mRNA vaccines for kaposi sarcoma associated herpesvirus

Abstract

Disclosed herein are compositions and methods for conferring immunity against Kaposi's Sarcoma Associated Herpesvirus (KSHV).

Description

MRNA VACCINES FOR KAPOSI SARCOMA ASSOCIATED HERPESVIRUS

[0001] CROSS-REFERENCE TO RELATED APPLICATIONS

[0002] This application claims the benefit of U.S. Patent Application No. 63 / 747,506, filed January 21, 2025, and U.S. Patent Application No. 63 / 826,578, filed June 19, 2025, both of which are herein incorporated by reference in their entirety.

[0003] REFERENCE TO A SEQUENCE LISTING SUBMITTED VIA PATENT CENTER

[0004] The content of the XML file of the sequence listing named“20260114_034044_263WOl_ST26” which is 248,115 bytes in size was created on January 14, 2026 and electronically submitted via Patent Center herewith the application is incorporated herein by reference in its entirety.

[0005] ACKNOWLEDGEMENT OF GOVERNMENT SUPPORT

[0006] This invention was made with Government support under CA283736, DE025567, DE028774, and CA305709 awarded by the National Institutes of Health. The Government has certain rights in the invention.

[0007] BACKGROUND OF THE INVENTION

[0008] 1. FIELD OF THE INVENTION

[0009] The field generally relates to Kaposi’s Sarcoma Associated Herpesvirus and vaccines and antibodies thereto.

[0010] 2. DESCRIPTION OF THE RELATED ART

[0011] Kaposi’s Sarcoma Associated Herpesvirus (KSHV or Human gammaherpesvirus 8) is the etiological agent for cancers such as Kaposi’s Sarcoma (KS) and is associated with primary effusion lymphoma (PEL) and multicentric Castleman disease (MCD). KS, the most frequent malignancy associated with KSHV infection, is estimated to account for about 34,000 new cases and 15,000 deaths annually worldwide. KS malignancies manifest as lesions composed of endothelial cells on the skin, lymph nodes, lungs, and digestive tract. While the occurrence of KS is low overall in the US at a rate of 4.5 cases per million people in 2017, the occurrence may be up to 500 times higher in transplant patients and in people living with Human Immunodeficiency Virus (HIV).

[0012] Like all herpesviruses, the life cycle of KSHV has two distinct phases: lytic replication that leads to virion production and latency where the viral genome is maintained in an episomal manner. Tumorigenesis of KSHV is linked to viral latency while lytic replication also contributes to this process indirectly.

[0013] Vaccination against KSHV would reduce the disease burden associated with infection. Thus, a need exists for a vaccine against KSHV.

[0014] SUMMARY OF THE INVENTION

[0015] In some embodiments, the present invention is directed to mRNA molecules which encode a membrane-bound protein comprising a signal-anchor peptide fused to the N-terminus of a gB protein sequence or an ORF4 protein sequence, said mRNA molecule comprises: (1) a gB encoding sequence that encodes the gB protein sequence which comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 3, or an ORF4 encoding sequence that encodes the ORF4 protein sequence which comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 4; and (2) a signal-anchor encoding sequence that encodes the signal-anchor peptide; wherein the mRNA molecule has N'-methylpseudouridine bases instead of uridine bases. In some embodiments, a single mRNA molecule encodes a first membrane-bound protein comprising a first signal-anchor peptide fused to the N- terminus of the gB protein sequence and a second membrane-bound protein comprising a second signal-anchor peptide fused to the N-terminus of the ORF4 protein sequence, wherein the first and second membrane-bound proteins may be the same or different. In some embodiments, the signal-anchor peptide comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 5 or SEQ ID NO: 6. In some embodiments, in the gB protein sequence, (a) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10 ) or TTQT ( SEQ ID NO: 11 ); (b) the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is D or P and / or the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G or P; (c) when the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G, then the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is other than D, preferably the amino acid residue is P; (d) when the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is D, then the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is other than G, preferably the amino acid residue is P; (e) at least one of the amino acids corresponding to positions 446 and 447 of SEQ ID NO: 3 is P; (f) the amino acid residues corresponding to positions 446and 447 of SEQ ID NO: 3 are P and G, respectively; (g) the amino acid residue corresponding to position 784 of SEQ ID NO: 3 is M or L, preferably M; (h) the amino acids residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10) or TTQT (SEQ ID NO: 11 ); and at least one of the amino acid residues corresponding to positions 446 and 447 of SEQ ID NO: 3 is P; (i) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR (SEQ ID NO: 10 ), the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is P, and the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G; (j) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10 ), and the amino acid residue corresponding to position 784 of SEQ ID NO: 3 is M; (k) the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is P, the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G, and the amino acid residue corresponding to position 784 of SEQ ID NO: 3 is M; or (1) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10 ), the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is P, the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G, and the amino acid residue corresponding to position 784 of SEQ ID NO: 3 is M. In some embodiments, in the gB protein sequence, the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10 ), the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is P, the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G, and the amino acid residue corresponding to position 784 of SEQ ID NO: 3 is M. In some embodiments, in the gB protein sequence, one or more amino acid residues corresponding to positions 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 are other than N. In some embodiments, the signal-anchor peptide is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 5. In some embodiments, the membrane-bound protein is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7 or SEQ ID NO: 8. In some embodiments, the membrane-bound protein comprises the ORF4 protein sequence and the signal-anchor peptide fused thereto is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 6. In some embodiments, the membrane-bound protein is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 9. In some embodiments, the sequence of the mRNA moleculeis at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 1 or SEQ ID NO: 2; wherein all indicated uridines are N1-methylpseudouridine. In some embodiments, the sequence of the mRNA molecule is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 1, wherein all indicated uridines are N1-methylpseudouridine, and the codon(s) encoding: (a) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 encode RKRR (SEQ ID NO: 10 ) or TTQT ( SEQ ID NO: 11 ); (b) the amino acid residue corresponding to position 446 of SEQ ID NO: 3 encodes D or P and / or the amino acid residue corresponding to position 447 of SEQ ID NO: 3 encodes G or P; (c) the amino acid residue corresponding to position 446 of SEQ ID NO: 3 encodes a residue other than D, preferably P, when the codon encoding the amino acid residue corresponding to position 447 of SEQ ID NO: 3 encodes G; (d) the amino acid residue corresponding to position 447 of SEQ ID NO: 3 encodes a residue other than G, preferably the residue is P, when codon encoding the amino acid residue corresponding to position 446 of SEQ ID NO: 3 encodes D; (e) at least one of the amino acids corresponding to positions 446 and 447 of SEQ ID NO: 3 encodes P, preferably the codon encoding the amino acid corresponding to position 446 of SEQ ID NO: 3 encodes P; (f) the amino acid residues corresponding to positions 446 and 447 of SEQ ID NO: 3 encode P and G, respectively; (g) the amino acid residue corresponding to position 784 of SEQ ID NO: 3 encodes M or L, preferably M; (h) the amino acids residues corresponding to positions 413-416 of SEQ ID NO: 3 encode RKRR ( SEQ ID NO: 10 ) or TTQT ( SEQ ID NO: 11 ); and the codons for at least one of the amino acid residues corresponding to positions 446 and 447 of SEQ ID NO: 3 encode P; (i) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 encode RKRR ( SEQ ID NO: 10 ), the codon for the amino acid residue corresponding to position 446 of SEQ ID NO: 3 encodes P, and codon for the amino acid residue corresponding to position 447 of SEQ ID NO: 3 encodes G; (j) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 encode RKRR ( SEQ ID NO: 10 ), and the codon for the amino acid residue corresponding to position 784 of SEQ ID NO: 3 encodes M; (k) the amino acid residue corresponding to position 446 of SEQ ID NO: 3 encodes P, the codon for the amino acid residue corresponding to position 447 of SEQ ID NO: 3 encodes G, and the codon for the amino acid residue corresponding to position 784 of SEQ ID NO: 3 encodes M; (1) the amino acid residues corresponding to positions 413-residue corresponding to position 446 of SEQ ID NO: 3 encodes P, the codon for the amino acid residue corresponding to position 447 of SEQ ID NO: 3 encodes G, and codon for the amino acid residue corresponding to position 784 of SEQ ID NO: 3 encodes M. In some embodiments, the mRNA molecules encode a gB protein sequence having one or more of the following amino acid substitutions: N155X, N230X, N251X, N331X, N344X, N348X, N361X, N575X, N590X, and N605X as compared to SEQ ID NO: 3 when optimally aligned thereto, wherein X is any amino acid residue other than N, preferably X is R, D, Q, E, H, K, S, T, more preferably X is D, Q, H, K, S, T, even more preferably X is Q or H, and most preferably X is Q. In some embodiments, the mRNA molecules encode a gB protein sequence having a deletion selected from A737- 821, A764-821, A776-821, and A798-821 as compared to SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the mRNA molecules encode a gB protein sequence having SEQ ID NO: 3 with one or more of the following amino acid substitutions: N155X, N230X, N251X, N331X, N344X, N348X, N361X, N575X, N590X, and N605X, wherein X is any amino acid residue other than N, preferably X is R, D, Q, E, H, K, S, T, more preferably X is D, Q, H, K, S, T, even more preferably X is Q or H, and most preferably X is Q. In some embodiments, the mRNA molecule encodes a gB protein sequence having SEQ ID NO: 3 with a deletion selected from A737-821, A764-821, A776-821, and A798-821.

[0016] In some embodiments, the present invention is directed to compositions, kits, and combination products comprising one or more mRNA molecules as described herein. In some embodiments, the one or more mRNA molecules are a first mRNA molecule and a second mRNA molecule, wherein said first mRNA molecule encodes a signal-anchor peptide fused to the N-terminus of the gB protein sequence; and said second mRNA molecule encodes a signal-anchor peptide fused to the N-terminus of the ORF4 protein sequence. In some embodiments, the compositions, kits, and combination products further comprise an antibody raised against an antigen comprising (a) amino acids 25- 683 of SEQ ID NO: 8, or (b) amino acids 20-527 of SEQ ID NO: 9. In some embodiments, the antibody is raised against an antigen comprising SEQ ID NO: 8 or SEQ ID NO: 9. In some embodiments, the compositions, kits, and combination products comprise an mRNA molecule that encodes the signal-anchor peptide fused to the N-terminus of the gB protein sequence and an antibody raised against the antigen comprising amino acids 20-527 of SEQ ID NO: 9; or an mRNA molecule that encodesthe signal-anchor peptide fused to the N-terminus of the ORF4 protein sequence and an antibody raised against the antigen comprising amino acids 25-683 of SEQ ID NO: 8. In some embodiments, the compositions, kits, and combination products comprise an mRNA molecule that encodes SEQ ID NO: 9 or SEQ ID NO: 8.

[0017] In some embodiments, the present invention is directed to polyclonal antibodies produced by administering to a subject an immunogenic amount of one or more mRNA molecules, as described herein, and then separating the polyclonal antibodies from the subject’s blood. In some embodiments, the immunogenic amount is administered in combination with an adjuvant. In some embodiments, the polyclonal antibodies are separated from the blood at least two weeks after administration of the immunogenic amount. In some embodiments, the polyclonal antibodies are separated from the blood up to 3 months after administration of the immunogenic amount. In some embodiments, the polyclonal antibodies are separated from the blood up to 12 months after administration of the immunogenic amount. In some embodiments, the polyclonal antibodies are in the form of immune serum.

[0018] In some embodiments, the present invention is directed to methods of inhibiting, reducing, or treating a KSHV infection or disease in a subject, which comprises administering to the subject (a) one or more mRNA molecules as described herein; (b) a composition or combination product as described herein; and / or (c) polyclonal antibodies as described herein.

[0019] Both the foregoing general description and the following detailed description are exemplary and explanatory only and are intended to provide further explanation of the invention as claimed. The accompanying drawings are included to provide a further understanding of the invention and are incorporated in and constitute part of this specification, illustrate several embodiments of the invention, and together with the description explain the principles of the invention.

[0020] DESCRIPTION OF THE DRAWINGS

[0021] The patent or application file contains at least one drawing executed in color.Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. This invention is further understood by reference to the drawings wherein:

[0022] FIG. 1 to FIG. 6: Blocking ORF4 Enables Complement-Mediated Neutralization by gB Antibodies. Four Balb / c mice per group received intramuscular injections of 10 pg recombinant soluble proteins of ORF4 or gB or both with 10 pg polyUs-LNP as anadjuvant. PolyUs-LNPs are lipid nanoparticles (LNPs) encapsulating phosphothioate- linked polyuridlyic acid (polyUs). The gB and dual antigen groups received 4 immunizations while the ORF4 group received 3 injections. FIG. 1 and FIG. 2: Sera from individual mice within the same group were pooled for use in neutralization assays. Four 2-fold serial dilutions of pooled sera, ranging from 1:40 to 1:320, were incubated with KSHV in the presence of 10% heat inactivated fetal bovine serum (FBS), normal human serum (NHS), or 10% NHS depleted of C5, C3 and C4, or Clq. NHS and the complement component depleted NHS were purchase from Complement Technology. FIG. 3 and FIG. 4: Eight 2-fold serial dilutions of sera from individual mice (FIG. 3) or pooled sera (FIG. 4), ranging from 1:40 to 1:5120, were incubated with KSHV in the presence of 10% FBS or NHS. FIG. 5: Four 2-fold serial dilutions of pooled sera, ranging from 1:40 to 1:320, were incubated with the wild-type KSHV or KSHV without a functional ORF4 on the surface in the presence of 10% FBS or NHS. FIG. 6 is a diagram that illustrates that disabling ORF 4 — either through antibodies or deleting the function of the SCR domain of ORF 4 — is necessary to enable gB antibodies to activate the complement cascade for neutralization. No significant neutralization — defined by more than 90% reduction in relative infection compared to the mock-immunized control — was observed in the presence of 10% FBS. Log2values of the neutralization titer 90 (NT90) are shown in the graphs.

[0023] FIG. 7 to FIG. 9: mRNA encoding membrane-bound proteins induces strong anti- ORF4 antibody responses, but weaker gB antibody responses compared to soluble proteins. FIG. 7: The adjuvant effects of LNP encapsulated with unmodified non-coding mesothelin sequence (U-RNA LNP) on mRNA encoding HIV gag (“gag-LNP”).C57B1 / 6 mice received two intramuscular injections of gag-LNP (2.5 pg) with or without U-RNA LNP. ELISA was performed to measure gag-specific total IgG or IgG2c binding antibodies. FIG. 8 and FIG. 9: Four Balb / c mice per group received two intramuscular injections of ORF4 mRNA (5 pg) or gB mRNA (10 pg) or both ORF4 mRNA and gB mRNA (“dual mRNA”) with contralateral injections. In one of the dual- mRNA groups, no U-RNA LNP was used. ELISA was performed to measure ORF4- or gB-specific total IgG or IgG2c binding antibodies in the sera collected from individual mice at two weeks after the second immunization. Area Under Curve (AUC) was calculated using GraphPad Prism, and statistical analysis was performed with Ordinary one-way ANOVA and Dunnett's multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001.

[0024] FIG. 10 and FIG. 11 mRNA encoding membrane-bound proteins induces stronger complement-activating antibodies than soluble proteins. Sera from individual mice within the same group was pooled for use in neutralization assays. Eight (FIG. 10) or four 2-fold (FIG. 11) serial dilutions of pooled sera starting from 1:40 were incubated with KSHV in the presence of 10% heat inactivated NHS (iNHS) or NHS.Neutralization of some pooled samples were done twice independently and indicated.

[0025] FIG. 12: Induced antibodies against mRNA encoding membrane-bound protein result in complement deposition on ORF4-expressing cells. FIG. 12: 293T cells transfected with plasmids encoding membrane-bound gB protein or membrane-bound ORF4 protein were incubated with the pooled immune sera and 10% NHS. After two hours of incubation, cells were stained with APC-conjugated C3b and PE-conjugated Clq followed by flow cytometry analysis. Latent KSHV (carrying a GFP-expressing cassette) in iSLK-KSHV cells was induced to enter the lytic phase doxycycline and NaB. After two days, cells were fixed and incubated with the ORF4 immune sera followed by PE-conjugated anti-mouse IgG antibodies to visualize cells bound by anti-ORF4 antibodies (data not shown).

[0026] DETAILED DESCRIPTION OF THE INVENTION

[0027] Disclosed herein are mRNA molecules that encode membrane-bound gB proteins and membrane-bound ORF4 proteins. The membrane-bound gB proteins are based on Accession No. YP 001129354.1 and the membrane-bound ORF4 proteins are based on Accession No. YP 001129351.1 of Kaposi Sarcoma-associated Herpesvirus (KSHV). As disclosed herein, the mRNA molecules encapsulated in the lipid nanoparticles induce antibodies against the membrane-bound forms that result from infection by KSHV.Therefore, the mRNA molecules may be used as mRNA vaccines inhibit, reduce, or treat infections by KSHV and diseases associated therewith.

[0028] To determine whether the mRNA molecules stimulate antibodies that inhibit, reduce, or treat KSHV infection of cells, the mRNA molecules were produced using methods in the art.

[0029] Prior Studies - Complement Mediated Neutralization via Soluble Protein Vaccination

[0030] To investigate the underlying mechanisms, C5-deficient human complement was used, as C5 is essential for the formation of the membrane attach complex (MAC), which mediates virolysis of enveloped viruses, including KSHV. For KSHV neutralization assays, serial dilutions of serum samples were incubated with KSHV virions and then added ontotarget cells, 293 cells. Because the KSHV virus that was used contains an insertion of a GFP-expression cassette under control of ef1α promoter in the viral genome, successful infection will generate GFP signals in 293 cells and can be quantified by flow cytometry. Relative infection is calculated based on the percentage of GFP-positive cells, normalized to the signal from the mock-immunized sample (PBS administration), which is set as 100% infection due to the absence of virus-specific antibodies. Significant neutralization was defined as a reduction in relative infection greater than 90% compared to the mock- immunized control. The neutralization titer 90 (NT90) refers to the dilution of a serum samples at which more than 90% of infection is inhibited relative to the mock-immune serum control. NT90 was chosen over NT50 to better distinguish antibody responses with truly potent neutralization from those with moderate neutralization. The virion was prepared by ultra-centrifuging the supernatants collected from an iSLK cell line infected with KSHV. iSLK is an epithelial cell line that expresses a viral transcriptional activator RTA under the doxycycline-inducible promoter. Latent KSHV is induced to enter lytic replication with 5 pg / ml of doxycycline and 1 mM sodium butyrate (NaB) to produce virions. The supernatant was harvested five days post-reactivation and then titrated on 293 cells. The amount of virions used for neutralization resulted in 5-10% GFP-positive cells after two days of infection in the absence of incubating with any serum samples. To assess the effect of complement mediated neutralization, we used 10% normal human serum (NHS) or NHS depleted with a specific complement component and matched with 10% heat-inactivated fetal bovine serum (FBS) or heat-inactivated NHS as a control during serum-virion incubation. Specifically, KSHV virions and serial dilutions of serum samples were incubated at 37°C for one hour, then the mixtures were added to 293 cells seeded on a 96- well plate. The plate was spun at 500 g for 30 minutes at room temperature and then incubated in the 37°C CO2incubator for 2 hours. After two hours, cells were washed with fresh growth medium and cultured for two days before subjected to flow cytometry analysis.

[0031] The NT90 of the pooled immune serum sample from mice that received both gB and ORF4 proteins was 320 (the maximal dilution tested) and decreased to 80 upon C5 depletion, indicating the role of membrane attack complex (MAC) and virolysis in neutralization (FIG. 1). It further dropped below 40 (the minimal dilution tested) when both C3 and C4 were depleted (FIG. 1), supporting that neutralization depends on complement. In the classical complement pathway, Clq is the very first component and binds to the antibody-antigen complexes, which triggers the downstream cascade. While less impacted compared to C5 depletion, Clq depletion also impaired the ability of NHS to mediate neutralization (FIG. 2). Immunization of soluble ORF4 protein alone is not sufficient toconsistently generate antibodies that can mediate complement neutralization in all immunized animals, like the dual-antigen vaccine group (FIG. 3). When the serum samples pooled together, the NT90 of the soluble ORF4 group was 30 while that of the dual-soluble antigen group (soluble ORF4 + soluble gB) was 640 (FIG. 4). The lower NT90 of pooled soluble ORF4 group samples compared to the average of individual NT90 in FIG. 3 indicates dilution of effective anti-ORF4 antibodies or competition from non-effective antibodies when pooling the serum samples.

[0032] To determine whether anti-ORF4 antibodies elicited by the dual antigen recombinant protein vaccine effectively block the complement inhibitory function of ORF4, enabling anti-gB antibodies to activate complement for neutralization, the KSHV mutant virus (referred to as “dSCR”), which has a deletion in the SCR region of ORF4 that confers its complement inhibition activity, was used for neutralization using the pooled serum samples from mice that were immunized with soluble gB or immunized with both soluble gB and soluble ORF4. Unlike WT virion neutralization, the immune serum from subjects immunized with soluble gB (but not soluble ORF4) was able to neutralize dSCR virions in the presence of complement without anti-ORF4 antibodies (FIG. 5).

[0033] mRNA Vaccines

[0034] To determine whether membrane-bound gB proteins and membrane-bound ORF4 proteins are more efficient in inducing antibodies that trigger complement activation, m1ψ mRNA-LNP vaccines encoding the membrane-bound forms were developed and tested. The coding mRNA molecules substitute uridines with N1-methylpseudouridine (m1ψ) to abolish activation of TLR7 and TLR8, leading to enhanced mRNA stability and translational capacity. Meanwhile, a small amount of RNA adjuvant that contains unmodified noncoding mRNA in the LNP, U-RNA LNP, was included to enhance Thl responses that facilitate B cells undergo class switching to IgG subclasses that are good at complement activation (IgG2a in Balb / c mice). The U-RNA LNP was previously used to enhance the generation of IgG2c subclass antibodies elicited by m1ψ mRNA-LNP encoding gag of HIV in C57BL / 6 mice (FIG. 7).

[0035] Balb / c mice were immunized twice with m h| / mRNA-LNP encoding membranebound gB protein (“gB mRNA”), m h| / mRNA-LNP encoding membrane-bound ORF4 protein (“ORF4 mRNA”), or m h| / mRNA-LNP encodings encoding both membrane-bound proteins (“dual mRNA”), with and without U-RNA LNP as an adjuvant. The anti-ORF4 antibodies generated from three immunizations with soluble ORF4 protein were lower than those from two immunizations with mRNA ORF4 (FIG. 8). The dual-antigen groups thatreceived vaccinations of both 0RF4 mRNA and gB mRNA had slightly lower ORF4- binding antibody responses compared to the 0RF4 mRNA single-antigen group. The anti- gB antibodies generated from four immunizations of soluble gB protein were significantly higher than those from two immunizations of gB mRNA (FIG. 9). Interestingly, the dualantigen groups that received both ORF4 mRNA and gB mRNA had slightly higher gB- binding antibody responses compared to the gB single antigen group.

[0036] Next, the neutralization titers of the pooled immune sera from these single and dualantigen immunization groups were assessed. No significant neutralization was observed in the absence of complement. In the presence of complement, the NT90 of both dual mRNA groups, with or without U-RNA LNP as an adjuvant, reached 2560, substantially higher than that of the dual soluble protein group, which measured at 960 (FIG. 10). These results indicate that mRNA vaccines are more effective than soluble proteins (aka protein subunit vaccines) in inducing antibodies that activate complement cascade for neutralization. The NT90 of the group vaccinated with only ORF4 mRNA reached 400, significantly higher than the soluble ORF4 protein group (FIG. 4). This result suggests that membrane-bound ORF4 protein induces more functionally effective antibodies capable of activating complement cascade for viral neutralization. As observed with the soluble gB protein, the anti-gB antibodies elicited by gB mRNA were able to mediate complement-dependent neutralization against dSCR but not WT (FIG. 11).

[0037] In addition to mediating complement-dependent neutralization, antibodies can also promote complement deposition on cells expressing the target. To test this, 293T cells were transfected with a plasmid encoding membrane-bound gB or membrane-bound ORF4 and 24 hours later, cells were incubated with mRNA-induced antibodies and 10% NHS for 2 hours and stained with APC-conjugated C3b and PE-conjugated Clq. Clq is the first complement component that binds to the Fc region of antigen-bound IgG and C3b generated from C3 cleavage indicates active complement cascade progression. About 43% cells were doubly stained when cells transfected with ORF4 were incubated with the pooled immune serum from subjects vaccinated with ORF4 mRNA while about 4% cells were double positive when cells transfected with gB were incubated with the pooled immune serum from subjects vaccinated with gB mRNA (FIG. 12). Incubation with the pooled mock immune serum and NHS produced about 1-2% double positive cells. These results suggest that induced antibodies against membrane-bound ORF4 protein not only neutralize cell-free virus through complement but also may contribute to immune clearance of infected cells through two potential pathways: 1) opsonization for phagocytosis, and 2) lysis via MAC. When KSHV-infected iSLK cells were stained with anti-ORF4 antibodies generated from solubleprotein vaccine or 0RF4 mRNA, a significant level of cells expressed membrane-bound ORF4 protein on the surface (data not shown), which can be targets for complement- mediated clearance.

[0038] In summary, the mRNA-LNP platform delivering membrane-bound gB protein and membrane-bound ORF4 protein as antigens induces robust antibodies capable of activating complement cascade. This leads to the neutralization of cell-free virions and complement deposition on the surface of ORF4-expressing cells, potentially resulting in the lysis and phagocytosis of infected cells.

[0039] NUCLEIC ACID MOLECULES ENCODING MEMBRANE-BOUND PROTEINS

[0040] Therefore, contemplated herein are mRNA molecules that encode membranebound gB proteins and membrane-bound ORF4 proteins. In some embodiments, the wherein the mRNA molecules have N'-methylpseudouridine bases instead of uridine bases.

[0041] As used herein, a “membrane-bound gB protein” refers to a protein that comprises (1) a gB protein sequence that comprises, consists essentially of, or consists of a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 3, and (2) a signal-anchor peptide, e.g., SEQ ID NO: 5, fused to the N-terminus of the gB protein sequence.

[0042] In some embodiments, gB protein sequence of the membrane-bound gB proteins comprise, consist essentially of, or consist of a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 3, wherein the amino acid residues corresponding to positions 413-416 (“XI”, “X2”, “X3”, and “X4”, respectively) are RKRR ( SEQ ID NO: 10 ) or TTQT ( SEQ ID NO: 11 ). In some embodiments, gB protein sequence of the membrane-bound gB proteins comprise, consist essentially of, or consist of a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 3, wherein the amino acid residue corresponding to position 446 (“X5”) is D or P and / or the amino acid residue corresponding to position 447 (“X6”) is G or P, preferably at least one of X5 and X6 is P, more preferably X5 is P and X6 is G. In some embodiments, gB protein sequence of the membrane-bound gB proteins comprise, consist essentially of, or consist of a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 3, wherein the amino acid residue corresponding to position 784 (“X7”) is M or L. In some embodiments, the gB protein sequence of membrane-bound gB proteins comprise, consist essentially of, or consist of a sequence that is at least 95%, at least 96%, at least97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 3, wherein X1-X4 is SEQ ID NO: 10, X5 is P, and X6 is G. In some embodiments, the gB protein sequence of membrane-bound gB proteins comprise, consist essentially of, or consist of a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 3, wherein X1-X4 is SEQ ID NO: 10, and X7 is M. In some embodiments, the gB protein sequence of membrane-bound gB proteins comprise, consist essentially of, or consist of a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 3, wherein X1-X4 is SEQ ID NO: 10, X5 is P, X6 is G, and X7 is M.

[0043] In some embodiments, the membrane-bound gB protein comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 7, wherein the amino acid residues corresponding to positions 437-440 (“XI”, “X2”, “X3”, and “X4”, respectively) are RKRR ( SEQ ID NO: 10 ) or TTQT ( SEQ ID NO: 11 ). In some embodiments, the membrane-bound gB protein comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 7, wherein the amino acid residue corresponding to position 470 (“X5”) is D or P and / or amino acid residue 471 (“X6”) is G or P, preferably at least one of X5 and X6 is P, more preferably X5 is and X6 is G. In some embodiments, the membrane-bound gB protein comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 7, wherein the amino acid residue corresponding to position 808 (“X7”) is M or L. In some embodiments, the membrane-bound gB protein comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 7, wherein X1-X4 is SEQ ID NO: 10, X5 is P, and X6 is G. In some embodiments, the membranebound gB protein comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 7, wherein X1-X4 is SEQ ID NO: 10, and X7 is M. In some embodiments, the membrane-bound gB protein comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 7,wherein X1-X4 is SEQ ID NO: 10, X5 is P, X6 is G, and X7 is M. In some embodiments, the membrane-bound gB protein comprises or consists of SEQ ID NO: 8.

[0044] KSHV gB (Accession No. YP_001129354.1) displays an extensive glycosylation pattern. Out of the 13 hypothetical glycosylation sites, ten N-linked glycans per protomer were observed: N179, N254, N275, N355, N368, N372, N385, N599, N614, and N629. Based on sequence alignments, these glycosylation sites on KSHV gB are either unique or only partially conserved among herpesviruses. Hence, in addition to the metastable prefusion conformation, glycosylation could provide another evasion mechanism by masking vulnerable regions of gB. This hindrance may impede B-cell receptor (BCR) activation and antibody binding, allowing the virus to evade immune detection and neutralization. While modifying glycosylation may not be necessary for viral proteins that naturally elicit strong neutralizing antibody responses, this approach could benefit the production of KSHV gB-specific neutralizing antibodies. Removing some or all of these glycans via amino acid substitution or deletion may enhance the immunogenicity of gB by improving access to key epitopes for BCR recognition.Therefore, the membrane-bound gB proteins in the preceding paragraph may have up to ten amino acid modifications (substitutions and / or deletions) at amino acid positions that correspond to residues 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the membrane-bound gB proteins have up to five amino acid modifications (substitutions and / or deletions) at amino acid positions that correspond to residues 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the membrane-bound gB proteins have up to three amino acid modifications (substitutions and / or deletions) at amino acid positions that correspond to residues 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the membrane-bound gB proteins have two amino acid modifications (substitutions and / or deletions) at amino acid positions that correspond to residues 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the membrane-bound gB proteins have one amino acid modification (substitution or deletion) at amino acid positions that correspond to residues 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the membrane-bound gB proteins in the preceding paragraph may have up to ten amino acid substitutions at amino acid positions that correspond to residues 155, 230, 251, 331, 344,348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the membrane-bound gB proteins have up to five amino acid substitutions at amino acid positions that correspond to residues 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the membrane-bound gB proteins have up to three amino acid substitutions at amino acid positions that correspond to residues 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the membrane-bound gB proteins have two amino acid substitutions at amino acid positions that correspond to residues 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the membrane-bound gB proteins have one amino acid substitution at an amino acid position that corresponds to an amino acid position selected from 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto. In some embodiments, the amino acid modifications at the amino acid positions that correspond to residues 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 when optimally aligned thereto are N~ X, wherein X is any amino acid other than N, preferably X is R, D, Q, E, H, K, S, T, more preferably X is D, Q, H, K, S, T, even more preferably X is Q or H, and most preferably X is Q. In some embodiments, the membrane-bound gB proteins have a deletion selected from A737-821, A764-821, A776- 821, and A798-821 as compared to SEQ ID NO: 3 when optimally aligned thereto. Preferably, the deletion is A737-821 or A764-821.

[0045] As used herein, a “membrane-bound ORF4 protein” refers to a protein that comprises (1) an ORF4 protein sequence that comprises, consists essentially of, or consists of a sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 4, and (2) a signal-anchor peptide, e.g., SEQ ID NO: 6, fused to the N-terminus of the ORF4 protein sequence. In some embodiments, the membrane-bound ORF4 protein comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% identical to SEQ ID NO: 9. In some embodiments, the membrane-bound ORF4 protein comprises or consists of SEQ ID NO: 9.

[0046] As used herein, a “signal-anchor peptide” refers to N-terminal transmembrane domains of membrane-bound proteins. Exemplary signal-anchor peptides includeMTPRSRLATLGTVILLVCFCAGAA ( SEQ ID NO: 5 ) and MAFLRQTLWILWTFTMVIG ( SEQ ID NO: 6 ).

[0047] In some embodiments, the mRNA molecules that encode the membrane-bound gB proteins as described herein comprise (1) a “gB encoding sequence” that encodes a gB protein sequence as described herein, said gB encoding sequence comprises, consists essentially of, or consists of at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% sequence identity to nucleotides 73-2535 of SEQ ID NO: 1; and (2) a “signal-anchor encoding sequence” that encodes a signal-anchor peptide; wherein the mRNA molecules have N'-methylpseudouridine bases instead of uridine bases. In some embodiments, the mRNA molecules that encode the membrane-bound gB proteins comprise, consist essentially of, or consist of at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% sequence identity to SEQ ID NO: 1; wherein the mRNA molecules have N'-rnethylpseudouridine bases instead of uridine bases.

[0048] In some embodiments, the mRNA molecules that encode the membrane-bound ORF4 proteins as described herein comprise (1) a “ORF4 encoding sequence” that encodes a ORF4 protein sequence as described herein, said ORF4 encoding sequence comprises, consists essentially of, or consists of at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% sequence identity to nucleotides 58- 1650 of SEQ ID NO: 2; and (2) a “signal-anchor encoding sequence” that encodes a signal-anchor peptide; wherein the mRNA molecules have N'-rnethylpseudouridine bases instead of uridine bases. In some embodiments, the mRNA molecules that encode the membrane-bound ORF4 proteins comprise, consist essentially of, or consist of at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99%, or 100% sequence identity to SEQ ID NO: 2; wherein the mRNA molecules have N1- methylpseudouridine bases instead of uridine bases.

[0049] ANTIBODIES

[0050] Also contemplated herein are antibodies raised against proteins encoded by one or more mRNA molecules as described herein. As used herein, an “antibody” refers to antibodies raised against proteins encoded by one or more mRNA molecules as described herein and synthetic immunoglobulin molecules and antibody fragments, which contain the antigen binding site of an antibody raised against one or more mRNA molecules. As such, the term antibody encompasses not only whole antibody molecules, but also antibody multimers and antibody fragments as well as variants (includingderivatives) of antibodies, antibody multimers and antibody fragments. Examples of molecules which are described by the term “antibody” herein include: single chain Fvs (scFvs), Fab fragments, Fab’ fragments, F(ab’)2, disulfide linked Fvs (sdFvs), Fvs, and fragments comprising or alternatively consisting of, either a VL or a VH domain. As used herein, an “anti-membrane-bound gB antibody” refers an antibody comprising the antigen binding site of an antibody raised against a membrane-bound gB protein.Similarly, an “anti-membrane-bound 0RF4 antibody” refers an antibody comprising the antigen binding site of an antibody raised against a membrane-bound 0RF4 protein.

[0051] In some embodiments, the antibodies are monoclonal antibodies (i.e., a laboratory-made antibody via, e.g., recombinant DNA and / or hybridoma techniques). In some embodiments, the antibodies are polyclonal antibodies. Compositions comprising antibodies against one or more mRNA molecules as described herein are also contemplated. In some embodiments, the compositions comprise antibodies against one or more membrane-bound gB proteins. In some embodiments, the compositions comprise antibodies against one or more membrane-bound ORF4 proteins. In some embodiments, the compositions comprise antibodies against one or more membranebound gB proteins and one or more membrane-bound ORF4 proteins. In some embodiments, the compositions are immune sera, which may be a single immune serum sample or pooled immune sera from several subjects. In some embodiments, the immune sera comprise antibodies against one or more membrane-bound gB proteins. In some embodiments, the immune sera comprise antibodies against one or more membrane-bound ORF4 proteins. In some embodiments, the immune sera comprise antibodies against one or more membrane-bound gB proteins and one or more membrane-bound ORF4 proteins.

[0052] The mRNA molecules, nucleic acid molecules encoding the mRNA molecules, and antibodies described herein may be substantially purified.

[0053] KITS AND COMBINATION PRODUCTS

[0054] In some embodiments, the present invention provides kits and combination products comprising one or more KSHV therapeutics packaged together. In some embodiments, the kits and combination products comprise one or more nucleic acid molecules (e.g., mRNA molecules) that encode one or more membrane-bound proteins as described herein. In some embodiments, a mRNA molecule that encodes a membrane-bound gB protein and a mRNA molecules that encodes a membrane-bound ORF4 protein are packaged together as separate compositions or as an admixture. Insome embodiments, the kits comprise an mRNA molecule that encodes both a membrane-bound gB protein and a membrane-bound ORF4 protein, which when the mRNA molecule is administered to a cell or a subject, the proteins are expressed as separate, distinct membrane-bound proteins. In some embodiments, the kits and combination products comprise one or more anti-membrane-bound gB antibodies and one or more anti-membrane-bound ORF4 antibodies are packaged together as separate compositions or as an admixture.

[0055] The kits and combination products may be packaged together with one or more reagents or drug delivery devices. In some embodiments, the one or more KSHV therapeutics are, optionally in one or more unit dosage forms, packaged together as a pack and / or in drug delivery device, e.g., a pre-filled syringe.

[0056] In some embodiments, the kits include a carrier, package, or container that may be compartmentalized to receive one or more containers, such as vials, tubes, and the like. In some embodiments, the kits optionally include an identifying description or label or instructions relating to its use. In some embodiments, the kits include information prescribed by a governmental agency that regulates the manufacture, use, or sale of compounds and compositions as contemplated herein.

[0057] TREATMENT METHODS

[0058] The mRNA molecules encoding one or more membrane-bound gB proteins and / or one or more membrane-bound ORF4 proteins may be employed as KSHV therapeutics to, e.g., inhibit, reduce, or treat a KSHV infection or disease. As used herein “KSHV therapeutics” include mRNA molecules that encode the membrane-bound proteins described herein as well as antibodies against the membrane-bound proteins. As used herein, a “KSHV infection or disease” refers to infections by KSHV and diseases where KSHV is believed by those skilled in the art to be the etiological agent, such infections and diseases include Kaposi’s Sarcoma (KS), primary effusion lymphoma (PEL), and multicentric Castleman disease (MCD). That is, contemplated herein are methods of inhibiting, reducing, or treating a KSHV infection or disease in a subject which comprise administering to the subject one or more KSHV therapeutics, e.g., an mRNA molecule that encodes a membrane-bound gB protein and / or an mRNA molecule that encodes a membrane-bound ORF4 protein.

[0059] In some embodiments, a subject is administered a composition which comprises a mixture of mRNA molecules that encode at least one membrane-bound gB protein and at least one membrane-bound ORF4 proteins. In some embodiments, one mRNA moleculeencodes both a membrane-bound gB protein and a membrane-bound ORF4 protein. For example, a subject may be administered a mRNA molecule that encodes a membranebound gB protein and an mRNA molecule that encodes a membrane-bound ORF4 protein. In some embodiments, the subject is administered a single (albeit multiple copies) mRNA molecule that encodes both a membrane-bound gB protein and a membrane-bound ORF4 protein, which are expressed in the subject as separate, distinct proteins.

[0060] In some embodiments, a subject is administered a first composition comprising one or more anti-membrane-bound gB antibodies and a second composition comprising one or more anti-membrane-bound ORF4 antibodies. In some embodiments, a subject is administered a composition comprising a mixture of one or more anti-membrane-bound gB antibodies and one or more anti-membrane-bound ORF4 antibodies.

[0061] Administration of two or more KSHV therapeutics may be by co-administration.As used herein, “co-administration” refers to the administration of at least two different agents, z.e., a first agent and a second agent (e.g., an membrane-bound gB protein and a membrane-bound ORF4 protein, which one, or both may be provided in the form of an mRNA molecule or a cell that expresses the membrane-bound protein on its surface) to a subject. In some embodiments, the first agent may either a membrane-bound gB protein or a membrane-bound ORF4 protein (which may be provided in the form of an mRNA molecule or a cell that expresses the given protein on its surface) and the second agent may be an antibody against the other membrane-bound protein. In some embodiments, the co-administration is concurrent. In embodiments involving concurrent co- administration, the agents may be administered as a single composition, e.g., an admixture, or as two separate compositions. In some embodiments, the first agent is administered before and / or after the administration of the second agent. Where the co- administration is sequential, the administration of the first and second agents may be separated by sites of administrations or a period of time, e.g., minutes, hours, or days. Those of skill in the art understand that the formulations and / or routes of administration of the various agents or therapies used may vary. The appropriate dosage for co- administration can be readily determined by one skilled in the art. In some embodiments, when two or more agents are co-administered, the respective agents are administered at lower dosages than appropriate for their administration alone.

[0062] COMPOSITIONS

[0063] Compositions, including pharmaceutical compositions and vaccines, comprising, consisting essentially of, or consisting of one or more KSHV therapeutics are contemplated herein. The term “pharmaceutical composition” refers to a composition suitable for pharmaceutical use in a subject. A composition generally comprises an effective amount of an active agent and a diluent and / or carrier. A pharmaceutical composition generally comprises a therapeutically effective amount or an immunogenic amount, of an active agent and a pharmaceutically acceptable carrier.

[0064] As used herein, an “effective amount” refers to a dosage or amount sufficient to produce a desired result. The desired result may comprise an objective or subjective change as compared to a control in, for example, in vitro assays, and other laboratory experiments. As used herein, a “therapeutically effective amount” refers to an amount that may be used to treat, prevent, or inhibit a given disease or condition in a subject as compared to a control, such as a placebo. Again, the skilled artisan will appreciate that certain factors may influence the amount required to effectively treat a subject, including the degree of the condition or symptom to be treated, previous treatments, the general health and age of the subject, and the like. Nevertheless, effective amounts and therapeutically effective amounts may be readily determined by methods in the art.

[0065] The one or more KSHV therapeutics may be administered, preferably in the form of pharmaceutical compositions, to a subject. Preferably the subject is mammalian, more preferably, the subject is human. Preferred pharmaceutical compositions are those comprising at least one KSHV therapeutic in a therapeutically effective amount or an immunogenic amount, and a pharmaceutically acceptable vehicle.

[0066] In some embodiments, a therapeutically effective amount or an immunogenic amount of an mRNA molecule that encodes one or more membrane-bound proteins described herein ranges from about 10-100 pg / dose, preferably about 25-35 pg / dose, more preferably about 30 pg / dose. In some embodiments, the immunogenic amounts for initial and boosting immunizations with an mRNA molecule for therapeutic or prophylactic administration ranges from about 0.01-0.1 mg / dose.

[0067] In the case of antibodies, in some embodiments, a therapeutically effective amount ranges from about 1-50 mg / kg body weight.

[0068] Vaccines provide a protective immune response when administered to a subject.As used herein, a “vaccine”, is a pharmaceutical composition that comprises an immunogenic amount of at least one KSHV therapeutic and provides a protective immune response when administered to a subject. The protective immune response maybe complete or partial, e.g., a reduction in symptoms as compared with an unvaccinated subject. As used herein, an “immunogenic amount” is an amount that is sufficient to elicit an immune response in a subject and depends on a variety of factors such as the immunogenicity of the given KSHV therapeutic, the degree of KSHV infection or disease, the manner of administration, the general state of health of the subject, and the like.

[0069] Examples of suitable immunization protocols include an initial immunization injection (time 0), followed by two booster injections at 4 and 8 weeks, which these initial immunization injections may be followed by further booster injections at 1 or 2 years, if needed.

[0070] KSHV therapeutics may be administered as single doses or as a series of several doses. The dosages used for treatment may increase or decrease over the course of a given treatment. Optimal dosages for a given set of conditions may be ascertained by those skilled in the art using dosage-determination tests and / or diagnostic assays in the art. Dosage-determination tests and / or diagnostic assays may be used to monitor and adjust dosages during the course of treatment.

[0071] The KSHV therapeutics may be administered in combination with an adjuvant.As used herein, an “adjuvant” refers to any substance which, when administered in conjunction with e.g., before, during, or after) a pharmaceutically active agent, such as a KSHV therapeutic as disclosed herein, aids the pharmaceutically active agent in its mechanism of action. Thus, an adjuvant in a vaccine is a substance that aids the at least one KSHV therapeutic in eliciting an immune response. Suitable adjuvants include incomplete Freund’s adjuvant, alum, aluminum phosphate, aluminum hydroxide, N- acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl- D-isoglutamine (CGP 11637, nor-MDP), N-acetylmuramyl-Lalanyl-D-isoglutaminyl-L- alanine-2-(r-2’-dipa-lmitoyl-sn-glycero-3-hydroxyphosphoryloxy)-ethylamine (CGP 19835 A, MTP-PE), and RIB I, which comprise three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (NPL+TDM+CWS) in a 2% squalene / Tween 80 emulsion, CpG-containing oligodeoxynucleotide (CpG ODN), agonists of toll-like receptor 9 (TLR9), Polyinosine- polycytidylic acid (polyEC), agonists of toll-like receptor 9 (TLR3), lipid nanoparticles (LNPs) and LNPs encapsulating phosphothioate-linked polyuridlyic acid (polyUs), and agonists of toll-like receptor 7 (TLR7). The effectiveness of an adjuvant may be determined by methods in the art.

[0072] Pharmaceutical compositions may be formulated for the intended route of delivery and administered to subjects accordingly using methods in the art. Suitable routes of delivery include intraileal, intravenous, intravenous bolus, intravenous drip, intraventricular, nasal, oral, oropharyngeal, parenteral, percutaneous, subcutaneous, transdermal, and transmucosal. Preferably, the administration is intramuscular. It will be appreciated that the preferred route of administration and pharmaceutical formulation will vary with the condition and age of the subject, the nature of the condition to be treated, the therapeutic effect desired, and the particular KSHV therapeutic used.

[0073] Pharmaceutical compositions may include one or more of the following: a pharmaceutically acceptable vehicle, pH buffered solutions, adjuvants (e.g., preservatives, wetting agents, emulsifying agents, and dispersing agents), liposomal formulations, nanoparticles, dispersions, suspensions, or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions. The compositions and formulations may be optimized for increased stability and efficacy using methods in the art. See, e.g., Carra et al., (2007) Vaccine 25:4149-4158.

[0074] As used herein, a “pharmaceutically acceptable vehicle” or “pharmaceutically acceptable carrier” are used interchangeably and refer to solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, that are compatible with pharmaceutical administration and comply with the applicable standards and regulations, e.g., the pharmacopeial standards set forth in the United States Pharmacopeia and the National Formulary (USP-NF) book, for pharmaceutical administration. Thus, for example, unsterile water is excluded as a pharmaceutically acceptable carrier for, at least, intravenous administration.Pharmaceutically acceptable vehicles include those known in the art. See, e.g., Remington: The Science and Practice of Pharmacy 20th ed (2000) Lippincott Williams & Wilkins, Baltimore, MD.

[0075] The pharmaceutical compositions may be provided in dosage unit forms. As used herein, a “dosage unit form” refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of the one or more KSHV therapeutic calculated to produce the desired therapeutic effect in association with the required pharmaceutically acceptable carrier. The specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the given KSHV therapeutic and desired therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.1

[0076] Toxicity and therapeutic efficacy of KSHV therapeutics according to the instant invention and compositions thereof can be determined using cell cultures and / or experimental animals and pharmaceutical procedures in the art. For example, one may determine the lethal dose, LCso (the dose expressed as concentration x exposure time that is lethal to 50% of the population) or the LDso (the dose lethal to 50% of the population), and the EDso (the dose therapeutically effective in 50% of the population) by methods in the art. The dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50 / ED50. KSHV therapeutics which exhibit large therapeutic indices are preferred. While KSHV therapeutics that result in toxic sideeffects may be used, care should be taken to design a delivery system that targets such compounds to the site of treatment to minimize potential damage to uninfected cells and, thereby, reduce side-effects.

[0077] The data obtained from the cell culture assays and animal studies can be used in formulating a range of dosages for use in humans. Preferred dosages provide a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage may vary depending upon the dosage form employed and the route of administration utilized. Therapeutically effective amounts and dosages of one or more KSHV therapeutics can be estimated initially from cell culture assays. A dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (z.e., the concentration of the test compound which achieves a half- maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma may be measured, for example, by high performance liquid chromatography. Additionally, a dosage suitable for a given subject can be determined by an attending physician or qualified medical practitioner, based on various clinical factors.

[0078] The following examples are intended to illustrate but not to limit the invention.

[0079] EXAMPLES

[0080] The amino acid sequence of the exemplary membrane-bound gB protein employed in the experiments herein comprises SEQ ID NO: 8, and was encoded by SEQ ID NO: 1, wherein all indicated uridines are Nkmethylpseudouridine.

[0081] The amino acid sequence of the exemplary membrane-bound ORF4 protein employed in the experiments herein comprises SEQ ID NO: 9, and was encoded by SEQ ID NO: 2, wherein all indicated uridines are Nkmethylpseudouridine.

[0082] For comparative experiments, soluble forms of the membrane-bound proteins were used. The soluble gB protein comprises amino acids 25-683 of SEQ ID NO: 8 and the soluble ORF4 protein comprises amino acids 20-527 of SEQ ID NO: 9.

[0083] Mice and Immunizations

[0084] 6-10 week old female C57B1 / 6J mice (The Jackson Laboratory, Bar Harbor, ME #000664) or BALB / cJ (The Jackson Laboratory, Bar Harbor, ME #000651) were immunized with 10 pg of soluble ORF4, soluble gB or both soluble proteins or PBS in a 50 pL volume intramuscularly using insulin syringes (Becton, Dickinson, and Company (BD), Franklin Lakes, NJ #329461) at the described time points. Soluble proteins were premixed with adjuvants and injected in the same volume described above. ODN2395 or ODN1018 CpG adjuvant was purchased from Invivogen (#vac-2395-lor #vac-1018-l).21-mer polyU with phosphothioate linkages (polyUs) was custom synthesized by IDT. Lipid nanoparticles were prepared using a self-assembly process using methods in the art; the ionizable cationic lipid and LNP composition are described WO 2017 / 004143, which is herein incorporated by reference in its entirety. At the experimental endpoint, mice were euthanized, and blood was collected by cardiac puncture with tuberculin syringes (BD #309623). Serum was collected by centrifugation in serum gel tubes (Sarstedt, Numbrecht, Germany #41.1378.005) and heat inactivated at 56 °C for 30 minutes before storage at -80 °C.

[0085] ELISA

[0086] ELISA plates were prepared by coating with soluble gB protein or soluble ORF4 protein, 1 pg / ml in carbonate-bicarbonate buffer. Coated 96-well plates were blocked with assay buffer consisting of DPBS with 2.5% BSA (%w / v), 2.5% normal goat serum (%v / v) (Equitech-Bio, Kerrville, TX #SG-0500), 0.005% Tween-20 (%v / v) (Fisher Scientific #BP337-500), and 0.005% Triton X-100 (%v / v) (Fisher Scientific #BP151-500) and stored at -80 °C until use. All serum samples and secondary antibodies were diluted in assay buffer. Coated plates were washed with DPBS containing 0.1% (vol / vol) Tween 20 (PBS-T) twice for 3 minutes. Plates were then washed twice with PBS-T before the addition of 50 pL serially diluted immune serum.6-8 wells per plate were incubated with assay buffer containing no primary antibody as a background control. Plates were incubated for 1-2 hours at room temperature on an orbital shaker. Plates were washed with PBS-T twice for 3 minutes, then twice quickly before the addition of 50 pL 1:4000 goat anti-mouse HRP secondary antibody (ThermoFisher Scientific #62-6520) or 1:5000 KPL peroxidase-labeled goat anti-human IgG (gamma) (LGC Clinical Diagnostics #474-1002). Secondary antibody was incubated for 1 hour at room temperature with shaking. Plates were then washed once with PBS-T for 3 minutes, then four times quickly. After one final wash with PBS (no Tween-20), 100 pL 1-Step Ultra TMB ELISA Substrate (Thermo Fisher Scientific #34028) was added to each well. Plates were covered to protect them from light and incubated at room temperature for 30 minutes with shaking. Signal development was stopped by the addition of 100 pL 1 M sulfuric acid (Sigma-Aldrich #1603131000) and the optical density at 450 nm (OD450) was measured with a ClarioStar plate reader (BMG Labtech, Cary, NC). Endpoint ELISA titer was defined as the first dilution before the OD450 dropped below the average signal from PBS-immunized serum at a 1: 1000 dilution.

[0087] Complement-Mediated Neutralization

[0088] KSHV neutralization was performed by infection of 20,000 HEK293 cells seeded overnight in a 96 well plate. The amount of virus used was calculated to give about 10% GFP+ cells for samples without neutralization. All assays comparing complement enhanced neutralization were performed using spin infection. Immune serum was diluted in DMEM containing 10% heated fetal bovine serum (FBS) for complementindependent neutralization or diluted in DMEM containing 10% normal human serum (NHS, Complement Technology Inc., Tyler, TX). 25 pl of diluted serum was mixed with 25 pl of diluted virus at a 1:1 ratio and incubated at 37 °C for 1 hour. 50 pL of the serum / virus mixture was added onto cells and the plate was spun at 500 g for 20 minutes and incubated at 37 °C for 2 hours. The inoculum was removed, replaced with growth medium, and incubated for an additional 2 days. Infection was measured by flow cytometry for GFP+ cells. The relative infection (% of mock) was calculated as (%GFPimmune serum / %GFPPBS mock serum)* 100, where %GFPPBS mock serum is the percentage of cells expressing GFP from wells infected with virus mixed with the PBS mock immune serum diluted in FBS and %GFPimmune serum is from experimental wells infected with virus mixed with the serum samples from mice immunized with KSHV viral proteins.

[0089] Significant neutralization is defined as a reduction in relative infection greater than 90% compared to the mock-immunized control. The neutralization titer 90 (NT90) refers to the dilution of a serum samples at which more than 90% of infection is inhibited relative to the mock-immune serum control. NT90 was chosen over NT50 to better distinguish antibody responses with truly potent neutralization from those with moderate neutralization.The virion was prepared by ultra-centrifuging the supernatants collected an iSLK cell line infected with KSHV. iSLK is an epithelial cell line that express a viral transcriptional activator RTA under the doxycycline-inducible promoter. Latent KSHV was induced to enter lytic replication with 7.5 pg / ml of doxycycline and 2.5 mM sodium butyrate (NaB) to produce virions. The supernatant was harvested five days post-reactivation and then titrated on 293 cells. The amount of virions used for neutralization resulted in 5-10% GFP-positive cells after two days of infection in the absence of incubating with any serum samples.

[0090] Immunofluorescence Assay

[0091] iSLK cells stably infected with KSHV were reactivated for one day with 7.5 pg / mL doxycycline and 2.5 mM sodium butyrate (NaB). Cells were then replaced with fresh growth media without dox and NaB and one day later they were fixed with 4% paraformaldehyde (Electron Microscopy Sciences; catalog number 15710) in DPBS for 15 minutes at room temperature without shaking. Cells were washed 3 times with PBS for 5 minutes and blocked with IFA buffer consisting of DPBS with 10% (vol / vol) heat- inactivated FBS and 3% (wt / vol) BSA for 1 hour at room temperature with orbital shaking. Cells were incubated with the pooled immune serum sample diluted at 1:200 in IFA buffer overnight at 4°C on a rocker. After primary incubation, cells were washed 3 times with PBS for 5 minutes before the addition of goat anti-mouse IgG(H+L)- Alexa Fluor 594 secondary antibody (Thermo Fisher Scientific; catalog number Al 1032) diluted at 1:2000 in IFA buffer. Cells were covered to protect them from light and incubated with secondary antibody for 2 hours at room temperature on an orbital shaker. Secondary antibody was removed, and nuclei were stained with 1:10,000 aqueous Hoescht 33342 solution (Thermo Fisher Scientific; #H3570) diluted in IFA buffer for 10 minutes at room temperature, protected from light, with orbital shaking. Cells were washed three times for 5 minutes with PBS before being visualized by fluorescence microscopy.

[0092] Complement Deposition Assay

[0093] 293 transfected with the ORF4 or gB expression plasmid using BioT transfection reagent (Bioland Scientific LLC, Paramount, C A; #B01). One day later, a total of 100,000 cells were placed in a 96-well V-bottom plate and washed twice with FACS buffer. Cells were then incubated in 50 pL PBS containing the pooled immune sera from either the ORF'4-protein based vaccine or the ORF4-mRNA vaccine diluted 1: 200 and 10% normal human serum for 2 hours at 37°C. Cells were washed twice with FACS buffer and stain first with Fixable Viability Dye eFluor 780 at a 1: 1000 dilution in PBSfor 10 minutes at room temperature. Then stained with the following antibodies at a 1: 100 dilution in PBS for at least 30 minutes at 4 °C: Clq-PE clone 1A4 (Sarita Cruz Biotechnology #sc-53544 PE) and C3b-APC clone 3E7 (Biolegend, San Diego, CA; #846106). Cells were washed twice and then analyzed on an Attune NxT flow cytometer equipped with a plate reader with single color controls for compensation.

[0094] EXEMPLIFIED mRNA SEQUENCES

[0095] SEQ ID NO: 1 - mRNA membrane-bound gB:atgaccccccgctcccgcctggccaccctgggcaccgtgatcctgctggtgtgcttctgcgccgg cgccgcccactcccgcggcgacaccttccagacctcctcctcccccaccccccccggctcctcct ccaaggcccccaccaagcccggcgaggaggcctccggccccaagtccgtggacttctaccagttc cgcgtgtgctccgcctccatcaccggcgagctgttccgcttcaacctggagcagacctgccccga caccaaggacaagtaccaccaggagggcatcctgctggtgtacaagaagaacatcgtgccccaca tcttcaaggtgcgccgctaccgcaagatcgccacctccgtgaccgtgtaccgcggcctgaccgag tccgccatcaccaacaagtacgagctgccccgccccgtgcccctgtacgagatctcccacatgga ctccacctaccagtgcttctcctccatgaaggtgaacgtgaacggcgtggagaacaccttcaccg accgcgacgacgtgaacaccaccgtgttcctgcagcccgtggagggcctgaccgacaacatccag cggtacttctcccagcccgtgatctacgccgagcccggctggttccccggcatctaccgcgtgcg caccaccgtgaactgcgagatcgtggacatgatcgcccgctccgccgagccctacaactacttcg tgacctccctgggcgacaccgtggaggtgtcccccttctgctacaacgagtcctcctgctccacc accccctccaacaagaacggcctgtccgtgcaggtggtgctgaaccacaccgtggtgacctactc cgaccgcggcacctcccccaccccccagaaccgcatcttcgtggagaccggcgcctacaccctgt cctgggcctccgagtccaagaccaccgccgtgtgccccctggccctgtggaagaccttcccccgc tccatccagaccacccacgaggactccttccacttcgtggccaacgagatcaccgccaccttcac cgcccccctgacccccgtggccaacttcaccgacacctactcctgcctgacctccgacatcaaca ccaccctgaacgcctccaaggccaagctggcctccacccacgtgcccaacggcaccgtgcagtac ttccacaccaccggcggcctgtacctggtgtggcagcccatgtccgccatcaacctgacccacgc ccagggcgactccggcaaccccacctcctccccccccccctccgcctcccccatgaccacctccg cctcccgccgcaagcgccgctccgcctccaccgccgccgccggcggcggcggctccaccgacaac ctgtcctacacccagctgcagttcgcctacgacaagctgcgccccggcatcaaccaggtgctgga ggagctgtcccgcgcctggtgccgcgagcaggtgcgcgacaacctgatgtggtacgagctgtcca agatcaaccccacctccgtgatgaccgccatctacggccgccccgtgtccgccaagttcgtgggc gacgccatctccgtgaccgagtgcatcaacgtggaccagtcctccgtgaacatccacaagtccct gcgcaccaactccaaggacgtgtgctacgcccgccccctggtgaccttcaagttcctgaactcct ccaacctgttcaccggccagctgggcgcccgcaacgagatcatcctgaccaacaaccaggtggag acctgcaaggacacctgcgagcactacttcatcacccgcaacgagaccctggtgtacaaggacta cgcctacctgcgcaccatcaacaccaccgacatctccaccctgaacaccttcatcgccctgaacc tgtccttcatccagaacatcgacttcaaggccatcgagctgtactcctccgccgagaagcgcctg gcctcctccgtgttcgacctggagaccatgttccgcgagtacaactactacacccaccgcctggc cggcctgcgcgaggacctggacaacaccatcgacatgaacaaggagcggttcgtgcgcgacctgt ccgagatcgtggccgacctgggcggcatcggcaagaccgtggtgaacgtggcctcctccgtggtg accctgtg cggctccctggt ga ccgg ct teat caacttcatcaagcaccccctgggcggcat get gatgatcatcatcgtgatcgccatcatcctgatcatcttcatgctgtcccgccgcaccaacacca tcgcccaggcccccgtgaagatgatctaccccgacgtggaccgccgcgcccccccctccggcggc gcccccacccgcgaggagatcaagaacatcctgctgggcatgcaccagctgcagcaggaggagcg ccagaaggccgacgacatgaagaagtccaccccctccgtgttccagcgcaccgccaacggcctgc gccagcgcctgcgcggctacaagcccctgacccagtccctggacatctcccccgagaccggcgag wherein all T’s are U’s, preferably all T's are N^methylpseudouridine bases.

[0096] SEQ ID NO: 2 - mRNA membrane-bound ORF4:atggccttcctgcgccagaccctgtggatcctgtggaccttcaccatggtgatcggccaggacaa cgagaagtgctcccagaagaccctgatcggctaccgcctgaagatgtcccgcgacggcgacatcgccgtgggcgagaccgtggagctgcgctgccgctccggctacaccacctacgcccgcaacatcacc gccacctgcctgcagggcggcacctggtccgagcccaccgccacctgcaacaagaagtcctgccc caaccccggcgagatccagaacggcaaggtgatcttccacggcggccaggacgccctgaagtacg gcgccaacatctcctacgtgtgcaacgagggctacttcctggtgggccgcgagtacgtgcgctac tgcatgatcggcgcctccggccagatggcctggtcctcctccccccccttctgcgagaaggagaa gtgccaccgccccaagatcgagaacggcgacttcaagcccgacaaggactactacgagtacaacg acgccgtgcacttcgagtgcaacgagggctacaccctggtgggcccccactccatcgcctgcgcc gtgaacaacacctggacctccaacatgcccacctgcgagctggccggctgcaagttcccctccgt gacccacggctaccccatccagggcttctccctgacctacaagcacaagcagtccgtgaccttcg cctgcaacgacggcttcgtgctgcgcggctcccccaccatcacctgcaacgtgaccgagtgggac ccccccctgcccaagtgcgtgctggaggacatcgacgaccccaacaactccaaccccggccgcct gcaccccacccccaacgagaagcccaacggcaacgtgttccagcggtccaactacaccgagcccc ccaccaagcccgaggacacccacaccgccgccacctgcgacaccaactgcgagcagccccccaag atcctgcccacctccgagggcttcaacgagaccaccacctccaacaccatcaccaagcagctgga ggacgagaagaccacctcccagcccaacacccacatcacctccgccctgacctccatgaaggcca agggcaacttcaccaacaagaccaacaactccaccgacctgcacatcgcctccacccccacctcc caggacgacgccaccccctccatcccctccgtgcagacccccaactacaacaccaacgcccccac ccgcaccctgacctccctgcacatcgaggagggcccctccaactccaccacctccgagaaggcca ccgcctccaccctgtcccacaactcccacaagaacgacaccggcggcatctacaccaccctgaac aagaccacccagctgccctccaccaacaagcccaccaactcccaggccaagtcctccaccaagcc ccgcgtggagacccacaacaagaccacctccaaccccgccatctccctgaccgactccgccgacg tgccccagcgcccccgcgagcccaccctgccccccatcttccgcccccccgcctccaagaaccgc tacctggagaagcagctggtgatcggcctgctgaccgccgtggccctgacctgcggcctgatcac cctgttccactacctgttcttccgcwherein all T’s are U’s, preferably all T's are N^methylpseudouridine bases.

[0097] REFERENCES

[0098] The following references are herein incorporated by reference in their entirety with the exception that, should the scope and meaning of a term conflict with a definition explicitly set forth herein, the definition explicitly set forth herein controls:WO 2017 / 004143US 20240123059Dollery SJ. Towards Understanding KSHV Fusion and Entry. Viruses. 2019 Nov 18;11(11). PMCID: PMC6893419Ferlay, et al. Estimates of worldwide burden of cancer in 2008: GLOBOCAN 2008. Int J Cancer. 2010 Dec 15;127(12):2893-2917. PMID: 21351269Hong & Kwak. Both sides now: evolutionary traits of antigens and B cells in tolerance and activation. Front Immunol. 2024 Aug 9; 15: 1456220.Ito, etal. Structure of the Kaposi’s sarcoma-associated herpesvirus gB in post-fusion conformation. J Virol. 2025 Feb 25;99(2):e0153324. PMCID: PMC11852774 Kariko, et al. Suppression of RNA Recognition by Toll-like Receptors: The Impact of Nucleoside Modification and the Evolutionary Origin of RNA. Immunity. 2005 Aug;23(2): 165-175.Kariko, et al. Incorporation of Pseudouridine Into mRNA Yields Superior Nonimmunogenic Vector With Increased Translational Capacity and Biological Stability. Molecular Therapy. 2008 Nov;16(ll):1833-1840.Lam, et al. Immunization of Mice with Virus-Like Vesicles of Kaposi Sarcoma- Associated Herpesvirus Reveals a Role for Antibodies Targeting ORF4 in Activating Complement-Mediated Neutralization. Jung JU, editor. J Virol. 2023 Feb 28;97(2):e01600-22.Myoung & Ganem. Generation of a doxycycline-inducible KSHV producer cell line of endothelial origin: maintenance of tight latency with efficient reactivation upon induction. J Virol Methods. 2011 Jun; 174(1-2): 12-21. PMCID: PMC3095772 Neuberger & Rajewsky. Activation of mouse complement by monoclonal mouse antibodies. Eur J Immunol. 1981;11 (12): 1012— 1016.Plummer, et al. Global burden of cancers attributable to infections in 2012: a synthetic analysis. The Lancet Global Health. 2016 Sep;4(9):e609-e616.Spiller, etal. Complement Regulation by Kaposi’s Sarcoma- Associated Herpesvirus ORF4 Protein. Journal of Virology. 2003 Jan l;77(l):592-599.Vollmer B, et al. The prefusion structure of herpes simplex virus glycoprotein B. Sci Adv. 2020 Sep;6(39):eabcl726.

[0099] All scientific and technical terms used in this application have meanings commonly used in the art unless otherwise specified.

[0100] As used herein, “and / or” means “and” or “or”. For example, “A and / or B” means “A, B, or both A and B” and “A, B, C, and / or D” means “A, B, C, D, or a combination thereof’ and said “A, B, C, D, or a combination thereof’ means any subset of A, B, C, and D, for example, a single member subset (e.g., A or B or C or D), a two-member subset (e.g., A and B; A and C; efc.), or a three-member subset (e.g., A, B, and C; or A, B, and D; efc.), or all four members (e.g., A, B, C, and D).

[0101] As used herein, the phrase “one or more of’, e.g., “one or more of A, B, and / or C” means “one or more of A”, “one or more of B”, “one or more of C”, “one or more of A and one or more of B”, “one or more of B and one or more of C”, “one or more of A and one or more of C” and “one or more of A, one or more of B, and one or more of C”.

[0102] As used herein, the phrase “consists essentially of’ in the context of a given ingredient in a composition, means that the composition may include additional ingredients so long as the additional ingredients do not adversely impact the activity,e.g., biological or pharmaceutical function, of the given ingredient. In the context of a mRNA molecule sequence, “consists essentially of’ means that the sequence of the mRNA molecule may have additional amino acid sequences fused one or both termini so long as the additional amino acid sequences are not normally associated therewith in the corresponding, naturally-occurring protein expressed by KSHV. In the context of compositions, “consists essentially of’ means that the composition may comprise additional ingredients so long as additional ingredients do not degrade or irreversibly modify the one or more mRNA molecules therein.

[0103] The phrase “comprises, consists essentially of, or consists of A” is used as a tool to avoid excess page and translation fees and means that in some embodiments the given thing at issue: comprises A, consists essentially of A, or consists of A. For example, the sentence “In some embodiments, the composition comprises, consists essentially of, or consists of A” is to be interpreted as if written as the following three separate sentences: “In some embodiments, the composition comprises A. In some embodiments, the composition consists essentially of A. In some embodiments, the composition consists of A.”

[0104] Similarly, a sentence reciting a string of alternates is to be interpreted as if a string of sentences were provided such that each given alternate was provided in a sentence by itself. For example, the sentence “In some embodiments, the composition comprises A, B, or C” is to be interpreted as if written as the following three separate sentences: “In some embodiments, the composition comprises A. In some embodiments, the composition comprises B. In some embodiments, the composition comprises C.” As another example, the sentence “In some embodiments, the composition comprises at least A, B, or C” is to be interpreted as if written as the following three separate sentences: “In some embodiments, the composition comprises at least A. In some embodiments, the composition comprises at least B. In some embodiments, the composition comprises at least C.”

[0105] As used herein, the terms “subject”, “patient”, and “individual” are used interchangeably to refer to humans and non-human animals. The terms “non-human animal” and “animal” refer to all non-human vertebrates, e.g., non-human mammals and non-mammals, such as non-human primates, horses, sheep, dogs, cows, pigs, chickens, and other veterinary subjects and test animals. In some embodiments, the subject is a mammal. In some embodiments, the subject is a human.

[0106] As used herein, the term “sample” is used in its broadest sense and includes specimens and cultures obtained from any source, as well as biological samples andenvironmental samples. Biological samples may be obtained from animals (including humans) and encompass fluids, solids, tissues, and gases. Biological samples include blood products, such as plasma, serum, and the like. A biological sample can be obtained from a subject using methods in the art.

[0107] As used herein, an “isolated” compound refers to a compound that is isolated from its native environment. For example, an isolated polynucleotide is a one which does not have the bases normally flanking the 5’ end and / or the 3’ end of the polynucleotide as it is found in nature. As another example, an isolated polypeptide is a one which does not have its native amino acids, which correspond to the full-length polypeptide, flanking the N-terminus, C-terminus, or both.

[0108] As used herein, a “substantially purified” compound refers to a compound that is removed from its natural environment and / or is at least about 60% free, preferably about 75% free, and more preferably about 90% free, and most preferably about 95-100% free from other macromolecular components or compounds with which the compound is associated with in nature or from its synthesis.

[0109] As used herein, the terms “protein”, “polypeptide” and “peptide” are used interchangeably to refer to two or more amino acids linked together. Groups or strings of amino acid abbreviations are used to represent peptides. Except when specifically indicated, peptides are indicated with the N-terminus on the left and the sequence is written from the N-terminus to the C-terminus. Except when specifically indicated, peptides are indicated with the N-terminus on the left and the sequences are written from the N-terminus to the C-terminus. Similarly, except when specifically indicated, nucleic acid sequences are indicated with the 5’ end on the left and the sequences are written from 5’ to 3’.

[0110] As used herein, a compound (e.g., receptor or antibody) “specifically binds” a given target (e.g., ligand or epitope) if it reacts or associates more frequently, more rapidly, with greater duration, and / or with greater binding affinity with the given target than it does with a given alternative, and / or indiscriminate binding that gives rise to nonspecific binding and / or background binding. As used herein, “non-specific binding” and “background binding” refer to an interaction that is not dependent on the presence of a specific structure (e.g., a given epitope).

[0111] As used herein, “binding affinity” refers to the propensity of a compound to associate with (or alternatively dissociate from) a given target and may be expressed in terms of its dissociation constant, Kd. In some embodiments, the antibodies have a Kd of 10'5or less, 10'6or less, preferably 10'7or less, more preferably 10'8or less, evenmore preferably 10'9or less, and most preferably IO'10or less, to their given target.Binding affinity can be determined using methods in the art, such as equilibrium dialysis, equilibrium binding, gel filtration, immunoassays, surface plasmon resonance, and spectroscopy using experimental conditions that exemplify the conditions under which the compound and the given target may come into contact and / or interact. Dissociation constants may be used determine the binding affinity of a compound for a given target relative to a specified alternative. Alternatively, methods in the art, e.g, immunoassays, in vivo or in vitro assays for functional activity, etc., may be used to determine the binding affinity of the compound for the given target relative to the specified alternative. Thus, in some embodiments, the binding affinity of the antibody for the given target is at least 1-fold or more, preferably at least 5-fold or more, more preferably at least 10-fold or more, and most preferably at least 100-fold or more than its binding affinity for the specified alternative.

[0112] As used herein, a given percentage of “sequence identity” refers to the percentage of nucleotides or amino acid residues that are the same between sequences, when compared and optimally aligned for maximum correspondence over a given comparison window, as measured by visual inspection or by a sequence comparison algorithm in the art, such as the BLAST algorithm, which is described in Altschul et al., (1990) J Mol Biol 215:403-410. Software for performing BLAST (e.g., BLASTP and BLASTN) analyses is publicly available through the National Center for Biotechnology Information (ncbi.nlm.nih.gov). The comparison window can exist over a given portion, e.g., a functional domain, or an arbitrarily selection a given number of contiguous nucleotides or amino acid residues of one or both sequences. Alternatively, the comparison window can exist over the full length of the sequences being compared. For purposes herein, where a given comparison window (e.g, over 80% of the given sequence) is not provided, the comparison window is over the entire length of the given comparison sequence. Additionally, for the percentages of sequence identity of the proteins provided herein, the percentages are determined using BLASTP 2.8.0+, scoring matrix BLOSUM62, and the default parameters available at blast.ncbi.nlm.nih.gov / Blast.cgi. See also Altschul, et al., (1997) Nucleic Acids Res 25:3389-3402; and Altschul, et al., (2005) FEBS J 272:5101-5109. An amino acid residue of a given sequence that “corresponds” to an amino acid position of a reference sequence refers to the residue that aligns with the position when the sequences are optimally aligned.

[0113] Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv Appl Math 2:482 (1981), by thehomology alignment algorithm of Needleman & Wunsch, J Mol Biol 48:443 (1970), by the search for similarity method of Pearson & Lipman, PNAS USA 85:2444 (1988), by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by visual inspection.

[0114] To the extent necessary to understand or complete the disclosure of the present invention, all publications, patents, and patent applications mentioned herein are expressly incorporated by reference therein to the same extent as though each were individually so incorporated.

[0115] Having thus described exemplary embodiments of the present invention, it should be noted by those skilled in the art that the within disclosures are exemplary only and that various other alternatives, adaptations, and modifications may be made within the scope of the present invention. Accordingly, the present invention is not limited to the specific embodiments as illustrated herein, but is only limited by the following claims.

Claims

What is claimed is:

1. A mRNA molecule which encodes a membrane-bound protein comprising a signal-anchor peptide fused to the N-terminus of (a) a gB protein sequence, or (b) an ORF4 protein sequence, said mRNA molecule comprises(1)(a) a gB encoding sequence that encodes the gB protein sequence which comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 3, or (b) an ORF4 encoding sequence that encodes the ORF4 protein sequence which comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 4; and(2) a signal-anchor encoding sequence that encodes the signal-anchor peptide;wherein the mRNA molecule has N'-methylpseudouridine bases instead of uridine bases.

2. The mRNA molecule according to claim 1, wherein the signal-anchor peptide comprises, consists essentially of, or consists of an amino acid sequence that is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 5 or SEQ ID NO: 6.

3. The mRNA molecule according to claim 1 or claim 2, wherein, in the gB protein sequence, (a) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10 ) or TTQT ( SEQ ID NO: 11 );(b) the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is D or P and / or the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G or P;(c) when the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G, then the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is other than D, preferably the amino acid residue is P;(d) when the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is D, then the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is other than G, preferably the amino acid residue is P;(e) at least one of the amino acids corresponding to positions 446 and 447 of SEQ ID NO: 3 is P;(f) the amino acid residues corresponding to positions 446 and 447 of SEQ ID NO: 3 are P and G, respectively;(g) the amino acid residue corresponding to position 784 of SEQ ID NO: 3 is M or L, preferably M;(h) the amino acids residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10 ) or TTQT ( SEQ ID NO: 11 ); and at least one of the amino acid residues corresponding to positions 446 and 447 of SEQ ID NO: 3 is P;(i) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10 ), the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is P, and the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G;(j) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10 ), and the amino acid residue corresponding to position 784 of SEQ ID NO: 3 is M;(k) the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is P, the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G, and the amino acid residue corresponding to position 784 of SEQ ID NO: 3 is M; or(l) the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10 ), the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is P, the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G, and the amino acid residue corresponding to position 784 of SEQ ID NO: 3 is M.

4. The mRNA molecule according to any one of claims 1 - 3, wherein, in the gB protein sequence, the amino acid residues corresponding to positions 413-416 of SEQ ID NO: 3 are RKRR ( SEQ ID NO: 10 ), the amino acid residue corresponding to position 446 of SEQ ID NO: 3 is P, the amino acid residue corresponding to position 447 of SEQ ID NO: 3 is G, and the amino acid residue corresponding to position 784 of SEQ ID NO: 3 is M.

5. The mRNA molecule according any one of claims 1 - 4, wherein, in the gB protein sequence, one or more amino acid residues corresponding to positions 155, 230, 251, 331, 344, 348, 361, 575, 590, and 605 of SEQ ID NO: 3 are other than N.

6. The mRNA molecule according to any one of claims 1 - 5, wherein the signal-anchor peptide is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 5.

7. The mRNA molecule according to any one of claims 1 - 6, wherein the membrane-bound protein is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 7 or SEQ ID NO: 8.

8. The mRNA molecule according to claim 1 or claim 2, wherein the membrane-bound protein comprises the ORF4 protein sequence and the signal-anchor peptide fused thereto is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 6.

9. The mRNA molecule according to any one of claims 1, 2, and 8, wherein the membranebound protein is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 9.

10. The mRNA molecule according to any one of claims 1 - 9, wherein the sequence of the mRNA molecule is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 1 or SEQ ID NO: 2; wherein all indicated uridines are N1-methylpseudouridine.

11. The mRNA molecule according to claim 10, wherein the sequence of the mRNA molecule is at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% identical to SEQ ID NO: 1, wherein all indicated uridines are N1-methyl pseudouridine, and the codon that encodes the amino acid residue corresponding to position 446 of SEQ ID NO: 3 encodes P.

12. A composition, a kit, or a combination product comprising one or more mRNA molecules according to any one of claims 1 - 11.

13. A composition, a kit, or a combination product comprising(1) a first mRNA molecule according to any one of claims 1 - 7, and 11, said first mRNA molecule encodes the signal-anchor peptide fused to the N-terminus of the gB protein sequence; and(2) a second mRNA molecule according to any one of claims 8 - 10, said second mRNA molecule encodes the signal-anchor peptide fused to the N-terminus of the ORF4 protein sequence.

14. The composition, a kit, or a combination product according to claim 12 or claim 13, further comprising an antibody raised against an antigen comprising (a) amino acids 25-683 of SEQ ID NO: 8, or (b) amino acids 20-527 of SEQ ID NO: 9.

15. The composition, a kit, or a combination product according to claim 14, which comprises an mRNA molecule that encodes the signal-anchor peptide fused to the N-terminus of the gB protein sequence and an antibody raised against the antigen comprising amino acids 20-527 of SEQ ID NO: 9; or an mRNA molecule that encodes the signal-anchor peptide fused to the N-terminus of the ORF4 protein sequence and an antibody raised against the antigen comprising amino acids 25-683 of SEQ ID NO: 8.

16. Polyclonal antibodies produced by administering to a subject an immunogenic amount of one or more mRNA molecules according to any one of claims 1 - 11, optionally in combination with an adjuvant; and thereafter separating the polyclonal antibodies from blood obtained from the subject.

17. The polyclonal antibodies according to claim 16, wherein the polyclonal antibodies are separated from the blood at least two weeks after administration of the immunogenic amount.

18. The polyclonal antibodies according to claim 16 or claim 17, wherein the polyclonal antibodies are separated from the blood up to 3 months after administration of the immunogenic amount.

19. The polyclonal antibodies according to any one of claims 16 - 18, wherein the polyclonal antibodies are in the form of immune serum.

20. A method of inhibiting, reducing, or treating a KSHV infection or disease in a subject, which comprises administering to the subject(a) one or more mRNA molecules according to any one of claims 1 - 11;(b) the composition or combination product according to any one of claims 12 - 15; and / or (c) polyclonal antibodies according to any one of claims 16 - 19.

Images