Examples of ROCK inhibitors include trans-N-(4-pyridyl)-4-(1-aminoethyl)-cyclohexanecarboxamide, 1-(5-isoquinolinylsulfonyl)homopiperazine, or salts thereof. Other examples include small molecule inhibitors such as Fasudil / HA1077, H-1152, and Wf-536, as well as their derivatives. ROCK inhibitors may include antisense nucleic acids, siRNAs, dominant-negative mutants, and expression vectors thereof against ROCK. A commercially available product of trans-N-(4-pyridyl)-4-(1-aminoethyl)-cyclohexanecarboxamide or its salt is Y27632((R)-(+)-trans-N-(4-pyridyl)-4-(1-aminoethyl)-cyclohexanecarboxamide・2HCl・H 2 Examples include O). One type of ROCK inhibitor may be used alone, or two or more types may be used in combination. Y27632 is preferred as the ROCK inhibitor. The concentration of the ROCK inhibitor in the culture medium is not particularly limited, but for example it can be 0.1 to 50 μM, preferably 1 to 20 μM, more preferably 1 to 10 μM, and even more preferably 3 to 8 μM.
[0033] ≪GSK3β Inhibitors≫ GSK (Glycogen Synthase Kinase) 3β inhibitors are substances that inhibit the function of GSK3β, such as its kinase activity (e.g., its phosphorylation ability for β-catenin). Examples of GSK3β inhibitors include 6-[[2-[[4-(2,4-dichlorophenyl)-5-(4-methyl-1H-imidazole-2-yl)-2-pyrimidinyl]amino]ethyl]amino]nicotinonitrile, Kenpaulone, 1-Azakenpaulone, CHIR98014, AR-A014418, and CT9902. 1. CT20026, SB216763, AR-A014418, Lithium, SB415286, TDZD-8, BIO, BIO-acetoxime, (5-methyl-1H-pyrazole-3-yl)-(2-phenylquinazoline-4-yl)amine, Pyridocarbazole-cyclopentadienylruthenium complex, TDZD-8 4-benzyl-2-methyl-1,2,4-thiadiazolidine-3,5-dione, 2-thio(3-iodobenzyl)-5-(1-pyridyl)-[1,3,4]-oxadiazole, OTDZT, alpha-4-dibromoacetophenone, AR-AO 144-18, 3-(1-(3-hydroxypropyl)-1H-pyrrolo[2,3-b]pyridin-3-yl]-4-pyrazine-2-ylpyrrole-2,5-dione; TWSl 19 Pyrrolopyrimidine compound, L803 Examples of small molecule inhibitors include H-KEAPAPPQSpP-NH2 or its myristoylated form; 2-chloro-1-(4,5-dibromothiophen-2-yl)-etanone, SB216763, and SB415286. GSK3β inhibitors may also be antisense nucleic acids, siRNAs, dominant-negative mutants, and their expression vectors against GSK3β. A commercially available example of 6-[[2-[[4-(2,4-dichlorophenyl)-5-(4-methyl-1H-imidazole-2-yl)-2-pyrimidinyl]amino]ethyl]amino]nicotinonitrile is CHIR99021. GSK3β inhibitors may be used individually or in combination of two or more.It is preferable to use CHIR99021 as the GSK3β inhibitor. The concentration of the GSK3β inhibitor in the culture medium is not particularly limited, but can be, for example, 0.1 to 20 μM, preferably 0.2 to 10 μM, more preferably 0.5 to 5 μM, and even more preferably 0.5 to 3 μM.
[0034] ≪p38 MAPK Inhibitors≫ p38 MAPK inhibitors are substances that inhibit the function of p38 MAPK (P38 mitogen-activated protein kinase). Examples of MAPK inhibitors include SB202190 (4-(4-fluorophenyl)-2-(4-hydroxyphenyl)-5-(4-pyridyl)-1H-imidazole), SB203580 (4-[4-(4-fluorophenyl)-2-[4-(methylsulfinyl)phenyl]-1H-imidazole-5-yl]pyridine), VX702 (6-(N-carbamoyl-2,6-difluoroanilino)-2-(2,4-difluorophenyl)pyridine-3-carboxamide), VX745 (5-(2,6-dichlorophenyl)-2-[2,4-difluorophenyl)thio]-6H-pyrimide[ Examples include [1,6-b]pyridazine-6-one), PD169316 (4-(4-fluorophenyl)-2-(4-nitrophenyl)-5-(4-pyridyl)-1H-imidazole), RO4402257 (6-(2,4-difluorophenoxy)-2-{[3-hydroxy-1-(2-hydroxyethyl)propyl]amino}-8-methylpyrido[2,3-D]pyrimidine-7(8h)-one), BIRB796 (1-[5-tert-butyl-2-(4-methylphenyl)pyrazole-3-yl]-3-[4-(2-morpholin-4-ilethoxy)naphthalene-1-yl]urea), etc. p38 MAPK inhibitors may also be antisense nucleic acids, siRNAs, dominant-negative mutants, and their expression vectors against p38 MAPK. The p38 MAPK inhibitor may be used alone or in combination of two or more types. It is preferable to use SB202190 as the p38 MAPK inhibitor. The concentration of the p38 MAPK inhibitor in the culture medium is not particularly limited, but can be, for example, 0.1 to 20 μM, preferably 0.2 to 10 μM, more preferably 0.5 to 5 μM, and even more preferably 0.5 to 3 μM.
[0035] Specific examples of preferred culture media include DMEM / F12 medium, the "basic medium for TS cell culture" used in the examples described later, and ECSY medium.
[0036] <Culturing> The culturing of TS cells can be performed by known methods. The culturing conditions can be those generally used for culturing animal cells. The culturing temperature can be 30 to 40 °C, preferably 35 to 38 °C, and typically 37 °C. 2 The CO₂ concentration can be 2 to 5%, and typically 5%.
[0037] The culture vessel is not particularly limited, and a culture vessel generally used for culturing animal cells can be used. Examples of the culture vessel include a culture flask, a culture dish, a well plate, etc. The culture vessel can be appropriately selected according to the volume of the medium.
[0038] The culturing can be started by seeding TS cells in a medium placed in an appropriate culture vessel. The cell density at the time of seeding TS cells can be, for example, 10 3 to 10 10 cells / mL, and 10 4 to 10 8 cells / mL is preferred.
[0039] The culturing can be either adherent culturing or suspension culturing, but adherent culturing is preferred. When performing adherent culturing, it is preferable to use a culture vessel having a cell-adhesive surface. The surface of the culture vessel (for example, the bottom surface) may be coated with a cell-supporting substrate such as an extracellular matrix (ECM) for the purpose of improving the adhesiveness to TS cells. Examples of the cell-supporting substrate include collagen, gelatin, poly-L-lysine, poly-D-lysine, laminin, fibronectin, etc. Also, commercially available extracellular matrix products such as Matrigel (registered trademark) (Corning Life Science), iMatrix (registered trademark) 511, etc. may be used.
[0040] As the culture period, 1 day or more is preferable, and 2 days or more is more preferable. The upper limit of the culture period is not particularly limited, and the cells may be cultured until confluent. Examples of the culture period include, for example, 1 to 10 days, 2 to 10 days, or 3 to 10 days. A preferable example of the culture period is 2 to 3 days. During the culture period, medium exchange may be performed at intervals of about 1 to 3 days (preferably about 2 to 3 days). The medium used for medium exchange may be the same as or different from the medium before exchange, but it is preferable that they are the same. The medium before medium exchange obtained by medium exchange may be used as the culture supernatant or discarded.
[0041] <Culture supernatant> The culture supernatant of TS cells is the liquid part of the culture obtained by culturing TS cells. The culture supernatant of TS cells does not necessarily have to contain no TS cells and may contain TS cells. The cell concentration of TS cells contained in the culture supernatant of TS cells is, for example, 0 to 10 3 cells / mL, preferably 0 to 10 2 cells / mL, more preferably 0 to 10 cells / mL, even more preferably 0 to 5 cells / mL, even more preferably 0 to 3 cells / mL, and even more preferably 0 to 1 cells / mL. From the viewpoints of quality maintenance and safety, etc., it is preferable that the culture supernatant of TS cells has a low cell concentration of TS cells, and it is more preferable that it does not contain TS cells (0 cells / mL).
[0042] The culture supernatant of TS cells can be obtained from the culture of TS cells. The culture of TS cells may be, for example, a culture obtained by culturing TS cells in a serum-free medium or a culture obtained by culturing TS cells for 1 to 10 days. A preferable example of the culture of TS cells is a culture obtained by culturing TS cells in a serum-free medium for 2 to 3 days. A preferable example of the culture supernatant of TS cells is a culture supernatant obtained from a culture obtained by culturing TS cells in a serum-free medium for 2 to 3 days.
[0043] When TS cells are cultured in adherent culture, the culture supernatant can be obtained by collecting the liquid portion (supernatant) of the culture after removing the adherent cells. The collected culture supernatant may be used as is, or it may be used after removing the TS cells by centrifugation and / or filtration. When centrifugation is performed, for example, centrifugation may be carried out for about 3 to 15 minutes at a centrifugal acceleration of about 300 to 1000 g. Centrifugation is preferably performed at 4°C. When filtration is performed, a 0.22 μm filter can be used. It is preferable to filter the culture supernatant obtained from the TS cell culture after centrifugation. When TS cells are cultured in suspension, the culture supernatant can be obtained by centrifugation of the culture. It is preferable to filter after centrifugation. The conditions for centrifugation and filtration are the same as those described above.
[0044] The culture supernatant of TS cells is preferably stored frozen until use. The storage temperature can be anywhere from -80°C to -20°C, with -80°C being preferred. The culture supernatant of TS cells may also be dried and used as a dried powder. The drying method is not particularly limited, but examples include freeze-drying, vacuum drying, and heat drying. Freeze-drying is preferred as the drying method.
[0045] TS cell exosomes contain a diverse range of miRNAs (see Figure 1). The expression pattern of TS cell miRNAs differs from that of mesenchymal stem cells. Therefore, they contain many miRNAs not found in mesenchymal stem cells. They contain many different types of miRNAs (see Figure 1). In particular, TS cell exosomes contain many miRNAs expressed from the miRNA cluster on chromosome 19 (see Figure 2). The miRNA cluster on chromosome 19 is known to be expressed specifically in the placenta. These miRNAs may be involved in placental formation. Since the miRNAs contained in TS cell exosomes are thought to be released extracellularly during TS cell culture, the culture supernatant of TS cells also contains these miRNAs.
[0046] Transgenic cells (TS) and their culture supernatant possess cell-activating activity. Therefore, TS cells and their culture supernatant can be used as cell activators. It is presumed that the proteins and miRNAs contained in TS cells and their culture supernatant possess cell-activating activity.
[0047] The cells targeted by the cell-activating activity of TS cells and their culture supernatant are not particularly limited, but examples include vascular endothelial cells and endometrial epithelial cells.
[0048] TS cells and their culture supernatant have the activity to enhance the expression of Ki67 (marker of proliferation Ki-67), FOXA2 (forkhead box A2), FOXO1 (forkhead box O1), GPX3 (glutathione peroxide 3), and HSD17B2 (hydroxysteroid 17-beta dehydrogenese 2) in endometrial epithelial cells when brought into contact with them (see Figures 5-7). Ki67 is a proliferative phase marker of the endometrium. FOXA2, FOXO1, GPX3, and HSD17B2 are genes whose expression is upregulated in endometrial epithelial cells during the implantation phase (meta-secretory phase). TS cells and their culture supernatant are presumed to promote the proliferation of endometrial epithelium by enhancing the expression of these genes. Therefore, TS cells and their culture supernatant can be used as endometrial epithelial proliferation promoters. Accordingly, in one embodiment, the present disclosure also provides an endometrial epithelial proliferation promoter comprising at least one selected from the group consisting of trophoblast stem cells and trophoblast stem cell culture supernatant.
[0049] TS cells and their culture supernatant have the activity to promote angiogenesis when brought into contact with vascular endothelial cells (see Figure 9). Therefore, TS cells and their culture supernatant can be used as an angiogenesis promoter. Accordingly, in one embodiment, the present disclosure also provides an angiogenesis promoter comprising at least one selected from the group consisting of trophoblast stem cells and the culture supernatant of trophoblast stem cells.
[0050] The cell activator of this embodiment may contain either TS cells or the culture supernatant of TS cells, or it may contain both.
[0051] <Method of Use> The cell activator of this embodiment may be used in vitro or in vivo. If the TS cells or their culture supernatant have been stored frozen, thaw them before use. The TS cells or their culture supernatant may be used as is, or they may be diluted with a pharmaceutically inert diluent (e.g., sterile purified water, physiological saline, PBS, culture medium used for TS cells, etc.). If the TS cells or their culture supernatant are in the form of a dry powder, they may be dissolved in a pharmaceutically inert solvent (e.g., sterile purified water, physiological saline, PBS, culture medium used for TS cells, etc.) before use.
[0052] The target organism for use of the cell activator is not particularly limited, but it is preferable to use it in mammals. Preferably, it is preferable to use it in placental organisms. Examples of placental organisms include primates (humans, chimpanzees, rhesus monkeys, marmosets, etc.), rodents (mice, rats, hamsters, guinea pigs, etc.), and carnivores (dogs, cats, weasels, etc.). The target organism is preferably primates, and more preferably humans. The cell activator may be used in living organisms or in cells.
[0053] When used as an endometrial epithelial proliferation promoter, the cell activator may be used in assisted reproductive technology. "Assisted reproductive technology" refers to treatments or methods performed to achieve pregnancy. Examples of assisted reproductive technology include methods involving embryo transfer. When the cell activator of this embodiment is used as an endometrial epithelial proliferation promoter, it can be used, for example, to proliferate the endometrial epithelium before embryo transfer. The endometrial epithelial proliferation promoter may be injected into the uterine cavity of the target patient before embryo transfer. The endometrial epithelial proliferation promoter injected into the uterus comes into contact with the endometrial epithelium and promotes the proliferation of the endometrium. This makes it possible to control the intrauterine environment to a state suitable for embryo transfer.
[0054] When used as an angiogenesis promoter, cell activators may be used for purposes such as hair growth, wound healing, and skin regeneration. They may also be added to cosmetics, hair products, supplements, etc. Cell activators can impart cell-activating effects to these products.
[0055] [Cell Activation Composition] A second aspect of the present disclosure is a cell activation composition. The cell activation composition contains the cell activator according to the first aspect as an active ingredient.
[0056] The cell activation composition of this embodiment may contain other components besides the cell activator (TS cells, culture supernatant of TS cells) according to the first embodiment. Other components include, for example, pharmaceutically acceptable carriers. "Pharmacologically acceptable carrier" means a carrier that does not inhibit the physiological activity of the active ingredient and does not exhibit substantial toxicity to the recipient. "Substantial toxicity" means that the ingredient does not exhibit toxicity to the recipient at the dose in which it is normally used. In the cell activation composition of this embodiment, the pharmaceutically acceptable carrier is a carrier that does not inhibit the cell activation activity of the cell activator according to the first embodiment and does not exhibit substantial toxicity to the recipient. The pharmaceutically acceptable carrier includes all known pharmaceutically acceptable components that are typically considered inactive components. Pharmaceutically acceptable carriers are not particularly limited, but examples include solvents, diluents, vehicles, excipients, flow promoters, binders, granulators, dispersants, suspending agents, wetting agents, lubricants, disintegrants, solubilizers, stabilizers, emulsifiers, and fillers. Pharmaceutically acceptable carriers may be used individually or in combination of two or more types.
[0057] The cell-activating composition may contain other components in addition to the above components. The other components are not particularly limited, and any components commonly used in the pharmaceutical field may be used without particular restriction. Examples of other components include pharmaceutical excipients other than those mentioned above. Examples of pharmaceutical excipients include, but are not limited to, preservatives (e.g., antioxidants), chelating agents, flavoring and odor-modifying agents, sweeteners, thickeners, buffering agents, and coloring agents. The cell-activating composition may contain the active ingredient of the cell activator according to the first embodiment. Examples of the active ingredient include, but are not limited to, other antiviral agents, antibiotics, anti-inflammatory agents, antipyretics, analgesics, etc.
[0058] The dosage form of the cell-activating composition is not particularly limited and can be any dosage form commonly used in pharmaceutical preparations. The cell-activating composition of this embodiment may be an oral preparation or a parenteral preparation, but a parenteral preparation is preferred. Examples of oral preparations include tablets, coated tablets, pills, powders, granules, capsules, syrups, fine granules, liquids, drops, emulsions, etc. Examples of parenteral preparations include injections, suppositories, nasal sprays, vaginal preparations, enteral preparations, inhalants, etc. Cell-activating compositions of these dosage forms can be formulated according to standard methods (for example, methods described in the Japanese Pharmacopoeia).
[0059] The cell-activating composition can administer a therapeutically effective amount of the cell activator according to the first embodiment. "Therapeutically effective amount" means the amount of drug that is effective for treating or preventing the target disease. For example, the therapeutically effective amount of the cell activator may be an amount effective for cell activation. The therapeutically effective amount may be, for example, 0.01 to 1 mL / individual or 0.05 to 0.5 mL / individual as the dose of the culture supernatant of TS cells. Alternatively, the therapeutically effective amount may be, for example, 0.01 to 1 mg / individual or 0.05 to 0.5 mg / individual as the dose of TS cells.
[0060] The cell-activating composition may be administered as a single dose or as a repeated dose. For example, the cell-activating composition may be administered only once, 1 to 5 days, more preferably 2 to 4 days, before embryo transfer.
[0061] The cell-activating composition of this embodiment may be a cosmetic, a hair growth product, a supplement (health food), etc. Examples of cosmetics include, but are not limited to, basic cosmetics such as lotions, emulsions, creams, gels, sunscreens, packs, masks, and serums; makeup cosmetics such as foundations, makeup bases, lipsticks, lip glosses, and blushes; cleansing products such as facial washes, body shampoos, and cleansing agents; hair cosmetics such as shampoos, rinses, hair conditioners, treatments, and hair styling products; and body cosmetics such as body powders and body lotions. "Hair growth products" refers to hair care products used for hair growth, hair nourishment, and / or hair loss prevention. Examples of hair growth products include, but are not limited to, hair growth agents, hair growth agents, hair tonics, hair loss prevention agents, hair growth or hair growth shampoos, hair growth or hair growth rinses, hair growth or hair growth treatments, etc. Examples of supplements include, but are not limited to, fatigue recovery supplements, etc.
[0062] The cell-activating composition of this embodiment may also be a composition for promoting endometrial epithelial proliferation. The endometrial epithelial proliferation composition can be injected into the uterus before embryo transfer or the like to promote the proliferation of endometrial epithelium.
[0063] The cell-activating composition of this embodiment may also be an angiogenesis-promoting composition. The angiogenesis-promoting composition can be used to promote angiogenesis for purposes such as wound healing, skin regeneration, and hair growth.
[0064] The target animals for use of the cell-activating composition are not particularly limited, but it is preferable to use it in mammals. Preferably, it is preferable to use it in placental animals. Examples of placental animals include primates (humans, chimpanzees, rhesus monkeys, marmosets, etc.), rodents (mice, rats, hamsters, guinea pigs, etc.), and carnivores (dogs, cats, weasels, etc.). The target animals are preferably primates, and more preferably humans.
[0065] [Method for producing a cell activator] A third aspect of this disclosure is a method for producing a cell activator. The production method includes (i) a step of culturing trophoblast stem cells, and (ii) a step of obtaining a culture supernatant or the trophoblast stem cells from the culture obtained by the culturing. The production method of this embodiment can be used to produce a cell activator according to the first aspect.
[0066] <Step (i)> Step (i) can be carried out as described in the [Cell Activator] section above. It is preferable to carry out Step (i) in serum-free medium. The culture period in Step (i) can be 1 to 10 days.
[0067] <Step (ii)> Step (ii) can be carried out as described in the section on [Cell Activator] above. For example, the culture supernatant or TS cells can be obtained from the TS cell culture by centrifugation and filtration.
[0068] <Optional Steps> The manufacturing method of this embodiment may include optional steps in addition to the steps described above. Optional steps include, for example, a step of cryopreserving TS cells or their culture supernatant. Examples of cryopreservation temperatures include -80°C to -20°C, with -80°C being preferred. The optional step may also be a step of drying the TS cells or their culture supernatant to obtain a dried powder. Drying methods include freeze-drying, vacuum drying, and heat drying.
[0069] [Other Embodiments] In one embodiment, the Disclosure provides a method for proliferating endometrial epithelium, comprising the step of injecting at least one selected from the group consisting of TS cells and the culture supernatant of TS cells into the uterine cavity of a subject to be embryo-transferred, prior to embryo transfer. In one embodiment, the Disclosure provides a method for promoting angiogenesis, comprising the step of contacting vascular endothelial cells with at least one selected from the group consisting of TS cells and the culture supernatant of TS cells. In one embodiment, the Disclosure provides a method for cell activation, comprising the step of contacting cells with at least one selected from the group consisting of TS cells and the culture supernatant of TS cells.
[0070] In one embodiment, the disclosure provides the use of at least one selected from the group consisting of TS cells and the culture supernatant of TS cells in the manufacture of a cell activator. In one embodiment, the disclosure provides the use of at least one selected from the group consisting of TS cells and the culture supernatant of TS cells in the manufacture of a pharmaceutical composition for cell activators. The cell activator may be an endometrial epithelial proliferation promoter or an angiogenesis promoter. The pharmaceutical composition for cell activators may be a pharmaceutical composition for promoting endometrial epithelial proliferation or an angiogenesis promoter.
[0071] In one embodiment, the disclosure provides at least one selected from the group consisting of TS cells and TS cell culture supernatants used for cell activation. In one embodiment, the disclosure provides at least one selected from the group consisting of TS cells and TS cell culture supernatants used for promoting the proliferation of endometrial epithelium. In one embodiment, the disclosure provides at least one selected from the group consisting of TS cells and TS cell culture supernatants used for promoting angiogenesis.
[0072] In one embodiment, the disclosure provides a use for cell activation of at least one selected from the group consisting of TS cells and TS cell culture supernatants. In one embodiment, the disclosure provides a use for promoting the proliferation of endometrial epithelium of at least one selected from the group consisting of TS cells and TS cell culture supernatants. In one embodiment, the disclosure provides a use for promoting angiogenesis of at least one selected from the group consisting of TS cells and TS cell culture supernatants.
[0073] The present invention will be described below with reference to examples, but the present invention is not limited to the following examples.
[0074] <Method> 1. Culture of human TS cells The maintenance culture of human TS cells and induction of differentiation into ST cells were performed according to a previously reported method (Okae et al. Derivation of Human Trophoblast Stem Cells. Cell Stem Cell (2018), 22(1), 50-63.e6.). Also, in order to track during co-culture with endometrial epithelial organoids, a cell line that constantly expresses EGFP (Enhanced Green Fluorescent Protein) was used.
[0075] 2. Obtaining human TS cell culture supernatant (TS-CM) 1 μL / well of i-Matrix (registered trademark) 511 (Nippi Co., Ltd.) was placed in the wells of a 6-well flat-bottom well plate (IWAKI microplate, AGC Techno Glass Co., Ltd.) and allowed to stand for 10 minutes. Thereby, the inner wall of the well was coated with i-Matrix. The coated well plate was filled with 2 mL / well of the basal medium of the TS cell medium or DMEM / F-12 medium. Human TS cells were seeded at a cell density of 1x10 5 cells / well and adherently cultured at 37 °C and 5% CO 2 concentration for 2 or 3 days, and then washed with PBS. Thereafter, the medium was replaced with ECSY medium and cultured at 37 °C and 5% CO 2 concentration for 3 days. Thereafter, the supernatant was collected, centrifuged at 500 g for 5 minutes, and the centrifuged supernatant was passed through a 0.22 μm filter and stored at -80 °C until use.
[0076] The composition of the basal medium for TS cell culture (TS basal medium) is as follows: DMEM / F-12 (Life Technologies) supplemented with 1% ITS-X supplement (FUJIFILM Wako), 0.15% bovine serum albumin (BSA) (FUJIFILM Wako), 1% Knockout Serum Replacement (KSR, Thermo Fisher Scientific), 200 mM L-ascorbic acid (FUJIFILM Wako), 5,000 units / mL penicillin, and 5,000 μg / mL streptomycin
[0077] The composition of the ESCY medium is as follows: DMEM / F-12 (Life Technologies) supplemented with 1% ITS-X supplement, 0.15% BSA (FUJIFILM Wako), 1% Knockout Serum Replacement (KSR, Thermo Fisher Scientific), 200 mM L-ascorbic acid (FUJIFILM Wako), 50 ng / ml EGF, 2 μM CHIR99021, 2 μM SB202190, and 10 μM Y27632
[0078] 3. Culture of Human Endometrial Epithelial Organoids The establishment of endometrial epithelial organoid cultures was carried out according to previously reported methods (Turco et al. Long-term, hormone-responsive organoid cultures of human endometrium in a chemically defined medium. Nature Cell Biology (2017) 19(5), 568-577.). Decidual tissue from aborted fetal specimens of women 6-8 weeks pregnant who gave their consent was finely chopped and immersed in an enzyme solution (collagenase V / dispase II), reacting with shaking at 37°C for 1 hour. Subsequently, the cell fraction trapped in a cell strainer (100 μm) was embedded in Matrigel and cultured. The culture medium was changed every 2-3 days. For subculturing, the organoids were detached from the culture plate using TS cell medium basal medium and fragmented by pipetting. The fragmented organoids were diluted, embedded in Matrigel, and subculturised.
[0079] 4. Preparation of a human endometrial model. Fragmented human endometrial epithelial organoids were suspended in a substrate mixture of collagen gel and Matrigel® (Corning) (collagen gel:Matrigel = 7:3 (volume ratio)). Droplets of the suspension were allowed to stand in a 48-well plate for 30 minutes to solidify, and then cultured in ESCY medium for 7-8 days. Subsequently, estradiol (E) was added. 2 After adding (10 nM) and culturing for another 2 days, E 2 (10 nM), medroxyprogesterone acetate (MPA) (1 μM), and 8-Bromo-cAMP (50 μM) were added, and maturation was carried out.
[0080] 5. Immunostained cells and organoids were fixed with 4% paraformaldehyde (PFA), washed with PBS, and then nonspecific reactions were blocked for 1 hour with PBS containing 5% normal goat serum and 0.3% Triton X-100. Primary antibodies were then added, and the cells were incubated overnight at 4°C. After staining with fluorescently labeled secondary antibodies (Cell Signaling) and Hoechst 33342 (Dojin Chemical). Observations were performed using an all-in-one fluorescence microscope BZ-X810 (Keyence) and a confocal laser scanning microscope LSM 710 (Carl Zeiss).
[0081] 6. RNA was extracted and purified from cells and organoids using the Quantitative Real-Time RT-PCR RNeasy Mini Kit (QIAGEN). cDNA was prepared using PrimeScript II (Takara Bio), and real-time PCR reactions were performed using StepOnePlus Real-Time PCR System (Applied Biosystems) and TB Green Premix Ex Taq™ II (Takara Bio).
[0082] The sequence of primers used is shown below. FOXA2 Fw: GGAGCAGCCTACTATGCAGAGC (Sequence No. 1) Rv: CGTGTTCCATGCCGTTTCC (Sequence No. 2) FOXO1 Fw: GGATGTGCATTCTATTGGTGTACC (Sequence No. 3) Rv: TTTCGGGATTGCTTATTCCAGAAC (Sequence No. 4) GPX3 Fw: TCTGGGTCATTCTGGGCTTTTC (Sequence No. 5) Rv: TCTCCATTTGACATCCCTTTC (Sequence No. 6) HSD17B2 Fw: TCTTCTCCGGTGTCATGCTTCC (Sequence No. 7) Rv: CAAAAACTCCGGCAAAAATACCGT (Sequence No. 8) PRL Fw: GGAGCAAGCCCAACAGATGAA (Sequence No. 9) Rv: GGCTCATTCCAGGATCGCAAT (Sequence No. 10) IGFBP1 Fw: TTGGGAACGCCATCAGTACCTA (Sequence No. 11) Rv: TTGGCTAAACTCTCTACGACTCT (Sequence No. 12) GAPDH Fw: CCTCCAACGACCACTTTGTCAAG (Sequence No. 13) Rv: TCTTCCTCTTGTGCTCTTTG (Sequence No. 14)
[0083] 7. RNA-sequencing RNA was extracted and purified from cells and organoids using the RNeasy Mini Kit (QIAGEN), and then genomic DNA was digested using DNase I (QIAGEN). The RNA library was NEBNext® Ultra. TMThe dataset was prepared using the II Directional RNA Library Prep Kit (New England Biolabs), and 150 bp paired-end reads were read on the Illumina NovaSeq 6000 platform (Illumina) to obtain sequence data. The sequenced data was trimmed using TrimGalore and aligned to the reference genome (UCSC hg38) using STAR. Gene expression levels (TPM) were calculated using RSEM. Differently expressed genes were extracted using DESeq2 software. GO term analysis was performed using clusterProfiler.
[0084] 8. miRNA analysis of exosomes After obtaining the culture supernatant of human TS cells using the same method as in "2. Acquisition of human TS cell culture supernatant (TS-CM)", nucleic acids were extracted using exoRNeasy kit (QIAGEN), and a library was prepared using NEBNext® Multiplex Small RNA Library Prep Kit for Illumina. The base sequence was then obtained using a next-generation sequencer (Illumina NovaSeq 6000) under conditions of 100 bp single-ended, 10 M reads / sample.
[0085] 9. Evaluation of angiogenic capacity 10 μL of Matrigel was packed into each well of μ-Slide Angiogenesis ibiTreat 15 wells (ibidi), and after gelling at 37°C, 10 4 HUVEC was suspended in 50 μL of EGM-2 medium (Lonza) and seeded. Adhesion of HUVEC to Matrigel was confirmed between 30 and 60 minutes after seeding. Next, 50 μL of TS-CM and 50 μL of ESCY medium containing 100 ng / mL of VEGF, or 50 μL of ESCY medium, were added to each well. After adding the medium, images were acquired over time using an all-in-one fluorescence microscope BZ-X810 (Keyence). Each image was quantified using Angiogenesis Analyzer for ImageJ.
[0086] <Results> 1. miRNA analysis of TS cells The miRNAs contained in the exosomes of TS cells were analyzed and compared with the miRNAs contained in the exosomes of mesenchymal stem cells (MSCs). Figure 1 shows the relative expression levels of the top 2% of miRNAs with high expression fluctuations between TS cells and MSCs. It was confirmed that the miRNA expression pattern in TS cells (TSCs) differs from the miRNA expression pattern in MSCs.
[0087] Figure 2 shows the expression patterns of the chromosome 19 miRNA cluster in transgenic stem cells (TSCs) and mesenchymal stem cells (MSCs). It was confirmed that TS cell exosomes contain a large amount of miRNA derived from the chromosome 19 miRNA cluster. The chromosome 19 miRNA cluster is known to be expressed specifically in the placenta.
[0088] 2. Evaluation of the endometrial proliferation-promoting activity of TS cells TS cells constitutively expressing EGFP (GFP-TS) and endometrial epithelial organoids (EMOs) were mixed cultured in Matrigel at 37°C for 5 days. Immunostaining was performed using anti-Ki67 antibody as the primary antibody. Observation was performed using a fluorescence microscope, and the Ki67 positivity rate was calculated for cells in contact with TS cells.
[0089] The results are shown in Figure 3. "Control" refers to EMOs cultured without the addition of GFP-TS. It was confirmed that endometrial epithelial cells that came into contact with TS cells showed an increased Ki67 positivity rate. Ki67 is a marker gene for the proliferative phase of endometrial epithelial cells. From the results shown in Figure 3, it was confirmed that TS cells have the ability to induce the proliferation of endometrial epithelial cells.
[0090] 3. Evaluation of TS-CM's Endometrial Proliferation-Promoting Activity A human endometrial model was prepared using the method described in "4. Preparation of Human Endometrial Model" above, and the effects of TS-CM treatment were investigated. Figure 4 shows the test schedule. The human endometrial model was cultured in 0.5 mL of ESCY medium at 37°C. 0.5 μL of TS-CM was added on the first day of culture (Day 0) and on the second day after the start of culture (Day 2). On the fifth day after the start of culture (Day 5), cells were harvested, and quantitative real-time RT-PCR was performed using the method described in "6. Quantitative Real-Time RT-PCR" above.
[0091] Figure 5 shows the expression analysis results for MKI67 (protein name: Ki67), a proliferation phase marker for endometrial epithelial cells, in human endometrial epithelial cells. "Control" shows the results in a human endometrial model without the addition of treatment agents. "EPC" is EPCP (E) instead of TS-CM. 2 The results are shown for human endometrial models treated with (10 nM), MPA (1 μM), 8-Bromo-cAMP (50 μM), and prolactin (50 mg / mL). TS-CM treatment increased Ki67 expression.
[0092] Figure 6 shows the results of gene expression analysis of genes (FOXA2, FOXO1, GPX3, HSD17B2) whose expression is upregulated during the implantation phase (meta-secretory phase) in human endometrial epithelial cells. TS-CM treatment increased the expression of all four genes: FOXA2, FOXO1, GPX3, and HSD17B2.
[0093] Figure 7 shows the expression analysis results of decidualization markers (PRL, IGFBP1, FOXO1) in human endometrial stromal cells. In human endometrial models treated with TS-CM, IGFBP1 expression was elevated compared to Control and EPC treatments. On the other hand, PRL expression was elevated in EPC treatment compared to Control, but decreased in TS-CM treatment. PRL expression was elevated in EPC treatment compared to Control, but did not change significantly in TS-CM treatment.
[0094] 4. Evaluation of TS-CM's angiogenesis-inducing ability Human umbilical vein endothelial cells (HUVECs) were cultured on Matrigel containing 50 μL / well of TS-CM at 37°C for 48 hours. Fluorescence images of the cultured HUVECs were obtained using a fluorescence microscope. These fluorescence images were quantitatively analyzed using Angiogenesis Analyzer for ImageJ. The number of nodes (vascular branches), the number of segments (vessels between nodes), the length of branches (small vessels branching from the main vessels), the total length of branches, and the area of meshes (areas surrounded by vessels) were measured.
[0095] Figure 8 shows fluorescence images of HUVEC at 18, 24, and 48 hours after the start of culture. "VEGF" indicates HUVEC cultured in Matrigel supplemented with 100 ng / mL of VEGF instead of TS-CM. "Control" indicates HUVEC cultured in ESCY medium. The fluorescence image at 48 hours was used for analysis. VEGF is a protein with angiogenesis-inducing ability and was used as a positive control.
[0096] Figure 9 shows the results of the fluorescence image analysis. TS-CM treatment showed higher values for all analysis parameters compared to Control and VEGF treatment. These results confirm that TS-CM has a higher angiogenesis-inducing ability than VEGF.
[0097] The results above demonstrate that TS cells and TS-CMs possess the ability to induce endometrial epithelial proliferation and angiogenesis. These results confirm that TS cells and TS-CMs have the ability to induce cell proliferation.
[0098] The present invention provides a cell activator, a cell activating composition, and a method for producing the cell activator, based on the newly discovered function of TS cells.
[0099] While preferred embodiments of the present invention have been described above, the present invention is not limited to these embodiments. Additions, omissions, substitutions, and other modifications are possible without departing from the spirit of the invention. The present invention is not limited by the foregoing description, but only by the scope of the appended claims.
Claims
1. A cell activator comprising at least one selected from the group consisting of trophoblast stem cells and the culture supernatant of trophoblast stem cells.
2. The cell activator according to claim 1, wherein the cells are vascular endothelial cells.
3. The cell activator according to claim 2, wherein the cell activator is an angiogenesis promoter.
4. The cell activator according to claim 1, wherein the cells are endometrial epithelial cells.
5. The cell activator according to claim 4, wherein the cell activator is an endometrial epithelial proliferation promoter.
6. The cell activator according to claim 1 or 2, wherein the culture supernatant is obtained from a culture obtained by culturing the trophoblast stem cells in a serum-free medium.
7. The cell activator according to claim 1 or 2, wherein the culture supernatant is obtained from a culture obtained by culturing trophoblast stem cells for 1 to 10 days.
8. A cell-activating composition comprising the cell activator according to claim 1, 2, or 4.
9. The cell-activating composition according to claim 8, which is a cosmetic product.
10. The cell-activating composition according to claim 8, which is a product for hair growth.
11. The cell-activating composition according to claim 8, which is a supplement.
12. A method for producing a cell activator, comprising: (i) a step of culturing trophoblast stem cells; and (ii) a step of obtaining a culture supernatant or the trophoblast stem cells from the culture obtained by the culture.
13. The method for producing a cell activator according to claim 12, wherein the culture in step (i) is carried out in a serum-free medium.
14. A method for producing a cell activator according to claim 12 or 13, wherein the culture in step (i) is carried out for 1 to 10 days.