Viral vectors and viral particles with novel properties and uses thereof

Abstract

The present invention relates to viral vectors, viral particles encoded by such vectors, and use of the same in medicine.

Description

[0001] Viral vectors and viral particles with novel properties and uses thereof

[0002] Cross reference to related applications

[0003] This application depends from and claims priority to European Application No:

[0004] EP25153843.5 filed January 24, 2025, the entire contents of which are incorporated herein by reference.

[0005] Sequence Listing Incorporation by Reference Statement

[0006] The instant application contains a Sequence Listing which has been submitted in .xml format via Patent Center and is hereby incorporated by reference in its entirety. Said .xml copy, created on January 20, 2025, is named Sequence Listing MYRTOOOlWO.xml and is 116,185 bytes in size.

[0007] Technical field

[0008] The present invention relates to viral vectors, viral particles encoded by such vectors, and use of the same in medicine.

[0009] Background

[0010] Engineering of viral vectors through directed evolution has generated a plethora of potent capsids with improved tropism and function1-9. While recent additions of Cre-recombinase restricted selection and deep sequencing for optimization has improved the accuracy and potency of this approach in recent years, it is still restricted by the serial infectivity and chimeras generated during production that requires multiple generations of screening until the real functional capsids surface2-4. Due to the randomness of the process, a very small fraction of the de novo sequences code for valid in frame amino-acid substitutions, and even fewer are assembled correctly. This screening approach is also inherently unreproducible and optimizations have to be conducted post hoc. The resulting capsid variants also provide little insights into the function and what molecular targets are engaged.

[0011] A commonly used alternative approach is rational design, where systematic changes are made based on the known properties of the capsid (e.g., the removal of heparan sulfate proteoglycan binding from the AAV2 capsid) or through systematic amino-acid substitutions or display of high affinity nanobodies of the capsid surface10-14. While functionally more stringent, this approach provides less diversity and has more restricted functional potential.Developing better AAV capsids for oligodendrocytes is crucial for treating a range of different disorders, including myelin-related disorders and other neurological disorders. Current capsids, such as OligOOl, show promise but have limitations, including suboptimal targeting efficiency, variable transduction, and immune-related risks. Challenges with OligOOl, like inconsistent transduction in diverse cell populations, highlight the need for improved specificity and reduced off-target effects. Addressing these drawbacks is vital for advancing effective therapies.

[0012] Summary

[0013] Accordingly, there is a need for viral vectors which can more efficiently target and transduce specific cells, have increased infectivity, and which can be used to more efficiently deliver a transgene to a target cell due to their increased tropism. Enhanced capsid proteins and viral particles comprising such capsid proteins could improve gene delivery, boost myelination, and repair damaged nerves if applied for treatment of e.g. demyelinating diseases.

[0014] The present inventors have developed a set of viral vectors with such improved properties, in particular with improved tropism towards a target cell. The present viral vectors are particularly suitable for targeting and transducing cells of the central nervous system, such as oligodendrocytes. Importantly, the set of viral vectors described herein have enhanced transduction efficiency and target cell selectivity, which is highly important for AAV gene therapy.

[0015] In a one embodiment, the set of viral vectors disclosed herein comprise a modified capsid gene, said gene having a polynucleotide insert. Preferably, the polynucleotide insert is inserted in the capsid gene encoding for capsid protein VP1. Hence, in one embodiment, the viral vectors disclosed herein encode for viral particles comprising modified capsid proteins, wherein said modified capsid proteins thus preferably comprise a polypeptide insert encoded by said polynucleotide insert. In one embodiment, the viral vectors disclosed herein have an improved tropism for oligodendrocytes as compared to a reference or ‘parent’ viral vector encoding for a reference or ‘parent’ viral particle. In other words, the viral vectors specifically target oligodendrocytes, i.e. have a high specificity of oligodendrocytes as compared to other cells, such as liver cells.

[0016] Hence, the present disclosure provides a viral vector encoding a viral particle for delivery of a transgene to a target cell, said viral vector comprising a modified capsid gene,wherein the modified capsid gene comprises a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising:

[0017] SEQ ID NO: 9;

[0018] SEQ ID NO: 10;

[0019] SEQ ID NO: 6;

[0020] SEQ ID NO: 7; or

[0021] SEQ ID NO: 8;

[0022] or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8.

[0023] Further provided herein is a viral particle encoded by the viral vector as described herein in the section “Viral vector”.

[0024] Also provided herein is a modified capsid protein comprising a polypeptide insert, wherein said polypeptide insert comprises:

[0025] SEQ ID NO: 9;

[0026] SEQ ID NO: 10;

[0027] SEQ ID NO: 6;

[0028] SEQ ID NO: 7; or

[0029] SEQ ID NO: 8;

[0030] or a polypeptide having one amino acid substitution relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8.

[0031] Further provided herein is a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for use as a medicament.

[0032] Also provided herein is a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for use in delivering a transgene to a target cell, preferably wherein the transgene is as described herein in the section “Transgene” and the target cell is as described herein in the section “Target cell”.

[0033] Further provided herein is a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for use in gene therapy.Also provided herein is a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for use in the treatment of a disease or disorder.

[0034] Further provided herein is a method of treatment of a disease or disorder of the central nervous system, said method comprising administration of the viral vector or viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, to an individual in need thereof. In one embodiment, the individual suffers from one or more disease or disorder as described herein.

[0035] Also provided herein is the use of a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for the manufacture of a medicament for the treatment of a disease or disorder.

[0036] Further provided herein is a method of delivering a transgene to a target cell, said method comprising:

[0037] i. providing a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively; and

[0038] ii. injecting said viral vector or viral particle into an injection site, such as an intracerebroventricular injection site or an intrastriatal injection site.

[0039] Also provided herein is the use of the viral vector or viral particle described herein for delivery of a transgene to a target cell, such as for transduction of a target cell.

[0040] Description of Drawings

[0041] Figure 1: Characterization of Kingfisher 10 using intracerebroventricular (ICV) and intrastriatal (IS) injections.

[0042] A (Intracerebroventricular injection). Kingfisher 10 (derived from AAV2) shows enriched number of GFP+ cells in corpus callosum with cells also found in cortex and septum. Spread from the ventricle is superior to oligOOl in the rostral-caudal axis, with overlapping Olig2 cells in the corpus callosum.

[0043] B (Intracerebroventricular injection). Kingfisher 10 shows enriched number of GFP+ cells in corpus callosum with cells also found in cortex and septum. Spread fromthe ventricle is superior to oligOOl in the rostral-caudal axis, with overlapping Olig2+ cells in the corpus callosum.

[0044] C (Intracerebroventricular injection). Kingfisher 10 shows GFP+ cells in the corpus callosum with cells also found in cortex. GFP+ cells in the corpus callosum overlap with olig2+ cells.

[0045] D (Intrastriatal injection). Kingfisher 10 shows good spread in the rostral-caudal axis and in the medial-lateral axis with many GFP+ cells.

[0046] E (Intrastriatal injection). Kingfisher 10 injection shows that Corpus callosum contain a good amount of GFP+ cells that morphologically appear as scattered myelinating oligodendrocytes and non-myelinating oligodendrocytes based on SOX10 overlap.

[0047] Figure 2: Characterization of Kingfisher 28 using intracerebroventricular (ICV) and intrastriatal (IS) injections.

[0048] A (Intracerebroventricular injection). Kingfisher 28 (derived from AAV2) shows enriched number of GFP+ cells in corpus callosum with some cells also found in cortex and septum. Spread from the ventricle is superior to oligOOl in the rostral-caudal and medial-lateral axis, with many GFP+ cells overlapping with Olig2 cells in the corpus callosum.

[0049] B (Intracerebroventricular injection). Kingfisher 28 shows enriched number of GFP+ cells in corpus callosum with some cells also found in cortex and septum. Spread from the ventricle is superior to oligOOl in the rostral- caudal and medial-lateral axis, with many GFP+ cells overlapping with Olig2 cells in the corpus callosum.

[0050] C (Intrastriatal injection). Kingfisher 28 shows good spread in the rostral-caudal axis and in the medial-lateral axis with many GFP+ cells in the Corpus callosum (CC).

[0051] D (Intrastriatal injection). Kingfisher 28 injection shows that Corpus callosum contains a good amount of GFP+ cells that morphologically appear as scattered myelinating oligodendrocytes and non-myelinating oligodendrocytes based on SOX10 overlap as well as other GFP+ cells.Figure 3: Characterization of Kingfisher 193 using intracerebroventricular (ICV) and intrastriatal (IS) injections.

[0052] A (Intracerebroventricular injection). Kingfisher 193 (derived from AAV2) shows high enrichment of GFP+ cells in corpus callosum with some cells also found in cortex and fimbria, hippocampus and septum. Spread from the ventricle is superior to oligOOl in the rostral-caudal and medial-lateral axis. Enrichment of GFP+ cells in the corpus callosum that overlaps with Olig2+.

[0053] B (Intracerebroventricular injection). Kingfisher 193 shows high enrichment of GFP+ cells in corpus callosum. GFP+ cells are almost only found in the corpus callosum with little or no neurons and are overlapping with Olig2+ cells.

[0054] C (Intrastriatal injection). Kingfisher 193 shows good spread in the rostral-caudal axis but more limited in the medial-lateral axis. GFP+ staining appears to be high in the corpus callosum and striatum with relatively few projections, indicating reduced neuronal transduction. White matter cells in corpus callosum are well transduced.

[0055] D (Intrastriatal injection). Kingfisher 193 injection shows GFP+ cells in the corpus callosum (CC) and overlap with SOX10, mainly in the periphery of the main transduction area. However, staining for SOX10 also appears less intense in the transduction area. Scattered neurons are also found in proximity to the corpus callosum but majority of GFP cells have a non-neuronal morphology. In the Striatum, GFP+ cells have mainly a non-neuronal morphology. SOX10 overlapping cells are also found in the white matter bundles.

[0056] Figure 4: Characterization of Kingfisher 249 using intracerebroventricular (ICV) and intrastriatal (IS) injections.

[0057] A (Intracerebroventricular injection). Kingfisher 249 (derived from AAV2) shows highly specific spread from the ventricle to the corpus callosum with few cells with neuronal morphology in the cortex and septum. Spread from ventricle is superior to OligOOl in the rostral-caudal and medial lateral axis and GFP+ cells are overlapping with Olig2+ cells with high specificity.

[0058] B (Intrastriatal injection). Kingfisher 249 shows good spread in the rostral-caudal axis and in the medial-lateral axis with many GFP+ cells in the Corpus callosum (CC)with strong expression. In the striatum, GFP+ cells appear within the gray matter with strong signal. Strong GFP+ neurons are also found in the Globus Pallidus.

[0059] C (Intrastriatal injection). Kingfisher 249 injection shows a good amount of GFP+ cells in Corpus callosum that morphologically appear as scattered myelinating oligodendrocytes and non-myelinating oligodendrocytes based on SOX10 overlap as well as other GFP+ cells. In the striatum (STRI) GFP+ cells are mainly found in the grey matter with overlapping SOX10+ cells.

[0060] Figure 5: Characterization of Kingfisher D2 using intracerebroventricular (ICV) and intrastriatal (IS) injections.

[0061] A (Intracerebroventricular injection). Kingfisher D2 (derived from AAV2) shows enriched number of GFP+ cells in corpus callosum with cells also found in cortex, fimbria, hippocampus and septum. Spread from the ventricle is superior to oligOOl in the rostral- caudal and medial-lateral axis, with overlapping Olig2+ cells in the corpus callosum.

[0062] B (Intracerebroventricular injection). Kingfisher D2 shows enriched number of GFP+ cells in corpus callosum with cells also found in cortex and septum. Spread from the ventricle is superior to oligOOl in the rostral-caudal and medial-lateral axis, with overlapping Olig2+ cells in the corpus callosum.

[0063] C (Intrastriatal injection). Kingfisher D2 shows good spread in the rostral-caudal and medial-lateral axis with many GFP+ cells. GFP+ staining appears within and adjacent to the corpus callosum (CC) and within the striatum as well as in some striata white matter bundles. Cells with GFP and SOX10 overlap are readily apparent.

[0064] D (Intrastriatal injection). Kingfisher D2 injection shows that Corpus callosum (CC) contains a large amount of GFP+ cells. SOX10 staining overlap with many GFP+. In the striatum (STRI) GFP+ cells are found in the grey matter but also some white matter bundles. Many cells here show overlap between GFP and SOX10.

[0065] Figure 6: Comparison of Kingfisher 193, Kingfisher D2, native AAV2 and OligOOl. After injections in striatum and corpus callosum Kingfisher 193 shows improved oligodendrocyte specificity & Kingfisher D2 shows increased spread as well as increased oligodendrocyte infectivity, compared to OligOOl and parent capsid AAV2.Figure 7: Comparison of Kingfisher 249 and OligOOl after intracerebroventricular injection. Kingfisher 249 shows superior oligodendrocyte targeting compared to OligOOl following ICV injection.

[0066] Detailed description

[0067] Definitions

[0068] Capsid protein: The term ‘capsid protein’ as used herein refers to the proteins which make up the capsid, i.e. the protein shell, of a virus. Capsid proteins are sometimes also referred to as viral coat proteins. The term capsid and viral particle is used interchangeably herein. The capsid or viral particle made up by the capsid proteins commonly encloses genetic material. The capsid or viral particle may for example enclose a transgene as described herein. Preferably, the capsid protein of the present disclosure is a modified capsid protein, said modified capsid protein comprising a peptide insert as compared to a native, unmodified, capsid protein. Even more preferably, said peptide insert gives the capsid protein, and thus the viral particle, improved properties, such as improved tropism for specific cell types, as compared to a native, unmodified capsid protein and a viral particle made up of such native, unmodified capsid protein.

[0069] Expression: The term ‘expression’ of a nucleic acid sequence or polynucleotide refers to the transcription of that nucleic acid sequence or polynucleotide to mRNA and / or transcription and translation of that nucleic acid sequence or polynucleotide, resulting in production of the polypeptide encoded by the nucleic acid sequence or polynucleotide.

[0070] Gene : The term ‘gene therapy’ used herein refers to the delivery of one or more genes into an individual's cells and tissues to treat a disease or disorder.

[0071] Insertion or insert: The term “insertion” or “insert” (used interchangeably herein) is herein used to refer to polynucleotides or polypeptides which are inserted in a capsid gene or capsid protein, respectively, thus rendering a modified capsid gene or a modified capsid protein, respectively. Preferably, a polynucleotide insert in a capsid gene is inserted at a given position, “in addition” to the capsid gene; hence, preferably, no polynucleotide fragment of the parent capsid gene is replaced by the polynucleotide, and the length of the modified capsid gene in which the polynucleotide is inserted is thus equal to the length of the parent capsid gene plus the length of the inserted polynucleotide. Likewise, the length of amodified capsid protein displaying a given polypeptide is equal to the length of the parent capsid protein plus the length of the displayed polypeptide.

[0072] The term is herein used in reference to a capsid gene or a capsid protein.

[0073] Preferably, a modified capsid protein is a capsid protein which displays an inserted polypeptide, such as a capsid protein as described herein. The capsid protein may thus have properties which have been altered by the insertion of said polypeptide. By extension, a modified capsid gene refers to a capsid gene in which a polynucleotide has been inserted, encoding for a polypeptide which when displayed on the capsid potentially alters its properties. The viral vectors and viral particles disclosed herein preferably comprise modified capsid genes and modified capsid proteins, respectively. Hence, the viral vectors disclosed herein preferably comprise an additional polynucleotide sequence encoding for a polypeptide which, when displayed on the modified capsid protein of the viral particle encoded by the viral vector, may alter the capsid protein’s properties. An unmodified capsid gene and capsid protein comprises a native polynucleotide and polypeptide sequence, respectively, without any polynucleotide or polypeptide insert.

[0074] linked The term ‘operably linked’ as used herein when referring to two polynucleotides indicates that identification of one of the two polynucleotides enables identification of the other of the two polynucleotides. The two polynucleotides that are operably linked may be physically part of the same nucleic acid molecule, or they may be on different nucleic acid molecules, i.e. they may be operably linked in trans.

[0075] Promoter: The term promoter’ is used herein as is known in the art and refers to a region of DNA that facilitates the transcription of a particular gene. Promoters are typically located near the genes they regulate, preferably on the same strand and upstream of the gene.

[0076] Transqene: The term herein designates a polynucleotide, which it is desirable to introduce in a target cell. The transgene may be a gene which is not naturally or natively expressed in said cell. In some embodiments, a mutated version of a native gene is present and expressed in the target cells, and the transgene is a non-mutated version of said native gene. In other words, the target cells may comprise a mutated native gene which upon expression encodes an enzyme or protein that is non-functioning, or sub-optimally functioning, as compared to a non-mutated version of said native gene. Hence, the transgene may be introduced to replace or complement said mutated native gene. Thus, preferably, the transgene encodes a non-mutated, functioning protein or enzyme, or afunctional domain thereof. Preferably, the viral particle or capsid protein comprises the transgene. The transgene is preferably harboured between terminal repeats or inverted terminal repeats on the viral vector, on a separate vector, or on another polynucleotide strand. The transgene may be expressed in the target cells once it has been delivered to said target cells.

[0077] The term “treatment” as used herein may refer to any kind of treatment. The treatment may be a curative treatment. It may also be an ameliorating treatment and / or a treatment reducing the effects, such as one or more symptoms, of a disease or disorder. The treatment may also be a treatment which delays progression of a disease or disorder, for example the treatment may reduce the speed of which symptoms appear or develop.

[0078] Viral : The term herein refers to the polynucleotide regions (DNA or RNA) which are flanked by terminal repeats (TR) and consequently packaged within a virion. For DNA viruses, the terminal repeats are inverted and termed inverted terminal repeats (ITR).

[0079] Retroviruses and lentoviruses typically have long terminal repeats (LTR). Accordingly, a gene such as a capsid gene, which is outside the viral genome, may be on the same polynucleotide molecule as the viral genome, but is not flanked by TR sequences and is thus not packaged within the virions.

[0080] Viral : The term viral particle as used herein refers to the virus encoded by the viral vectors as described herein. Preferably, the viral particle comprises a capsid protein, such as a modified capsid protein as described herein above. The viral particle may further comprise a transgene, optionally flanked by ITRs.

[0081] Viral vector

[0082] The present inventors have developed viral vectors with improved properties. In particular, said viral vectors comprise a polynucleotide insert in the gene encoding for capsid proteins, which results in the vectors encoding a capsid protein with surprisingly high tropism for specific target cells. Hence, said viral vectors are surprisingly efficient at delivering transgenes to and transducing specific target cells. Said target cells are preferably as described herein in the section “Target cell”.

[0083] The viral vectors and viral particles encoded by such viral vectors may be useful for a number of applications, for example in gene therapy and in particular for gene transfer to the central nervous system (CNS).Thus, the viral vectors disclosed herein preferably comprise a modified capsid gene, wherein said modified capsid gene comprises a polynucleotide insert. Further preferably, said modified capsid gene preferably encodes a modified capsid protein having improved properties, such as improved tropism, as compared to a native, unmodified, capsid protein.

[0084] In other words, the viral vectors disclosed herein preferably encode viral particles comprising modified capsid proteins, wherein said modified capsid proteins thus preferably comprise a polypeptide encoded by the polynucleotide insert in the modified capsid gene.

[0085] Thus, in one embodiment, the present disclosure provides a viral vector encoding a viral particle for delivery of a transgene to a target cell, said viral vector comprising a modified capsid gene,

[0086] wherein the modified capsid gene comprises a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising:

[0087] SEQ ID NO: 9;

[0088] SEQ ID NO: 10;

[0089] SEQ ID NO: 6;

[0090] SEQ ID NO: 7; or

[0091] SEQ ID NO: 8;

[0092] or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8.

[0093] Hence, in one embodiment, the present disclosure provides a viral vector encoding a viral particle for delivery of a transgene to a target cell, said viral vector comprising a modified capsid gene,

[0094] wherein the modified capsid gene comprises a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising SEQ ID NO: 9 or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 9.

[0095] In one embodiment, the present disclosure provides a viral vector encoding a viral particle for delivery of a transgene to a target cell, said viral vector comprising a modified capsid gene,

[0096] wherein the modified capsid gene comprises a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising SEQ ID NO: 10 or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 10.In one embodiment, the present disclosure provides a viral vector encoding a viral particle for delivery of a transgene to a target cell, said viral vector comprising a modified capsid gene,

[0097] wherein the modified capsid gene comprises a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising SEQ ID NO: 6 or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 6.

[0098] In one embodiment, the present disclosure provides a viral vector encoding a viral particle for delivery of a transgene to a target cell, said viral vector comprising a modified capsid gene,

[0099] wherein the modified capsid gene comprises a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising SEQ ID NO: 7 or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 7.

[0100] In one embodiment, the present disclosure provides a viral vector encoding a viral particle for delivery of a transgene to a target cell, said viral vector comprising a modified capsid gene,

[0101] wherein the modified capsid gene comprises a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising SEQ ID NO: 8 or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 8.

[0102] In one embodiment, the polypeptide comprises or consists of two, three, four or five of SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8.

[0103] In one embodiment, the modified capsid gene is outside the viral genome. In one embodiment, the vector further comprises at least one replication gene. In one embodiment, the viral vector further comprises at least one assembly gene.

[0104] In one embodiment, the polynucleotide insert comprises:

[0105] SEQ ID NO: 4;

[0106] SEQ ID NO: 5;

[0107] SEQ ID NO: 1;

[0108] SEQ ID NO: 2; or

[0109] SEQ ID NO: 3;or a polynucleotide having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity to SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 1 ; SEQ ID NO: 2; or SEQ ID NO: 3.

[0110] In one embodiment, the polynucleotide insert comprises or consists of two, three, four or five of SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 1 , SEQ ID NO: 2 and / or SEQ ID NO: 3.

[0111] In one embodiment, the polypeptide insert has a length of between 5 and 30 amino acids, such as 7 and 20 amino acids, such as 10 and 15 amino acids.

[0112] In one embodiment, the viral vector is an adeno-associated virus (AAV) vector, a retrovirus vector, a lentivirus vector, an adeno-virus vector, a herpes simplex virus vector, a bocavirus vector or a rabies virus vector.

[0113] Preferably, the viral vector is an AAV vector. Even more preferably, the viral vector is an AAV2 vector or an AAV9 vector.

[0114] The viral vector preferably encodes a viral particle comprising a modified capsid protein as described herein in the sections “Viral particle” and “Modified capsid protein”, respectively.

[0115] In one embodiment, the viral vector is an AAV vector and the polynucleotide insert encoding the polypeptide is located between two adjacent nucleotides at a position between nucleotide 1710 and 1833 of the polynucleotide encoding VP1 of AAV2, or the corresponding position in a polynucleotide encoding a VP1 of another AAV serotype.

[0116] In one embodiment, the viral vector is an AAV vector and the polynucleotide insert encoding the polypeptide is located between nucleotide number 1761 and 1762 of the polynucleotide encoding VP1 of AAV2, or the corresponding position in a polynucleotide encoding a VP1 of another AAV serotype.

[0117] In one embodiment, the viral vector is an AAV vector and the modified capsid gene encodes a modified capsid protein, wherein the polypeptide encoded by the polynucleotide insert is located at a surface-exposed region of VP1, VP2, and / or VP3.In one embodiment, the viral vector is an AAV vector and the modified capsid gene encodes a modified capsid protein, wherein the polypeptide encoded by the polynucleotide insert is located in a loop region of VP1 corresponding structurally to amino acid 570 to 611 in AAV2.

[0118] In one embodiment, the viral vector is an AAV vector and the modified capsid gene encodes a modified capsid protein, wherein the polypeptide encoded by the polynucleotide insert is located at a position between amino acid number 570 and 611 of the VP1 capsid protein of AAV2, or the corresponding position in a polypeptide encoding VP1 of another AAV serotype.

[0119] In other words, in one embodiment, the polypeptide encoded by the polynucleotide insert is located between two adjacent amino acids at a position between amino acid number 570 and 611 of the VP1 capsid protein of AAV2, or the corresponding position in a polypeptide encoding VP1 of another AAV serotype.

[0120] In one embodiment, the viral vector is an AAV vector and the modified capsid gene encodes a modified capsid protein, wherein the polypeptide encoded by the polynucleotide insert is located between amino acid number 587 and 588 of the VP1 capsid protein of AAV2, or the corresponding position in a polypeptide encoding VP1 of another AAV serotype.

[0121] In other words, in one embodiment, the polypeptide encoded by the polynucleotide insert is located between amino acid number 587 and 588 of the VP1 capsid protein of AAV2, or the corresponding position in a polypeptide encoding VP1 of another AAV serotype.

[0122] The polypeptide may be flanked by one or more amino acids. In one embodiment, said one or more amino acids is alanine, glycine and / or serine. In other words, the polypeptide may comprise one or more amino acids, such as one or more alanine, glycine and / or serine at the C- and / or N-terminal of the peptide. Hence, in one embodiment, the polynucleotide insert further comprises one or more codons encoding one or more amino acids, such as one or more alanine, glycine and / or serine at the 5’- and / or 3’-strand of said polynucleotide insert.

[0123] In a preferred embodiment, the polypeptide is flanked by one or more alanine. In one embodiment, the polypeptide is flanked by one alanine at the N-terminal and one alanine at the C-terminal. In one embodiment, the polypeptide is flanked by two alanine at the N-terminal and two alanine at the C-terminal. In one embodiment, the polypeptide is flanked by three alanine at the N-terminal and three alanine at the C-terminal.In one embodiment, the polynucleotide insert encodes a polypeptide comprising or consisting of:

[0124] SEQ ID NO: 35;

[0125] SEQ ID NO: 36;

[0126] SEQ ID NO: 32;

[0127] SEQ ID NO: 33; or

[0128] SEQ ID NO: 34;

[0129] or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 35; SEQ ID NO: 36; SEQ ID NO: 32; SEQ ID NO: 33; or SEQ ID NO: 34.

[0130] Thus, in one embodiment, the polynucleotide insert comprises of consists of:

[0131] SEQ ID NO: 30;

[0132] SEQ ID NO: 31;

[0133] SEQ ID NO: 27;

[0134] SEQ ID NO: 28; or

[0135] SEQ ID NO: 29;

[0136] or a polynucleotide sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity to SEQ ID NO:30; SEQ ID NO: 31; SEQ ID NO: 27; SEQ ID NO: 28; or SEQ ID NO: 29.

[0137] In one embodiment, the viral vector is an AAV2 vector comprising a modified AAV2 capsid gene. Hence, in one embodiment the viral vector comprises:

[0138] SEQ ID NO: 16;

[0139] SEQ ID NO: 17;

[0140] SEQ ID NO: 13;

[0141] SEQ ID NO: 14; or

[0142] SEQ ID NO: 15;

[0143] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 13; SEQ ID NO: 14; or SEQ ID NO: 15.

[0144] In one embodiment, the viral vector encodes an AAV2 viral particle comprising a modified AAV2 capsid protein . Hence, in one embodiment the viral vector comprises a polynucleotide encoding a polypeptide comprising or consisting of:SEQ ID NO: 21;

[0145] SEQ ID NO: 22;

[0146] SEQ ID NO: 18;

[0147] SEQ ID NO: 19; or

[0148] SEQ ID NO: 20;

[0149] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 21; SEQ ID NO: 22; SEQ ID NO: 18; SEQ ID NO: 19; or SEQ ID NO: 20.

[0150] In one embodiment, the viral vector is an AAV9 vector comprising a modified AAV9 capsid gene. Hence, in one embodiment, the viral vector comprises:

[0151] SEQ ID NO: 40;

[0152] SEQ ID NO: 41;

[0153] SEQ ID NO: 37;

[0154] SEQ ID NO: 38; or

[0155] SEQ ID NO: 39;

[0156] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 37; SEQ ID NO: 38; or SEQ ID NO: 39.

[0157] In one embodiment, the viral vector encodes an AAV9 viral particle comprising a modified AAV9 capsid protein. Hence, in one embodiment the viral vector comprises a polynucleotide encoding a polypeptide comprising or consisting of:

[0158] SEQ ID NO: 45;

[0159] SEQ ID NO: 46;

[0160] SEQ ID NO: 42;

[0161] SEQ ID NO: 43; or

[0162] SEQ ID NO: 44;

[0163] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 45; SEQ ID NO: 46; SEQ ID NO: 42; SEQ ID NO: 43; or SEQ ID NO: 44.In some embodiments, the viral vector further comprises a transgene. In one embodiment, the transgene is harboured on the same viral vector as the modified capsid gene. In one embodiment, the transgene is harboured on a separate vector, thus forming a vector system comprising a viral vector and a vector for the transgene. In one embodiment, the transgene is as described herein in the section “Transgene”.

[0164] In one embodiment, the present invention provides one or more vectors comprising:

[0165] i. a modified capsid gene as set forth in:

[0166] SEQ ID NO: 16;

[0167] SEQ ID NO: 17;

[0168] SEQ ID NO: 13;

[0169] SEQ ID NO: 14; or

[0170] SEQ ID NO: 15;

[0171] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 13; SEQ ID NO: 14; or SEQ ID NO: 15; and

[0172] ii. a transgene comprising or consisting of SEQ ID NO: 47, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 47.

[0173] In one embodiment, the present invention provides one or more vectors comprising:

[0174] i. a modified capsid gene as set forth in:

[0175] SEQ ID NO: 40;

[0176] SEQ ID NO: 41;

[0177] SEQ ID NO: 37;

[0178] SEQ ID NO: 38; or

[0179] SEQ ID NO: 39;

[0180] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 37; SEQ ID NO: 38; or SEQ ID NO: 39; and

[0181] ii. a transgene comprising or consisting of SEQ ID NO: 47, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, suchas at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 47.

[0182] As indicated above, the modified capsid gene may be comprised on a first, viral vector and the transgene may be comprised on a separate vector, thus forming a vector system. Th person skilled in the art knows how to select a vector system which is suitable for combining the transgene and the modified capsid gene.

[0183] Target cell

[0184] As stated herein above, the viral vectors and viral particles disclosed herein have superior properties as compared to viral vectors and viral particles not comprising a polynucleotide and polypeptide insert, respectively. Preferably, the viral vectors and viral particles have improved tropism for specific target cells.

[0185] In one embodiment, the target cell is a cell of the central nervous system.

[0186] In one embodiment, the target cell is a glial cell and / or a neuron.

[0187] In one embodiment, the target cell is an oligodendrocyte, a microglia, and / or a neuron.

[0188] In a preferred embodiment, the target cell is an oligodendrocyte. In other words, the viral vectors and viral particles preferably specifically target oligodendrocytes, i.e. have a high specificity for oligodendrocytes as compared to other cells.

[0189] In one embodiment, the viral vectors and viral particles are more efficient at transduction of a transgene to oligodendrocytes as compared to viral particles not comprising a polynucleotide and polypeptide insert, respectively.

[0190] In one embodiment, the viral vector and viral particle have reduced liver tropism.

[0191] In one embodiment, the viral vector and viral particle have improved tropism for oligodendrocytes as compared to a ‘parent’ viral vector and viral particle, respectively, wherein said ‘parent’ viral vector and viral particle do not comprise a polynucleotide insert and polypeptide insert, respectively. In one embodiment, the viral vector and viral particle have improved transduction to oligodendrocytes as compared to a ‘parent’ viral vector and viral particle, respectively, wherein said ‘parent’ viral vector and viral particle do not comprisea polynucleotide and polypeptide insert, respectively. The skilled person will understand that the ’parent’ viral vector is a native AAV2 vector if the polynucleotide insert has been inserted in an AAV2 capsid gene.

[0192] In one embodiment, the viral vector and viral particle have improved tropism for oligodendrocytes as compared to a reference viral vector and reference viral particle, respectively. In one embodiment, the viral vector and viral particle have improved transduction to oligodendrocytes as compared to a reference viral vector and reference viral particle, respectively.

[0193] Hence, the viral vector and viral particle are preferably better at delivering a transgene to the target cell, such as the oligodendrocyte, as compared to a reference viral vector and reference viral particle, respectively.

[0194] In one embodiment, the reference viral vector is vector rAAV-Olig001 (referred to herein as OligOOl) described by e.g. Leone et al. (2025). Hence, in one embodiment, the reference viral vector comprises a polynucleotide sequence as set forth in SEQ ID NO: 11, encoding a capsid protein as set forth in SEQ ID NO: 12 as well as the corresponding VP2 and VP3 domains thereof.

[0195] In other words, the viral vector and viral particles disclosed herein are preferably more efficient at targeting, e.g. transducing, oligodendrocytes as compared to a reference viral vector as described by e.g. Leone et al. (2025).

[0196] In one embodiment, one or more of:

[0197] i. tropism of the viral particle for the target cell;

[0198] ii. delivery of the transgene by the viral particle to the target cell;

[0199] iii. transduction of the target cell;

[0200] iv. targeting of the target cell;

[0201] v. infectivity of the viral vector or viral particle; and

[0202] vi. retrograde transport of the viral vector or viral particle;

[0203] is / are improved as compared to a reference or ‘parent’ viral vector or a reference or ‘parent’ viral particle encoded by such reference or ‘parent’ viral vector.In one embodiment, the tropism of the viral particle for the target cell is improved by at least 50-fold as compared to the tropism of a reference or ‘parent’ viral particle encoded by a reference or ‘parent’ viral vector.

[0204] Preferably, the ‘parent’ or ‘reference’ viral vector further comprises the same transgene as the viral vector disclosed herein. Further preferably, the ‘parent’ or ‘reference’ viral particle further comprises the same transgene as the viral particle disclosed herein.

[0205] In one embodiment, the tropism of the modified viral particle for the target cell is improved by:

[0206] • at least 100 fold, such as at least 150 fold, such as at least 200 fold, such as at least 250 fold, such as at least 300 fold, such as at least 350 fold, such as at least 400 fold, such as at least 450 fold, such as at least 500 fold, such as at least 550 fold, such as at least 600 fold, such as at least 650 fold, such as at least 700 fold, such as at least 750 fold, such as at least 800 fold, such as at least 850 fold, such as at least 900 fold, such as at least 950 fold, such as at least 1000 fold, such as at least 1500 fold, such as at least 2000 fold, such as at least 2500 fold, such as at least 3000 fold, such as at least 3500 fold, such as at least 4000 fold, such as at least 4500 fold, such as at least 5000 fold, such as at least 5500 fold, such as at least 6000 fold; or • between 50-fold and 5000-fold, such as between 500-fold and 2500-fold, such as between 750-fold and 1500-fold;

[0207] as compared to the tropism of a reference or ‘parent’ viral vector or a reference or ‘parent’ viral particle encoded by such reference or ‘parent’ viral vector.

[0208] In one embodiment, the delivery of the transgene to the target cell is improved by:

[0209] • at least 100 fold, such as at least 150 fold, such as at least 200 fold, such as at least 250 fold, such as at least 300 fold, such as at least 350 fold, such as at least 400 fold, such as at least 450 fold, such as at least 500 fold, such as at least 550 fold, such as at least 600 fold, such as at least 650 fold, such as at least 700 fold, such as at least 750 fold, such as at least 800 fold, such as at least 850 fold, such as at least 900 fold, such as at least 950 fold, such as at least 1000 fold, such as at least 1500 fold, such as at least 2000 fold, such as at least 2500 fold, such as at least 3000 fold, such as at least 3500 fold, such as at least 4000 fold, such as at least 4500 fold, such as at least 5000 fold, such as at least 5500 fold, such as at least 6000 fold; or • between 50-fold and 5000-fold, such as between 500-fold and 2500-fold, such as between 750-fold and 1500-fold;as compared to the delivery of the transgene to the target cell by a reference or ‘parent’ viral vector or a reference or ‘parent’ viral particle encoded by such reference or ‘parent’ viral vector.

[0210] In one embodiment, the reference viral vector comprises SEQ ID NO: 11. Thus, in one embodiment, the viral particle is encoded by SEQ ID NO: 11 and / or comprises SEQ ID NO: 12.

[0211] In one embodiment, the viral vector is an AAV vector comprising a polynucleotide insert in the capsid gene encoding for VP1 , and the reference viral vector is a native AAV vector which does not comprise any polynucleotide insert in the capsid gene encoding for VP1.

[0212] In one embodiment, the parent vector comprises SEQ ID NO: 23. Thus, in one embodiment, the viral particle is encoded by SEQ ID NO: 23 and / or comprises SEQ ID NO: 24.

[0213] In one embodiment, the parent vector comprises SEQ ID NO: 25. Thus, in one embodiment, the viral particle is encoded by SEQ ID NO: 25 and / or comprises SEQ ID NO: 26.

[0214] Viral particle

[0215] Further provided herein is a viral particle encoded by the viral vector as described herein in the section “Viral vector”.

[0216] In one embodiment, the viral particle is an AAV, a retrovirus, a lentivirus, an adeno-virus, a herpes simplex virus, a bocavirus or a rabies virus.

[0217] In one embodiment, the viral particle is an AAV.

[0218] In a preferred embodiment, the viral particle is an AAV2 or an AAV9.

[0219] The viral particle preferably comprises a capsid comprising or consisting of a modified capsid protein as described herein in the section “Modified capsid protein”. In one embodiment, the modified capsid protein is encoded by the modified capsid gene harboured on the viral vector.

[0220] Thus, in one embodiment, the modified capsid gene encodes a modified capsid protein.In one embodiment, the viral particle displays the polypeptide encoded by the polynucleotide insert on the surface of the modified capsid protein.

[0221] In one embodiment, the viral particle comprises a capsid protein comprising:

[0222] SEQ ID NO: 21;

[0223] SEQ ID NO: 22;

[0224] SEQ ID NO: 18;

[0225] SEQ ID NO: 19; or

[0226] SEQ ID NO: 20;

[0227] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 21; SEQ ID NO: 22; SEQ ID NO: 18; SEQ ID NO: 19; or SEQ ID NO: 20.

[0228] In one embodiment, the viral particle comprises a capsid protein comprising:

[0229] SEQ ID NO: 45;

[0230] SEQ ID NO: 46;

[0231] SEQ ID NO: 42;

[0232] SEQ ID NO: 43; or

[0233] SEQ ID NO: 44;

[0234] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 45; SEQ ID NO: 46; SEQ ID NO: 42; SEQ ID NO: 43; or SEQ ID NO: 44.

[0235] It is well known in the art that an AAV capsid or AAV viral particle is composed of a mixture of VP1 , VP2 and VP3. The ratio of VP1 :VP2:VP3 is further known in the art to be approximately 1:1:10. The three VPs are encoded from the same polynucleotide. The mRNA generated from said polynucleotide is spliced and / or translated differently (i.e. using different start codons) in order to generate each respective VP. VP1, VP2 and VP3 thus share overlapping sequences, with a common C-terminus but different N-terminal extensions. VP1 is the largest, VP2 the second largest, and VP3 the smallest, with sizes of approximately SO-87 kDa; 65-73 kDa; and 60-62 kDa; respectively. Hence, the full sequence of VP2 and VP3 are “comprised in” the sequence of VP1. Thus, the skilled person understands that a viral vector comprising a modified capsid gene encoding VP1 is also capable of encoding VP2 and VP3, and is thus capable of encoding a full, functioning AAV viral particle.In one embodiment, the viral particle comprises or consists of modified VP1, VP2 and VP3 capsid proteins encoded by the polynucleotide sequence set forth in:

[0236] SEQ ID NO: 16;

[0237] SEQ ID NO: 17;

[0238] SEQ ID NO: 13;

[0239] SEQ ID NO: 14; or

[0240] SEQ ID NO: 15;

[0241] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 13; SEQ ID NO: 14; or SEQ ID NO: 15.

[0242] In one embodiment, the viral particle comprises or consists of modified VP1, VP2 and VP3 capsid proteins encoded by the polynucleotide sequence set forth in:

[0243] SEQ ID NO: 40;

[0244] SEQ ID NO: 41;

[0245] SEQ ID NO: 37;

[0246] SEQ ID NO: 38; or

[0247] SEQ ID NO: 39;

[0248] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 37; SEQ ID NO: 38; or SEQ ID NO: 39.

[0249] In a preferred embodiment, the viral particle further comprises, i.e. encapsulates, a transgene. In one embodiment, the transgene is as described herein in the section “Transgene”.

[0250] Hence, also provided herein is a viral particle comprising:

[0251] i. a modified capsid protein as defined herein in the section “Modified capsid protein”. ii. a transgene as defined herein in the section “Transgene”.

[0252] In one embodiment, the viral particle comprises:

[0253] i. a modified capsid protein encoded by the polynucleotide sequence set forth in: SEQ ID NO: 16;SEQ ID NO: 17;

[0254] SEQ ID NO: 13;

[0255] SEQ ID NO: 14; or

[0256] SEQ ID NO: 15;

[0257] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 13; SEQ ID NO: 14; or SEQ ID NO: 15; and

[0258] ii. a transgene selected from ABCA13, APP, ASPA, ataxia, ataxin 1, ataxin 10, ataxin 2, ataxin 3, ataxin 7, C4A, CACNA1A, C9orf72, channel rhodopsins (gene encoding), chemogenetic receptors (gene encoding), COQ2, DGCR2, DGCR8, DMD, DRD2, DYNC1H1, FGF14, FUS, Galanin, GALC, HTT, IOSCA, ITPR1, KCNA1, KCNC3, KCND3, MAPT, MIR137, NOS1AP, NRXN1, NPY, OLIG2, PDE11a, p11 , PLP1, PLEKHG4, PPP2R2B, PRKCG, PSEN2, RTN4R, SMN1, SMN2, SNCA, SOD1, somatostatin, SPEN1 , SPTBN2, SYN2, TARDBP, TBP, TOP3B, TTBK2, TUBB4A, UBA1, VAPB, YWHAE, orZDHHC8.

[0259] In one embodiment, the viral particle comprises:

[0260] i. a modified capsid protein encoded by the polynucleotide sequence set forth in:

[0261] SEQ ID NO: 40;

[0262] SEQ ID NO: 41;

[0263] SEQ ID NO: 37;

[0264] SEQ ID NO: 38; or

[0265] SEQ ID NO: 39;

[0266] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 37; SEQ ID NO: 38; or SEQ ID NO: 39; and

[0267] ii. a transgene selected from ABCA13, APP, ASPA, ataxia, ataxin 1, ataxin 10, ataxin 2, ataxin 3, ataxin 7, C4A, CACNA1A, C9orf72, channel rhodopsins (gene encoding), chemogenetic receptors (gene encoding), COQ2, DGCR2, DGCR8, DMD, DRD2, DYNC1H1, FGF14, FUS, Galanin, GALC, HTT, IOSCA, ITPR1, KCNA1, KCNC3, KCND3, MAPT, MIR137, NOS1AP, NRXN1, NPY, OLIG2, PDE11a, p11 , PLP1, PLEKHG4, PPP2R2B, PRKCG, PSEN2, RTN4R, SMN1, SMN2, SNCA, SOD1, somatostatin, SPEN1 , SPTBN2, SYN2, TARDBP, TBP, TOP3B, TTBK2, TUBB4A, UBA1, VAPB, YWHAE, orZDHHC8.In one embodiment, the viral particle comprises:

[0268] i. a modified capsid protein encoded by the polynucleotide sequence set forth in:

[0269] SEQ ID NO: 16;

[0270] SEQ ID NO: 17;

[0271] SEQ ID NO: 13;

[0272] SEQ ID NO: 14; or

[0273] SEQ ID NO: 15;

[0274] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 13; SEQ ID NO: 14; or SEQ ID NO: 15; and

[0275] ii. a transgene comprising or consisting of SEQ ID NO: 47, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 47.

[0276] In one embodiment, the viral particle comprises:

[0277] ii. a modified capsid protein encoded by the polynucleotide sequence set forth in: SEQ ID NO: 40;

[0278] SEQ ID NO: 41;

[0279] SEQ ID NO: 37;

[0280] SEQ ID NO: 38; or

[0281] SEQ ID NO: 39;

[0282] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 37; SEQ ID NO: 38; or SEQ ID NO: 39; and

[0283] iii. a transgene comprising or consisting of SEQ ID NO: 47, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 47.

[0284] Modified capsid protein

[0285] Also provided herein is a modified capsid protein comprising a polypeptide insert, wherein said polypeptide insert comprises:SEQ ID NO: 9;

[0286] SEQ ID NO: 10;

[0287] SEQ ID NO: 6;

[0288] SEQ ID NO: 7; or

[0289] SEQ ID NO: 8;

[0290] or a polypeptide having one amino acid substitution relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8.

[0291] In one embodiment, the polypeptide insert comprises or consists of:

[0292] SEQ ID NO: 35;

[0293] SEQ ID NO: 36;

[0294] SEQ ID NO: 32;

[0295] SEQ ID NO: 33; or

[0296] SEQ ID NO: 34;

[0297] or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 35; SEQ ID NO: 36; SEQ ID NO: 32; SEQ ID NO: 33; or SEQ ID NO: 34.

[0298] In one embodiment, the modified capsid protein is encoded by the polynucleotide sequence set forth in:

[0299] SEQ ID NO: 16;

[0300] SEQ ID NO: 17;

[0301] SEQ ID NO: 13;

[0302] SEQ ID NO: 14; or

[0303] SEQ ID NO: 15;

[0304] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 13; SEQ ID NO: 14; or SEQ ID NO: 15.

[0305] In one embodiment, the modified capsid protein is encoded by the polynucleotide sequence set forth in:

[0306] SEQ ID NO: 40;

[0307] SEQ ID NO: 41;

[0308] SEQ ID NO: 37;

[0309] SEQ ID NO: 38; or

[0310] SEQ ID NO: 39;or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 40; SEQ ID NO: 41; SEQ ID NO: 37; SEQ ID NO: 38; orSEQ ID NO: 39.

[0311] Preferably, the modified capsid protein is an AAV capsid protein and the polypeptide insert is relative to a corresponding parent AAV capsid protein that is the same AAV capsid protein of the same wild-type AAV serotype as the modified AAV capsid protein but that does not comprise the polypeptide insert of the modified AAV capsid protein.

[0312] In one embodiment, the modified capsid protein is an AAV capsid protein and the polypeptide insert site is located between two adjacent amino acids at a position between amino acids 570 and 611 of VP1 of AAV2 or the corresponding position in the capsid protein of another AAV serotype.

[0313] In one embodiment, the modified capsid protein is an AAV capsid protein and the polypeptide insert site is located between amino acid 587 and 588 of VP1 of AAV2, or the corresponding position in the capsid protein of another AAV serotype.

[0314] In one embodiment, the modified capsid protein is an AAV2 capsid protein or an AAV9 capsid protein.

[0315] In one embodiment, the modified capsid protein is a modified AAV2 VP1 capsid protein as set forth in:

[0316] SEQ ID NO: 21;

[0317] SEQ ID NO: 22;

[0318] SEQ ID NO: 18;

[0319] SEQ ID NO: 19; or

[0320] SEQ ID NO: 20;

[0321] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 21; SEQ ID NO: 22; SEQ ID NO: 18; SEQ ID NO: 19; orSEQ ID NO: 20;

[0322] and / or the VP2 or VP3 variant of said modified AAV2 VP1 capsid protein.In one embodiment, the modified capsid protein is a modified AAV9 VP1 capsid protein as set forth in:

[0323] SEQ ID NO: 45;

[0324] SEQ ID NO: 46;

[0325] SEQ ID NO: 42;

[0326] SEQ ID NO: 43; or

[0327] SEQ ID NO: 44;

[0328] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 45; SEQ ID NO: 46; SEQ ID NO: 42; SEQ ID NO: 43; or SEQ ID NO: 44;

[0329] and / or the VP2 or VP3 variant of said modified AAV9 VP1 capsid protein.

[0330] Transgene

[0331] The viral vectors disclosed herein preferably further comprises a transgene. In one embodiment, the transgene is harboured on the same viral vector as the modified capsid gene. In one embodiment, the transgene is harboured on a separate vector, thus forming a vector system comprising a viral vector and a vector for the transgene. In one embodiment, the transgene is inserted between the terminal repeat (TR) sequences of the viral genome of the viral vector or of said separate vector.

[0332] In one embodiment, the viral particles disclosed herein in the section “Viral particle” encapsulates said transgene.

[0333] The nature of the transgene will typically be directed by the result that is desired. The transgene may be a gene useful for gene therapy, for example a “replacement” or “correction” gene replacing a gene which is deficient in an individual. The transgene may also encode a protein or a transcript which upon expression may compensate for a deficient mechanism in the target cell. The transgene may also be used to knock down or reduce expression of a gene causing a disease. This can be by way of inhibition if the transgene codes for a silencing RNA. Below are listed some examples of genes that may be targeted by transgenes using the present vectors to treat or alleviate symptoms of diseases of the nervous system, by way of illustration.

[0334] The transgene may be a gene involved in the synthesis of dopamine, which may be useful to alleviate symptoms of Parkinson’s disease, for examples genes encoding tyrosinehydroxylase, aromatic amino-acid decarboxylase (AADC), GTP-cyclohydrolase 1 (GCH1) or vesicular mono-amine transporter 2 (VMAT2). The transgene may also be a neuroprotective gene, which it may be desirable to express for example in patients suffering from Parkinson’s disease, such as Nurrl, GDNF, neurturin (NRTN), CNDF orMANF. The transgene may upon expression result in knock-down or correction of genes causing Parkinson’s disease, e.g. alpha-synuclein (SNCA), LRRK2, Pinkl, PRKN, GBA, DJ1, UCHL1 , MAPT, ATP13A2 or VPS35.

[0335] Examples of genes that may be knocked down or corrected in Alzheimer’s patients are APP, MAPT, SPEN1 and PSEN2. In Huntington’s disease patients, the HTT gene (coding for huntingtin) may be knocked down or corrected by delivery of the transgene. In patients suffering from spinocerebellar ataxia, ataxin 1, 2, 3, 7 or 10, PLEKHG4, SPTBN2, CACNA1A, IOSCA, TTBK2, PPP2R2B, KCNC3, PRKCG, ITPR1, TBP, KCND3 or FGF14 may be knocked down or corrected upon delivery and expression of the transgene. In multiple system atrophy, SNCA or COQ2 may be relevant targets of for knock-down or correction. In amyotrophic lateral sclerosis, the transgene may lead to overexpression or correction of C9orf72, SOD1, TARDBP or FUS. SMN1, SMN2, UBA1, DYNC1H1 or VAPB are targets for knock-down or correction in spinal muscular atrophy patients. DMD is a target for overexpression or correction in Duchenne muscular dystrophy. PLP1 is a target for overexpression or correction in Pelizaeus-Merzbacher disease. TUBB4A is a target for overexpression or correction in hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC; TUBB4A-Associated Disorder). GALC is a target for overexpression or correction in Krabbe disease (also known as globoid cell leukodystrophy). The transgene may allow for correction of ABCA13, C4A, DGCR2, DGCR8, DRD2, MIR137, NOS1AP, NRXN1, OLIG2, RTN4R, SYN2, TOP3B, YWHAE orZDHHC8 in schizophrenic patients. Galanin, NPY, somatostatin or KCNA1 may be targets for overexpression in epileptic patients. The transgene may enable overexpression of p11 , PDE11a, channel rhodopsins or chemogenetic receptors in individuals suffering from depression.

[0336] In one embodiment, the transgene is aromatic amino-acid decarboxylase (AADC), ATP13A2, CNDF, DJ1, GBA, GCH1, GDNF, LRRK2, MANF, MAPT, neurturin (NRTN), Nurrl, Pinkl, PRKN, alpha-synuclein (SNCA), tyrosine hydroxylase, UCHL1, vesicular mono-amine transporter 2 (VMAT2), VPS35.

[0337] In one embodiment, the transgene is APP, MAPT, PSEN2 or SPEN1.In one embodiment, the transgene is HTT.

[0338] In one embodiment, the transgene is ataxia, ataxin 1 , ataxin 10, ataxin 2, ataxin 3, ataxin 7, CACNA1A, FGF14, IOSCA, ITPR1, KCNC3, KCND3, PLEKHG4, PPP2R2B, PRKCG, SPTBN2, TBP, TTBK2.

[0339] In one embodiment, the transgene is C9orf72, FUS, SOD1 , or TARDBP.

[0340] In one embodiment, the transgene is DYNC1 H1 , SMN1 , SMN2, UBA1 , or VAPB.

[0341] In one embodiment, the transgene is DMD.

[0342] In one embodiment, the transgene COQ2, GALC PLP1, SNCA, orTUBB4A.

[0343] In one embodiment, the transgene is ABCA13, C4A, DGCR2, DGCR8, DRD2, MIR137, NOS1AP, NRXN1, OLIG2, RTN4R, SYN2, TOP3B, YWHAE orZDHHC8.

[0344] In one embodiment, the transgene is Galanin, KCNA1, NPY, or somatostatin.

[0345] In one embodiment, the transgene is p11 , PDE11a, a gene encoding channel rhodopsins or a gene encoding chemogenetic receptors.

[0346] In one embodiment, the transgene is a “replacement” or “correction” gene replacing a gene which is deficient, e.g. mutated, in an individual. In other words, the transgene of the present disclosure preferably encodes a protein or enzyme which is not natively expressed, or which is expressed but has reduced activity and reduced function, in an individual.

[0347] Hence, the transgene may encode a protein or enzyme which upon expression may compensate, at least partially, for a deficient protein or enzyme in the target cell.

[0348] Aspartoacylase (ASPA)

[0349] In one embodiment, the transgene is aspartoacylase (ASPA), which encodes the enzyme aspartoacylase (ASPA). ASPA is a hydrolytic enzyme with EC no. 3.5.1.15. It is also referred to as aminoacylase II.ASPA catalyses the deacylation of N-acetyl-l-aspartate (also referred to as N-acetyl aspartate, A / -acetyl-aspartic acid, or NAA; these terms are used interchangeably herein) into aspartate and acetate. It is a zinc-dependent hydrolase that promotes the deprotonation of water to use as a nucleophile in a mechanism analogous to many other zinc-dependent hydrolases. ASPA is most commonly found in the brain, where it controls the levels of NAA. Mutations that result in loss of ASPA activity are associated with Canavan disease, a rare autosomal recessive n eurodegen erative disease.

[0350] Thus, in one embodiment, the transgene is aspartoacylase (ASPA).

[0351] In one embodiment, the transgene comprises or consists of SEQ ID NO: 47, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 47.

[0352] In one embodiment, the transgene encodes a polypeptide comprising or consisting of SEQ ID NO: 48, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 48.

[0353] Medical use of the viral vector and the viral particle

[0354] The viral vectors and viral particles disclosed herein are particularly useful within medicine, in particular for delivering genes to target cells with high specificity and efficacy.

[0355] Hence, provided herein is a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for use as a medicament.

[0356] Further provided herein is a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for use in delivering a transgene to a target cell, preferably wherein the transgene is as described herein in the section “Transgene” and the target cell is as described herein in the section “Target cell”.

[0357] The viral vectors and viral particles disclosed herein are particularly useful for treatment of diseases or disorders where expression of a gene in an oligodendrocyte is affected, such as wherein a gene in an oligodendrocyte is overexpressed or expressed insufficiently as compared to the level of expression of the same gene in a healthy individual. The viralvectors and viral particles disclosed herein are further particularly useful for treatment of diseases or disorders where a gene that is expressed in an oligodendrocyte is mutated, for example wherein the protein encoded by said gene is non-functional or has an abnormal, e.g. a higher or lower, activity as compared to the same protein encoded by a non-mutated gene in a healthy individual.

[0358] Also provided herein is a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for use in gene therapy.

[0359] Further provided herein is a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for use in the treatment of a disease or disorder.

[0360] Also provided herein is a method of treatment of a disease or disorder of the central nervous system, said method comprising administration of the viral vector or viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, to an individual in need thereof. In one embodiment, the individual suffers from one or more disease or disorder as described herein.

[0361] In one embodiment, administration comprises intrastriatal, intracerebroventricular, intrathecal, intravenous and / or intranasal injection.

[0362] In one embodiment, administration comprises intracerebroventricular injection.

[0363] Further provided herein is the use of a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for the manufacture of a medicament for the treatment of a disease or disorder.

[0364] In one embodiment, the disease or disorder is a disease or disorder of the central nervous system.

[0365] In one embodiment, the disease or disorder is a leukodystrophy, enzyme deficiency, metabolic disorder, aggregopathy, oncogenicity, neuronal hyper- or hypo-activity, protein dysregulation or erroneous gene splicing.In one embodiment, the disease or disorder is Alzheimer's disease, amyotrophic lateral sclerosis, cerebellar ataxia, depression, epilepsy, haemophilia, Huntington’s disease, multiple sclerosis, multiple system atrophy, muscular dystrophy, spinal muscular atrophy, stroke, or an autoimmune disease, such as a chronic autoimmune disease.

[0366] In one embodiment, the disease or disorder is a leukodystrophy.

[0367] In one embodiment, the leukodystrophy is Canavan disease, Alexander disease, cerebrotendineous xanthomatosis, hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC; TUBB4A-Associated Disorder), hypomyelinating leukodystrophy type 7, Krabbe disease, leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation, leukoencephalopathy with vanishing white matter, metachromatic leukodystrophy, Pelizaeus-Merzbacher disease, orX-linked adrenoleukodystrophy.

[0368] Canavan disease

[0369] In one embodiment, the disease or disorder is Canavan disease. Canavan disease is one of a group of genetic diseases referred to as leukodystrophies. It is a fatal autosomal recessive degenerative disease that causes progressive damage to nerve cells and loss of white matter in the brain. It is characterized by degeneration of myelin in the phospholipid layer insulating the axon of a neuron.

[0370] The most common form of Canavan disease is the neonatal / infantile form. Individuals suffering from this form do not develop motor skills such as turning over, controlling head movement, or sitting without support. They commonly suffer from weak muscle tone (hypotonia), an unusually large head size (macrocephaly), and irritability. Feeding and swallowing difficulties, seizures, and sleep disturbances may also develop. Most individuals with the neonatal / infantile form live only into childhood.

[0371] Canavan disease is caused by a deficiency of the enzyme aspartoacylase (ASPA). There are over 70 reported mutations of ASPA. The most common ones are the amino acid substitutions E285A and A305E. E285A reduces activity of ASPA down to as low as 0.3% of its normal function. A305E reduces activity to about 10%. It has been shown that the E285A mutation results in loss of the hydrogen bonding from glutamate, leading to a conformational change that distorts the active site and alters the substrate binding, resulting in the much lower catalytic activity.As mentioned in the section “Aspartoacylase (ASPA)” herein above, ASPA catalyses the deacylation of N-acetyl-l-aspartate (NAA) into aspartate and acetate. The loss of ASPA activity thus leads to accumulation of NAA in the brain, interfering with the growth of the myelin sheath of the nerve fibers. Oligodendrocytes, which are the brain cells that produce myelin, are the primary cells affected in Canavan disease.

[0372] Thus, further provided herein is a method for:

[0373] i. decreasing the concentration of N-acetyl-aspartic acid (NAA) in oligodendrocytes; ii. increasing the level of myelination;

[0374] iii. increasing the amount of white matter;

[0375] iv. normalizing the extracellular water content in the brain;

[0376] v. improving the Mullen Scales of Early Learning (MSEL); and / or

[0377] vi. improving Gross Motor Function Measure (GMFM);

[0378] in an individual suffering from Canavan disease, said method comprising administration of the viral vector or viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, to said individual.

[0379] In one embodiment:

[0380] i. concentration of NAA in oligodendrocytes is increased;

[0381] ii. the level of myelination is increased;

[0382] iii. the amount of white matter is increased;

[0383] iv. the extracellular water content in the brain is normalized;

[0384] v. the Mullen Scales of Early Learning (MSEL) is improved; and / or

[0385] vi. the Gross Motor Function Measure (GMFM) is improved;

[0386] after administration of the viral vector or viral particle as compared to the level of NAA; the myelination; the amount of white matter; the extracellular water content; the MSEL; and / or the GMFM, respectively, as compared to prior to administration of the viral vector or viral particle,

[0387] optionally between 12 and 36 months after administration of the viral vector or viral particle as compared to prior to administration of the viral vector or viral particle.

[0388] In one embodiment:

[0389] i. concentration of NAA in oligodendrocytes is increased;

[0390] ii. the level of myelination is increased;

[0391] iii. the amount of white matter is increased;

[0392] iv. the extracellular water content in the brain is normalized;v. the Mullen Scales of Early Learning (MSEL) is improved; and / or vi. the Gross Motor Function Measure (GMFM) is improved;

[0393] after administration of the viral vector or viral particle as compared to the level of NAA; the myelination; the amount of white matter; the extracellular water content; the MSEL; and / or the GMFM, respectively, as compared to that of an age-matched, untreated, individual for whom natural history data is available.

[0394] Methods

[0395] Methods for improving tropism

[0396] Further provided herein is a method for improving tropism of a viral vector or viral particle toward a target cell and / or for improving delivery of a transgene to a target cell, said method comprising the steps of:

[0397] i. providing a parent viral vector;

[0398] ii. introducing in the parent viral vector a modified capsid gene comprising a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising: SEQ ID NO: 9;

[0399] SEQ ID NO: 10;

[0400] SEQ ID NO: 6;

[0401] SEQ ID NO: 7; or

[0402] SEQ ID NO: 8;

[0403] or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8, thereby obtaining the viral vector as described herein in the section “Viral vector”;

[0404] iii. introducing the viral vector from step ii. in a host cell; and

[0405] iv. recovering the viral vector from the host cell.

[0406] In one embodiment, the host cell is a mammalian cell such as a human cell, an insect cell such as an SF9 cell, a bacterial cell such as an Escherichia coli cell, or a yeast cell such as a Saccharomyces cerevisiae cell.

[0407] In one embodiment, the host cell is a Hela cell, a primary neuron, an induced neuron, a fibroblast, an embryonic stem cell, an induced pluripotent stem cell, an insect cell such as an SF9 cell, a yeast cell, or an embryonic cell, such as an embryonic kidney cell, for example HEK293 cells.

[0408] In one embodiment, the target cell is an oligodendrocyte.Methods of manufacturing viral vector and viral particle

[0409] Further provided herein is a method for manufacturing a viral vector, said method comprising:

[0410] i. providing a parent viral vector harbouring an unmodified capsid gene, said parent viral vector encoding a parent capsid;

[0411] ii. introducing in the parent viral vector a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising:

[0412] SEQ ID NO: 9;

[0413] SEQ ID NO: 10;

[0414] SEQ ID NO: 6;

[0415] SEQ ID NO: 7; or

[0416] SEQ ID NO: 8;

[0417] or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8, thereby obtaining the viral vector as defined herein in the section “Viral vector”;

[0418] iii. introducing the viral vector from step ii) in a host cell;

[0419] iv. propagating the host cell, thereby amplifying the viral vector; and

[0420] v. recovering the viral vector from the host cell.

[0421] Further provided herein is a cell, such as a host cell or an oligodendrocyte, comprising the viral vector as described herein in the section “Viral vector”.

[0422] In one embodiment, the host cell is a mammalian cell.

[0423] In one embodiment, the host cell is a human cell, an insect cell, a bacterial cell, or a yeast cell.

[0424] In one embodiment, the host cell is an SF9 cell, an Escherichia coli cell, or a Saccharomyces cerevisiae cell.

[0425] A host cell such as the one described above may be used to produce the viral particle as described herein in the section “Viral particle”. Various approaches, such as various combinations of vectors, may be used, including but not limited to what is described herein below.The host cell may comprise the vectors, e.g. plasmids, required for producing the viral particles in the cell. Typical systems are based on three plasmids:

[0426] • A transfer plasmid containing the genetic sequence packaged into the produced virions.

[0427] The sequence is flanked by inverted terminal repeats to be replicated and inserted into the capsid. This plasmid may also contain a gene of interest driven by a promoter, a 3’ untranslated region (3’UTR) and a polyadenylation sequence.

[0428] • A packaging plasmid, comprising the Rep and Cap genes, often under the control of a strong promoter.

[0429] • A helper plasmid, which supplies the remaining genes required for viral production. In the case of an AAV, these may be E4, E2a and VA, and optionally E1a and E1b - some of these genes may however be expressed directly in the host cell.

[0430] Other systems based on two plasmids comprise a transfer plasmid as above, and one plasmid corresponding to both the helper and the packaging plasmid. Such systems allow production of replication deficient viruses in a simplified manner.

[0431] A third approach is that the packaging and the transfer plasmids are combined into one functional plasmid, which thus provides the Rep and Cap genes and the TR or ITR-flanked genome to be inserted in the virion, but still ensures that the vector is replication deficient. The helper plasmid is as described above, i.e. it supplies the remaining genes required for viral production. In particular embodiments, the production system thus comprises a cell, a plasmid providing the Rep and Cap genes and the TR or ITR-flanked genome, and a helper plasmid providing the remaining genes required for viral production.

[0432] The viral vector has been described herein above. Preferably, the viral vector is an AAV vector, such as an AAV2 or AAV9 vector.

[0433] The host cell may be a mammalian cell, such as a human cell, an insect cell such as an SF9 cell, a bacterial cell such as an Escherichia coli cell or a yeast cell such as a Saccharomyces cerevisiae cell.

[0434] Gene therapy and methods of delivering a transqene

[0435] Further provided herein is a method of delivering a transgene to a target cell, said method comprising:

[0436] i. providing a viral vector or a viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively; andii. injecting said viral vector or viral particle into an injection site, such as intracerebroventricular injection site or an intrastriatal injection site.

[0437] Use

[0438] Also provided herein is the use of the viral vector or viral particle described herein for delivery of a transgene to a target cell, such as for transduction of a target cell.

[0439] In one embodiment, the present invention provides the use of the viral vector or viral particle as described herein in the sections “Viral vector” and “Viral particle”, respectively, for delivery of a transgene to a target cell, such as for transduction of a target cell, said viral vector or viral particle comprising a modified capsid gene or a modified capsid protein, respectively, and a transgene to be delivered to the target cell;

[0440] wherein the:

[0441] • delivery of the transgene to the target cell,

[0442] • targeting to the target cell,

[0443] • transduction of the target cell,

[0444] • infectivity of the modified viral vector or modified viral particle, and / or

[0445] • retrograde transport,

[0446] of the viral vector or viral particle is improved as compared to a reference or ‘parent’ viral vector or a reference or ‘parent’ viral particle.

[0447] In one embodiment, the ‘parent’ or reference viral vector or viral particle is as described herein in the section “Target cell”.

[0448] In one embodiment, the target cell is as described herein in the section “Target cell”.

[0449] Items I

[0450] 1. A viral vector encoding a viral particle for delivery of a transgene to a target cell, said viral vector comprising a modified capsid gene,

[0451] wherein the modified capsid gene comprises a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising:

[0452] SEQ ID NO: 9;

[0453] SEQ ID NO: 10;

[0454] SEQ ID NO: 6;

[0455] SEQ ID NO: 7; or

[0456] SEQ ID NO: 8;or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8.

[0457] 2. The viral vector according to item 1 , wherein the viral vector is an adeno- associated virus (AAV) vector, a retrovirus vector, a lentivirus vector, an adenovirus vector, a herpes simplex virus vector, a bocavirus vector or a rabies virus vector.

[0458] 3. The viral vector according to any one of the preceding items, wherein the viral vector is an AAV vector.

[0459] 4. The viral vector according to any one of the preceding items, wherein the viral vector is an AAV2 vector or an AAV9 vector.

[0460] 5. The viral vector according to any one of the preceding items, wherein the modified capsid gene is outside the viral genome.

[0461] 6. The viral vector according to any one of the preceding items, wherein the viral vector further comprises at least one replication gene.

[0462] 7. The viral vector according to any one of the preceding items, wherein the viral vector further comprises at least one assembly gene.

[0463] 8. The viral vector according to any one of the preceding items, wherein the polynucleotide insert comprises:

[0464] SEQ ID NO: 4;

[0465] SEQ ID NO: 5;

[0466] SEQ ID NO: 1;

[0467] SEQ ID NO: 2; or

[0468] SEQ ID NO: 3;

[0469] or a polynucleotide having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity to SEQ ID NO: 4; SEQ ID NO: 5; SEQ ID NO: 1; SEQ ID NO: 2; or SEQ ID NO: 3.

[0470] 9. The viral vector according to any one of the preceding items, wherein the viral vector is an AAV vector and the polynucleotide insert encoding the polypeptide islocated between two adjacent nucleotides at a position between nucleotide 1710 and 1833 of the polynucleotide encoding VP1 of AAV2, or the corresponding position in a polynucleotide encoding a VP1 of another AAV serotype.

[0471] 10. The viral vector according to any one of the preceding items, wherein the viral vector is an AAV vector and the polynucleotide insert encoding the polypeptide is located between nucleotide number 1761 and 1762 of the polynucleotide encoding VP1 of AAV2, or the corresponding position in a polynucleotide encoding a VP1 of another AAV serotype.

[0472] 11. The viral vector according to any one of the preceding items, wherein the viral vector is an AAV vector and the modified capsid gene encodes a modified capsid protein, wherein the polypeptide encoded by the polynucleotide insert is located at a position between amino acid number 570 and 611 of the VP1 capsid protein of AAV2, or the corresponding position in a polypeptide encoding VP1 of another AAV serotype.

[0473] 12. The viral vector according to any one of the preceding items, wherein the viral vector is an AAV vector and the modified capsid gene encodes a modified capsid protein, wherein the polypeptide encoded by the polynucleotide insert is located between amino acid number 587 and 588 of the VP1 capsid protein of AAV2, or the corresponding position in a polypeptide encoding VP1 of another AAV serotype.

[0474] 13. The viral vector according to any one of the preceding items, wherein the polynucleotide insert encodes a polypeptide comprising or consisting of:

[0475] SEQ ID NO: 35;

[0476] SEQ ID NO: 36;

[0477] SEQ ID NO: 32;

[0478] SEQ ID NO: 33; or

[0479] SEQ ID NO: 34;

[0480] or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 35; SEQ ID NO: 36; SEQ ID NO: 32; SEQ ID NO: 33; or SEQ ID NO: 34.The viral vector according to any one of the preceding items, wherein the polynucleotide insert comprises of consists of:

[0481] SEQ ID NO: 30;

[0482] SEQ ID NO: 31;

[0483] SEQ ID NO: 27;

[0484] SEQ ID NO: 28; or

[0485] SEQ ID NO: 29;

[0486] or a polynucleotide sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 95% sequence identity to SEQ ID NO:30; SEQ ID NO: 31 ; SEQ ID NO: 27; SEQ ID NO: 28; or SEQ ID NO: 29.

[0487] The viral vector according to any one of the preceding items, wherein the viral vector comprises:

[0488] SEQ ID NO: 16;

[0489] SEQ ID NO: 17;

[0490] SEQ ID NO: 13;

[0491] SEQ ID NO: 14; or

[0492] SEQ ID NO: 15;

[0493] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 16; SEQ ID NO: 17; SEQ ID NO: 13; SEQ ID NO: 14; or SEQ ID NO: 15.

[0494] The viral vector according to any one of the preceding items, wherein the viral vector comprises:

[0495] SEQ ID NO: 40;

[0496] SEQ ID NO: 41;

[0497] SEQ ID NO: 37;

[0498] SEQ ID NO: 38; or

[0499] SEQ ID NO: 39;

[0500] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 40; SEQ ID NO: 41 ; SEQ ID NO: 37; SEQ ID NO: 38; or SEQ ID NO: 39.The viral vector according to any one of the preceding items, wherein the viral vector comprises a polynucleotide encoding a polypeptide comprising or consisting of:

[0501] SEQ ID NO: 21;

[0502] SEQ ID NO: 22;

[0503] SEQ ID NO: 18;

[0504] SEQ ID NO: 19; or

[0505] SEQ ID NO: 20;

[0506] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 21 ; SEQ ID NO: 22; SEQ ID NO: 18; SEQ ID NO: 19; or SEQ ID NO: 20.

[0507] The viral vector according to any one of the preceding items, wherein the viral vector comprises a polynucleotide encoding a polypeptide comprising or consisting of:

[0508] SEQ ID NO: 45;

[0509] SEQ ID NO: 46;

[0510] SEQ ID NO: 42;

[0511] SEQ ID NO: 43; or

[0512] SEQ ID NO: 44;

[0513] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 45; SEQ ID NO: 46; SEQ ID NO: 42; SEQ ID NO: 43; or SEQ ID NO: 44.

[0514] The viral vector according to any one of the preceding items, wherein said vector further comprises a transgene.

[0515] The viral vector according to any one of the preceding items, wherein the transgene is inserted between the terminal repeat (TR) sequences of the viral genome.

[0516] The viral vector according to any one of the preceding items, wherein the transgene is harboured on a separate vector.22. The viral vector according to any one of the preceding items, wherein the transgene is APP, MAPT, PSEN2 or SPENT

[0517] 23. The viral vector according to any one of the preceding items, wherein the transgene is HTT.

[0518] 24. The viral vector according to any one of the preceding items, wherein the transgene is ataxia, ataxin 1, ataxin 10, ataxin 2, ataxin 3, ataxin 7, CACNA1A, FGF14, IOSCA, ITPR1, KCNC3, KCND3, PLEKHG4, PPP2R2B, PRKCG, SPTBN2, TBP, or TTBK2.

[0519] 25. The viral vector according to any one of the preceding items, wherein the transgene is C9orf72, FUS, SOD1, or TARDBP.

[0520] 26. The viral vector according to any one of the preceding items, wherein the transgene is DYNC1H1, SMN1, SMN2, UBA1, orVAPB.

[0521] 27. The viral vector according to any one of the preceding items, wherein the transgene is DMD.

[0522] 28. The viral vector according to any one of the preceding items, wherein the transgene COQ2, GALC PLP1, SNCA, orTUBB4A.

[0523] 29. The viral vector according to any one of the preceding items, wherein the transgene is ABCA13, C4A, DGCR2, DGCR8, DRD2, MIR137, NOS1AP, NRXN1, OLIG2, RTN4R, SYN2, TOP3B, YWHAE orZDHHC8.

[0524] 30. The viral vector according to any one of the preceding items, wherein the transgene is Galanin, KCNA1, NPY, or somatostatin.

[0525] 31. The viral vector according to any one of the preceding items, wherein the transgene is p11 , PDE11 a, a gene encoding channel rhodopsins or a gene encoding chemogenetic receptors.

[0526] 32. The viral vector according to any one of the preceding items, wherein the transgene is aspartoacylase (ASPA).The viral vector according to any one of the preceding items, wherein the transgene comprises or consists of SEQ ID NO: 47, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 47.

[0527] The viral vector according to any one of the preceding items, wherein the transgene encodes a polypeptide comprising or consisting of SEQ ID NO: 48, or a sequence having at least 80%, such as at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 48.

[0528] The viral vector according to any one of the preceding items, wherein the target cell is a cell of the central nervous system.

[0529] The viral vector according to any one of the preceding items, wherein the target cell is a glial cell and / or a neuron.

[0530] The viral vector according to any one of the preceding items, wherein the target cell is an oligodendrocyte, a microglia, and / or a neuron.

[0531] The viral vector according to any one of the preceding items, wherein the target cell is an oligodendrocyte.

[0532] The viral vector according to any one of the preceding items, wherein one or more of:

[0533] i. tropism of the viral particle for the target cell;

[0534] ii. delivery of the transgene by the viral particle to the target cell;

[0535] iii. transduction of the target cell;

[0536] iv. targeting to the target cell;

[0537] v. infectivity of the viral vector or viral particle; and

[0538] vi. retrograde transport of the viral vector or viral particle;

[0539] is / are improved compared to a reference viral vector or a reference viral particle encoded by a reference viral vector, said reference viral vector comprising a native, i.e. unmodified, capsid gene and the transgene.The viral vector according to any one of the preceding items, wherein the tropism of the viral particle for the target cell is improved by at least 50-fold as compared to the tropism of a reference viral particle encoded by a reference viral vector comprising a native, i.e. unmodified, capsid gene and the transgene.

[0540] The viral vector according to any one of the preceding items, wherein the tropism of the viral particle for the target cell is improved by at least 50-fold as compared to the tropism of a reference viral particle encoded by SEQ ID NO: 11.

[0541] The viral vector according to any one of the preceding items, wherein the tropism of the viral particle for the target cell is improved by at least 100 fold, such as at least 150 fold, such as at least 200 fold, such as at least 250 fold, such as at least 300 fold, such as at least 350 fold, such as at least 400 fold, such as at least 450 fold, such as at least 500 fold, such as at least 550 fold, such as at least 600 fold, such as at least 650 fold, such as at least 700 fold, such as at least 750 fold, such as at least 800 fold, such as at least 850 fold, such as at least 900 fold, such as at least 950 fold, such as at least 1000 fold, such as at least 1500 fold, such as at least 2000 fold, such as at least 2500 fold, such as at least 3000 fold, such as at least 3500 fold, such as at least 4000 fold, such as at least 4500 fold, such as at least 5000 fold, such as at least 5500 fold, such as at least 6000 fold as compared to the tropism of a reference viral particle encoded by a reference viral vector comprising a native, i.e. unmodified, capsid gene and the transgene.

[0542] The viral vector according to any one of the preceding items, wherein the delivery of the transgene to the target cell is improved by at least 100 fold, such as at least 150 fold, such as at least 200 fold, such as at least 250 fold, such as at least 300 fold, such as at least 350 fold, such as at least 400 fold, such as at least 450 fold, such as at least 500 fold, such as at least 550 fold, such as at least 600 fold, such as at least 650 fold, such as at least 700 fold, such as at least 750 fold, such as at least 800 fold, such as at least 850 fold, such as at least 900 fold, such as at least 950 fold, such as at least 1000 fold, such as at least 1500 fold, such as at least 2000 fold, such as at least 2500 fold, such as at least 3000 fold, such as at least 3500 fold, such as at least 4000 fold, such as at least 4500 fold, such as at least 5000 fold, such as at least 5500 fold, such as atleast 6000 fold as compared to the delivery of the transgene to the target cell by a reference viral vector comprising a native, i.e. unmodified, capsid gene and the transgene.

[0543] 44. The viral vector according to any one of the preceding items, wherein the tropism of the viral particle for the target cell is improved by at least 100 fold, such as at least 150 fold, such as at least 200 fold, such as at least 250 fold, such as at least 300 fold, such as at least 350 fold, such as at least 400 fold, such as at least 450 fold, such as at least 500 fold, such as at least 550 fold, such as at least 600 fold, such as at least 650 fold, such as at least 700 fold, such as at least 750 fold, such as at least 800 fold, such as at least 850 fold, such as at least 900 fold, such as at least 950 fold, such as at least 1000 fold, such as at least 1500 fold, such as at least 2000 fold, such as at least 2500 fold, such as at least 3000 fold, such as at least 3500 fold, such as at least 4000 fold, such as at least 4500 fold, such as at least 5000 fold, such as at least 5500 fold, such as at least 6000 fold as compared to the tropism of a reference viral particle encoded by SEQ ID NO: 11 and the transgene.

[0544] 45. The viral vector according to any one of the preceding items, wherein the delivery of the transgene to the target cell is improved by at least 100 fold, such as at least 150 fold, such as at least 200 fold, such as at least 250 fold, such as at least 300 fold, such as at least 350 fold, such as at least 400 fold, such as at least 450 fold, such as at least 500 fold, such as at least 550 fold, such as at least 600 fold, such as at least 650 fold, such as at least 700 fold, such as at least 750 fold, such as at least 800 fold, such as at least 850 fold, such as at least 900 fold, such as at least 950 fold, such as at least 1000 fold, such as at least 1500 fold, such as at least 2000 fold, such as at least 2500 fold, such as at least 3000 fold, such as at least 3500 fold, such as at least 4000 fold, such as at least 4500 fold, such as at least 5000 fold, such as at least 5500 fold, such as at least 6000 fold as compared to the delivery of the transgene to the target cell by a reference viral vector comprising SEQ ID NO: 11 and the transgene.

[0545] 46. The viral vector according to any one of items 39, 40, 42 or 43, wherein said reference viral vector or reference viral particle is an AAV2 viral vector or viral particle, optionally wherein said reference viral vector comprises SEQ ID NO: 23.47. The viral vector according to any one of the preceding items, wherein the polypeptide comprises or consists of two, three, four or five of SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8.

[0546] 48. The viral vector according to any one of the preceding items, wherein the viral particle is an AAV, a retrovirus, a lentivirus, an adeno-virus, a herpes simplex virus, a bocavirus or a rabies virus.

[0547] 49. The viral vector according to any one of the preceding items, wherein the viral particle is an AAV.

[0548] 50. The viral vector according to any one of the preceding items, wherein the viral particle is an AAV2 or an AAV9.

[0549] 51. The viral vector according to any one of the preceding items, wherein the modified capsid gene encodes a modified capsid protein.

[0550] 52. The viral vector according to any one of the preceding items, wherein the viral particle displays the polypeptide on the surface of the modified capsid protein encoded by the modified capsid gene.

[0551] 53. The viral vector according to any one of the preceding items, wherein the viral particle comprises a modified capsid protein as defined in any one of items 60 to 64.

[0552] 54. A viral particle encoded by the viral vector as defined in any one of items 1 to 53.

[0553] 55. A viral particle comprising:

[0554] i. a modified capsid protein encoded by the viral vector as defined in any one of items 1 to 53, and

[0555] ii. a transgene as defined in any one of items 22 to 34.

[0556] 56. A viral particle comprising:

[0557] i. a modified capsid protein as defined in any one of items 60 to 64, and ii. a transgene as defined in any one of items 22 to 34.57. The viral particle according to any one of items 54 to 56, wherein the viral particle comprises:

[0558] SEQ ID NO: 21;

[0559] SEQ ID NO: 22;

[0560] SEQ ID NO: 18;

[0561] SEQ ID NO: 19; or

[0562] SEQ ID NO: 20;

[0563] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 21; SEQ ID NO: 22; SEQ ID NO: 18; SEQ ID NO: 19; or SEQ ID NO: 20.

[0564] 58. The viral particle according to any one of items 54 to 57, wherein the viral particle comprises:

[0565] SEQ ID NO: 45;

[0566] SEQ ID NO: 46;

[0567] SEQ ID NO: 42;

[0568] SEQ ID NO: 43; or

[0569] SEQ ID NO: 44;

[0570] or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 45; SEQ ID NO: 46; SEQ ID NO: 42; SEQ ID NO: 43; or SEQ ID NO: 44.

[0571] 59. The viral particle according to any one of items 54 to 58, wherein said viral particle further comprises a transgene as defined in any one of items 22 to 32.

[0572] 60. A modified capsid protein comprising a polypeptide insert, wherein said polypeptide insert comprises:

[0573] SEQ ID NO: 9;

[0574] SEQ ID NO: 10;

[0575] SEQ ID NO: 6;

[0576] SEQ ID NO: 7; or

[0577] SEQ ID NO: 8;

[0578] or a polypeptide having one amino acid substitution relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8.The modified capsid protein according to item 60, wherein said modified capsid protein is an AAV capsid protein and the polypeptide insert is relative to a corresponding parent AAV capsid protein that is the same AAV capsid protein of the same wild-type AAV serotype as the modified AAV capsid protein but that does not comprise the polypeptide insert of the modified AAV capsid protein.

[0579] The modified capsid protein according to any one of items 60 to 61 , wherein said modified capsid protein is an AAV capsid protein and the polypeptide insert site is located between two adjacent amino acids at a position between amino acids 570 and 611 of VP1 of AAV2 or the corresponding position in the capsid protein of another AAV serotype.

[0580] The modified capsid protein according to any one of items 60 to 62, wherein said modified capsid protein is an AAV capsid protein and the polypeptide insert site is located between amino acid 587 and 588 of VP1 of AAV2, or the corresponding position in the capsid protein of another AAV serotype.

[0581] The modified capsid protein according to any one of items 60 to 63, wherein said modified capsid protein is an AAV2 capsid protein or an AAV9 capsid protein.

[0582] A cell comprising the viral vector as defined in any one of items 1 to 53.

[0583] A viral vector or a viral particle according to any one of items 1 to 59 for use as a medicament.

[0584] A viral vector or a viral particle according to any one of items 1 to 59 for use in gene therapy.

[0585] A viral vector or a viral particle according to any one of items 1 to 59 for use in delivering a transgene to a target cell.

[0586] The viral vector or a viral particle for use according to item 68, wherein the target cell is as defined in any one of items 35 to 38.70. The viral vector or a viral particle for use according to any one of items 68 to 69, wherein the transgene if as defined in any one of items 22 to 32.

[0587] 71. A viral vector or a viral particle according to any one of items 1 to 59, for use in the treatment of a disease or disorder.

[0588] 72. The viral vector or viral particle for use according to item 71 , wherein the disease or disorder is a disease or disorder of the central nervous system.

[0589] 73. The viral vector or viral particle for use according to any one of items 71 to 72, wherein the disease or disorder is leukodystrophy, enzyme deficiency, metabolic disorder, aggregopathy, oncogenicity, neuronal hyper- or hypo-activity, protein dysregulation or erroneous gene splicing.

[0590] 74. The viral vector or viral particle for use according to any one of items 71 to 73, wherein the disease or disorder is Alzheimer's disease, amyotrophic lateral sclerosis, cerebellar ataxia, depression, epilepsy, haemophilia, Huntington’s disease, multiple sclerosis, multiple system atrophy, muscular dystrophy, spinal muscular atrophy, stroke, or an autoimmune disease, such as a chronic autoimmune disease.

[0591] 75. The viral vector or viral particle for use according to any one of items 71 to 74, wherein the disease or disorder is multiple system atrophy.

[0592] 76. The viral vector or viral particle for use according to any one of items 71 to 75, wherein the disease or disorder is a leukodystrophy.

[0593] 77. The viral vector or viral particle for use according to any one of items 71 to 76, wherein the disease or disorder is Canavan disease, Alexander disease, cerebrotendineous xanthomatosis, hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC; TUBB4A-Associated Disorder), hypomyelinating leukodystrophy type 7, Krabbe disease, leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation, leukoencephalopathy with vanishing white matter, metachromatic leukodystrophy, Pelizaeus-Merzbacher disease, orX-linked adrenoleukodystrophy.The viral vector or viral particle for use according to any one of items 71 to 77, wherein the disease or disorder is Canavan disease.

[0594] A method of treatment of a disease or disorder of the central nervous system, said method comprising administration of the viral vector or the viral particle according to any one of items 1 to 59 to an individual in need thereof.

[0595] The method according to item 79, wherein the disease or disorder is as defined in any one of items 72 to 78.

[0596] A method for:

[0597] i. decreasing the concentration of A / -acetyl-aspartic acid (NAA) in oligodendrocytes;

[0598] ii. increasing the level of myelination;

[0599] iii. increasing the amount of white matter;

[0600] iv. normalizing the extracellular water content in the brain;

[0601] v. improving the Mullen Scales of Early Learning (MSEL); and / or

[0602] vi. improving Gross Motor Function Measure (GMFM);

[0603] in an individual suffering from Canavan disease, said method comprising administration of the viral vector or viral particle according to any one of items 1 to 59 to said individual.

[0604] The method according to item 81 , wherein:

[0605] i. the concentration of NAA in oligodendrocytes is increased;

[0606] ii. the level of myelination is increased;

[0607] iii. the amount of white matter is increased;

[0608] iv. the extracellular water content in the brain is normalized;

[0609] v. the Mullen Scales of Early Learning (MSEL) is improved; and / or vi. the Gross Motor Function Measure (GMFM) is improved;

[0610] after administration of the viral vector or viral particle as compared to the level of NAA; the myelination; the amount of white matter; the extracellular water content; the MSEL; and / or the GMFM, respectively, as compared to prior to administration of the viral vector or viral particle,

[0611] optionally between 12 and 36 months after administration of the viral vector or viral particle as compared to prior to administration of the viral vector or viral particle.The method according to any one of items 79 to 82, wherein the administration comprises intrastriatal, intracerebroventricular, intrathecal, intravenous and / or intranasal injection, preferably wherein administration comprises intracerebroventricular injection.

[0612] The method according to any one of items 79 to 83, wherein the disease or disorder is Canavan disease.

[0613] Use of a viral vector or a viral particle according to any one of items 1 to 59 for the manufacture of a medicament for the treatment of a disease or disorder.

[0614] The use according to item 85, wherein the disease or disorder is as defined in any one of items 72 to 78.

[0615] A method for improving tropism of a viral vector or viral particle toward a target cell and / or for improving delivery of a transgene to a target cell, said method comprising the steps of:

[0616] i. providing a parent viral vector;

[0617] ii. introducing in the parent viral vector a modified capsid gene comprising a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising:

[0618] SEQ ID NO: 9;

[0619] SEQ ID NO: 10;

[0620] SEQ ID NO: 6;

[0621] SEQ ID NO: 7; or

[0622] SEQ ID NO: 8;

[0623] or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8, thereby obtaining the viral vector as defined in any one of items 1 to 53;

[0624] iii. introducing the viral vector from step ii) in a host cell; and

[0625] iv. recovering the viral vector from the host cell.88. The method according to item 87, wherein the host cell is a mammalian cell such as a human cell, an insect cell such as an SF9 cell, a bacterial cell such as an Escherichia coli cell, or a yeast cell such as a Saccharomyces cerevisiae cell.

[0626] 89. The method according to any one of items 87 to 88, wherein the host cell is a Hela cell, a primary neuron, an induced neuron, a fibroblast, an embryonic stem cell, an induced pluripotent stem cell, an insect cell such as an SF9 cell, a yeast cell, or an embryonic cell, such as an embryonic kidney cell, for example HEK293 cells.

[0627] 90. The method according to any one of items 87 to 89, wherein the target cell is an oligodendrocyte.

[0628] 91. A method for manufacturing the viral vector according to any one of the preceding items, said method comprising:

[0629] i. providing a parent viral vector harbouring an unmodified capsid gene, said parent viral vector encoding a parent capsid;

[0630] introducing in the parent viral vector a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising:

[0631] SEQ ID NO: 9;

[0632] SEQ ID NO: 10;

[0633] SEQ ID NO: 6;

[0634] SEQ ID NO: 7; or

[0635] SEQ ID NO: 8;

[0636] or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8,

[0637] ii. thereby obtaining the viral vector as defined in any one of items 1 to 64; iii. introducing the viral vector from step ii) in a host cell;

[0638] iv. propagating the host cell, thereby amplifying the viral vector; and v. recovering the viral vector from the host cell.

[0639] 92. The method according to item 91 , wherein the host cell is a mammalian cell.

[0640] 93. The method according to items 91 to 92, wherein the host cell is a human cell, an insect cell, a bacterial cell, or a yeast cell.94. The method according to any one of items 91 to 93, wherein the host cell is an SF9 cell, an Escherichia coli cell, or a Saccharomyces cerevisiae cell.

[0641] 95. A method of delivering a transgene to a target cell, said method comprising: i. providing a viral vector or a viral particle as defined in any one of items 1 to 53; and

[0642] ii. injecting said viral vector or viral particle into an injection site, such as intracerebroventricular injection site or an intrastriatal injection site.

[0643] 96. Use of the viral vector or viral particle according to any one of items 1 to 59 for delivery of a transgene to a target cell, said viral vector or viral particle comprising a modified capsid gene or a modified capsid protein, respectively, and a transgene to be delivered to the target cell;

[0644] wherein the:

[0645] • delivery of the transgene to the target cell,

[0646] • transduction of the target cell;

[0647] • targeting to the target cell,

[0648] • infectivity of the modified viral vector or modified viral particle, and / or • retrograde transport,

[0649] of the viral vector or viral particle is improved as compared to a reference viral vector or viral particle comprising or encoded by, respectively, a native capsid gene.

[0650] 97. The use according to item 96, wherein said reference viral vector comprises a reference polynucleotide encoding a reference polypeptide comprising or consisting of SEQ ID NO: 11, preferably wherein the reference polynucleotide comprises or consists of SEQ ID NO: 12.

[0651] 98. The use according to any one of items 96 to 97, wherein the target cell is a cell of the central nervous system, such as an oligodendrocyte.

[0652] Items II

[0653] 99. A viral vector encoding a viral particle for delivery of a transgene to a target cell, said viral vector comprising a modified capsid gene;wherein the modified capsid gene is outside the viral genome and comprises a polynucleotide encoding a polypeptide comprising or consisting of any one or more of SEQ ID NO: 1 to SEQ ID NO: 5,

[0654] or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 1 to SEQ ID NO: 5,

[0655] and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced.

[0656] . The viral vector according to item 99, wherein the tropism of the viral particle for the target cell is improved by at least 50 fold, compared to the tropism of a reference viral particle for said target cell, respectively, preferably wherein said reference viral particle comprises a reference polynucleotide encoding a reference polypeptide comprising or consisting of SEQ ID NO: 11.

[0657] . The viral vector according to any one of items 99 to 100, wherein the viral vector comprises or consists of:

[0658] - SEQ ID NO: 13, preferably wherein the viral vector comprises a polynucleotide such as SEQ ID NO: 6, encoding a polypeptide comprising or consisting of any one or more of SEQ ID NO: 1 ,

[0659] or encoding a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 1, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced; - SEQ ID NO: 14, preferably wherein the viral vector comprises a polynucleotide such as SEQ ID NO 7, encoding a polypeptide comprising or consisting of any one or more of SEQ ID NO: 2,

[0660] or encoding a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 2, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced; - SEQ ID NO: 15, preferably wherein the viral vector comprises a polynucleotide such as SEQ ID NO: 8, encoding a polypeptide comprising or consisting of SEQ ID NO: 3,

[0661] or encoding a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, suchas at least 99% identical to any one of SEQ ID NO: 3, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced;

[0662] - SEQ ID NO: 16, preferably wherein the viral vector comprises a polynucleotide such as SEQ ID NO: 9, encoding a polypeptide comprising or consisting of SEQ ID NO: 4,

[0663] or encoding a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 4, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced;

[0664] - or SEQ ID NO: 17, preferably wherein the viral vector comprises a polynucleotide such as SEQ ID NO: 10, encoding a polypeptide comprising or consisting of SEQ ID NO: 5,

[0665] or encoding a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 5, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced;

[0666] - or a homologue thereof having at least 90% identity thereto.

[0667] . The viral vector according to any one of items 99 to 101, further comprising the transgene, and wherein one or more of: delivery of the transgene by the viral vector to the target cell, targeting to the target cell, infectivity of the viral vector or viral particle, and / or retrograde transport of the viral vector or viral particle are improved compared to an unmodified viral particle comprising a native capsid gene and the transgene.

[0668] . The viral vector according to any one of items 99 to 102, wherein the delivery of the transgene to the target cell and / or the tropism of the modified viral particle for the target cell is improved by at least 100 fold, such as at least 150 fold, such as at least 200 fold, such as at least 250 fold, such as at least 300 fold, such as at least 350 fold, such as at least 400 fold, such as at least 450 fold, such as at least 500 fold, such as at least 550 fold, such as at least 600 fold, such as at least 650 fold, such as at least 700 fold, such as at least 750 fold, such as at least 800 fold, such as at least 850 fold, such as at least 900 fold, such as atleast 950 fold, such as at least 1000 fold, such as at least 1500 fold, such as at least 2000 fold, such as at least 2500 fold, such as at least 3000 fold, such as at least 3500 fold, such as at least 4000 fold, such as at least 4500 fold, such as at least 5000 fold, such as at least 5500 fold, such as at least 6000 fold, compared to the delivery of said transgene by the reference viral particle to the target cell and / or the tropism of said reference viral particle for said target cell, preferably wherein the target cell is a cell of the central nervous system, such as an oligodendrocyte.

[0669] . The viral vector according to any one of items 99 to 103, wherein the delivery of the transgene to the target cell and / or the tropism of the modified viral particle for the target cell is improved by at least 75 fold, such as at least 125 fold, such as at least 175 fold, such as at least 225 fold, such as at least 275 fold, such as at least 325 fold, such as at least 375 fold, such as at least 425 fold, such as at least 475 fold, such as at least 525 fold, such as at least 575 fold, such as at least 625 fold, such as at least 675 fold, such as at least 725 fold, such as at least 775 fold, such as at least 825 fold, such as at least 875 fold, such as at least 925 fold, such as at least 975 fold, such as at least 1250 fold, such as at least 1750 fold, such as at least 2250 fold, such as at least 2750 fold, such as at least 3250 fold, such as at least 3750 fold, such as at least 4250 fold, such as at least 4750 fold, such as at least 5250 fold, such as at least 5750 fold, such as at least 6250 fold, compared to the delivery of said transgene by the reference viral particle to the target cell and / or the tropism of said reference viral particle for said target cell, preferably wherein the target cell is a cell of the central nervous system, such as an oligodendrocyte.

[0670] . The viral vector according to any one of items 99 to 104, wherein said reference polynucleotide comprises or consists of SEQ ID NO: 12.

[0671] . The viral vector according to any one of items 99 to , wherein the modified capsid comprises or consists of a polypeptide of SEQ ID NO: 1 , or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 1 , and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced.107. The viral vector according to any one of items 99 to 106, wherein the modified capsid comprises or consists of a polypeptide of SEQ ID NO: 2, or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 2, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced.

[0672] 108. The viral vector according to any one of items 99 to 107, wherein the modified capsid comprises a polypeptide of SEQ ID NO: 3, or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 3, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced.

[0673] 109. The viral vector according to any one of items 99 to 108, wherein the modified capsid comprises a polypeptide of SEQ ID NO: 4, or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 4, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced.

[0674] 110. The viral vector according to any one of items 99 to 109, wherein the modified capsid comprises a polypeptide of SEQ ID NO: 5, or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 5, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced.

[0675] 111. The viral vector according to any one of items 99 to 110, wherein said polynucleotide is selected from any one or more of SEQ ID NO: 6 to SEQ ID NO: 10, or a polynucleotide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 6 to SEQ ID NO: 10.

[0676] 112. The viral vector according to any one of items 99 to 111, wherein said polynucleotide is SEQ ID NO: 6, or a polynucleotide at least 85%, such as atleast 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 6.

[0677] 113. The viral vector according to any one of items 99 to 112, wherein said polynucleotide is SEQ ID NO: 7, or a polynucleotide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 7.

[0678] 114. The viral vector according to any one of items 99 to 113, wherein said polynucleotide is SEQ ID NO: 8, or a polynucleotide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 8.

[0679] 115. The viral vector according to any one of items 99 to 114, wherein said polynucleotide is SEQ ID NO: 9, or a polynucleotide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 9.

[0680] 116. The viral vector according to any one of items 99 to 115, wherein said polynucleotide is selected from the group consisting of SEQ ID NO: 10, or a polynucleotide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 10.

[0681] 117. The viral vector according to any one of items 99 to 116, wherein the target cell is an oligodendrocyte.

[0682] 118. The viral vector according to any one of items 99 to 117, wherein the polypeptide comprises or consists of two, three, four or five of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 and SEQ ID NO: 5.

[0683] 119. The viral vector according to any one of items 99 to 118, wherein the modified capsid gene is outside the viral genome.

[0684] 120. The viral vector according to any one of items 99 to 119, wherein the viral vector is an adeno-associated virus (AAV), a retrovirus, a lentivirus, an adeno-virus, a herpes simplex virus, a bocavirus or a rabies virus, preferably wherein the viral vector is AAV9.

[0685] 121. The viral vector according to any one of items 99 to 120, wherein the transgene is inserted between the terminal repeat (TR) sequences of the viral genome.

[0686] 122. The viral vector according to any one of items 99 to 121, wherein the viral vector upon injection to an injection site promotes retrograde transport to regions afferent to the injection site.

[0687] 123. The viral vector according to any one of items 99 to 122, wherein the viral particle displays a polypeptide encoded by the transgene.

[0688] 124. The viral vector according to any one of items 99 to 123, wherein the viral vector further comprises at least one replication gene.

[0689] 125. The viral vector according to any one of items 99 to 124, wherein the viral vector further comprises at least one assembly gene.

[0690] 126. A method of manufacturing the viral vector according to any one of the preceding items, said method comprising:

[0691] i) providing a parent capsid;

[0692] ii) introducing in the parent capsid a polynucleotide encoding a polypeptide with SEQ ID NO: 1 to 5, thereby obtaining the viral vector as defined in any one of items 99 to 124;

[0693] iii) introducing the viral vector from step ii) in a host cell;

[0694] iv) propagating the host cell, thereby amplifying the viral vector; and v) recovering the viral vector from the host cell.

[0695] 127. The method according to item 126, wherein the host cell is a mammalian cell, such as a human cell, an insect cell such as an SF9 cell, a bacterial cell such as an Escherichia coli cell or a yeast cell such as a Saccharomyces cerevisiae cell.

[0696] 128. A method of delivering a transgene to a target cell, said method comprising: a) providing a viral vector or a viral particle comprising a capsid and encapsulating a transgene, wherein the modified viral vector or themodified viral particle is the viral vector defined in any one of items 99 to 124; and

[0697] b) injecting said modified viral vector or said modified viral particle into an injection site, such as intracerebroventricular injection site or an intrastriatal injection site.

[0698] . The method according to item 128, wherein the modified viral particle comprises a modified capsid comprising or consisting of a polypeptide which comprises or consists of one or more of SEQ ID NO: 1 , SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, or variants thereof at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 1 to SEQ ID NO: 5, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced.

[0699] . A cell comprising the viral vector as defined in any one of items 99 to 124.

[0700] . A viral particle encoded by the viral vector as defined in any one of items 99 to 124.

[0701] . The viral particle according to item 131 , wherein the viral particle comprises or consists of:

[0702] - SEQ ID NO: 18, preferably wherein the viral particle comprises a polypeptide comprising or consisting of SEQ ID NO: 6, or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 6, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced;

[0703] - SEQ ID NO: 14, preferably wherein the viral particle comprises a polypeptide comprising or consisting of SEQ ID NO: 7, or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 7, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced;

[0704] - SEQ ID NO: 15, preferably wherein the viral particle comprises a polypeptide comprising or consisting of SEQ ID NO: 8, or a polypeptide at least 85%, such asat least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 8, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced;

[0705] - SEQ ID NO: 16, preferably wherein the viral particle comprises a polypeptide comprising or consisting of SEQ ID NO: 9, or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 9, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced;

[0706] - or SEQ ID NO: 17, preferably wherein the viral particle comprises a polypeptide comprising or consisting of SEQ ID NO: 10, ora polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 10, and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced;

[0707] - or a variant thereof having at least 85% identity thereto.

[0708] . Use of the viral vector or viral particle according to any one of items 99 to 124 for delivery of a transgene to a target cell, said modified viral vector or viral particle comprising a modified capsid and a transgene to be delivered to the target cell;

[0709] wherein the modified capsid improves one or more of: delivery of the transgene to the target cell, targeting to the target cell, infectivity of the modified viral vector or modified viral particle, and / or retrograde transport of the modified viral vector or modified viral particle compared to a reference viral particle comprising a native capsid gene and the transgene.

[0710] . The use according to item 133, wherein said reference viral particle comprises a reference polynucleotide encoding a reference polypeptide comprising or consisting of SEQ ID NO: 11, preferably wherein the reference polynucleotide comprises or consists of SEQ ID NO: 12.

[0711] . The use according to any one of items 133 to 134, wherein the target cell is a cell of the central nervous system, such as an oligodendrocyte.. A viral vector according to any one of items 99 to 124, for use in gene therapy.

[0712] . A viral vector according to any one of items 99 to 124, for use in a method of treatment of a disorder, such as a disorder of the nervous system.

[0713] . The viral vector for the use according to any one of items 136 to 137, wherein the disorder is selected from the group consisting of: enzyme deficiency, metabolic disorders, aggregopathy, oncogenicity, neuronal hyper- or hypoactivity, protein dysregulation and erroneous gene splicing.

[0714] . The viral vector or particle or the modified viral vector or particle for the use according to any one of items 136 to 138, wherein the disorder is selected from the group consisting of Huntington’s disease, cerebellar ataxia, multiple system atrophy, depression, epilepsy, amyotrophic lateral sclerosis, stroke, haemophilia, spinal muscular atrophy, muscular dystrophy, leukodystrophy, autoimmune diseases such as chronic autoimmune diseases.

[0715] . A method for improving tropism of a viral vector or particle toward a target cell and / or for improving delivery of a transgene to a target cell, said method comprising the steps of:

[0716] i. providing a parent capsid;

[0717] ii. introducing in the parent capsid a modified capsid gene encoding a polypeptide with one or more of SEQ ID NO: 1 to 5, or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 1 to SEQ ID NO: 5,

[0718] and / or wherein at the most one, two or three amino acid residues have been deleted, modified or replaced, thereby obtaining the viral vector as defined in any one of items 99 to 124;

[0719] iii. introducing the viral vector from step ii) in a host cell; and

[0720] iv. recovering the viral vector from the host cell.

[0721] . The method according to item 140, wherein the host cell is a mammalian cell, such as a human cell, an insect cell such as an SF9 cell, a bacterial cell such as an Escherichia coli cell or a yeast cell such as a Saccharomyces cerevisiae cell.. The method according to item any one of items 140 to 141 , wherein the host cell is a Hela cell, a primary neuron, an induced neuron, a fibroblast, an embryonic stem cell, an induced pluripotent stem cell, an insect cell such as an SF9 cell, a yeast cell or an embryonic cell, such as an embryonic kidney cell, for example HEK293 cells.

[0722] . The method according to any one of items 140 to 142, wherein the target cell is an oligodendrocyte.

[0723] . The method according to any one of items 42 to 45, wherein the tropism of the viral vector for the target cell is improved relative to the tropism of the parent capsid for the target cell, preferably by at least 75 fold, such as at least 125 fold, such as at least 175 fold, such as at least 225 fold, such as at least 275 fold, such as at least 325 fold, such as at least 375 fold, such as at least 425 fold, such as at least 475 fold, such as at least 525 fold, such as at least 575 fold, such as at least 625 fold, such as at least 675 fold, such as at least 725 fold, such as at least 775 fold, such as at least 825 fold, such as at least 875 fold, such as at least 925 fold, such as at least 975 fold, such as at least 1250 fold, such as at least 1750 fold, such as at least 2250 fold, such as at least 2750 fold, such as at least 3250 fold, such as at least 3750 fold, such as at least 4250 fold, such as at least 4750 fold, such as at least 5250 fold, such as at least 5750 fold, such as at least 6250 fold compared to the tropism of a reference viral particle, a reference viral particle to the target cell and / or the tropism of said reference viral particle for said target cell, respectively, preferably wherein said reference viral particle comprises a reference polynucleotide encoding a reference polypeptide comprising or consisting of SEQ ID NO: 11 , such as wherein said reference polynucleotide comprises or consists of SEQ ID NO: 12.

[0724] . A viral vector encoding a viral particle comprising a modified capsid gene; wherein the modified capsid gene is outside the viral genome and comprises a polynucleotide encoding a polypeptide comprising or consisting of any one or more of SEQ ID NO: 1 to SEQ ID NO: 5,

[0725] or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 1 to SEQ ID NO: 5,and / or wherein at the most one amino acid residue has been deleted, modified or replaced,

[0726] preferably wherein the tropism of the viral particle for the target cell is improved by at least 50 fold, compared to the tropism of a reference viral particle for said target cell, respectively.

[0727] 146. The viral vector according to item 145 for delivery of a transgene to a target cell, further comprising the transgene, and wherein one or more of: delivery of the transgene by the viral vector to the target cell, targeting to the target cell, infectivity of the viral vector or viral particle, and / or retrograde transport of the viral vector or viral particle are improved compared to an unmodified viral particle comprising a native capsid gene and the transgene,

[0728] preferably wherein the delivery of the transgene to the target cell and / or the tropism of the modified viral particle for the target cell is improved by at least 50 fold, compared to the delivery of said transgene by a reference viral particle to the target cell and / or the tropism of said reference viral particle for said target cell, respectively, preferably wherein said reference viral particle comprises a reference polynucleotide encoding a reference polypeptide comprising or consisting of SEQ ID NO: 11, such as wherein said reference polynucleotide comprises or consists of SEQ ID NO: 12.

[0729] 147. The viral vector according to any one of items 145 to 146, wherein the target cell is a cell of the central nervous system, such as an oligodendrocyte.

[0730] 148. The viral vector according to any one of items 145 to 147, wherein said polynucleotide is selected from any one or more of SEQ ID NO: 6 to SEQ ID NO: 10, or a polynucleotide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 6 to SEQ ID NO: 10.

[0731] 149. The viral vector according to any one of items 145 to 148, wherein the viral vector comprises or consists of:

[0732] SEQ ID NO: 13, preferably wherein the viral vector comprises a polynucleotide such as SEQ ID NO: 6, encoding a polypeptide comprising or consisting of any one or more of SEQ ID NO: 1 ,or encoding a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 1, and / or wherein at the most one amino acid residue has been deleted, modified or replaced;

[0733] SEQ ID NO: 14, preferably wherein the viral vector comprises a polynucleotide such as SEQ ID NO 7, encoding a polypeptide comprising or consisting of any one or more of SEQ ID NO: 2,

[0734] or encoding a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to SEQ ID NO: 2, and / or wherein at the most one amino acid residue has been deleted, modified or replaced;

[0735] SEQ ID NO: 15, preferably wherein the viral vector comprises a polynucleotide such as SEQ ID NO: 8, encoding a polypeptide comprising or consisting of SEQ ID NO: 3,

[0736] or encoding a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 3, and / or wherein at the most one amino acid residue has been deleted, modified or replaced;

[0737] SEQ ID NO: 16, preferably wherein the viral vector comprises a polynucleotide such as SEQ ID NO: 9, encoding a polypeptide comprising or consisting of SEQ ID NO: 4,

[0738] or encoding a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 4, and / or wherein at the most one amino acid residue has been deleted, modified or replaced;

[0739] or SEQ ID NO: 17, preferably wherein the viral vector comprises a polynucleotide such as SEQ ID NO: 10, encoding a polypeptide comprising or consisting of SEQ ID NO: 5,

[0740] or encoding a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 5, and / or wherein at the most one amino acid residue has been deleted, modified or replaced;

[0741] or a homologue thereof having at least 85% identity thereto.150. A method of manufacturing the viral vector according to any one of the preceding items, said method comprising:

[0742] i. providing a parent capsid;

[0743] ii. introducing in the parent capsid a polynucleotide encoding a polypeptide with SEQ ID NO: 1 to 5, thereby obtaining the viral vector as defined in any one of the preceding items;

[0744] iii. introducing the viral vector from step ii) in a host cell;

[0745] iv. propagating the host cell, thereby amplifying the viral vector; and v. recovering the viral vector from the host cell.

[0746] 151. A method of delivering a transgene to a target cell, said method comprising:

[0747] i. providing a viral vector or a viral particle comprising a capsid and encapsulating a transgene, wherein the viral vector or the viral particle is the viral vector or the viral particle as defined in any one of the preceding items; and

[0748] ii. injecting said viral vector or said viral particle into an injection site.

[0749] 152. A cell comprising the viral vector or the viral particle as defined in any one of items 99 to 124.

[0750] 153. A viral particle encoded by the viral vector as defined in any one of items 99 to 124.

[0751] 154. Use of the viral vector or viral particle as defined in any one items 99 to 124 for delivery of a transgene to a target cell, said viral vector or viral particle comprising a modified capsid and a transgene to be delivered to the target cell; wherein the capsid improves one or more of: delivery of the transgene to the target cell, targeting to the target cell, infectivity of the modified viral vector or modified viral particle, and / or retrograde transport of the modified viral vector or modified viral particle compared to a reference viral particle comprising a native capsid gene and the transgene.

[0752] 155. The use according to item 154, wherein said reference viral particle comprises a reference polynucleotide encoding a reference polypeptide comprising orconsisting of SEQ ID NO: 11, preferably wherein the reference polynucleotide comprises or consists of SEQ ID NO: 12.

[0753] . A viral vector according to any one of items 99 to 124, for use in gene therapy.

[0754] . A viral vector according to any one of items 99 to 124, for use in medicine.

[0755] . A viral vector according to any one of the preceding items, for use in a method of treatment of a disorder, such as a disorder of the nervous system, preferably wherein the disorder is selected from the group consisting of: enzyme deficiency, metabolic disorders, aggregopathy, oncogenicity, neuronal hyper- or hypoactivity, protein dysregulation and erroneous gene splicing, preferably wherein the disorder is selected from the group consisting of Huntington’s disease, cerebellar ataxia, multiple system atrophy, depression, epilepsy, amyotrophic lateral sclerosis, stroke, haemophilia, spinal muscular atrophy, muscular dystrophy, leukodystrophy, autoimmune diseases such as chronic autoimmune diseases.

[0756] . A method for improving tropism of a viral vector or particle toward a target cell and / or for improving delivery of a transgene to a target cell, said method comprising the steps of:

[0757] i. providing a parent capsid;

[0758] ii. introducing in the parent capsid a modified capsid gene encoding a polypeptide with SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4 or SEQ ID NO: 5, or a polypeptide at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% identical to any one of SEQ ID NO: 1 to SEQ ID NO: 5,

[0759] and / or wherein at the most one acid residue has been deleted, modified or replaced, thereby obtaining the viral vector as defined in any one of the preceding items;

[0760] iii. introducing the viral vector from step ii) in a host cell; and

[0761] iv. recovering the viral vector from the host cell.Examples

[0762] Example 1

[0763] Materials and methods

[0764] Library Design

[0765] Candidates of peptides to be inserted were derived from known Oligodendrocyte-related proteins. Hundreds of proteins were selected, belonging to diverse categories such as; neurotropic viruses, lectins, neurotrophins, neurotoxins, neuronal proteins and others. The candidate protein selection was based on known interaction between the proteins and oligodendrocytes in binding and different stages of AAV infection and replication process (e.g. internalization, endosomal trafficking, nuclear import, etc.). Peptides were designed to be incorporated between N587 and R588 of VP1 capsid protein 11, a site that previously was reported to tolerate insertion of large peptides and blocks heparan sulfate proteoglycan binding. One peptide conformation was designed as: A-7aa-A. All possible unique peptides of 7aa from the candidate proteins were identified and generated by a sliding window approach using Python script. The peptide library was reverse translated to oligonucleotides using codon optimization for high-level expression in mammalian cells. A semi-randomized NNK designed library was also applied, A-NNK7-A.

[0766] AAV production-capsid validation studies

[0767] HEK293T cells were seeded in 175 cm cell culture flasks to achieve 60-80% confluency before transfection. 2 hours before transfection the medium was replaced with 27ml fresh Dulbecco’s modified Eagle medium (DM EM) + 10% FBS + P / S. AAV was produced using standard PEI transfection15using a three-plasmid system; transfer vector, modified AAV-capsid, and pHGT-1 adenoviral helper plasmid in a 1.2:1:1 ratio. PEI and plasmids were mixed in 3ml DMEM, incubated for 15 min and then added to the cells. 16 hours post transfection 27 ml of medium was removed and equal volume of OptiPRO serum free medium (Thermo Fischer Scientific) +P / S was added. AAVs were harvested 72 hours post transfection using polyethylene glycol 8000 (PEG8000) precipitation and chloroform extraction followed by PBS exchange in Amicon Ultra-0.5 Centrifugal filters (Merck Millipore)16. Purified AAV’s were titered using ddPCR with primers specific for ITRs.

[0768] AAV Injection

[0769] Each AAV variant within the library was tagged with a unique barcode sequence to facilitate tracking and identification as well as GFP, to facilitate for cell sorting. The engineered AAV library was introduced into the brain through the following methods:1. Direct Injection into the Corpus Callosum and Striatum: This approach allowed for the identification of AAV variants capable of efficiently transducing oligodendrocytes in localized brain regions.

[0770] 2. Intraventricular Injection: This method assessed the capacity of AAV variants to spread throughout the brain and infect oligodendrocytes across diverse regions.

[0771] Tissue Collection and Cell Sorting

[0772] Post-injection, brain tissue was harvested, and nuclei were isolated for further analysis. To ensure specificity, fluorescence-activated cell sorting (FACS) was utilized:

[0773] 1. GFP-positive / SOX10-positive nuclei: Represented virally infected oligodendrocytes, identified by the expression of the nuclear marker SOX10.

[0774] 2. GFP-positive / SOX10-negative nuclei: Represented other virally infected cell types, enabling comparative analysis.

[0775] The sorted nuclei from both populations were collected for RNA extraction and downstream sequencing.

[0776] RNA Recovery and Barcode Sequencing

[0777] RNA was extracted from the nuclei and reverse transcribed into complementary DNA (cDNA). The unique barcodes associated with each AAV variant were sequenced to quantify their abundance in SOX10-positive versus SOX10-negative fractions. The relative enrichment of each variant in SOX10-positive nuclei was calculated as a ratio, which served as a measure of oligodendrocyte specificity. Variants with high specificity ratios were prioritized for further validation.

[0778] Assessment of Vector Spread

[0779] For the intraventricular injections, tissue punches were collected from various brain regions. Barcode sequencing was performed on these samples to evaluate the distribution and spread of AAV variants. Variants demonstrating high read counts in multiple regions were further analyzed fortheir ability to infect oligodendrocytes specifically. These results were cross-referenced with the SOX10-specific ratios to identify vectors with dual capabilities: widespread distribution and oligodendrocyte specificity.

[0780] Final Candidate Selection

[0781] Through comprehensive analysis of SOX10 enrichment and distribution across brain tissues,the following AAV variants were identified as high-performing candidates: Kingfisher 10, 28, 193, 249, and D2. These vectors exhibited:

[0782] 1. Robust targeting of SOX10-expressing oligodendrocytes.

[0783] 2. Effective dissemination from ventricular injection sites to multiple brain regions while maintaining specificity.

[0784] These engineered AAV vectors, as claimed, represent advanced tools for targeted gene delivery to oligodendrocytes, with potential applications in neurological research and therapy.

[0785] Candidate Validation

[0786] AAV intracranial injections: AAVs were injected stereotactically unilaterally into striatum and corpus callosum (2,5 ul each site, rate 0.2 pl / min.). The injection coordinates (anterior-posterior axis: + 0.0 mm, medial-lateral axis: -3.0 mm, dorsoventral axis: - 4.5 mm and -3.1 mm) were measured from the bregma. After injecting the virus at each set of coordinates, the needle was left in place for 2 minutes, before being slowly retracted.

[0787] AAV intraventricular injections: AAVs were injected stereotactically into lateral ventricle (10 ul total volum, rate 1 pl / min.). The injection coordinates (anterior-posterior axis: -0.7 mm, medial-lateral axis: -1.3 mm, doroventral axis: -3.5 mm) were measured from the bregma. After injecting the virus at each set of coordinates, the needle was left in place for 10 minutes, before being slowly retracted.

[0788] Immunohistochemistry: After 4 weeks, the rats were sacrificed under deep anaesthesia and perfused with 4% PFA in PBS. Then their brains were removed, post-fixed in 4% PFA, cryoprotected in 30% sucrose in PBS for 48 hours and stored at +4°C prior to sectioning. Microtome-cut sections 35 pm in thickness were incubated overnight at room temperature with antibodies against Olig2 (dilution, 1:200, Millipore), Sox10 (dilution, 1:500; R&D Systems), GFP (dilution 1 :2000; Thermofisher. Next day the sections were processed using appropriate secondary antibodies (donkey-anti-rabbit AF 647, donkey-anti-goat AF 555 and donkey-anti-chicken AF 488 (all from Thermofisher), mounted on microscopy slides using Prolong Diamond antifade mounting medium and imaged using fluorescence microscope.Results

[0789] The AAV2 variant exhibited limited spread following injections, with only a few GFP+ cells observed within the corpus callosum and near the ventricle after intraventricular injection. The OligOOl variant was primarily detected in the corpus callosum but demonstrated similarly restricted spread after both intrastriatal and intraventricular delivery. The novel variants Kingfisher 10, Kingfisher 28, Kingfisher 193, Kingfisher 249 and Kingfisher D2 displayed significantly enhanced spread following intracerebral and intraventricular injections, surpassing the distribution observed with both OligOOl and AAV2 variants.

[0790] Kingfisher 10 shows enriched number of GFP+ cells in corpus callosum with cells also found in cortex and septum. Spread from the ventricle is superior to oligOOl in the rostral-caudal axis, with overlapping Olig2 cells in the corpus callosum (Fig 1 A).

[0791] Kingfisher 10 shows enriched number of GFP+ cells in corpus callosum with cells also found in cortex and septum. Spread from the ventricle is superior to oligOOl in the rostral-caudal axis, with overlapping Olig2+ cells in the corpus callosum (Fig 1B).

[0792] Kingfisher 10 shows GFP+ cells in the corpus callosum with cells also found in cortex. GFP+ cells in the corpus callosum overlap with olig2+ cells (Fig 1 C).

[0793] Kingfisher 10 shows good spread in the rostral-caudal axis and in the medial-lateral axis with many GFP+ cells (Fig 1 D).

[0794] Kingfisher 10 injection shows that Corpus callosum contain a good amount of GFP+ cells that morphologically appear as scattered myelinating oligodendrocytes and non-myelinating oligodendrocytes based on SOX10 overlap (Fig 1E).

[0795] Kingfisher 28 shows enriched number of GFP+ cells in corpus callosum with some cells also found in cortex and septum. Spread from the ventricle is superior to oligOOl in the rostral-caudal and medial-lateral axis, with many GFP+ cells overlapping with Olig2 cells in the corpus callosum (Fig 2A).

[0796] Kingfisher 28 shows enriched number of GFP+ cells in corpus callosum with some cells also found in cortex and septum. Spread from the ventricle is superior to oligOOl in the rostral-caudal and medial-lateral axis, with many GFP+ cells overlapping with Olig2 cells in the corpus callosum (Fig 2B).Kingfisher 28 shows good spread in the rostral-caudal axis and in the medial-lateral axis with many GFP+ cells in the Corpus callosum (CC)(Fig 2C).

[0797] Kingfisher 28 injection shows that Corpus callosum contains a good amount of GFP+ cells that morphologically appear as scattered myelinating oligodendrocytes and non-myelinating oligodendrocytes based on SOX10 overlap as well as other GFP+ cells (Fig 2D).

[0798] Kingfisher 193 shows high enrichment of GFP+ cells in corpus callosum with some cells also found in cortex and fimbria, hippocampus and septum. Spread from the ventricle is superior to oligOOl in the rostral-caudal and medial-lateral axis. Enrichement of GFP+ cells in the corpus callosum that overlaps with Olig2+ (Fig 3A).

[0799] Kingfisher 193 shows high enrichment of GFP+ cells in corpus callosum. GFP+ cells are almost only found in the corpus callosum with little or no neurons and are overlapping with Olig2+ cells (Fig 3B).

[0800] Kingfisher 193 shows good spread in the rostral-caudal axis but more limited in the medial-lateral axis. GFP+ staining appears to be high in the corpus callosum and striatum with relatively few projections, indicating reduced neuronal transduction. White matter cells in corpus callosum are well transduced (Fig 3C).

[0801] Kingfisher 193 injection shows GFP+ cells in the corpus callosum (CC) and overlap with SOX10, mainly in the periphery of the main transduction area. However, staining for SOX10 also appears less intense in the transduction area. Scattered neurons are also found in proximity to the corpus callosum but majority of GFP cells have a non-neuronal morphology. In the Striatum, GFP+ cells have mainly a non-neuronal morphology. SOX10 overlapping cells are also found in the white matter bundles (Fig 3D).

[0802] Kingfisher 249 shows highly specific spread from the ventricle to the corpus callosum with few cells with neuronal morphology in the cortex and septum. Spread from ventricle is superior to OligOOl in the rostral-caudal and medial lateral axis and GFP+ cells are overlapping with Olig2+ cells with high specificity (Fig 4A).

[0803] Kingfisher 249 shows good spread in the rostral-caudal axis and in the medial-lateral axis with many GFP+ cells in the Corpus callosum (CC) with strong expression. In the striatum,GFP+ cells appear in within the gray matter with strong signal. Strong GFP+ neurons are also found in the Globus Pallid us (Fig 4B).

[0804] Kingfisher 249 injection shows a good amount of GFP+ cells in Corpus callosum that morphologically appear as scattered myelinating oligodendrocytes and non-myelinating oligodendrocytes based on SOX10 overlap as well as other GFP+ cells. In the striatum (STRI) GFP+ cells are mainly found in the grey matter with overlapping SOX10+ cells (Fig 4C).

[0805] Kingfisher D2 shows enriched number of GFP+ cells in corpus callosum with cells also found in cortex, fimbria, hippocampus and septum. Spread from the ventricle is superior to oligOOl in the rostral- caudal and medial-lateral axis, with overlapping Olig2+ cells in the corpus callosum (Fig 5A).

[0806] Kingfisher D2 shows enriched number of GFP+ cells in corpus callosum with cells also found in cortex and septum. Spread from the ventricle is superior to oligOOl in the rostral-caudal and medial-lateral axis, with overlapping Olig2+ cells in the corpus callosum (Fig 5B).

[0807] Kingfisher D2 shows good spread in the rostral-caudal and medial-lateral axis with many GFP+ cells. GFP+ staining appears within and adjacent to the corpus callosum (CC) and within the striatum as well as in some striata white matter bundles. Cells with GFP and SOX10 overlap are readily apparent (Fig 5C).

[0808] Kingfisher D2 injection shows that Corpus callosum (CC) contains a large amount of GFP+ cells. SOX10 staining overlap with many GFP+. In the striatum(STRI) GFP+ cells are found in the grey matter but also some white matter bundles. Many cells here show overlap between GFP and SOX10 (Fig 5D).

[0809] After injections in striatum and corpus callosum Kingfisher 193 shows improved oligodendrocyte specificity & Kingfisher D2 shows increased spread as well as oligodendrocyte infectivity, compared to OligOOl and parent capsid AAV2 (Fig 6).

[0810] Kingfisher 249 shows superior oligodendrocyte targeting compared to OligOOl following ICV injection (Fig 7).Kingfisher 10 (SEQ NO ID: 13, SEQ I NO: 18), Kingfisher 28 (SEQ NO ID: 14, SEQ ID NO: 19), Kingfisher 193 (SEQ NO ID: 15, SEQ ID NO: 20), Kingfisher 249 (SEQ NO ID: 16, SEQ ID NO: 21) and Kingfisher D2 (SEQ NO ID: 17, SEQ ID NO: 22) all conferred a significantly improved infectivity over OligOOl (SEQ NO ID: 11, SEQ ID NO: 12).

[0811] This example shows that the present capsid have improved properties compared to OligOOl and AAV2.

[0812] Example 2

[0813] Materials and methods

[0814] Mouse model of Canavan disease

[0815] Nur7 mice, a well-characterized and publicly available null ASPA mouse model of Canavan disease (CD) with an inactive ASPA enzyme caused by a Q193X nonsense mutation in the ASPA gene will be used for this study. The Nur7 mouse5, 18-22 effectively replicates human pathology primarily restricted to the brain, characterized by inactive ASPA enzyme, elevated N-acetylaspartate (NAA) concentrations, dysmyelination, spongy degeneration, vacuolation and motor deficits.

[0816] Efficacy and safety studies in Nur7 mice using another viral vector, rAAV-Olig001-ASPA (OligOOl), designed to restore ASPA expression in oligodendrocytes, have shown that intracranial doses reversed behavioural and pathological features of CD in symptomatic 12-week-old Nur7 mice. OligOOl showed no toxicity or microscopic pathology in major organs. OligOOl -treated Nur7 mice had significantly improved motor function and significantly lower NAA concentrations in the brain compared with controls.

[0817] Experimental approach and treatment

[0818] Protocol

[0819] 1. AAV2 with insert comprising SEQ ID NO: 9, 10, 6, 7 or 8 (Kingfisher 249, D2, 10, 28, or 193) and ASPA will be delivered into the intracerebroventricular (i.c.v.) cerebrospinal fluid of 6-week-old nur7 mice.

[0820] 2. In control animals, AAV2 without any insert will be injected at the same site.

[0821] Readouts

[0822] 1. Motor function will be assessed by latency to fall from an accelerating rotarod at 10, 14, 18, and 22 weeks of age.2. At the conclusion of the 22-week rotarod time point, mice will be sacrificed and brains analyzed for ASPA expression, whole-brain NAA levels, and gross pathology (H&E staining), including evaluation of vacuolation (a prominent pathological hallmark of Canavan disease).

[0823] Results

[0824] Significantly improved motor function, along with decreased levels of NAA, increased ASPA expression, and reduction in vacuolation are expected in 22-week-old nur7 mice after i.c.v. delivery of AAV2 with insert comprising SEQ ID NO: 9, 10, 6, 7 or 8, when compared to a control injected with vector without insert (AAV2 and AAV9 .

[0825] Example 3

[0826] Materials and methods

[0827] Oligodendrocyte tropism in non-human primate model

[0828] The biodistribution and transduction efficiency of AAV2 or AAV9 with insert comprising SEQ ID NO: 9, 10, 6, 7 or 8 (Kingfisher 249, D2, 10, 28, or 193), administered via i.c.v. and intra-striatal routes, will be evaluated in a non-human primate model. A useful method for visualizing and / or quantifying gene expression after AAV transduction is the incorporation of a green fluorescent protein (GFP) reporter transgene gene into the vector. Successful transduction results in cellular production of GFP, a fluorescent reporter protein that can be quantified and compared with other selective cellular markers to determine cellular tropism. Quantitative assessments of GFP expression are conducted to compare transduction efficacy in CNS and peripheral tissues. The biodistribution and transduction efficiency of the AAV2 or AAV9 with insert comprising SEQ ID NO: 9, 10, 6, 7 or 8, administered via i.c.v. and intra-striatal routes, will be evaluated in a non-human primate model. Quantitative assessments of green fluorescent protein (GFP) expression will be conducted to compare transduction efficacy in CNS and peripheral tissues.

[0829] Experimental approach and treatment

[0830] Protocol

[0831] 1. To establish tropism, non-human primates will receive i.c.v. or intrastriatal injections of the AAV2 or AAV9 with insert comprising SEQ ID NO: 9, 10, 6, 7 or 8 expressing a GFP transgene.

[0832] 2. At least one month later, brains will be removed and processed for GFP

[0833] immunohistochemistry.3. To assess the specificity of transduction and to determine any potential off-target transduction, double-label immunofluorescence will be used, using GFP combined with markers of other cell types. The percentage of double-labeling will be determined by counting GFP transduced cells in selected CNS regions using stereological counting methods.

[0834] Readouts

[0835] 1. GFP immunohistochemistry will be utilized to determine biodistribution and the number of transduced cells in the CNS.

[0836] 2. Stereological counting methods after double-label immunofluorescence will be utilized to determine specificity of transduction and cellular tropism.

[0837] Results

[0838] Robust oligodendrocyte-specific tropism is expected in non-human primates, with less expression in other CNS cell types (neurons and astrocytes) four weeks after either i.c.v. or intrastriatal delivery of AAV2 or AAV9 with insert comprising SEQ ID NO: 9, 10, 6, 7 or 8, expressing a GFP transgene, when compared to a control injected with vector without insert (AAV2 and AAV9.Sequence list

[0839] SEQ ID NO 1: Kingfisher 10 polynucleotide comprised in the modified capsid gene TTTGGTGATAATGATGTTGCT

[0840] SEQ ID NO 2: Kingfisher 28 polynucleotide comprised in the modified capsid gene GCCGACGACCCCGCCTTCCTG

[0841] SEQ ID NO 3: Kingfisher 193 polynucleotide comprised in the modified capsid gene GGCCGGGCCGTGAGCCTGCCC

[0842] SEQ ID NO 4: Kingfisher 249 polynucleotide comprised in the modified capsid gene CTTTTGCTGCGGAATGAGTCT

[0843] SEQ ID NO 5: Kingfisher D2 polynucleotide comprised in the modified capsid gene GCCAAGACCGGCGAGACCAGC

[0844] SEQ ID NO 6: Kingfisher 10 polypeptide comprised in the modified capsid FGDNDVA

[0845] SEQ ID NO 7: Kingfisher 28 polypeptide comprised in the modified capsid ADDPAFL

[0846] SEQ ID NO 8: Kingfisher 193 polypeptide comprised in the modified capsid GRAVSLP

[0847] SEQ ID NO 9: Kingfisher 249 polypeptide comprised in the modified capsid LLLRNES

[0848] SEQ ID NO 10: Kingfisher D2 polypeptide comprised in the modified capsid AKTGETS

[0849] SEQ ID NO 11: OligOOl - VP1 (polynucleotide)

[0850] SEQ ID NO 12: OligOOl - VP1 (amino acid)SEQ ID NO 13: AAV2 VP1 with Kingfisher 10 insert (polynucleotide) SEQ ID NO 14: AAV2 VP1 with Kingfisher 28 insert (polynucleotide) SEQ ID NO 15: AAV2 VP1 with Kingfisher 193 insert (polynucleotide) SEQ ID NO 16: AAV2 VP1 with Kingfisher 249 insert (polynucleotide) SEQ ID NO 17: AAV2 VP1 with Kingfisher D2 insert (polynucleotide) SEQ ID NO 18: AAV2 VP1 with Kingfisher 10 insert (amino acid) SEQ ID NO 19: AAV2 VP1 with Kingfisher 28 insert (amino acid) SEQ ID NO 20: AAV2 VP1 with Kingfisher 193 insert (amino acid) SEQ ID NO 21: AAV2 VP1 with Kingfisher 249 insert (amino acid) SEQ ID NO 22: AAV2 VP1 with Kingfisher D2 insert (amino acid) SEQ ID NO 23: AAV2 VP1 (polynucleotide)

[0851] SEQ ID NO 24: AAV2 VP1 (amino acid)

[0852] SEQ ID NO 25: AAV9 VP1 (polynucleotide)

[0853] SEQ ID NO 26: AAV9 VP1 (amino acid)

[0854] SEQ ID NO 27: Kingfisher 10 incl. alanines (polynucleotide) SEQ ID NO 28: Kingfisher 28 incl. alanines (polynucleotide) SEQ ID NO 29: Kingfisher 193 incl. alanines (polynucleotide) SEQ ID NO 30: Kingfisher 249 incl. alanines (polynucleotide)SEQ ID NO 31: Kingfisher D2 incl. alanines (polynucleotide) SEQ ID NO 32: Kingfisher 10 incl. alanines (amino acid)

[0855] SEQ ID NO 33: Kingfisher 28 incl. alanines (amino acid)

[0856] SEQ ID NO 34: Kingfisher 193 incl. alanines (amino acid)

[0857] SEQ ID NO 35: Kingfisher 249 incl. alanines (amino acid)

[0858] SEQ ID NO 36: Kingfisher D2 incl. alanines (amino acid)

[0859] SEQ ID NO 37: AAV9 VP1 with Kingfisher 10 insert (polynucleotide) SEQ ID NO 38: AAV9 VP1 with Kingfisher 28 insert (polynucleotide) SEQ ID NO 39: AAV9 VP1 with Kingfisher 193 insert (polynucleotide) SEQ ID NO 40: AAV9 VP1 with Kingfisher 249 insert (polynucleotide) SEQ ID NO 41: AAV9 VP1 with Kingfisher D2 insert (polynucleotide) SEQ ID NO 42: AAV9 VP1 with Kingfisher 10 insert (amino acid) SEQ ID NO 43: AAV9 VP1 with Kingfisher 28 insert (amino acid) SEQ ID NO 44: AAV9 VP1 with Kingfisher 193 insert (amino acid) SEQ ID NO 45: AAV9 VP1 with Kingfisher 249 insert (amino acid) SEQ ID NO 46: AAV9 VP1 with Kingfisher D2 insert (amino acid) SEQ ID NO 47: Aspartoacylase (ASPA) (polynucleotide)

[0860] SEQ ID NO 48: Aspartoacylase (ASPA) (amino acid)References

[0861] 1. Gray, S.J. et al. Directed evolution of a novel adeno-associated virus (AAV) vector that crosses the seizure-compromised blood-brain barrier (BBB). Mol Ther 18, 570-578 (2010).

[0862] 2. Chan, K.Y. et al. Engineered AAVs for efficient noninvasive gene delivery to the central and peripheral nervous systems. Nat Neurosci 20, 1172-1179 (2017).

[0863] 3. Deverman, B.E. et al. Cre-dependent selection yields AAV variants for widespread gene transfer to the adult brain. Nat Biotechnol 34, 204-209 (2016).

[0864] 4. Ojala, D.S. et al. In Vivo Selection of a Computationally Designed SCHEMA AAV Library Yields a Novel Variant for Infection of Adult Neural Stem Cells in the SVZ. Mol Ther (2017).

[0865] 5. Grimm, D. et al. In vitro and in vivo gene therapy vector evolution via multispecies interbreeding and retargeting of adeno-associated viruses. J Virol 82, 5887-5911 (2008).

[0866] 6. Maheshri, N., Koerber, J.T., Kaspar, B.K. & Schaffer, D.V. Directed evolution of adeno- associated virus yields enhanced gene delivery vectors. Nat Biotechnol 24, 198-204 (2006).

[0867] 7. Muller, O.J. et al. Random peptide libraries displayed on adeno-associated virus to select for targeted gene therapy vectors. Nat Biotechnol 21 , 1040-1046 (2003).

[0868] 8. Yang, L. et al. A myocardium tropic adeno-associated virus (AAV) evolved by DNA shuffling and in vivo selection. Proc Natl Acad Sci U SA 106, 3946-3951 (2009).

[0869] 9. Tervo, D.G. et al. A Designer AAV Variant Permits Efficient Retrograde Access to Projection Neurons. Neuron 92, 372-382 (2016).

[0870] 10. Adachi, K., Enoki, T., Kawano, Y., Veraz, M. & Nakai, H. Drawing a high-resolution functional map of adeno-associated virus capsid by massively parallel sequencing. Nat Common 5, 3075 (2014).

[0871] 11. Girod, A. et al. Genetic capsid modifications allow efficient re-targeting of adeno- associated virus type 2. Nat Med 5, 1052-1056 (1999).

[0872] 12. Opie, S.R., Warrington, K.H., Jr., Agbandje-McKenna, M., Zolotukhin, S. & Muzyczka, N. Identification of amino acid residues in the capsid proteins of adeno-associated virus type 2 that contribute to heparan sulfate proteoglycan binding. J Virol 77, 6995-7006 (2003).

[0873] 13. Perabo, L. et al. Heparan sulfate proteoglycan binding properties of adeno-associated virus retargeting mutants and consequences for their in vivo tropism. J Virol 80, 7265-7269 (2006).4. Ried, M.U., Girod, A., Leike, K., Buning, H. & Hallek, M. Adeno-associated virus capsids displaying immunoglobulin-binding domains permit antibody-mediated vector retargeting to specific cell surface receptors. J Virol 76, 4559-4566 (2002).

[0874] 5. Gray, S.J. et al. Production of recombinant adeno-associated viral vectors and use in in vitro and in vivo administration. CurrProtoc Ne urosci Chapter 4, Unit 417 (2011).

[0875] 6. Wu, X., Dong, X., Wu, Z. et al A novel method for purification of recombinant adenoassociated virus vectors on a large scale. Chinese Science Bulletin 46, 485-488 (2001).

[0876] 7. Leone et al. Oligodendrocyte-targeted adeno-associated virus gene therapy for Canavan disease in children: a phase 1 / 2 trial. Nature Medicine 31, 3772-3779 (2025).

Claims

Claims1. A viral vector encoding a viral particle for delivery of a transgene to a target cell, said viral vector comprising a modified capsid gene,wherein the modified capsid gene comprises a polynucleotide insert, said polynucleotide insert encoding a polypeptide comprising:SEQ ID NO: 9;SEQ ID NO: 10;SEQ ID NO: 6;SEQ ID NO: 7; orSEQ ID NO: 8;or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 9; SEQ ID NO: 10; SEQ ID NO: 6; SEQ ID NO: 7; or SEQ ID NO: 8.

2. The viral vector according to claim 1 , wherein the viral vector is an adeno- associated virus (AAV) vector, a retrovirus vector, a lentivirus vector, an adenovirus vector, a herpes simplex virus vector, a bocavirus vector or a rabies virus vector.

3. The viral vector according to any one of the preceding claims, wherein the viral vector is an AAV2 vector or an AAV9 vector.

4. The viral vector according to any one of the preceding claims, wherein the viral vector is an AAV vector and the polypeptide encoded by the polynucleotide insert is located at a position between amino acid number 570 and 611 of the VP1 capsid protein of AAV2, or the corresponding position in a polypeptide encoding VP1 of another AAV serotype.

5. The viral vector according to any one of the preceding claims, wherein the viral vector is an AAV vector and the polypeptide encoded by the polynucleotide insert is located between amino acid number 587 and 588 of the VP1 capsid protein of AAV2, or the corresponding position in a polypeptide encoding VP1 of another AAV serotype.

6. The viral vector according to any one of the preceding claims, wherein the polynucleotide insert encodes a polypeptide comprising or consisting of:SEQ ID NO: 35;SEQ ID NO: 36;SEQ ID NO: 32;SEQ ID NO: 33; orSEQ ID NO: 34;or a polypeptide having one amino acid substitution and / or deletion relative to SEQ ID NO: 35; SEQ ID NO: 36; SEQ ID NO: 32; SEQ ID NO: 33; or SEQ ID NO: 34.

7. The viral vector according to any one of the preceding claims, wherein the viral vector comprises a polynucleotide encoding a polypeptide comprising or consisting of:SEQ ID NO: 21;SEQ ID NO: 22;SEQ ID NO: 18;SEQ ID NO: 19; orSEQ ID NO: 20;or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 21 ; SEQ ID NO: 22; SEQ ID NO: 18; SEQ ID NO: 19; or SEQ ID NO: 20.

8. The viral vector according to any one of the preceding claims, wherein the viral vector comprises a polynucleotide encoding a polypeptide comprising or consisting of:SEQ ID NO: 45;SEQ ID NO: 46;SEQ ID NO: 42;SEQ ID NO: 43; orSEQ ID NO: 44;or a sequence having at least 85%, such as at least 90%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity as compared to SEQ ID NO: 45; SEQ ID NO: 46; SEQ ID NO: 42; SEQ ID NO: 43; or SEQ ID NO: 44.

9. The viral vector according to any one of the preceding claims, wherein the target cell is an oligodendrocyte, a microglia, and / or a neuron.

10. The viral vector according to any one of the preceding claims, wherein the target cell is an oligodendrocyte.

11. The viral vector according to any one of the preceding claims, wherein the modified capsid gene encodes a modified capsid protein.

12. The viral vector according to claim 11, wherein the viral particle encoded by the viral vector displays the polypeptide on the surface of the modified capsid protein encoded by the modified capsid gene.

13. A viral particle encoded by the viral vector as defined in any one of claims 1 to 12.

14. The viral particle according to claim 13, wherein said viral particle further comprises a transgene.

15. The viral particle according to any one of claims 13 to 14, wherein the transgene is ABCA13, APP, ASPA, ataxia, ataxin 1, ataxin 10, ataxin 2, ataxin 3, ataxin 7, C4A, CACNA1A, C9orf72, a gene encoding channel rhodopsins, a gene encoding chemogenetic receptors, COQ2, DGCR2, DGCR8, DMD, DRD2, DYNC1H1, FGF14, FUS, Galanin, GALC, HTT, IOSCA, ITPR1, KCNA1, KCNC3, KCND3, MAPT, MIR137, NOS1AP, NRXN1, NPY, OLIG2, PDE11a, p11 , PLP1, PLEKHG4, PPP2R2B, PRKCG, PSEN2, RTN4R, SMN1, SMN2, SNCA, SOD1, somatostatin, SPEN1, SPTBN2, SYN2, TARDBP, TBP, TOP3B, TTBK2, TUBB4A, UBA1, VAPB, YWHAE, orZDHHC8.

16. The viral particle according to any one of claims 13 to 15, wherein the transgene is aspartoacylase (ASPA).

17. The viral particle according to any one of claims 13 to 16, wherein the transgene encodes a polypeptide comprising or consisting of SEQ ID NO: 48, or a sequence having at least 80%, such as at least 85%, such as at least 90%, suchas at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99% sequence identity to SEQ ID NO: 48.

18. The viral particle according to any one of claims 13 to 17, wherein the tropism of the viral particle for the target cell is improved by at least 50-fold as compared to the tropism of a reference viral particle encoded by a reference viral vector comprising a native, i.e. unmodified, capsid gene and the transgene.

19. The viral particle according to any one of claims 13 to 18, wherein the tropism of the viral particle for the target cell is improved by at least 50-fold as compared to the tropism of a reference viral particle encoded by SEQ ID NO: 11.

20. A viral vector or a viral particle according to any one of claims 1 to 19 for use as a medicament.

21. A viral vector or a viral particle according to any one of claims 1 to 19 for use in the treatment of a disease or disorder.

22. The viral vector or a viral particle for use according to claim 21 , wherein the disease or disorder is a disease or disorder of the central nervous system.

23. The viral vector or viral particle for use according to any one of claims 21 to 22, wherein the disease or disorder is a leukodystrophy.

24. The viral vector or viral particle for use according to any one of claims 21 to 23, wherein the disease or disorder is Canavan disease, Alexander disease, cerebrotendineous xanthomatosis, hypomyelination with atrophy of the basal ganglia and cerebellum (H-ABC; TUBB4A-Associated Disorder), hypomyelinating leukodystrophy type 7, Krabbe disease, leukoencephalopathy with brainstem and spinal cord involvement and lactate elevation, leukoencephalopathy with vanishing white matter, metachromatic leukodystrophy, Pelizaeus-Merzbacher disease, orX-linked adrenoleukodystrophy.

25. The viral vector or viral particle for use according to any one of claims 21 to 24, wherein the disease or disorder is Canavan disease.

26. The viral vector or viral particle for use according to any one of claims 21 to 22, wherein the disease or disorder is Alzheimer's disease, amyotrophic lateral sclerosis, an autoimmune disease, such as a chronic autoimmune disease, cerebellar ataxia, depression, epilepsy, haemophilia, Huntington’s disease, multiple sclerosis, multiple system atrophy, muscular dystrophy, spinal muscular atrophy, or stroke.

27. The viral vector or viral particle for use according to any one of claims 21 to 22, wherein the disease or disorder is multiple system atrophy.

28. A method of treatment of a disease or disorder of the central nervous system, said method comprising administration of the viral vector or the viral particle according to any one of claims 1 to 19 to an individual in need thereof.

29. The method according to claim 28, wherein the disease or disorder is as defined in any one of claims 23 to 27.

Images