Antitumor or tumor metastasis-inhibiting composition containing lactobacillus reuteri ATG-f4 strain as active ingredient

WO2026160949A1PCT designated stage Publication Date: 2026-07-30ATOGEN CO LTD +1
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
ATOGEN CO LTD
Filing Date
2026-01-22
Publication Date
2026-07-30

Smart Images

  • Figure KR2026095022_30072026_PF_FP_ABST
    Figure KR2026095022_30072026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to a composition for combined administration, comprising a Lactobacillus reuteri ATG-F4 strain deposited under accession number KCTC13717BP and a chemotherapeutic agent. The combined administration of the strain and the chemotherapeutic agent was confirmed to significantly inhibit the metastasis of a tumor such as colon cancer or pancreatic cancer and reduce the growth of the tumor itself, as compared to a group treated with the chemotherapeutic agent alone. This result demonstrates that the Lactobacillus reuteri ATG-F4 strain of the present invention can be effectively used as an anticancer adjuvant, a metastasis-inhibiting adjuvant or the like for chemotherapeutic agents.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for anti-tumor or tumor metastasis inhibition containing Lactobacillus reuteri ATG-F4 strain as an active ingredient

[0001] The present invention relates to a composition for anti-tumor or tumor metastasis inhibition characterized by containing the Lactobacillus reuteri ATG-F4 strain deposited under accession number KCTC13717BP as an active ingredient.

[0002]

[0003] Cancer, a malignant tumor that threatens human health, ranks first or second globally as a cause of death and is the most common cause of death in Western societies, second only to cardiovascular disease. Lung cancer is on the rise due to the aging population, increased smoking rates, and air pollution in modern society. Furthermore, colorectal, pancreatic, breast, and prostate cancers are on a continuous upward trend due to the consumption of high-fat diets resulting from the Westernization of dietary habits, increased exposure to environmental pollutants, and increased alcohol consumption. Therefore, there is an urgent need to create anticancer substances that can enable the early prevention and treatment of cancer, thereby contributing to the improvement of human health, the enhancement of the quality of a healthy life, and the advancement of public health.

[0004] The commonly used anticancer drugs are cytotoxic agents that exert their anticancer effects through a mechanism in which they directly attack and kill cancer cells. Major mechanisms of action include the induction of DNA damage, inhibition of cell division, and metabolic antagonism. These anticancer effects are confirmed by changes in apoptosis factors (BAX, Caspase-3 fragment) and tumor growth factors (AKT, ERK1 / 2, MEK1, COX-2).

[0005] Meanwhile, cancer cells detach from the primary site and migrate to other organs via blood vessels or lymphatic vessels to form new tumors; this process is called tumor metastasis. This process is divided into several stages—local invasion, intravascular invasion, circulation, and establishment at the metastatic site—each stage being regulated by the interactions of various molecules and cells. IL-6 and TGF-β are cytokines involved in inflammation and immune responses that play important roles in the tumor microenvironment. They are involved in promoting metastasis by regulating the behavior of cancer cells at various stages of metastasis. IL-6 promotes the proliferation, survival, invasion, and angiogenesis of cancer cells, and induces epithelial-mesenchymal transition (EMT), thereby increasing the motility and invasiveness of cancer cells. Furthermore, it plays a role in facilitating cancer cell metastasis by promoting the degradation of the extracellular matrix (ECM) and angiogenesis. TGF-β initially exhibits tumor-suppressing effects, but as cancer progresses, it displays tumor-promoting effects and facilitates metastasis through the induction of EMT, promotion of cancer cell invasion and angiogenesis, immunosuppression, and the maintenance of cancer stem cells. IL-6 and TGF-β interact and exhibit synergistic effects, making them important factors that can further promote tumor metastasis. In other words, if either IL-6 or TGF-β is blocked, an anti-metastatic effect capable of inhibiting the metastasis of cancer cells can be expected.

[0006] Furthermore, the regulation of protein expression of Claudin, E-cadherin, and Vimentin is also associated with cancer cell metastasis. Claudin is a protein that forms tight junctions; a decrease in its expression weakens intercellular binding forces, leading to increased invasiveness of cancer cells. E-cadherin is an adhesion protein between epithelial cells, and its reduced expression promotes cell motility and metastasis. Additionally, Vimentin is a mesenchymal cell marker, and increased expression enhances the invasiveness and metastatic ability of cancer cells. Therefore, inhibiting or normalizing changes in the expression of these biomarkers is an important therapeutic strategy that can effectively suppress the progression and metastasis of pancreatic cancer.

[0007] However, conventional cytotoxic chemotherapy carries a high risk of serious side effects, particularly diarrhea, vomiting, dehydration, and bone marrow suppression, which limits its use to only a select group of cancer patients with good general health. Consequently, research into safer and more effective adjuvant or alternative therapies is actively underway.

[0008] Probiotics have long been reported to regulate the balance of intestinal microorganisms and play various useful roles. Accordingly, the present invention was completed by confirming whether Lactobacillus reuteri ATG-F4 regulates the expression of various apoptosis factors and tumor metastasis factors.

[0009]

[0010] [Prior Art Literature]

[0011] [Patent Literature]

[0012] Republic of Korea Registered Patent No. 10-1951919 (Title of Invention: Novel Lactobacillus reuteri ATG-F4 strain having dopamine secretion-enhancing function, composition for the prevention or treatment of mental illness containing the same, Applicant: A2GEN Co., Ltd., Registration Date: 2019.02.19)

[0013] Republic of Korea Registered Patent No. 10-2049700 (Title of Invention: Composition for the Prevention or Treatment of Muscle Diseases Containing Lactobacillus reuteri ATG-F4, Applicant: A2GEN Co., Ltd., Registration Date: November 21, 2019)

[0014]

[0015] The object of the present invention is to provide a composition for anti-tumor or tumor metastasis inhibition characterized by containing the Lactobacillus reuteri ATG-F4 strain deposited under accession number KCTC13717BP as an active ingredient.

[0016]

[0017] The present invention relates to a composition for anti-tumor or tumor metastasis inhibition characterized by containing the Lactobacillus reuteri ATG-F4 strain deposited under accession number KCTC13717BP as an active ingredient.

[0018] The strain may include one or more selected from the group consisting of the cell, the culture of the strain, the extract, concentrate, and dried product of the culture.

[0019] The above strain inhibits the protein expression of the tumor metastasis factor IL-6 receptor (Interleukin-6 receptor) or TGF-β (transforming growth factor-β) and increases the protein expression of the apoptosis factor BAX (Bcl-2 associated X Protein). It also decreases the protein expression of the tumor growth factors p-AKT (p-Akt8 virus transforming kinase target), p-ERK1 / 2 (p-Extracellular signal-regulated kinases 1 / 2), p-MEK1 (p-MAPK / ERK kinase 1), and COX-2 (Cyclooxygenase-2).

[0020] The above strain can increase the expression of the apoptosis factor Caspase-3 fragment protein.

[0021] In addition, the above strain increases the protein expression of the tumor metastasis factors Claudin and E-cadherin, and inhibits the protein expression of Vimentin.

[0022] The above composition is characterized by the co-administration of a chemical anticancer agent. Preferably, the anticancer agent is selected from the group consisting of oxaliplatin, cisplatin, cyclophosphamide, ifosfide, bendamustine, melphalan, carboplatin, busulfan, dacarbazine, temozolomide, fluorouracil, capecitabine, doxifluridine, tegafur, cytarabine, azacitidine, decitamine, enositabine, methotrexate, pemetrexid, pralatrexate, cladribine, cloparabine, fludarabine, mercaptopurine, irinotecan, doxorubicin, daunorubicin, epirubicin, idarubicin, mitoxantrone, etoposide, topotecan, cabazitaxel, paclitaxel, docetaxel, vinblastine, vincristine, vinorelbine, bleomycin, hydroxyurea, and mitomycin C. One or more types may be selected.

[0023] Accordingly, the present invention can provide a pharmaceutical composition for anticancer or antimetastatic use containing the above-mentioned Lactobacillus reuteri ATG-F4 strain and a pharmaceutical excipient.

[0024] In another aspect, the present invention may provide a method for treating cancer using the above composition, and a treatment method for inhibiting the metastasis of cancer using the above composition. This treatment method is intended for humans or mammals other than humans.

[0025]

[0026] The present invention will be described in detail below.

[0027] In the present invention, "culture of a strain" includes a culture medium, such as the culture solution itself cultured in a liquid medium, and the supernatant (filtrate) obtained by filtering and / or centrifuging the culture solution to remove the strain.

[0028] In the present invention, "extracts, concentrates, and dried products of a culture" may undergo centrifugation or filtration processes to remove the liquid culture medium from the culture and recover only the concentrated cells, but the present invention is not limited thereto. Additionally, the concentrated cells may be preserved by drying, freezing, or freeze-drying according to conventional methods so as not to lose their activity.

[0029] The above Lactobacillus reuteri ATG-F4 strain, the cells of the strain, the culture of the strain, the extract, concentrate, and dried product of the culture may be added to the composition of the present invention in an amount of 0.001 to 100 weight%.

[0030] In the present invention, "anticancer chemotherapy" refers to a systemic treatment method that prevents or kills cancer cells by using drugs, namely anticancer agents, for cancer treatment.

[0031] The Lactobacillus reuteri ATG-F4 strain of the present invention may induce an increase in the production of butyric acid (BA). The butyric acid may be produced due to changes in the intestinal microbial flora of an individual administered Lactobacillus reuteri ATG-F4, and preferably may be induced by an increase in the butyric acid bacteria (Butyricicoccus) flora.

[0032] The increase in the production of the above butyric acid is confirmed by changes in blood concentration in the cecum or blood of individuals administered the Lactobacillus reuteri ATG-F4 strain, and the said individuals include humans, mammals other than humans, and any animals capable of developing tumors.

[0033] The expression level of the caspase-3 fragment identified in the present invention is determined by comparing it with the total expression level of the intact caspase-3 protein before fragmentation. This is as disclosed in FIG. 4b. In addition, the caspase-3 fragment protein may be an anticancer-related factor.

[0034] The anticancer agents applied in this invention are cytotoxic chemotherapy agents that exhibit an anticancer effect by directly attacking cancer cells that differentiate more rapidly than normal cells; the types include alkylating agents (oxaliplatin, cisplatin, cyclophosphamide, ifosfide, bendamustine, melphalan, carboplatin, busulfan, dacarbazine, temozolomide), metabolic antagonists (fluorouracil, capecitabine, doxifluridine, tegafur, cytarabine, azacitidine, decitamine, enositabine, methotrexate, pemetrexid, pralatrexate, cladribine, cloparabine, fludarabine, mercaptopurine), DNA rotase inhibitors (irinotecan, doxorubicin, daunorubicin, epirubicin, idarubicin, mitoxantrone, etoposide, topotecan), and microtubules There are inhibitors (carbazitaxel, paclitaxel, docetaxel, vinblastine, vincristine, vinorelbine) and others (bleomycin, hydroxyurea, mitomycin C), and the above chemotherapy drugs have similar enzymatic mechanisms of action, mainly through the inhibition of DNA damage or DNA synthesis.

[0035] The chemical anticancer agents administered in combination with the composition of the present invention may be one or two to five types of combination anticancer agents for each anticancer agent. In addition, the dosage of the anticancer agents is not specifically determined, and the effective concentration may vary depending on the anticancer agents, such as 1~5 mg / kg / day, 2.5~5 mg / kg, 2.5~5 mg / kg / day, 2.5~10 mg / kg / day, 10~25 mg / kg / day, 10~50 mg / kg / day, 10~100 mg / kg / day, 30~100 mg / kg / day, 50~100 mg / kg / day, 10~200 mg / kg / day, 1~200 mg / kg / day, etc.

[0036] In addition, the dosage of the strain is 1.0 x 108 Up to 4.0 x 10 11 CFU ATG-F4 strain / day, more preferably 1.0 x 10 9 Up to 4.0 x 10 10 CFU ATG-F4 strain / day, most preferably 1.0 x 10 10 Up to 4.0 x 10 10 CFU ATG-F4 strain / day may be

[0037] The antitumor composition or anticancer agent of the present invention may be a therapeutic agent targeting the treatment of the following cancers.

[0038] Preferably, the cancer may be a disease selected from the group consisting of colorectal cancer, pancreatic cancer, hemangioma, angiofibroma, lung cancer, non-small cell lung cancer, liver cancer, colon cancer, bone cancer, skin cancer, head cancer, neck cancer, melanoma, uterine cancer, ovarian cancer, rectal cancer, stomach cancer, pro-anal cancer, colon cancer, breast cancer, fallopian tube carcinoma, endometrial carcinoma, cervical carcinoma, vaginal carcinoma, vulvar carcinoma, Hodgkin's disease, esophageal cancer, small intestine cancer, endocrine gland cancer, thyroid cancer, parathyroid cancer, adrenal cancer, soft tissue sarcoma, urethral cancer, penile cancer, prostate cancer, bladder cancer, kidney or ureteral cancer, renal cell carcinoma, renopelvic carcinoma, central nervous system tumor, primary central nervous system lymphoma, spinal cord tumor, brainstem glioma and pituitary adenoma, and is not limited to other cancer diseases.

[0039]

[0040] The composition of the present invention is 1.0 x 10 8 Up to 4.0 x 10 11 Based on the administration of the ATG-F4 strain at CFU / day, more preferably 1.0 x 10 9 Up to 4.0 x 10 10 Based on the administration rate of ATG-F4 strain at CFU / day, most preferably 1.0 x 10 10 Up to 4.0 x 10 10Based on the administration of the ATG-F4 strain at CFU / day, additionally, based on the co-administration of an anticancer drug at 10–100 mg / kg, more preferably based on the co-administration of an anticancer drug at 30–100 mg / kg, and most preferably based on the co-administration of an anticancer drug at 50–100 mg / kg / day, colorectal cancer tumor metastasis is inhibited by more than 81% (see Fig. 2). In addition, when the strain and the anticancer drug are administered in combination, the weight of colorectal cancer tumors is reduced by more than 50% compared to the administration of the anticancer drug alone (see Fig. 3).

[0041] Meanwhile, under these conditions, compared to the administration of the anticancer drug alone, BAX protein expression increased 3.5 to 5.5 times in the group administered in combination with the anticancer drug and the ATG-F4 strain, and Caspase-3 fragment protein increased 3.0 to 8.5 times. Phosphorylation of AKT decreased by 65 to 95% in the group administered in combination with the ATG-F4 strain compared to the administration of the anticancer drug alone, which is a result that is significantly suppressed compared to the values ​​in the tumorigenetic group. Under the same criteria, phosphorylation of ERK and MEK was suppressed by 45 to 70% in the group administered in combination with the ATG-F4 strain compared to the group administered with the anticancer drug alone, and expression of COX2, IL-6 receptor, and TGF-β was suppressed by 40 to 70% in the group administered in combination with the ATG-F4 strain compared to the group administered with the anticancer drug alone.

[0042]

[0043] In the present invention, 1.0 x 10 8 Up to 4.0 x 10 11 Based on the administration of the ATG-F4 strain at CFU / day, more preferably 1.0 x 10 9 Up to 4.0 x 10 10 Based on the administration rate of ATG-F4 strain at CFU / day, most preferably 1.0 x 10 10 Up to 4.0 x 10 10Based on the administration of the ATG-F4 strain at CFU / day, and additionally based on the combination administration of an anticancer drug at 1–200 mg / kg / day, pancreatic cancer tumor weight is reduced by 60–90% compared to the administration of the anticancer drug alone. In addition, pancreatic cancer tumor metastasis is almost entirely suppressed (approaching 0%).

[0044] In addition, compared to the administration of the anticancer drug alone, the Caspase-3 fragment protein increased 1.7 to 2.0 times when the ATG-F4 strain was administered in combination with the anticancer drug. The Claudin protein increased 2.0 to 2.5 times in the group administered in combination with the ATG-F4 strain compared to the group administered with the anticancer drug alone, which is a significantly higher increase than the value in the tumorigenetic group. Under the same criteria, the E-cadherin protein increased 2.0 to 2.5 times in the group administered in combination with the ATG-F4 strain compared to the group administered with the anticancer drug alone, and the expression of Vimentin was inhibited by 70 to 80% in the group administered in combination with the ATG-F4 strain compared to the group administered with the drug alone.

[0045]

[0046] In an embodiment of the present invention, a process is presented in which anticancer or tumor metastasis-inhibiting efficacy is exerted through anticancer chemotherapy in which Lactobacillus reuteri ATG-F4 and an anticancer agent are administered in combination.

[0047] To this end, first, oral administration of Lactobacillus reuteri ATG-F4 and the combination anticancer drug FOLFOX (Oxaliplatin, 5-Fluorouracil, Leucovorin) to mice induced with colorectal cancer inhibits the growth of colorectal cancer tumors, inhibits tumor metastasis, and also inhibits the growth of metastatic tumors.

[0048] Next, secondly, oral administration of Lactobacillus reuteri ATG-F4 and the combination anticancer agent of FOLFIRINOX (Oxaliplatin, 5-Fluorouracil, Leucovorin, Irinotecan) or GnP (Gemcitabine, Nab-paclitaxel) to mice with induced pancreatic cancer inhibits the growth of pancreatic cancer tumors, inhibits tumor metastasis, and also inhibits the growth of metastatic tumors.

[0049] Accordingly, the present invention suggests that the use of the above-mentioned combination anticancer agent, that is, the simultaneous use of two or more agents along with the administration of Lactobacillus reuteri ATG-F4, is effective in inhibiting anticancer or tumor metastasis.

[0050]

[0051] Although anticancer or anti-metastatic efficacy is confirmed upon administration of existing anticancer drugs, there are limitations in that cytotoxic anticancer drugs cannot inhibit the growth of cancer cells or completely suppress metastasis. However, the present invention demonstrates that when Lactobacillus reuteri ATG-F4 is administered in combination with the aforementioned anticancer drug, the expression of apoptosis-related proteins increases, while proteins related to tumor growth / proliferation and tumor metastasis decrease, thereby reducing or decreasing tumor growth. Consequently, Lactobacillus reuteri ATG-F4 acts as a 'booster,' 'enhancer,' or 'amplifier' that promotes or enhances the anticancer or anti-metastatic efficacy of the existing anticancer drug. This indicates that the strain of the present invention can be applied to various individuals that have developed resistance to various anticancer drugs.

[0052]

[0053] In addition, the present invention provides a pharmaceutical composition for anticancer or antimetastatic use containing the Lactobacillus reuteri ATG-F4 strain and a pharmaceutical excipient. The composition derived from the Lactobacillus reuteri ATG-F4 strain may be added to the pharmaceutical composition of the present invention in an amount of 0.001 to 100.0 weight%, preferably 0.001 to 30.0 weight%.

[0054] The above pharmaceutical composition may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, as well as external preparations, suppositories, and sterile injectable solutions, according to conventional methods. Carriers, excipients, and diluents that may be included in the above pharmaceutical composition may include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. When formulating, the product is prepared using diluents or excipients such as commonly used fillers, volume expanders, binders, humectants, disintegrants, and surfactants. Solid dosage forms for oral administration include tablets, pills, powders, granules, and capsules; these solid dosage forms are prepared by mixing at least one excipient, such as starch, calcium carbonate, sucrose or lactose, or gelatin, with the extract of the present invention. In addition to simple excipients, lubricants such as magnesium stearate and talc are also used. Liquid dosage forms for oral administration include suspensions, liquids, emulsions, and syrups; in addition to commonly used simple diluents such as water and liquid paraffin, various excipients, such as humectants, sweeteners, flavorings, and preservatives, may be included. Preparations for parenteral administration include sterile aqueous solutions, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, and suppositories. As non-aqueous solvents and suspending agents, propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate may be used. As bases for suppositories, Witepsol, Macrogol, Tween 61, cocoa paste, laurin paste, glycerogelatin, etc. may be used.

[0055] The dosage of the pharmaceutical composition of the present invention will vary depending on the age, gender, and weight of the subject to treatment, the specific disease or pathological condition to be treated, the severity of the disease or pathological condition, the route of administration, and the judgment of the prescriber. The determination of the dosage based on these factors is within the level of a person skilled in the art and is generally in the range of 0.01 mg / kg / day to approximately 2000 mg / kg / day. A more preferred dosage is 1 mg / kg / day to 500 mg / kg / day. It may be administered once a day or divided into several doses. The above dosage does not limit the scope of the present invention in any way.

[0056] The pharmaceutical composition of the present invention can be administered to mammals, such as rats, livestock, and humans, via various routes. Any mode of administration is expected, for example, by oral, rectal or intravenous, intramuscular, subcutaneous, intrauterine, dura mater, or intracerebrovascular injection. Since the composition of the present invention has minimal toxicity and side effects, it is a drug that can be safely used for long-term preventive purposes.

[0057]

[0058] The present invention relates to a composition for combined administration comprising the Lactobacillus reuteri ATG-F4 strain deposited under accession number KCTC13717BP and a chemical anticancer agent, and it is confirmed that tumor metastasis is significantly inhibited and the growth of the tumor itself is reduced through the combined administration of the strain and the anticancer agent.

[0059] In addition, in colorectal cancer and metastatic tissues, compared to the group treated with the anticancer drug alone, the expression of IL-6 receptor (Interleukin-6 receptor) and TGF-β (transforming growth factor-β) is suppressed in the group treated with the combination of the anticancer drug and the Lactobacillus reuteri ATG-F4 strain, the expression of BAX (Bcl-2 associated X Protein) and Caspase-3 fragment proteins is increased, and the expression of proteins such as p-AKT (p-Akt8 virus transforming kinase target), p-ERK1 / 2 (p-Extracellular signal-regulated kinases 1 / 2), p-MEK1 (p-MAPK / ERK kinase 1), and COX-2 (Cyclooxygenase-2) is decreased. In pancreatic cancer and metastatic tissues, compared to the anticancer drug alone, the expression of caspase-3 fragment, claudin, and E-cadherin is further increased in the group treated with the combination of the anticancer drug and the Lactobacillus reuteri ATG-F4 strain, and the efficacy of inhibiting the expression of vimentin is enhanced.

[0060] This result suggests that by combining the Lactobacillus reuteri ATG-F4 strain of the present invention with a chemical anticancer agent, the strain can be usefully utilized as an excellent anticancer adjuvant or a metastasis inhibitor adjuvant.

[0061]

[0062] Figure 1 shows the process of inducing tumors and metastasis in the experimental animals of Example 1.

[0063] Figure 2 shows a photograph of a tumor taken from an experimental animal of Example 1.

[0064] Figure 3 is a graph showing the average tumor weight results of the experimental animals in Example 1.

[0065] Figure 4 is a Western blot image confirming tumor-associated protein factors expressed in the tumors of the experimental animals of Example 1. Fig. 4a: BAX, Fig. 4b: Caspase-3 fragment, Fig. 4c: p-AKT, Fig. 4d: p-ERK1 / 2, Fig. 4e: p-MEK1, Fig. 4f: COX-2, Fig. 4g: IL-6 receptor, Fig. 4h: TGF-β

[0066] Figure 5 shows the results of confirming the distribution of the intestinal microbiota of the experimental animals of Example 1 and the butyric acid content in the cecum and blood.

[0067] Figure 6 shows the administration schedule of the anticancer agent and ATG-F4 strain to the experimental animals of Example 6 (Group I in Figure 6a: FOLFIRINOX and ATG-F4 strain administration group, Group II in Figure 6b: GnP and ATG-F4 strain administration group).

[0068] Figure 7a shows the results of confirming diarrhea symptoms in the experimental animals of Example 6 after administration of the anticancer agent FOLFIRINOX and the ATG-F4 strain (Group I).

[0069] Figure 7b shows the results of confirming diarrhea symptoms in the experimental animals of Example 6 after administration of the anticancer agent GnP and the ATG-F4 strain (Group II).

[0070] Figure 8a is a tumor photograph of an experimental animal of Example 6 after administration of the anticancer agent FOLFIRINOX and the ATG-F4 strain, Figure 8b is the tumor weight, and Figure 8c is a graph of the metastasis rate results (Group I).

[0071] Figure 9a is a tumor photograph of an experimental animal of Example 6 after administration of the anticancer agent GnP and the ATG-F4 strain, and Figure 9b is a tumor weight graph (Group II).

[0072] Figure 10 shows Western blot results and graphs confirming tumor-associated protein factors expressed in the tumors of experimental animals of Example 6 after administration of the anticancer agent FOLFIRINOX and the ATG-F4 strain. Figure 10a: Caspase-3, Figure 10b: Claudin, Figure 10c: E-cadherin, Figure 10d: Vimentin.

[0073]

[0074] Preferred embodiments of the present invention will be described in detail below. However, the present invention is not limited to the embodiments described herein and may be embodied in other forms. Rather, the content introduced herein is provided to fully convey the concept of the present invention to those skilled in the art, so that it may be thorough and complete.

[0075]

[0076] I. Anti-colon cancer experiment

[0077] <Example 1. Experimental Animals>

[0078] This animal experiment was approved as an appropriate procedure by the Institutional Animal Care and Use Committee (IACUC) of A2GEN Co., Ltd. (Approval No.: ATG-IACUCRDSP-220321), and ethical animal experiment guidance was provided. The animals used in this experiment were 5-week-old (Table 1) BALB / c nude mice purchased from Raon Bio (Seoul, Korea). HCT-116 cells (human colon cancer cell line, Korean Cell Bank) were cultured in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% FBS (fetal bovine serum). Mice were housed in a rearing room that maintained a constant indoor temperature of 23 ± 2℃, controlled temperature and humidity, and maintained a 12h:12h light cycle. A minimum acclimatization period of 7 days was provided to allow the mice to adapt to the new environment and feed, and there were no restrictions on water or rodent food (Purina) intake.

[0079] After the acclimatization period, 1.0 x 10 6 HCT-116 cells were administered subcutaneously to the flanks of mice, and tumors were grown for 10 days. The tumors were sliced ​​to a width x length x height of 1.5 mm and fixed to the mouse sigmoid colon using surgical sutures. During this process, the sigmoid colon was slightly scratched with a razor blade to promote tumor engraftment. After transplanting the tumors into the sigmoid colon, a recovery period of 7 days was observed. Subsequently, FOLFOX (Oxaliplatin 6 mg / kg, 5-Fluorouracil 50 mg / kg, Leucovorin (calcium folinate) 90 mg / kg) was administered intraperitoneally, and 4.0 x 10 10 CFU of ATG-F4 was administered orally daily. The anticancer agent FOLFOX was administered 10 times over a total of 20 days, whenever the animal's body weight recovered after the anticancer agent administration. This process is shown in Figure 1 and Table 1.

[0080] Number of GroupsNormal Control (NC)10Cancer4Cancer + FOLFOX (Cancer Fx)11Cancer + FOLFOX + ATG-F4 (Cancer Fx ATG-F4)11

[0081]

[0082] <Example 2. Confirmation of the condition of mice administered ATG-F4 strain and anticancer drug>

[0083] The mice were autopsied by CO2 euthanasia on the last day of the experiment.

[0084] The condition photos of each tumor are as shown in Fig. 2, and the average weight of the tumors is shown in Fig. 3.

[0085] Looking at Figures 2 and 3, it is confirmed that the tumors of the mice in the group that were not administered anticancer drugs grew very large, both metastatic tumors and colon tumors. In mice administered only chemotherapy drugs, the volume of the tumors decreased for both metastatic tumors and colon tumors, but when comparing this to the group administered chemotherapy drugs and the ATG-F4 strain in combination in Figure 3, it is confirmed that the tumor weight decreased by about half.

[0086]

[0087] <Example 3. Confirmation of Anti-tumor / Anti-metastasis Related Protein Expression - Western Blot Analysis>

[0088] Mouse colon tumor tissue was placed in RIPA buffer (0.5 M Tris-HCl, pH 7.4, 1.5 M NaCl, 2.5% deoxycholic acid, 10% NP-40) containing a protease inhibitor cocktail (Millipore, USA) and chopped with scissors. Subsequently, the tissue was separated in a centrifuge at 14,000 rpm at 4°C for 10 minutes, and the supernatant was collected. The protein concentration in the supernatant was measured using a BCA assay (Thermo Fisher, USA). The protein extract (40 μg) was separated using an 8% or 10% polyacrylamide mini-gel and transferred to a PVDF membrane (Bio-Rad, USA). The transcribed PVDF membranes were incubated overnight at 4°C with SuperBlock (PBS) Blocking buffer (pH 7.4) containing Kathon™ Antimicrobial Agent and primary antibodies related to tumors and metastases, respectively. The assay parameters were apoptosis factors (BAX, Caspase), tumor growth factors (AKT, ERK1 / 2, MEK1, COX-2), and metastasis-related factors (IL-6, TGF-β). The PVDF membranes were washed four times with 0.1% Tween TBS and then placed in 0.1% Tween TBS buffer containing 3% BSA (Bovogen, USA) and incubated at room temperature for one hour with goat anti-rabbit IgG HRP conjugated secondary antibody (Bio-Rad, USA). After thorough washing with 0.1% Tween TBS, the immunostained bands were verified using ECL (Bio-Rad, USA). Target proteins were identified using the ChemiDoc™ Imaging System (Bio-Rad, USA), and band intensity was quantified using Image Lab™ software (Bio-Rad, USA).

[0089] The results for this are shown in Figure 4. As a result, the protein expression levels of apoptosis-related BAX (Figure 4a) and Caspase-3 fragment (Figure 4b) increased in the group administered with the anticancer agent FOLFOX and the ATG-F4 strain. An increase in the Caspase-3 fragment (Cleaved caspase-3) compared to intact Caspase-3 indicates an enhanced anticancer effect.

[0090] In addition, at this time, p-AKT (Fig. 4c), p-ERK1 / 2 (Fig. 4d), p-MEK1 (Fig. 4e), and COX-2 (Fig. 4f), which are associated with tumor growth / proliferation, were reduced, and the expression of metastasis-related IL-6 receptor (Fig. 4g) and TGF-β (Fig. 4h) was significantly reduced.

[0091] Accordingly, it can be confirmed that the efficacy of the anticancer drug FOLFOX is very effectively boosted through the combination administration of ATG-F4, which produces effects that were not well observed with the anticancer drug FOLFOX alone, through the processes of apoptosis, inhibition of tumor growth and proliferation, and inhibition of tumor metastasis.

[0092]

[0093] <Example 4. Confirmation of efficacy in inducing changes in gut microbiota and increase in butyric acid>

[0094] Amplicons of the V3-V4 region of 16S rRNA were obtained from metagenomic DNA extracted from appendiceal samples using the QIAamp PowerFecal Pro DNA kit (Qiagen, Germany) via PCR, and changes in the gut microbiota caused by ATG-F4 were analyzed by sequencing using the Miseq platform, a next-generation sequencing instrument.

[0095] Butyric acid analysis in serum and cecum was performed using the SCIEX Triple Quad™ 4500 LC-MS / MS System. The process involved standard preparation, sample pretreatment, derivatization, and LC-MS / MS analysis. Serum and cecum samples underwent deproteinization and filtration using 1% formic acid in methanol, while an additional derivatization step was performed for butyric acid analysis. 0.1% formic acid in water / acetonitrile was used as the mobile phase for the LC-MS / MS analysis, and the results were analyzed using SCIEX OS 2.1.0 and Analyst 1.7.1 software.

[0096] Through this process, the gut microbiome of each mouse individual euthanized in Example 2 was identified. The results are shown in the following Figure 5a through the LDA score. This LDA score indicates how characteristically each bacterium is distributed in the experimental mouse group; a higher LDA score indicates that the corresponding bacterium is present in greater quantities in the experimental group of the present invention.

[0097] In other words, looking at Figure 5a, it was confirmed that compared to NC, there was a slight effect on the changes in the gut microbiome upon cancer cell transplantation, and a significant change in the gut microbiome was observed in the group administered the anticancer drug FOLFOX alone, and in particular, the combined administration of the anticancer drug and the ATG-F4 strain showed a very different pattern.

[0098] When classifying the increase or decrease by each bacterial colony, it was shown that there was a distinct differentiation between the group administered the anticancer drug alone and the group administered the anticancer drug in combination with the ATG-F4 strain. Among these, Butyricicoccus and others were found to increase in the group administered the anticancer drug in combination with the ATG-F4 strain. Meanwhile, Escherichia and Shigella, which are well-known harmful bacteria, increased due to the administration of the anticancer drug, but decreased due to the combined administration of the anticancer drug and ATG-F4, which indicated a return to the state prior to the administration of the anticancer drug and the occurrence of cancer.

[0099] Similarly, in the group administered the anticancer drug alone, butyric acid (BA) production in the cecum and blood was reduced, but through the increase of Butyricicoccus, it can be seen that in the group administered the anticancer drug and the ATG-F4 strain in combination, as shown in Figures 5b and 5c, butyric acid production was maintained in a state where no change in the intestinal microbiome occurred (NC).

[0100]

[0101] Through the results of the above animal experiments on colorectal cancer induction, it is proven that the composition of the Lactobacillus reuteri ATG-F4 strain of the present invention combined with an anticancer agent is an excellent composition for anticancer or tumor metastasis inhibition.

[0102]

[0103] II. Anti-pancreatic cancer experiment

[0104] <Example 6. Experimental Animals>

[0105] The animal experiments were conducted under the guidance of the Institutional Animal Care and Use Committee (IACUC) of A2GEN Co., Ltd., through appropriate procedures for ethical animal experimentation. The animals used in this experiment were 5-week-old BALB / c nude mice purchased from Raon Bio (Seoul, Korea) (Table 2). PANC-1 cells (human pancreatic cancer cell line, Korean Cell Bank) were cultured in DMEM (Dulbecco's modified Eagle's medium) supplemented with 10% FBS (fetal bovine serum).

[0106] Mice were reared in a room where the indoor temperature was constantly maintained at 23 ± 2℃, temperature and humidity were controlled, and a 12h:12h lighting cycle was maintained. A minimum acclimatization period of 7 days was provided to allow the mice to adapt to the new environment and food, and there were no restrictions on the intake of water and rodent food (Purina).

[0107] After that, the mice were divided into Group I and Group II.

[0108] For Group I, after the acclimatization period, 1.0 x 10 6 PANC-1 cells were administered into and transplanted into the tail of the mouse pancreas, and tumors were allowed to grow for 28 days. FOLFIRINOX (Oxaliplatin 2.5 mg / kg, 5-Fluorouracil 25 mg / kg, Leucovorin (calcium folinate) 50 mg / kg, Irinotecan 25 mg / kg) was administered intraperitoneally, and 4.0 x 10⁶ 10 The ATG-F4 strain of CFU was administered orally every day. The anticancer drug FOLFIRINOX was administered once a week for 36 days, for a total of 6 administrations (Fig. 6).

[0109] For Group II, after the acclimatization period, 1.0 x 10 6PANC-1 cells were administered and transplanted into the tail of the mouse pancreas, and the tumor was grown for 21 days. Subsequently, GnP (Nab-paclitaxel 1 mg / kg, Gemcitabine 8 mg / kg) was administered intraperitoneally, and 4.0 x 10⁶ 10 ATG-F4 in CFU was administered orally every day. GnP anticancer agent was administered every 4 days for 29 days, for a total of 8 administrations.

[0110] Group I (FOLFIRINOX and ATG-F4 administration model)Normal Control (NC)5Cancer4Cancer + FOLFIRINOX8Cancer + FOLFIRINOX + ATG-F48

[0111]

[0112] Group II (GnP and ATG-F4 administration models) n Number Normal Control (NC) 4 Cancer 5 Cancer + GnP 5 Cancer + GnP + ATG-F4 5

[0113]

[0114] <Example 6. Checking for Diarrhea Symptoms - Checking for Anticancer Drug Side Effects>

[0115] Since diarrhea is one of the side effects of anticancer drug administration, stool consistency was checked. For this purpose, the stool consistency score (evaluation of improvement in diarrhea symptoms, Table 4) was used as an indicator.

[0116] Stool condition was measured in Group I 30 minutes after the 4th administration of FOLFIRINOX, and in Group II 30 minutes after the 8th administration of GnP.

[0117] Score Status Details 0 Normal Dry, hard stool 1 Dry, hard stool Some moisture; maintains stool shape when pressed with tweezers and the tweezers penetrate (crushed) 2 Less hard stool Low moisture and less hard stool (does not crumble) 3 Soft stool High moisture; maintains stool shape when pressed with tweezers but squashes 4 Soft and mild diarrhea High moisture; does not maintain stool shape when pressed with tweezers and squashes 5 Severe watery diarrhea High moisture; no stool shape from the moment of discharge (watery state)

[0118] The results for this are shown in Figure 7, where mice with induced cancer or mice administered an anticancer drug show symptoms of diarrhea.

[0119] This can be described as diarrhea symptoms appearing due to immune disturbance caused by disease or side effects of anticancer drugs. On the other hand, along with anticancer drugs, 4.0 x 10 10 In mice administered the CFU ATG-F4 strain, it is confirmed that the stool consistency score caused by FOLFIRINOX and GnP is lowered.

[0120] Accordingly, it was confirmed that diarrhea symptoms were reduced due to the administration of the ATG-F4 strain, indicating that side effects induced by anticancer drugs were alleviated.

[0121]

[0122] <Example 8. Confirmation of the condition of mice administered with ATG-F4 strain and anticancer drug>

[0123] Each mouse was necropsied by CO2 euthanasia on the last day of the experiment. Photos of the condition of the necropsied mice and the weights of tumors and metastatic tumors in each group are shown in Figures 8 and 9 according to the anticancer drug administration group.

[0124]

[0125] Example 8-1. Group I: FOLFIRINOX + ATG-F4 administration group

[0126] Looking at Figure 8, it appears that the tumors of the mice in the group not administered the anticancer drug FOLFIRINOX grew very large, both metastatic tumors and pancreatic tumors.

[0127] In mice administered only the chemotherapy drug FOLFIRINOX, the volume of both metastatic and pancreatic tumors decreased, but compared to the group administered the anticancer drug in combination with the ATG-F4 strain, the weight of the tumors decreased by about one-third.

[0128]

[0129] Example 8-2. Group II: GnP+ ATG-F4 administration group

[0130] In Figure 9 as well, it is confirmed that the tumors in the group of mice not administered the anticancer drug GnP grew very large overall. Although the volume of the tumors in mice administered only the anticancer drug decreased, when compared to the group administered the anticancer drug and the ATG-F4 strain in combination, it is confirmed that the tumor weight decreased to about 1 / 6.

[0131]

[0132] <Example 9. Confirmation of Pancreatic Cancer Tumor / Anti-Metastasis Related Protein Expression - Western Blot Analysis>

[0133] Protein expression was confirmed in the FOLFIRINOX and ATG-F4 administration groups.

[0134] Mouse pancreatic tumor tissue was placed in RIPA buffer (0.5 M Tris-HCl, pH 7.4, 1.5 M NaCl, 2.5% deoxycholic acid, 10% NP-40) containing a protease inhibitor cocktail (Millipore, USA) and chopped with scissors. Subsequently, the tissue was separated in a centrifuge at 17,548 xg at 4°C for 10 minutes, and the supernatant was collected. The protein concentration in the supernatant was measured using a BCA assay (Thermo Fisher, USA). The protein extract (40 µg) was separated using an 8% or 10% polyacrylamide mini-gel and transferred to a PVDF membrane (Bio-Rad, USA). The transferred PVDF membrane was incubated overnight at 4°C with a primary antibody diluted 1:1000 in SuperBlock (PBS) Blocking buffer. The primary antibodies analyzed were apoptosis factors (Caspase-3, Cleaved caspase-3) and metastasis-related factors (Claudin, E-cadherin, Vimentin). The PVDF membrane was washed four times with 0.1% Tween TBS and then incubated for 1 hour at room temperature in 0.1% Tween TBS buffer containing 3% BSA (Bovogen, USA) along with goat anti-rabbit IgG HRP conjugated secondary antibody (Bio-Rad, USA). After thorough washing with 0.1% Tween TBS, the immunostained bands were visualized using ECL (Bio-Rad, USA). Target proteins were identified using the ChemiDoc™ Imaging System (Bio-Rad, USA), and band intensity was quantified using Image Lab™ software (Bio-Rad, USA). The results are shown in Figure 10.

[0135]

[0136] The expression levels of apoptosis and metastasis-related proteins in pancreatic cancer tissue showed a distinct increase or decrease due to the administration of the ATG-F4 strain. When the anticancer drug and the ATG-F4 strain were administered in combination (Cancer+FFX+ATG-F4), the protein expression of the Caspase-3 fragment increased by more than twofold compared to mice treated with the anticancer drug alone, confirming that the ATG-F4 strain has excellent anticancer booster efficacy.

[0137] In the results of Figure 10b, there was no significant difference in the expression of Claudin when the anticancer drug FOLFIRINOX (Cancer+FFX) was administered compared to tumor tissue (Cancer), but it increased significantly when the anticancer drug and the ATG-F4 strain were administered together (Cancer+FFX+ATG-F4).

[0138] In the results of Figure 10c, it can be seen that although the expression of E-cadherin increased when the anticancer drug FOLFIRINOX was administered alone (Cancer+FFX) compared to tumor tissue (Cancer), when the anticancer drug and the ATG-F4 strain were administered in combination (Cancer+FFX+ATG-F4), it increased significantly by more than twofold compared to treatment with the anticancer drug alone.

[0139] Meanwhile, in Fig. 10d, compared to tumor tissue (Cancer), Vimentin is reduced when the anticancer drug is administered alone (Cancer+FFX), but is almost not expressed when the anticancer drug and the ATG-F4 strain are administered together (Cancer+FFX+ATG-F4), confirming the excellent combination effect of the ATG-F4 strain.

[0140]

[0141] Accordingly, it can be confirmed through the present invention that ATG-F4 very efficiently boosts the efficacy of cytotoxic combination anticancer agents in inhibiting pancreatic cancer cell death and metastasis.

[0142]

[0143] Meanwhile, the Lactobacillus reuteri ATG-F4 strain of the present invention is characterized by having the 16s rRNA polynucleotide sequence of SEQ ID NO. 1 of Table 5 below, and has the following entrustment information.

[0144]

[0145] 서열번호 1tcaggatgaa cgccggcggt gccctaata catgcaagtc gtacgcactg gcccaactgattgatggtgc ttgcacctga ttgacgatgg atcaccagtg agtggcggac gggtgagtaacacgtaggta acctgccgcgcg taacagatcggc tataccgcataacaacaaa agccgcatgg cttttgtttg aaagatggct ttggctatca ctctgggatggacctgcggt gcattagcta gttggtaagg taacggctta ccaaggcgat gatgcatagccgagttgaga gactgatcgg ccacaatgga actgagacac ggtccatacctc acaatgggcg caagcctgat ggagcaacac cgcgtgagtgaagaagggtt tcggctcgta aagctctgtt gttggagaag aacgtgcgtg agagtaactgtcacgcagt gacggtatcc aaccagaaag tcacggctaa ctacgtgcca gcagccgcggtacgc ttattggcg taaagcgagc gcaggcggttgcttaggtct gatgtgaaag ccttcggctt aaccgaagaa gtgcatcgga aaccgggcgacttgagtgca gaagaggaca gtggaactcc atgtgtagcg gtggaatgcg tagatatatggaagaacc agtggcgag gctggcgctgcgc gctcgaaagcatgggtagcg aacaggatta gataccctgg tagtccatgc cgtaaacgat gagtgctaggtgttggaggg ttccgccct tcagtgccgg agctaacgca ttaagcactc cgcctggggagtacgaccgcaaggttgaaa ctcaaaggaa ttgacgggg cccgcacaag cggtggagcatgtggtttaa ttcgaagcta cgcgaagaac cttaccaggt cttgacatct tgcgctaaccttagagataa ggcgttccct tcggggacgc aatgacaggt ggtgcatggt cgtcgtcagctcgtgtcgtg agatgttggg ttaagtcccg caacgagcgc aacccttgtt actagttgccagcattgagt tgggcactct agtgagactg ccggtgacaa accggaggaa ggtggggacgacgtcagatc atcatgcccc ttatgacctg ggctacacac gtgctacaat ggacggtacaacgagtcgca aactcgcgag agtaagctaa tctcttaaag ccgttctcag ttcggactgtaggctgcaac tcgcctac gaagtcggaa tcgctagtaa tcgcggatca gcatgccgcggtgaatacgt tcccgggcct tgtacacacc gcccgtcaca ccatgggagt ttgtaacgcccaaaagtcggt ggcctaacct ttatggaggg agccgcctaa ggcgggacag atgactggggtgaagtcgta acaggaaacc ccg

[0146]

[0147] [수한국어]

[0148] 기하기사명명 : 한국생물자원센터

[0149] 수한번다 : KCTC13717BP

[0150] 수한일자 : 20181115

[0151]

Claims

1. A composition for antitumor or tumor metastasis inhibition characterized by containing the Lactobacillus reuteri ATG-F4 strain deposited under accession number KCTC13717BP as an active ingredient.

2. In Paragraph 1, A composition for inhibiting tumor or tumor metastasis, characterized in that the strain comprises one or more selected from the group consisting of the cell, culture of the strain, extract, concentrate, and dried product of the culture.

3. In Paragraph 1, The above composition increases the expression of BAX (Bcl-2 associated X Protein) or Caspase-3 fragment proteins, or Inhibiting the protein expression of IL-6 receptor (Interleukin-6 receptor), TGF-β (transforming growth factor-β), p-AKT (p-Akt8 virus transforming kinase target), p-ERK1 / 2 (p-Extracellular signal-regulated kinases 1 / 2), p-MEK1 (p-MAPK / ERK kinase 1), or COX-2 (Cyclooxygenase-2), and A composition for antitumor or tumor metastasis inhibition characterized by increasing the protein expression of Claudin or E-cadherin, or inhibiting the protein expression of Vimentin.

4. In Paragraph 1, A composition for inhibiting tumors or tumor metastasis, characterized by the co-administration of a chemical anticancer agent to the above composition.

5. In Paragraph 4, The above chemical anticancer agents are among the group consisting of oxaliplatin, cisplatin, cyclophosphamide, ifosfide, bendamustine, melphalan, carboplatin, busulfan, dacarbazine, temozolomide, fluorouracil, capecitabine, doxifluridine, tegafur, cytarabine, azacitidine, decitamine, enositabine, methotrexate, pemetrexid, pralatrexate, cladribine, cloparabine, fludarabine, mercaptopurine, irinotecan, doxorubicin, daunorubicin, epirubicin, idarubicin, mitoxantrone, etoposide, topotecan, cabazitaxel, paclitaxel, docetaxel, vinblastine, vincristine, vinorelbine, bleomycin, hydroxyurea, and mitomycin C A composition for inhibiting tumor or tumor metastasis, characterized by selecting one or more types.

6. In Paragraph 4, A composition for inhibiting tumors or tumor metastasis characterized by reducing symptoms of diarrhea caused by the administration of anticancer drugs.

7. An anticancer or anti-metastatic pharmaceutical composition containing the composition of claim 1 and pharmaceutical excipients.

8. A method for treating cancer using the composition of claim 1.

9. A treatment method for inhibiting cancer metastasis using the composition of claim 1.