Methods for barcoding capsules and uses thereof

Abstract

The present disclosure relates generally to methods of barcoding capsules and uses thereof.

Description

Attorney Docket No. 002806- 000158WOPTMETHODS FOR BARCODING CAPSULES AND USES THEREOFRELATED APPLICATIONS

[0001] This application claims benefit under 35 U.S.C. § 119(e) of the U.S. Provisional Application No. 63 / 747,613 filed on January 21, 2025, the content of which is incorporated herein by reference in its entirety.GOVERNMENT SUPPORT

[0002] This invention was made with government support under HG012771 and CA278392 awarded by National Institutes of Health (NIH). The government has certain rights in the invention.TECHNICAL FIELD

[0003] The technology described herein relates to methods for barcoding capsules and uses thereof.BACKGROUND

[0004] There remains a need in the art for methods and strategies for high-throughput combinatorial drug or perturbation screening on cells growing in particles, e.g., capsules such as core-shell capsules. This disclosure addresses this need.SUMMARY

[0005] This work is directed to methods related to a use-case of core shell capsules, e.g., as described in Fig. 23 of PCT publication no. W02024030526A1 (“Core Shell Capsules and Uses Thereof’) to Harvard University, contents of which are incorporated by reference in their entireties. Accordingly, provided herein are methods for exploring large number of treatment conditions on living cells. To do this, as shown in Fig. 1 one can grow cells within capsules and then subject them to different treatment conditions in a plate. The capsules can be transferred iteratively between treatment conditions, such that cells sample one of a large number of unique sequences of treatments. By pooling the capsules between steps and then splitting them at random (“split-and-pool”), the capsules can explore all possible combinations of treatment. For example, one capsule will be exposed to well Al in step 1, and well B8 in step 2, and well E12 in step 3, and so on. Another capsule would sample a different sequence of steps. Optionally, the capsules can be washed between steps.14917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0001] During treatment, the capsules can be labeled in a manner that allows later identification of the exact sequence of treatments that each capsule was exposed to. In some embodiments, as shown in Fig. 2A, the capsules are prepared with modifications to the shell or to the core, which then facilitate the attachment of a single- or double-stranded DNA or RNA molecule to the capsules during each step, with the DNA or RNA molecule carrying a DNA barcode that is unique to each treatment and step. As shown in Fig. 2B, the DNA barcodes can be attached in one of two methods: in Method 1, the barcodes labeling treatment step 1 are attached to the capsules via the modifications to the shell or core; and the barcodes labeling subsequent steps 2,3,4, and so on, are each sequentially attached to the end of the prior DNA or RNA molecule. In Method 2, the barcodes labeling treatment step 1 are again attached to the capsules via the modifications to the shell or core as in Method 1; but the barcodes labeling subsequent steps 2,3,4 are attached to the same modifications to result in a parallel library.

[0002] After treatment, as shown schematically in Fig. 2B, cells in the capsules can be analyzed to determine their phenotype, for example by generating an RNA-Seq library via split-and-pool barcoding as described PCT publication no. W02024030526, and the identity of the sequence of treatments for each capsule is determined. In this manner, it becomes possible to relate treatment sequences to outputs. In one embodiment, all capsules are analyzed. In another embodiment, the capsules are first sorted to select for a desired phenotype and some treatment sequences are enriched. In both cases, the sequences are determined upon completion of the experiment.

[0003] Any known method can be used to carry out barcoding of capsules during split-and-pool treatment sequences. For example, Method 1 and Method 2 described in FIG. 2B can be used to carry out barcoding of capsules during split-and-pool treatment sequences.

[0004] Methodi:

[0005] Method 1 is depicted in FIGS. 3A-3C. The workflow generates DNA molecules attached to capsules. The DNA molecules encode a sequence of treatment steps that a capsule has undergone.1. As shown in Fig. 2A-2B, the method entails pre-attachment of a linker to capsules. In this method, the linker shown in Fig. 3A consists of an oligonucleotide with sequence 0 followed by sequence 1’.a. For example, as shown in Fig. 3A a 5’-Acryd-[0]-[l’] oligonucleotide bearing an Acrydite modification is added to the capsule shell mix during capsule production. This oligonucleotide will become incorporated into the capsule shell during photo-polymerization. [0] refers to a specific sequence, and 24917-1608-4613 1Attorney Docket No. 002806- 000158WOPToptionally can include a random sequence. [T] refers to a second specific sequence. Sequence [1 ’] may be modified by a 3’ phosphate group, or it may include a Uridine that can be cleaved by USER enzyme to generate a free 3’ end with phosphate group.i. The sequence [0] may be suitable for PCR amplification and may be suitable for generating a sequencing library. E.g the sequence [O]=CTCTTTCCCTACACGACGCTCTTC (SEQ ID NO: 1) is a fragment of the PEI sequence for Illumina sequencing.2. As shown in Fig- 3A, the method makes use of m x n barcoding oligonucleotide elements in order to record m steps, and n treatment conditions per step. An additional m “blocker oligos” are used in between treatment steps.a. For example, as shown in Fig.3A, the barcoding oligonucleotide elements may each consist of one of n dsDNA barcodes, with two overhangs encoding m adapter sequences.b. Optionally, only n barcoding oligonucleotide elements can be used, with a single adapter sequence.3. As shown in Fig- 3B, the barcode oligonucleotide elements are added at each of m steps.a. Prior to treatment (step 0), the capsules are generated.b. In step k, the capsules are split into n parallel treatments, where the barcode oligonucleotide elements of the form [U|-[bcl,...,n]-|U+7’] are dissolved in solution. The adapter sequence [&] hybridizes to the complementary sequence [U] that terminates the sequence attached to the capsule. A ligation reaction is used to covalent attach the barcodes. For example, for step 1 (k= 1), the barcode oligonucleotide elements are [7]-[bcl,...,n]-[2’].c. Free ‘blocker oligo’ [U] is then added to each of the treatment wells to block remaining unused barcode nucleotide elements.d. The capsules are then pooled and washed.e. The step advances, now k<-k+l. Steps b-e repeat until all treatment steps are completed.4. As shown in Fig.3B, each capsule encodes a sequence of barcodes xltx2, ... , xm, where each of the steps xkE [1, n].34917-1608-4613 1Attorney Docket No. 002806- 000158WOPT5. As shown in Fig. 3C, upon completion of the treatment, the capsules will have fully elongated DNA initiating with sequence [0] and terminating with sequence [F], These sequences record the history of treatments for each capsule.

[0006] Although the schematics show just one DNA molecule per capsule, this approach generates multiple full-length DNA molecules. Every capsule contains a large number of molecules. Any molecules that fail to ligate at one step will cease to be extended in further steps. As a result, only full-length molecules will contain the final sequence [F], which can be used to selectively amplify or enrich full-length molecules for subsequent analysis. Upon sequencing, the full treatment history of a capsule can be identified.

[0007] Method 2: Parallel barcode addition

[0008] Method 2 is depicted in FIGS. 4A-4C. The method attaches a set of separate DNA molecules, which encode the sequence of treatment steps that a capsule has undergone. DNA molecules are attached via a series of conjugation reactions. Unlike Method 1, this method does not require use of an enzymatic reaction. However, it does not chain barcodes together.1. During capsule synthesis, reactive conjugation groups are added to the capsule core or shell. Eg. Includes click-chemistry and bioconjugation reagents. For example, capsule’s shell / core can be functionalized with a set of conjugation chemistry groups, such as Azide / Dibenzocyclooctyne (DBCO) tetrazine / Z / vw / .s-cyclooctene (TCO) or Streptavidin / Biotin moieties. In one example, the conjugation groups can be linked to capsules via acrydite modification. Such as Tetrazine-PEGx-Acrylate, TCO-PEGx- acrylate and streptavidin-acrylate2. During cell treatment steps, a DNA oligo housing a barcode sequence for a specific condition modified with a conjugation chemistry reaction group is added. In one example, DBCO modifies DNA oligo when added to a reaction mix will react with azide moiety inside a capsule in a physiological condition. This covalently links a DNA barcode to a capsule. Only one set of click-chemistry groups is used.3. During subsequent treatment, a different reactive group housing DNA barcode is used, which will be linked to a capsule via a different conjugation reaction. For example, a DNA barcode housing tetrazine modification is conjugated to TCO group. In the end, capsules housing multiple barcodes for the different conditions they have encored are processed via scRNA-seq. In one such example, the conjugated condition barcodes are captured during reverse-transcription reaction, generating dsDNA molecules suitable44917-1608-4613 1Attorney Docket No. 002806- 000158WOPTfor split-and-pool barcoding described in PCT publication no. W02024030526, contents of which are incorporated herein by reference in their entireties.4. During the step of in-capsule DNA barcoding, attached condition DNA oligos will receive a capsule specific barcode, enabling linking the genomic redout to a specific condition.BRIEF DESCRIPTION OF THE DRAWINGS

[0009] This patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0010] FIG. 1 is a schematic representation of the method described herein.

[0011] FIGS. 2A-2B are schematic representations of an exemplary method for appending a “condition” DNA barcode to the capsules. Capsules can be synthesized to house a conjugation group - DNA stub for a ligation reaction, streptavidin / biotin group or click chemistry moiety. As capsules are subjected to different conditions, conjugation groups react with a modified DNA barcode corresponding to that specific condition. As shown in FIG.2B, the process can be repeated several times by performing step-wise barcode ligation (Method 1) or by appending the barcodes via different conjugation group (Method 2). The appended barcodes, corresponding to unique set of conditions can be captured and identified during genomic sequencing protocols.

[0012] FIGS. 3A-3C describe the Method 1 described in FIG. 2B. FIG. 3A depicts the exemplary DNA oligonucleotide components needed for n treatment conditions over each of m treatment steps to implement Method 1. FIG.3B is a schematic representation of Method 1 showing barcoding steps with sequential elongation over m steps. FIG. 3C is a schematic representation of Method 1 showing N capsules after completion of m treatment steps. In FIGS. 3A-3C, the linker chemistry (acrydite) can be switched for other linker chemistries. An apostrophe (‘) indicates a reverse-complement sequence.

[0013] FIGS. 4A-4C describe the Method 1 described in FIG. 2B. FIG. 4A depicts the exemplary DNA oligonucleotide components needed to implement Method 2. FIG. 4B is a schematic representation of Method 2 showing the sequence of barcoding of a single capsule during treatment. FIG. 4C depicts a schematic showing the sequence of barcoding of N capsules during treatment.54917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0014] FIG. 5A: Micrographs showing methods for linking molecules to capsule’s shell and core polymers. No linker control shows no retention of the fluorescence. Scale bar = 50 pm.

[0015] FIG. 5B: Micrographs showing methods for linking molecules to longer DNA molecules that are stably retained inside capsules. No linker control shows no retention of the fluorescence. Scale bar = 50 pm.

[0016] FIG. 6 : Schematic for multiple barcode addition to a shell immobilized stub oligo. Ligation reaction can be performed after every barcode addition reaction (steps 1-3) or after final barcode addition (step 3). Following this, adapter sequences (such as poly-A tail) can be used to facilitate the capture of the barcode molecules for sequencing library preparation.

[0017] FIG. 7A: Micrographs showing that barcode DNA amplified using primers labeled with 6-FAM is only produced if a ligation reaction is carried out to link all the barcodes into a contiguous molecule. Ligation reactions were performed in three different buffers (IX T4 DNA ligase buffer, DPBS or IMDM supplemented with lOmM MgC12, lOmM DTT and ImM ATP) in series (after each round) or as a single reaction after the final barcode addition (one reaction).

[0018] FIG. 7B: 3-Step ligation barcode DNA amplified in capsules produced DNA fragments of expected size (FIG. 6).

[0019] FIG. 8: Schematic representing capsule barcoding via adapter ligation to a DNA molecule that is too large to diffuse out. DNA housing other adapter sequences (etc. Poly-A tail for capture using poly-T primer mediated reverse transcription; overhanging ends for ligation) is used as a scaffold to retain short DNA adapter barcodes added in series (step 1-3). The molecule is then captured via standard sequencing library preparation procedures (for example, RNA-seq, step 4-5).

[0020] FIG. 9 : Schematic representing sequences used for CAGE barcoding using a scaffold DNA. xxxxxx corresponds to one of the barcodes used.

[0021] FIG. 10: Experimental design for barcoding CAGEs using two sets of ligation barcodes (1-6 and 7-12) to test the barcode cross-contamination occurring after CAGEs are pooled.

[0022] FIG. 11 : Schematic representing the experimental design for barcoding CAGEs using a scaffolding DNA with which 3 barcodes were (left). DNA fragment size analysis of DNA purified from CAGEs after the barcoding experiment (right).64917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0023] FIG. 12: Example sequencing reads obtained from CAGE barcoding. Top row is used as a general annotation of the reads.

[0024] FIG. 13: Heatmap representing occurrences of different barcodel - barcode2 pairs. Only minimal occurrences of unexpected barcodes (1-6 with 7-12) are observed with most barcodes detected at shallow sequencing depth (5000 reads).

[0025] FIG. 14: Bar plots representing the frequency of correct barcode pairs for each ligation 1 barcode.DETAILED DESCRIPTION

[0026] One aspect of any of the embodiments is a method of barcoding particles, the method comprising: (a) dividing a plurality of particles into two or more sub-pluralities; (b) treating each sub-plurality under at least one treatment condition, wherein during said treatment condition, a treatment-specific barcode is associated with the particles in each sub-plurality, and wherein the treatment condition for at least one sub-plurality is different from the treatment condition of at least one other sub-plurality; (c) reforming the plurality by combining the two or more sub-pluralities; and (d) optionally repeating steps a) to c) a desired number of times.

[0027] As used herein, “treating” refers to the exposure of a plurality or sub-plurality of particles to a specific condition, e.g., a “treatment condition”. Such treatment can, for example, lead to the association of a barcode with a particle undergoing the treatment. Such a barcode is referred to a “treatment-specific barcode” herein.

[0028] As used herein, a "barcode", "barcode sequence" or “barcode strand” generally refers a single-stranded nucleic acid that is 5-10 nucleotides in length and encodes data. In some embodiments, a barcode strand is 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, a barcode strand may be more than 10 nucleotides in length. In some embodiments, a barcode strand may be assigned a bit value of 0 or 1. In some embodiments, a barcode strand may be read using a nucleic acid sequencing technology. In some embodiments, the sequence of the barcode strand may be determined through the use of complementary sequences labeled with detectable moieties such as fluorophores, quantum dots, peptide tags, beads e.g., agarose, latex, magnetoresponsive, chromatic), polymer dots, nanoparticles, additional docking sites, tags such as biotin, or functional groups such that their presence may be detected e.g., by fluorescence microscopy, fluorescent scanners, optical scanners and the like.

[0029] As used herein, the term “nucleic acid” or “nucleic acid sequence” refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid,74917-1608-4613 1Attorney Docket No. 002806- 000158WOPTdeoxyribonucleic acid or an analog thereof. The nucleic acid can be either single-stranded or double-stranded. A single-stranded nucleic acid can be one nucleic acid strand of a denatured double- stranded DNA. Alternatively, it can be a single-stranded nucleic acid not derived from any double-stranded DNA. In one aspect, the nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA. Suitable DNA can include, e.g., genomic DNA or cDNA. Suitable RNA can include, e.g., mRNA.

[0030] As used herein, “associating” refers to interactions between one or more components in the systems described herein, e.g., a particle and a barcode. An association can be reversible and / or non-covalent, or it can be irreversible and / or covalent. An association can occur under a certain set of conditions, and be reversed under another set of conditions. An association can be through a noncovalent bond such as a hydrogen bond, ionic bond, van der Waals forces, or hydrophobic interaction. A nucleic acid barcode can be associated with the particle by either its 5’-end or by its 3’-end. An association can also be one caused by steric hinderance or physical containment. An association can also be transient. As used herein, the term “transient binding” or a “transient association” refers to weak, reversible, and / or temporary, specific interactions between molecules, i.e., readout molecules with a binding affinity such that they can bind and unbind repeatedly. Such binding affinity can be measured using a dissociation constant, Kd.

[0031] As used herein, the term “plurality” generally refers to any number or value greater than one. A plurality may be at least 2, at least 3, at least 5, at least 10, at least 20, at least 25, at least 30, at least 40, at least 50, at least 100, at least 150, at least 200, at least 250, at least 300, at least 350, at least 400, at least 500, or at least 1,000.

[0032] In some embodiments of any of the aspects, the treatment-specific barcode comprises a condition specific portion and a treatment step specific portion.

[0033] As used herein, a “treatment-specific barcode” means a barcode that is capable of identifying the specific treatment step and / or specific condition under which it was associated with the particles undergoing the treatment. Stated in another way, a “treatmentspecific barcode” is label that can be used for later identification of the treatment step and / or condition.

[0034] As used herein, a “condition specific portion” of the treatment-specific barcode refers to a portion of the treatment-specific barcode that is specific to the condition the plurality or sub-plurality of particles is subjected to during treatment. The condition specific portion of the treatment-specific barcode can comprise a nucleic acid sequence that represents special information, an arbitrary value, or code. The condition specific portion of the treatment-specific 84917-1608-4613 1Attorney Docket No. 002806- 000158WOPTbarcode can be predetermined by a barcode library. The condition specific portion of the treatment-specific barcode can be a sequence comprising DNA, RNA, synthetic nucleobases, or any combination thereof.

[0035] As used herein, a “treatment step specific portion” of the treatment-specific barcode refers to a portion of the treatment-specific barcode that is specific to the treatment step that the plurality or sub-plurality of particles is subjected to during treatment. The treatment step specific portion of the treatment-specific barcode can comprise a nucleic acid sequence that represents special information, an arbitrary value, or code. The treatment step specific portion of the treatment-specific barcode can be predetermined by a barcode library. The treatment step specific portion of the treatment-specific barcode can be a sequence comprising DNA, RNA, synthetic nucleobases, or any combination thereof.

[0036] In some embodiments of any of the aspects, the particles in the plurality comprise a primary barcode associated therewith prior to step (a).

[0037] As used herein, a “primary barcode” refers to a barcode associated with the particles in the plurality of particles prior to carrying out any of the methods disclosed herein.

[0038] In some embodiments of any of the aspects, the primary barcode associated with the particles comprises an adaptor suitable for amplification and / or preparing a sequencing library.

[0039] As used herein, a “sequencing library” refers to a collection of prepared DNA or RNA fragments that have been tagged with specific adaptor sequences. In some embodiments, this tagging enables high-throughput analysis, such as through the use of a nextgeneration sequencing (NGS) platform.

[0040] As used herein, an “adaptor” refers to a linker that couples a first nucleotide sequence to a second nucleotide sequence. In some aspects of any of the embodiments, an adapter region can include a contiguous portion of nucleotide sequence that acts as a linker. For example, an adaptor comprises a nucleotide sequence that permits identification, recognition, and / or molecular or biochemical manipulation of the DNA to which the adaptor is attached (e.g., by providing a site for annealing an oligonucleotide, such as a primer for extension by a DNA polymerase, or an oligonucleotide for capture or for a ligation reaction). In some aspects of any of the embodiments, an adaptor region or adaptor molecule can include a binding site. Different methods to attach adaptor regions exist, including but not limited to, doing PCR with primers with 5' flanking adaptor region sequences, sticky and blunt end ligations, template-switching-mediated addition of nucleotides, or other methods to covalently attach nucleotides to the 5' end, to the 3' end, or to the 5' and 3' ends of the polynucleotides.94917-1608-4613 1Attorney Docket No. 002806- 000158WOPTThese methods can employ properties of enzymes commonly used in molecular biology. PCR can use, e.g., thermophilic DNA polymerase. Sticky ends that are complementary or substantially complementary are created through either cutting dsDNA with restriction enzymes that leave overhanging ends or through 3' tailing activities of enzymes such as TdT (terminal transferase). Sticky and blunt ends can then be ligated with a complementary adaptor region using ligases such as T4 ligase. Template-switching utilizes the 3' tailing activity of MMLV H reverse transcriptase to add one or more cytosines (Cs) to the 3' end of cDNAs and its ability to switch template from mRNA to an adaptor region with complementary G's.

[0041] In some embodiments of any of the aspects, an adaptor can include one or more ribonucleoside residues. In embodiments, an adaptor can be single-stranded or double-stranded nucleic acids, or can include single-stranded and / or double-stranded portions. In embodiments, an adaptor can have any structure, including linear, hairpin, forked, or stem-loop.

[0042] In some embodiments of any of the aspects, an adaptor can have any length, including fewer than 10 bases in length, or about 10-20 bases in length, or about 20-50 bases in length, or about 50-100 bases in length, or longer.

[0043] In some embodiments of any of the aspects, an adaptor can have any combination of blunt end(s) and / or sticky end(s). In some embodiments of any of the aspects, at least one end of an adaptor can be compatible with at least one end of a nucleic acid fragment. In some embodiments of any of the aspects, a compatible end of an adaptor can be joined to a compatible end of a nucleic acid fragment. In embodiments, an adaptor can have a 5' or 3' overhang end.

[0044] In some embodiments of any of the aspects, an adaptor can have a 5' or 3' overhang tail. In some embodiments of any of the aspects, the tail can be any length, including 1-50 or more nucleotides in length.

[0045] In some embodiments of any of the aspects, an adaptor can include an internal nick. In some embodiments of any of the aspects, an adaptor can have at least one strand that lacks a terminal 5' phosphate residue. In some embodiments of any of the aspects, an adaptor lacking a terminal 5' phosphate residue can be joined to a nucleic acid fragment to introduce a nick at the junction between the adaptor and the nucleic acid fragment.

[0046] In some embodiments of any of the aspects, an adaptor can include a nucleotide sequence that is part of, or is complementary to, any portion of a primer, or to the entire sequence of a primer, present in the amplification reaction mixture, or any portion of a sequencing primer, or the entire sequence of a sequencing primer, or any portion thereof.104917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0047] In some embodiments of any of the aspects, an adaptor can include degenerate sequences. In some embodiments of any of the aspects, an adaptor can include one or more inosine residues. In some embodiments of any of the aspects, a barcode adaptor can include a uniquely identifiable sequence. In some embodiments of any of the aspects, a barcode adaptor can be used for constructing multiplex nucleic acid libraries.

[0048] In some embodiments of any of the aspects, an adaptor can include at least one scissile linkage. In some embodiments of any of the aspects, a scissile linkage can be susceptible to cleavage or degradation by an enzyme or chemical compound. In some embodiments of any of the aspects, an adaptor can include at least one phosphorothiolate, phosphorothioate, and / or phosphoramidate linkage.

[0049] In some embodiments of any of the aspects, an adaptor can include identification sequences. In some embodiments of any of the aspects, an identification sequences can be used for sorting or tracking. In some embodiments of any of the aspects, an identification sequences can be a unique sequence (e.g., barcode sequence). In some embodiments of any of the aspects, a barcode sequence can allow identification of a particular adaptor among a mixture of different adaptors having different barcodes sequences.

[0050] In some embodiments of any of the aspects, the primary barcode comprises hybridization domain capable of hybridizing with a hybridization domain of a treatment specific barcode.

[0051] As used herein, the term “hybridization domain(s)” generally refers to either a crosslinking strand or a complementary domain. In some embodiments, a hybridization domain is a crosslinking strand, as defined herein. In some embodiments, a hybridization domain is a complementary strand, as defined herein. In some embodiments, two alternating hybridization domains refer to a single crosslinking strand and a single complementary strand. As used herein, the term “hybridize” refers to the phenomenon of a single-stranded nucleic acid or region thereof forming hydrogen-bonded base pair interactions with either another single stranded nucleic acid or region thereof (intermolecular hybridization) or with another single-stranded region of the same nucleic acid (intramolecular hybridization). Hybridization is governed by the base sequences involved, with complementary nucleobases forming hydrogen bonds, and the stability of any hybrid being determined by the identity of the base pairs (e.g., G:C base pairs being stronger than A:T base pairs) and the number of contiguous base pairs, with longer stretches of complementary bases forming more stable hybrids.

[0052] As used herein the term “complementary” generally refers to the potential for a hybridized pairing or binding interaction between two sets of nucleic acids. Complementary 114917-1608-4613 1Attorney Docket No. 002806- 000158WOPTnucleic acids are capable of binding to one another through hydrogen bond pairing according to canonical Watson-Crick base pairing and non-Watson-Crick base pairing (e.g., Wobble base pairing and Hoogsteen base pairing). In some embodiments, two sets of nucleic acids may be 100% complementary to one another. In other embodiments, two sets of nucleic acids may comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more nucleotides that are not complementary. In other embodiments, two sets of nucleic acids may be at least 50%, at least 60%, at least 70%, at least 80%, or at least 90% complementary. In some embodiments, two sets of nucleic acids are complementary so long as they are capable of forming a stable or transient complex. As used herein, the term “complementary strand” generally refers to a single-stranded nucleic acid that is 200 nucleotides or fewer in length. In some embodiments, a complementary strand may be 5-100, 5-75, 5-50, 5-25, 5-15, or 5-10 nucleotides in length. In some embodiments, a complementary strand may be 10-100, 10-50, 10-25, 10-20, 15-25, or 15-25 nucleotides in length. In some embodiments, a complementary strand may be 7 nucleotides in length. In some embodiments, a complementary strand comprises at least one detectable moiety. In some embodiments, a detectable moiety may be a fluorophore or a nanoparticle.

[0053] In some embodiments of any of the aspects, the method further comprises a step, prior to step a), of associating a primary barcode with the particles in the plurality.

[0054] In some embodiments of any of the aspects, the treatment specific barcode comprises: (i) a first hybridization domain capable of hybridizing with a hybridization domain of a barcode already associated with the particle; and (ii) a second hybridization domain capable of hybridizing with a hybridization domain of a subsequent treatment specific barcode, or an adaptor suitable for amplification and / or preparing a sequencing library.

[0055] In some embodiments of any of the aspects, the treatment specific barcode comprises a first strand and a second strand capable of hybridizing with the first strand and thereby forming a single-stranded region at each end of a double-stranded region, wherein one of the single-stranded regions comprises a first hybridization domain capable of hybridizing with a hybridization domain of a barcode already associated with the particle, and the other of the single-stranded region comprises a second hybridization domain capable of hybridizing with a hybridization domain of a subsequent treatment specific barcode, or an adaptor suitable for amplification and / or preparing a sequencing library.

[0056] In some embodiments of any of the aspects, the method further comprises, prior to step (c), blocking any unhybridized hybridization domain of the barcode already associated with the particle after step (b).124917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0057] As used herein, blocking any unhybridized hybridization domain refers to the process of using specific blocking agents to saturate non-target binding sites of a molecule, e.g., a nucleic acid, e.g., a barcode. By saturating the non-target binding sites, no hybridization is able to occur at these sites. The terms “reversible blocking group,” and “blocking moiety” when used in reference to blocking any unhybridized hybridization domain refers to a chemical moiety attached to the nucleotide sugar (e.g., deoxyribose), usually at the 3'-0 position of the sugar moiety, which prevents addition of a nucleotide by a polymerase at that position. A reversible blocking group can be cleaved by an enzyme (e.g., a phosphatase or esterase), chemical reaction, heat, light, sound, mechanical force etc., to provide a hydroxyl group at the 3 '-position of the nucleoside or nucleotide such that addition of a nucleotide by a polymerase may occur.

[0058] In some embodiments of any of the aspects, the method further comprises, after step c) and prior to step d), a step of washing the plurality of the particles.

[0059] In some embodiments of any of the aspects, the method further comprises a step of ligating together the treatment specific barcodes associated with each particle to form a concatenation of treatment specific barcodes.

[0060] As used herein, “ligating” or “ligating together” refers to covalently attaching two molecules to form a single molecule. Ligases may be used to attach a barcode to a nucleic acid molecule or a fragment thereof. As used herein, the terms “ligating”, “ligate” and their derivatives refer to a method of two or more molecules together, such as covalently linking two or more nucleic acids molecules to each other. In some embodiments, ligation can include forming a covalent bond between the 5'-end (e.g., 5’-phosphate group) of one nucleic acid molecule andthe 3’-end (e.g., 3'-hydroxyl group) of a second nucleic acid, e.g., through a phosphodiester bond. In some embodiments, ligation reactions are catalyzed by ligases. Ligase refers to a class of enzymes that catalyze the reaction by hydrolysis of ATP or similar triphosphates.

[0061] As used herein, the term “linking” refers to a physical or chemical method of associating two components, e.g., a nucleic acid barcode pair with a target analyte. In some embodiments, the linking is covalent. In some embodiments, the linking is non-covalent. In some embodiments, the linking is reversible. In some embodiments, the linking is irreversible. In some embodiments, dissociation of the linking can be induced through chemical reactions.

[0062] For instance, in certain embodiments, the barcodes may be joined using ligases. Non-limiting examples of ligases include DNA ligases such as DNA Ligase I, DNA Ligase II, DNA Ligase III, DNA Ligase IV, T4 DNA ligase, T7 DNA ligase, T3 DNA Ligase, E. coli DNA 134917-1608-4613 1Attorney Docket No. 002806- 000158WOPTLigase, Taq DNA Ligase, or the like. Many such ligases may be purchased commercially. As additional examples, in some embodiments, two or more barcodes may be ligated together using annealing or a primer extension method.

[0063] In another set of embodiments, the barcodes may be joined and / or amplified using PCR (polymerase chain reaction) or other suitable amplification techniques, including any of those recited herein. Typically, in PCR reactions, the nucleic acids are heated to cause dissociation of the nucleic acids into single strands, and a heat-stable DNA polymerase (such as Taq polymerase) is used to amplify the nucleic acid. This process is often repeated multiple times to amplify the nucleic acids.

[0064] In some embodiments, the PCR may be used to amplify the barcodes. Those of ordinary skill in the art will be aware of suitable PCR techniques and variations, such as assembly PCR or polymerase cycling assembly, which may be used in some embodiments to produce an amplified nucleic acid. Non-limiting examples of such procedures are also discussed below. In addition, in some cases, suitable primers may be used to initiate polymerization, e.g., P5 and P7, or other primers known to those of ordinary skill in the art. Those of ordinary skill in the art will be aware of suitable primers, many of which can be readily obtained commercially.

[0065] Other non-limiting examples of amplification methods known to those of ordinary skill in the art that may be used include, but are not limited to, reverse transcriptase (RT) PCR amplification, in vitro transcription amplification (IVT), multiple displacement amplification (MDA), or quantitative real-time PCR (qPCR).

[0066] In some embodiments of any of the aspects, amplifying the nucleic acid barcode molecule comprises Polymerase Chain Reaction (PCR), Rolling Circle Amplification (RCA), Loop Mediated Isothermal Amplification (LAMP), Recombinase Polymerase Amplification (RPA), Helicase-dependent isothermal DNA amplification (HDA), Nucleic acid sequencebased amplification (NASBA), strand displacement amplification (SDA), nicking enzyme amplification reaction (NEAR), polymerase Spiral Reaction (PSR), Hybridization Chain Reaction (HCR), Primer Exchange Reaction (PER), Signal Amplification by Exchange Reaction (SABER), transcription-based amplification system (TAS), Self-sustained sequence replication reaction (3 SR), Single primer isothermal amplification (SPIA), cross-priming amplification (CPA), single primer isothermal amplification (SPIA), restriction aided rolling circle amplification, reverse transcription recombinase polymerase amplification (RT-RPA), reverse transcription Loop-mediated isothermal amplification (RT-LAMP), or transcription mediated amplification (TMA).144917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0067] In some embodiments of any of the aspects, the target analyte is a nucleic acid library, e.g., a cDNA library (RNA-Seq), an amplicon library, a genomic DNA library, an ATAC-Seq or CUT&Tag library.

[0068] In some embodiments, the barcodes may be sequenced using a variety of techniques and instruments, many of which are readily available commercially. Examples of such techniques include, but are not limited to, chain-termination sequencing, sequencing-by-hybridization, Maxam-Gilbert sequencing, dye-terminator sequencing, chain-termination methods, Massively Parallel Signature Sequencing (Lynx Therapeutics), polony sequencing, pyrosequencing, sequencing by ligation, ion semiconductor sequencing, DNA nanoball sequencing, single-molecule real-time sequencing, nanopore sequencing, microfluidic Sanger sequencing, digital RNA sequencing (“digital RNA-seq”), etc. The exact sequencing method chosen is not critical.

[0069] In some embodiments of any of the aspects, the step of associating the treatment specific barcode with the particle comprises annealing the treatment specific barcode to a barcode already associated with the particle.

[0070] In some embodiments of any of the aspects, the treatment-specific barcode is covalently linked with the particle. In some embodiments of any of the aspects, the treatmentspecific barcode is covalently linked with the particle via a linker. In some embodiments of any of the aspects, the treatment-specific barcode is covalently linked with the particle via its 5’-end. In some embodiments of any of the aspects, the treatment-specific barcode is covalently linked with the particle via its 3 ’-end.

[0071] In some embodiments of any of the aspects, each treatment specific barcode comprises a reactive moiety for covalently linking with the particle. Such moieties can include, but are not limited to, maleimides, acrylamides, acrylates, N-hydroxysuccinimide esters, aldehydes, epoxides, alkynes, sulfones, keto-carbonyls, cyano groups, phosphorus fluoride exchange groups, sulver(VI) fluoride exchange groups, click chemistry groups, a,P-unsaturated carbonyls, sulfonyl fluorides, and boronic acids.

[0072] The term “linker” means an organic moiety that connects two parts of a compound. Linkers typically comprise a direct bond or an atom such as oxygen or sulfur, a unit such as NR1, C(O), C(O)O, C(O)NR1, SO, SO2, SO2NH or a chain of atoms, such as substituted or unsubstituted alkyl, substituted or unsubstituted alkenyl, substituted or unsubstituted alkynyl, arylalkyl, arylalkenyl, arylalkynyl, heteroarylalkyl, heteroarylalkenyl, heteroarylalkynyl, heterocyclylalkyl, heterocyclylalkenyl, heterocyclylalkynyl, aryl, heteroaryl, heterocyclyl, cycloalkyl, cycloalkenyl, alkylarylalkyl, alkylarylalkenyl, alkylarylalkynyl, alkenylarylalkyl, alkenylarylalkenyl,154917-1608-4613 1Attorney Docket No. 002806- 000158WOPTalkenylarylalkynyl, alkynylarylalkyl, alkynylarylalkenyl, alkynylarylalkynyl, alkylheteroarylalkyl, alkylheteroarylalkenyl, alkylheteroarylalkynyl, alkenylheteroarylalkyl, alkenylheteroarylalkenyl, alkenylheteroarylalkynyl, alkynylheteroarylalkyl, alkynylheteroarylalkenyl alkynylheteroarylalkynyl, alkylheterocyclylalkyl, alkylheterocyclylalkenyl alkylhererocyclylalkynyl, alkenylheterocyclylalkyl, alkenylheterocyclylalkenyl alkenylheterocyclylalkynyl, alkynylheterocyclylalkyl, alkynylheterocyclylalkenyl alkynylheterocyclylalkynyl, alkylaryl, alkenylaryl, alkynylaryl, alkylheteroaryl, alkenylheteroaryl, alkynylhereroaryl, where one or more methylenes can be interrupted or terminated by O, S, S(O), SO2, N(R')2, C(O), cleavable linking group, substituted or unsubstituted aryl, substituted or unsubstituted heteroaryl, substituted or unsubstituted heterocyclic; where R1is hydrogen, acyl, aliphatic or substituted aliphatic. In some embodiments, linker L is -C(O)NH-L1-, where L1is a substituted or unsubstituted alkylene, substituted or unsubstituted alkenylene, substituted or unsubstituted alkynylene. For example, L1is a Ci-Cealkylene. In some embodiments, L1is methylene, ethylene, propylene, butylene, pentylene, or hexylene.

[0073] As used herein, “covalently attached”, “covalently linked” and “covalently bonded” all refer to chemical moieties that are bound via a covalent bond.

[0074] In some embodiments of any of the aspects, at least one treatment specific barcode in a subsequent step (b) is associated directly with the particle independently of a treatment specific barcode already associated with the particle.

[0075] In some embodiments of any of the aspects, the treatment specific barcode in a subsequent step (b) comprises a reactive moiety that is different from a reactive moiety of a treatment specific barcode already associated with the particle.

[0076] In some embodiments of any of the aspects, each particle comprises two or more different reactive moieties. In some embodiments of any of the aspects, each reactive moiety comprises one member of a conjugation pair.

[0077] As used herein, a “conjugation pair” refers to a pair of reactive moieties, usually one reactive moiety of the pair being present on a first molecule and the second reactive moiety of the pair being present on a second molecule, wherein the two reactive moieties undergo a reaction to form a covalent bond. In some embodiments, where the reactive moieties are on separate molecules, the resulting covalent bond joins to the two molecules together.

[0078] In some embodiments of any of the aspects, the treatment specific barcode comprises one member of the conjugation pair and the particle comprises the other member of the conjugation pair. For example, the conjugation pair can be an azide-alkyne pair, an azidephosphine pair, a hydrazone / oxime formation, a DNA ligation pair, In some embodiments of164917-1608-4613 1Attorney Docket No. 002806- 000158WOPTany of the aspects, conjugation pairs are selected from the group consisting of azide / dibenzocyclooctyne (DBCO), tetrazine / trans-cyclootene (TCO), streptavidin / biotin, amine targeted chemistries (NHS ester / amine coupling; Carbodiimide (EDC) coupling of carboxyls to amines), thiol targeted chemistries (maleimide / thiol Michael addition; haloacetamide / thiol alkylation; disulfide formation / exchange; vinyl sulfone / thiol), click chemistry (Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC); Staudinger ligation; and enzymatic / tag ligations (SNAP -tag / CLIP -tag; HaloTag).

[0079] In some embodiments of any of the aspects, each treatment specific barcode comprises an adaptor suitable of amplification and / or preparing a sequencing library. In some embodiments of any of the aspects, the method further comprises a step of identifying the treatment specific barcodes associated with the particles.

[0080] As used herein, the term “sequencing library” refers to a collection of stored nucleic acid sequences with associated information. Each sequence and the associated information are stored in a database with information such as the sequence, pattern, structure, and label. The sequencing library can be used to decipher or read the special information contained in each barcode strand. The sequencing library can also be used to pre-determine the concatemer pattern for data storage, writing, and reading of the concatemers.

[0081] In some embodiments of any of the aspects, said step of identifying the treatment specific barcodes associated with the particles comprises reverse transcription of treatment specific barcodes associated with the particles. In some embodiments of any of the aspects, said step of identifying the treatment specific barcodes associated with the particles comprises amplifying the treatment specific barcodes associated with the particles. In some embodiments of any of the aspects, said step of identifying the treatment specific barcodes associated with the particles comprises sequencing. In some embodiments of any of the aspects, said step of identifying the treatment specific barcodes associated with the particles comprises generating a sequencing library.

[0082] As used herein, the term “nucleic acid sequencing” refers to a method of identifying individual nucleobases of a given nucleic acid. Methods of nucleic acid sequencing are known in the art such as cDNA and RNA sequencing, imaging-based methods such as NanoString and a wide range of methods that use PCR as well as qPCR. See, e.g., Sanger, F. et. al., Proc. Natl. Acad. Sci. USA, 74:5463- 5467 1977; U.S. Patent Nos. 6,025,136 and 6,018,041, 7,473,767; which are incorporated herein by reference in their entireties. In some embodiments, the method further comprises amplifying a nucleic acid sequence. As used herein, the term “amplifying” refers to a step of submitting a nucleic acid sequence to 174917-1608-4613 1Attorney Docket No. 002806- 000158WOPTconditions sufficient to allow for amplification of a polynucleotide if all of the components of the reaction are intact. Components of an amplification reaction include, e.g., primers, a polynucleotide template, polymerase, nucleotides, and the like.

[0083] Methods of amplifying and synthesizing nucleic acid sequences are known in the art. For example, see US Patent Nos. 7,906.282, 8,367,328, 5,518,900, 7,378,262, 5,476,774, and 6,638,722, contents of all of which are incorporated by reference herein in their entirety.

[0084] As used herein, the term “amplifying” refers to a step of submitting a nucleic acid strand to conditions sufficient to allow for amplification of a polynucleotide if all of the components of the reaction are intact. Components of an amplification reaction include, e.g., primers, a polynucleotide template, polymerase, nucleotides, and the like. The term “amplifying” typically refers to an “exponential” increase in target nucleic acid. However, “amplifying” as used herein can also refer to linear increases in the numbers of a select target sequence of nucleic acid, such as is obtained with cycle sequencing. Methods of amplifying and synthesizing nucleic acid sequences are known in the art. For example, see US Patent Nos.7,906.282, 8,367,328, 5,518,900, 7,378,262, 5,476,774, and 6,638,722, contents of all of which are incorporated by reference herein in their entirety. Such methods include, but are not limited to, isothermal amplification, polymerase chain reaction (PCR) and variants of PCR such as Rapid amplification of cDNA ends (RACE), ligase chain reaction (LCR), multiplex RT-PCR, immuno-PCR, SSIPA, qPCR, Real Time RT-qPCR and nanofluidic digital PCR. Accordingly, the methods described herein comprise a step of contacting the sample with a DNA polymerase and a set of primers. In some embodiments of any of the aspects, a set of primers comprises at least 2 primers and comprises a forward primer and reverse primer that amplify a target of about 50 base pairs (bp) to about 50,000 bp, unless indicated otherwise.

[0085] In some embodiments of any of the aspects, the amplification step comprises isothermal amplification. As used herein, “isothermal amplification” refers to amplification that occurs at a single temperature. For example, the amplification process is performed at a single temperature or where the major aspect of the amplification process is performed at a single temperature. Generally, isothermal amplification relies on the ability of a polymerase to copy the template strand being amplified to form a bound duplex. Isothermal amplification permits rapid and specific amplification of a target nucleic acid at a constant temperature. In general, isothermal amplification is comprised of (i) sequence-specific hybridization of primers to sequences within a target nucleic acid, and (ii) subsequent amplification involving multiple rounds of primer annealing, elongation, and strand displacement (as a non-limiting example,184917-1608-4613 1Attorney Docket No. 002806- 000158WOPTusing a combination of recombinase, single-stranded binding proteins, and DNA polymerase). The primers used in isothermal amplification are oligonucleotides of sufficient length and appropriate sequence to provide initiation of polymerization, i.e. each primer is specifically designed to be complementary to a strand of the target nucleic acid to be amplified.

[0086] Non-limiting examples of isothermal amplification include: Loop Mediated Isothermal Amplification (LAMP), Recombinase Polymerase Amplification (RPA), Helicasedependent isothermal DNA amplification (HDA), Rolling Circle Amplification (RCA), Nucleic acid sequence-based amplification (NASBA), strand displacement amplification (SDA), nicking enzyme amplification reaction (NEAR), and polymerase Spiral Reaction (PSR). See e.g., Yan et al., Isothermal amplified detection of DNA and RNA, March 2014, Molecular BioSystems 10(5), DOI: 10.1039 / c3mb70304e, the content of which is incorporated herein by reference in its entirety.

[0087] In some embodiments of any of the aspects, the isothermal amplification reaction(s) is Loop Mediated Isothermal Amplification (LAMP), i.e., the step of amplifying the target nucleic acids comprises Loop Mediated Isothermal Amplification. LAMP is a single tube technique for the amplification of DNA; LAMP uses 4-6 primers, which form loop structures to facilitate subsequent rounds of amplification. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample with a DNA polymerase and a set of primers, wherein the set of primers comprises 4, 5, or 6 loop-forming primers.

[0088] In some embodiments of any of the aspects, the isothermal amplification reaction(s) is Recombinase Polymerase Amplification (RPA), i.e., the step of amplifying the target nucleic acids comprises Recombinase Polymerase Amplification. RPA is a low temperature DNA and RNA amplification technique. The RPA process employs three core enzymes - a recombinase, a single-stranded DNA-binding protein (SSB) and strand-displacing polymerase. Recombinases are capable of pairing oligonucleotide primers with homologous sequence in duplex DNA. SSB bind to displaced strands of DNA and prevent the primers from being displaced. Finally, the strand displacing polymerase begins DNA synthesis where the primer has bound to the target DNA. By using two opposing primers, much like PCR, if the target sequence is indeed present, an exponential DNA amplification reaction is initiated. No other sample manipulation such as thermal or chemical melting is required to initiate amplification. At optimal temperatures (e.g., 37-42 °C), the RPA reaction progresses rapidly and results in specific DNA amplification from just a few target copies to detectable levels, typically within 10 minutes, for rapid detection of the target nucleic acid. In some embodiments of any of the aspects, the single-stranded DNA-binding protein is a gp32 SSB protein. In some 194917-1608-4613 1Attorney Docket No. 002806- 000158WOPTembodiments of any of the aspects, the recombinase is a uvsX recombinase. See e.g., US Patent 7,666,598, the content of which is incorporated herein by reference in its entirety. In some embodiments of any of the aspects, RPA can also be referred to as Recombinase Aided Amplification (RAA). Accordingly, in some embodiments of any of the aspects, the amplification step comprises contacting the sample with a recombinase and single-stranded DNA binding protein. In some embodiments of any of the aspects, the amplification step comprises contacting the sample with a DNA polymerase, a set of primers, a recombinase, and single-stranded DNA binding protein.

[0089] In some embodiments of any of the aspects, the isothermal amplification reaction(s) is Helicase-dependent isothermal DNA amplification (HD A). HDAuses the doublestranded DNA unwinding activity of a helicase to separate strands for in vitro DNA amplification at constant temperature. In some embodiments of any of the aspects, the helicase is a thermostable helicase, which can improve the specificity and performance of HD A; as such, the isothermal amplification reaction(s) can be thermophilic helicase-dependent amplification (tHDA). As a non-limiting example, the helicase is the thermostable UvrD helicase (Tte-UvrD), which is stable and active from 45 to 65 °C. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample with a DNA polymerase, a set of primers, and a helicase, wherein the helicase is optionally a thermostable helicase.

[0090] In some embodiments of any of the aspects, the isothermal amplification reaction(s) is Rolling Circle Amplification (RCA). RCA starts from a circular DNA template and a short DNA or RNA primer to form a long single stranded molecule. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample (e.g., a circular DNA) with a DNA polymerase and a set of primers, wherein the second set of primers comprises a single primer.

[0091] In some embodiments of any of the aspects, the isothermal amplification reaction(s) is Nucleic acid sequence-based amplification (NASBA), which is also known as transcription mediated amplification (TMA). NASBA is an isothermal technique predominantly used for the amplification of RNA through the cyclic formation of complimentary DNA and destruction of original RNA sequence (e.g., using RNase H). The NASBA reaction mixture contains three enzymes — reverse transcriptase (RT), RNase H, and T7 RNA polymerase — and two primers. T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'— 3' direction. Primer 1 (Pl) contains a 3' terminal sequence that is complementary to a sequence on the target 204917-1608-4613 1Attorney Docket No. 002806- 000158WOPTnucleic acid and a 5' terminal (+)sense sequence of a promoter that is recognized by the T7 RNA polymerase. Primer 2 (P2) contains a sequence complementary to the Pl -primed DNA strand. The NASB A enzymes and primers operate in concert to amplify a specific nucleic acid sequence exponentially. NASBA results in the amplification of the target RNA to cDNA to RNA to cDNA, etc., with alternating reverse transcription (e.g., RNA to DNA) and transcription steps (e.g., DNA to RNA), and the RNA being degraded after each transcription. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample (e.g., a cDNA) with an RNA polymerase, a reverse transcriptase, RNaseH, and a set of primers, wherein the set of primers comprise a 5’ sequence that is recognized by the RNA polymerase.

[0092] In some embodiments of any of the aspects, the isothermal amplification reach on(s) is Strand Displacement Amplification (SDA). SDAis an isothermal, in vitro nucleic acid amplification technique based upon the ability of the restriction endonuclease HincII to nick the unmodified strand of a hemiphosphorothioate form of its recognition site, and the ability of exonuclease deficient klenow (exo-klenow) DNA polymerase to extend the 3 '-end at the nick and displace the downstream DNA strand. Exponential amplification results from coupling sense and antisense reactions in which strands displaced from a sense reaction serve as target for an antisense reaction and vice versa. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample with a DNA polymerase (e.g., exo-klenow), a set of primers, and a restriction endonuclease (e.g., HincII).

[0093] In some embodiments of any of the aspects, the isothermal amplification reaction(s) is nicking enzyme amplification reaction (NEAR), which is a similar approach to SDA. In NEAR, DNA is amplified at a constant temperature (e.g., 55 °C to 59 °C) using a polymerase and nicking enzyme. The nicking site is regenerated with each polymerase displacement step, resulting in exponential amplification. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample with a DNA polymerase (e.g., exo-klenow), a set of primers, and a nicking enzyme (e.g., N.BstNBI).

[0094] In some embodiments of any of the aspects, the isothermal amplification reach on(s) is Polymerase Spiral Reaction (PSR). The PSR method employs a DNA polymerase (e.g., Bst) and a pair of primers. The forward and reverse primer sequences are reverse to each other at their 5’ end, whereas their 3’ end sequences are complementary to their respective target nucleic acid sequences. The PSR method is performed at a constant temperature 61 °C-65 °C, yielding a complicated spiral structure. Accordingly, in some embodiments of the214917-1608-4613 1Attorney Docket No. 002806- 000158WOPTaspects, the amplification step comprises contacting the sample with a DNA polymerase (e.g., exo-klenow) and a set of primers that are reverse to each other at their 5’ end.

[0095] In some embodiments of any of the aspects, the isothermal amplification reaction(s) is polymerase cross-linking spiral reaction (PCLSR). PCLSR uses three primers (e.g., two outer-spiral primers and a cross-linking primer) to produce three independent prerequisite spiral products, which can be cross-linked into a final spiral amplification product. Accordingly, in some embodiments of the aspects, the amplification step comprises contacting the sample with a DNA polymerase and a set of primers (e.g., two outer-spiral primers and a cross-linking primer).

[0096] As used herein, the term “primer” means an oligonucleotide, either natural or synthetic, which is capable, upon forming a duplex with a polynucleotide template, of acting as a point of initiation of nucleic acid synthesis and being extended from its 3' end along the template so that an extended duplex is formed. The sequence of nucleotides added during the extension process are determined by the sequence of the template polynucleotide. Primers can be extended by a DNA polymerase. Primers for use with the methods and compositions provided herein can have any desired nucleotide length and nucleic acid sequence. Generally, a primer comprises between about 10 nucleotides to about 100 nucleotides, between about 10 nucleotides to about 70 nucleotides, between about 15 nucleotides to about 50 nucleotides, between about 20 nucleotides to about 60 nucleotides and all ranges and values in between whether overlapping or not. It is noted that the primer can be any sequence that can bind to the genome. For example, the primer can comprise a mixture of random bases (e.g. N [mixture of A, C, T, G], deoxyinosine [universal base], etc.). In some embodiments of any one of the aspects, the primer can comprise only one type of nucleobase. For example, the primer can comprise all T’s, e.g., for binding to polyA sequences.

[0097] In some embodiments, the primer is a barcode. It is noted that the primers can be interrogated using methods known to those of skill in the art including fluorescently labeled oligonucleotide / DNA / RNA hybridization, primer extension with labeled nucleotides, sequencing, e.g., sequencing-by-ligation, -synthesis or -hybridization. The primers can also be interrogated using ligated circular padlock probes as described in Larsson, et al., (2004), Nat. Methods 1:227-232, content of which is incorporated herein by reference in its entirety. Ligated circular padlock can be used to detect multiple primers in parallel, followed sequencing, e.g., sequencing-by-ligation, -synthesis or -hybridization of the barcode sequences in the padlock probe to identify individual primers.224917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0098] In some embodiments, the primer can comprise a label. For example, the primer can comprise a detectable label. For example, the label is a functional group for incorporating the primer into a matrix or linking with an element for detection. Some exemplary functional groups include, but are not limited to, an amino group, a N- substituted amino group, a carboxyl group, a carbonyl group, an acid anhydride group, an aldehyde group, a hydroxyl group, an epoxy group, a thiol, a disulfide group, an alkenyl group, an azide group, a diol group, a hydrazine group, a hydrazide group, a semicarbazide group, a thiosemicarbazide group, one partner of a binding pair, an amide group, an aryl group, an ester group, an ether group, a glycidyl group, a halo group, a hydride group, an isocyanate group, an urea group, an urethane group, and any combinations thereof.

[0099] It is noted that, as used herein, the term “label” is not limited to a detectable label, but can also include any moiety which can carry out a particular or desired function. For example, detectability, such as by imaging, is just an exemplary function for a label.

[0100] In some embodiments, the label can be a detectable label. As used herein, the term “detectable label” means a moiety capable of producing a detectable signal. Detectable labels include any molecule or composition detectable by spectroscopic, photochemical, biochemical, immunochemical, electrical, electromagnetic, optical, chemical, mechanical or any other appropriate means. Suitable labels include light-absorbing dyes, fluorescent molecules, radioisotopes, nucleotide chromophores, enzymes, substrates, chemiluminescent moieties, bioluminescent moieties, mass labels, electron dense particles, magnetic particles, spin labels, charged groups, and the like. The detectable labels used in the methods described herein can be primary labels (where the label comprises a moiety that is directly detectable or that produces a directly detectable moiety) or secondary labels (where the detectable label binds to another moiety to produce a detectable signal, e.g., as is common in immunological labeling using secondary and tertiary antibodies). In some embodiments, the detectable label comprises biotin, amines, metals, metal nanoclusters (e.g., gold, silver, platinum, or copper), metal nanoparticles (e.g., gold, silver, platinum, or copper), anchoring molecules, quantum dotes, fluorescent polydots or acrydite. In some embodiments of any of the aspects, the detectable label comprises DNA origami structures (i.e., nanoscale folding of DNAto create non-arbitrary two- and three-dimensional shapes); see e.g., Rothemund, “Folding DNA to create nanoscale shapes and patterns”, Nature 440, 297-302 (2006). In some embodiments of any of the aspects, the detectable labels are detected using electron microscopy, fluorescence microscopy, dark field microscopy, or any combination thereof.234917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0101] As used herein “detectable signal” refers to a signal that can detected by appropriate means. For example, the detectable signal can be a color, an intensity orbrightness, fluorescence lifetime, fluorescence anisotropy, a color gradient, an intensity gradient, emission spectrum characteristics, absorption spectrum characteristics, energy transfer, mechanical force characteristics, light scattering and the like. In some embodiments, the detectable signal comprises a cumulative signal produced from a plurality of detectable labels (i.e., multiple copies of a given fluorophore or multiple oligos) attached to a given primer or nucleotide. Such methods can employ the use of an antibody or portion thereof, or a nanoparticle (e.g., gold nanoparticle) to carry the plurality of detectable labels and which are attached to a primer or nucleotide using, for example, a cleavable linker. A cleavable linker is one which is sufficiently stable under a first set of conditions and can be cleaved to release the two parts the cleavable linker is holding together (e.g., an antibody and detectable labels from a nucleotide; a gold nanoparticle with detectable labels and a nucleotide). Generally, cleavable linkers are susceptible to cleavage agents, e.g., photo or UV irradiation, degradative molecules (e.g., enzymes and chemicals), pH, redox potential and the like. Accordingly, the label can be attached to the nucleotide via a photo-cleavable, chemically cleavable or enzymatically cleavable linker.

[0102] A linker serves to connect a detectable label with any portion of a nucleotide or nucleic acid. In certain embodiments, the linker is connected to a nitrogenous base portion of the nucleotide or nucleotide analog. The linker can be connected to any atom on of the nitrogenous base portion of the nucleotide or analog thereof. For example, the linker can be attached to N3 of the base when the base is thymine or uracil, attached to N4 of the base when the base is cytosine or adenine, attached to Nl, N2, or 06 of the base when the base is guanine, attached to N5 when the base is y-uridine or attached to N7 of the base when the base is 9-deaza-G or 9-deaza-A.The linker can include any type of chemistry that upon contact with an activating agent results in cleavage of the linker to release the detectable label and also results in elimination of any portion of the linker that remains attached to the nucleotide analog, thereby producing the natural nucleotide. An exemplary linker is a linker that includes a disulfide bond. Additional linkers that can be used are Staudinger linkers. In certain embodiments, a cyclization reaction is used to eliminate the portion of the linker that remains attached to the nucleotide or nucleotide analog after cleavage.

[0103] In one embodiment, the label is a “fluorophore,” which is a label that is capable of emitting light when in an unquenched form (e.g., when not quenched by another agent). The fluorescent moiety emits light energy (i.e., fluoresces) at a specific emission wavelength when 244917-1608-4613 1Attorney Docket No. 002806- 000158WOPTexcited by an appropriate excitation wavelength. Exemplary fluorophores include, but are not limited to, 1,5 IAEDANS; 1,8-ANS; 4-Methylumbelliferone; 5-carboxy-2,7-di chlorofluorescein; 5-Carboxyfluorescein (5-FAM); 5-Carboxynapthofluorescein (pH 10); 5-Carboxytetramethylrhodamine (5-TAMRA); 5-FAM (5-Carboxyfluorescein); 5-Hydroxy Tryptamine (HAT); 5-ROX (carboxy-X-rhodamine); 5-TAMRA (5-Carboxytetramethylrhodamine); 6-Carboxyrhodamine 6G; 6-CR 6G; 6-JOE; 7-Amino-4-methylcoumarin; 7- Aminoactinomycin D (7-AAD); 7-Hydroxy-4-methylcoumarin; 9-Amino-6-chloro-2-methoxyacridine; ABQ; Acid Fuchsin; ACMA (9-Amino-6-chloro-2-methoxyacridine); Acridine Orange; Acridine Red; Acridine Yellow; Acriflavin; Acriflavin Feulgen SITSA; Aequorin (Photoprotein); Alexa Fluor 350™; Alexa Fluor 430™; Alexa Fluor 488™; Alexa Fluor 532™; Alexa Fluor 546™; Alexa Fluor 568™; Alexa Fluor 594™; Alexa Fluor 633™; Alexa Fluor 647™; Alexa Fluor 660™; Alexa Fluor 680™; JF 549, JF 646, JF 594, CF 488, CF 568, CF 647, CF 750, CF 660, SiR, HMSiR, Alizarin Complexon; Alizarin Red; Allophycocyanin (APC); AMC, AMCA-S; AMCA (Aminomethylcoumarin); AMCA-X; Aminoactinomycin D; Aminocoumarin; Anilin Blue; Anthrocyl stearate; APC-Cy7; APTS; Astrazon Brilliant Red 4G; Astrazon Orange R; Astrazon Red 6B; Astrazon Yellow 7 GLL; Atabrine; ATTO-TAG™ CBQCA; ATTO-TAG™ FQ; Auramine; Aurophosphine G; Aurophosphine; BAO 9 (Bisaminophenyloxadiazole); BCECF (high pH); BCECF (low pH); Berberine Sulphate; Beta Lactamase; BFP blue shifted GFP (Y66H); BG-647; Bimane; Bisbenzamide; Blancophor FFG; Blancophor SV; BOBO™-1; BOBO™-3; Bodipy 492 / 515; Bodipy 493 / 503; Bodipy 500 / 510; Bodipy 505 / 515; Bodipy 530 / 550; Bodipy 542 / 563; Bodipy 558 / 568; Bodipy 564 / 570; Bodipy 576 / 589; Bodipy 581 / 591; Bodipy 630 / 650-X; Bodipy 650 / 665-X; Bodipy 665 / 676; Bodipy Fl; Bodipy FL ATP; Bodipy Fl-Ceramide; Bodipy R6G SE; Bodipy TMR; Bodipy TMR-X conjugate; Bodipy TMR-X, SE; Bodipy TR; Bodipy TR ATP; Bodipy TR-X SE; BO-PRO™-1; BO-PRO™-3; Brilliant Sulphoflavin FF; Calcein; Calcein Blue; Calcium Crimson™; Calcium Green; Calcium Green- 1 Ca2+Dye; Calcium Green-2 Ca2+; Calcium Green-5N Ca2+; Calcium Green-C18 Ca2+; Calcium Orange; Calcofluor White; Carboxy-X-rhodamine (5-ROX); Cascade Blue™; Cascade Yellow; Catecholamine; CFDA; CFP-Cyan Fluorescent Protein; Chlorophyll; Chromomycin A; Chromomycin A; CMFDA; Coelenterazine; Coelenterazine cp; Coelenterazine f; Coelenterazine fcp; Coelenterazine h; Coelenterazine hep; Coelenterazine ip; Coelenterazine O; Coumarin Phalloidin; CPM Methylcoumarin; CTC; Cy2™; Cy3.1 8; Cy3.5™; Cy3™; Cy5.1 8; Cy5.5™; Cy5™; Cy7™; Cyan GFP; cyclic AMP Fluorosensor (FiCRhR); d2; Dabcyl; Dansyl; Dansyl Amine; Dansyl Cadaverine; Dansyl Chloride; Dansyl DHPE; Dansyl fluoride; DAPI; Dapoxyl;254917-1608-4613 1Attorney Docket No. 002806- 000158WOPTDapoxyl 2; Dapoxyl 3; DCFDA; DCFH (Diehl orodihydrofluorescein Diacetate); DDAO; DHR (Dihydorhodamine 123); Di-4-ANEPPS; Di-8-ANEPPS (non-ratio); DiA (4-Di-16-ASP); DIDS; Dihydorhodamine 123 (DHR); DiO (DiOC18(3)); DiR; DiR (DiIC18(7)); Dopamine; DsRed; DTAF; DY-630-NHS; DY-635-NHS; EBFP; ECFP; EGFP; ELF 97; Eosin; Erythrosin; Erythrosin ITC; Ethidium homodimer-1 (EthD-1); Euchrysin; Europium (III) chloride; Europium; EYFP; Fast Blue; FDA; Feulgen (Pararosaniline); FITC; FL-645; Flazo Orange; Fluo-3; Fluo-4; Fluorescein Diacetate; Fluoro-Emerald; Fluoro-Gold (Hydroxy stilbamidine); Fluor-Ruby; FluorX; FM 1-43™; FM 4-46; FuraRed™ (high pH); Fura-2, high calcium; Fura-2, low calcium; Genacryl Brilliant Red B; Genacryl Brilliant Yellow 10GF; Genacryl Pink 3G; Genacryl Yellow 5GF; GFP (S65T); GFP red shifted (rsGFP); GFP wild type, non-UV excitation (wtGFP); GFP wild type, UV excitation (wtGFP); GFPuv; Gloxalic Acid; Granular Blue; Haematoporphyrin; Hoechst 33258; Hoechst 33342; Hoechst 34580; HPTS; Hydroxycoumarin; Hydroxystilbamidine (FluoroGold); Hydroxytryptamine; Indodicarbocyanine (DiD); Indotricarbocyanine (DiR); Intrawhite Cf; JC-1; JO-JO-1; JO-PRO- 1; LaserPro; Laurodan; LDS 751; Leucophor PAF; Leucophor SF; Leucophor WS; Lissamine Rhodamine; Lissamine Rhodamine B; LOLO-1; LO-PRO-1; Lucifer Yellow; Mag Green; Magdala Red (Phloxin B); Magnesium Green; Magnesium Orange; Malachite Green; Marina Blue; Maxiion Brilliant Flavin 10 GFF; Maxiion Brilliant Flavin 8 GFF; Merocyanin; Methoxy coumarin; Mitotracker Green FM; Mitotracker Orange; Mitotracker Red; Mitramycin; Monobromobimane; Monobromobimane (mBBr-GSH); Monochlorobimane; MPS (Methyl Green Pyronine Stilbene); NBD; NBD Amine; Nile Red; Nitrobenzoxadidole; Noradrenaline; Nuclear Fast Red; Nuclear Yellow; Nylosan Brilliant lavin E8G; Oregon Green™; Oregon Green 488-X; Oregon Green™ 488; Oregon Green™ 500; Oregon Green™ 514; Pacific Blue; Pararosaniline (Feulgen); PE-Cy5; PE-Cy7; PerCP; PerCP-Cy5.5; PE-TexasRed (Red 613); Phloxin B (Magdala Red); Phorwite AR; Phorwite BKL; Phorwite Rev; Phorwite RPA; Phosphine 3R; PhotoResist; Phycoerythrin B [PE]; Phycoerythrin R [PE]; PKH26; PKH67; PMIA; Pontochrome Blue Black; POPO-1; POPO-3; PO-PRO-1; PO-PRO-3; Primuline; Procion Yellow; Propidium Iodide (PI); PyMPO; Pyrene; Pyronine; Pyronine B; Pyrozal Brilliant Flavin 7GF; QSY 7; Quinacrine Mustard; Resorufin; RH 414; Rhod-2; Rhodamine; Rhodamine 110; Rhodamine 123; Rhodamine 5 GLD; Rhodamine 6G; Rhodamine B 540; Rhodamine B 200; Rhodamine B extra; Rhodamine BB; Rhodamine BG; Rhodamine Green; Rhodamine Phallicidine; Rhodamine Phalloidine; Rhodamine Red; Rhodamine WT; Rose Bengal; R-phycoerythrin (PE); red shifted GFP (rsGFP, S65T); S65A; S65C; S65L; S65T; Sapphire GFP; Serotonin; Sevron Brilliant Red 2B; Sevron Brilliant Red 4G; Sevron Brilliant 264917-1608-4613 1Attorney Docket No. 002806- 000158WOPTRed B; Sevron Orange; Sevron Yellow L; sgBFP™; sgBFP™ (super glow BFP); sgGFP™; sgGFP™ (super glow GFP); SITS; SITS (Primuline); SITS (Stilbene Isothiosulphonic Acid); SPQ (6-methoxy-N-(3-sulfopropyl)-quinolinium); Stilbene; Sulphorhodamine B can C; Sulphorhodamine G Extra; Tetracycline; Tetramethylrhodamine; Texas Red™; Texas Red-X™ conjugate; Thiadicarbocyanine (DiSC3); Thiazine Red R; Thiazole Orange; Thioflavin 5; Thioflavin S; Thioflavin TCN; Thiolyte; Thiozole Orange; Tinopol CBS (Calcofluor White); TMR; TO-PRO-1; TO-PRO-3; TO-PRO-5; TOTO-1; TOTO-3; TriColor (PE-Cy5); TRITC (TetramethylRodaminelsoThioCyanate); True Blue; TruRed; Ultralite; Uranine B; Uvitex SFC; wt GFP; WW 781; XL665; X-Rhodamine; XRITC; Xylene Orange; Y66F; Y66H; Y66W; Yellow GFP; YFP; Y0-PR0-1; Y0-PR0-3; YOYO-1; and YOYO-3. Many suitable forms of these fluorescent compounds are available and can be used. In some embodiments, a combination of different fluorophores is used, for example, to distinguish between A, T, C, or G nucleotides (i.e., sequential fluorophores) and to reduce background noise.

[0104] Other exemplary detectable labels include chemiluminescent or bioluminescent markers (e.g., biotin, luciferase (e.g., bacterial, firefly, click beetle and the like), luciferin, aequorin, lucigenin, luminol, isoluminol, theromatic acridinium ester, imidazole, acridinium salt and oxalate ester), radiolabels (e.g.,3H,1251,35S,14C,32P, and33P), and spectral calorimetric labels such as colloidal gold or colored glass or plastic (e.g., polystyrene, polypropylene, and latex) beads.

[0105] In some embodiments of any of the aspects described herein, a detectable label can be an enzyme including, but not limited to horseradish peroxidase and alkaline phosphatase. An enzymatic label can produce, for example, a chemiluminescent signal, a color signal, or a fluorescent signal. Enzymes contemplated for use as detectable labels include, but are not limited to, malate dehydrogenase, staphylococcal nuclease, del ta-V- steroid isomerase, yeast alcohol dehydrogenase, alpha-glycerophosphate dehydrogenase, triose phosphate isomerase, horseradish peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, betagalactosidase, ribonuclease, urease, catalase, glucose- Vl-phosphate dehydrogenase, glucoamylase and acetylcholinesterase.

[0106] As used herein, “contacting” refers to any suitable means for delivering, or exposing, at least one component as provided herein (e.g., sample, a target, etc.). In some embodiments, contacting comprises physical human activity, e.g., an injection; an act of dispensing, mixing, and / or decanting; and / or manipulation of a delivery device or machine.

[0107] In some embodiments of any of the aspects, wherein at least one particle in the plurality of particles is a core shell particle or capsule, e.g., a core shell capsule.274917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0108] Capsules are semi-permeable compartments composed out of a thin shell and a hollow core. The shell is a membrane material, such as a hydrogel, or a porous hydrophobic material, or a composite of these two. Through this shell, the core exchanges small molecules with the surroundings, and thus its solvent composition will reflect that of the surrounding media in which the capsules are incubated. For what follows we consider capsules in aqueous environments such as those compatible with growing cells or carrying out biochemical and enzymatic reactions. The capsule shell acts as a selective barrier that restricts transport in and out of the hollow core for molecules depending on their physical or chemical properties. The shell may restrict transport above a certain molecule size, or as a function of its charge or affinity to shell components.

[0109] In some embodiments of any of the aspects, the capsule is a capsule with amphiphilic gel envelope (CAGE). In some embodiments of any of the aspects, the capsule is a semi-permeable capsule (SPC). In some embodiments of any of the aspects, capsules represent a physical structure for carrying out selective dialysis of molecules. The use of the word “capsule” in this context has occurred in more than one case. We specifically refer to capsules that can be formed around a sample of interest, by inducing the continuous polymerization of a shell around the sample. This can be done rapidly using micro- and macrofluidic approaches. We focus on such capsules here and their applications. In some embodiments of any of the aspects, the capsule comprises (a) a liquid core; and (b) a shell surrounding the liquid core.

[0110] In some embodiment of any one of the aspects described herein, the shell is semi-permeable. As used herein, “semi-permeable” means permeable to the passage of some molecules but not all, e.g., a selective impediment to the passage of fluids and / or substances in the fluids. Semi-permeability is one of the key functions that substantially increases the usability of capsules. In some embodiments of any one of the aspects described herein, the semi-permeable shell prevents the passage of macromolecules and cells, but allows the passage of smaller molecules. In some embodiments of any one of the aspects described herein, the passage of one or more biologically active molecules is allowed.

[0111] In some embodiments of any one of the aspects described herein, the core comprises a solute. In some embodiments of any one of the aspects described herein, the solute is a viscosity modifier. In some embodiments of any one of the aspects described herein, the solute is a sugar. In some embodiments of any one of the aspects described herein, the solute is dextran. In some embodiments of any one of the aspects described herein, the dextran has a molecular weight in the range of 3000 Daltons to 2,000,000 Daltons. In some embodiments of 284917-1608-4613 1Attorney Docket No. 002806- 000158WOPTany one of the aspects described herein, the capsule is a microcapsule. In some embodiments of any one of the aspects described herein, the capsule has a diameter of from about 1 pm to about 1000 pm. In some embodiments of any one of the aspects described herein, the capsule has a diameter of from about 5 pm to about 200 pm. In some embodiments of any one of the aspects described herein, the capsule is optically clear. In some embodiments of any one of the aspects described herein, the capsule further comprises a coating covering an outer surface of the shell, wherein the coating is a biocompatible material. In some embodiments of any one of the aspects described herein, the coating comprises a fluorinated compound, polyethylene glycol (PEG), pol oxamer, gelatin, or bovine serum albumin (BSA). In some embodiments of any one of the aspects described herein, the capsule further comprises an agent. In some embodiments of any one of the aspects described herein, the agent is in the core. In some embodiments of any one of the aspects described herein, the agent is in the shell. In some embodiments of any one of the aspects described herein, the agent is a cell, biomolecule, polymer, small organic or inorganic molecule, microorganism or organoid. In some embodiments of any one of the aspects described herein, the agent is an amino acid, peptide, polypeptide, nucleotide, oligonucleotide, polynucleotide, saccharide, oligosaccharide, or polysaccharide. In some embodiments of any one of the aspects described herein, the agent is an enzyme, an antibody, a primer nucleic acid, or a plasmid. In some embodiments of any one of the aspects described herein, the agent is a cell. In some embodiments of any one of the aspects described herein, the agent is a therapeutic agent or an imaging agent. In some embodiments of any one of the aspects described herein, the capsule further comprises a high molecular weight molecule in the core. In some embodiments of any one of the aspects described herein, the high molecular weight molecule comprises at least one functional group for forming a linkage with an agent. In some embodiments of any one of the aspects described herein, the high molecular weight molecule is a high molecular weight polymer. In some embodiments of any one of the aspects described herein, the capsule further comprises a crosslinking molecule in the shell. In some embodiments of any one of the aspects described herein, the cross-linking molecule comprises at least one functional group for forming a linkage with an agent. In some embodiments of any one of the aspects described herein, the high molecular weight molecule is a high molecular weight polymer. In some embodiments of any one of the aspects described herein, the capsule further comprises a cross-linking molecule in the shell. In some embodiments of any one of the aspects described herein, the cross-linking molecule comprises at least one functional group for forming a linkage with an agent. In some embodiments of any one of the aspects described herein, the capsule further includes one or 294917-1608-4613 1Attorney Docket No. 002806- 000158WOPTmore beads in the core. In some embodiments of any one of the aspects described herein, the bead within the capsule has a cross-linking molecule on its surface. In some embodiments of any one of the aspects described herein, the cross-linking molecule on the bead in the capsule forms a linkage with an agent, such as an antibody.

[0112] In some embodiments of any of the aspects, the capsule is prepared by a method comprising: (i) forming an emulsion comprising droplets of an aqueous phase solution disposed in a non-aqueous phase solution, wherein the droplets comprise a liquid core surrounded by a shell comprising an uncross-linked polymer blend, wherein the uncross-linked polymer blend comprises an uncross-linked polyethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer and an uncross-linked poly(ethylene glycol) diacrylate homopolymer; and (ii) cross-linking the polymer blend, and wherein the capsule comprises: (a) a liquid core; and (b) a shell surrounding the liquid core, wherein the shell comprises a cross-linked polymer blend, wherein the cross-linked polymer blend comprises a cross-linked poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer and cross-linked poly(ethylene glycol) diacrylate homopolymer.

[0113] In some embodiments of any one of the aspects described herein, the shell comprises polyethylene glycol) diacrylate homopolymer, e.g., cross-linked poly(ethylene glycol) diacrylate homopolymer. Such capsules can be produced by the methods described herein using a mixture or blend of uncross-linked poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer and uncross-linked poly(ethylene glycol) diacrylate homopolymer.

[0114] It is noted that the amount of the homopolymer, or the length of the homopolymer, or the length of the triblock copolymer, or the relative length of the different blocks of the triblock copolymer in the shell can be adjusted to optimize different shell properties such as permeability. For example, the homopolymer can be omitted from the shell. Accordingly, in another aspect, provided herein is a method for preparing a capsule, where the shell does not comprise a cross-linked homopolymer. The method comprises: (i) forming an emulsion comprising droplets of an aqueous phase solution disposed in a non-aqueous phase solution, wherein the droplets comprise a liquid core surrounded by a shell comprising a polyethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer; and (ii) cross-linking the copolymer, and wherein the capsule comprises: (a) a liquid core; and (b) a cross-linked shell surrounding the liquid core, wherein the cross-linked shell comprises a cross-linked poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) triblock copolymer.304917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0115] In one example, a single aqueous phase comprising diacrylate triblock copolymer (e.g., Pluronic® F127 DA) and dextran is mixed with a fluorinated oil to form droplets. The droplets are heated to induce micelle formation thereby initiating phase separation of dextran and diacrylate triblock copolymer (e.g., Pluronic® F127 DA) into a core:shell capsule inside the droplets.

[0116] It is noted that cross-linking can be initiated chemically or by light. Accordingly, in some embodiments of any one of the aspects described herein, the step of cross-linking comprises exposing the emulsion to ultraviolet (UV) radiation or visible light radiation. In some other embodiments, the step of cross-linking comprises adding a chemical cross-linking initiator to the emulsion.

[0117] In some embodiments of the various aspects, the step of forming the emulsion comprises mixing the aqueous phase solution with the uncross-linked copolymer or the uncross-linked polymer blend to form a first mixture and mixing the first mixture with the nonaqueous phase solution. In some embodiments of any one of the aspects described herein, the step of forming the emulsion is in a microfluidic device. In some embodiments of any one of the aspects described herein, wherein the step of forming the emulsion comprises: feeding the aqueous phase solution into a first microfluidic channel of a microfluidic device; feeding the uncross-linked copolymer or the uncross-linked polymer blend into a second microfluidic channel of the microfluidic device; feeding the non-aqueous phase solution into a fourth microfluidic channel of the microfluidic device; mixing the aqueous phase solution with the uncross-linked copolymer or the uncross-linked polymer blend at a first intersection between the first microfluidic channel and the second microfluidic channel to form a first mixture; conveying the first mixture through a third microfluidic channel toward a second intersection between the third microfluidic channel and the fourth microfluidic channel; mixing the first mixture with the non-aqueous phase solution at the second intersection to form the emulsion; and collecting the emulsion from the microfluidic device.

[0118] In some embodiments, the method further comprises adding a cross-linking initiator, e.g., a photoinitiator or a chemical cross-linking initiator to the emulsion prior to the step of cross-linking. In some embodiments, the non-aqueous phase solution comprises an oil, e.g., a fluorinated oil such as a fluorine-substituted alkylsiloxane or a fluorocarbon or a hydrofluoroether. In some embodiments, the method further comprises coating an outer surface of the cross-linked shell, e.g., with a biocompatible material. In some embodiments, the method further comprises adding an agent to the capsule. In some embodiments, the method further comprises adding a high molecular weight molecule in the liquid core. In some 314917-1608-4613 1Attorney Docket No. 002806- 000158WOPTembodiments, the method further comprises adding a cross-linking molecule in the shell, e.g., a cross-linking molecule comprising at least one functional group for forming a linkage with an agent.

[0119] Embodiments of the various aspects described herein include a homopolymer in the shell. When the homopolymer is included in the shell, an amount of the homopolymer in the shell can be higher or lower relative to an amount of the triblock copolymer (w / w or v / v). Generally, a ratio of homopolymer to triblock copolymer in the shell is from about 99:1 to about 1 :99 (w / w or v / v). For example, the ratio of homopolymer to triblock copolymer in the shell is from about 0.5:1 to about 1:50 (w / w or v / v). In some embodiments of any one of the aspects described herein, the ratio of homopolymer to triblock copolymer is from about 0.5:1 to about 1:25 (w / w or v / v). In some embodiments of any one of the aspects described herein, the ratio of homopolymer to triblock copolymer in the shell is from about 1:2 to about 1:20 (w / w or v / v). For example, the ratio of homopolymer to triblock copolymer in the shell is from about 1:2 to about 1:20, from about 1:2 to about 1:8, from about 1:8 to about 4:8, from about 1:8 to about 1:16, from about 1:2 to about 1:8, from about 0.5:8 to about 1:8, from about 4:18 to about 1 : 10, or from about 4:10 to about 1:18 (w / w or v / v).

[0120] One skilled in the art will understand that the capsules generally show a size distribution around the indicated "diameter". Unless otherwise indicated, the terms "capsule diameter" as used herein refer to the mode of size distribution of capsules, i.e., the value that appears most frequently in the size distribution. Methods for measuring capsule or particle size are known to those skilled in the art, for example, by visible light microscopy and fluorescence microscopy (for capsules of diameter l-1000pm), and (for capsules <lpm diameter) by dynamic light scattering (such as photocorrelation spectroscopy, laser diffraction, low angle laser light scattering (LALLS) and medium angle laser light scattering (MALLS)), light obscuration procedures (such as the Coulter analysis procedure), or other techniques (such as rheology and light or electron microscopy).

[0121] It is noted that the capsule described herein can be of spherical or non-spherical shape. In some embodiments of any one of the aspects described herein, the capsule can be substantially spherical. What is meant by "substantially spherical" is that the ratio of the lengths of the longest to the shortest perpendicular axes of the cross-section of the capsule is less than or equal to about 1.5. Substantially spherical does not require a line of symmetry. In addition, capsules can have surface texturing, such as lines or indentations or bumps that are small in scale compared to the total size of the capsule and still be substantially spherical. In some embodiments of any one of the aspects described herein, the ratio of lengths between the 324917-1608-4613 1Attorney Docket No. 002806- 000158WOPTlongest and shortest axes of the capsule is less than or equal to about 1.5, less than or equal to about 1.45, less than or equal to about 1.4, less or equal to about 1.35, less than or equal to about 1.30, less than or equal to about 1.25, less than or equal to about 1.20, less than or equal to about 1.15 less than or equal to about 1 , one. Without wishing to be bound by theory, surface contact is minimized in capsules that they are substantially spherical, which minimizes unwanted agglomeration of capsules during storage. Many crystals or flakes have flat surfaces that can allow large surface contact areas where agglomeration can take place by ionic or nonionic interactions. A sphere allows contact in a much smaller area.

[0122] Embodiments of the various aspects described herein include a polyethylene glycol)-poly(propylene oxide)-poly(ethylene glycol) diacrylate triblock copolymer. Generally, the poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer comprises a structure of Formula I:(Formula I).

[0123] In polymers of Formula I, x is 1-200, y is 1-200, z is 1-200, and R1and R2independently are H or Ci-Cealkyl (e.g., methyl).

[0124] Poly(ethylene glycol)-poly(propylene oxide)-poly(ethylene glycol) triblock copolymers are also referred to as poloxamers in the art and commonly known by the trade names Pluronic®, Kolliphor®, and Synperonic®. Thus, in some embodiments of any one of the aspects described herein, the triblock copolymer is a diacrylate poloxamer. For example, the triblock copolymer is a diacrylated Pluronic®.

[0125] In some embodiments of any one of the aspects described herein, the uncross-linked polyethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer has a molecular weight (Mw) of about 1,000 Daltons to about 20,000 Daltons. In some embodiments of any one of the aspects described herein, the uncross-linked poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer has a molecular weight (Mw) of about 2,000 Daltons to about 19,000 Daltons. In some embodiments of any one of the aspects described herein, the uncross-linked poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer has a molecular weight (Mw) of about 3,000 Daltons to about 18,000 Daltons. In some embodiments of any one of the aspects described herein, the uncross-linked polyethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer has a molecular weight (Mw) of 334917-1608-4613 1Attorney Docket No. 002806- 000158WOPTabout 4,000 Daltons to about 17,000 Daltons. In some embodiments of any one of the aspects described herein, the uncross-linked polyethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer has a molecular weight (Mw) of about 5,000 Daltons to about 15,000 Daltons. In some embodiments of any one of the aspects described herein, the uncross-linked poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer has a molecular weight (Mw) of about 14,600 Daltons. In some embodiments of any one of the aspects described herein, the uncrosslinked polyethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer has a molecular weight (Mw) of about 12,500 Daltons. In some embodiments of any one of the aspects described herein, the uncross-linked poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer has a molecular weight (Mw) of about 8,400 Daltons. In some embodiments of any one of the aspects described herein, the uncross-linked polyethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) diacrylate triblock copolymer has a molecular weight (Mw) of about 5,800 Daltons. Nonlimiting examples of uncross-linked poly(ethylene glycol)-poly(propylene glycol)-poly(ethylene glycol) triblock copolymers include (poly(ethylene glycol)ioo-poly(propylene glycol)65-poly(ethylene glycol)ioo diacrylate (i.e., Pluronic® F127 DA), (poly(ethylene glycol)76-poly(propylene glycol)29-poly(ethylene glycol)?6 diacrylate (i.e., Pluronic® F68 DA), (poly(ethylene glycol)i36-poly(propylene glycol)52-poly(ethylene glycol)i36 diacrylate (i.e., Pluronic® Fl 08 DA), and poly(ethylene glycol)20-poly(propylene glycol)69-poly(ethylene glycol)2o diacrylate (i.e., Pluronic® P123 DA).

[0126] In some embodiments of any one of the aspects described herein, the shell further comprises a homopolymer, e.g., a cross-linked homopolymer. For example, the shell further comprises a polyethylene glycol) diacrylate homopolymer, e.g., a cross-linked poly(ethylene glycol) diacrylate homopolymer. In some embodiments of any one of the aspects described herein, the shell is substantially free of homopolymers. For example, the shell is substantially free of polyethylene glycol) diacrylate or polyethylene glycol.

[0127] Generally, the uncross-linked poly(ethylene glycol) diacrylate homopolymer comprises a structure of Formula II:(Formula II).344917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0128] In homopolymers of Formula II, a is 1-10,000 and R3and R4independently are H or Ci-Cealkyl (e.g., methyl).

[0129] Non-limiting examples of the uncross-linked polyethylene glycol) diacrylate homopolymer include poly(ethylene glycol)4 diacrylate (PEG4-DA), poly(ethylene glycol)s75 diacrylate (PEG575-DA), poly(ethylene glycol)750 diacrylate (PEG750-DA), and poly(ethylene glycol)2ooo diacrylate (PEG2000-DA).

[0130] In some embodiment of any one of the aspects described herein, a ratio of homopolymer to triblock copolymer is from about 99:1 to about 1:99 (w / w or v / v). In some embodiment of the various aspects described herein, a ratio of homopolymer to triblock copolymer is from about 1:2 (homopolymertriblock copolymer) to about 1:8 (homopolymertriblock copolymer) (w / w or v / v). In some embodiments of any one of the aspects described herein, a ratio of homopolymer to triblock copolymer is from about 1:8 (homopolymertriblock copolymer) to about 1:16 (homopolymertriblock copolymer) (w / w or v / v).

[0131] In some embodiment of any one of the aspects described herein, an amount of the homopolymer is higher relative to an amount of the triblock copolymer (w to w or v to v). In some embodiment of any one of the aspects described herein, an amount of the homopolymer to an amount of the triblock copolymer is about 10% - 18% homopolymer to about 1% - 4% triblock copolymer.

[0132] In some embodiment of any one of the aspects described herein, an amount of the homopolymer to an amount of the triblock copolymer is about 0.5% - 1% homopolymer to about 8% triblock copolymer. In some embodiment of any one of the aspects described herein, an amount of the homopolymer to an amount of the triblock copolymer is about 1% - 4% homopolymer to about 8% triblock copolymer.

[0133] In some embodiments of any of the aspects described herein, the capsule has a diameter of about 2 pm to about 500 pm. In some embodiments of any one of the aspects described herein, the capsule has a diameter of about 3 pm to about 300 pm. For example, the capsule has a diameter of about 4 pm to about 250 pm. In some embodiments of any one of the aspects described herein, the capsule has a diameter of about 5 pm to about 200 pm.

[0134] In some embodiments of any one of the aspects described herein, the capsules have substantially the same particle size. Capsules that have a broad size distribution in which relatively large and small capsules are found allow smaller capsules to fill the gaps between capsules, thus creating new contact surfaces. A wide size distribution can result in larger spheres by creating many contact opportunities for the joining of an agglomeration. The 354917-1608-4613 1Attorney Docket No. 002806- 000158WOPTcapsules described herein are within a narrow size distribution, thus minimizing the opportunities for contact agglomeration. What is meant by a "narrow size distribution" is a particle size distribution that has a relationship between the 90th percentile volumetric diameter of small spherical particles and the 10th percentile volumetric diameter less than or equal to 5. In some forms For realization, the volumetric diameter of the 90th percentile of small spherical particles with respect to the volumetric diameter of the 10th percentile is less than or equal to 4.5, less than or equal to 4, less than or equal to 3.5, less than or equal to 3 , less than or equal to 2.5, less than or equal to 2, less than or equal to 1.5, less than or equal to 1.45, less than or equal to 1.40, less than or equal to 1.35, less than or equal 1.3, less than or equal to 1.25, less than or equal to 1.20, less than or equal to 1.15, or less than or equal to 1.1.

[0135] The geometric standard deviation (GSD) can also be used to indicate the narrow size distribution. The GSD calculations involved determining the effective cutting diameter (ECD) in the cumulative percentages less than 15.9% and 84.1%. The GSD is equal to the square root of the ratio of ECD less than 84.17% to ECD less than 15.9%. The GSD has a narrow size distribution when GSD <2.5. In some embodiments of any one of the aspects described herein, the GSD is less than 2, less than 1.75, or less than 1.5. In one embodiment, GSD is less than 1.8.

[0136] In some embodiments of any one of the aspects described herein, the capsule is optically clear.

[0137] In some embodiments of any one of the aspects described herein, the capsule further comprises a coating covering an outer surface of the shell. The coating can comprise a biocompatible material. The term "biocompatible" refers a substance that is substantially nontoxic.

[0138] In some embodiments of any one of the aspects described herein, the coating comprises a material selected from the group consisting of fluorinated compounds, polyethylene glycol (PEG), poloxamers, gelatins, silanizing agent, collagen, fibrinogen, laminin, bovine serum albumin (BSA), and any combinations thereof.

[0139] In some embodiments of any one of the aspects described herein, the capsule further comprises an agent. Exemplary agents for including in the capsules described herein include, but are not limited to, cells, biomolecules, polymers, small organic or inorganic molecules, microorganisms and organoids.

[0140] It is noted that the agent can be located in the core and / or the shell. In some embodiments of any one of the aspects described herein, the agent is in the core. In some other embodiments of any one of the aspects described herein, the agent is in the shell.364917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0141] In some embodiments of any one of the aspects described herein, the agent is covalently linked with a component in the capsule. For example, the agent is covalently linked with a component in the shell. In another non-limiting example, the agent is covalently linked with a component in the core.

[0142] In some embodiments of any one of the aspects described herein, the agent is an amino acid, peptide, polypeptide, nucleotide, oligonucleotide, polynucleotide, saccharide, oligosaccharide, or polysaccharide.

[0143] In some embodiments of any one of the aspects described herein, the agent is a cell, biomolecule, polymer, small organic or inorganic molecule, microparticle, bead, microorganism or organoid. In some embodiments of any one of the aspects described herein, the microparticle has a diameter of at least 100 nm and at most half the diameter of the capsule. In some embodiments of any one of the aspects described herein, the microparticle comprises polystyrene, polymethacrylate, or another polymer. In some embodiments of any one of the aspects described herein, the bead has a diameter of at least 100 nm and at most half the diameter of the capsule. In some embodiments of any one of the aspects described herein, the bead comprises polystyrene, polymethacrylate, or another polymer.

[0144] In some embodiments of any one of the aspects describe herein, the agent is an enzyme, an antibody, a primer nucleic acid, or a plasmid.

[0145] In some embodiments of any one of the aspects described herein, the agent is a cell.

[0146] In some embodiments of any one of the aspects described herein, the agent is a therapeutic agent. As used herein, a “therapeutic agent” is a substance used to influence the outcome of a disease, whether it be to cure, reduce, eliminate (some of) its symptoms, or improve the quality of life.

[0147] In some embodiments of any one of the aspects described herein, the agent is an imaging agent.

[0148] It is noted that the agent can be located in the core and / or the shell. In some embodiments of any one of the aspects described herein, the agent is in the core. In some other embodiments of any one of the aspects described herein, the agent is in the shell.

[0149] In some embodiments of any one of the aspects described herein, the agent is covalently linked with a component in the capsule. For example, the agent is covalently linked with a component in the shell. In another non-limiting example, the agent is covalently linked with a component in the core.

[0150] In some embodiments of any one of the aspects described herein, the capsule further comprises a high molecular weight molecule or a bead in the core. In some embodiments of 374917-1608-4613 1Attorney Docket No. 002806- 000158WOPTany of the aspects described herein, the high molecular weight molecule in the core is amino dextran, chitosan, or gelatin. In some embodiments of any one of the aspects described herein, the high molecular weight molecule or the bead comprises at least one functional group for forming a linkage with an agent. In some embodiments of any one of the aspects described herein, the high molecular weight molecule is a high molecular weight polymer.

[0151] As used herein, “beads” may refer to small bodies made of rigid or semi-rigid materials. The body may have a shape characterized, for example, by spherical, elliptical, microspherical, or other recognized particle shapes, whether of regular or irregular size. Exemplary materials that can be used for beads include: glass, such as modified or functionalized glass; plastics, such as acrylic, polystyrene, or copolymers of styrene and another material, polypropylene, polyethylene, polybutylene, polyurethane, or Teflon; polysaccharides or cross-linked polysaccharides, such as agarose or agarose gel; nylon; nitrocellulose; resin; silica or silica-based materials, including silicon and modified silicon; carbon fibers; metals; inorganic glass; fiber bundles, or a variety of other polymers. Exemplary beads include controlled pore glass beads, paramagnetic beads, thoria sols, agarose beads, nanocrystals, and other beads known in the art. The beads may be made of biological or non-biological materials. Magnetic beads are particularly useful because they are easy to manipulate with magnets. Beads used in certain embodiments may have a diameter, width, or length of 0.1 pm to 100 pm. Bead size may be selected to have a reduced size, and thus increased density, while maintaining a sufficiently strong signal to analyze the feature.

[0152] As used herein, “bead barcoding” refers to the use of a bead attached to a barcode sequence of DNA for use in barcoding techniques. Bead barcoding can be used in, for example, but not limited to, single-cell genomics, spatial transcriptomics, multiplexed detection, and single-cell sequencing.

[0153] In some embodiments of any one of the aspects described herein, the capsule further comprises a cross-linking molecule in the shell. In some embodiments of any one of the aspects described herein, the cross-linking molecule comprises at least one functional group for forming a linkage with an agent.

[0154] In some embodiments of any of the aspects, wherein at least one treatment specific barcode is associated with a component in a core of the particle. In some embodiments of any of the aspects, at least one treatment specific barcode is associated with a component in a shell of the particle. In some embodiments of any of the aspects, said component in the core or shell of the particle is a cell, a biomolecule, a polymer, a small organic or inorganic molecule,384917-1608-4613 1Attorney Docket No. 002806- 000158WOPTa microorganism, or an organoid. In some embodiments of any of the aspects, said component in the core or shell of the particle is an amino acid, a peptide, a polypeptide, a nucleotide, an oligonucleotide, a polynucleotide, a saccharide, an oligosaccharide, or a polysaccharide. In some embodiments of any of the aspects, said component in the core or shell of the particle is an enzyme, an antibody, a primer nucleic acid, or a plasmid. In some embodiments of any of the aspects, said component in the core or shell of the particle is a therapeutic agent or an imaging agent. For example, the component in the core or shell is a drug, or a diagnostic molecule. In some embodiments of any of the aspects, said component in the core or shell of the particle is a microparticle or a bead. In some embodiments of any of the aspects, the component in the core of the particle is a nucleic acid. In some embodiments of any of the aspects, said nucleic acid has length sufficient to inhibit / reduce diffusion of the nucleic acid from the core of the particle to outside of the particle. , In some embodiments of any of the aspects, a cell is present in each particle.

[0155] As used herein, a “cell” generally refers to a biological cell. A cell can be a single cell as well as to a population of (i.e., more than one) cells. A cell can be the basic structural, functional and / or biological unit of a living organism. A cell can originate from any organism having one or more cells. Some non-limiting examples include: a prokaryotic cell, eukaryotic cell, a bacterial cell, an archaeal cell, a cell of a single-cell eukaryotic organism, a protozoa cell, a cell from a plant (e.g., cells from plant crops, fruits, vegetables, grains, soy bean, com, maize, wheat, seeds, tomatoes, rice, cassava, sugarcane, pumpkin, hay, potatoes, cotton, cannabis, tobacco, flowering plants, conifers, gymnosperms, fems, clubmosses, homworts, liverworts, mosses), an algal cell, (e.g. Botryococcus braunii. Chlamydomonas reinhardtii, Nannochloropsis gaditana, Chlorella pyrenoidosa, Sargassum patens, C. Agardh, and the like), seaweeds (e.g., kelp), a fungal cell (e.g.,, a yeast cell, a cell from a mushroom), an animal cell, a cell from an invertebrate animal (e.g., fruit fly, cnidarian, echinoderm, nematode, etc.), a cell from a vertebrate animal (e.g., fish, amphibian, reptile, bird, mammal), a cell from a mammal (e.g., a pig, a cow, a goat, a sheep, a rodent, a rat, a mouse, a non-human primate, a human, etc.), and etc. Sometimes a cell is not originating from a natural organism (e.g., a cell can be a synthetically made, sometimes termed an artificial cell). In some embodiments, cell is a human cell.

[0156] In some embodiments of any of the aspects, the nucleic acid e.g. the barcode, is chemically modified to enhance stability or other beneficial characteristics. The nucleic acids described herein may be synthesized and / or modified by methods well established in the art, such as those described in “Current protocols in nucleic acid chemistry,” Beaucage, S.L. et al.394917-1608-4613 1Attorney Docket No. 002806- 000158WOPT(Edrs.), John Wiley & Sons, Inc., New York, NY, USA, which is hereby incorporated herein by reference. Modifications include, for example, (a) end modifications, e.g., 5’ end modifications (phosphorylation, conjugation, inverted linkages, etc.) 3’ end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, removal of bases (abasic nucleotides), or conjugated bases, (c) sugar modifications (e.g., at the 2’ position or 4’ position) or replacement of the sugar, as well as (d) backbone modifications, including modification or replacement of the phosphodiester linkages. Specific examples of nucleic acid compounds useful in the embodiments described herein include, but are not limited to nucleic acids containing modified backbones or no natural internucleoside linkages, nucleic acids having modified backbones include, among others, those that do not have a phosphorus atom in the backbone. For the purposes of this specification, and as sometimes referenced in the art, modified nucleic acids that do not have a phosphorus atom in their intemucleoside backbone can also be considered to be oligonucleosides. In some embodiments of any of the aspects, the modified nucleic acid will have a phosphorus atom in its internucleoside backbone.

[0157] Modified nucleic acid backbones can include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3 '-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, and boranophosphates having normal 3'-5' linkages, 2'-5' linked analogs of these, and those) having inverted polarity wherein the adjacent pairs of nucleoside units are linked 3'-5' to 5'-3' or 2'-5' to 5'-2'. Various salts, mixed salts and free acid forms are also included. Modified nucleic acid backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatoms and alkyl or cycloalkyl intemucleoside linkages, or one or more short chain heteroatomic or heterocyclic intemucleoside linkages. These include those having morpholino linkages (formed in part from the sugar portion of a nucleoside); siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones; alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; others having mixed N, O, S and CH2 component parts, and oligonucleosides with heteroatom backbones, and in particular — CH2— NH— CH2— , — CH2— N(CHs)— O— CH2—404917-1608-4613 1Attorney Docket No. 002806- 000158WOPT[known as a methylene (methylimino) or MMI backbone], — CH2— O— N(CH3)— CH2— , — CH2--N(CH3)— N(CHS)— CH2— and — N(CHs)— CH2— CH2— [wherein the native phosphodiester backbone is represented as — O— P— O— CH2— ].

[0158] Modified nucleic acids can also contain one or more substituted sugar moi eties. The nucleic acids described herein can include one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-O-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Ci to C10 alkyl or C2 to C10 alkenyl and alkynyl. Exemplary suitable modifications include O[(CH2)nO] mCH?, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and O(CH2)nON[(CH2)nCH3)]2, where n and m are from 1 to about 10. In some embodiments of any of the aspects, dsRNAs include one of the following at the 2' position: Ci to C10 lower alkyl, substituted lower alkyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties a nucleic acid, or a group for improving the pharmacodynamic properties of a nucleic acid, and other substituents having similar properties. In some embodiments of any of the aspects, the modification includes a 2' methoxyethoxy (2'-O— CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-M0E) (Martin et al., Helv. Chim. Acta, 1995, 78:486-504) i.e., an alkoxy-alkoxy group. Another exemplary modification is 2'-dimethylaminooxy ethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMA0E, as described in examples herein below, and 2'-dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethylaminoethoxyethyl or 2'-DMAEOE), i.e., 2'-O— CH2— O— CH2— N(CH2)2, also described in examples herein below.

[0159] Other modifications include 2'-methoxy (2'-OCH3), 2'-aminopropoxy (2'-OCH2CH2CH2NH2) and 2'-fluoro (2'-F). Similar modifications can also be made at other positions on the nucleic acid, particularly the 3' position of the sugar on the 3' terminal nucleotide or in 2'-5' linked dsRNAs and the 5' position of 5' terminal nucleotide. Nucleic acids may also have sugar mimetics such as cyclobutyl moieties in place of the pentofuranosyl sugar.

[0160] A nucleic acid can also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions. As used herein, “unmodified” or “natural” nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U). Modified nucleobases can include ther synthetic and natural nucleobases including but not limited to 5-methylcytosine (5-me-C), 5 -hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of 414917-1608-4613 1Attorney Docket No. 002806- 000158WOPTadenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5-propynyl uracil and cytosine, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl anal other 8-substituted adenines and guanines, 5-halo, particularly 5-bromo, 5-trifluoromethyl and other 5-substituted uracils and cytosines, 7-methylguanine and 7-methyladenine, 8-azaguanine and 8-azaadenine, 7-deazaguanine and 7-daazaadenine and 3 -deazaguanine and 3 -deazaadenine. Certain of these nucleobases are particularly useful for increasing the binding affinity of the inhibitory nucleic acids featured in the invention. These include 5-substituted pyrimidines, 6-azapyrimidines and N-2, N-6 and 0-6 substituted purines, including 2-aminopropyladenine, 5-propynyluracil and 5-propynylcytosine. 5-methylcytosine substitutions have been shown to increase nucleic acid duplex stability by 0.6-1.2°C (Sanghvi, Y. S., Crooke, S. T. and Lebleu, B., Eds., dsRNA Research and Applications, CRC Press, Boca Raton, 1993, pp. 276-278) and are exemplary base substitutions, even more particularly when combined with 2'-O-methoxyethyl sugar modifications. In some embodiments of any of the aspects, modified nucleobases can include d5SICS and dNAM, which are a non-limiting example of unnatural nucleobases that can be used separately or together as base pairs (see e.g., Leconte et. al. J. Am. Chem. Soc.2008, 130, 7, 2336-2343; Malyshev et. al. PNAS. 2012. 109 (30) 12005-12010). In some embodiments of any of the aspects, barcodes can comprise any modified nucleobases known in the art, i.e., any nucleobase that is modified from an unmodified and / or natural nucleobase.

[0161] The preparation of the modified nucleic acids, backbones, and nucleobases described above are well known in the art.

[0162] As used herein, the term “oligonucleotide” is intended to include, but is not limited to, a single-stranded DNA or RNA molecule, typically prepared by synthetic means. Nucleotides of the present invention will typically be the naturally-occurring nucleotides such as nucleotides derived from adenosine, guanosine, uridine, cytidine and thymidine. When oligonucleotides are referred to as “double-stranded,” it is understood by those of skill in the art that a pair of oligonucleotides exists in a hydrogen-bonded, helical array typically associated with, for example, DNA. In addition to the 100% complementary form of double-stranded oligonucleotides, the term “double-stranded” as used herein is also meant to include those form which include such structural features as bulges and loops (see Stryer, Biochemistry, Third Ed. (1988), incorporated herein by reference in its entirety for all purposes). As used herein, the term “polynucleotide” is intended to include, but is not limited to, two or more oligonucleotides joined together (e.g., by hybridization, ligation, polymerization and the like).424917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0163] It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[0164] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose.

[0165] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.

[0166] Specific elements of any of the foregoing embodiments can be combined or substituted for elements in other embodiments. Furthermore, while advantages associated with certain embodiments of the disclosure have been described in the context of these embodiments, other embodiments may also exhibit such advantages, and not all embodiments need necessarily exhibit such advantages to fall within the scope of the disclosure.

[0167] Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. Unless explicitly stated otherwise, or apparent from context, the terms and phrases below do not exclude the meaning that the term or phrase has acquired in the art to which it pertains. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can 434917-1608-4613 1Attorney Docket No. 002806- 000158WOPTvary. The definitions and terminology used herein are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims.

[0168] Preferred embodiments of this application are described herein, including the best mode known to the inventors for carrying out the application. Variations on those preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. It is contemplated that skilled artisans can employ such variations as appropriate, and the application can be practiced otherwise than specifically described herein. Accordingly, many embodiments of this application include all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the application unless otherwise indicated herein or otherwise clearly contradicted by context.Some selected definitions

[0169] Unless stated otherwise, or implicit from context, the following terms and phrases include the meanings provided below. Unless explicitly stated otherwise, or apparent from context, the terms and phrases below do not exclude the meaning that the term or phrase has acquired in the art to which it pertains. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary. The definitions and terminology used herein are provided to aid in describing particular embodiments, and are not intended to limit the claimed invention, because the scope of the invention is limited only by the claims.

[0170] As used herein the term “comprising” or “comprises” is used in reference to compositions, methods, systems, articles of manufacture, apparatus, and respective component(s) thereof, that are useful to an embodiment, yet open to the inclusion of unspecified elements, whether useful or not. It will be understood by those within the art that, in general, terms used herein are generally intended as “open” terms (e.g., the term “including” should be interpreted as “including but not limited to,” the term “having” should be interpreted as “having at least,” the term “includes” should be interpreted as “includes but is not limited to,” etc.). Although the open-ended term “comprising,” as a synonym of terms such as including, containing, or having, is used herein to describe and claim the invention, the present 444917-1608-4613 1Attorney Docket No. 002806- 000158WOPTinvention, or embodiments thereof, may alternatively be described using alternative terms such as “consisting of’ or “consisting essentially of.”

[0171] Unless stated otherwise, the terms “a” and “an” and “the” and similar references used in the context of describing a particular embodiment of the application (especially in the context of claims) can be construed to cover both the singular and the plural. The recitation of ranges of values herein is merely intended to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples, or exemplary language (for example, “such as”) provided with respect to certain embodiments herein is intended merely to better illuminate the application and does not pose a limitation on the scope of the application otherwise claimed.

[0172] The abbreviation, “e.g.” is derived from the Latin exempli gratia, and is used herein to indicate a non-limiting example. Thus, the abbreviation “e.g.” is synonymous with the term “for example.” No language in the specification should be construed as indicating any nonclaimed element essential to the practice of the application.

[0173] “Optional" or “optionally” means that the subsequently described circumstance may or may not occur, so that the description includes instances where the circumstance occurs and instances where it does not.

[0174] In some embodiments of any one of the aspects described herein, the numbers expressing quantities of reagents, properties such as concentration, reaction conditions, and so forth, used to describe and claim certain embodiments of the invention are to be understood as being modified in some instances by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. Accordingly, in some embodiments of any one of the aspects described herein, the numerical parameters set forth in the written description and attached claims are approximations that can vary depending upon the desired properties sought to be obtained by a particular embodiment. In some embodiments of any one of the aspects described herein, the numerical parameters should be construed in light of the number of reported significant digits and by applying ordinary rounding techniques. Notwithstanding 454917-1608-4613 1Attorney Docket No. 002806- 000158WOPTthat the numerical ranges and parameters setting forth the broad scope of some embodiments of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as practicable. The numerical values presented in some embodiments of the invention may contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements.

[0175] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member can be referred to and claimed individually or in any combination with other members of the group or other elements found herein. One or more members of a group can be included in, or deleted from, a group for reasons of convenience and / or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0176] Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the invention. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the invention, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the invention.

[0177] The invention is further illustrated by the following examples which are intended to be purely exemplary of the invention, and which should not be construed as limiting the invention in any way. The following examples are illustrative only, and are not intended to limit, in any manner, any of the aspects described herein. The following examples are provided to better illustrate the claimed invention and are not to be interpreted as limiting the scope of the invention. To the extent that specific materials are mentioned, it is merely for purposes of illustration and is not intended to limit the invention. One skilled in the art may develop equivalent means or reactants without the exercise of inventive capacity and without departing from the scope of the invention.

[0178] Some exemplary embodiments of the various aspects described herein can be defined as in any of the following numbered embodiments:

[0179] Embodiment 1: A method of barcoding particles, the method comprising: dividing a plurality of particles into two or more sub-pluralities; treating each sub-plurality under at least one treatment condition, wherein during said treatment condition, a treatment-specific barcode 464917-1608-4613 1Attorney Docket No. 002806- 000158WOPTis associated with the particles in each sub-plurality, and wherein the treatment condition for at least one sub-plurality is different from the treatment condition of at least one other subplurality; reforming the plurality by combining the two or more sub-pluralities; and optionally repeating steps a) to c) a desired number of times.

[0180] Embodiment 2: The method of Embodiment 1 wherein the treatment-specific barcode comprises a condition specific portion and a treatment step specific portion.

[0181] Embodiment 3: The method of any one of Embodiments 1-2, wherein the particles in the plurality comprise a primary barcode associated therewith prior to step a).

[0182] Embodiment 4: The method of any one of Embodiments 1-3, wherein the primary barcode associated with the particles comprises an adaptor suitable for amplification and / or preparing a sequencing library.

[0183] Embodiment 5: The method of any one of Embodiments 1-4, wherein the primary barcode comprises hybridization domain capable of hybridizing with a hybridization domain of a treatment specific barcode.

[0184] Embodiment 6: The method of any one of Embodiments 1-5, further comprising a step, prior to step a), of associating a primary barcode with the particles in the plurality.

[0185] Embodiment 7: The method of any one of Embodiments 1-6, wherein the treatment specific barcode comprises: (i) a first hybridization domain capable of hybridizing with a hybridization domain of a barcode already associated with the particle; and (ii) a second hybridization domain capable of hybridizing with a hybridization domain of a subsequent treatment specific barcode, or an adaptor suitable for amplification and / or preparing a sequencing library.

[0186] Embodiment 8: The method of any one of Embodiments 1-7, wherein the treatment specific barcode comprises a first strand and a second strand capable of hybridizing with the first strand and thereby forming a single-stranded region at each end of a double-stranded region, wherein one of the single-stranded regions comprises a first hybridization domain capable of hybridizing with a hybridization domain of a barcode already associated with the particle, and the other of the single-stranded region comprises a second hybridization domain capable of hybridizing with a hybridization domain of a subsequent treatment specific barcode, or an adaptor suitable for amplification and / or preparing a sequencing library.

[0187] Embodiment 9: The method of any one of Embodiments 1-8, further comprising, prior to step c), blocking any unhybridized hybridization domain of the barcode already associated with the particle after step b).474917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0188] Embodiment 10: The method of any one of Embodiments 1-9, further comprising, after step c) and prior to step d), a step of washing the plurality of the particles.

[0189] Embodiment 11: The method of any one of Embodiments 1-10, further comprising a step of ligating together the treatment specific barcodes associated with each particle to form a concatenation of treatment specific barcodes.

[0190] Embodiment 12: The method of any one of Embodiments 1-11, wherein the step of associating the treatment specific barcode with the particle comprises annealing the treatment specific barcode to a barcode already associated with the particle.

[0191] Embodiment 13: The method of any one of Embodiments 1-12, wherein the treatment-specific barcode is covalently linked with the particle.

[0192] Embodiment 14: The method of any one of Embodiments 1-13, wherein the treatment-specific barcode is covalently linked with the particle via a linker.

[0193] Embodiment 15: The method of any one of Embodiments 1-14, wherein the treatment-specific barcode is covalently linked with the particle via its 5’-end.

[0194] Embodiment 16: The method of any one of Embodiments 1-14, wherein the treatment-specific barcode is covalently linked with the particle via its 3 ’-end.

[0195] Embodiment 17: The method of any one of Embodiments 1-16, wherein each treatment specific barcode comprises a reactive moiety for covalently linking with the particle.

[0196] Embodiment 18: The method of any one of Embodiments 1-17, wherein at least one treatment specific barcode in a subsequent step b) is associated directly with the particle independently of a treatment specific barcode already associated with the particle.

[0197] Embodiment 19: The method of Embodiment 18, wherein the treatment specific barcode in a subsequent step b) comprises a reactive moiety that is different from a reactive moiety of a treatment specific barcode already associated with the particle.

[0198] Embodiment 20: The method of any one of Embodiments 1-19, wherein each particle comprises two or more different reactive moieties.

[0199] Embodiment 21: The method of any one of Embodiments 1-20, wherein each reactive moiety comprises one member of a conjugation pair.

[0200] Embodiment 22: The method of Embodiment 21, wherein the treatment specific barcode comprises one member of the conjugation pair and the particle comprises the other member of the conjugation pair.

[0201] Embodiment 23: The method of any one of Embodiments 21-22, wherein conjugation pairs are selected from the group consisting of azide / dibenzocyclooctyne (DBCO), tetrazine / trans-cyclootene (TCO), streptavidin / biotin, Amine targeted chemistries (NHS ester / 484917-1608-4613 1Attorney Docket No. 002806- 000158WOPTamine coupling; Carbodiimide (EDC) coupling of carboxyls to amines), Thiol targeted chemistries (Maleimide / thiol Michael addition; Haloacetamide / thiol alkylation; Disulfide formation / exchange; Vinyl sulfone / thiol), Click chemistry (Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC); Staudinger ligation; and Enzymatic / Tag ligations (SNAP -tag / CLIP -tag; HaloTag).

[0202] Embodiment 24: The method of any one of Embodiments 1-23, wherein each treatment specific barcode comprises an adaptor suitable of amplification and / or preparing a sequencing library.

[0203] Embodiment 25: The method of any one of Embodiments 1-24, further comprising a step of identifying the treatment specific barcodes associated with the particles.

[0204] Embodiment 26: The method of Embodiment 25, wherein said step of step of identifying the treatment specific barcodes associated with the particles comprises reverse transcription of treatment specific barcodes associated with the particles.

[0205] Embodiment 27: The method of Embodiment 25, wherein said step of step of identifying the treatment specific barcodes associated with the particles comprises amplifying the treatment specific barcodes associated with the particles.

[0206] Embodiment 28: The method of any one of Embodiments 25-27 wherein said step of step of identifying the treatment specific barcodes associated with the particles comprises sequencing.

[0207] Embodiment 29: The method of any one of Embodiments 25-28 wherein said step of step of identifying the treatment specific barcodes associated with the particles comprises generating a sequencing library.

[0208] Embodiment 30: The method of any one of Embodiments 1-29, wherein at least one particle in the plurality of particles is a core shell particle or capsule.

[0209] Embodiment 31 : The method of any one of Embodiments 1-30, wherein at least one treatment specific barcode is associated with a component in a core of the particle.

[0210] Embodiment 32: The method of Embodiment 31, wherein said component in the core of the particle is a nucleic acid.

[0211] Embodiment 33: The method of Embodiment 32, wherein said nucleic acid has length sufficient to inhibit / reduce diffusion of the nucleic acid from the core of the particle to outside of the particle.

[0212] Embodiment 34: The method of any one of Embodiments 1-33, wherein at least one treatment specific barcode is associated with a component in a shell of the particle.494917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0213] Embodiment 35: The method of any one of Embodiments 1-34, wherein a cell is present in each particle.

[0214] The technology described herein is further illustrated by the following examples which in no way should be construed as being further limiting.EXAMPLES

[0215] Example 1. Methods to link barcodes to semi-permeable capsules

[0216] Here, we report methods for linking nucleic acids to the polymers contained inside capsule’s shell, core, or other longer scaffolding molecules (such as DNA) that are retained inside semi-permeable capsules due to their size. The attached nucleic acids can directly act as barcodes or be a landing “stub” oligonucleotide to which DNA barcodes can be linked in subsequent steps. In addition, each new attachment step can link a different nucleic acid barcode to capsules as separate molecules (in parallel) or sequentially add them into one contiguous molecule that contains all the barcodes (Fig. 2B). In all cases, barcodes may be added combinatorially in several rounds to create a large space of unique labels. These labels are added in a way that is compatible with cell culturing and later report on different conditions to which the cells were exposed.

[0217] First, we showcase a number of examples for attaching nucleic acids to capsules.

[0218] Linking to shell. In one embodiment of any of the aspects, nucleic acids are linked to the hydrogel capsule’s shell. A variety of conjugation chemistries can be used to achieve this. In one example, reactive chemical groups (such as -NH2, trans-cyclooctene (TCO) derivatives, tetrazine derivatives, azide derivatives, streptavidin / biotin) can be incorporated into the shell. Fig. 5A (shell, top) showcases fluorescent images of hydrogel capsules where the -NH2 reactive group was incorporated into the shell and visualized using -NH2 reactive fluorophore. To achieve this, NH2-PEG2000-Acrydite was added to the shell polymer solution at 1% (w / v). Hydrogel capsules were produced as described in Mazelis et al. 2025 and W02024030526A1, the contents of each of which are incorporated herein by reference in their entireties. After the polymerization step, hydrogel capsules were washed 5 times with lOmM Tris (pH 8.0) containing 0.1% Igepal CA-630. Next, IpL of lOmM N-Hydroxysuccinimide (NHS) ester AZdye488 was added to 10 pL of packed hydrogel capsules and incubated at room temperature for 20 minutes. After the reaction, hydrogel capsules were washed 5 times with lOmM Tris (pH 8.0) containing 0.1% Igepal CA-630 and imaged using AIR Nikon Confocal laser-scanning microscope. In another embodiment, a chemical group that participates in radical polymerization reactions (such as but not limited to acrylate and methacrylate) linked 504917-1608-4613 1Attorney Docket No. 002806- 000158WOPTto a nucleic acid is used to attach it to the shell during hydrogel capsule polymerization step.Fig 5A (shell, bottom) showcases fluorescent images of hydrogel capsules where DNA oligonucleotide of arbitrary sequence labeled with acrylate and 6-carboxyfluorescein (FAM) modifications is included in the hydrogel capsule shell or core polymer solution at a concentration of 0.5 pM. Hydrogel capsules were produced as described in Mazelis et al. 2025 and W02024030526A1. After the polymerization step, hydrogel capsules were washed 5 times with lOmM Tris (pH 8.0) containing 0.1% Igepal CA-630 and imaged using AIR Nikon Confocal laser-scanning microscope.

[0219] Linking to core. In some embodiments of any of the aspects, nucleic acids are linked to the polymers retained inside the hydrogel capsule’s core. A variety of conjugation chemistries can be used to achieve this. In one instance, reactive chemical groups (such as -NH2, trans-cyclooctene (TCO) derivatives, tetrazine derivatives, azide derivatives, streptavidin / biotin) can be incorporated into the core by attaching them to high molecular weight polymers (Fig. 2A). Fig 5A (core) showcases an example where the -NH2 group was incorporated into the shell and visualized using -NH2 reactive NHS ester AZdye488. To achieve this, NH2-alginate was added to the core polymer solution at 0.5% (w / v) and capsules were produced as described \n Mazelis etal. 2025 and W02024030526A1. After the polymerization step, hydrogel capsules were washed 5 times with lOmM Tris (pH 8.0) containing 0.1% Igepal CA-630. Next, IpL of lOmM N-Hydroxysuccinimide (NHS) ester AZdye488 was added to lOpL of packed hydrogel capsules and incubated at room temperature for 20 minutes. After the reaction, hydrogel capsules were washed 5 times with lOmM Tris (pH 8.0) containing 0.1% Igepal CA-630 and imaged using AIR Nikon Confocal laser-scanning microscope. Fig. 5A (core) showcases an example where the TCO- group was incorporated into the shell and visualized using tetrazine-Cy5 click fluorophore. To achieve this, TCO group labeled alginate was added to the core polymer solution at 0.5% (w / v) and capsules were produced and washed as described above. Next, IpL of ImM tetrazine-Cy5 was added to 10 pL of packed hydrogel capsules and incubated at room temperature for 15 minutes. After the reaction, hydrogel capsules were washed 5 times with lOmM Tris (pH 8.0) containing 0.1% Igepal CA-630 and imaged using AIR Nikon Confocal laser-scanning microscope.

[0220] Linking to larger DNA. In some embodiments of any of the aspects, nucleic acids are linked to other longer nucleic acids retained inside the hydrogel capsule’s core. In this approach, nucleic acids that are too large to diffuse out of the capsules (>300bp in the case of CAGEs, Mazelis et al. 2025 and W02024030526A1) are added to the capsules core polymer solution during the capsule production step. In one instance of this approach, ligation is used 514917-1608-4613 1Attorney Docket No. 002806- 000158WOPTto link a short DNA barcode to a longer DNA retained inside the capsules. Fig. 5B showcases an example where a Cy5 labeled 32nt DNA oligo of was ligated to a dsDNA of 420 bp retained inside the capsules core. First, capsules containing 420 bp dsDNA were produced by adding the DNA to the core polymer solution during the production step (Mazelis et al 2025). After the polymerization step, hydrogel capsules were washed 5 times with lOmM Tris (pH 8.0) containing 0.1% Igepal CA-630 and 10 mM NaCl (TI10). Next, a 10 pL ligation reaction was carried out containing 1 pL of 10X T4 DNA ligase buffer, 0.8pL of capsules, 3 pL of lOpM Cy5 labeled DNA oligo, 2 pL of IM NaCl and 1 pL of Salt-T4® DNA Ligase. Reaction was carried out on ice for 30 min. After the reaction, capsules were washed 5 times with TI10 and were imaged using AIR Nikon Confocal laser-scanning microscope. Control reaction shows that no DNA is retained when the ligase enzyme is omitted from the reaction.

[0221] Multiple barcode additions. A combination of aforementioned nucleic acid attachment variations can be used to add a unique set of nucleic acid sequences to capsules (Figs. 2A-2B, 3A-3C). The use of nucleic acids enables the barcodes to be captured during genomic analysis and read out during downstream sequencing. In the instance where a nucleic acid “stub” linker is used to link all the barcodes into a single contiguous molecule, nucleic acid ligation or click chemistry reactions can be used (Figs. 2B, 3A-3C, 4A-4C). In addition, the ligation can be performed at every sequential DNA addition step or after all the addition steps have been carried out. In the latter case, the contiguous molecule of barcodes is held by nucleic acid complementarity.

[0222] Here, we showcase this approach where a DNA stub oligo was incorporated into the capsule's shell using an acrydite modified DNA oligo to which subsequent DNA barcodes were then annealed or ligated to (Figs.3A, 6). First, CAGEs were produced as described in Mazelis etal. 2025 with 3pM / 5Acryd / ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 1) DNA oligo supplemented to core polymer solution. After CAGE production, CAGEs were washed 3 times with DPBS containing 0.1% (w / v) Pluronic F127 and L31 (DPBS-FL). Next, barcode adapters were prepared by mixing 5 pL of 100 pM DNA bridging oligo with 5 pL of 100 pM DNA barcode in a PCR tube and annealing in PCR machine by heating to 98°C for 5 min, followed by cooling to 65°C at -0.1°C / s, incubating at 65°C for min and then cooling to 4°C at -0.1°C / s.

[0223] Bridging oligo stub-A: CTGAATCGCCAGCGGCATCAGCACC AGATCGGAAGAGCGTCGTGTAGGGA(SEQ ID NO: 2) was annealed with Stub-A barcode ACGCCACCTCTGACTTGAGCGTCGATAGAGGATAGGTGCTGATGCCGCTGGCGAT TCAG (SEQ ID NO: 3). Bridging oligo B-C ATCGACGCTCAAGTCAGAGGTGGCG 524917-1608-4613 1Attorney Docket No. 002806- 000158WOPTTGCCCGCCTGATGAATGCTCATCCG (SEQ ID NO: 4) was annealed with C-A barcode CGCCACCTCTGACTTGAGCGTCGATGTAACGTTGGTGCTGATGCCGCTGGCGATTC AG (SEQ ID NO: 4) and bridging oligo A-B CTGAATCGCCAGCGGCATCAGCACC CTGAATCGCCAGCGGCATCAGCACC (SEQ ID NO: 5) was annealed with CGGATGAGCATTCATCAGGCGGGCACTCCTTACGAAAAAAAAAAAAAAAAAAAA AAAAAAA (SEQ ID NO: 6).

[0224] Two different proof of concept approaches were carried out to test the sequential ligation (ligation reaction at steps 1-3, Fig. 6) and single final ligation reaction methods (Ligation after step 3, Fig. 6).

[0225] Sequential ligation experiments were carried out in three different buffer conditions - IX T4 DNA ligase buffer, DPBS or IMDM supplemented with 10 mM MgCh, 10 mM DTT and 1 mM ATP. In each case, 100 pL of CAGEs were mixed with 1 pL of annealed barcode oligos and incubated at 37 °C for 5 min. Next, ligation reactions were performed in each buffer in 136 pL volumes containing 81.6 pL of CAGEs with annealed oligos, 6.8 pL of T4 DNA ligase for 10 min at room temperature. After each reaction, CAGEs were washed 3 times with DPBS-FL. The next barcode addition reaction was performed in the same way - CAGEs were diluted to 100 pL in DPBS-FL, followed by the addition of 1 pL of annealed barcode, incubation and ligation. In the case of one final ligation experimental design, CAGEs were mixed with the DNA adapters at the same ratio for 5 min at 37 °C, followed by 5 washes with DPBS-FL. After all the DNA barcode adapter have been annealed and excess washed off, a single ligation reaction composed out of 24 pL CAGEs, 12 pL water, 4 pL of 10X T4 ligase buffer and 2 pL of T4 DNA ligase were carried out at 25 °C for 30 min to link all annealed adapter into a single contiguous molecule.

[0226] In both ligation approaches, CAGEs were then washed twice with TI10 buffer, followed by heating to 80°C for 5 min and two additional TI10 washes. Next, a RT reaction was set up to capture the contiguous DNA barcode molecule (Table 1).534917-1608-4613 1Attorney Docket No. 002806- 000158WOPT

[0227] RT reaction was performed at 42 °C for 60 min. After RT, CAGEs were washed three times with 10 mM Tris (pH 8.0) containing 0.1% Igepal CA-630 and 10 mM NaCl (TI100), twice with 10 mM Tris (pH 8.0) containing 0.1% Igepal CA-630 and 0.05% SDS (TIS), three times with ice-cold TI100 with 2 min incubations on ice. Finally, CAGEs were washed twice with TI10.

[0228] Next, a PCR was performed with primers targeting the T30 RT primer handle and DNA stub linker (Table 2).

[0229] PCR cycling program: 98 °C for 30 s; 12 cycles of 98 °C for 15 s, 68 °C for 20 s, 72 °C for 20 s min; a final extension of 72 °C for 1 min and hold at 25 °C.

[0230] After PCR, CAGEs were washed three times with TH 00 (pH 8.0) buffer facilitating faster diffusion, then twice with detergent-containing TIS (pH 8.0) buffer to denature enzymes, and twice with a low-salt buffer TI10 (pH 8.0). Fluorescent images provided in Fig. 7A shows that the DNA product of a full contiguous molecule is successfully produced in all cases. In addition, fragment size analysis of DNA purified from the CAGEs verifies that the product is of correct size (Fig. 7B).References

[0231] Mazelis, I., Sun, H., Kulkami, A., Torre, T. L. & Klein, A. M. Multistep genomics on single cells and live cultures in subnanoliter capsules. Science (2025).Example 2 - Barcode addition onto a longer DNA scaffold molecule

[0232] In one embodiment of the technology described herein, a longer DNA can be used as a scaffold molecule (sfDNA) to which other DNA barcodes are then linked using a ligation reaction (FIGs.5A, 5B, and 8). These sfDNA molecules may contain additional DNA adapters and handles that facilitate DNA ligation and its capture during downstream processing step, such as reverse transcription step (FIG. 8). Here, we showcase barcode addition to an 544917-1608-4613 1Attorney Docket No. 002806- 000158WOPTencapsulated 429bp sfDNA in mild ligation conditions. To do this, DNA carrying an overhanging GCACTACGACATGAATGTACACTGA (SEQ ID NO: 7) 3’ end was encapsulated into CAGEs by adding it to the core mix at 2 ng / pL (FIG. 9). CAGEs were produced as described in Mazelis et al. 2025. Next, barcode adapters were prepared as described previously by mixing FW and RV adapters.

[0233] Sequential ligation experiments were carried out in two different buffer conditions -IX T4 DNA ligase buffer or DPBS supplemented with lOmM MgC12, lOmM DTT and ImM ATP. In each case, 12 different 20pL reactions housing 2pL of annealed different barcode oligos, lOpL of CAGEs, 1 pL of T4 DNA ligase in T4 or DPBS were carried for 20 min at room temperature. After the reaction, for each condition, CAGEs were pooled in barcode sets of 6 (1-6 and 7-12), and were washed 3 times with DPBS-FL (FIG. 10). The next barcode addition reaction was performed in the same way, with each set receiving the same set of 2nd ligation barcodes. After the reaction all CAGEs were pooled into a single tube based on their ligation buffer condition and were washed 3 times with DPBS-FL. For each condition 12 barcoding PCR reactions were performed by distributing 5.2pL of CAGEs into PCR wells containing lOpL of 2x NEBNext® High-Fidelity 2X PCR Master Mix (NEB, M0543L), 0.8pL of 10% Igepal CA-630 (Millipore Sigma, I8896-50ML), 2pL of lOpM universal PCR primer, targeting the other end of DNA molecule, 2 pL of lOpM PCR barcode (5’-C AAGC AGAAGACGGC ATACGAGATxxxxxxGTCTCGTGGGCTCGGAGATG-3 ’ , (SEQ554917-1608-4613 1Attorney Docket No. 002806- 000158WOPTID NO: 12) where xxxxx corresponds to a variable barcode sequence). PCR cycling program: 98°C for 45s; 5 cycles of 98°C for 10s, 68°C for 20s, 72°C for 30s; a final extension of 72°C for 2min and hold at 25°C. After PCR, CAGEs were washed as described previously. For each ligation condition, this results in two populations of CAGEs housing DNA molecules with different sets of ligation 1 and ligation 2 barcodes while sharing the same 3rd PCR barcode set (FIG. 10). Results from fragment size analysis of DNA purified from CAGEs verifies that the product is of correct size (band at 498bp, FIG. 11). In addition, nanopore sequencing of the purified DNA barcodes shows that molecules have the correct structure and barcodes (FIG.12). Out of these, the majority of barcodes correspond to correct pairs of sets, showing minimal barcode switching or cross-contamination (FIGs. 13, 14).

[0234] References

[0235] 1. Mazelis, I., Sun, H., Kulkami, A., Torre, T. L. & Klein, A. M. Multistep genomics on single cells and live cultures in subnanoliter capsules. Science (2025).

[0236] All patents and other publications; including literature references, issued patents, published patent applications, and co-pending patent applications; cited throughout this application are expressly incorporated herein by reference for the purpose of describing and disclosing, for example, the methodologies described in such publications that might be used in connection with the technology described herein. These publications are provided solely for their disclosure prior to the filing date of the present application. Nothing in this regard should be construed as an admission that the inventors are not entitled to antedate such disclosure by virtue of prior invention or for any other reason. All statements as to the date or representation as to the contents of these documents is based on the information available to the applicants and does not constitute any admission as to the correctness of the dates or contents of these documents.564917-1608-4613 1

Claims

Attorney Docket No. 002806- 000158WOPTCLAIMSWe claim:

1. A method of barcoding particles, the method comprising:a) dividing a plurality of particles into two or more sub-pluralities;b) treating each sub-plurality under at least one treatment condition, wherein during said treatment condition, a treatment-specific barcode is associated with the particles in each sub-plurality, and wherein the treatment condition for at least one sub-plurality is different from the treatment condition of at least one other subplurality;c) reforming the plurality by combining the two or more sub-pluralities; and d) optionally repeating steps a) to c) a desired number of times.

2. The method of claim 1 wherein the treatment-specific barcode comprises a condition specific portion and a treatment step specific portion.

3. The method of any one of claims 1-2, wherein the particles in the plurality comprise a primary barcode associated therewith prior to step a).

4. The method of any one of claims 1-3, wherein the primary barcode associated with the particles comprises an adaptor suitable for amplification and / or preparing a sequencing library.

5. The method of any one of claims 1-4, wherein the primary barcode comprises hybridization domain capable of hybridizing with a hybridization domain of a treatment specific barcode.

6. The method of any one of claims 1-5, further comprising a step, prior to step a), of associating a primary barcode with the particles in the plurality.

7. The method of any one of claims 1-6, wherein the treatment specific barcode comprises: (i) a first hybridization domain capable of hybridizing with a hybridization domain of a barcode already associated with the particle; and(ii) a second hybridization domain capable of hybridizing with a hybridization domain of a subsequent treatment specific barcode, or an adaptor suitable for amplification and / or preparing a sequencing library.

8. The method of any one of claims 1-7, wherein the treatment specific barcode comprises a first strand and a second strand capable of hybridizing with the first strand and thereby forming a single-stranded region at each end of a double-stranded region, wherein one of the single-stranded regions comprises a first hybridization domain capable of hybridizing with a hybridization domain of a barcode already 574917-1608-4613 1Attorney Docket No. 002806- 000158WOPTassociated with the particle, and the other of the single-stranded region comprises a second hybridization domain capable of hybridizing with a hybridization domain of a subsequent treatment specific barcode, or an adaptor suitable for amplification and / or preparing a sequencing library.

9. The method of any one of claims 1-8, further comprising, prior to step c), blocking any unhybridized hybridization domain of the barcode already associated with the particle after step b).

10. The method of any one of claims 1-9, further comprising, after step c) and prior to step d), a step of washing the plurality of the particles.

11. The method of any one of claims 1-10, further comprising a step of ligating together the treatment specific barcodes associated with each particle to form a concatenation of treatment specific barcodes.

12. The method of any one of claims 1-11, wherein the step of associating the treatment specific barcode with the particle comprises annealing the treatment specific barcode to a barcode already associated with the particle.

13. The method of any one of claims 1-12, wherein the treatment-specific barcode is covalently linked with the particle.

14. The method of any one of claims 1-13, wherein the treatment-specific barcode is covalently linked with the particle via a linker.

15. The method of any one of claims 1-14, wherein the treatment-specific barcode is covalently linked with the particle via its 5 ’-end.

16. The method of any one of claims 1-14, wherein the treatment-specific barcode is covalently linked with the particle via its 3 ’-end.

17. The method of any one of claims 1-16, wherein each treatment specific barcode comprises a reactive moiety for covalently linking with the particle.

18. The method of any one of claims 1-17, wherein at least one treatment specific barcode in a subsequent step b) is associated directly with the particle independently of a treatment specific barcode already associated with the particle.

19. The method of claim 18, wherein the treatment specific barcode in a subsequent step b) comprises a reactive moiety that is different from a reactive moiety of a treatment specific barcode already associated with the particle.

20. The method of any one of claims 1-19, wherein each particle comprises two or more different reactive moieties.584917-1608-4613 1Attorney Docket No. 002806- 000158WOPT21. The method of any one of claims 1-20, wherein each reactive moiety comprises one member of a conjugation pair.

22. The method of claim 21, wherein the treatment specific barcode comprises one member of the conjugation pair and the particle comprises the other member of the conjugation pair.

23. The method of any one of claims 21-22, wherein conjugation pairs are selected from the group consisting of azide / dibenzocyclooctyne (DBCO), tetrazine / trans-cyclootene (TCO), streptavidin / biotin, Amine targeted chemistries (NHS ester / amine coupling; Carbodiimide (EDC) coupling of carboxyls to amines), Thiol targeted chemistries (Maleimide / thiol Michael addition; Haloacetamide / thiol alkylation; Disulfide formation / exchange; Vinyl sulfone / thiol), Click chemistry (Cu(I)-catalyzed azidealkyne cycloaddition (CuAAC); Staudinger ligation; and Enzymatic / Tag ligations (SNAP -tag / CLIP -tag; HaloTag).

24. The method of any one of claims 1-23, wherein each treatment specific barcode comprises an adaptor suitable of amplification and / or preparing a sequencing library.

25. The method of any one of claims 1-24, further comprising a step of identifying the treatment specific barcodes associated with the particles.

26. The method of claim 25, wherein said step of step of identifying the treatment specific barcodes associated with the particles comprises reverse transcription of treatment specific barcodes associated with the particles.

27. The method of claim 25, wherein said step of step of identifying the treatment specific barcodes associated with the particles comprises amplifying the treatment specific barcodes associated with the particles.

28. The method of any one of claims 25-27 wherein said step of step of identifying the treatment specific barcodes associated with the particles comprises sequencing.

29. The method of any one of claims 25-28 wherein said step of step of identifying the treatment specific barcodes associated with the particles comprises generating a sequencing library.

30. The method of any one of claims 1-29, wherein at least one particle in the plurality of particles is a core shell particle or capsule.

31. The method of any one of claims 1-30, wherein at least one treatment specific barcode is associated with a component in a core of the particle.

32. The method of claim 31, wherein said component in the core of the particle is a nucleic acid.594917-1608-4613 1Attorney Docket No. 002806- 000158WOPT33. The method of claim 32, wherein said nucleic acid has length sufficient to inhibit / reduce diffusion of the nucleic acid from the core of the particle to outside of the particle.

34. The method of any one of claims 1-33, wherein at least one treatment specific barcode is associated with a component in a shell of the particle.

35. The method of any one of claims 1-34, wherein a cell is present in each particle.604917-1608-4613 1

Images