Hydrocarbyl maleate-derived ionizable lipid compounds, methods of preparation thereof, and lipid nanoparticles (LNPS) comprising the same

Hydrocarbyl maleate-derived ionizable lipids and LNPs address the inefficiencies of current LNPs by enhancing circRNA delivery and gene editing, achieving improved safety and efficacy.

WO2026161444A1PCT designated stage Publication Date: 2026-07-30THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
THE TRUSTEES OF THE UNIV OF PENNSYLVANIA
Filing Date
2026-01-21
Publication Date
2026-07-30

AI Technical Summary

Technical Problem

Current lipid nanoparticles (LNPs) face challenges in safely and efficiently delivering gene editing tools, particularly for circRNA, requiring high mRNA dosages and leading to inflammatory responses, necessitating the development of optimized LNP formulations.

Method used

Development of hydrocarbyl maleate-derived ionizable lipids and lipid nanoparticles (LNPs) through combinatorial chemistry for efficient delivery of circRNA, enhancing stability and reducing immunogenicity.

Benefits of technology

The novel LNPs achieve improved circRNA delivery and gene editing efficiency, minimizing inflammatory responses and optimizing transfection and expression.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2026011981_30072026_PF_FP_ABST
    Figure US2026011981_30072026_PF_FP_ABST
Patent Text Reader

Abstract

In one aspect, the disclosure relates to certain ionizable lipids compounds prepared from hydrocarbyl maleate electrophiles and amine or thiol nucleophiles. In another aspect, the disclosure relates to lipid nanoparticle (LNP) compositions comprising the ionizable lipids of the disclosure. In certain embodiments, the LNPs of the disclosure comprise nucleic acid cargo. In certain embodiments, the nucleic acid cargo comprises mRNA, sgRNA, and / or circRNA.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Attorney Docket No. 046483-7495WO1(04120)

[0002] TITLE OF THE INVENTION

[0003] Hydrocarbyl Maleate-Derived Ionizable Lipid Compounds, Methods of Preparation Thereof, and Lipid Nanoparticles (LNPs) Comprising the Same

[0004] CROSS-REFERENCE TO RELATED APPLICATIONS This application claims priority under 35 U. S. C. § 119(e) to U. S. Provisional Patent Application No. 63 / 747,692, filed January 21, 2025, which is incorporated herein by reference in its entirety.

[0005] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

[0006] This invention was made with government support under TR002776 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0007] REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0008] The XML file named “046493-7495WO1 - Sequence Listing.xmT’ created on January 21, 2026, comprising 8,256 bytes, is incorporated herein by reference in its entirety.

[0009] BACKGROUND

[0010] Compared to other therapeutic modalities, gene editing therapy holds the promise to cure diseases permanently with only a single treatment. However, the critical challenge lies in delivering gene editing tools safely and efficiently in vivo. These limitations can be overcome by lipid nanoparticles (LNPs), the most clinically advanced nonviral vector. Compared to mRNA vaccines. mRNA-encoded CRISPR therapeutics require as much as a 1,000-fold-higher mRNA dosage (or protein expression) to reach a therapeutic threshold, which raises higher requirements for the potency and safety of LNPs.

[0011] Additionally, recent advances in circular RNA (circRNA) platforms for RNA vaccination applications have highlighted the need for LNPs capable of delivering circRNA efficiently. Because circRNA offers increased stability and potentially reduced immunogenicity compared to conventional linear mRNA, there is a growing demand for LNP formulations specifically optimized for circRNA payloads to maximize expression while minimizing inflammatory responses.

[0012] There is thus a need in the art for LNPs suitable for gene therapy applications, ionizable lipids for preparing the same, and facile methods for preparing said ionizable lipids.Attorney Docket No. 046483-7495WO1(04120)

[0013] The present disclosure addresses these unmet needs.

[0014] BRIEF SUMMARY OF THE INVENTION

[0015] In one aspect, the disclosure provides a compound of formula (I), or a salt, stereoisomer, or isotopologue thereof:

[0016] R1a— A — R1b(i)

[0017] wherein:

[0018] A is selected from the group consisting of:

[0019] 7 'N— 'N— (-LH-S'

[0020]

[0021] R2, 'S', R1c / mR1d, and R1c";

[0022] each occurrence of L1, if present, is independently selected from the group consisting of -(optionally substituted C1-C12 alkylenyl)-, -(optionally substituted C2-C12 alkenylenyl)-, -(optionally substituted C1-C12 alkynylenyl)-, -(optionally substituted C1-C12 heteroalkylenyl)-, -(optionally substituted C3-C8 cycloalkylenyl)-, -(optionally substituted C2-C8 heterocycloalkylenyl)-, -(optionally substituted C₆-C₁₀ arylenyl)-, -(optionally substituted C2-Cs heteroarylenyl)-, -(optionally substituted C1-C12 alkylenyl)-X-, -(optionally substituted C2-C12 alkenylenyl)-X-, -(optionally substituted C1-C12 alkynylenyl)-X-, -(optionally substituted C1-C12 heteroalkylenyl)-X-, -(optionally substituted Cs-Cs cycloalkylenyl)-X-, -(optionally substituted C2-C8 heterocycloalkylenyl)-X-, -(optionally substituted C₆-C₁₀ arylenyl)-X-, and -(optionally substituted C2-C8 heteroarylenyl)-X-;

[0023] each occurrence of X, if present, is independently selected from the group consisting of -N(Rle)-, -[N(CH2)1-3N(R1e)(R1e)]-, -[N(CH2)1-3(C(=O))N(RA)(CH2)1-3N(R1e)(R1e)]-, - N(RA)-, -O-, and -S-;

[0024] R1a, R1b, R1c, R1d, and each occurrence of R1e, if present, are each independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, and

[0025]

[0026] wherein each of the following apply:

[0027] (i) at least one of Rla, Rlb. and Rlc, if present, i

[0028]

[0029] s

[0030] (11) no more than one Rla, Rlb, Rlc, Rld, or Rlebonded to the same atom isAttorney Docket No. 046483-7495WO1(04120)

[0031]

[0032] (iii) one of Rlaand Rlbcan combine with R2to form an optionally substituted C2-Cs heterocycloalkyl, and

[0033] (iv) one of R1a, R1b, R1c, and R1dcan combine with one occurrence of L1to form an optionally substituted C2-C8 heterocycloalkyl;

[0034] R2is selected from the group consisting of optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C6 heteroalkyl, optionally substituted C3-C6 heteroalkenyl, optionally substituted C2-C8 heterocycloalkyl, and N(RA)(RB);

[0035] each occurrence of R3aand R3bis independently selected from the group consisting of optionally substituted C1-C24 alkyl, optionally substituted C2-C24 alkenyl, optionally substituted C2-C24 alkynyl, optionally substituted C1-C24 heteroalkyl, optionally substituted C2-C24 heteroalkenyl, optionally substituted C2-C24 heteroalkynyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C6-C10 aryl, and optionally substituted C2-C8 heteroaryl;

[0036] each occurrence of R4a, R4b, and R4cis independently selected from the group consisting of H and optionally substituted Ci-Ce alkyl;

[0037] Y is selected from the group consisting of -O- and -S-;

[0038] m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and

[0039] each occurrence of RAand RBis independently selected from the group consisting of H and optionally substituted C1-C6 alkyl.

[0040] In certain embodiments, the compound of formula (I) is 5D8:

[0041]

[0042] In certain embodiments, the compound of formula (I) is 12D6.2:Attorney Docket No. 046483-7495WO1(04120)

[0043]

[0044] In another aspect, the disclosure provides lipid nanoparticle (LNP) composition. In certain embodiments, the LNP comprises at least one ionizable lipid. In certain embodiments, the LNP comprises at least one ionizable lipid comprises at least one compound of formula (I). In certain embodiments, the LNP comprises at least one neutral lipid. In certain embodiments, the LNP comprises at least one cholesterol lipid and / or a modified derivative thereof. In certain embodiments, the LNP comprisesat least one polymer-conjugated lipid and / or a modified derivative thereof.

[0045] In another aspect, the disclosure provides a pharmaceutical composition comprising the lipid nanoparticle (LNP) of the disclosure and at least one pharmaceutically acceptable carrier.

[0046] In another aspect, the disclosure provides a method of treating, ameliorating, and / or preventing at least one disease, disorder, or condition in a subject in need thereof. In certain embodiments, the method comprises administering a therapeutically effectively amount of at least one LNP of the disclosure or a pharmaceutical composition thereof to the subject.

[0047] In another aspect, the disclosure provides a method of genome editing a mutated gene sequence associated with a disease or disorder in a subject. In certain embodiments, the method comprises administering a therapeutically effectively amount of at least one LNP of the disclosure or a pharmaceutical composition thereof to the subject.

[0048] In another aspect, the disclosure provides a method for delivering a therapeutic cargo to an immune cell of a subject. In certain embodiments, the method comprises administering a therapeutically effectively amount of at least one LNP of the disclosure or a pharmaceutical composition thereof to the subject.

[0049] In another aspect, the disclosure provides a method for preparing a compound of formula (I), or a salt, stereoisomer, or isotopologue thereof.

[0050] BRIEF DESCRIPTION OF THE FIGURESAttorney Docket No. 046483-7495WO1(04120)

[0051] The drawings illustrate generally, by way of example, but not by way of limitation, various embodiments of the present application.

[0052] FIGs. 1A-1G: Plug-and-play assembly of ILs and in vitro / vivo screening. FIG. 1A: Plug-and-play assembly of biodegradable ILs through Michael addition between amines / thiols and dialkyl maleates. FIG. 1B: Heat map of in vitro luciferase expression. Data are presented as mean (n = 2 independent biological replicates, initial screening). HepG2 cells were treated with mLuc-loaded LNPs at an mRNA dose of 3 ng / well for 24 h. RLU, relative light unit. Untreated cells typically exhibited <100 RLU. FIG. 1C: Distribution of ILs with in vitro luciferase expression >2000 RLU based on the number of pluggable sites. FIG. ID: Analysis of relative hit rate (percentage in the group with luciferase expression >2000 RLU -percentage in library) based on the number of pluggable sites. FIG. IE: In vitro luciferase expression for batch LNP screening. mLuc-LNPs with the same amine structure were pooled and used to treat HepG2 cells at an mRNA dose of 15 ng / well for 24 h. Data are normalized to C12-200 LNP and presented as mean (n = 2 independent biological replicates, initial screening). FIG. IF: In vivo luciferase expression for batch LNP screening. mLuc-LNPs with the same amine structure were pooled and injected into mice at an mRNA dose of 0.1 mg / kg. Data are normalized to C12-200 LNP and presented as mean (n = 2 independent biological replicates, initial screening). FIG. 1G: In vivo luciferase expression for individual LNP screening. Selected ILs derived from amine 5, 8 and 12 were formulated into mLuc-LNPs individually, which were injected into mice at an mRNA dose of 0.1 mg / kg. Data are normalized to C12-200 LNP and presented as mean (n = 4 independent biological replicates).

[0053] FIGs. 2A-2H: LNP -mediated in vivo gene editing. FIGs. 2A-2B: TTR gene editing and serum TTR reduction. LNPs encapsulating Cas9 mRNA / TTR sgRNA (4:1, wt:wt) were i.v. injected into C57BL / 6 mice at a total RNA dose of 1 mg / kg. On day 7, DNA was extracted from the liver to determine on-target indel frequency by next-generation sequencing (FIG. 2A, n = 3-4 independent biological replicates), and serum was collected for ELISA analy sis of TTR (FIG. 2B, n = 3-4 independent biological replicates). Data are presented as mean. FIGs. 2C-2E: PCSK9 base editing. LNPs encapsulating ABE8.8 mRNA / PCSK9 sgRNA (4:1, wt:wt) were i.v. injected into C57BL / 6 mice at a total RNA dose of 0.75 mg / kg (FIG. 2C). On day 7, DNA was extracted from the liver to determine on-target editing frequency by next-generation sequencing (FIG. 2D, n = 4 independent biological replicates), and serum was collected for ELISA analysis of PCSK9 (FIG. 2E, n = 4 independent biological replicates). Data are presented as mean ± SD. Statistical significance was evaluated by a one-way ANOVA with Tukey’s correction. FIGs. 2F-2H: HPD base editing. LNPsAttorney Docket No. 046483-7495WO1(04120)

[0054] encapsulating CBE4max mRNA / HPD sgRNA (4:1, wt:wt) were i.v. injected into FAH− / −mice at a total RNA dose of 0.6 mg / kg (FIG. 2F). Seven days later, DNA was extracted from the liver to determine on-target editing frequency by next-generation sequencing (FIG. 2G, n = 3 independent biological replicates). Data are presented as mean ± SD. Statistical significance was evaluated by a one-way ANOVA with Tukey’s correction. Two weeks later, nitisinone was removed and the survival of FAH− / −mice was monitored (FIG. 2H, n = 5 independent biological replicates). Statistical significance was evaluated using Survival Curve with Log-rank (Mantel-Cox) test.

[0055] FIGs. 3A-3B: Exemplary amines / thiols (FIG. 3 A) and dialkyl maleates (FIG. 3B) used in the library to prepare certain ionizable lipids of the disclosure.

[0056] FIG. 4: Synthetic routes for maleates with two different alkyl chains. D18, D9.2, D9.8, D11.1, D11.10 and D12.8 were synthesized via aDCC / DMAP-mediated esterification reaction.

[0057] FIG. 5: Representative in vivo bioluminescence imaging results of batch LNP screening. mLuc-LNPs with the same amine structure were pooled and i.v. injected into mice at an mRNA dose of 0.1 mg / kg. Images were taken at 4 h post-treatment.

[0058] FIGs. 6A-6C: Representative purification traces of ILs: 5D8 (FIG. 6A), 8D6.2 (FIG.

[0059] 6B), and 12D6.2 (FIG. 6C). The purification trace was recorded by a CombiFlash NextGen 300+ chromatography system equipped with an evaporative light scattering (ELS) detector. The crude product was purified with gradient elution from 100% CH2CI2 to 100% CH2Cl2 / MeOH / NH4OH (75:22:3) over 10 min to give target product.

[0060] FIG. 7: Indels at TTR locus. Mice were i.v. injected with LNPs encapsulating Cas9 mRNA / TTR sgRNA (4:1, wt:wt) at a total RNA dose of 1 mg / kg. On day 7, DNA was extracted from the liver to determine on-target indel frequency by next-generation sequencing. Data are presented as mean ± SD (n=3 independent biological replicates).

[0061] FIG. 8: A representative cryo-EM image of 5D8 LNP from three independent experiments. Scale bar = 50 nm.

[0062] FIG. 9: TNS assay was used to determine the apparent pKa of 5D8 LNP. TNS fluorescence signal corresponds to ionization. pKa is calculated as the pH corresponding to half of the maximum TNS fluorescence value.

[0063] FIG. 10: LNP-mediated TTR siRNA delivery in vivo. Mice were i.v. injected with TTR siRNA-loaded LNPs at a dose of 0.05 mg / kg. Serum was collected on day 3 for ELISA analysis. Both 5D8 and C12-200 LNPs achieved -100% reduction of serum TTR. Data are presented as mean ± SD (n=4 independent biological replicates).Attorney Docket No. 046483-7495WO1(04120)

[0064] FIGs. 11A-11B: The top 10 most abundant plasma proteins that bind LNPs. FIG. 11 A: 5D8 LNP. FIG. 11B: C12-200 LNP. Apolipoprotein E is highly enriched on the surface of 5D8 LNP compared to C12-200 LNP.

[0065] FIGs. 12A-12C: Correlation analysis. FIG. 12A: Correlation between in vivo mLuc delivery efficiency and TTRgene editing efficiency. Statistical significance was evaluated by a two-tailed correlation analysis using GraphPad Prism 8.0. FIG. 12B: Correlation between in vivo mLuc delivery efficiency and serum TTR reduction. Statistical significance was evaluated by a two-tailed correlation analysis using GraphPad Prism 8.0. FIG. 12C:

[0066] Correlation between serum TTR reduction and TTR gene editing efficiency. Statistical significance was evaluated by a two-tailed correlation analysis using GraphPad Prism 8.0. The red dots indicate amine 5-derived ILs. The blue dots indicate amine 8-derived ILs. The cyan dots indicate amine 12-derived ILs. The brown dot indicates C12-200.

[0067] FIG. 13: ALT and AST analysis. LNPs encapsulating Cas9 mRNA / TTR sgRNA (4:1, wt:wt) were i.v. injected into mice at a total RNA dose of 1 mg / kg. Serum was collected for ALT and AST analysis at 24 h post-treatment. Data are presented as mean ± SD (n=4 independent biological replicates). Statistical significance was evaluated by a one-way ANOVA with Tukey’s correction.

[0068] FIG. 14: Performance evaluation across various machine learning models using 5-fold cross-validation. RF-RDKit emerged as the most promising approach and showed good performance at anticipating the transfection efficiency of different ILs. “Reactants’" refers to featurization of building blocks separately and concatenating these descriptors, while “product” used the reaction product for featurization, with only the first product generated by RDKit used for asymmetric dialkyl maleates for simplicity. RF. Random Forest.

[0069] FIG. 15: Scatter plot comparing predicted versus experimental luciferase expression for the RF-RDKit model on the test datasets for 5-fold, leave-one-head-out (Amine or thiol), and leave-one-tail-out (dialkyl maleate) cross-validation. LOHO, leave-one-head-out. LOTO, leave-one-tail-out.

[0070] FIGs. 16A-16B: Machine learning analysis. FIG. 16A: Scatter plot comparing machine learning (ML) predicted versus experimental in vitro luciferase expression based on 5-fold cross-validation. FIG. 16B: SHAP beeswarm plot showing feature importance for predicting in vitro luciferase expression. Each point represents a single LNP in the dataset, with position on the x-axis showing the SHAP value (positive values increase predicted expression, negative values decrease predicted expression). Color indicates the feature value (red = high, blue = low).Attorney Docket No. 046483-7495WO1(04120)

[0071] FIGs. 17A-17B: Box plots comparing experimental luciferase expression (y axis) against feature values of various features identified as important for transfection through the machine learning analysis. FIG. 17A: Two selected features for amine / thiol. NumHDonors: number of hydrogen bond donors. TPSA, topological polar surface area. FIG. 17B: Two selected features for dialkyl maleate. FractionCSP3, ratios of sp3 hybridized carbons over the total carbon count. Heavy AtomMolWt: heavy atom molecular weight.

[0072] FIGs. 18A-18G: LNPs formulated with the ionizable lipid 12D6.2 enable potent circRNA transfection in vitro and in vivo. FIGs. 18A-18C: Relative NanoLuc expression in DC2.4 murine dendritic cells (DCs) Jurkat human T cells (FIG. 18A), RAW 264.7 (FIG. 18B), murine macrophages (FIG. 18C) 24 h following transfection with unoptimized circRNA LNPs containing various ionizable lipids at a dose of 1 ng circRNA equivalent per 10,000 cells. Reported luminescence values are presented relative to DLin-MC3-DMA (MC3) circRNALNPs. FIGs. 18D-18E: Quantification (FIG. 18D) and bioluminescence images (FIG. 18E) of whole body NanoLuc expression in C57BL / 6 mice 12 h following i.m. administration of unoptimized circRNA LNP formulations containing various ionizable lipids at a dose of 4 μg circRNA equivalent. FIG. 18F: Comparison of in vitro and in vivo NanoLuc expression after treatment with unoptimized circRNALNPs. FIG. 18G: Chemical structure of lead ionizable lipid 12D6.2 for circRNA transfection. Data are presented as mean ± SEM (in vitro experiments: n = 5 independent biological replicates with 6 technical replicates each; in vivo experiments: n = 4 independent biological replicates). Nested two-sided, one-way analyses of variance (ANOVAs) with post hoc t tests using the Holm-Sidak correction for multiple comparisons were used for inferential analysis of LNP performance. Indicated P values summarize results from comparison to MC3 LNPs.

[0073] FIGs. 19A-19M: Design-of-experiments (DoE) optimization of LNP lipid excipients enhances leukocyte circRNA transfection. FIG. 19A: Schematic overview of the circRNA LNP optimization approach. A pair of sequential orthogonal DoE iterations was used to identify key parameters for circRNA encapsulation and transfection using LNPs. FIG. 19B: Summary of lipid parameters investigated in orthogonal DoE refinement. Relative NanoLuc expression and library hit rate in DC2.4 murine DCs (FIG. 19C), Jurkat human T cells (FIG.

[0074] 19D), and RAW 264.7 murine macrophages (FIG. 19E) 24 h following transfection with 12D6.2 LNPs of varying excipient composition at a dose of 1 ng circRNA equivalent per 10,000 cells. Blue bars (label: 12D6.2) and horizontal dashed lines represent the unoptimized formulation. Reported luminescence values are presented relative to the unoptimized formulation. FIGs. 19F-19K: Analyses of the influence of helper lipid identity in DC2.4 (FIG.Attorney Docket No. 046483-7495WO1(04120)

[0075] 19F), Jurkat (FIG. 19H), and RAW 264.7 (FIG. 19J) cells and ionizable lipid: circRNA weight ratio DC2.4 (FIG. 19G), Jurkat (FIG. 191), and RAW 264.7 (FIG. 19K) cells on relative leukocyte transfection in vitro, irrespective of other formulation parameters. FIG. 19L:

[0076] Summary of key differences in formulation parameters between standard and DoE-optimized (B7) 12D6.2 LNPs. FIG. 19M: Dose-response data for 12D6.2 and B7 NanoLuc circRNA LNPs in DC2.4 cells. Data are presented as mean ± SEM (n = 5 independent biological replicates with 4 to 8 technical replicates each). Nested two-sided, one-way analyses of variance (ANOVAs) with post hoc t tests using the Holm-Sidak correction for multiple comparisons were used for inferential analysis of LNP performance. Indicated P values summarize results from comparison to unoptimized 12D6.2 circRNA LNPs.

[0077] FIGs. 20A-20R: Optimized circRNA LNPs accumulate in and transfect secondary lymphoid tissues following i.m. administration. FIGs. 20A-20E: Images (FIG. 20 A) and quantification (FIGs. 20B-20E) of fluorescence signal from DiD-tagged LNPs 12 h following i.m. administration in C57BL / 6 mice at a dose of 4 / zg circRNA equivalent. Mice were treated with phosphate-buffered saline (PBS). 12D6.2 LNPs containing mRNA (12D6.2 mRNA), unoptimized 12D6.2 LNPs containing circRNA (12D6.2 circRNA). or optimized 12D6.2 LNPs containing circRNA (B7 circRNA). FIGs. 20F-20J: Images (FIG. 20F) and quantification (FIGs. 20G-20J) of luminescence signal 12 h following i.m. administration of LNPs containing NanoLuc RNA to C57BL / 6 mice. IVIS images are separated by white space to indicate multiple original sources as images were taken at different times or data were excluded due to failed injections. FIGs. 20K-20N: Flow- cytometric analysis of accumulation of DiD-tagged LNPs within CD19+B cells (FIG. 20K), CD3+T cells (FIG. 20L), CDllb+myeloid cells (FIG. 20M), and CDllc+DCs (FIG. 20M) in the inguinal lymph nodes 12 h following i.m. administration. (FIGs. 200-20R) Flow cytometric analysis of accumulation of DiD- tagged LNPs within CD19+B cells (FIG. 200), CD3+T cells (FIG. 20P), CDllff myeloid cells (FIGs. 20Q), and CDllc+DCs (FIG. 20R) in the iliac lymph nodes 12 h following i.m. administration. Data are presented as mean ± SEM ( n = 5 independent biological replicates). Two-sided, one-way analyses of variance (ANOVAs) with post hoc t tests using the Holm-Sidak correction for multiple comparisons were used for inferential analysis of LNP performance.

[0078] FIGs. 21A-21J: circRNA LNP formulation optimization drives durable protein translation in vitro and in vivo. FIG. 21 A: Relative NanoLuciferase (NanoLuc) expression by DC2.4 murine DCs following treatment with mRNA or circRNA LNPs at a dose of 10 ng circRNA equivalent per 10,000 cells. Clinical standard ALC-0315 LNPs encapsulatingAttorney Docket No. 046483-7495WO1(04120)

[0079] NanoLuc mRNA (ALC-0315 mRNA), 12D6.2 LNPs encapsulating NanoLuc mRNA (12D6.2 mRNA), unoptimized 12D6.2 LNPs encapsulating NanoLuc circRNA(12D6.2 circRNA), and optimized 12D6.2 LNPs encapsulating NanoLuc circRNA (B7 circRNA) were used as treatment groups. Luminescence measurements are presented relative to ALC-0315 mRNA LNPs 24 h post-transfection. FIG. 21B: Area-under-the-curve (AUC) analysis of cumulative NanoLuc expression in (FIG. 21 A). FIG. 21C: Relative persistence of RNA-induced NanoLuc expression from FIG. 21 A. Data are presented relative to each treatment’s luminescence signal 24 h after transfection to visualize signal decay profiles. FIG. 21D: Whole-body luminescence in C57BL / 6 mice following i.m. administration of NanoLuc RNA LNPs at a dose of 2 zg circRNA equivalent. The dashed horizontal line indicates average background value from untreated mice over the 28-day study. FIG. 2 IE: AUC analysis of cumulative NanoLuc expression in FIG. 21D. FIG. 21F: Relative persistence of RNA-induced NanoLuc expression from FIG. 21D. Data are presented relative to the luminescence signal of each treatment group 12 h after treatment to visualize signal decay profiles. FIGs.

[0080] 21G-21J: Bioluminescence images following treatment with ALC-0315 LNPs encapsulating NanoLuc mRNA (FIG. 21G), 12D6.2 LNPs encapsulating NanoLuc mRNA (FIG. 21H). unoptimized 12D6.2 LNPs encapsulating NanoLuc circRNA (FIG. 211), or optimized 12D6.2 LNPs encapsulating NanoLuc circRNA (FIG. 21 J). Data are presented as mean ± SEM ( n = 5 independent biological replicates). Two-sided, one-way analyses of variance (ANOVAs) with post hoc t tests using the Holm-Sidak correction for multiple comparisons were used for inferential analysis of LNP performance.

[0081] FIGs. 22A-22E: Optimized circRNA LNPs trigger DC maturation following i.m. vaccination against SARS-CoV-2. FIG. 22A: Schematic overview of DC maturation study. Mice were injected with LNPs containing RNA encoding the SARS-CoV-2 B.1.617.2 Spike (S) protein at a dose of 4 / / g of circRNA equivalent. 24 h later, mice were euthanized, and iliac and inguinal lymph nodes were collected for analysis of DC maturation. FIGs. 22B-22E: Flow cytometric analysis of DC maturation markers CD80 (FIG. 22B and FIG. 22D) and CD86 (FIG. 22C and FIG. 22E) in DCs isolated from the inguinal (FIG. 22B and FIG. 22C) or iliac (FIG. 22D and FIG. 22E) lymph nodes following treatment with spike RNA LNPs. Data are presented as mean ± SEM ( n = 5 independent biological replicates). Two-sided, one-way analyses of variance (ANOVAs) with post hoc t tests using the Holm-Sidak correction for multiple comparisons were used for inferential analysis of DC maturation.

[0082] FIGs. 23A-23O: Optimized circRNA LNP formulations induce a specific inflammatory response against SARS-CoV-2 antigen. FIG. 23 A: Schematic overview ofAttorney Docket No. 046483-7495WO1(04120)

[0083] vaccination study. Mice were immunized on day 0 (prime) and / or day 21 (boost) with clinical standard ALC-0315 LNPs encapsulating mRNA encoding SARS-CoV-2 B.1.617.2 Spike (S) protein (ALC-0315 mRNA), 12D6.2 LNPs encapsulating S mRNA(12D6.2 mRNA), or optimized 12D6.2 LNPs encapsulating S circRNA (B7 circRNA) at a dose of 4 / g circRNA equivalent. Sera and spleens were collected on day 35 to assess anti-S receptor binding domain (RBD) antibody levels and RBD-specific T cell responses. FIGs. 23B-23D: RBD-specific reciprocal endpoint IgG (FIG. 23B), IgG2c (FIG. 23C), and IgGl (FIG. 23D) titers following immunization. FIG. 23E: Ratio of RBD-specific reciprocal endpoint IgG2c / IgGl titers. Greater values suggest a more Th1-skewed response. FIGs. 23F-23O: Flow cytometric analysis of RBD-specific CD4+helper (FIGs. 23F-23K) and CD8+cytotoxic (FIG. 23L-23O) T cell response following ex vivo stimulation of splenocytes from vaccinated mice with an RBD peptide pool. Intracellular staining was performed to assess the proportion of T cells producing cytolytic marker CD107, Th1 cytokines [interferon (IFN)-y, interleukin (IL)-2, tumor necrosis factor (TNF)], Th2 cytokines (IL-4, IL- 5), and Th17 cytokine (IL-17) in response to RBD stimulation. Data are presented as mean ± SEM ( n = 5 independent biological replicates). Two-sided, one-way analyses of variance (ANOVAs) with post hoc t tests using the Holm-Sidak correction for multiple comparisons were used for inferential analysis of antibody titers and cytokine production.

[0084] FIGs. 24A-24B: FIG. 24A: The clinical standard SM-102 (Modema Spikevax). ALC-0315 (Pfizer / BioNTech Comimaty). and DLin-MC3-DMA (Alnylam Onpattro) LNPs were formulated with NanoLuc circRNA according to their standard formulations and the optimized B7 formulation. FIG. 24B: Transfection in DC2.4 murine dendritic cells was evaluated 24 h after treatment with circRNA LNPs at a dose of 1 ng circRNA per 10,000 cells. Reported luminescence values are presented relative to cells treated with MC3 circRNA LNPs. Data are presented as mean ± standard error of the mean (n = 5 independent biological replicates with 8 technical replicates each).

[0085] FIGs. 25A-25H: DiD-tagged LNP accumulation in the spleen and blood. Mice were treated with phosphate-buffered saline (PBS), 12D6.2 LNPs containing mRNA (12D6.2 mRNA), unoptimized 12D6.2 LNPs containing circRNA (12D6.2 circRNA), or optimized 12D6.2 LNPs containing circRNA (B7 circRNA). FIGs. 25A-25D: Flow cytometric analysis of DiD-tagged LNP accumulation in CD19+ B cells (FIG. 25 A), CD3+ T cells (FIG. 25B), CDllb+ myeloid cells (FIG. 25C), or CDllc+ dendritic cells (FIG. 25D) in the spleen 12 h following i.m. administration. FIGs. 25E-25H: Flow cytometric analysis of uptake of DiDtagged LNPs by CD19+ B cells (FIG. 25E), CD3+ T cells (FIG. 25F), CDllb+ myeloidAttorney Docket No. 046483-7495WO1(04120)

[0086] cells (FIG. 25G), or CDllc+ dendritic cells (FIG. 25H) in the blood 12 h following i.m. administration. Data are presented as mean ± standard error of the mean (n = 5 biological replicates). One-way analyses of variance (ANOVAs) with post hoc t tests using the Holm-Sidak correction for multiple comparisons were used for inferential analysis of LNP performance. Whole blood was collected into microcentrifuge tubes containing EDTA to avoid clotting. Ammonium-chloride-potassium (ACK) lysing buffer washing steps were then used to lyse and remove red blood cells prior to staining for flow cytometric analysis.

[0087] FIGs. 26A-26B: Receptor binding domain (RBD)-specific polyfunctional T cell responses from mice immunized on day 0 (prime) and / or day 21 (boost) with clinical standard ALC-0315 LNPs encapsulating mRNA encoding SARS-CoV-2 B.1.617.2 Spike (SI) protein (ALC-0315 mRNA). 12D6.2 LNPs encapsulating SI mRNA(12D6.2 mRNA). or optimized 12D6.2 LNPs encapsulating SI circRNA(B7 circRNA). Spleens were collected on day 35 to assess RBDspecific polyfunctional CD4+ helper (FIG. 26A) and CD8+ cytotoxic T cell responses (FIG. 26B). Data are presented as mean ± standard error of the mean (n = 5 independent biological replicates). One-way analyses of variance (ANOVAs) with post hoc t tests using the Holm-Sidak correction for multiple comparisons were used for inferential analysis of cytokine production.

[0088] FIGs. 27A-27E: (FIG. 27A) Images and (FIGs. 27B-27E) quantification of luminescence signal 12 h following i.v. administration of LNPs containing NanoLuc RNA to C57BL / 6 mice at a dose of 4 pg circRNA equivalent. Mice were treated with phosphate-buffered saline (PBS), 12D6.2 LNPs containing mRNA (12D6.2 mRNA), unoptimized 12D6.2 LNPs containing circRNA (12D6.2 circRNA), or optimized 12D6.2 LNPs containing circRNA (B7 circRNA). Data are presented as mean ± standard error of the mean (n = 4 independent biological replicates). Two-sided, one-way analyses of variance (ANOVAs) with post hoc t tests using the Holm-Sidak correction for multiple comparisons were used for inferential analysis of LNP performance.

[0089] FIGs. 28A-28B: Stability assessments of LNPs encapsulating mRNA or circRNA as measured via NanoLuc expression at discrete post-formulation times when stored at 4 °C (FIG. 28 A) or 25 °C (FIG. 28B). Transfection of DC2.4 murine dendritic cells was evaluated 24 h after treatment with RNA LNPs or Lipofectamine at a dose of 1 ng circRNA equivalent per 10,000 cells. Reported luminescence values are presented relative to cells treated with either mRNA with Lipofectamine or circRNA with Lipofectamine. Data are presented as mean ± standard error of the mean (4 < n < 8 technical replicates). Annotations indicate fold-Attorney Docket No. 046483-7495WO1(04120)

[0090] change in normalized NanoLuc luminescence from post-formulation day 0 to day 28.

[0091] DETAILED DESCRIPTION OF THE INVENTION

[0092] Reference will now be made in detail to certain embodiments of the disclosed subject matter, examples of which are illustrated in part in the accompanying drawings. While the disclosed subject matter will be described in conjunction with the enumerated claims, it will be understood that the exemplified subject mater is not intended to limit the claims to the disclosed subject mater.

[0093] Throughout this document, values expressed in a range format should be interpreted in a flexible manner to include not only the numerical values explicitly recited as the limits of the range, but also to include all the individual numerical values or sub-ranges encompassed within that range as if each numerical value and sub-range is explicitly recited. For example, a range of "about 0.1% to about 5%" or "about 0.1% to 5%" should be interpreted to include not just about 0.1% to about 5%, but also the individual values (e.g., 1%, 2%, 3%, and 4%) and the sub-ranges (e.g., 0.1% to 0.5%, 1.1% to 2.2%, 3.3% to 4.4%) within the indicated range. The statement "about X to Y" has the same meaning as "about X to about Y," unless indicated otherwise. Likewise, the statement "about X, Y, or about Z" has the same meaning as "about X, about Y, or about Z," unless indicated otherwise.

[0094] In this document, the terms "a," "an," or "the" are used to include one or more than one unless the context clearly dictates otherwise. The term "or" is used to refer to a nonexclusive "or" unless otherwise indicated. The statement "at least one of A and B" or "at least one of A or B" has the same meaning as " A, B, or A and B." In addition, it is to be understood that the phraseology or terminology employed herein, and not otherwise defined, is for the purpose of description only and not of limitation. Any use of section headings is intended to aid reading of the document and is not to be interpreted as limiting; information that is relevant to a section heading may occur within or outside of that particular section. All publications, patents, and patent documents referred to in this document are incorporated by reference herein in their entirety, as though individually incorporated by reference.

[0095] In the methods described herein, the acts can be carried out in any order, except when a temporal or operational sequence is explicitly recited. Furthermore, specified acts can be carried out concurrently unless explicit claim language recites that they be carried out separately. For example, a claimed act of doing X and a claimed act of doing Y can be conducted simultaneously within a single operation, and the resulting process will fall within the literal scope of the claimed process.Attorney Docket No. 046483-7495WO1(04120)

[0096] Description: Hydrocarbyl Maleate-Derived Ionizable Lipids and LNPs Comprising Same

[0097] Lipid nanoparticle (LNP)-mediated mRNA delivery presents a promising alternative strategy for in vivo gene editing, with the success highly depending on the safety and efficiency of LNP. Ionizable lipid is a critical component that governs the potency and biodegradability of LNP.

[0098] Described herein, in one aspect, is an innovative combinatorial chemistry for the plug-and-play assembly of biodegradable ionizable lipids (ILs) between amines and maleates. After screening 500 ILs, dozens of exemplary ILs were identified with comparable or enhanced in vivo mRNA delivery efficiency to the benchmark one C12-200. The lead IL-formulated LNP can deliver distinct mRNA-based CRISPR genome editing machinery to the liver, achieving significantly higher gene editing efficiency than benchmark ones. Overall, this combinatorial chemistry is highly valuable for IL synthesis due to the simplicity, robustness and scalability. Certain exemplary ILs of the disclosure, and LNPs thereof (i.e..

[0099] 5D8), hold great promise for delivering CRISPR gene editors that warrant further development, including delivery to the fetal lung and liver.

[0100] Description: Exemplary LNPs for Delivery of Circular RNA (circRNA)

[0101] Messenger RNA (mRNA) lipid nanoparticle (LNP) vaccines against severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) have seen widespread deployment during the COVID-19 pandemic, proving themselves both safe and highly effective at reducing disease-associated morbidity and mortality. These RNA vaccines offer low production costs with unprecedentedly rapid development and manufacturing. Furthermore, vaccination platforms based on RNA possess a high degree of modularity, which has spurred numerous investigations into the development of RNA vaccines against influenza and other infectious diseases.

[0102] Circular RNA (circRNA) is an emerging RNA cargo, unique in that it is covalently closed. circRNA is substantially more stable than linear RNA species in the cell due to its resistance to exonuclease-mediated degradation, allowing more durable transgene expression than mRNA. This potential for durable gene expression is attractive both for protein replacement therapies and for vaccination, providing a potential route for dose sparing.

[0103] Furthermore, while nucleoside modification of exogenous mRNA is essential to reduce its immunogenicity to manageable levels, protein-coding circRNA has no such requirement.Attorney Docket No. 046483-7495WO1(04120)

[0104] demonstrating low immunogenicity even with only canonical nucleosides, a favorable attribute for manufacturability. Just as the advent of nucleoside modification enabled the present mRNA renaissance, so too have recent advances in RNA synthesis and circularization enabled advances in circRNA technology, leading to renewed interest in circRNA as anew class of RNA for therapeutics and vaccines.

[0105] As circRNA is a relatively new class of RNA payload, drug delivery technologies tailored for the cargo have yet to emerge. Like other RNA types, circRNA is a fragile payload, sensitive to abundant endogenous nucleases and unable to transit the cell membrane by itself due to its negative charge. While previous studies have effectively encapsulated and delivered circRNA using LNPs, most investigators have simply adopted LNP formulation parameters previously optimized for mRNA or small interfering RNA (siRNA) delivery, and the development of design criteria for circRNA LNP formulations remains an underexplored area. As reoptimization of historical siRNA LNP formulations for mRNA delivery previously resulted in substantial improvements in mRNA transfection, there is reason to think that the development of circRNA-tailored LNP formulation parameters could provide enhanced circRNA transfection.

[0106] In one aspect, the disclosure describes the identification of an ionizable lipid capable of strong immune cell circRNA transfection in vitro and in vivo, outperforming clinical standard ionizable lipids. Iterative design-of-experiments (DoE) optimization of LNP formulation parameters were performed with this ionizable lipid to further improve LNP-mediated circRNA transfection by up to 20-fold, identifying key design parameters for effective circRNA encapsulation and delivery. The optimized circRNA LNPs were administered to mice and LNP accumulation in antigen-presenting cells (APCs) in draining lymph nodes and strong transfection within secondary lymphoid tissues was noted. Finally, the optimized circRNA LNP formulation was evaluated for immunization against SARS-CoV-2 variant B.1.617.2 (Delta) in mice, demonstrating enhanced immune responses compared to mRNA LNPs, including a 3.8-fold increase in antigen-specific reciprocal endpoint serum IgG titers.

[0107] Definitions

[0108] The term "about" as used herein can allow for a degree of variability in a value or range, for example, within 10%, within 5%, or within 1% of a stated value or of a stated limit of a range, and includes the exact stated value or range.

[0109] The term '‘alkenyl” as used herein refers to straight and branched chain and cyclicAttorney Docket No. 046483-7495WO1(04120)

[0110] alkyl groups as defined herein, except that at least one double bond exists between two carbon atoms. Thus, alkenyl groups have from 2 to 40 carbon atoms, or 2 to about 20 carbon atoms, or 2 to 12 carbon atoms or, in some embodiments, from 2 to 8 carbon atoms.

[0111] Examples include, but are not limited to vinyl, -CH=C=CCH2, -CH=CH(CH3), -CH=C(CH3)2, -C(CH3)=CH2, -C(CH3)=CH(CH3), -C(CH2CH3)=CH2, cyclohexenyl, cyclopentenyl, cyclohexadienyl, butadienyl, pentadienyl, and hexadienyl among others.

[0112] The term “alkoxy” as used herein refers to an oxygen atom connected to an alkyl group, including a cycloalkyl group, as are defined herein. Examples of linear alkoxy groups include but are not limited to methoxy, ethoxy, propoxy, butoxy, pentyloxy. hexyloxy, and the like. Examples of branched alkoxy include but are not limited to isopropoxy, sec-butoxy, tert-butoxy, isopentyloxy, isohexyloxy, and the like. Examples of cyclic alkoxy include but are not limited to cyclopropyloxy, cyclobutyloxy, cyclopentyloxy, cyclohexyloxy, and the like. An alkoxy group can include about 1 to about 12, about 1 to about 20, or about 1 to about 40 carbon atoms bonded to the oxygen atom, and can further include double or triple bonds, and can also include heteroatoms. For example, an allyloxy group or a methoxyethoxy group is also an alkoxy group within the meaning herein, as is a methylenedioxy group in a context where two adjacent atoms of a structure are substituted therewith.

[0113] The term “alkyl” as used herein refers to straight chain and branched alkyl groups and cycloalkyl groups having from 1 to 40 carbon atoms, 1 to about 20 carbon atoms, 1 to 12 carbons or, in some embodiments, from 1 to 8 carbon atoms. Examples of straight chain alkyl groups include those with from 1 to 8 carbon atoms such as methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-heptyl, and n-octyl groups. Examples of branched alkyl groups include, but are not limited to, isopropyl, iso-butyl, sec-butyl, t-butyl, neopentyl, isopentyl, and 2,2-dimethylpropyl groups. As used herein, the term “alkyl” encompasses n-alkyl, isoalkyl, and anteisoalkyl groups as well as other branched chain forms of alkyl. Representative substituted alkyl groups can be substituted one or more times with any of the groups listed herein, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups.

[0114] The term “alkynyl” as used herein refers to straight and branched chain alkyl groups, except that at least one triple bond exists between two carbon atoms. Thus, alkynyl groups have from 2 to 40 carbon atoms, 2 to about 20 carbon atoms, or from 2 to 12 carbons or, in some embodiments, from 2 to 8 carbon atoms. Examples include, but are not limited to -C≡CH, -C≡C(CH3), -C≡C(CH2CH3), -CH2C=CH. -CH2C≡C(CH3), and -CH2C=C(CH2CH3) among others.Attorney Docket No. 046483-7495WO1(04120)

[0115] The term “alkylene” or “alkylenyl” as used herein refers to a bivalent saturated aliphatic radical (e.g., -CH2-, -CH2CH2-. and -CH2CH2CH2-, inter alia). In certain embodiments, the term may be regarded as a moiety derived from an alkene by opening of the double bond or from an alkane by removal of two hydrogen atoms from the same (e.g., -CH2-) different (e.g., -CH2CH2-) carbon atoms. Similarly, the terms “heteroalkylenyl”, “cycloalkylenyl”, “heterocycloalkylenyl”, and the like, as used herein, refer to a divalent radical of the moiety corresponding to the base group (e.g., heteroalkyl, cycloalkyl, and / or heterocycloalkyl). A divalent radical possesses two open valencies at any position(s) of the group, wherein each radical may be on a carbon atom or heteroatom. Thus, the divalent radical may form a single bond to two distinct atoms or groups, or may form a double bond with one atom.

[0116] The term “anionic lipid” refers to any lipid that is negatively charged at physiological pH. These lipids include phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamines, N-succinylphosphatidylethanolamines. N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphosphatidylglycerol (POPG), and other anionic modifying groups joined to neutral lipids.

[0117] The term “antibody,” as used herein, refers to an immunoglobulin molecule, which specifically binds with an antigen. Antibodies can be intact immunoglobulins derived from natural sources or from recombinant sources and can be immunoreactive portions of intact immunoglobulins. Antibodies are typically tetramers of immunoglobulin molecules. The antibodies in the present invention may exist in a variety of forms including, for example, polyclonal antibodies, monoclonal antibodies, Fv, Fab and F(ab)2, as well as single chain antibodies and humanized antibodies (Harlow et al., 1999, In: Using Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY; Harlow et al., 1989, In: Antibodies: A Laboratory Manual, Cold Spring Harbor, New York; Houston et al., 1988, Proc. Natl. Acad. Sci. USA 85:5879-5883; Bird et al., 1988, Science 242:423-426).

[0118] The term “antibody fragment” refers to a portion of an intact antibody and refers to the antigenic determining variable regions of an intact antibody. Examples of antibody fragments include, but are not limited to. Fab, Fab’, F(ab’)2, and Fv fragments, linear antibodies, scFv antibodies, and multispecific antibodies formed from antibody fragments.

[0119] An “antibody heavy chain,” as used herein, refers to the larger of the two types of polypeptide chains present in all antibody molecules in their naturally occurring

[0120] conformations.Attorney Docket No. 046483-7495WO1(04120)

[0121] An “antibody light chain,” as used herein, refers to the smaller of the two types of polypeptide chains present in all antibody molecules in their naturally occurring conformations, K and X light chains refer to the two major antibody light chain isotypes.

[0122] By the term “synthetic antibody” as used herein, is meant an antibody, which is generated using recombinant DNA technology, such as, for example, an antibody expressed by a bacteriophage. The term should also be construed to mean an antibody which has been generated by the synthesis of a DNA molecule encoding the antibody and which DNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the DNA or amino acid sequence has been obtained using synthetic DNA or amino acid sequence technology which is available and well known in the art. The term should also be construed to mean an antibody, which has been generated by the synthesis of an RNA molecule encoding the antibody. The RNA molecule expresses an antibody protein, or an amino acid sequence specifying the antibody, wherein the RNA has been obtained by transcribing DNA (synthetic or cloned) or other technology, which is available and well known in the art.

[0123] The term “antigen” or “Ag” as used herein is defined as a molecule that provokes an adaptive immune response. This immune response may involve either antibody production, or the activation of specific immunogenically-competent cells, or both. The skilled artisan will understand that any macromolecule, including virtually all proteins or peptides, can serve as an antigen. Furthermore, antigens can be derived from recombinant or genomic DNA or RNA. A skilled artisan will understand that any DNA or RNA, which comprises a nucleotide sequences or a partial nucleotide sequence encoding a protein that elicits an adaptive immune response therefore encodes an “antigen” as that term is used herein. Furthermore, one skilled in the art will understand that an antigen need not be encoded solely by a full length nucleotide sequence of a gene. It is readily apparent that the present invention includes, but is not limited to, the use of partial nucleotide sequences of more than one gene and that these nucleotide sequences are arranged in various combinations to elicit the desired immune response. Moreover, a skilled artisan will understand that an antigen need not be encoded by a “gene” at all. It is readily apparent that an antigen can be generated synthesized or can be derived from a biological sample. Such a biological sample can include, but is not limited to a tissue sample, a tumor sample, a cell or a biological fluid.

[0124] The term “amine” as used herein refers to primary, secondary, and tertiary amines having, e.g, the formula N(group)3wherein each group can independently be H or non-H,Attorney Docket No. 046483-7495WO1(04120)

[0125] such as alky l, aryl, and the like. Amines include but are not limited to R-NH2, for example, alkylamines, arylamines, alkylarylamines; R2NH wherein each R is independently selected, such as dialkylamines, diarylamines, aralkylamines, heterocyclylamines and the like; and R3N wherein each R is independently selected, such as trialkylamines, dialkylarylamines, alkyldiarylamines, triarylamines, and the like. The term “amine” also includes ammonium ions as used herein.

[0126] The term “amino group” as used herein refers to a substituent of the form -NH2, -NHR, -NR2, -NR3+. wherein each R is independently selected, and protonated forms of each, except for -NR3+, which cannot be protonated. Accordingly, any compound substituted with an amino group can be viewed as an amine. An “amino group” within the meaning herein can be a primary, secondary, tertiary, or quaternary amino group. An “alkylamino” group includes a monoalkylamino, dialkylamino, and trialkylamino group.

[0127] The term “anionic lipid” refers to any lipid that is negatively charged at physiological pH. These lipids include phosphatidylglycerol, cardiolipin, diacylphosphatidylserine, diacylphosphatidic acid, N-dodecanoylphosphatidylethanolamines, N-succinylphosphatidylethanolamines, N-glutarylphosphatidylethanolamines, lysylphosphatidylglycerols, palmitoyloleyolphosphatidylglycerol (POPG), and other anionic modifying groups joined to neutral lipids.

[0128] The term “aryl” as used herein refers to cyclic aromatic hydrocarbon groups that do not contain heteroatoms in the ring. Thus aryl groups include, but are not limited to, phenyl, azulenyl, heptalenyl, biphenyl, indacenyl, fluorenyl, phenanthrenyl, triphenylenyl, pyrenyl, naphthacenyl, chrysenyl, biphenylenyl, anthracenyl, and naphthyl groups. In some embodiments, aryl groups contain about 6 to about 14 carbons in the ring portions of the groups. Aryl groups can be unsubstituted or substituted, as defined herein. Representative substituted aryl groups can be mono-substituted or substituted more than once, such as, but not limited to, a phenyl group substituted at any one or more of 2-, 3-, 4-, 5-, or 6-positions of the phenyl ring, or a naphthyl group substituted at any one or more of 2- to 8-positions thereof.

[0129] The term “monovalent cation” as used herein refers to any positively charged (+1) organic or inorganic ion. Non-limiting examples include H+, NH4+, Li+, Na+, K+, Cu+, Ag+, Cs+, and Au+.

[0130] The term “cationic lipid” refers to any of a number of lipid species that carry a net positive charge at a selected pH. such as physiological pH (e.g, pH of about 7.0). It has been found that cationic lipids comprising alkyl chains with multiple sites of unsaturation, e.g., atAttorney Docket No. 046483-7495WO1(04120)

[0131] least two or three sites of unsaturation, are particularly useful for forming lipid particles with increased membrane fluidity. A number of cationic lipids and related analogs, which are also useful in the present disclosure, have been described in U. S. Patent Publication Nos.

[0132] 20060083780 and 20060240554; U. S. Pat. Nos. 5,208,036; 5,264,618; 5,279,833; 5,283,185; 5,753,613; and 5,785,992; and PCT Publication No. WO 96 / 10390, the disclosures of which are herein incorporated by reference in their entirety for all purposes. Non-limiting examples of cationic lipids are described in detail herein. In some cases, the cationic lipids comprise a protonatable tertiary amine (e.g., pH titratable) head group, Cis alkyl chains, ether linkages between the head group and alkyl chains, and 0 to 3 double bonds. Such lipids include, e.g., DSDMA, DLinDMA, DLenDMA, and DODMA.

[0133] The term “conjugated lipid” as used herein refers to a lipid which is conjugated to one or more polymeric groups, which inhibits aggregation of lipid particles. Such lipid conjugates include, but are not limited to, polyamide oligomers (e.g., ATTA-lipid conjugates), PEG-lipid conjugates, such as PEG coupled to dialkyloxypropyls, PEG coupled to diacylglycerols, PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines, PEG conjugated to ceramides (e.g., U. S. Pat. No. 5,885,613, the disclosure of which is herein incorporated by reference in its entirety for all purposes), cationic PEG lipids, and mixtures thereof. PEG can be conjugated directly to the lipid or may be linked to the lipid via a linker moiety. Any linker moiety suitable for coupling the PEG to a lipid can be used including, e.g.. non-ester containing linker moieties and ester-containing linker moieties. In preferred embodiments, non-ester containing linker moieties are used.

[0134] The term “cycloalkyl” as used herein refers to cyclic alkyl groups such as, but not limited to, cyclopropyl, cyclobutyl, cyclopentyl, cyclohexyl, cycloheptyl, and cyclooctyl groups. In some embodiments, the cycloalkyl group can have 3 to about 8-12 ring members, whereas in other embodiments the number of ring carbon atoms range from 3 to 4, 5, 6, or 7. Cycloalkyl groups further include polycyclic cycloalkyl groups such as, but not limited to, norbomyl, adamantyl, bomyl, camphenyl, isocamphenyl, and carenyl groups, and fused rings such as, but not limited to, decalinyl, and the like. Cycloalkyl groups also include rings that are substituted with straight or branched chain alkyl groups as defined herein. Representative substituted cycloalkyl groups can be mono-substituted or substituted more than once, such as, but not limited to, 2,2-, 2,3-, 2,4- 2,5- or 2,6-disubstituted cyclohexyl groups or mono-, di- or tri-substituted norbomyl or cycloheptyl groups, which can be substituted with, for example, amino, hydroxy, cyano, carboxy, nitro, thio, alkoxy, and halogen groups. The term “cycloalkenyl” alone or in combination denotes a cyclic alkenyl group.Attorney Docket No. 046483-7495WO1(04120)

[0135] A “disease"’ is a state of health of an animal wherein the animal cannot maintain homeostasis, and wherein if the disease is not ameliorated then the animal’s health continues to deteriorate.

[0136] In contrast, a “disorder” in an animal is a state of health in which the animal is able to maintain homeostasis, but in which the animal’s state of health is less favorable than it would be in the absence of the disorder. Left untreated, a disorder does not necessarily cause a further decrease in the animal’s state of health.

[0137] A disease or disorder is “alleviated” if the severity of a symptom of the disease or disorder, the frequency with which such a symptom is experienced by a patient, or both, is reduced.

[0138] As used herein, the terms "effective amount,” “pharmaceutically effective amount” and “therapeutically effective amount” refer to a nontoxic but sufficient amount of an agent to provide the desired biological result. That result may be reduction and / or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. An appropriate therapeutic amount in any individual case may be determined by one of ordinary skill in the art using routine experimentation.

[0139] In particular, in the case of a mRNA, and “effective amount” or “therapeutically effective amount” of a therapeutic nucleic acid as relating to a mRNA is an amount sufficient to produce the desired effect, e.g., mRNA-directed expression of an amount of a protein that causes a desirable biological effect in the organism within which the protein is expressed. For example, in some embodiments, the expressed protein is an active form of a protein that is normally expressed in a cell type within the body, and the therapeutically effective amount of the mRNA is an amount that produces an amount of the encoded protein that is at least 50% (e.g., at least 60%, or at least 70%, or at least 80%, or at least 90%) of the amount of the protein that is normally expressed in the cell type of a healthy individual. For example, in some embodiments, the expressed protein is a protein that is normally expressed in a cell type within the body, and the therapeutically effective amount of the mRNA is an amount that produces a similar level of expression as observed in a healthy individual in an individual with aberrant expression of the protein (z.e., protein deficient individual). Suitable assays for measuring the expression of an mRNA or protein include, but are not limited to dot blots, Northern blots, in situ hybridization, ELISA, immunoprecipitation, enzyme function, as well as phenotypic assays known to those of skill in the art.

[0140] The term “encode” as used herein refers to the product specified (e.g., protein and RNA) by a given sequence of nucleotides in a nucleic acid (i.e., DNA and / or RNA), uponAttorney Docket No. 046483-7495WO1(04120)

[0141] transcription or translation of the DNA or RNA, respectively. In certain embodiments, the term "encode" refers to the RNA sequence specified by transcription of a DNA sequence. In certain embodiments, the term “encode” refers to the amino acid sequence (e.g., polypeptide or protein) specified by translation of mRNA. In certain embodiments, the term “encode” refers to the amino acid sequence specified by transcription of DNA to mRNA and subsequent translation of the mRNA encoded by the DNA sequence. In certain embodiments, the encoded product may comprise a direct transcription or translation product. In certain embodiments, the encoded product may comprise post-translational modifications understood or reasonably expected by one skilled in the art.

[0142] The term “fully encapsulated” indicates that the active agent or therapeutic agent in the lipid particle is not significantly degraded after exposure to serum or a nuclease or protease assay that would significantly degrade free DNA, RNA, or protein. In a fully encapsulated system, preferably less than about 25% of the active agent or therapeutic agent in the particle is degraded in a treatment that would normally degrade 100% of free active agent or therapeutic agent, more preferably less than about 10%, and most preferably less than about 5% of the active agent or therapeutic agent in the particle is degraded. In the context of nucleic acid therapeutic agents, full encapsulation may be determined by an OLIGREEN® assay. OLIGREEN® is an ultra-sensitive fluorescent nucleic acid stain for quantitating oligonucleotides and single-stranded DNA or RNA in solution (available from Invitrogen Corporation; Carlsbad, Calif). “Fully encapsulated” also indicates that the lipid particles are serum stable, that is, that they do not rapidly decompose into their component parts upon in vivo administration.

[0143] The terms “halo,” “halogen,” or “halide” group, as used herein, by themselves or as part of another substituent, mean, unless otherwise stated, a fluorine, chlorine, bromine, or iodine atom.

[0144] The term “haloalkyl” group, as used herein, includes mono-halo alkyl groups, polyhalo alkyl groups wherein all halo atoms can be the same or different, and per-halo alky l groups, wherein all hydrogen atoms are replaced by halogen atoms, such as fluoro. Examples of haloalkyl include trifluoromethyl, 1,1 -dichloroethyl, 1,2-dichloroethyl, l,3-dibromo-3,3-difluoropropyl, perfluorobutyl, and the like.

[0145] The term “helper lipid” as used herein refers to a lipid capable of increasing the effectiveness of delivery of lipid-based particles such as cationic lipid-based particles to a target, preferably into a cell. The helper lipid can be neutral, positively charged, or negatively charged. In certain embodiments, the helper lipid is neutral or negatively charged. Non-Attorney Docket No. 046483-7495WO1(04120)

[0146] limiting examples of helper lipids include l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1.2-di-(9Z-octadecenoyl)-sn-glycero-3-phosphoethanolamine (DOPE), 1-palmitoyl-2-oleoyl-sn-glycero-3phosphocholin (POPC) and l,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC).

[0147] The term “heteroalkyl” as used herein by itself or in combination with another term, means, unless otherwise stated, a non-cyclic stable straight or branched chain, or combinations thereof, including at least one carbon atom and at least one heteroatom selected from the group consisting of O, N, P, Si, and S, and wherein the nitrogen and sulfur atoms may optionally be oxidized, and the nitrogen heteroatom may optionally be quatemized. The heteroatom(s) (e.g., O, N, P, and S) may be placed at any interior position of the heteroalkyl group or at either terminal position at which the group is attached to the remainder of the molecule.

[0148] The term “heteroaryl” as used herein refers to aromatic ring compounds containing 5 or more ring members, of which, one or more is a heteroatom such as, but not limited to, N, O, and S; for instance, heteroaryl rings can have 5 to about 8-12 ring members. A heteroaryl group is a variety of a heterocyclyl group that possesses an aromatic electronic structure. A heteroaryl group designated as a C2-heteroaryl can be a 5-ring with two carbon atoms and three heteroatoms, a 6-ring with two carbon atoms and four heteroatoms and so forth.

[0149] Likewise a C4-heteroaryl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms, and so forth. The number of carbon atoms plus the number of heteroatoms sums up to equal the total number of ring atoms. Heteroaryl groups include, but are not limited to, groups such as pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, thiophenyl, benzothiophenyl, benzofuranyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. Heteroaryl groups can be unsubstituted, or can be substituted with groups as is discussed herein. Representative substituted heteroaryl groups can be substituted one or more times with groups such as those listed herein.

[0150] Additional examples of aryl and heteroaryl groups include but are not limited to phenyl, biphenyl, indenyl, naphthyl (1-naphthyl, 2-naphthyl), N-hydroxytetrazolyl, N-hydroxytriazolyl, N-hydroxyimidazolyl, anthracenyl (1-anthracenyl, 2-anthracenyl, 3-anthracenyl). thiophenyl (2-thienyl, 3-thienyl), furyl (2-furyl, 3-furyl), indolyl. oxadiazolyl, isoxazolyl, quinazolinyl, fluorenyl, xanthenyl, isoindanyl, benzhydryl, acridinyl, thiazolyl,Attorney Docket No. 046483-7495WO1(04120)

[0151] pyrrolyl (2-pyrrolyl), pyrazolyl (3-pyrazolyl), imidazolyl (1-imidazolyl, 2-imidazolyl, 4-imidazolyl, 5-imidazolyl), triazolyl (1,2,3-triazol-l-yl, 1,2,3-triazol-2-yl 1,2,3-triazol-4-yl, 1,2,4-triazol-3-yl), oxazolyl (2-oxazolyl, 4-oxazolyl, 5-oxazolyl), thiazolyl (2 -thiazolyl, 4-thiazolyl, 5-thiazolyl), pyridyl (2-pyridyl, 3-pyridyl, 4-pyridyl), pyrimidinyl (2-pyrimidinyl, 4-pyrimidinyl, 5 -pyrimidiny l, 6-pyrimidinyl), pyrazinyl, pyridazinyl (3- pyridazinyl, 4-pyridazinyl, 5 -pyridazinyl), quinolyl (2-quinolyl, 3-quinolyl, 4-quinolyl, 5-quinolyl, 6-quinolyl, 7-quinolyl, 8-quinolyl), isoquinolyl (1 -isoquinolyl, 3-isoquinolyl, 4-isoquinolyl, 5-isoquinolyl, 6-isoquinolyl, 7-isoquinolyl, 8-isoquinolyl), benzo[b]furanyl (2-benzo[b]furanyl, 3-benzo[b]furanyl, 4-benzo[b]furanyl, 5-benzo[b]furanyl, 6-benzo[b]furanyl, 7-benzo[b]furanyl), 2,3-dihydro-benzo[b]furanyl (2-(2,3-dihydro-benzo[b]furanyl), 3-(2,3-dihydro-benzo[b]furanyl), 4-(2,3-dihydro-benzo[b]furanyl), 5-(2,3-dihydro-benzo[b]furanyl), 6-(2,3-dihydro-benzo[b]furanyl), 7-(2,3-dihydro-benzo[b]furanyl), benzo[b]thiophenyl (2-benzo[b]thiophenyl, 3-benzo[b]thiophenyl, 4-benzo[b]thiophenyl, 5-benzo[b]thiophenyl, 6-benzo[b]thiophenyl, 7-benzo[b]thiophenyl), 2,3-dihydro-benzo[b]thiophenyl, (2-(2,3-dihydro-benzo[b]thiophenyl), 3-(2,3-dihydro-benzo[b]thiophenyl), 4-(2,3-dihydro-benzo[b]thiophenyl), 5-(2,3-dihydro-benzo[b]thiophenyl), 6-(2,3-dihydro-benzo[b]thiophenyl), 7-(2,3-dihydro-benzo[b]thiophenyl), indolyl (1-indolyl, 2-indolyl, 3-indolyl, 4-indolyl, 5-indolyl, 6-indolyl, 7-indolyl), indazole (1-indazolyl, 3-indazolyl, 4-indazolyl, 5-indazolyl, 6-indazolyl, 7-indazolyl), benzimidazolyl (1 -benzimidazolyl, 2-benzimidazolyl, 4-benzimidazolyl, 5 -benzimidazolyl. 6-benzimidazolyl, 7-benzimidazolyl, 8-benzimidazolyl), benzoxazolyl (1-benzoxazolyl, 2-benzoxazolyl), benzothiazolyl (1-benzothiazolyl, 2-benzothiazolyl, 4-benzothiazolyl, 5 -benzothiazolyl, 6-benzothiazolyl, 7-benzothiazolyl), carbazolyl (1-carbazolyl, 2-carbazolyl, 3-carbazolyl, 4-carbazolyl), 5H-dibenz[b.f] azepine (5H-dibenz[b,f| azepin- 1-yl, 5H-dibenz[b,f|azepine-2-yl,

[0152] 5H-dibenz[b,f]azepine-3-yl, 5H-dibenz[b,f]azepine-4-yl, 5H-dibenz[b,f]azepine-5-yl), 10,11 -dihy dro-5H-dibenz[b,f] azepine ( 10, 11 -dihy dro-5H-dibenz[b,f] azepine- 1 -yl,

[0153] 10,11-dihydro-5H-dibenz[b,f]azepine-2-yl, 10,11-dihydro-5H-dibenz[b,f]azepine-3-yl, 10,11-dihydro-5H-dibenz[b,f]azepine-4-yl, 10,11-dihydro-5H-dibenz[b,f]azepine-5-yl), and the like.

[0154] The term “heterocycloalkyl” as used herein refers to an aliphatic, partially unsaturated or fully saturated, 3- to 14-membered ring system, including single rings of 3 to 8 atoms and bi- and tricyclic ring systems where at least one of the carbon atoms of the ring is replaced with a heteroatom such as. but not limited to, nitrogen, oxygen, sulfur, or phosphorus. A heterocycloalkyl can include one to four heteroatoms independently selected from oxygen,Attorney Docket No. 046483-7495WO1(04120)

[0155] nitrogen, and sulfur, wherein a nitrogen and sulfur heteroatom optionally can be oxidized and a nitrogen heteroatom optionally can be substituted. Representative heterocycloalkyl groups include, but are not limited, to the following exemplary groups: pyrrolidinyl, pyrazolinyl, pyrazolidinyl, imidazolinyl, imidazolidinyl, piperidinyl, piperazinyl, oxazolidinyl, isoxazolidinyl, morpholinyl, thiazolidinyl, isothiazolidinyl, and tetrahydrofuryl.

[0156] The term “heterocyclyl” as used herein refers to aromatic and non-aromatic ring compounds containing three or more ring members, of which one or more is a heteroatom such as, but not limited to, N, O, and S. Thus, a heterocyclyl can be a cycloheteroalkyl, or a heteroaryl, or if polycyclic, any combination thereof. In some embodiments, heterocyclyl groups include 3 to about 20 ring members, whereas other such groups have 3 to about 15 ring members. A heterocyclyl group designated as a C2-heterocyclyl can be a 5-ring with two carbon atoms and three heteroatoms, a 6-ring with two carbon atoms and four heteroatoms and so forth. Likewise a C4-heterocyclyl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms, and so forth. The number of carbon atoms plus the number of heteroatoms equals the total number of ring atoms. A heterocyclyl ring can also include one or more double bonds. A heteroaryl ring is an embodiment of a heterocyclyl group. The phrase “heterocyclyl group" includes fused ring species including those that include fused aromatic and non-aromatic groups. For example, a dioxolanyl ring and a benzdioxolanyl ring system (methylenedioxyphenyl ring system) are both heterocyclyl groups within the meaning herein. The phrase also includes polycyclic ring systems containing a heteroatom such as, but not limited to, quinuclidyl. Heterocyclyl groups can be unsubstituted, or can be substituted as discussed herein. Heterocyclyl groups include, but are not limited to, pyrrolidinyl, piperidinyl, piperazinyl, morpholinyl, pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, thiophenyl, benzothiophenyl, benzofuranyl, dihydrobenzofuranyl, indolyl, dihydroindolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. Representative substituted heterocyclyl groups can be mono-substituted or substituted more than once, such as, but not limited to, piperidinyl or quinolinyl groups, which are 2-, 3-, 4-, 5-, or 6-substituted, or disubstituted with groups such as those listed herein.

[0157] The term “hydrocarbon” or “hydrocarbyl” as used herein refers to a molecule or functional group that includes carbon and hydrogen atoms. The term can also refer to a molecule or functional group that normally includes both carbon and hydrogen atoms butAttorney Docket No. 046483-7495WO1(04120)

[0158] wherein all the hydrogen atoms are substituted with other functional groups.

[0159] The term “ionizable lipid"’ as used herein refers to a lipid (e.g, a cationic lipid) having at least one protonatable or deprotonatable group, such that the lipid is positively charged at a pH at or below physiological pH (e.g., pH 7.4), and neutral at a second pH, preferably at or above physiological pH. It will be understood by one of ordinary skill in the art that the addition or removal of protons as a function of pH is an equilibrium process, and that the reference to a charged or neutral lipid refers to the nature of the predominant species and does not require that all of the lipid be present in the charged or neutral form. Generally, ionizable lipids have a pKa of the protonatable group in the range of about 4 to about 7.

[0160] As used herein, the term “hydrocarbyl” refers to a functional group derived from a straight chain, branched, or cyclic hydrocarbon, and can be alkyl, alkenyl, alkynyl, aryl, cycloalkyl, acyl, or any combination thereof. Hydrocarbyl groups can be shown as (Ca-Cb)hydrocarbyl, wherein a and b are integers and mean having any of a to b number of carbon atoms. For example, (Ci-C4)hydrocarbyl means the hydrocarbyl group can be methyl (Ci), ethyl (C2), propyl (C3), or butyl (C4), and (Co-Cb)hydrocarbyl means in certain embodiments there is no hydrocarbyl group.

[0161] The term “immune cell,” as used herein refers to any cell involved in the mounting of an immune response. Such cells include, but are not limited to, T cells, B cells, NK cells, antigen-presenting cells (e.g., dendritic cells and macrophages), monocytes, neutrophils, eosinophils, basophils, and the like.

[0162] The term “independently selected from” as used herein refers to referenced groups being the same, different, or a mixture thereof, unless the context clearly indicates otherwise. Thus, under this definition, the phrase “X1, X2, and X3are independently selected from noble gases” would include the scenario where, for example, X1, X2, and X3are all the same, where X1, X2, and X3are all different, where X1and X2are the same but X3is different, and other analogous permutations.

[0163] The term “ionizable lipid” as used herein refers to a lipid (e.g., a cationic lipid) having at least one protonatable or deprotonatable group, such that the lipid is positively charged at a pH at or below physiological pH (e.g., pH 7.4), and neutral at a second pH, preferably at or above physiological pH. It will be understood by one of ordinary skill in the art that the addition or removal of protons as a function of pH is an equilibrium process, and that the reference to a charged or neutral lipid refers to the nature of the predominant species and does not require that all of the lipid be present in the charged or neutral form. Generally, ionizable lipids have a pKa of the protonatable group in the range of about 4 to about 7.Attorney Docket No. 046483-7495WO1(04120)

[0164] The term “local delivery,” as used herein, refers to delivery of an active agent or therapeutic agent such as a messenger RNA directly to a target site within an organism. For example, an agent can be locally delivered by direct injection into a disease site such as a tumor or other target site such as a site of inflammation or a target organ such as the liver, heart, pancreas, kidney, and the like.

[0165] The term “lipid” refers to a group of organic compounds that include, but are not limited to, esters of fatty acids and are characterized by being insoluble in water, but soluble in many organic solvents. They are usually divided into at least three classes: (1) “simple lipids,” which include fats and oils as well as waxes; (2) “compound lipids,” which include phospholipids and glycolipids; and (3) “derived lipids” such as steroids.

[0166] The term “conjugated lipid” as used herein refers to a lipid which is conjugated to one or more polymeric groups, which inhibits aggregation of lipid particles. Such lipid conjugates include, but are not limited to, polyamide oligomers (e.g., ATTA-lipid conjugates), PEG-lipid conjugates, such as PEG coupled to dialkyloxypropyls, PEG coupled to diacylglycerols, PEG coupled to cholesterol, PEG coupled to phosphatidylethanolamines, PEG conjugated to ceramides (e.g., U. S. Pat. No. 5,885,613, the disclosure of which is herein incorporated by reference in its entirety for all purposes), cationic PEG lipids, and mixtures thereof. PEG can be conjugated directly to the lipid or may be linked to the lipid via a linker moiety. Any linker moiety suitable for coupling the PEG to a lipid can be used including, e.g.. non-ester containing linker moieties and ester-containing linker moieties. In preferred embodiments, non-ester containing linker moieties are used.

[0167] As used herein, “lipid encapsulated” can refer to a lipid particle that provides an active agent or therapeutic agent, such as a nucleic acid (e.g., a protein cargo), with full encapsulation, partial encapsulation, or both. In a preferred embodiment, the nucleic acid is fully encapsulated in the lipid particle (e.g, to form an SPLP, pSPLP, SNALP, or other nucleic acid-lipid particle).

[0168] The term “lipid nanoparticle” refers to a particle having at least one dimension on the order of nanometers (e.g., 1-1,000 nm) which includes one or more lipids and / or additional agents.

[0169] The term “lipid particle” is used herein to refer to a lipid formulation that can be used to deliver an active agent or therapeutic agent, such as a nucleic acid (e.g., mRNA), to a target site of interest. In the lipid particle of the disclosure, which is typically formed from a cationic lipid, a non-cationic lipid, and a conjugated lipid that prevents aggregation of the particle, the active agent or therapeutic agent may be encapsulated in the lipid, therebyAttorney Docket No. 046483-7495WO1(04120)

[0170] protecting the agent from enzymatic degradation.

[0171] The term “monovalent’" as used herein refers to a substituent connecting via a single bond to a substituted molecule. When a substituent is monovalent, such as, for example, F or Cl, it is bonded to the atom it is substituting by a single bond.

[0172] The term “mRNA’' or “messenger RNA'’ as used herein refers to a ribonucleic acid sequences which encodes a peptide or protein. In certain embodiments, the mRNA may comprise a “transcript” that is produced by using a DNA template and encodes a peptide or protein. Typically, mRNA comprises 5’-UTR, protein coding region and 3’-UTR. mRNA can be produced by in vitro transcription from a DNA template. Methods of in vitro transcription are known to those of skill in the art. For example, various in vitro transfer kits are commercially available. According to the present invention, mRNA can be modified by further stabilizing modifications and cap formation in addition to the modifications according to the invention.

[0173] The term “neutral lipid” refers to any of a number of lipid species that exist either in an uncharged or neutral zwiterionic form at a selected pH. At physiological pH, such lipids include, for example, diacylphosphatidylcholine, diacylphosphatidylethanolamine, ceramide, sphingomyelin, cephalin, cholesterol, cerebrosides, and diacylglycerols.

[0174] The term “non-cationic lipid” refers to any amphipathic lipid as w ell as any other neutral lipid or anionic lipid.

[0175] The term “nucleic acid” as used herein refers to a polymer containing at least two deoxyribonucleotides or ribonucleotides in either single- or double-stranded form and includes DNA and RNA. DNA may be in the form of, e.g., antisense molecules, plasmid DNA, pre-condensed DNA, a PCR product, vectors (Pl, PAC, BAC, YAC, artificial chromosomes), expression cassettes, chimeric sequences, chromosomal DNA, or derivatives and combinations of these groups. RNA may be in the form of siRNA, asymmetrical interfering RNA (aiRNA), microRNA (miRNA), mRNA, tRNA, rRNA, tRNA, viral RNA (vRNA), and combinations thereof. Nucleic acids include nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, and which have similar binding properties as the reference nucleic acid. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2’-O-methyl ribonucleotides, and peptide-nucleic acids (PNAs). Unless specifically limited, the term encompasses nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid. Unless otherwise indicated, aAttorney Docket No. 046483-7495WO1(04120)

[0176] particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g, degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J. Biol. Chem., 260:2605-2608 (1985); Rossolini et al., Mol. Cell. Probes, 8:91-98 (1994)).

[0177] As used herein, the term '‘nucleic acid” includes any oligonucleotide or polynucleotide, with fragments containing up to 60 nucleotides generally termed oligonucleotides, and longer fragments termed polynucleotides. In particular embodiments, oligonucleotides of the disclosure are from about 15 to about 60 nucleotides in length.

[0178] Nucleic acid may be administered alone in the lipid particles of the disclosure, or in combination (e.g., co-administered) with lipid particles of the disclosure comprising peptides, polypeptides, or small molecules such as conventional drugs. In other embodiments, the nucleic acid may be administered in a viral vector.

[0179] “Nucleotides” contain a sugar deoxyribose (DNA) or ribose (RNA), a base, and a phosphate group. Nucleotides are linked together through the phosphate groups. “Bases” include purines and pyrimidines, which further include natural compounds adenine, thymine, guanine, cy tosine, uracil, inosine, and natural analogs, and synthetic derivatives of purines and pyrimidines, which include, but are not limited to, modifications which place new reactive groups such as, but not limited to, amines, alcohols, thiols, carboxylates, and alkyl halides.

[0180] Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g, degenerate codon substitutions), alleles, orthologs, SNPs, and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and / or deoxyinosine residues (Batzer et al., Nucleic Acid Res., 19:5081 (1991); Ohtsuka et al., J. Biol. Chem., 260:2605-2608 (1985); Rossolini et al.. Mol. Cell. Probes, 8:91-98 (1994)).

[0181] The terms “patient,” “subject,” or “individual” are used interchangeably herein, and refer to any animal, or cells thereof whether in vitro or in situ, amenable to the methods described herein. In a non-limiting embodiment, the patient, subject or individual is a human.

[0182] As used herein, the term '‘pharmaceutically acceptable” refers to a material, such as aAttorney Docket No. 046483-7495WO1(04120)

[0183] carrier or diluent, which does not abrogate the biological activity or properties of the compound, and is relatively non-toxic, i.e., the material may be administered to an individual without causing undesirable biological effects or interacting in a deleterious manner with any of the components of the composition in which it is contained.

[0184] As used herein, the language “pharmaceutically acceptable salt” refers to a salt of the administered compounds prepared from pharmaceutically acceptable non-toxic acids or bases, including inorganic acids or bases, organic acids or bases, solvates, hydrates, or clathrates thereof.

[0185] As used herein, the terms “peptide,” “polypeptide,” and “protein” are used interchangeably, and refer to a compound comprised of amino acid residues covalently linked by peptide bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide’s sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

[0186] The term “siRNA” or “small interfering RNA” as used herein refers to a small (e.g. generally less than 30 nucleotides) non-coding RNA molecule which functions in transcriptional and post-transcriptional regulation of gene expression. Generally, a siRNA specifically targets 1 nucleic acid. In general, a siRNA comprises a double-stranded RNA molecule that ranges from about 15 to about 29 nucleotides in length. In some embodiments, the siRNA may be 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides in length. In some embodiments, the siRNA may be less than 16, 17, 18, 19, 20, 21, 22. 23, 24, 25, 26, 27, 28 or 29 nucleotides in length. In some embodiments, the siRNA may be more than 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 nucleotides in length. A siRNA may optionally further comprise one or two single-stranded overhangs, e.g., a 5' overhang on one or both ends, a 3' overhang on one or both ends, or a combination thereof. The siRNA may be formed from two RNA molecules that hybridize together or, alternatively, may be generated from a short hairpin RNA (shRNA). In some embodiments, the two strands of theAttorney Docket No. 046483-7495WO1(04120)

[0187] siRNA may be completely complementary, such that no mismatches or bulges exist in the duplex formed between the two sequences. In other embodiments, the two strands of the siRNA may be substantially complementary, such that one or more mismatches and / or bulges may exist in the duplex formed between the two sequences. In certain embodiments, one or both of the 5' ends of the siRNA may have a phosphate group, while in other embodiments one or both of the 5' ends lack a phosphate group. In other embodiments, one or both of the 3' ends of the siRNA may have a hydroxyl group, while in other embodiments one or both of the 5' ends lack a hydroxyl group. Typically, siRNAs are targeted to exonic sequences of the target nucleic acid. One strand of the siRNA, which is referred to as the “antisense strand” or “guide strand,” includes a portion that hybridizes with a target nucleic acid. A target nucleic acid refers to a nucleic acid sequence expressed by a cell for which it is desired expression be disrupted. In the context of a therapeutic composition of the invention, disrupting expression of a target nucleic acid may produce a beneficial effect. Those of skill in the art are familiar with programs, algorithms, and / or commercial services that design siRNAs for target genes. For example, the Roseta siRNA Design Algorithm (Roseta Inpharmatics, North Seatle, Wash.), MISSION® siRNA (Sigma-Aldrich, St. Louis. Mo.) and siGENOME siRNA (Thermo Scientific) may be used.

[0188] Suitable pharmaceutically acceptable acid addition salts may be prepared from an inorganic acid or from an organic acid. Examples of inorganic acids include hydrochloric, hydrobromic, hydriodic. nitric, carbonic, sulfuric (including sulfate and hydrogen sulfate), and phosphoric acids (including hydrogen phosphate and dihydrogen phosphate). Appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include formic, acetic, propionic, succinic, glycolic, gluconic, lactic, malic, tartaric, citric, ascorbic, glucuronic, maleic, malonic, saccharin, fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, 4-hydroxybenzoic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, benzenesulfonic, pantothenic, trifluoromethanesulfonic, 2-hydroxyethanesulfonic, p-toluenesulfonic. sulfanilic, cyclohexylaminosulfonic, stearic, alginic, (3-hydroxybutyric, salicylic, galactaric and galacturonic acid.

[0189] Suitable pharmaceutically acceptable base addition salts of compounds described herein include, for example, ammonium salts, metallic salts including alkali metal, alkaline earth metal and transition metal salts such as, for example, calcium, magnesium, potassium, sodium and zinc salts. Pharmaceutically acceptable base addition salts also include organic salts made from basic amines such as, for example, N, N’ -dibenzyl ethylene-diamine,Attorney Docket No. 046483-7495WO1(04120)

[0190] chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine) and procaine. All of these salts may be prepared from the corresponding compound by reacting, for example, the appropriate acid or base with the compound.

[0191] As used herein, the term “pharmaceutically acceptable carrier” or “pharmaceutically acceptable excipient” means a pharmaceutically acceptable material, composition or carrier, such as a liquid or solid filler, stabilizer, dispersing agent, suspending agent, diluent, excipient, thickening agent, solvent or encapsulating material, involved in carrying or transporting a compound described herein within or to the patient such that it may perform its intended function. Typically, such compounds are carried or transported from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be “acceptable” in the sense of being compatible with the other ingredients of the formulation, including the compound(s) described herein, and not injurious to the patient. Some examples of materials that may serve as pharmaceutically acceptable carriers include: sugars, such as lactose, glucose and sucrose; starches, such as corn starch and potato starch; cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; powdered tragacanth; malt; gelatin; talc; excipients, such as cocoa butter and suppository waxes; oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil and soybean oil; glycols, such as propylene glycol; polyols, such as glycerin, sorbitol, mannitol and polyethylene glycol; esters, such as ethyl oleate and ethyl laurate; agar; buffering agents, such as magnesium hydroxide and aluminum hydroxide; surface active agents; alginic acid; pyrogen-free water; isotonic saline; Ringer’s solution; ethyl alcohol; phosphate buffer solutions; and other non-toxic compatible substances employed in pharmaceutical formulations. As used herein, “pharmaceutically acceptable carrier” also includes any and all coatings, antibacterial and antifungal agents, and absorption delaying agents, and the like that are compatible with the activity of the compound(s) described herein, and are physiologically acceptable to the patient. Supplementary active compounds may also be incorporated into the compositions. The “pharmaceutically acceptable carrier” may further include a pharmaceutically acceptable salt of the compound(s) described herein. Other additional ingredients that may be included in the pharmaceutical compositions used with the methods or compounds described herein are known in the art and described, for example in Remington’s Pharmaceutical Sciences (Genaro, Ed., Mack Publishing Co., 1985, Easton, PA), which is incorporated herein by reference.

[0192] The terms “peptide,” “polypeptide,” and “protein” are used interchangeably herein, and refer to a compound comprised of amino acid residues covalently linked by peptideAttorney Docket No. 046483-7495WO1(04120)

[0193] bonds. A protein or peptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids that can comprise a protein’s or peptide's sequence. Polypeptides include any peptide or protein comprising two or more amino acids joined to each other by peptide bonds. As used herein, the term refers to both short chains, which also commonly are referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as proteins, of which there are many types. ‘" Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural peptides, recombinant peptides, synthetic peptides, or a combination thereof.

[0194] The term ‘‘polymer conjugated lipid” refers to a molecule comprising both a lipid portion and a polymer portion. An example of a polymer conjugated lipid is a pegylated lipid. The term “pegylated lipid” refers to a molecule comprising both a lipid portion and a polyethylene glycol portion. Pegylated lipids are known in the art and include

[0195] l-(monomethoxy-polyethyleneglycol)-2,3-dimyristoylglycerol (PEG-s- DMG), DSPE-PEG-DBCO, DOPE-PEG-Azide, DSPE-PEG-Azide, DPPE-PEG-Azide, DSPE-PEG-Carboxy-NHS, DOPE-PEG-Carboxylic Acid, DSPE-PEG-Carboxylic acid and the like.

[0196] By the term “specifically binds,” as used herein with respect to an antibody, is meant an antibody which recognizes a specific antigen, but does not substantially recognize or bind other molecules in a sample. For example, an antibody that specifically binds to an antigen from one species may also bind to that antigen from one or more other species. But, such cross-species reactivity does not itself alter the classification of an antibody as specific. In another example, an antibody that specifically binds to an antigen may also bind to different allelic forms of the antigen. However, such cross reactivity does not itself alter the classification of an antibody as specific. In some instances, the terms “specific binding” or “specifically binding,” can be used in reference to the interaction of an antibody, a protein, or a peptide with a second chemical species, to mean that the interaction is dependent upon the presence of a particular structure (e.g., an antigenic determinant or epitope) on the chemical species; for example, an antibody recognizes and binds to a specific protein structure rather than to proteins generally. If an antibody is specific for epitope “A”, the presence of a molecule containing epitope A (or free, unlabeled A), in a reaction containing labeled “A” and the antibody, will reduce the amount of labeled A bound to the antibody.

[0197] The term “substantially” as used herein refers to a majority of, or mostly, as in at leastAttorney Docket No. 046483-7495WO1(04120)

[0198] about 50%. 60%, 70%, 80%. 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more, or 100%. The term "‘substantially free of’ as used herein can mean having none or having a trivial amount of, such that the amount of material present does not affect the material properties of the composition including the material, such that the composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3, 0.2, 0.1, 0.01, or about 0.001 wt% or less. The term “substantially free of’ can mean having a trivial amount of, such that a composition is about 0 wt% to about 5 wt% of the material, or about 0 wt% to about 1 wt%, or about 5 wt% or less, or less than, equal to, or greater than about 4.5 wt%, 4, 3.5, 3, 2.5, 2, 1.5, 1, 0.9, 0.8, 0.7, 0.6, 0.5, 0.4, 0.3. 0.2, 0.1, 0.01, or about 0.001 wt% or less, or about 0 wt%.

[0199] The term “substituted” as used herein in conjunction with a molecule or an organic group as defined herein refers to the state in which one or more hydrogen atoms contained therein are replaced by one or more non-hydrogen atoms. The term “functional group” or “substituent” as used herein refers to a group that can be or is substituted onto a molecule or onto an organic group. Examples of substituents or functional groups include, but are not limited to, a halogen (e.g., F, Cl, Br, and I); an oxygen atom in groups such as hydroxy groups, alkoxy groups, aryloxy groups, aralkyloxy groups, oxo(carbonyl) groups, carboxyl groups including carboxylic acids, carboxylates, and carboxylate esters; a sulfur atom in groups such as thiol groups, alkyl and aryl sulfide groups, sulfoxide groups, sulfone groups, sulfonyl groups, and sulfonamide groups; a nitrogen atom in groups such as amines, hydroxyamines, nitriles, nitro groups, N-oxides, hydrazides, azides, and enamines; and other heteroatoms in various other groups. Non-limiting examples of substituents that can be bonded to a substituted carbon (or other) atom include F, Cl, Br, I, OR, OC(O)N(R)2, CN, NO, NO2, ONO2, azido, CF3, OCF3, R, O (oxo), S (thiono), C(O), S(O), methylenedioxy, ethylenedioxy, N(R)2, SR, SOR, SO2R, SO2N(R)2, SO3R, C(O)R, C(O)C(O)R, C(O)CH2C(O)R, C(S)R, C(O)OR, OC(O)R, C(O)N(R)2, OC(O)N(R)2, C(S)N(R)2, (CH2)O-2N(R)C(O)R, (CH2)O-2N(R)N(R)2, N(R)N(R)C(O)R, N(R)N(R)C(O)OR, N(R)N(R)CON(R)2, N(R)SO2R, N(R)SO2N(R)2, N(R)C(O)OR, N(R)C(O)R, N(R)C(S)R, N(R)C(O)N(R)2.

[0200] N(R)C(S)N(R)2, N(COR)COR, N(OR)R, C(=NH)N(R)2, C(O)N(OR)R, and C(=NOR)R, wherein R can be hydrogen or a carbon-based moiety; for example, R can be hydrogen, (C₁-C₁₀₀) hydrocarbyl, alkyl, acyl, cycloalkyl, aryl, aralkyl, heterocyclyl, heteroaryl, or heteroarylalkyl; or wherein two R groups bonded to a nitrogen atom or to adjacent nitrogen atoms can together with the nitrogen atom or atoms form a heterocyclyl.Attorney Docket No. 046483-7495WO1(04120)

[0201] A “therapeutic"’ treatment is a treatment administered to a subject who exhibits signs of pathology, for the purpose of diminishing or eliminating those signs.

[0202] The term “therapeutic protein” as used herein refers to a protein or peptide which has a positive or advantageous effect on a condition or disease state of a subject when provided to the subject in a therapeutically effective amount. In one embodiment, a therapeutic protein or peptide has curative or palliative properties and may be administered to ameliorate, relieve, alleviate, reverse, delay onset of or lessen the severity of one or more symptoms of a disease or disorder. A therapeutic protein or peptide may have prophylactic properties and may be used to delay the onset of a disease or to lessen the severity of such disease or pathological condition. The term “therapeutic protein” includes entire proteins or peptides, and can also refer to therapeutically active fragments thereof. It can also include therapeutically active variants of a protein. Exemplary therapeutic proteins include, but are not limited to, an analgesic protein, an anti-inflammatory protein, an anti-proliferative protein, an proapoptotic protein, an anti-angiogenic protein, a cytotoxic protein, a cytostatic protein, a cytokine, a chemokine, a growth factor, a wound healing protein, a pharmaceutical protein, or a pro-drug activating protein. Therapeutic proteins may include growth factors (EGF, TGF-a, TGF-, TNF, HGF, IGF, and IL-1-8, inter alia) cytokines, paratopes, Fabs (fragments, antigen binding), and antibodies.

[0203] The terms “treat,” “treating” and “treatment.” as used herein, means reducing the frequency or severity with which symptoms of a disease or condition are experienced by a subject by virtue of administering an agent or compound to the subject.

[0204] Ionizable Lipid Compounds

[0205] In one aspect, the disclosure provides compounds of formula (I), or a salt, stereoisomer, or isotopologue thereof:

[0206] R1a— A — R1b(i);

[0207] wherein:

[0208] Y '' A is selected from the group consisting of R. 'S"

[0209]

[0210] RcR, and N— (-l_1-)-S

[0211] R1CZ

[0212] each occurrence of L1, if present, is independently selected from the group consisting of -(optionally substituted C1-C12 alkylenyl)-, -(optionally substituted C2-C12 alkenylenyl)-, -Attorney Docket No. 046483-7495WO1(04120)

[0213] (optionally substituted C1-C12 alkynylenyl)-, -(optionally substituted C1-C12 heteroalkylenyl)-, -(optionally substituted C3-C8 cycloalkylenyl)-, -(optionally substituted C2-C8 heterocycloalkylenyl)-, -(optionally substituted C₆-C₁₀ arylenyl)-, -(optionally substituted C2-Cs heteroarylenyl)-, -(optionally substituted C1-C12 alkylenyl)-X-, -(optionally substituted C2-C12 alkenylenyl)-X-, -(optionally substituted C₁-C₁₂ alkynylenyl)-X-. -(optionally substituted C1-C12 heteroalkylenyl)-X-, -(optionally substituted C3-C8 cycloalkylenyl)-X-, -(optionally substituted C2-C8 heterocycloalkylenyl)-X-, -(optionally substituted C₆-C₁₀ arylenyl)-X-, and -(optionally substituted C₂-C₈ heteroarylenyl)-X-;

[0214] each occurrence of X, if present, is independently selected from the group consisting of -N(R1e)-, -[N(CH2)1-3N(R1e)(R1e)]-, -[N(CH₂)₁₋₃(C(=O))N(Rᴬ)(CH₂)₁₋₃N(R¹ᵉ)(R¹ᵉ)]-. - N(RA)-, -O-, and -S-;

[0215] R1a, R1b, R1c, R1d, and each occurrence of R1e, if present, are each independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, and

[0216]

[0217] wherein each of the following apply:

[0218] (i) at least one of R1a, R1b, and R1c, if present, is

[0219]

[0220] s

[0221] (ii) no more than one R1a, R1b, R1c, R1d, or R1ebonded to the same atom is

[0222]

[0223] (iii) one of R1aand R1bcan combine with R2to form an optionally substituted C2-C8 heterocycloalkyl, and

[0224] (iv) one of R1a, R1b, R1c, and R1dcan combine with one occurrence of L1to form an optionally substituted C2-C8 heterocycloalkyl;

[0225] R2is selected from the group consisting of optionally substituted Ci-Ce alky l. optionally substituted C2-C6 alkenyl, optionally substituted Cs-Cs cycloalkyl, optionally substituted C2-C6 heteroalkyl, optionally substituted C3-C6 heteroalkenyl, optionally substituted C2-C8 heterocycloalkyl, and N(RA)(RB);

[0226] each occurrence of R3aand R3bis independently selected from the group consisting of optionally substituted C1-C24 alkyl, optionally substituted C2-C24 alkenyl, optionallyAttorney Docket No. 046483-7495W01(04120)

[0227] substituted C2-C24 alkynyl, optionally substituted C1-C24 heteroalkyl, optionally substituted C2-C24 heteroalkenyl, optionally substituted C2-C24 heteroalkynyl, optionally substituted C₃-C₈ cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C₆-C₁₀ aryl, and optionally substituted C2-C8 heteroaryl;

[0228] each occurrence of R4a, R4b, and R4cis independently selected from the group consisting of H and optionally substituted Ci-Ce alkyl;

[0229] Y is selected from the group consisting of -O- and -S-;

[0230] m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and

[0231] each occurrence of RAand RBis independently selected from the group consisting of H and optionally substituted C1-C6 alkyl.

[0232] In certain embodiments, R2is

[0233]

[0234] . in certain embodiments, R2is

[0235]

[0236] OH. In certain embodiments, R2is I In certain embodiments, R2is

[0237]

[0238] 1

[0239] in certain embodiments, R2is \ In certain embodiments, R2is

[0240]

[0241] In certain embodiments, R2is

[0242]

[0243] In certain embodiments. R2is I — \

[0244]

[0245] . in certain embodiments, R2is

[0246] In certain embodiments, Rlband R2combine with the N atom to which they are bound

[0247] to form

[0248]

[0249] \. In certain embodiments, Rlband R2combine with the N atom to which

[0250] they are bound to form

[0251]

[0252] \. In certain embodiments, Rlband R2combine with the

[0253] N atom to which they are bound to form

[0254]

[0255] \. In certain embodiments, Rlband R2

[0256] ''N^NO

[0257] combine with the N atom to which they are bound to form

[0258]

[0259] \. In certain embodiments, Rlband R2combine with the N atom to which they are bound to form

[0260] " N^V'NCL

[0261]

[0262] \ — '. In certain embodiments, Rlband R2combine with the N atom to which theyAttorney Docket No. 046483-7495WO1(04120)

[0263] are bound to form

[0264]

[0265] \. In certain embodiments, Rlband R2combine with the N 'N

[0266] atom to which they are bound to form

[0267]

[0268] OH. In certain embodiments, R1band R2

[0269] --N - N

[0270] combine with the N atom to which they are bound to form X — ' X. In certain embodiments, Rlband R2combine with the N atom to which they are bound to form

[0271] --N N

[0272]

[0273] X —. In certain embodiments, Rlband R2combine with the N atom to which

[0274] thev are bound to form

[0275]

[0276] . In certain embodiments, Rlband R2combine

[0277]

[0278] _-N N~- wi th the N atom to which they are bound to form X — /

[0279] In certain embodiments, one of Rlaand Rlbis CH3. In certain embodiments, one of Rlaand Rlbis CH2CH3.

[0280] In certain embodiments, L¹ is -(CH₂)₁₋₄-. In certain embodiments, L¹ is -(CH₂)₁₋₃C(=O)N(Rᴬ)-,. In certain embodiments, L1is N(CH3)-. In certain embodiments, L1is - N(Rle)-. In certain embodiments, L¹ is -N[(CH₂)₁₋₃N(R¹ᵉ)(R¹ᵉ)]-. In certain embodiments, L1

[0281] --N N-- is -O-. In certain embodiments, L1is X — / . In certain embodiments, L1is

[0282] H CT N

[0283]

[0284] H

[0285] In certain embodiments, -(L¹)ₘ- is -(CH₂)₂-. In certain embodiments, -(L¹)ₘ- is -(CH₂)₃-. In certain embodiments, -(L¹)ₘ- is -(CH₂)₆-. In certain embodiments, -(L^m- is

[0286]

[0287] N I

[0288]

[0289] In certain embodiments, -(L^m- is Re. In certain embodiments,

[0290] N

[0291] o1e

[0292]

[0293] N N'R-(Ll)m- is. In certain embodiments, -(L^m - is R1eN I

[0294] In certain embodiments, -(L^m- is

[0295]

[0296] '7 In certain embodiments, -Attorney Docket No. 046483-7495W01(04120)

[0297] . In certain embodiments, -(L^m- is

[0298] In certain embodiments, -(L^m- is

[0299]

[0300] R i1a

[0301] In certain embodiments, the compound of formula (I) is

[0302]

[0303] In certain

[0304] R1a

[0305] embodiments, the compound of formula (I) is

[0306]

[0307] In certain embodiments, the R1a

[0308] compound of formula (I) is

[0309]

[0310] HO. in certain embodiments, the compound of formula R i1a

[0311] (I) is HO. in certain embodiments, the compound of formula (I) is

[0312] |1a

[0313]

[0314] R1a. In certain embodiments, the compound of formula (I) is

[0315]

[0316] in

[0317] certain embodiments, the compound of formula (I) is. In certain

[0318] embodiments, the compound of formula (I) is

[0319]

[0320] In certain embodiments, the

[0321]

[0322] compound of formula (I) is R1a. In certain embodiments, the compound of R I1a

[0323] formula (I) is

[0324]

[0325] in certain embodiments, the compound of formula (I) isAttorney Docket No. 046483-7495W01(04120)

[0326]

[0327] In certain embodiments, the compound of formula (I) is

[0328]

[0329]

[0330] certain embodiments, the compound of formula (I) is R1a. In certain embodiments,

[0331] the compound of formula (I) is

[0332]

[0333] In certain embodiments, the compound of

[0334] formula (I) is In certain embodiments, the compound of formula (I) is

[0335]

[0336] In certain embodiments, the compound of formula (I) is

[0337] In certain embodiments, the compound of formula (I) is

[0338]

[0339] — N / \l-R1aembodiments, the compound of formula (I) is \. In certain embodiments, the

[0340] compound of formula (I) is

[0341]

[0342] In certain embodiments, the compound of N^, / — \

[0343]

[0344] - / N N— R1a

[0345] formula (I) is

[0346]

[0347] \. In certain embodiments, the compound of formula (I)

[0348] R1aN

[0349]

[0350] . In certain embodiments, the compound of formula (I) is

[0351]

[0352] 'R1b. in / x,, R1acertain embodiments, the compound of formula (I) is R1b. in certain V-N., R1a

[0353]

[0354] N embodiments, the compound of formula (I) is

[0355]

[0356] R. In certain embodiments, theAttorney Docket No. 046483-7495W01(04120)

[0357] R i1a

[0358]

[0359] compound of formula (I) isN'o R1b. In certain embodiments, the compound of N.. R N1aformula (I) is R1b. In certain embodiments, the compound of formula (I) is N I R i1a1bR. In certain embodiments, the compound of formula (I) is R i1a.hk

[0360]

[0361] 1bR. In certain embodiments, the compound of formula (I) is R i1a

[0362] NN'o R1b. In certain embodiments, the compound of formula (I) is

[0363] R1a

[0364]

[0365]

[0366] R. In certain embodiments, the compound of formula (I) is R1b. In R1a^. OH HO N

[0367] certain embodiments, the compound of formula (I) is R1b. In certain

[0368]

[0369] embodiments, the compound of formula (I) isR a R. In certain embodiments,

[0370] the compound of formula (I) is

[0371]

[0372] In certain embodiments, the | R1aR1b

[0373] . N.1d

[0374] compound of formula (I) is

[0375]

[0376] R. In certain embodiments, the R1b

[0377] . R

[0378]

[0379] HO N1b

[0380] compound of formula (I) isR' 1d. In certain embodiments, the compound R1b

[0381] R,--N^N.Rld

[0382]

[0383] of formula (I) isR' 1c. In certain embodiments, the compound of formula (I) is R I1aR I1b

[0384]

[0385] R

[0386] K1 N x -in

[0387] R. In certain embodiments, the compound of formula (I) isAttorney Docket No. 046483-7495W01(04120)

[0388] R1b

[0389] o1a _ R1c. In certain embodiments, the compound of formula (I) is R?, R N1ivNbi RcR. In certain embodiments, the compound of formula (I) is R1aR i1bN %idR1c. In certain embodiments, the compound of formula (I) is □1aR'N N I R i1bR bk R. In certain embodiments, the compound of formula (I) is R1b

[0390]

[0391] O' R1c. In certain embodiments, the compound of formula (I) is R1aO IXN

[0392] R1c

[0393] R1d. In certain embodiments, the compound of formula R

[0394] I1aR1c(I) is R1e. In certain embodiments, the compound of formula (I) is R

[0395] I1bR1a| / ^N / ^xN'R1dR1C N

[0396]

[0397] R1e. In certain embodiments, the compound of formula

[0398] R1e"N'R1 e(I) is. In certain embodiments, the compound of formula (I) is □ 1a. □ 1b N N'RR1cR1dpie N'R

[0399]

[0400] R1e. In certain embodiments, the compound of formula (I) isAttorney Docket No. 046483-7495W01(04120)

[0401] R1a

[0402]

[0403] R1e. In certain embodiments, the compound of

[0404] formula (

[0405]

[0406] I) is H. in certain embodiments,

[0407] I

[0408] . R

[0409] h c m o n o f r u a I i

[0410]

[0411] 1a

[0412] t e o p u d f o m l ( ) s S. In certain embodiments, the compound of

[0413] formula (I) is In certain embodiments, the compound of formula (I) is

[0414]

[0415] R3aOxy A)0

[0416] In certain embodiments, Rlais

[0417]

[0418] ' OR3b. in certain embodiments, Rlbis R3aO R3aO

[0419]

[0420] OR3b. In certain embodiments, Rlcis

[0421]

[0422] OR3bIn certain R3aO. ~ R3aO^O ~

[0423] O O

[0424] embodiments, Rldis

[0425]

[0426] OR3b. In certain embodiments. Rleis

[0427]

[0428] '' OR3b.

[0429] In certain embodiments, each occurrence of R3ais independently selected from the group consisting of n-butyl, / / -pentyl, / / -hexyl, / / -heptyl, / / -octyl, / / -nonyl, / / -decyl, / / -undecyl, and / / -dodecyl, wherein the / / -butyl, / / -pentyl, / / -hexyl, / / -heptyl, / / -octyl, / / -nonyl, / / -decyl, n-undecyl, and / / -dodec l is optionally substituted with at least one selected from the group consisting of methyl, ethyl, / / -propyl, z-propyl, / / -butyl, z-butyl, / -butyl, / / -pentyl, / / -hexyl, n-heptyl, / / -octyl, / / -nonyl, w-decyl, zi-undecyl, and n-dodecyl. In certain embodiments, each occurrence of R3bis independently selected from the group consisting of / / -butyl, / / -pentyl, n-Attorney Docket No. 046483-7495W01(04120)

[0430] hexyl, n-heptyl, n-octyl, w-nonyl, n-decyl, -undecyl, and -dodecyl, wherein the rz-butyl, n-pentyl, / 7-hexyl. n-heptyl, M-octyl, / 7-nonyl. n-decyl, «-undecyl, and w-dodecyl is optionally substituted with at least one selected from the group consisting of methyl, ethyl, w-propyl. i-propyl, w-butyl, z-butyl, / -butyl. n-pentyl, n-hexyl, w-heptyl, w-octyl, n-nonyl, w-decyl, n-undecyl, and n-dodecyl.

[0431] In certain embodiments, R3ais

[0432]

[0433] In certain embodiments, R3ais

[0434] In certain embodiments, R3ais In certain embodiments,

[0435] R

[0436]

[0437] 3ais ''. In certain embodiments, R3ais. In certain

[0438] embodiments, R3ais

[0439]

[0440] ''. In certain embodiments, R3ais

[0441]

[0442] In certain embodiments, R3ais -

[0443] certain embodiments, R3is

[0444]

[0445] -. In certain embodiments, R3ais

[0446]

[0447] In certain embodiments, R3ais. In certain embodiments,

[0448]

[0449] R?ais

[0450] In certain embodiments, R3bis

[0451]

[0452] In certain embodiments, R3bis

[0453] In certain embodiments, R3bis In certain embodiments,

[0454]

[0455] . In certain embodiments, R3bis. In certain

[0456] embodiments, R3bis

[0457]

[0458] ''. In certain embodiments, R3bis

[0459]

[0460] In certain embodiments, R3bis '

[0461] certain embodiments, R3bis

[0462]

[0463] -. In certain embodiments, R3bis

[0464]

[0465] In certain embodiments, R3bis. In certain embodiments,

[0466]

[0467] R?bisAttorney Docket No. 046483-7495W01(04120)

[0468] In certain embodiments, R

[0469]

[0470] lais0In certain embodiments, Rlais

[0471]

[0472] certain embodiments, R

[0473]

[0474] lais In certain embodiments, R1ais

[0475]

[0476] Attorney Docket No. 046483-7495W01(04120)

[0477]

[0478] In certain embodiments, Rlbis embodiments,

[0479]

[0480] Rlbis O. In certain embodiments, Rlbis

[0481]

[0482] In certain embodiments,

[0483]

[0484] Rlbis In certain embodiments. Rlb

[0485]

[0486] In certain embodiments, RlbisAttorney Docket No. 046483-7495W01(04120)

[0487]

[0488] In certain embodiments, Rlbis

[0489]

[0490] embodiments,

[0491]

[0492] Rlcis O. In certain embodiments, Rlcis

[0493] I

[0494]

[0495] n certain embodiments, Rlcis In certain embodiments, RlcAttorney Docket No. 046483-7495W01(04120)

[0496]

[0497] embodiments,

[0498]

[0499] Rldis O. In certain embodiments, Rldis

[0500]

[0501] Attorney Docket No. 046483-7495W01(04120)

[0502] In certain embodiments,

[0503]

[0504] Rldis In certain embodiments, RldIn certain embodiments, Rldis

[0505]

[0506]

[0507] In certain embodiments, Rleis embodiments,

[0508]

[0509] Rleis O. In certain embodiments, RleisAttorney Docket No. 046483-7495W01(04120)

[0510]

[0511] In certain embodiments,

[0512]

[0513] Rleis In certain embodiments, Rle

[0514] In certain embodiments, Rleis

[0515]

[0516]

[0517] Table 1. Exemplary nucleophiles

[0518] No. Compound No. Compound H

[0519] 1 H2N226

[0520] 2H2N>^^-NH2 27 1

[0521]

[0522] Attorney Docket No. 046483-7495WO1(04120)

[0523] 3H2N-X^^NH228 1 H / ■N^^^N'X H

[0524] 4 29

[0525] H ^N^NH25 1 H 30

[0526] H

[0527] \

[0528] 6 N^\

[0529] 2 / x zL

[0530] 231

[0531] H N NH NH

[0532] 7 ^N^N^N / 32H0^-N^

[0533] H H k^NH8 1

[0534] H2NN N H2 33

[0535] \^NX^-X^NH29 H 1 H 34 H H

[0536] 10 ^x ^x

[0537] 235

[0538] HO NH<^NXX^XNH2HOH

[0539] 11 / ^N^XN / X^OH 36

[0540] H H

[0541] 12 37

[0542] 13H2N-^O^O^NH238 / 1 H V-N^^x^N'x o

[0543] H2Nx^^yuNH1

[0544] 14 39

[0545] HNx^A^^ / N'^ / X'NH2

[0546] 0

[0547] ^ ^

[0548] 15 40

[0549] H / N^N- H

[0550] H2N^^N^^NH2

[0551] 16 41

[0552] k^Mx^x^NH217 42

[0553] ^NH2NH 18 J 43 — N / \ NH

[0554] H

[0555] H2N^X^V|

[0556] 1

[0557] 19 N NH244

[0558] l^. NH

[0559]

[0560] ^X^X'NH2Attorney Docket No. 046483-7495W01(04120)

[0561] H

[0562] H2N^NY°H2N-^NH

[0563] H S A

[0564] 20 45

[0565] 0L^NH

[0566] H

[0567] H

[0568] 21 46 0^

[0569] V NH

[0570] H

[0571] 22 47 / — \

[0572] -Z_ ^NH

[0573] 23HO^NH248 °^X|

[0574] N^SH H 1 24 49

[0575] HCT—N- / N^SH 25HO^^NH250

[0576]

[0577] O^sH

[0578] Table 2. Exemplary but-2-enedioates and selected characterization data No. Compound No. Compound 0

[0579] D4 D9.8

[0580] Cco

[0581] 0

[0582] 0 o |

[0583] D6.2 DILI

[0584] Q

[0585] o

[0586] D8 Dll.10

[0587] Ceooo

[0588] o

[0589]

[0590] Attorney Docket No. 046483-7495W01(04120)

[0591] D8i D12.8

[0592] ( ) o°==

[0593] o o

[0594] o (S'

[0595] D9.2 D18 O O ' —

[0596] o / 5o==

[0597] 0

[0598] Light yellow oil, yield 92%. ¹H NMR (400 MHz, CDCl₃) δ 6.23 (s, 2H), 5.44 – 5.27 (m, 4H), 4.20 – 4.08 (m, 4H), 2.77 (t, J = 6.5 Hz, 2H), 2.10 – 2.00 (m, 4H), 1.70 – 1.58 (m, 1H), 1.43 – 1.24 (m, 26H), 0.89 (td, J = 7.2, 3.8 Hz, 9H).

[0599] Colorless oil, yield 90%. ¹H NMR (400 MHz, CDCl₃) δ 6.30 – 6.18 (m, 2H), 4.13 (ddd, J = 10.7, 5.9, 3.7 Hz, 3H), 1.67 – 1.61 (m, 1H), 1.45 – 1.24 (m, 24H), 0.96 – 0.87 (m, 12H).

[0600] Colorless oil, yield 88%. ¹H NMR (400 MHz, CDCl₃) δ 6.30 – 6.17 (m, 2H), 4.13 (dddd, J = 10.2, 6.1, 4.3, 1.3 Hz, 3H), 1.58 (s, 1H), 1.46 – 1.23 (m, 36H), 0.95 – 0.87 (m, 12H).

[0601] Colorless oil, yield 90%. ’H NMR (400 MHz, CDCh) 56.23 (d, J = 2.6 Hz, 2H), DILI 4.18 - 4.06 (m, 3H), 1.86 - 1.59 (m, 1H), 1.46 - 1.21 (m, 29H N A () oo, 0.91 (td, J = 7.3, 5.3 Hz, 9H).

[0602] Colorless oil, yield 85%. 'H NMR (400 MHz, CDCh) 56.30 - 6.16 (m, 2H), Dll. 10

[0603] 4.18 - 4.08 (m, 3H), 1.65 (s, 1H), 1.49 - 1.22 (m, 44H), 0.97 - 0.86 (m, 12H). Colorless oil, yield 85%. ‘H NMR (400 MHz, CDCh) 56.25 (s, 2 —H), 4.20 \ - 4.06 D12.8 (m, 4H), 1.72 - 1.62 (m, 2H), 1.47 - 1.24 (m, 40H), 0.91 (td, J = 7.2, 4.9 Hz,

[0604]

[0605] 12H).

[0606] In certain embodiments, the compound is selected from the group consisting of 1D4, 1D6.2, 1D8, 1D81, 1D9.2, 1D9.8, 1D11.1, 1D11.10, 1D12.8, 1D18, 2D4, 2D6.2, 2D8, 2D81, 2D9.2, 2D9.8, 2D11.1, 2D11.10, 2D12.8, 2D18, 3D4, 3D6.2, 3D8, 3D8i, 3D9.2, 3D9.8, 3D11.1, 3D11.10, 3D12.8, 3D18, 4D4, 4D6.2, 4D8, 4D8i, 4D9.2, 4D9.8, 4D11.1, 4D11.10, 4D12.8, 4D18, 5D4, 5D6.2, 5D8, 5D8i, 5D9.2, 5D9.8, 5D11.1, 5D11.1O, 5D12.8, 5D18, 6D4. 6D6.2, 6D8, 6D81, 6D9.2, 6D9.8, 6D11.1. 6D11.10. 6D12.8, 6D18. 7D4. 7D6.2, 7D8, 7D8i, 7D9.2, 7D9.8, 7D11.1, 7D11.10, 7D12.8, 7D18, 8D4, 8D6.2, 8D8, 8D8i, 8D9.2, 8D9.8, 8D11.1, 8D11.1O, 8D12.8, 8D18, 9D4, 9D6.2, 9D8, 9D8i, 9D9.2, 9D9.8, 9D11.1, 9D11.10. 9D12.8, 9D18, 10D4, 10D6.2, 10D8, 10D81, 10D9.2, 10D9.8, 10D11.1, 10D11.10, 10D12.8. 1OD18, 11D4, 11D6.2, 11D8, 11D8i, 11D9.2. 11D9.8, 11D11.1, 11D11.10, 11D12.8, 11D18, 12D4, 12D6.2, 12D8, 12D81, 12D9.2, 12D9.8, 12D11.1, 12D11.10,Attorney Docket No. 046483-7495WO1(04120)

[0607] 12D12.8, 12D18, 13D4, 13D6.2, 13D8, 13D81, 13D9.2, 13D9.8, 13D11.1, 13D11.10, 13D12.8. 13D18, 14D4, 14D6.2, 14D8, 14D8i, 14D9.2. 14D9.8, 14D11.1, 14D11.10, 14D12.8, 14D18, 15D4, 15D6.2, 15D8, 15D81, 15D9.2, 15D9.8, 15D11.1, 15D11.10, 15D12.8, 15D18, 16D4, 16D6.2, 16D8, 16D81, 16D9.2, 16D9.8, 16D11.1, 16D11.10, 16D12.8, 16D18, 17D4, 17D6.2, 17D8, 17D81, 17D9.2, 17D9.8, 17D11.1, 17D11.10, 17D12.8. 17D18, 18D4, 18D6.2, 18D8, I8D81, 18D9.2. 18D9.8, 18D11.1, 18D11.10, 18D12.8. 18D18, 19D4, 19D6.2, 19D8, 19D81, 19D9.2. 19D9.8, 19D11.1, 19D11.10, 19D12.8, 19D18, 20D4, 20D6.2, 20D8, 20D81, 20D9.2, 20D9.8, 20D11.1, 20D11.10, 20D12.8, 20D18, 21D4, 21D6.2, 21D8, 21D81, 21D9.2, 21D9.8, 21D11.1, 21D11.10, 21D12.8, 21D18, 22D4, 22D6.2, 22D8, 22D81, 22D9.2, 22D9.8, 22D11.1, 22D11.10, 22D12.8. 22D18, 23D4, 23D6.2, 23D8, 23D8i, 23D9.2. 23D9.8, 23D11.1, 23D11.10, 23D12.8, 23D18, 24D4, 24D6.2, 24D8, 24D81, 24D9.2, 24D9.8, 24D11.1, 24D11.10, 24D12.8, 24D18, 25D4, 25D6.2, 25D8, 25D81, 25D9.2, 25D9.8, 25D11.1, 25D11.10, 25D12.8, 25D18, 26D4, 26D6.2, 26D8, 26D81, 26D9.2, 26D9.8, 26D11.1, 26D11.10, 26D12.8. 26D18, 27D4, 27D6.2, 27D8, 27D8i, 27D9.2. 27D9.8, 27D11.1, 27D11.10, 27D12.8, 27D18, 28D4, 28D6.2, 28D8, 28D81, 28D9.2. 28D9.8, 28D11.1, 28D11.10, 28D12.8, 28D18, 29D4, 29D6.2, 29D8, 29D81, 29D9.2, 29D9.8, 29D11.1, 29D11.10, 29D12.8, 29D18, 30D4, 30D6.2, 30D8, 30D81, 30D9.2, 30D9.8, 30D11.1, 30D11.10, 30D12.8. 30D18, 31D4, 31D6.2, 31D8, 31D81, 31D9.2. 31D9.8, 31D11.1, 31D11.10, 31D12.8. 31D18, 32D4, 32D6.2, 32D8, 32D8i, 32D9.2. 32D9.8, 32D11.1, 32D11.10, 32D12.8, 32D18, 33D4, 33D6.2, 33D8, 33D81, 33D9.2, 33D9.8, 33D11.1, 33D11.10, 33D12.8, 33D18, 34D4, 34D6.2, 34D8, 34D81, 34D9.2, 34D9.8, 34D11.1, 34D11.10, 34D12.8, 34D18, 35D4, 35D6.2, 35D8, 35D81, 35D9.2, 35D9.8, 35D11.1, 35D11.10, 35D12.8. 35D18, 36D4, 36D6.2, 36D8, 36D8i, 36D9.2. 36D9.8, 36D11.1, 36D11.10, 36D12.8, 36D18, 37D4, 37D6.2, 37D8, 37D81, 37D9.2, 37D9.8, 37D11.1, 37D11.10, 37D12.8, 37D18, 38D4, 38D6.2, 38D8, 38D81, 38D9.2, 38D9.8, 38D11.1, 38D11.10, 38D12.8, 38D18, 39D4, 39D6.2, 39D8, 39D81, 39D9.2, 39D9.8, 39D11.1, 39D11.10, 39D12.8. 39D18, 40D4, 40D6.2, 40D8, 40D81, 40D9.2. 40D9.8, 40D11.1, 40D11.10, 40D12.8, 40D18, 41D4, 41D6.2, 41D8, 41 D8i, 41 D9.2. 41 D9.8, 41 D 11.1, 41 D 11.10, 41D12.8, 41D18, 42D4, 42D6.2, 42D8, 42D81, 42D9.2, 42D9.8, 42D11.1, 42D11.10, 42D12.8, 42D18, 43D4, 43D6.2, 43D8, 43D81, 43D9.2, 43D9.8, 43D11.1, 43D11.10, 43D12.8, 43D18, 44D4, 44D6.2, 44D8, 44D81, 44D9.2, 44D9.8, 44D11.1, 44D11.10, 44D12.8. 44D18, 45D4, 45D6.2, 45D8, 45D8i, 45D9.2. 45D9.8, 45D11.1, 45D11.10, 45D12.8, 45D18. 46D4, 46D6.2. 46D8, 46D81, 46D9.2, 46D9.8. 46D11.1, 46D11.10.Attorney Docket No. 046483-7495WO1(04120)

[0608] 46D12.8, 46D18, 47D4, 47D6.2, 47D8, 47D81, 47D9.2, 47D9.8, 47D11.1, 47D11.10, 47D12.8. 47D18, 48D4, 48D6.2, 48D8, 48D8i, 48D9.2. 48D9.8, 48D11.1, 48D11.10, 48D12.8, 48D18, 49D4, 49D6.2, 49D8, 49D81, 49D9.2, 49D9.8, 49D11.1, 49D11.10, 49D12.8, 49D18, 50D4, 50D6.2, 50D8, 50D81, 50D9.2, 50D9.8, 50D11.1, 50D11.10, 50D12.8, and 50D18.

[0609] The nomenclature for ionizable lipid compounds described herein is based on the specific reactants involved in their synthesis. These lipids are synthesized by reacting an amine or thiol nucleophile (i.e., compounds 1-50) with an a, P-unsaturated diester compound (i.e., compounds D4, D6.2, D8, D8i, D9.2, D9.8, DILI, D11.10, D12.8, and D18) The resulting ionizable lipids are named by combining the identifier of the nucleophile with that of the diester. For example, if nucleophile 1 is reacted with diester D4, the resulting ionizable lipid is named 1D4. Similarly, if nucleophile 2 is reacted with diester D8, the lipid is named 2D8. The skilled artisan is familiar with Michael addition reactions and which positions are functionalized by reactions between the indicated amine / thiol and a, -unsaturated diester.

[0610] Lipid nanoparticles (LNPs) formulated with these ionizable lipids are named according to the specific ionizable lipid used in their preparation, and additional components, according to the ratios described herein. For example, LNP 1D4 is formulated using the ionizable lipid 1D4, and LNP 2D8 is formulated using the ionizable lipid 2D8. This systematic nomenclature provides a straightforward way to identify both the lipid components and their corresponding LNP formulations.

[0611] In certain embodiments, the compound of formula (I) is:

[0612]

[0613] dioctyl (3-((1,4-bis(octyloxy)-1,4-dioxobutan-2-yl)(3- (dimethylamino)propyl)amino)propyl)aspartate (5D8).

[0614] In certain embodiments, the compound of formula (I) is:Attorney Docket No. 046483-7495WO1(04120)

[0615]

[0616] tetrakis(2-ethy lhexyl) 2,2'-((piperazine- 1,4-diylbis(propane-3, 1 - diyl))bis(azanediyl))disuccinate,

[0617] (12D6.2)

[0618] Ionizable Lipids and / or Cationic Lipids

[0619] The scope of ionizable lipids contemplated for use in the present disclosure is not limited to ionizable lipids of Formula (I). In the lipid nanoparticles of the disclosure, the cationic lipid or ionizable lipid may comprise, e.g, one or more of the following:

[0620] (6Z,9Z,28Z,31Z)-heptatriaconta-6,9,28,31-tetraen-19-yl 4-(dimethylamino)butanoate (DLinMC3DMA), [(4-hydroxybutyl)azanediyl]di(hexane-6,1-diyl) bis(2-hexyldecanoate) (ALC-0315), heptadecan-9-yl 8-{(2-hydroxyethyl)[6-oxo-6-(undecyloxy)hexyl] amino} octanoate (SM-102). 1, 1 '-[[2-[4-[2-[[2-[bis(2-hy droxy dodecyl)amino]ethyl](2-hy droxy dodecyl)amino]ethyl]-l-piperazinyl]ethyl]imino]bis-2-dodecanol (Cl 2-200), l,2-dilinoleyloxy-N, N-dimethylaminopropane (DLinDMA), 1,2-dilinolenyloxy-N, N-dimethylaminopropane (DLenDMA), 2,2-dilinoleyl-4-(2-dimethylaminoethyl)-[l,3]-dioxolane (DLin-K-C2-DMA; “XTC2”), 2,2-dilinoleyl-4-(3-dimethylaminopropyl)-[1,3]-dioxolane (DLin-K-C3-DMA), 2,2-dilinoleyl-4-(4-dimethylaminobutyl)-[l,3]-dioxolane (DLin-K-C4-DMA), 2,2-dilinoleyl-5-dimethylaminomethyl-[l,3]-dioxane (DLin-K6-DMA), 2,2-dilinoleyl-4-N-methylpepiazino-[l,3]-dioxolane (DLin-K-MPZ), 2,2-dili-noleyl-4-dimethylaminomethyl-[1,3] -di oxolane (DLin-KDMA), 1,2-dilinoleylcarbamoyloxy-3-dimethylaminopropane (DLin-C-DAP), 1,2-dilinoleyoxy-3-(dimethylaminoacetoxypropane (DLin-DAC), 1,2-dilinoleyoxy-3-morpholinopropane (DLin-MA), 1,2-dilinoleoyl-3-dimethylaminopropane (DLinDAP), l,2-dilinoleylthio-3-dimethylaminopropane (DLin-2-DMAP), 1,2-dilinoleyloxy-3 -trimethylaminopropane chloride salt (DLin-TMA. Cl), l,2-dilinoleoyl-3-trimethylaminopropane chloride salt (DLin-TAP. Cl), l,2-dilinoleyloxy-3-(N-Attorney Docket No. 046483-7495WO1(04120)

[0621] methylpiperazino)propane (D Lin-MPZ), 3-(N, N-dilinoleylamino)-l,2-propanediol (D LinAP), 3-(N, N-dioleylamino)-l,2-propanedio (DOAP), l,2-dilinoleyloxo-3-(2-N. N-dimethylamino)ethoxy propane (D Lin-EG-D MA), N,N-dioleyl-N,N-dimethylammonium chloride (DODAC), l,2-dioleyloxy-N, N-dimethylaminopropane (DODMA), 1,2-distearyloxy-N, N-dimethylaminopropane (DSD MA), N-(l-(2,3-dioleyloxy)propyl)-N, N, N-trimethylammonium chloride (DOTMA), N, N-distearyl-N, N-dimethylammonium bromide (DDAB), N-(l-(2,3-dioleoyloxy)propyl)-N, N, N-trimethylammonium chloride (DOTAP), 3-(N-(N’, N’dimethylaminoethane)-carbamoyl)cholesterol (DC-Chol), N-(1,2-dimyristyloxyprop-3-yl)-N,N-dimethyl-N-hydroxyethyl ammonium bromide (DMRIE), 2,3-dioleyloxy-N-[2 (spermine-carboxamidoethyl]-N, N-dimethy 1-1-propanaminiumtrifluoroacetate (DOSPA). dioctadecylamidoglycyl spermine (DOGS), 3-dimethylamino-2-(cholest-5-en-3-beta-oxybutan-4-oxy)-l-(cis,cis-9,12-octadecadienoxy)propane (CLinDMA), 2-[5’-(cholest-5-en-3-beta-oxy)-3’-oxapentoxy)-3-dimethyl-l-(cis,cis-9’,l-2’-octadecadienoxy) propane (CpLinDMA), N, N-dimethyl-3,4-dioleyloxy benzylamine (DMOBA), l,2-N, N’dioleylcarbamyl-3-dimethylaminopropane (DOcarbDAP), l,2-N, N’-dilinoleylcarbamyl-3-dimethylaminopropane (DLincarbDAP), or mixtures thereof. In certain embodiments, the cationic lipid is DLinDMA, DLin-K-C2-DMA (“XTC2’ ), or mixtures thereof. The ionizable lipids are not limited to those recited herein, and can further include ionizable lipids known to those skilled in the art, or described in PCT Application No. PCT / US2020 / 056255 and / or PCT Application No. PCT / US2020 / 056252. the disclosures of which are herein incorporated by reference in its entirety.

[0622] The synthesis of cationic lipids such as DLin-K-C2-DMA (“XTC2”), DLin-K-C3-DMA, DLin-K-C4-DMA, DLin-K6-DMA, and DLin-K-MPZ, as well as additional cationic lipids, is described in U. S. Application Publication No. US 2011 / 0256175, the disclosure of which is herein incorporated by reference in its entirety for all purposes. The synthesis of cationic lipids such as DLin-K-DMA, DLin-CDAP, DLin-DAC, DLin-MA, DLinDAP, DLin-S-DMA, DLin-2-DMAP, DLin-TMA.Cl, DLin-TAP.Cl, DLin-MPZ, DLinAP, DOAP, and DLin-EG-DMA. as well as additional cationic lipids, is described in PCT Application No. PCT / US08 / 88676, filed December 31, 2008, the disclosure of which is herein incorporated by reference in its entirety for all purposes. The synthesis of cationic lipids such as CLinDMA, as well as additional cationic lipids, is described in U. S. Patent Publication No. US20060240554, the disclosure of which is herein incorporated by reference in its entirety for all purposes.Attorney Docket No. 046483-7495WO1(04120)

[0623] Non-Cationic Lipid

[0624] In the nucleic acid-lipid particles of the present disclosure, the non-cationic lipid may comprise, e.g., one or more anionic lipids and / or neutral lipids. In some embodiments, the non-cationic lipid comprises one of the following neutral lipid components: (1) cholesterol or a derivative thereof (2) a phospholipid; or (3) a mixture of a phospholipid and cholesterol or a derivative thereof.

[0625] Examples of cholesterol derivatives include, but are not limited to, cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2’ -hydroxy ethyl ether, cholesteryl-4'-hydroxybutyl ether, and mixtures thereof. The synthesis of cholesteryl-2’ -hydroxy ethyl ether is known to one skilled in the art and described in U. S. Patent Nos. 8,058,069, 8,492,359, 8,822,668, 9.364,435, 9,504.651, and 11,141,378. all of which are hereby incorporated herein in their entireties for all purposes.

[0626] Non-limiting examples of non-cationic lipids include phospholipids such as lecithin, phosphatidylethanolamine, lysolecithin, lysophosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, sphingomyelin, egg sphingomyelin (ESM), cephalin, cardiolipin, phosphatidic acid, cerebrosides, dicetylphosphate, distearoylphosphatidylcholine (DSPC), dioleoylphosphatidylcholine (DOPC), dipalmitoylphosphatidylcholine (DPPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), dioleoylphosphatidylethanolamine (DOPE), palmitoy loleoy lphosphatidylcholine (POPC), palmitoyloleoylphosphatidylethanolamine (POPE), palmitoyloleyolphosphatidylglycerol (POPG), dioleoylphosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-1-carboxylate (DOPE-mal), dipalmitoylphosphatidylethanolamine (DPPE), dimyristoylphosphatidylethanolamine (DMPE), distearoylphosphatidylethanolamine (DSPE), monomethylphosphatidylethanolamine, dimethylphosphatidylethanolamine, dielaidoylphosphatidylethanolamine (DEPE), stearoyloleoylphosphatidylethanolamine (SOPE), lysophosphatidylcholine, dilinoleoylphosphatidylcholine, and mixtures thereof.

[0627] Other diacylphosphatidylcholine and diacylphosphatidy lethanolamine phospholipids can also be used. The acyl groups in these lipids can be. for example, acyl groups derived from fatty acids having C10-C24 carbon chains, e.g, lauroyl, myristoyl, palmitoyl, stearoyl, or oleoyl. Additional examples of non-cationic lipids include sterols such as cholesterol and derivatives thereof such as cholestanol, cholestanone, cholestenone, coprostanol, cholesteryl-2 ’-hydroxy ethyl ether, cholesteryl-4’-hydroxybutyl ether, and mixtures thereof. In certain embodiments, the phospholipid is DPPC, DSPC, or mixtures thereof.Attorney Docket No. 046483-7495WO1(04120)

[0628] Conjugated Lipid

[0629] In the nucleic acid-lipid particles of the present disclosure, the conjugated lipid that inhibits aggregation of particles may comprise, e.g., one or more of the following: a polyethyleneglycol (PEG) lipid conjugate, a polyamide (ATTA)-lipid conjugate, a cationic-polymer-lipid conjugates (CPLs), or mixtures thereof. In some embodiments, the nucleic acid-lipid particles comprise either a PEG-lipid conjugate or an ATTA-lipid conjugate.

[0630] PEG is a linear, water-soluble polymer of ethylene PEG repeating units with two terminal hydroxyl groups. PEGs are classified by their molecular weights; for example, PEG 2000 has an average molecular weight of about 2,000 daltons, and PEG 5000 has an average molecular weight of about 5.000 daltons. PEGs are commercially available from Sigma Chemical Co. and other companies and include, for example, the following: monomethoxypolyethylene glycol (MePEGOH), monomethoxypolyethylene glycolsuccinate (MePEGS), monomethoxypolyethylene glycolsuccinimidyl succinate (MePEG-S-NHS), monomethoxypolyethylene glycolamine (MePEG-NH₂), monomethoxypolyethylene glycoltresylate (MePEG-TRES). and monomethoxypolyethylene glycolimidazolylcarbonyl (MePEG-IM). Other PEGs such as those described in U. S. Patent Nos. 6,774,180 and 7,053,150 (e.g., mPEG (20 KDa) amine) are also useful for preparing the PEG-lipid conjugates of the present disclosure. The disclosures of these patents are herein incorporated by reference in their entirety for all purposes. In addition, monomethoxypolyethyleneglycolacetic acid (MePEG-CH₂COOH) is particularly useful for preparing PEG-lipid conjugates including, e.g, PEG-DAA conjugates.

[0631] In certain embodiments, the PEG-lipid conjugate or ATTA-lipid conjugate is used together with a CPL. The conjugated lipid that inhibits aggregation of particles may comprise a PEG-lipid including, e.g, a PEG-diacylglycerol (DAG), a PEG dialkyloxypropyl (DAA), a PEG-phospholipid, a PEG-ceramide (Cer), or mixtures thereof. The PEGDAA conjugate may be PEG-dilauryloxypropyl (C12), a PEG-dimyristyloxypropyl (C14), a PEG-dipalmitoyloxypropyl (C₁₆), a PEG-distearyloxypropyl (C₁₈), or mixtures thereof.

[0632] Additional PEG-lipid conjugates suitable for use in the disclosure include, but are not limited to, mPEG2000-l,2-diO-alkyl-sn3-carbomoylglyceride (PEG-C-DOMG). The synthesis of PEG-C-DOMG is described in PCT Application No. PCT / US08 / 88676, filed December 31, 2008, the disclosure of which is herein incorporated by reference in its entirety for all purposes. Yet additional PEG-lipid conjugates suitable for use in the disclosure include, without limitation, l-[8’-(l,2-dimyristoyl-3-propanoxy)-carboxamido-3’.6’-dioxaoctanyl] carbamoyl-methyl-poly(ethylene glycol) (2 KPEG-DMG). The synthesis of 2Attorney Docket No. 046483-7495WO1(04120)

[0633] KPEG-DMG is described in U. S. Patent No. 7,404,969, the disclosure of which is herein incorporated by reference in its entirety for all purposes.

[0634] The PEG moiety of the PEG-lipid conjugates described herein may comprise an average molecular weight ranging from about 550 daltons to about 10,000 daltons. In certain instances, the PEG moiety has an average molecular weight of from about 750 daltons to about 5,000 daltons (e.g., from about 1,000 daltons to about 5,000 daltons, from about 1.500 daltons to about 3,000 daltons, from about 750 daltons to about 3,000 daltons, from about 750 daltons to about 2,000 daltons, etc.). In some embodiments, the PEG moiety has an average molecular weight of about 2,000 daltons or about 750 daltons.

[0635] In addition to the foregoing, it will be readily apparent to those of skill in the art that other hydrophilic polymers can be used in place of PEG. Examples of suitable polymers that can be used in place of PEG include, but are not limited to, polyvinylpyrrolidone, polymethyloxazoline, polyethyloxazoline, polyhydroxypropyl methacrylamide, polymethacrylamide and polydimethylacrylamide, polylactic acid, poly glycolic acid, and derivatized celluloses such as hydroxymethylcellulose or hydroxyethylcellulose.

[0636] In addition to the foregoing components, the particles (e.g., LNP) of the present disclosure can further comprise cationic poly(ethylene glycol) (PEG) lipids or CPLs (e.g., Chen et al., Bioconj. Chem., 11:433-437 (2000)). Suitable SPLPs and SPLP-CPLs for use in the present disclosure, and methods of making and using SPLPs and SPLP-CPLs, are disclosed, e.g.. in U. S. Patent No. 6.852,334 and PCT Publication No. WO 00 / 62813, the disclosures of which are herein incorporated by reference in their entirety for all purposes.

[0637] In certain instances, the conjugated lipid that inhibits aggregation of particles (e.g., PEG-lipid conjugate) may comprise from about 0.1 mol% to about 2 mol%, from about 0.5 mol% to about 2 mol%, from about 1 mol% to about 2 mol%, from about 0.6 mol% to about 1.9 mol%, from about 0.7 mol% to about 1.8 mol%, from about 0.8 mol% to about 1.7 mol%, from about 1 mol% to about 1.8 mol%, from about 1.2 mol% to about 1.8 mol%, from about 1.2 mol% to about 1.7 mol%, from about 1.3 mol% to about 1.6 mol%, from about 1.4 mol% to about 1.5 mol%. or about 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8. 1.9, or 2 mol% (or any fraction thereof or range therein) of the total lipid present in the particle.

[0638] In the lipid nanoparticles of the present disclosure, the active agent or therapeutic agent may be fully encapsulated within the lipid portion of the particle, thereby protecting the active agent or therapeutic agent from enzymatic degradation. In some embodiments, a nucleic acid-lipid particle comprising a nucleic acid such as a messenger RNA (i.e., mRNA) is fully encapsulated within the lipid portion of the particle, thereby protecting the nucleicAttorney Docket No. 046483-7495WO1(04120)

[0639] acid from nuclease degradation. In certain instances, the nucleic acid in the nucleic acid-lipid particle is not substantially degraded after exposure of the particle to a nuclease at 37° C. for at least about 20, 30, 45, or 60 minutes. In certain other instances, the nucleic acid in the nucleic acid-lipid particle is not substantially degraded after incubation of the particle in serum at 37° C. for at least about 30, 45, or 60 minutes or at least about 2, 3, 4, 5, 6, 7, 8, 9, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34. or 36 hours. In other embodiments, the active agent or therapeutic agent (e.g., nucleic acid such as siRNA) is complexed with the lipid portion of the particle. One of the benefits of the formulations of the present disclosure is that the lipid particle compositions are substantially non-toxic to mammals such as humans.

[0640] Lipid Nanoparticles (LNPs)

[0641] In another aspect, the disclosure provides a lipid nanoparticle (LNP) composition. In certain embodiments, the LNP comprises at least one ionizable lipid, wherein the at least one ionizable lipid comprises at least one compound of formula (I). In certain embodiments, the LNP comprises at least one neutral lipid. In certain embodiments, the LNP comprises at least one cholesterol lipid and / or a modified derivative thereof. In certain embodiments, the LNP comprises at least one polymer-conjugated lipid and / or a modified derivative thereof.

[0642] In certain embodiments, the at least one ionizable lipid compound comprises less than about 10. 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25. 26, 27, 28, 29, 30, 31, 32, 33. 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45. 46. 47. 48. 49. 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 mol% of the LNP. In certain embodiments, the at least one ionizable lipid compound comprises about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35. 36. 37. 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 mol% of the LNP. In certain embodiments, the at least one ionizable lipid compound comprises greater than about 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22. 23.24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35. 36. 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47. 48. 49. 50. 51. 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, or 90 mol% of the LNP.

[0643] In certain embodiments, the at least one ionizable lipid compound comprises less than about 40 mol% of the LNP. In certain embodiments, the at least one ionizable lipid compound comprises about 40 mol% of the LNP. In certain embodiments, the at least oneAttorney Docket No. 046483-7495WO1(04120)

[0644] ionizable lipid compound comprises greater than about 40 mol% of the LNP.

[0645] In certain embodiments, the at least one ionizable lipid compound comprises less than about 48.3 mol% of the LNP. In certain embodiments, the at least one ionizable lipid compound comprises about 48.3 mol% of the LNP. In certain embodiments, the at least one ionizable lipid compound comprises greater than about 48.3 mol% of the LNP.

[0646] In certain embodiments, the at least one neutral lipid comprises less than about 1. 2, 3, 4, 5, 6. 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18. 19. 20. 21. 22. 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or about 40 mol% of the LNP. In certain embodiments, the at least one neutral lipid comprises about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30. 31, 32, 33, 34, 35, 36, 37, 38, 39, or about 40 mol% of the LNP. In certain embodiments, the at least one neutral lipid comprises greater than about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or about 40 mol% of the LNP.

[0647] In certain embodiments, the at least one neutral lipid comprises less than about 10 mol% of the LNP. In certain embodiments, the at least one neutral lipid comprises about 10 mol% of the LNP. In certain embodiments, the at least one neutral lipid comprises greater than about 10 mol% of the LNP.

[0648] In certain embodiments, the at least one neutral lipid comprises less than about 8.9 mol% of the LNP. In certain embodiments, the at least one neutral lipid comprises about 8.9 mol% of the LNP. In certain embodiments, the at least one neutral lipid comprises greater than about 8.9 mol% of the LNP.

[0649] In certain embodiments, the neutral lipid comprises or consists essentially of at least one neutral lipid selected from the group consisting of ddioleoylphosphatidylethanolamine (DOPE), distearoylphosphatidylcholine (DSPC), 1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), and dioleoylphosphatidylcholine (DOPC). In certain embodiments, the neutral lipid comprises or consists essentially of ddioleoylphosphatidylethanolamine (DOPE) or 1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC).

[0650] In certain embodiments, the at least one cholesterol lipid and / or modified derivative thereof comprises less than about 20, 21, 22, 23, 24. 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or about 75 mol% of the LNP. In certain embodiments, the at least one cholesterol lipid and / or modified derivative thereof comprises about 20. 21. 22. 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35. 36. 37. 38. 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67,Attorney Docket No. 046483-7495WO1(04120)

[0651] 68, 69, 70, 71, 72, 73, 74, or about 75 mol% of the LNP. In certain embodiments, the at least one cholesterol lipid and / or modified derivative thereof comprises greater than about 20. 21.

[0652] 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, or about 75 mol% of the LNP.

[0653] In certain embodiments, the at least one cholesterol lipid and / or modified derivative thereof comprises less than about 40.9 mol% of the LNP. In certain embodiments, the at least one cholesterol lipid and / or modified derivative thereof comprises about 40.9 mol% of the LNP. In certain embodiments, the at least one cholesterol lipid and / or modified derivative thereof comprises greater than about 40.9 mol% of the LNP.

[0654] In certain embodiments, the at least one cholesterol lipid and / or modified derivative thereof comprises less than about 48.5 mol% of the LNP. In certain embodiments, the at least one cholesterol lipid and / or modified derivative thereof comprises about 48.5 mol% of the LNP. In certain embodiments, the at least one cholesterol lipid and / or modified derivative thereof comprises greater than about 48.5 mol% of the LNP.

[0655] In certain embodiments, the at least one cholesterol lipid and / or modified derivative thereof comprises or consists essentially of cholesterol.

[0656] In certain embodiments, the at least one polymer-conjugated lipid comprises less than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4. 2.5, 2.6, 2.7, 2.8. 2.9, 3.0, 3.1, 3.2. 3.3, 3.4, 3.5, 3.6. 3.7, 3.8, 3.9. 4.0. 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7. 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.9, 10.0, 10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9, 11.0, 11.1, 11.2, 11.3. 11.4. 11.5, 11.6, 11.7, 11.8, 11.9, 12.0, 12.1, 12.2, 12.3, 12.4, 12.5, 12.6, 12.7, 12.8, 12.9, 13.0, 13.1, 13.2, 13.3, 13.4, 13.5, 13.6, 13.7, 13.8, 13.9, 14.0, 14.1, 14.2, 14.3, 14.4, 14.5, 14.6, 14.7, 14.8, 14.9, or about 15 mol% of the LNP. In certain embodiments, the at least one polymer-conjugated lipid comprises about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2. 1.3, 1.4, 1.5, 1.6. 1.7, 1.8, 1.9, 2.0. 2.1, 2.2, 2.3, 2.4, 2.5. 2.6, 2.7, 2.8, 2.9. 3.0, 3.1, 3.2, 3.3. 3.4, 3.5, 3.6. 3.7. 3.8, 3.9, 4.0. 4.1. 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7. 6.8, 6.9, 7.0, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8.0, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9.0, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.9, 10.0, 10.1, 10.2, 10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9, 11.0, 11.1, 11.2, 11.3. 11.4. 11.5, 11.6, 11.7, 11.8, 11.9, 12.0, 12.1, 12.2, 12.3, 12.4, 12.5, 12.6, 12.7, 12.8, 12.9, 13.0, 13.1, 13.2, 13.3, 13.4, 13.5, 13.6,Attorney Docket No. 046483-7495WO1(04120)

[0657] 13.7, 13.8, 13.9, 14.0, 14.1, 14.2, 14.3, 14.4, 14.5, 14.6, 14.7, 14.8, 14.9, or about 15 mol% of the LNP. In certain embodiments, the at least one polymer-conjugated lipid comprises greater than about 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1.0, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2.0, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3.0, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4.0, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5.0, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7. 6.8, 6.9, 7.0, 7.1, 7.2, 7.3. 7.4, 7.5, 7.6, 7.7. 7.8, 7.9, 8.0, 8.1. 8.2, 8.3, 8.4, 8.5, 8.6. 8.7, 8.8, 8.9, 9.0. 9.1, 9.2, 9.3, 9.4. 9.5, 9.6, 9.7. 9.9. 10.0. 10.1. 10.2, 10.3, 10.4, 10.5, 10.6, 10.7, 10.8, 10.9, 11.0, 11.1, 11.2, 11.3, 11.4, 11.5, 11.6, 11.7, 11.8, 11.9, 12.0, 12.1, 12.2, 12.3, 12.4, 12.5, 12.6, 12.7, 12.8, 12.9, 13.0, 13.1, 13.2, 13.3, 13.4, 13.5, 13.6, 13.7, 13.8, 13.9, 14.0, 14.1, 14.2, 14.3, 14.4. 14.5, 14.6, 14.7, 14.8, 14.9, or about 15 mol% of the LNP.

[0658] In certain embodiments, the at least one polymer-conjugated lipid comprises less than about 1.5 mol%. In certain embodiments, the at least one polymer-conjugated lipid comprises about 1.5 mol%. In certain embodiments, the at least one polymer-conjugated lipid comprises greater than about 1.5 mol%.

[0659] In certain embodiments, the at least one polymer-conjugated lipid comprises less than about 1.9 mol%. In certain embodiments, the at least one polymer-conjugated lipid comprises about 1.9 mol%. In certain embodiments, the at least one polymer-conjugated lipid comprises greater than about 1.9 mol%.

[0660] In certain embodiments, the at least one polymer-conjugated lipid comprises or consists essentially of 1,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol-2000 (DMG-PEG 2000). In certain embodiments, the at least one polymer-conjugated lipid comprises or consists essentially of 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (C14-PEG 2000)

[0661] In certain embodiments, the LNP has a molar ratio of (a): (b): (c): (d) of about 40:10:48.5:1.5.

[0662] In certain embodiments, the LNP is LNP B7. In certain embodiments, the LNP B7 has a molar ratio of (a): (b): (c): (d) of about 65:12:55:2.5.

[0663] In certain embodiments, the LNP further comprises at least one cargo selected from the group consisting of a nucleic acid molecule and a therapeutic agent. In certain embodiments, the therapeutic agent is at least one selected from the group consisting of a small molecule, a protein, and an antibody.

[0664] In certain embodiments, the LNP comprises a nucleic acid molecule. In certain embodiments, the nucleic acid molecule is a DNA molecule or an RNA molecule. In certainAttorney Docket No. 046483-7495WO1(04120)

[0665] embodiments, the nucleic acid molecule is selected from the group consisting of cDNA, circRNA, mRNA, miRNA, siRNA, modified RNA. antagomir, antisense molecule, and a targeted nucleic acid, or any combination thereof. In certain embodiments, the nucleic acid molecule encodes a chimeric antigen receptor (CAR). In certain embodiments, the CAR is specific for binding to a surface antigen of a pathogenic cell. In certain embodiments, the nucleic acid molecule encodes at least one selected from the group consisting of mRNA and sgRNA, optionally wherein the ionizable lipid and mRNA have a weight ratio of about 20: 1, 19:1, 18:1, 17:1, 16:1, 15:1, 14:1, 13:1, 12:1, 11:1, 10:1, 9:1, 8: 1, 7:1, 6:1, 5:1, 4:1, 3:1, 2:1, or about 1: 1. In certain embodiments, the mRNA encodes a therapeutic protein, optionally wherein the therapeutic protein is a CRISPR-associated protein, and optionally wherein the CRISPR-associated protein is CRISPR-associated protein 9 (Cas9). In certain embodiments, the therapeutic agent is a CRISPR-associated protein, optionally wherein the CRISPR-associated protein is CRISPR-associated protein 9 (Cas9).

[0666] In certain embodiments, the nucleic acid comprises circRNA. In certain embodiments, the circRNA encodes a therapeutic protein. In certain embodiments, the therapeutic protein comprises an antigen. In certain embodiments, the circRNA encodes a SARS-CoV glycoprotein. In certain embodiments the SARS-CoV glycoprotein is a SARS-CoV-2 glycoprotein. In certain embodiments the SARS-CoV glycoprotein is SARS-CoV-2

[0667] B.1.6.17.2 (Delta) S glycoprotein.

[0668] In certain embodiments, the total lipid components of the LNP and circRNA have a weight ratio of about 30: 1 to about 10:1. In certain embodiments, the total lipid components of the LNP and circRNA have a weight ratio of about 20: 1.

[0669] Methods

[0670] Therapeutic Methods

[0671] In another aspect, the disclosure provides a method of treating, ameliorating, and / or preventing at least one disease, disorder, or condition in a subject in need thereof. In certain embodiments, the method comprises administering a therapeutically effectively amount of at least one LNP of the disclosure or the pharmaceutical composition of the disclosure.

[0672] In certain embodiments, the disease, disorder, or condition is selected from the group consisting of cancer, immune-mediated diseases, cardiovascular disease, a viral infection, a bacterial infection, and a metabolic disease.

[0673] In certain embodiments, the viral infection comprises SARS-CoV-2.

[0674] In another aspect, the disclosure provides a method of genome editing a mutated geneAttorney Docket No. 046483-7495WO1(04120)

[0675] sequence associated with a disease or disorder in a subject. In certain embodiments, the method comprises administering a therapeutically effectively amount of at least one LNP of the disclosure or the pharmaceutical composition of the disclosure.

[0676] In another aspect, the disclosure provides a method for delivering a therapeutic cargo to an immune cell of a subject. In certain embodiments, the method comprises administering a therapeutically effectively amount of at least one LNP of the disclosure or the pharmaceutical composition of the disclosure. In certain embodiments, the LNP comprises LNP B7.

[0677] In certain embodiments, the immune cell comprises a T cell.

[0678] In certain embodiments, the nucleic acid cargo comprises a mRNA encoding a base editor and a single guide RNA (sgRNA).

[0679] In certain embodiments, the sgRNA is targeted to a DNA sequence of the mutated gene sequence associated with the disease or disorder in the subject.

[0680] In certain embodiments, the nucleic acid comprises circRNA. In certain embodiments, the circRNA encodes a therapeutic protein. In certain embodiments, the therapeutic protein comprises an antigen. In certain embodiments, the circRNA encodes a SARS-CoV glycoprotein. In certain embodiments the SARS-CoV glycoprotein is a SARS-CoV-2 glycoprotein. In certain embodiments the SARS-CoV glycoprotein is SARS-CoV-2

[0681] B.1.6.17.2 (Delta) S glycoprotein.

[0682] In certain embodiments, the total lipid components of the LNP and circRNA have a weight ratio of about 30: 1 to about 10:1. In certain embodiments, the total lipid components of the LNP and circRNA have a weight ratio of about 20: 1.

[0683] In certain embodiments, the subject is a mammal.

[0684] In certain embodiments, the subject is a human.

[0685] Synthesis

[0686] In another aspect, the disclosure provides a method for preparing a compound of formula (I), or a salt, stereoisomer, or isotopologue thereof:

[0687] R1a— A — R1b(i),

[0688] the method comprising:

[0689] contacting a compound of formula (A): R5aB R5b(A), andAttorney Docket No. 046483-7495WO1(04120)

[0690] R4aO

[0691] a compound of formula (

[0692]

[0693] B): O R4b

[0694] wherein:

[0695] A is selected from the group consisting of

[0696]

[0697] R6, S' R1cR1d, and (-L1^-S

[0698] RZ

[0699]

[0700] ic /

[0701] each occurrence of L1, if present, is independently selected from the group consisting of -(optionally substituted C1-C12 alkylenyl)-, -(optionally substituted C2-C12 alkenylenyl)-, -(optionally substituted C1-C12 alkynylenyl)-, -(optionally substituted C1-C12 heteroalkylenyl)-, -(optionally substituted C3-C8 cycloalkylenyl)-, -(optionally substituted C2-C8 heterocycloalkylenyl)-, -(optionally substituted C₆-C₁₀ arylenyl)-, -(optionally substituted C2-Cs heteroarylenyl)-, -(optionally substituted C1-C12 alkylenyl)-X-, -(optionally substituted C2-C12 alkenylenyl)-X-, -(optionally substituted C1-C12 alkynylenyl)-X-, -(optionally substituted C1-C12 heteroalkylenyl)-X-, -(optionally substituted C3-C8 cycloalkylenyl)-X-. -(optionally- substituted C2-C8 heterocyloalkylenyl)-X-, -(optionally substituted C₆-C₁₀ arylenyl)-X-. and -(optionally substituted C2-C8 heteroarylenyl)-X-;

[0702] each occurrence of X, if present, is independently selected from the group consisting of -N(Rle)-, -[N(CH2)1-3N(R1e)(R1e)]-, -[N(CH2)i-3(C(=O))N(RA)(CH2)i-3N(Rle)(Rle)]-, - N(RA)-, -O-, and -S-;

[0703] Rla. Rlb, Rlc, Rld, and each occurrence of R16, if present, are each independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, and

[0704]

[0705] , wherein each of the following apply:

[0706] (i) at least one of Rla, Rlb, and Rlc, if present,

[0707]

[0708] is

[0709] (11) no more than one Rla, Rlb, Rlc, Rld, or Rlebonded to the same atom isAttorney Docket No. 046483-7495WO1(04120)

[0710]

[0711] (iii) one of R1aand R1bcan combine with R2to form an optionally substituted C2-C8 heterocycloalkyl, and

[0712] (iv) one of R1a, R1b, R1c, and R1dcan combine with one occurrence of L1to form an optionally substituted C2-C8 heterocycloalkyl;

[0713] each occurrence of R3aand R3bis independently selected from the group consisting of optionally substituted C1-C24 alkyl, optionally substituted C2-C24 alkenyl, optionally substituted C2-C24 alkynyl, optionally substituted C1-C24 heteroalkyl, optionally substituted C2-C24 heteroalkenyl, optionally substituted C2-C24 heteroalkynyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C6-C10 aryl, and optionally substituted C2-C8 heteroaryl;

[0714] each occurrence of R4a, R4b, and R4cis independently selected from the group consisting of H and optionally substituted Ci-Ce alkyl;

[0715] Y is selected from the group consisting of -O- and -S-;

[0716] m is 1, 2, 3. 4, 5, 6. 7, 8, 9, or 10;

[0717] Y

[0718] B is selected from the group consisting of R2, S',

[0719]

[0720] R5cR5d, and; N-eL2>-s

[0721] R

[0722]

[0723] 5C M z

[0724] each occurrence of L2, if present, is independently selected from the group consisting of -(optionally substituted C1-C12 alkylenyl)-, -(optionally substituted C2-C12 alkenylenyl)-, -(optionally substituted C1-C12 alkynylenyl)-, -(optionally substituted C1-C12 heteroalkylenyl)-, -(optionally substituted C3-C8 cycloalkylenyl)-. -(optionally substituted C2-C8 heterocycloalkylenyl)-, -(optionally substituted C₆-C₁₀ arylenyl)-, -(optionally substituted C2-Cs heteroarylenyl)-, -(optionally substituted C1-C12 alkylenyl)-Z-. -(optionally substituted C2-C12 alkenylenyl)-Z-, -(optionally substituted C1-C12 alkynylenyl)-Z-, -(optionally substituted C1-C12 heteroalkylenyl)-Z-, -(optionally substituted C3-C8 cycloalkylenyl)-Z-, -(optionally substituted C2-C8 heterocycloalkylenyl)-Z-, -(optionally substituted C₆-C₁₀ arylenyl)-Z-, and -(optionally substituted C2-C8 heteroarylenyl)-Z-;

[0725] each occurrence of Z, if present, is independently selected from the group consisting of -N(R5e)-, -[N(CH2)1-3N(R5e)(R5e)]-, -[N(CH2)1-3(C(=O))N(RA)(CH2)1-3N(R5e)(R5e)]-, -Attorney Docket No. 046483-7495WO1(04120)

[0726] N(RA)-, -O-, and -S-;

[0727] R5a. R5b, R5C, R5d, and each occurrence of R5e, if present, are each independently selected from the group consisting of H and optionally substituted Ci-Ce alkyl, wherein at least one of R5a, R5b, and R5c, if present, is H,

[0728] one of R5aand R5bcan combine with R6to form an optionally substituted C2-C8 heterocycloalkyl, and

[0729] one of R5a, R5b, R5c, and R5dcan combine with one occurrence of L2to form an optionally substituted C2-C8 heterocycloalkyl;

[0730] R6is selected from the group consisting of optionally substituted Ci-Ce alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C3-C8 cycloalky 1, optionally- substituted C2-C6 heteroalkyl, optionally substituted C3-C6 heteroalkenyl, optionally substituted C2-C8 heterocycloalkyl, andN(RA)(RB);

[0731] Z is selected from the group consisting of -O- and -S-;

[0732] n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and

[0733] each occurrence of RAand RBis independently selected from the group consisting of H and optionally substituted C1-C6 alkyl.

[0734] In certain embodiments, the contacting occurs at a temperature of about 85 °C. In certain embodiments, the contacting occurs for a period of about 24-48 hours.

[0735] In certain embodiments, R6is '' ^OH. in certain embodiments. R6is

[0736]

[0737] N

[0738] OH in certain embodiments, R6is I. In certain embodiments, R6is N

[0739] In certain embodiments, R6is

[0740]

[0741] . In certain embodiments, R6is N \

[0742]

[0743] In certain embodiments, R6is

[0744]

[0745] . In certain embodiments, R6is IN

[0746]

[0747] ^N"' / . In certain embodiments, R6is ' N. J

[0748] In certain embodiments, R5ais H and R5band R6combine with the N atom to which

[0749] N\

[0750] thev are bound to form

[0751]

[0752] . In certain embodiments, R5ais H and R5band R6

[0753] combine with the N atom to which they are bound to form \

[0754]

[0755] . In certain embodiments, R5ais H and R5band R6combine with the N atom to which they are bound toAttorney Docket No. 046483-7495W01(04120)

[0756] I

[0757] form

[0758]

[0759] \. In certain embodiments, R5ais H and R5band R6combine with the N

[0760] " Ny-N

[0761] atom to which they are bound to form \. In certain embodiments, R5ais H and

[0762] " Ny-'N

[0763] R5band R6combine with the N atom to which they are bound to form N — <. In certain embodiments, R5ais H and R5band R6combine with the N atom to which they are

[0764] "Ny-NCL

[0765] bound to form

[0766]

[0767] \. In certain embodiments, R5ais H and R5band R6combine

[0768] with the N atom to which they are bound to form

[0769]

[0770] OH jncertain embodiments, R5ais H and R5band R6combine with the N atom to which they are bound to form

[0771] -N^> NZ

[0772]

[0773] \ \. In certain embodiments, R5ais H and R5hand R6combine with the N atom to - -N / l /

[0774] which they are bound to form

[0775]

[0776] \ \. In certain embodiments, R5ais H and R5hand / — \ / —d

[0777]

[0778] --N N— 'x— R6combine with the N atom to which they are bound to form \. In certain embodiments, R5ais H and R5band R6combine with the N atom to which they are 'Inbound to form

[0779]

[0780] /

[0781] In certain embodiments, one of R5aand R5bis CH3. In certain embodiments, one of R5aand R5bis CH2CH3.

[0782] In certain embodiments, L2is -(CH2)1-4-. In certain embodiments, L2is -(CH2)1-3C(=O)N(RA)-. In certain embodiments, L2is -N(CH3)-. In certain embodiments, L2is -N(R5e)-. In certain embodiments, L2is -N[(CH2)1-3N(R5e)(R5e)]-. In certain embodiments, L2

[0783] -- \l-- is -O-. In certain embodiments, L2is \. In certain embodiments, L2is

[0784]

[0785] H

[0786] In certain embodiments, -(L2)n- is -(CH2)2-. In certain embodiments, -(L2)n- is -Attorney Docket No. 046483-7495W01(04120)

[0787] (CH2)3-. In certain embodiments, -(L2)n- is -(CH₂)₆-. In certain embodiments, -(L2)n- is

[0788]

[0789] N

[0790]

[0791] In certain embodiments, -(L2)n- is R5e. In certain embodiments,

[0792] N

[0793] o5e

[0794]

[0795] N N -(L2)n- is. In certain embodiments, -(L2)n- is R5e. In N I

[0796] certain embodiments, -(L2)n- is

[0797]

[0798] ''. In certain embodiments, -(L2)n- is

[0799] O

[0800]

[0801] . In certain embodiments, -(L2)n- is c H

[0802] R5?

[0803] N

[0804] R5e

[0805] H O N O H

[0806] R5e

[0807] I

[0808] O' / \^N'R5e

[0809] In certain embodiments, -(

[0810]

[0811] L2)n- is H

[0812] H

[0813] In certain embodiments, the compound of formula (A) is

[0814]

[0815] In certain

[0816] H

[0817] embodiments, the compound of formula (A) is

[0818]

[0819] In certain embodiments, the H

[0820] compound of formula (A) is

[0821]

[0822] HO. in certain embodiments, the compound of formula H

[0823] N.

[0824] (A) is HO’. In certain embodiments, the compound of formula (A) is

[0825]

[0826] N— N- I H

[0827] H. In certain embodiments, the compound of formula (A) is /

[0828]

[0829] N

[0830] certain embodiments, the compound of formula (A) isH. In certain

[0831] H

[0832] embodiments, the compound of formula (A) is

[0833]

[0834] In certain embodiments,

[0835]

[0836] N

[0837] the compound of formula (A) is H. In certain embodiments, the compound ofAttorney Docket No. 046483-7495W01(04120)

[0838] / "" I H

[0839] formula (A) is

[0840]

[0841] In certain embodiments, the compound of formula (A) is

[0842]

[0843] NH. in certain embodiments, the compound of formula (A)

[0844]

[0845] is NH incertain

[0846] x'N" O

[0847] embodiments, the compound of formula (A) is NH. In certain embodiments, the

[0848] compound of formula (A) is

[0849]

[0850] In certain embodiments, the compound of

[0851] formula (A) is

[0852]

[0853] In certain embodiments, the compound of formula (A) is

[0854]

[0855] In certain embodiments, the compound of formula (A) is

[0856]

[0857] certain embodiments, the compound of formula (A) is

[0858]

[0859] embodiments, the compound of formula (A) is. In certain embodiments, theH°—

[0860] L KIU

[0861] compound of formula (A) is

[0862]

[0863] . In certain embodiments, the compound of / — \

[0864]

[0865] -ZN NH

[0866] formula (A) is

[0867]

[0868] \. In certain embodiments, the compound of formula (A) is

[0869]

[0870] — NH in certain embodiments, the compound of formula (A) is HO

[0871]

[0872] . In certain embodiments, the compound of formula (A) is

[0873]

[0874] NH2. in certain

[0875] embodiments, the compound of formula (A) is

[0876]

[0877] NH2. In certain embodiments, the

[0878] compound of formula (A) is

[0879]

[0880] in certain embodiments, the compound ofAttorney Docket No. 046483-7495W01(04120)

[0881] formula (A) is

[0882]

[0883] NH2. In certain embodiments, the compound of formula (A) is

[0884] NH2. In certain embodiments, the compound of formula (A) is

[0885] N NH

[0886] 2. In certain embodiments, the compound of formula (A) is

[0887]

[0888] N2. In certain embodiments, the compound of formula (A)

[0889]

[0890] isNH2

[0891] H

[0892]

[0893] In certain embodiments, the compound of formula (A) isHIn certain

[0894] H HO—N—N— OH embodiments, the compound of formula (A) is H. In certain

[0895] N—N— N"'

[0896] embodiments, the compound of formula (A) isH H. In certain

[0897] H H

[0898] embodiments, the compound of formula (A) is N NN^. In certain

[0899] H

[0900] e

[0901]

[0902] mbodiments, the compound of formula (A) is N NNH2. in certain

[0903] H

[0904] embodiments, the compound of formula (A) is

[0905]

[0906] HO NH2in certain embodiments, the compound of formula (A) is HM2 NN^\ / NH2. in certain embodiments, the compound of formula (A) isH2N^ / ~\^NH2 In certain embodiments, the compound of NH2

[0907] formula (A) is

[0908]

[0909] H2N. In certain embodiments, the compound of formula

[0910] (A) is H2N NH2jn cer(amembodiments, the compound of formula (A) is H2N NNH2. In certain embodiments, the compound of formula (A) is H2N N NH2. In certain embodiments, the compound of formula (A) is ^NH2

[0911]

[0912] H2Nu. In certain embodiments, the compound of formula (A) isAttorney Docket No. 046483-7495W01(04120)

[0913] o

[0914] O. In certain embodiments, the compound of formula (A) H2N^^N^^NH2is H. In certain embodiments, the compound of formula (A) is

[0915]

[0916] H,0 O, R3ao^ / y— 0R3bIn certain embodiments, the compound of formula (B) is

[0917]

[0918] \= / . In

[0919] R3aOy^J<OR»

[0920]

[0921] certain embodiments, the compound of formula (B) is O

[0922] In certain embodiments, each occurrence of R3ais independently selected from the group consisting of / / -butyl, / / -pentyl, / / -hexyl, / / -heptyl, / / -octyl, / / -nonyl, / / -decyl, / / -undecyl, and / / -dodecyl, wherein the / / -butyl, / / -pentyl, n-hexyl, / / -heptyl, / / -octyl, / / -nonyl, / / -decyl, n-undecyl, and / / -dodec l is optionally substituted with at least one selected from the group consisting of methyl, ethyl, / / -propyl, z-propyl, / / -butyl, z-butyl, / -butyl, / / -pentyl, / / -hexyl, n-heptyl, / / -octyl, / / -nonyl, / / -decyl, / / -undecyl, and / / -dodecyl. In certain embodiments, each occurrence of R3bis independently selected from the group consisting of / / -butyl, / z-pcnt l. n-hexyl, / / -heptyl, / / -octyl, / / -nonyl, / / -decyl, / / -undecyl, and / / -dodecyl, wherein the / / -butyl, n-pentyl, / / -hexyl, / / -heptyl, / / -octyl, / / -nonyl, / / -decyl, / / -undecyl, and / / -dodecyl is optionally substituted with at least one selected from the group consisting of methyl, ethyl, / / -propyl, z-propyl, / / -butyl, z-butyl, / -butyl, / / -pentyl, / / -hexyl, / / -heptyl, / / -octyl, / / -nonyl, / / -decyl, n-undecyl, and / / -dodecyl.

[0923] In certain embodiments, R3ais

[0924]

[0925] In certain embodiments, R3ais

[0926] . In certain embodiments, R3ais certain embodiments,

[0927] R

[0928]

[0929] 3ais In certain embodiments, R3aiscer(ain

[0930] embodiments, R'ais

[0931]

[0932] . In certain embodiments, R3aisAttorney Docket No. 046483-7495W01(04120)

[0933]

[0934] In certain embodiments, R3ais. In

[0935] certain embodiments, R?ais

[0936]

[0937] In certain embodiments, R3ais

[0938]

[0939] . In certain embodiments, R3ais. In certain embodiments,

[0940]

[0941] R3ais

[0942] In certain embodiments, R3bis

[0943]

[0944] In certain embodiments, R?bis

[0945] In certain embodiments, R3bis

[0946]

[0947] . In certain embodiments,

[0948] R

[0949]

[0950] 3bis In certain embodiments, R3bis

[0951]

[0952] . In certain

[0953] embodiments, R3bis

[0954]

[0955] In certain embodiments, R3bis

[0956]

[0957] In certain embodiments, R3bis. In

[0958] certain embodiments, R?b

[0959]

[0960] In certain embodiments, R3bis

[0961]

[0962] In certain embodiments, R3bis. In certain embodiments,

[0963]

[0964] R3bis

[0965] In certain embodiments, the compound of formula (

[0966]

[0967] B) is O. in certain

[0968] embodiments, the compound of formula (

[0969]

[0970] B) is

[0971] O

[0972] embodiments, the compound of formula (

[0973]

[0974] B) is °. In certainAttorney Docket No. 046483-7495W01(04120)

[0975] embodiments, the compound of formula (B) is embodiments, the compound of formula (B) is

[0976]

[0977] embodiments, the compound of formula (B) is

[0978]

[0979] embodiments, the compound of formula (B) is embodiments, the compound of formula (

[0980]

[0981] B) is

[0982] certain embodiments, the compound of formula (

[0983]

[0984] B) isAttorney Docket No. 046483-7495WO1(04120)

[0985] LNP Cargo

[0986] Anti-Cancer Agents

[0987] In one embodiment, the at least one additional agent is an anti-cancer agent. Any suitable anti-cancer agent may be used in the compositions and methods of the present disclosure. The selection of a suitable anti-cancer agent may depend upon, among other things, the type of cancer to be treated and the nanoparticle compositions of the present disclosure. In certain embodiments, the anti-cancer agent may be effective for treating one or more of pancreatic cancer, esophageal cancer, rectal cancer, colon cancer, prostate cancer, kidney cancer, liver cancer, breast cancer, ovarian cancer, and stomach cancer. Examples of anti-cancer agents include, but are not limited to, chemotherapeutic agents, antiproliferative agents, anti-tumor agents, checkpoint inhibitors, and anti-angiogenic agents. For example, in one embodiment, the anti-cancer agent is gemcitabine, doxorubicin, 5-Fu, tyrosine kinase inhibitors, sorafenib, trametinib, rapamycin, fulvestrant, ezalutamide, or paclitaxel.

[0988] Chemotherapeutic agents include cytotoxic agents (e.g. 5-fluorouracil, cisplatin, carboplatin, methotrexate, daunorubicin, doxorubicin, vincristine, vinblastine, oxorubicin, carmustine (BCNU), lomustine (CCNU), cytarabine USP, cyclophosphamide, estramucine phosphate sodium, altretamine, hydroxyurea, ifosfamide, procarbazine, mitomycin, busulfan, cyclophosphamide, mitoxantrone, carboplatin, cisplatin, interferon alfa-2a recombinant, paclitaxel, teniposide, and streptozoci), cytotoxic alkylating agents (e.g., busulfan, chlorambucil, cyclophosphamide, melphalan, or ethylesulfonic acid), alkylating agents (e.g, asaley, AZQ, BCNU, busulfan, bisulphan, carboxyphthalatoplatinum, CBDCA, CCNU, CHIP, chlorambucil, chlorozotocin, cis-platinum, clomesone, cyanomorpholinodoxorubicin, cyclodisone, cyclophosphamide, dianhydrogalactitol, fluorodopan, hepsulfam, hy canthone, iphosphamide, melphalan, methyl CCNU, mitomycin C, mitozolamide, nitrogen mustard, PCNU, piperazine, piperazinedione, pipobroman, porfiromycin, spirohydantoin mustard, streptozotocin, teroxirone, tetraplatin, thiotepa, triethy lenemelamine, uracil nitrogen mustard, and Yoshi-864), antimitotic agents (e.g. allocolchicine, Halichondrin M, colchicine, colchicine derivatives, dolastatin 10, maytansine, rhizoxin, paclitaxel derivatives, paclitaxel, thiocolchicine, trityl cysteine, vinblastine sulfate, and vincristine sulfate), plant alkaloids (e.g., actinomycin D, bleomycin, L-asparaginase, idarubicin, vinblastine sulfate, vincristine sulfate, mitramycin, mitomycin, daunorubicin, VP- 16-213, VM-26. navelbine and taxotere), biologicals (e.g, alpha interferon, BCG. G-CSF, GM-CSF, and interleukin-2), topoisomerase I inhibitors (e.g., camptothecin, camptothecin derivatives, and morpholinodoxorubicin),Attorney Docket No. 046483-7495WO1(04120)

[0989] topoisomerase II inhibitors (e.g, mitoxantron, amonafide, m-AMSA, anthrapyrazole derivatives, pyrazoloacridine, bisantrene HCL, daunorubicin, deoxydoxorubicin, menogaril, N, N-dibenzyl daunomycin, oxanthrazole, rubidazone, VM-26 and VP- 16), and synthetics (e.g., hydroxyurea, procarbazine, o,p’-DDD, dacarbazine, CCNU, BCNU, cis-diamminedichloroplatimun, mitoxantrone, CBDCA, levamisole, hexamethylmelamine, all-trans retinoic acid, gliadel and porfimer sodium).

[0990] Antiproliferative agents are compounds that decrease the proliferation of cells.

[0991] Antiproliferative agents include alkylating agents, antimetabolites, enzymes, biological response modifiers, miscellaneous agents, hormones and antagonists, androgen inhibitors (e.g., flutamide and leuprolide acetate), antiestrogens (e.g., tamoxifen citrate and analogs thereof, toremifene, droloxifene and roloxifene), Additional examples of specific antiproliferative agents include, but are not limited to levamisole, gallium nitrate, granisetron, sargramostim strontium-89 chloride, filgrastim, pilocarpine, dexrazoxane, and ondansetron.

[0992] The inhibitors of the invention can be administered alone or in combination with other anti-tumor agents, including cytotoxic / antineoplastic agents and anti-angiogenic agents. Cytotoxic / anti-neoplastic agents are defined as agents which attack and kill cancer cells. Some cytotoxic / anti-neoplastic agents are alkylating agents, which alkylate the genetic material in tumor cells, e.g., cis-platin, cyclophosphamide, nitrogen mustard, trimethylene thiophosphoramide, carmustine, busulfan, chlorambucil, belustine, uracil mustard, chlomaphazin, and dacabazine. Other cytotoxic / anti-neoplastic agents are antimetabolites for tumor cells, e.g., cytosine arabinoside, fluorouracil, methotrexate, mercaptopuirine, azathioprime, and procarbazine. Other cytotoxic / anti-neoplastic agents are antibiotics, e.g., doxorubicin, bleomycin, dactinomycin, daunorubicin, mithramycin, mitomycin, mytomycin C, and daunomycin. There are numerous liposomal formulations commercially available for these compounds. Still other cytotoxic / anti-neoplastic agents are mitotic inhibitors (vinca alkaloids). These include vincristine, vinblastine and etoposide. Miscellaneous cytotoxic / anti-neoplastic agents include taxol and its derivatives, L-asparaginase, anti-tumor antibodies, dacarbazine, azacytidine, amsacrine, melphalan, VM-26, ifosfamide, mitoxantrone, and vindesine.

[0993] Anti-angiogenic agents are well known to those of skill in the art. Suitable anti-angiogenic agents for use in the methods and compositions of the present disclosure include anti-VEGF antibodies, including humanized and chimeric antibodies, anti-VEGF aptamers and antisense oligonucleotides. Other known inhibitors of angiogenesis include angiostatin, endostatin, interferons, interleukin 1 (including alpha and beta) interleukin 12, retinoic acid,Attorney Docket No. 046483-7495WO1(04120)

[0994] and tissue inhibitors of metalloproteinase- 1 and -2. (TIMP-1 and -2). Small molecules, including topoisomerases such as razoxane, a topoisomerase II inhibitor with anti-angiogenic activity, can also be used.

[0995] Other anti-cancer agents that can be used in combination with the disclosed compounds include, but are not limited to: aci vicin; aclarubicin; acodazole hydrochloride; acronine; adozelesin; aldesleukin; altretamine; ambomycin; ametantrone acetate; aminoglutethimide; amsacrine; anastrozole; anthramycin; asparaginase; asperlim azacitidine; azetepa; azotomycin; batimastat; benzodepa; bicalutamide; bisantrene hydrochloride; bisnafide dimesylate; bizelesin; bleomycin sulfate; brequinar sodium; bropirimine; busulfan; cactinomycin; cal us terone: caracemide; carbetimer; carboplatin; carmustine; carubicin hydrochloride; carzelesin; cedefingol; chlorambucil; cirolemycin; cisplatin; cladribine; crisnatol mesylate; cyclophosphamide; cytarabine; dacarbazine; dactinomycin; daunorubicin hydrochloride; decitabine; dexormaplatin; dezaguanine; dezaguanine mesylate; diaziquone; docetaxel; doxorubicin; doxorubicin hydrochloride; droloxifene; droloxifene citrate; dromostanolone propionate; duazomycin; edatrexate; eflomithine hydrochloride; elsamitrucin; enloplatin; enpromate; epipropidine; epirubicin hydrochloride; erbulozole; esorubicin hydrochloride; estramustine; estramustine phosphate sodium; etanidazole; etoposide; etoposide phosphate; etoprine; fadrozole hydrochloride; fazarabine; fenretinide; floxuridine; fludarabine phosphate; fluorouracil; fluorocitabine; fosquidone; fostriecin sodium; gemcitabine; gemcitabine hydrochloride; hydroxyurea; idarubicin hydrochloride; ifosfamide; ilmofosine; interleukin II (including recombinant interleukin II, or rIL2), interferon alfa-2a; interferon alfa-2b; interferon alfa-nl; interferon alfa-n3; interferon beta-I a; interferon gamma-I b; iproplatin; irinotecan hydrochloride; lanreotide acetate; letrozole; leuprolide acetate; liarozole hydrochloride; lometrexol sodium; lomustine; losoxantrone hydrochloride; masoprocol; maytansine; mechlorethamine hydrochloride; megestrol acetate; melengestrol acetate; melphalan; menogaril; mercaptopurine; methotrexate; methotrexate sodium; metoprine; meturedepa; mitindomide; mitocarcin; mitocromin; mitogillin; mitomalcin; mitomycin; mitosper; mitotane; mitoxantrone hydrochloride; mycophenolic acid; nocodazole; nogalamycin; ormaplatin; oxisuran; paclitaxel; pegaspargase; peliomycin; pentamustine; peplomycin sulfate; perfosfamide; pipobroman; piposulfan; piroxantrone hydrochloride; plicamycin; plomestane; porfimer sodium; porfiromycin; prednimustine; procarbazine hydrochloride; puromycin: puromycin hydrochloride; pyrazofurin; riboprine; rogletimide; safingol; safmgol hydrochloride; semustine; simtrazene; sparfosate sodium; sparsomycin; spirogermanium hydrochloride; spiromustine; spiroplatin; streptonigrin;Attorney Docket No. 046483-7495WO1(04120)

[0996] streptozocin; sulofenur; talisomycin; tecogalan sodium; tegafur; teloxantrone hydrochloride; temoporfin; teniposide; teroxirone; testolactone; thiamiprine; thioguanine; thiotepa; tiazofurin; tirapazamine; toremifene citrate; trestolone acetate: triciribine phosphate; trimetrexate; trimetrexate glucuronate; triptorelin; tubulozole hydrochloride; uracil mustard; uredepa; vapreotide; verteporfin; vinblastine sulfate; vincristine sulfate; vindesine; vindesine sulfate: vinepidine sulfate; vinglycinate sulfate; vinleurosine sulfate; vinorelbine tartrate: vinrosidine sulfate; vinzolidine sulfate; vorozole; zeniplatin; zinostatin: zorubicin hydrochloride. Other anti-cancer drugs include, but are not limited to: 20-epi-l,25 dihydroxy vitamin D3; 5-ethynyluracil; abiraterone; aclarubicin; acylfulvene; adecypenol; adozelesin; aldesleukin; ALL-TK antagonists; altretamine; ambamustine: amidox; amifostine: aminolevulinic acid: amrubicin; amsacrine; anagrelide; anastrozole; andrographolide; angiogenesis inhibitors; antagonist D; antagonist G; antarelix; anti-dorsalizing morphogenetic protein- 1; antiandrogen, prostatic carcinoma; antiestrogen; antineoplaston; antisense oligonucleotides; aphidicolin glycinate; apoptosis gene modulators; apoptosis regulators; apurinic acid; ara-CDP-DL-PTBA; arginine deaminase: asulacrine: atamestane; atrimustine; axinastatin 1; axinastatin 2; axinastatin 3; azasetron; azatoxin; azatyrosine; baccatin III derivatives; balanol; batimastat; BCR / ABL antagonists; benzochlorins; benzoylstaurosporine; beta lactam derivatives; beta-alethine; betaclamycin B; betulinic acid; bFGF inhibitor; bicalutamide; bisantrene; bisaziridinylspermine; bisnafide; bistratene A: bizelesin; breflate; bropirimine; budotitane; buthionine sulfoximine; calcipotriol; calphostin C; camptothecin derivatives: canarypox TL-2; capecitabine; carboxamide-amino-triazole; carboxyamidotriazole; CaRest M3; CARN 700; cartilage derived inhibitor; carzelesin; casein kinase inhibitors (ICOS); castanospermine; cecropin B; cetrorelix; chlorins; chloroquinoxaline sulfonamide; cicaprost; cis-porphyrin; cladribine: clomifene analogues; clotrimazole; collismycin A; collismycin B; combretastatin A4; combretastatin analogue; conagenin; crambescidin 816; crisnatol; cryptophycin 8; cryptophycin A derivatives; curacin A; cyclopentanthraquinones; cycloplatam; cypemycin; cytarabine ocfosfate; cytolytic factor; cytostatin; dacliximab; decitabine; dehydrodidemnin B; deslorehn; dexamethasone; dexifosfamide; dexrazoxane; dexverapamil; diaziquone; didemnin B; didox: diethylnorspermine; dihydro-5-azacytidine; dihydrotaxol, 9-; dioxamycin; diphenyl spiromustine; docetaxel; docosanol; dolasetron; doxifluridine; droloxifene; dronabinol; duocarmycin SA; ebselen; ecomustine; edelfosine; edrecolomab; eflomithine; elemene; emitefur; epirubicin; epristeride; estramustine analogue: estrogen agonists; estrogen antagonists; etanidazole; etoposide phosphate; exemestane; fadrozole;Attorney Docket No. 046483-7495WO1(04120)

[0997] fazarabine; fenretinide; filgrastim; finasteride; flavopiridol; flezelastine; fluasterone; fludarabine; fluorodaunorunicin hydrochloride; forfenimex; formestane; fostriecin; fotemustine; gadolinium texaphyrin; gallium nitrate; galocitabine; ganirelix; gelatinase inhibitors; gemcitabine; glutathione inhibitors; hepsulfam; heregulin; hexamethylene bisacetamide; hypericin; ibandronic acid; idarubicin; idoxifene; idramantone; ilmofosine; ilomastat; imidazoacridones; imiquimod; immunostimulant peptides; insulin-like growth factor- 1 receptor inhibitor; interferon agonists; interferons; interleukins; iobenguane; iododoxorubicin; ipomeanol, 4-; iroplact; irsogladine; isobengazole; isohomohalicondrin B; itasetron; jasplakinolide; kahalalide F; lamellarin-N triacetate; lanreotide; leinamycin; lenograstim; lentinan sulfate; leptolstatin; letrozole; leukemia inhibiting factor; leukocyte alpha interferon; leuprolide+estrogen+progesterone; leuprorelin; levamisole; liarozole; linear polyamine analogue; lipophilic disaccharide peptide; lipophilic platinum compounds; lissoclinamide 7; lobaplatin; lombricine; lometrexol; lonidamine; losoxantrone; lovastatin; loxoribine; lurtotecan; lutetium texaphyrin; lysofylline; lytic peptides; maitansine; mannostatin A; marimastat; masoprocol; maspin; matrilysin inhibitors; matrix metalloproteinase inhibitors; menogaril; merbarone; meterelin; methioninase; metoclopramide; MIF inhibitor; mifepristone; miltefosine; mirimostim; mismatched double stranded RNA; mitoguazone; mitolactol; mitomycin analogues; mitonafide; mitotoxin fibroblast growth factor-saporin; mitoxantrone; mofarotene; molgramostim; monoclonal antibody, human chorionic gonadotrophin; monophosphoryl lipid A+myobacterium cell wall sk; mopidamol; multiple drug resistance gene inhibitor; multiple tumor suppressor 1 -based therapy; mustard anticancer agent; mycaperoxide B; mycobacterial cell wall extract; myriaporone; N-acetyldinaline; N-substituted benzamides; nafarelin; nagrestip; naloxone+pentazocine; napavin; naphterpin; nartograstim; nedaplatin; nemorubicin; neridronic acid; neutral endopeptidase; nilutamide; nisamycin; nitric oxide modulators; nitroxide antioxidant; nitrullyn; O6-benzylguanine; octreotide; okicenone; oligonucleotides; onapristone; ondansetron; ondansetron; oracin; oral cytokine inducer; ormaplatin; osaterone; oxaliplatin; oxaunomycin; paclitaxel; paclitaxel analogues; paclitaxel derivatives; palauamine; palmitoylrhizoxin; pamidronic acid; panaxytnol; panomifene; parabactin; pazelliptine; pegaspargase; peldesine; pentosan polysulfate sodium; pentostatin; pentrozole; perflubron; perfosfamide; perillyl alcohol; phenazinomycin; phenylacetate; phosphatase inhibitors; picibanil; pilocarpine hydrochloride; pirarubicin; piritrexim; placetin A; placetin B; plasminogen activator inhibitor; platinum complex; platinum compounds; platinumtriamine complex; porfimer sodium; porfiromycin; prednisone; propyl bis-acridone;Attorney Docket No. 046483-7495WO1(04120)

[0998] prostaglandin J2; proteasome inhibitors; protein A-based immune modulator; protein kinase C inhibitor; protein kinase C inhibitors, microalgal; protein tyrosine phosphatase inhibitors; purine nucleoside phosphorylase inhibitors; purpurins; pyrazoloacridine; pyridoxylated hemoglobin polyoxyethylene conjugate; raf antagonists; raltitrexed; ramosetron; ras famesyl protein transferase inhibitors; ras inhibitors; ras-GAP inhibitor; retelliptine demethylated; rhenium Re 186 etidronate; rhizoxin; ribozymes; RII retinamide; rogletimide; rohitukine; romurtide; roquinimex; rubiginone Bl; ruboxyl; safingol; saintopin; SarCNU; sarcophytol A; sargramostim; Sdi 1 mimetics; semustine; senescence derived inhibitor 1; sense oligonucleotides; signal transduction inhibitors; signal transduction modulators; single chain antigen binding protein; sizofuran; sobuzoxane; sodium borocaptate; sodium phenylacetate; solverol; somatomedin binding protein; sonermin; sparfosic acid; spicamycin D; spiromustine; splenopentin; spongistatin 1; squalamine; stem cell inhibitor; stem-cell division inhibitors; stipiamide; stromelysin inhibitors; sulfinosine; superactive vasoactive intestinal peptide antagonist; suradista; suramin; swainsonine; synthetic glycosaminoglycans; tallimustine; tamoxifen methiodide; tauromustine; tazarotene; tecogalan sodium; tegafur; tellurapyrylium; telomerase inhibitors; temoporfin; temozolomide; teniposide; tetrachlorodecaoxide; tetrazomine; thaliblastine; thiocoraline; thrombopoietin; thrombopoietin mimetic; thymalfasin; thymopoietin receptor agonist; thymotrinan; thyroid stimulating hormone; tin ethyl etiopurpurin; tirapazamine; titanocene bichloride; topsentin; toremifene; totipotent stem cell factor; translation inhibitors; tretinoin; triacetyluridine; triciribine; trimetrexate; triptorelin; tropisetron; turosteride; tyrosine kinase inhibitors; tyrphostins; UBC inhibitors; ubenimex; urogenital sinus-derived growth inhibitory factor; urokinase receptor antagonists; vapreotide; variolin B; vector system, erythrocyte gene therapy; velaresol; veramine; verdins; verteporfin; vinorelbine; vinxaltine; vitaxin; vorozole; zanoterone; zeniplatin; zilascorb; and zinostatin stimalamer. In one embodiment, the anticancer drug is 5 -fluorouracil, taxol, or leucovorin.

[0999] In some embodiments, the anti-cancer agent may be a prodrug form of an anti-cancer agent. As used herein, the term ‘“prodrug form” and its derivatives is used to refer to a drug that has been chemically modified to add and / or remove one or more substituents in such a manner that, upon introduction of the prodrug form into a subject, such a modification may be reversed by naturally occurring processes, thus reproducing the drug. The use of a prodrug form of an anti-cancer agent in the compositions, among other things, may increase the concentration of the anti-cancer agent in the compositions of the present disclosure. In certain embodiments, an anti-cancer agent may be chemically modified with an alkyl or acyl groupAttorney Docket No. 046483-7495WO1(04120)

[1000] or some form of lipid. The selection of such a chemical modification, including the substituent(s) to add and / or remove to create the prodrug, may depend upon a number of factors including, but not limited to, the particular drug and the desired properties of the prodrug. One of ordinary skill in the art, with the benefit of this disclosure, will recognize suitable chemical modifications.

[1001] Small molecule therapeutic agents

[1002] In various embodiments, the agent is a therapeutic agent. In various embodiments, the therapeutic agent is a small molecule. When the therapeutic agent is a small molecule, a small molecule may be obtained using standard methods known to the skilled artisan. Such methods include chemical organic synthesis or biological means. Biological means include purification from a biological source, recombinant synthesis and in vitro translation systems, using methods well known in the art. In certain embodiments, a small molecule therapeutic agents comprises an organic molecule, inorganic molecule, biomolecule, synthetic molecule, and the like.

[1003] Combinatorial libraries of molecularly diverse chemical compounds potentially useful in treating a variety of diseases and conditions are well known in the art, as are method of making the libraries. The method may use a variety of techniques well-known to the skilled artisan including solid phase synthesis, solution methods, parallel synthesis of single compounds, synthesis of chemical mixtures, rigid core structures, flexible linear sequences, deconvolution strategies, tagging techniques, and generating unbiased molecular landscapes for lead discovery vs. biased structures for lead development. In some embodiments of the invention, the therapeutic agent is synthesized and / or identified using combinatorial techniques.

[1004] In a general method for small library synthesis, an activated core molecule is condensed w ith a number of building blocks, resulting in a combinatorial library of covalently linked, core-building block ensembles. The shape and rigidity of the core determines the orientation of the building blocks in shape space. The libraries can be biased by changing the core, linkage, or building blocks to target a characterized biological structure (‘■focused libraries”) or synthesized with less structural bias using flexible cores. In some embodiments of the invention, the therapeutic agent is synthesized via small library synthesis.

[1005] The small molecule and small molecule compounds described herein may be present as salts even if salts are not depicted, and it is understood that the invention embraces all salts and solvates of the therapeutic agents depicted here, as well as the non-salt and non-solvateAttorney Docket No. 046483-7495WO1(04120)

[1006] form of the therapeutic agents, as is well understood by the skilled artisan. In some embodiments, the salts of the therapeutic agents of the invention are pharmaceutically acceptable salts.

[1007] Where tautomeric forms may be present for any of the therapeutic agents described herein, each and every tautomeric form is intended to be included in the present invention, even though only one or some of the tautomeric forms may be explicitly depicted. For example, when a 2-hydroxypyndyl moiety is depicted, the corresponding 2-pyridone tautomer is also intended.

[1008] The invention also includes any or all of the stereochemical forms, including any enantiomeric or diastereomeric forms of the therapeutic agents described. The recitation of the structure or name herein is intended to embrace all possible stereoisomers of therapeutic agents depicted. All forms of the therapeutic agents are also embraced by the invention, such as crystalline or non-crystalline forms of the therapeutic agent. Compositions comprising a therapeutic agents of the invention are also intended, such as a composition of substantially pure therapeutic agent, including a specific stereochemical form thereof, or a composition comprising mixtures of therapeutic agents of the invention in any ratio, including two or more stereochemical forms, such as in a racemic or non-racemic mixture.

[1009] The invention also includes any or all active analog or derivative, such as a prodrug, of any therapeutic agent described herein. In certain embodiments, the therapeutic agent is a prodrug. In certain embodiments, the small molecules described herein are candidates for derivatization. As such, in certain instances, the analogs of the small molecules described herein that have modulated potency, selectivity, and solubility are included herein and provide useful leads for drug discovery and drug development. Thus, in certain instances, during optimization new analogs are designed considering issues of drug delivery, metabolism, novelty, and safety.

[1010] In some instances, small molecule therapeutic agents described herein are derivatives or analogs of known therapeutic agents, as is well known in the art of combinatorial and medicinal chemistry. The analogs or derivatives can be prepared by adding and / or substituting functional groups at various locations. As such, the small molecules described herein can be converted into derivatives / analogs using well known chemical synthesis procedures. For example, all of the hydrogen atoms or substituents can be selectively modified to generate new analogs. Also, the linking atoms or groups can be modified into longer or shorter linkers with carbon backbones or hetero atoms. Also, the ring groups can be changed so as to have a different number of atoms in the ring and / or to include hetero atoms.Attorney Docket No. 046483-7495WO1(04120)

[1011] Moreover, aromatics can be converted to cyclic rings, and vice versa. For example, the rings may be from 5-7 atoms, and may be carbocyclic or heterocyclic.

[1012] As used herein, the term '‘analog,” “analogue,” or '‘derivative” is meant to refer to a chemical compound or molecule made from a parent compound or molecule by one or more chemical reactions. As such, an analog can be a structure having a structure similar to that of the small molecule therapeutic agents described herein or can be based on a scaffold of a small molecule therapeutic agents described herein, but differing from it in respect to certain components or structural makeup, which may have a similar or opposite action metabolically. An analog or derivative of any of a small molecule inhibitor in accordance with the present invention can be used to treat a disease or disorder.

[1013] In certain embodiments, the small molecule therapeutic agents described herein can independently be derivatized, or analogs prepared therefrom, by modifying hydrogen groups independently from each other into other substituents. That is, each atom on each molecule can be independently modified with respect to the other atoms on the same molecule. Any traditional modification for producing a derivative / analog can be used. For example, the atoms and substituents can be independently comprised of hydrogen, an alkyl, aliphatic, straight chain aliphatic, aliphatic having a chain hetero atom, branched aliphatic, substituted aliphatic, cyclic aliphatic, heterocyclic aliphatic having one or more hetero atoms, aromatic, heteroaromatic, polyaromatic, polyamino acids, peptides, polypeptides, combinations thereof, halogens, halo-substituted aliphatics, and the like. Additionally, any ring group on a compound can be derivatized to increase and / or decrease ring size as well as change the backbone atoms to carbon atoms or hetero atoms.

[1014] Nucleic Acids

[1015] In certain embodiments, the invention includes an ionizable LNP molecule formulated for targeted in vivo T cell delivery comprising or encapsulating one or more nucleic acid molecule. In certain embodiments, the nucleic acid molecule is a mRNA molecule. In certain embodiments, the mRNA molecule encodes a CAR. In certain embodiments, the nucleoside-modified mRNA molecule encodes a CAR. In certain embodiments, the invention includes a nucleoside-modified mRNA molecule encoding an adjuvant.

[1016] The nucleotide sequences encoding an CAR, as described herein, can alternatively comprise sequence variations with respect to the original nucleotide sequences, for example, substitutions, insertions and / or deletions of one or more nucleotides, with the condition that the resulting polynucleotide encodes a polypeptide according to the invention. Therefore, theAttorney Docket No. 046483-7495WO1(04120)

[1017] scope of the present invention includes nucleotide sequences that are substantially homologous to the nucleotide sequences recited herein and encode an antigen or antigen binding molecule or adjuvant of interest.

[1018] Further, the scope of the invention includes nucleotide sequences that encode amino acid sequences that are substantially homologous to the amino acid sequences recited herein and preserve the immunogenic function of the original amino acid sequence.

[1019] As used herein, an amino acid sequence is ^substantially homologous7’ to any of the amino acid sequences described herein when its amino acid sequence has a degree of identity with respect to the amino acid sequence of at least 60%, advantageously of at least 70%, preferably of at least 85%, and more preferably of at least 95%. The identity between two amino acid sequences is preferably determined by using the BLASTN algorithm (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md. 20894, Altschul, S., et al., J. Mol. Biol. 215: 403-410 (1990)).

[1020] In certain embodiments, the invention relates to a construct, comprising a nucleotide sequence encoding a CAR. In certain embodiments, the construct comprises a plurality of nucleotide sequences encoding a plurality of antigens. For example, in certain embodiments, the construct encodes 1 or more, 2 or more, 5 or more, 10 or more, 15 or more, or 20 or more antigens. In certain embodiments, the invention relates to a construct, comprising a nucleotide sequence encoding an adjuvant. In certain embodiments, the construct comprises a first nucleotide sequence encoding a CAR and a second nucleotide sequence encoding an adjuvant.

[1021] In certain embodiments, the composition comprises a plurality of constructs, each construct encoding one or more antigens. In certain embodiments, the composition comprises 1 or more, 2 or more, 5 or more, 10 or more, 15 or more, or 20 or more constructs. In certain embodiments, the composition comprises a first construct, comprising a nucleotide sequence encoding a CAR; and a second construct, comprising a nucleotide sequence encoding an adjuvant.

[1022] In another particular embodiment, the construct is operatively bound to a translational control element. The construct can incorporate an operatively bound regulatory sequence for the expression of the nucleotide sequence of the invention, thus forming an expression cassette.

[1023] Polypeptide therapeutic agents

[1024] In other related aspects, the therapeutic agent includes an isolated peptide thatAttorney Docket No. 046483-7495WO1(04120)

[1025] modulates a target. For example, In certain embodiments, the peptide of the invention inhibits or activates a target directly by binding to the target thereby modulating the normal functional activity of the target. In certain embodiments, the peptide of the invention modulates the target by competing with endogenous proteins. In certain embodiments, the peptide of the invention modulates the activity of the target by acting as a transdominant negative mutant.

[1026] The variants of the polypeptide therapeutic agents may be (i) one in which one or more of the amino acid residues are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue) and such substituted amino acid residue may or may not be one encoded by the genetic code, (ii) one in which there are one or more modified amino acid residues, e.g., residues that are modified by the attachment of substituent groups, (iii) one in which the polypeptide is an alternative splice variant of the polypeptide of the present invention, (iv) fragments of the polypeptides and / or (v) one in which the polypeptide is fused with another polypeptide, such as a leader or secretory sequence or a sequence which is employed for purification (for example, His-tag) or for detection (for example, Sv5 epitope tag). The fragments include polypeptides generated via proteolytic cleavage (including multi-site proteolysis) of an original sequence. Variants may be post-translationally, or chemically modified. Such variants are deemed to be within the scope of those skilled in the art from the teaching herein.

[1027] CAR agents

[1028] In certain embodiments, the mRNA molecule of the invention encodes a chimeric antigen receptor (CAR). In certain embodiments, the CAR comprises an antigen binding domain. In certain embodiments, the antigen binding domain is a targeting domain, wherein the targeting domain directs the T cell expressing the CAR to a specific cell or tissue of interest. For example, In certain embodiments, the targeting domain comprises an antibody, antibody fragment, or peptide that specifically binds to an expressed on a pathogenic organism or a tumor cell thereby directing the T cell expressing the CAR to a cell or tissue expressing the antigen.

[1029] In certain embodiments, the invention relates to an immune cell targeted LNP comprising an agent, wherein the agent comprises a nucleic acid sequence encoding a chimeric antigen receptor (CAR). In certain embodiments, agent comprises an mRNA molecule encoding a CAR. In certain embodiments, the agent comprises a modified nucleoside mRNA molecule encoding a CAR.

[1030] In various embodiments, the CAR can be a ‘’first generation,” “second generation,”Attorney Docket No. 046483-7495WO1(04120)

[1031] “third generation,’" “fourth generation"’ or “fifth generation” CAR (see, for example, Sadelain et al., Cancer Discov. 3(4):388-398 (2013); Jensen et al., Immunol. Rev. 257:127-133 (2014); Sharpe et al., Dis. Model Meeh. 8(4):337-350 (2015); Brentjens et al., Clin. Cancer Res. 13:5426-5435 (2007); Gade et al., Cancer Res. 65:9080-9088 (2005); Maher et al., Nat. Biotechnol. 20:70-75 (2002); Kershaw et al., J. Immunol. 173:2143-2150 (2004); Sadelain et al., Curr. Opin. Immunol. (2009); Hollyman et al., J. Immunother. 32:169-180 (2009)).

[1032] “First generation” CARs for use in the invention comprise an antigen binding domain, for example, a single-chain variable fragment (scFv), fused to a transmembrane domain, which is fused to a cytoplasmic / intracellular domain of the T cell receptor chain. “First generation"’ CARs typically have the intracellular domain from the CD3^-chain. which is the primary transmitter of signals from endogenous T cell receptors (TCRs). “First generation” CARs can provide de novo antigen recognition and cause activation of both CD4+ and CD8+ T cells through their CD3^ chain signaling domain in a single fusion molecule, independent of HLA-mediated antigen presentation.

[1033] “Second-generation” CARs for use in the invention comprise an antigen binding domain, for example, a single-chain variable fragment (scFv), fused to an intracellular signaling domain capable of activating T cells and a co-stimulatory domain designed to augment T cell potency and persistence (Sadelain et al., Cancer Discov. 3:388-398 (2013)). CAR design can therefore combine antigen recognition with signal transduction, two functions that are physiologically borne by two separate complexes, the TCR heterodimer and the CD3 complex. “Second generation” CARs include an intracellular domain from various co-stimulatory molecules, for example, CD28, 4-1BB, ICOS, 0X40, and the like, in the cytoplasmic tail of the CAR to provide additional signals to the cell.

[1034] “Second generation” CARs provide both co-stimulation, for example, by CD28 or 4-1BB domains, and activation, for example, by a CD3 signaling domain. Preclinical studies have indicated that “Second Generation” CARs can improve the anti-tumor activity of T cells. For example, robust efficacy of “Second Generation” CAR modified T cells was demonstrated in clinical trials targeting the CD 19 molecule in patients with chronic lymphoblastic leukemia (CLL) and acute lymphoblastic leukemia (ALL) (Davila et al., Oncoimmunol. 1(9): 1577-1583 (2012)).

[1035] “Third generation” CARs provide multiple co-stimulation, for example, by comprising both CD28 and 4-1BB domains, and activation, for example, by comprising a CD3^ activation domain.

[1036] "‘Fourth generation” CARs provide co-stimulation, for example, by CD28 or 4-1BBAttorney Docket No. 046483-7495WO1(04120)

[1037] domains, and activation, for example, by a CD3ζ signaling domain in addition to a constitutive or inducible chemokine component.

[1038] ■‘Fifth generation’’ CARs provide co-stimulation, for example, by CD28 or 4- IBB domains, and activation, for example, by a CD3^ signaling domain, a constitutive or inducible chemokine component, and an intracellular domain of a cytokine receptor, for example, IL-2Rp.

[1039] In various embodiments, the CAR can be included in a multivalent CAR system, for example, a DualCAR or '‘TandemCAR” system. Multivalent CAR systems include systems or cells comprising multiple CARs and systems or cells comprising bivalent / bispecific CARs targeting more than one antigen.

[1040] In the embodiments disclosed herein, the CARs generally comprise an antigen binding domain, a transmembrane domain and an intracellular domain, as described above. In a particular non-limiting embodiment, the antigen-binding domain is an scFv specific for binding to a surface antigen of a target cell of interest (e.g., a pathogen or tumor cell.)

[1041] Combinations

[1042] In certain embodiments, the composition of the present invention comprises a combination of agents described herein. In certain embodiments, a composition comprising a combination of agents described herein has an additive effect, wherein the overall effect of the combination is approximately equal to the sum of the effects of each individual agent. In other embodiments, a composition comprising a combination of agents described herein has a synergistic effect, wherein the overall effect of the combination is greater than the sum of the effects of each individual agent.

[1043] A composition comprising a combination of agents comprises individual agents in any suitable ratio. For example, In certain embodiments, the composition comprises a 1:1 ratio of two individual agents. However, the combination is not limited to any particular ratio. Rather any ratio that is shown to be effective is encompassed.

[1044] Pharmaceutical Compositions

[1045] In another aspect, the present disclosure provides a pharmaceutical composition comprising the lipid nanoparticle (LNP) of the present disclosure and at least one pharmaceutically acceptable carrier. In certain embodiments, the composition further comprises at least one adjuvant. In certain embodiments, the composition is a vaccine.

[1046] Such a pharmaceutical composition may consist of at least one composition of theAttorney Docket No. 046483-7495WO1(04120)

[1047] invention, in a form suitable for administration to a subject, or the pharmaceutical composition may comprise at least one composition, and one or more pharmaceutically acceptable carriers, one or more additional ingredients, or any combinations of these. At least one composition of the invention may be present in the pharmaceutical composition in the form of a physiologically acceptable salt, such as in combination with a physiologically acceptable cation or anion, as is well known in the art.

[1048] In certain embodiments, the pharmaceutical compositions useful for practicing the method of the invention may be administered to deliver a dose of between 1 ng / kg / day and 100 mg / kg / day. In other embodiments, the pharmaceutical compositions useful for practicing the invention may be administered to deliver a dose of between 1 ng / kg / day and 1,000 mg / kg / day.

[1049] The relative amounts of the active ingredient, the pharmaceutically acceptable carrier, and any additional ingredients in a pharmaceutical composition of the invention will vary, depending upon the identity, size, and condition of the subject treated and further depending upon the route by which the composition is to be administered. By way of example, the composition may comprise between 0.1% and 100% (w / w) active ingredient.

[1050] Pharmaceutical compositions that are useful in the methods of the invention may be suitably developed for nasal, inhalational, oral, rectal, vaginal, pleural, peritoneal, parenteral, topical, transdermal, pulmonary, intranasal, buccal, ophthalmic, epidural, intrathecal, intravenous, or another route of administration. A composition useful within the methods of the invention may be directly administered to the brain, the brainstem, or any other part of the central nervous system of a mammal or bird. Other contemplated formulations include projected nanoparticles, microspheres, liposomal preparations, coated particles, polymer conjugates, resealed erythrocytes containing the active ingredient, and immunologically-based formulations.

[1051] In certain embodiments, the compositions of the invention are part of a pharmaceutical matrix, which allows for manipulation of insoluble materials and improvement of the bioavailability thereof, development of controlled or sustained release products, and generation of homogeneous compositions. By way of example, a pharmaceutical matrix may be prepared using hot melt extrusion, solid solutions, solid dispersions, size reduction technologies, molecular complexes (e g., cyclodextrins, and others), microparticulate, and particle and formulation coating processes. Amorphous or crystalline phases may be used in such processes.

[1052] The route(s) of administration will be readily apparent to the skilled artisan and willAttorney Docket No. 046483-7495WO1(04120)

[1053] depend upon any number of factors including the type and severity of the disease being treated, the type and age of the veterinary or human patient being treated, and the like.

[1054] The formulations of the pharmaceutical compositions described herein may be prepared by any method known or hereafter developed in the art of pharmacology and pharmaceutics. In general, such preparatory methods include the step of bringing the active ingredient into association with a carrier or one or more other accessory’ ingredients, and then, if necessary or desirable, shaping or packaging the product into a desired single-dose or multi-dose unit.

[1055] As used herein, a “unit dose” is a discrete amount of the pharmaceutical composition comprising a predetermined amount of the active ingredient. The amount of the active ingredient is generally equal to the dosage of the active ingredient that would be administered to a subject or a convenient fraction of such a dosage such as, for example, one-half or one-third of such a dosage. The unit dosage form may be for a single daily dose or one of multiple daily doses (e.g, about 1 to 4 or more times per day). When multiple daily doses are used, the unit dosage form may be the same or different for each dose.

[1056] Although the descriptions of pharmaceutical compositions provided herein are principally directed to pharmaceutical compositions suitable for ethical administration to humans, it will be understood by the skilled artisan that such compositions are generally suitable for administration to animals of all sorts. Modification of pharmaceutical compositions suitable for administration to humans in order to render the compositions suitable for administration to various animals is well understood, and the ordinarily skilled veterinary’ pharmacologist can design and perform such modification with merely ordinary, if any, experimentation. Subjects to which administration of the pharmaceutical compositions of the invention is contemplated include, but are not limited to, humans and other primates, mammals including commercially relevant mammals such as cattle, pigs, horses, sheep, cats, and dogs.

[1057] In certain embodiments, the compositions of the invention are formulated using one or more pharmaceutically acceptable excipients or carriers. In certain embodiments, the pharmaceutical compositions of the invention comprise a therapeutically effective amount of at least one compound of the invention and a pharmaceutically acceptable carrier.

[1058] Pharmaceutically acceptable carriers, which are useful, include, but are not limited to, glycerol, water, saline, ethanol, recombinant human albumin (e.g., RECOMBUMIN®). solubilized gelatins (e.g., GELOFUSINE®), and other pharmaceutically acceptable salt solutions such as phosphates and salts of organic acids. Examples of these and otherAttorney Docket No. 046483-7495WO1(04120)

[1059] pharmaceutically acceptable carriers are described in Remington's Pharmaceutical Sciences (1991, Mack Publication Co., New Jersey).

[1060] The carrier may be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyethylene glycol, and the like), recombinant human albumin, solubilized gelatins, suitable mixtures thereof, and vegetable oils. The proper fluidity may be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants. Prevention of the action of microorganisms may be achieved by various antibacterial and antifungal agents, for example, parabens, chlorobutanol, phenol, ascorbic acid, thimerosal, and the like. In many cases, isotonic agents, for example, sugars, sodium chloride, or polyalcohols such as mannitol and sorbitol, are included in the composition. Prolonged absorption of the injectable compositions may be brought about by including in the composition an agent that delays absorption, for example, aluminum monostearate or gelatin.

[1061] Formulations may be employed in admixtures with conventional excipients, i.e., pharmaceutically acceptable organic or inorganic carrier substances suitable for oral, parenteral, nasal, inhalational, intravenous, subcutaneous, transdermal enteral, or any other suitable mode of administration, known to the art. The pharmaceutical preparations may be sterilized and if desired mixed with auxiliary agents, e.g, lubricants, preservatives, stabilizers, wetting agents, emulsifiers, salts for influencing osmotic pressure buffers, coloring, flavoring, and / or fragrance-conferring substances and the like. They may also be combined where desired with other active agents, e.g., other analgesic, anxiolytics or hypnotic agents. As used herein, “additional ingredients” include, but are not limited to, one or more ingredients that may be used as a pharmaceutical carrier.

[1062] The composition of the invention may comprise a preservative from about 0.005% to 2.0% by total weight of the composition. The preservative is used to prevent spoilage in the case of exposure to contaminants in the environment. Examples of preservatives useful in accordance with the invention include but are not limited to those selected from the group consisting of benzyl alcohol, sorbic acid, parabens, imidurea and any combinations thereof. One such preservative is a combination of about 0.5% to 2.0% benzyl alcohol and 0.05-0.5% sorbic acid.

[1063] The composition may include an antioxidant and a chelating agent that inhibit the degradation of the compound. Antioxidants for some compounds are BHT. BHA, alphatocopherol and ascorbic acid in the exemplary range of about 0.01% to 0.3%, or BHT in theAttorney Docket No. 046483-7495WO1(04120)

[1064] range of 0.03% to 0.1% by weight by total weight of the composition. The chelating agent may be present in an amount of from 0.01% to 0.5% by weight by total weight of the composition. Exemplary chelating agents include edetate salts (e.g. disodium edetate) and citric acid in the weight range of about 0.01% to 0.20%, or in the range of 0.02% to 0.10% by weight by total weight of the composition. The chelating agent is useful for chelating metal ions in the composition that may be detrimental to the shelf life of the formulation. While BHT and disodium edetate are exemplary antioxidant and chelating agent, respectively, for some compounds, other suitable and equivalent antioxidants and chelating agents may be substituted therefore as would be known to those skilled in the art.

[1065] Liquid suspensions may be prepared using conventional methods to achieve suspension of the active ingredient in an aqueous or oily vehicle. Aqueous vehicles include, for example, water, and isotonic saline. Oily vehicles include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin. Liquid suspensions may further comprise one or more additional ingredients including, but not limited to, suspending agents, dispersing or wetting agents, emulsifying agents, demulcents, preservatives, buffers, salts, flavorings, coloring agents, and sweetening agents. Oily suspensions may further comprise a thickening agent. Known suspending agents include, but are not limited to, sorbitol syrup, hydrogenated edible fats, sodium alginate, polyvinylpyrrolidone, gum tragacanth, gum acacia, and cellulose derivatives such as sodium carboxymethylcellulose, methylcellulose, hydroxypropylmethyl cellulose. Known dispersing or weting agents include, but are not limited to, naturally-occurring phosphatides such as lecithin, condensation products of an alkylene oxide with a fatty acid, with a long chain aliphatic alcohol, with a partial ester derived from a fatty acid and a hexitol, or with a partial ester derived from a fatty acid and a hexitol anhydride (e.g., polyoxyethylene stearate, heptadecaethyleneoxy cetanol, polyoxyethylene sorbitol monooleate, and polyoxyethylene sorbitan monooleate, respectively). Known emulsifying agents include, but are not limited to, lecithin, acacia, and ionic or non-ionic surfactants. Known preservatives include, but are not limited to, methyl, ethyl, or w-propyl para-hydroxybenzoates, ascorbic acid, and sorbic acid. Known sweetening agents include, for example, glycerol, propylene glycol, sorbitol, sucrose, and saccharin.

[1066] Liquid solutions of the active ingredient in aqueous or oily solvents may be prepared in substantially the same manner as liquid suspensions, the primary difference being that the active ingredient is dissolved, rather than suspended in the solvent. As used herein, an "oily" liquid is one which comprises a carbon-containing liquid molecule and which exhibits a lessAttorney Docket No. 046483-7495WO1(04120)

[1067] polar character than water. Liquid solutions of the pharmaceutical composition of the invention may comprise each of the components described with regard to liquid suspensions, it being understood that suspending agents will not necessarily aid dissolution of the active ingredient in the solvent. Aqueous solvents include, for example, water, and isotonic saline. Oily solvents include, for example, almond oil, oily esters, ethyl alcohol, vegetable oils such as arachis, olive, sesame, or coconut oil, fractionated vegetable oils, and mineral oils such as liquid paraffin.

[1068] A pharmaceutical composition of the invention may also be prepared, packaged, or sold in the form of oil-in-water emulsion or a water-in-oil emulsion. The oily phase may be a vegetable oil such as olive or arachis oil, a mineral oil such as liquid paraffin, or a combination of these. Such compositions may further comprise one or more emulsify ing agents such as naturally occurring gums such as gum acacia or gum tragacanth, naturally-occurring phosphatides such as soybean or lecithin phosphatide, esters or partial esters derived from combinations of fatty acids and hexitol anhydrides such as sorbitan monooleate, and condensation products of such partial esters with ethylene oxide such as polyoxyethylene sorbitan monooleate. These emulsions may also contain additional ingredients including, for example, sweetening or flavoring agents.

[1069] Methods for impregnating or coating a material with a chemical composition are known in the art, and include, but are not limited to methods of depositing or binding a chemical composition onto a surface, methods of incorporating a chemical composition into the structure of a material during the synthesis of the material (i.e., such as with a physiologically degradable material), and methods of absorbing an aqueous or oily solution or suspension into an absorbent material, with or without subsequent drying. Methods for mixing components include physical milling, the use of pellets in solid and suspension formulations and mixing in a transdermal patch, as known to those skilled in the art.

[1070] Administration / Dosing

[1071] The regimen of administration may affect what constitutes an effective amount. The therapeutic formulations may be administered to the patient either prior to or after the onset of a disease or disorder. Further, several divided dosages, as well as staggered dosages may be administered daily or sequentially, or the dose may be continuously infused, or may be a bolus injection. Further, the dosages of the therapeutic formulations may be proportionally increased or decreased as indicated by the exigencies of the therapeutic or prophylactic situation.Attorney Docket No. 046483-7495WO1(04120)

[1072] Administration of the compositions of the present disclosure to a patient, such as a mammal, such as a human, may be carried out using known procedures, at dosages and for periods of time effective to treat a disease or disorder contemplated herein. An effective amount of therapeutic (z.e., composition) necessary to achieve a therapeutic effect may vary according to factors such as the activity of the particular therapeutic employed; the time of administration; the rate of excretion of the composition; the duration of the treatment; other drugs, compounds or materials used in combination with the composition; the state of the disease or disorder, age, sex, weight, condition, general health and prior medical history of the patient being treated, and like factors well-known in the medical arts. Dosage regimens may be adjusted to provide the optimum therapeutic response. For example, several divided doses may be administered daily or the dose may be proportionally reduced as indicated by the exigencies of the therapeutic situation. A non-limiting example of an effective dose range for a therapeutic composition of the disclosure is from about 0.01 mg / kg to 100 mg / kg of body weight / per day of active agent (i.e., nucleic acid). One of ordinary skill in the art would be able to study the relevant factors and make the determination regarding the effective amount of the therapeutic composition without undue experimentation.

[1073] The composition may be administered to an animal as frequently as several times daily, or it may be administered less frequently, such as once a day, once a week, once every two weeks, once a month, or even less frequently, such as once every several months or even once a year or less. It is understood that the amount of composition dosed per day may be administered, in non-limiting examples, every day, every other day, every 2 days, every 3 days, every 4 days, or every 5 days. For example, with every other day administration, a 5 mg per day dose may be initiated on Monday with a first subsequent 5 mg per day dose administered on Wednesday, a second subsequent 5 mg per day dose administered on Friday, and so on. The frequency of the dose is readily apparent to the skilled artisan and depends upon a number of factors, such as, but not limited to, type and severity of the disease being treated, and ty pe and age of the animal.

[1074] Actual dosage levels of the active ingredients in the pharmaceutical compositions of this disclosure may be varied so as to obtain an amount of the active ingredient that is effective to achieve the desired therapeutic response for a particular patient, composition, and mode of administration, without being toxic to the patient.

[1075] A medical doctor, e.g., physician or veterinarian, having ordinary skill in the art may readily determine and prescribe the effective amount of the pharmaceutical composition required. For example, the physician or veterinarian could start doses of the compounds ofAttorney Docket No. 046483-7495WO1(04120)

[1076] the disclosure employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved.

[1077] In particular embodiments, it is especially advantageous to formulate the compound in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary’ dosages for the patients to be treated: each unit containing a predetermined quantity of therapeutic composition to produce the desired therapeutic effect in association with the required pharmaceutical vehicle. The dosage unit forms of the disclosure are dictated by and directly dependent on (a) the unique characteristics of the therapeutic composition and the particular therapeutic effect to be achieved, and (b) the limitations inherent in the art of compounding / formulating such a therapeutic composition for the treatment of a disease or disorder in a patient.

[1078] In certain embodiments, the compositions of the disclosure are administered to the patient in dosages that range from one to five times per day or more. In other embodiments, the compositions of the disclosure are administered to the patient in range of dosages that include, but are not limited to, once every day, every two days, every three days to once a week, and once every two weeks. It will be readily apparent to one skilled in the art that the frequency of administration of the various combination compositions of the disclosure will vary from subject to subject depending on many factors including, but not limited to. age, disease or disorder to be treated, gender, overall health, and other factors. Thus, the disclosure should not be construed to be limited to any particular dosage regime and the precise dosage and composition to be administered to any patient will be determined by the attending physician taking all other factors about the patient into account.

[1079] The amount of active agent of the composition(s) of the disclosure for administration may be in the range of from about 1 pg to about 7,500 mg, about 20 pg to about 7,000 mg, about 40 pg to about 6,500 mg, about 80 p g to about 6,000 mg, about 100 p g to about 5,500 mg, about 200 p g to about 5,000 mg, about 400 p g to about 4,000 mg, about 800 p g to about 3,000 mg, about 1 mg to about 2,500 mg, about 2 mg to about 2,000 mg, about 5 mg to about 1,000 mg, about 10 mg to about 750 mg, about 20 mg to about 600 mg, about 30 mg to about 500 mg, about 40 mg to about 400 mg, about 50 mg to about 300 mg, about 60 mg to about 250 mg, about 70 mg to about 200 mg, about 80 mg to about 150 mg, and any and all whole or partial increments there-in-between.

[1080] In some embodiments, the dose of active agent (i.e.. nucleic acid) present in the composition of the disclosure is from about 0.5 pg and about 5,000 mg. In someAttorney Docket No. 046483-7495WO1(04120)

[1081] embodiments, a dose of active agent present in the composition of the disclosure used in compositions described herein is less than about 5,000 mg, or less than about 4,000 mg, or less than about 3,000 mg, or less than about 2,000 mg, or less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 200 mg, or less than about 50 mg. Similarly, in some embodiments, a dose of a second compound as described herein is less than about 1,000 mg, or less than about 800 mg, or less than about 600 mg, or less than about 500 mg, or less than about 400 mg. or less than about 300 mg, or less than about 200 mg, or less than about 100 mg, or less than about 50 mg, or less than about 40 mg, or less than about 30 mg, or less than about 25 mg, or less than about 20 mg, or less than about 15 mg. or less than about 10 mg, or less than about 5 mg, or less than about 2 mg. or less than about 1 mg, or less than about 0.5 mg, and any and all whole or partial increments thereof.

[1082] In certain embodiments, the present disclosure is directed to a packaged pharmaceutical composition comprising a container holding a therapeutically effective amount of the composition of the disclosure, alone or in combination with a second pharmaceutical agent; and instructions for using the compound to treat, prevent, or reduce one or more symptoms of a disease or disorder in a patient.

[1083] The term “container” includes any receptacle for holding the pharmaceutical composition or for managing stability or water uptake. For example, in certain embodiments, the container is the packaging that contains the pharmaceutical composition, such as liquid (solution and suspension), semisolid, lyophilized solid, solution and powder or lyophilized formulation present in dual chambers. In other embodiments, the container is not the packaging that contains the pharmaceutical composition, i.e., the container is a receptacle, such as a box or vial that contains the packaged pharmaceutical composition or unpackaged pharmaceutical composition and the instructions for use of the pharmaceutical composition. Moreover, packaging techniques are well known in the art. It should be understood that the instructions for use of the pharmaceutical composition may be contained on the packaging containing the pharmaceutical composition, and as such the instructions form an increased functional relationship to the packaged product. However, it should be understood that the instructions may contain information pertaining to the compound’s ability to perform its intended function, e.g., treating, preventing, or reducing a disease or disorder in a patient.

[1084] Administration

[1085] Routes of administration of any of the compositions of the disclosure includeAttorney Docket No. 046483-7495WO1(04120)

[1086] inhalational, oral, nasal, rectal, parenteral, sublingual, transdermal, transmucosal (e.g, sublingual, lingual, (trans)buccal, (trans)urethral, vaginal (e.g., trans- and perivaginally). (intra)nasal, and (trans)rectal), intravesical, intrapulmonary, intraduodenal, intragastrical, intrathecal, epidural, intrapleural, intraperitoneal, subcutaneous, intramuscular, intradermal, intra-arterial, intravenous, intrabronchial, inhalation, and topical administration.

[1087] Suitable compositions and dosage forms include, for example, tablets, capsules, caplets, pills, gel caps, troches, emulsions, dispersions, suspensions, solutions, syrups, granules, beads, transdermal patches, gels, powders, pellets, magmas, lozenges, creams, pastes, plasters, lotions, discs, suppositories, liquid sprays for nasal or oral administration, dry powder or aerosolized formulations for inhalation, compositions and formulations for intravesical administration and the like. It should be understood that the formulations and compositions that would be useful in the present disclosure are not limited to the particular formulations and compositions that are described herein.

[1088] Parenteral Administration

[1089] As used herein, “parenteral administration7’ of a pharmaceutical composition includes any route of administration characterized by physical breaching of a tissue of a subject and administration of the pharmaceutical composition through the breach in the tissue. Parenteral administration thus includes, but is not limited to, administration of a pharmaceutical composition by injection of the composition, by application of the composition through a surgical incision, by application of the composition through a tissue-penetrating non-surgical wound, and the like. In particular, parenteral administration is contemplated to include, but is not limited to, subcutaneous, intravenous, intraperitoneal, intramuscular, intrastemal injection, and kidney dialytic infusion techniques.

[1090] Formulations of a pharmaceutical composition suitable for parenteral administration comprise the active ingredient combined with a pharmaceutically acceptable carrier, such as sterile water or sterile isotonic saline. Such formulations may be prepared, packaged, or sold in a form suitable for bolus administration or for continuous administration. Injectable formulations may be prepared, packaged, or sold in unit dosage form, such as in ampules or in multidose containers containing a preservative. Injectable formulations may also be prepared, packaged, or sold in devices such as patient-controlled analgesia (PCA) devices. Formulations for parenteral administration include, but are not limited to, suspensions, solutions, emulsions in oily or aqueous vehicles, pastes, and implantable sustained-release or biodegradable formulations. Such formulations may further comprise one or more additionalAttorney Docket No. 046483-7495WO1(04120)

[1091] ingredients including, but not limited to, suspending, stabilizing, or dispersing agents. In certain embodiments of a formulation for parenteral administration, the active ingredient is provided in dry (i.e., powder or granular) form for reconstitution with a suitable vehicle (e.g, sterile pyrogen-free water) prior to parenteral administration of the reconstituted composition.

[1092] The pharmaceutical compositions may be prepared, packaged, or sold in the form of a sterile injectable aqueous or oily suspension or solution. This suspension or solution may be formulated according to the known art, and may comprise, in addition to the active ingredient, additional ingredients such as the dispersing agents, wetting agents, or suspending agents described herein. Such sterile injectable formulations may be prepared using a non-toxic parenterally acceptable diluent or solvent, such as water or 1,3-butanediol, for example. Other acceptable diluents and solvents include, but are not limited to. Ringer's solution, isotonic sodium chloride solution, and fixed oils such as synthetic mono- or di-glycerides. Other parentally-administrable formulations which are useful include those which comprise the active ingredient in microcrystalline form in a recombinant human albumin, a fluidized gelatin, in a liposomal preparation, or as a component of a biodegradable polymer system. Compositions for sustained release or implantation may comprise pharmaceutically acceptable polymeric or hydrophobic materials such as an emulsion, an ion exchange resin, a sparingly soluble polymer, or a sparingly soluble salt.

[1093] EXAMPLES

[1094] Various embodiments of the present application can be better understood by reference to the following Examples which are offered by way of illustration. The scope of the present application is not limited to the Examples given herein.

[1095] Materials and Methods: Hydrocarbyl Maleate-Derived Ionizable Lipids and LNPs Comprising Same

[1096] Materials

[1097] Amines, aliphatic alcohols, N, N'-Dicyclohexylcarbodiimide (DCC), 4-Dimethylaminopyridine (DMAP) and were purchased from Sigma Aldrich. Tokyo Chemical Industry, Ambeed and AstaTech. Dibutyl maleate (D4), Bis(2-ethylhexyl) maleate (D6.2), dioctyl maleate (D8), Bis(O-methylheptyl) maleate (D8i) and (Z)-4-((2-ethylhexyl)oxy)-4-oxobut-2-enoic acid were obtained from Ambeed and AstaTech. l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), l,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dimyristoyl-rac-glycero-3-methoxypoly ethylene gly col-2000 (DMG-PEG 2000) andAttorney Docket No. 046483-7495WO1(04120)

[1098] cholesterol were obtained from Avanti Polar Lipids. Ionizable lipids C 12-200, MC3 and SM-102 were purchased from MedChem Express. LP-01 was purchased from Cayman Chemical. Nucleoside-modified luciferase mRNA (5moU) and Cas9 mRNA (5moU) were bought from TriLink. TTR siRNAs (#NM_013697, siRNA IDs: SASI_Mm01_00076059, SASI_Mm01_00076060 and SASI_Mm01_00076061) were purchased from Sigma Aldrich. Highly modified sgRNA target mouse TTR (guide No. G211) was chemically synthesized by AxoLabs based on a previous publication. Modified sgRNA targeting mouse PCSK9 (cccauaccuuggagcaacgg) (SEQ ID NO: 1) and HPD (cauucaacgucacaaccacc) (SEQ ID NO:2) were chemically synthesized by Synthego via proprietary specifications.

[1099] mRNA synthesis

[1100] ABE8.8 mRNA and CBE4max mRNA were produced synthetically. Briefly, codon-optimized ABE8.8 or CBE4max sequence was cloned into a proprietary mRNA production plasmid (optimized 3’ and 5' UTR with a 101 polyAtail), in vitro transcribed in the presence of 1 -methyl pseudouridine modified nucleoside, co-transcriptionally capped using the CleanCap technology (TriLink) and cellulose purified to remove double-stranded RNAs. Purified mRNA was ethanol precipitated, washed, resuspended in nuclease-free water and subjected to quality control. All mRNAs were stored at -20 °C until use.

[1101] General procedure for the synthesis of maleates with two different alkyl chains Aliphatic alcohol (2 mmol, 1 eq.), (Z)-4-((2-ethylhexyl)oxy)-4-oxobut-2-enoic acid (2.2 mmol, 1.1 eq.), DCC (2.2 mmol, 1.1 eq.) and DMAP (0.4 mmol, 0.2 eq.) were dissolved in 20 ml anhydrous DCM in a round bottom flask and stirred at RT under N2 protection for 24 h. The reaction mixture was filtered and the filtrate was evaporated under vacuum. The residue was separated using a CombiFlash NextGen 300+ chromatography system (Teledyne Isco) with gradient elution from hexane to 20:80 ethyl acetate / hexane over 15 min to give desired products that were confirmed by ¹H NMR (FIG. 4).

[1102] Combinatorial synthesis of ILs

[1103] ILs were combinatorially synthesized by solvent-free, catalyst-free Michael addition between amines / thiols and dialkyl maleates. Excess dialkyl maleates (1.25 eq. of -NH2 / -NH- / -SH) were used to saturate the reaction sites. Taking 5D8 as an example, amine 5 (0.1 mmol, 1 eq.) and D8 (0.25 mmol. 0.25 eq.) were combined in a glass vial and stirred at 80 °C for 24 h. For amine / thiol in the salt form, excess tri ethylamine was added to neutralize the acid. ForAttorney Docket No. 046483-7495WO1(04120)

[1104] insoluble amine / thiol, 100 pL of isopropanol was added to dissolve the reactants. The yield was typically >80%. Crude ILs were dissolved in ethanol and directly used for initial screening. Selected ILs were purified using a CombiFlash NextGen 300+ chromatography system with gradient elution from 100% CH2CI2 to 100% CH2C12 / MeOH / NH4OH (75:22:3) over 10 min to give desired products (FIGs. 6A-6C). The lead 5D8 was characterized by¬ mass spectrometry (MS) and nuclear magnetic resonance spectroscopy (¹H NMR). MS-ESI: calculated for C48H93N3O8: 839.70, found [M + H]+= 840.70; ¹H NMR (600 MHz, CDCl₃) δ4.05 – 3.75 (m, 10H), 3.52 (q, J = 6.2 Hz, 1H), 2.82 - 2.34 (m, 12H), 2.13 (s, 6H), 1.50 (t, J = 10.0 Hz, 8H), 1.38 - 1.10 (m, 44H), 0.85 - 0.79 (m, 12H).

[1105] LNP preparation

[1106] For initial in vitro and in vivo screening, LNPs were prepared by pipette mixing of the ethanolic phase containing IL, DOPE, cholesterol and DMG-PEG with the aqueous phase (10 mM citrate buffer, pH 3) containing mLuc at a volume ratio of 1:3. The weight ratio of IL: DOPE:cholesterol: DMG-PEG: mRNAwas fixed at 16:10:10:3:1.6. The hydrodynamic size of LNPs formulated by pipette mixing was typically 100-200 nm and the mRNA encapsulation efficiency was typically 60-80%.

[1107] For microfluidic formulation of LNPs (including C12-200 LNP), the ethanolic phase containing lipids (IL / DOPE / cholesterol / DMG-PEG = 40:10:48.5:1.5) was mixed with the aqueous phase containing mRNA at a flow rate ratio of 1:3 and at an IL / mRNA weight ratio of 10:1 in a microfluidic device. The benchmark MC3 LNP (or SM-102 LNP) was formulated with MC3 (or SM-102), DSPC, cholesterol and DMG-PEG at a molar ratio of 50:10:38.5:1.5 using microfluidic mixing at an ionizable lipid / mRNA weight ratio of 10:1. The LP-01 LNP was formulated similarly according to a previous study. LNPs were dialyzed against 1 xPBS in a 20 kDa MWCO cassette for 2 h, filtered through a 0.22 pM filter and stored at 4 °C. The hydrodynamic size of LNPs formulated by microfluidic mixing was typically 80-120 nm and the mRNA encapsulation efficiency was typically >90%.

[1108] Characterization

[1109] 1H-NMR was recorded using a Bruker 400 MHz NMR spectrometer. MS was performed on a Waters Acquity LC-MS system equipped with UV-Vis and MS detectors. The hydrodynamic size, polydispersity index (PDI) and zeta potential of LNPs were measured using a Malvern Zetasizer Nano ZS90. The morphology of LNPs was characterized by a cryo-electron microscope (Titan Krios, Thermo Fisher) equipped with a K3 Bioquantum. TheAttorney Docket No. 046483-7495WO1(04120)

[1110] mRNA encapsulation efficiency and the paof LNP were determined using a modified Quant-iT RiboGreen RNA assay (Invitrogen) and a 6-(p-toluidinyl)naphthalene-2-sulfonic acid (TNS) assay, respectively.

[1111] Cell culture and animal studies

[1112] Human hepatocellular carcinoma HepG2 cells were purchased from American Type Culture Collection (ATCC) and maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 100 U / mL penicillin and 100 pg / mL streptomycin. Cells were cultured at 37 °C in a humidified incubator of 5% CO2, and routinely tested for mycoplasma contamination.

[1113] C57BL / 6 female mice (6-8 weeks. 18-20 g) were purchased from The Jackson Laboratory. FAH⁻ / ⁻ male mice (6-8 months, 25-30 g) were bred in our animal facility and genotyped using a previously described protocol. They were maintained on nitisinone (Yecuris Corporation) in their drinking water at a concentration of 16.5 mg / L. Mice were housed in a specific-pathogen-free animal facility at ambient temperature (22 ± 2 °C), air humidity 40%-70% and 12-h dark / 12-h light cycle.

[1114] In vitro LNP screening

[1115] For high-throughput in vitro screening of LNPs, HepG2 cells were seeded in 384-well plates at a density of 1,000 per well overnight and mLuc-loaded LNPs were used to treat cells at an mRNA dose of 3 ng / well for 24 h. For in vitro batch screening of LNPs, HepG2 cells were seeded in 96-well plates at a density of 5,000 per well overnight. mLuc-LNPs with the same amine structure were pooled and used to treat cells at an mRNA dose of 15 ng / well for 24 h. Luciferase expression was evaluated by Luciferase Reporter 1000 Assay System (Promega, #E4550) according to the manufacturer’s protocol.

[1116] In vivo LNP screening

[1117] For in vivo screening of LNPs, mice were i.v. injected with either pooled LNPs or individual LNPs at an mLuc dose of 0.1 mg / kg. Four hours later, mice were intraperitoneally injected with D-luciferin potassium salt (150 mg / kg), and bioluminescence imaging was performed using an in vivo imaging system (PerkinElmer). Whole-body total flux was quantified and normalized to C12-200 LNP-treated mice.

[1118] Isolation and identification of plasma proteins absorbed to LNPsAttorney Docket No. 046483-7495WO1(04120)

[1119] Plasma proteins absorbed to LNPs were isolated as previously described. Briefly, mouse blood was collected into EDTA-treated tubes and centrifuged at 3.000 x g at 4 °C for 10 min to obtain plasma. Plasma was further centrifuged at 13,000 x g at 4 °C for 30 min to remove protein aggregates. LNPs were mixed with an equal volume of plasma at a final mRNA concentration of 0.1 mg / mL and incubated for 1 h at 37 °C under shaking. The plasma protein-coated LNPs were isolated by centrifugation at 13.000 / g at 4 °C for 30 min. followed by washing with cold PBS three times to remove unbound proteins. The protein concentration was determined using a BCA method before protein analysis by Wistar Institute’s Proteomics and Metabolomics Core.

[1120] Systemic delivery of CRISPR gene editor targeting TTR

[1121] C57BL / 6 mice were i.v. injected with Cas9 mRNA / TTR sgRNA (4:1, wt:wt)-loaded LNPs at a total RNA dose of 1 mg / kg. Serum was collected on day 7 and analyzed by ELISA (Aviva Systems Biology, #OKIA00111). Mice w ere euthanized, and livers were collected to determine the on-target indel frequency by next-generation sequencing (NGS). For TTR on-target DNA sequencing, DNA was extracted from the liver using the Qiagen Puregene Tissue Kit (#158063) and quantified using a Nanodrop 2000. PCR amplification of the TTR target site w as carried out using Q5 High-Fidelity DNA Polymerase (#M0491, New England Biolabs) and the following primers: 5 -CGGTTTACTCTGACCCATTTC-3’ (SEQ ID NO:3) and 5 -GGGCTTTCTACAAGCTTACC-3’ (SEQ ID NO:4). Deep sequencing of the TTR amplicons and determination of the on-target indel frequency was performed essentially as described except that 150 bp pair end reads were produced.

[1122] Systemic delivery of ABE base editor targeting PCSK9

[1123] C57BL / 6 mice were i.v. injected with ABE8.8 mRNA / PCSK9 sgRNA (4:1, wt:wt)-loaded LNPs at a total RNA dose of 0.75 mg / kg. Serum was collected on day 7 and analyzed by ELISA (#ab215538, Abeam). Mice were euthanized, and livers were collected. Genomic DNA was extracted for the analysis of on-target PCSK9 editing by NGS. PCR amplification of the PCSK9 target site was carried out w ith the follow ing primers: 5’-GGCTGCACTTAGAGACC ACC-3’ (SEQ ID NO:5) and 5’-ATGAAGAGCTGATGCTCGCC-3' (SEQ IDNO:6). Deep sequencing of the PCSK9 amplicons was performed.

[1124] Systemic delivery of CBE base editor targeting HPDAttorney Docket No. 046483-7495WO1(04120)

[1125] FAH⁻ / ⁻ mice maintained on nitisinone were i.v. injected with CBE4max mRNA / HPD sgRNA (4:1, wt:wt)-loaded LNPs at a total RNA dose of 0.6 mg / kg. On day 7, mice were euthanized, and livers were collected. Genomic DNA was extracted for the analysis of on-target HPD editing by NGS. PCR amplification of the HPD target site was carried out with the following primers: 5 -CCTTCCTTTAACAGAGCCCACT-3’ (SEQ ID NO:7) and 5’-TGGGTAAGATTTCGCAGGCA-3’ (SEQ IDNO:8). Deep sequencing of the HPD amplicons was performed. For the survival study, nitisinone was withdrawn two weeks posttreatment and the survival of FAH~’~ mice was monitored.

[1126] Systemic delivery of siRNA targeting TTR

[1127] Three TTR siRNAs were pooled at a 1: 1: 1 molar ratio and encapsulated into LNPs using microfluidic mixing. Mice were i.v. injected with TTR siRNA-loaded LNPs at a total siRNA dose of 0.05 mg / kg. Serum was collected on day 3 and analyzed by ELISA.

[1128] Liver toxicity evaluation

[1129] Serum was collected at 24 h post injection of Cas9 mRNA / TTR sgRNA-loaded LNPs at a total RNA dose of 1 mg / kg. ALT and AST activities were determined by alanine transaminase colorimetric activity assay kit (#700260, Cayman) and aspartate aminotransferase colorimetric activity assay kit (#701640, Cayman), respectively.

[1130] Statistical analysis

[1131] Data are presented as mean ± SD. Student’s / -test or one-way analysis of variance (ANOVA) followed by Tukey's test was applied for comparison between two groups or among multiple groups using Graphpad Prism 8.0, respectively, p < 0.05 was considered to be statistically significant.

[1132] Materials and Methods: Exemplary LNPs for Delivery of Circular RNA (circRNA) RNA Synthesis and Purification

[1133] Linear mRNA was synthesized using in vitro transcription with T7 RNA polymerase with full N¹-methylpseudouridine (m¹ᵠP) substitution and was co-transcriptionally capped with CleanCap AG (3’-OMe). Nucleotide triphosphate analogs and capping reagent were purchased from TriLink Biotechnologies (San Diego, CA). Resultant RNA w as further purified using POROS™ Oligo (dT)25 affinity resin (Thermo Fisher Scientific) according to the manufacturer's instructions. Circular RNA precursors were synthesized with T7 RNAAttorney Docket No. 046483-7495WO1(04120)

[1134] polymerase and were circularized using permuted intron-exon splicing with the Anabaena ribozyme. Circularized RNA was enriched using RNase R. Subsequently, enriched circular RNA was further purified by cellulose to remove double-stranded RNA contaminants and treated with calf intestinal alkaline phosphatase to remove phosphates. All final RNA samples were examined using standard agarose electrophoresis or E-Gel EX system (Thermo Fisher) before cell-based experiments or animal studies

[1135] Lipid Synthesis

[1136] The C14-482, C14-488, and C14-494 ionizable lipids were synthesized using SN2 reactions. The 5D6.2, 8D6.2, 12D6.2, 12T-O14, and 11-10-8 ionizable lipids were synthesized according to methods known to those of ordinary skill in the art. SM-102, ALC-0315, and DLin-MC3-DMA ionizable lipids were purchased from Cayman Chemical (Ann Arbor, MI). Cholesterol was purchased from MilliporeSigma. 1,2-dioleoyl-s7?-glycero-3-phosphoethanolamine (DOPE), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC). 1-stearoyl-2-oleoyl-sn-glycero-3-phosphocholine (SOPC), 1,2-dimyristoyl-rac-glycero-3-methoxypoly(ethylene glycol)-2000 (DMG-PEG2000), and 1,2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-methoxy(poly(ethylene glycol)-1000 (C14-PEG2000) were purchased from Avanti Polar Lipids (Alabaster, AL)

[1137] LNP Formulation

[1138] LNPs were formulated using microfluidic mixing. Briefly, an ethanol phase containing ionizable lipid, helper lipid, cholesterol, and PEG-lipid was mixed with an aqueous phase containing RNA at a lipid: RNA volume ratio of 1:3 in a microfluidic device. LNPs were dialyzed against IX phosphate-buffered saline (PBS) and stored at 4 °C for later use. Fluorescently labeled LNPs were prepared by incubating preformed LNPs with 20 pM DiD (post-insertion).

[1139] LNP Characterization

[1140] Hydrodynamic size and polydispersity of LNPs were measured using a DynaPro plate reader (Wyatt Technology, Santa Barbara, CA). RNA concentration and encapsulation efficiency were assessed using a modified Quant-iT RiboGreen assay essentially as described previously (8). Briefly, LNPs were diluted 100-fold in either tris-EDTA (TE) buffer or TE buffer containing 0.1% (v / v) Triton X-100 surfactant. RNA concentration in each sample wasAttorney Docket No. 046483-7495WO1(04120)

[1141] fluorometrically quantified in quadruplicate through comparison to a standard curve.

[1142] Concentrations from detergent-treated samples were taken as total RNA concentrations, while concentrations from samples diluted in TE were taken as free RNA concentrations. Encapsulated RNA concentration was calculated by subtracting free RNA concentration from total RNA concentration, and entrapment was calculated as the ratio of encapsulated to total RNA. RNA dosages are given as amount of encapsulated circRNA equivalent. For instance, a 1 ng dose refers to 1 ng of encapsulated circRNA or to an equimolar amount (-0.67 ng) of encapsulated mRNA. Similarly, a dose of 4 pg circRNA equivalent refers to 4 pg of encapsulated circRNA or to -2.67 pg of encapsulated mRNA, while a dose of 10 ng circRNA equivalent refers to 10 ng of encapsulated circRNA or to -6.67 ng of encapsulated mRNA.

[1143] Cell Culture

[1144] Jurkat human T cells and RAW 264.7 murine macrophages were obtained from the American Type Culture Collection (ATCC; Manassas, VA). DC2.4 murine dendritic cells were obtained from MilliporeSigma (Burlington, MA). Cells were cultured in Roswell Park Memorial Institute (RPMI) 1640 medium with L-glutamine supplemented with 10% (v / v) fetal bovine serum (FBS) and 1% (v / v) penicillin-streptomycin (Jurkat, DC2.4) or in Dulbecco’s modified Eagle’s medium (DMEM) with D-glucose and L-glutamine supplemented with 10% (v / v) FBS and 1% (v / v) penicillin- streptomycin (RAW 264.7). Cells were incubated at 37 °C in a humidified atmosphere containing 5% CO2. Adherent cells (DC2.4, RAW 264.7) were allowed to adhere to culture surfaces overnight before treatment with nanoparticles. For in vitro NanoLuc bioluminescence measurements, 50 pL of Nano-Gio detection reagent (Promega Corporation, Madison, WI) was added to 50 pL of cultures and luminescence flux was measured on a plate reader. For initial LNP screening, LNPs yielding a luminescence signal at least an order of magnitude greater than MC3 circRNA LNPs were considered “hits.” For shelf-life stability assessments, cells treated with mRNA or circRNA prepared with the Lipofectamine MessengerMAX transfection reagent (ThermoFisher Scientific) were used as controls.

[1145] Animal Experiments

[1146] Female C57BL / 6 mice were purchased from The Jackson Laboratory (Bay Harbor, ME). Intramuscular (z.m.) administration was performed using paired injections, with half of the total RNA dose administered into each hindlimb. Intravenous (z.v.) administration was performed via tail vein injection. For bioluminescence imaging, 220 nmol ofAttorney Docket No. 046483-7495WO1(04120)

[1147] fluorofurimazine (FFz) reagent (Promega Corporation) in PBS was administered intraperitoneally (i.p.) prior to image acquisition. Bioluminescence and fluorescence imaging of whole mice and / or organs was performed using an in vivo imaging system (PerkinElmer, Shelton, CT) and data were analyzed using the Living Image software (Revvity, Waltham, MA). For initial LNP screening, LNPs yielding a whole-body luminescence signal of at least 107p / s (roughly 2 orders of magnitude above background signal) were considered “hits.”

[1148] Leukocyte Isolation from Lymph Nodes

[1149] Leukocytes were isolated from lymph nodes through enzymatic digestion followed by mechanical homogenization. Lymph nodes were first dissected and placed in Hank’s buffered salt solution (HBSS) containing collagenase IV and DNase I for 30 minutes. After enzymatic digestion, lymph nodes were mechanically homogenized to produce cell suspensions, which were rinsed with PBS and filtered with a 35 pm mesh before downstream analysis.

[1150] Splenocyte Isolation and Stimulation

[1151] Splenocytes were harvested similarly to nodal leukocytes. Mouse spleens were first dissected and placed in HBSS containing collagenase IV and DNase I for 30 minutes, after which they were mechanically extruded through a 70 pm cell strainer to produce a single-cell suspension. Red blood cells were lysed using ammonium-chloride-potassium (ACK) lysing buffer and splenocytes were placed in unsupplemented RPMI 1640 medium for culture. To assess antigen-specific T cell responses, 2 million splenocytes were stimulated with 5 pg of pooled SARS-CoV-2 B.1.617.2 (Delta) RBD peptides (JPT Peptide Technologies GmbH, Berlin, DE). Co-stimulation was provided by adding 2 pg of anti-CD28 antibody (BioLegend). A staining antibody against CD107a was added, and after 1 h of incubation at 37 °C in 5% CO2, brefeldin A and monensin were added to inhibit cytokine secretion.

[1152] Samples were incubated for a further 5 h prior to staining and fixation for flow cytometric analysis.

[1153] Flow Cytometry

[1154] cytometry experiments were performed using a BD Symphony A3 cell analyzer with violet, blue, green, and red lasers. All antibodies were purchased from BioLegend (San Diego, CA). TruStain FcX PLUS (rat anti-mouse CD16 / 32) was used to block nonspecific interactions with staining antibodies. For experiments requiring staining of intracellular epitopes, the Cyto-Fast Fix / Perm Buffer Set (BioLegend) was used according to theAttorney Docket No. 046483-7495WO1(04120)

[1155] manufacturer’s instructions. Antibody clones and fluorophores used are available in the Supporting Information. Data were analyzed using standard techniques with doublet exclusion.

[1156] Anti-RBD Endpoint Antibody Titer Measurement

[1157] Anti-RBD antibody titers were assessed using enzyme-linked immunosorbent assays (ELIS As) as described previously. Briefly, SARS-CoV-2 B.1.617.2 (Delta) S RBD peptide (Sino Biological) was used to coat microplate wells overnight. After rinsing and blocking, serially diluted mouse sera were plated and incubated with adsorbed peptide for 2 h. After further rinsing, diluted horseradish peroxidase (HRP)-conjugated antibodies (anti-mouse IgG, anti-mouse IgGl, or anti- mouse IgG2c. Abeam) were added and incubated for 1.5 h before further rinsing. 3, 3’, 5, 5’- Tetramethylbenzidine (TMB) substrate was then added and allowed to react with HRP for 8 min, after which the reaction was stopped by adding 2 N sulfuric acid. Absorbance was measured using a plate reader and RBD-specific dilution titer was determined using the Frey method.

[1158] Statistical Analysis

[1159] Unless otherwise specified, all data are reported as mean ± standard error of the mean. Ordinary or nested two-sided, one-way analyses of variance (ANOVAs) with post hoc Student’s t tests with the Holm-Sidak correction for multiple comparisons were employed for comparisons across multiple groups. GraphPad Prism version 8 was employed for statistical analyses and data visualization.

[1160] Example 1: Design, synthesis, and screening of “plug and play” biodegradable ionizable lipids (ILs)

[1161] In this study, a two-component combinatorial chemistry for “plug-and-play” assembly of biodegradable ILs between amines / thiols and dialkyl maleates was devised (FIG. 1A). This “click-like” Michael addition reaction has many advantages, such as easily accessible building blocks, a simple experimental procedure, avoidance of solvent and catalyst, 100% atom economy, and a high product yield. Notably, compared with previously reported Michael addition reaction for IL synthesis that use alkyl acrylate, the use of dialkyl maleate in the present scheme has several benefits: (1) dialkyl maleate is more reactive than alkyl acrylate, due to the two electron-withdrawing groups to the double bond. (2) unlike alkyl acrylate, that uncontrollably produces a mixture of both mono- and bis-adduct, dialkylAttorney Docket No. 046483-7495WO1(04120)

[1162] maleate is highly selective towards the mono-adduct for primary amines due to the high steric hindrance, leading to less by-products; and (3) ILs with asymmetric tails can be easily prepared from asymmetric dialkyl maleate (FIG. 1 A and FIGs. 3A-3B), which expands the structural diversity of ILs.

[1163] 500 ILs were combinatorially synthesized using 50 amines / thiols and 10 dialkyl maleates (FIG. IB and FIGs. 3A-3B). Notably, amines / thiols 1-50 are classified based on the number of reaction sites (z.e., each -NH2, -NH-, and -SH moiety comprising a single “pluggable site” for addition to a single dialkyl maleate). Symmetric dialkyl maleates (z.e., D4, D6.2, D8 and D8i) are commercially available, while asymmetric ones (z.e., D18, D9.2, D9.8, D11.1, D11.10 and D12.8), that are variable in length, branch, and saturation, were synthesized through the one-step esterification reaction (FIG. 4). These ILs were individually formulated into mLuc-LNPs along with other lipid excipients and firefly luciferase mRNA (mLuc), which were then subjected to high-throughput in vitro screening. HepG2 cells (z.e., a human hepatocellular carcinoma cell line) were treated with mLuc-LNPs at a low mRNA dose (3 ng / well) to avoid cytotoxicity, and luciferase expression was measured after 24 hours (FIG. IB). The in vitro transfection efficiency of ILs assembled from amine 1-20 with two to four pluggable sites was greatly affected by amine structure. Overall, amines bearing multiple pluggable sites (e.g, amine 20) afforded efficacious ILs. In contrast, tail structure profoundly impacted the transfection efficiency of ILs assembled from amine 21-47 with only one pluggable site. Generally, only dialkyl maleate with a long tail and a branch (e.g, D12.8) generated efficacious ILs. In contrast, thiols (e.g, thiol ated amine) 48-50 with one pluggable site resulted in suboptimal ILs irrelevant of tail structure.

[1164] Example 2: Machine learning-assisted disclosure of structure-activity relationships Through this screen, 76 ILs were identified that mediated in vitro mRNA delivery with luciferase expression >2000 relative light unit (RLU, FIGs. 1B-1C). Notably, none of these ILs was assembled from dialkyl maleate D4, presumably due to its short hydrocarbon chains and low lipophilicity (FIGs. 3A-3B). For amine / thiol with one to four pluggable sites, relative hit rates (percentage in the group with luciferase expression >2000 RLU -percentage in library) were calculated to be -32.4, 11.5, 9.8 and 13.1, respectively (FIG. ID). These results suggest that amine / thiol 21-50 with one pluggable site are inferior in affording efficacious ILs compared to other counterparts. Thus, we focused on the 200 ILs assembled from amines 1-20 in the following studies.

[1165] To gain deeper insights into the screening data, machine learning techniques wereAttorney Docket No. 046483-7495WO1(04120)

[1166] employed. Across various tested models and descriptors, Random Forest trained on calculated physicochemical properties of the building blocks (RF-RDKit) emerged as the most promising approach (FIGs. 14-15) and showed good performance at anticipating the transfection efficiency of different ILs (FIG. 16A). Using SHAP (SHapley Additive exPlanations) analysis, several physicochemical properties were extracted that the model identified to correlate with in vitro luciferase expression (FIG. 16B and FIGs. 17A-17B). The SHAP analysis highlights the differential importance of molecular features for each component. An increase in hydrogen bond donors (NumHDonors, in particular through amine or hydroxyl groups) and topological polar surface area (TPSA) in the amine / thiol component led to higher in vitro luciferase expression, which aligns with our results that amine with multiple -NH2 / -NH- tends to produce superior IL. For the dialkyl maleates, features of higher ratios of sp3-hybridized carbons over the total carbon count (FractionCSP3) and higher heavy atom molecular weight (Heavy AtomMolWt) correlate with higher transfection, suggesting that a bulky alkyl tail is favorable for efficacious IL. Based on above results and analysis, 200 ILs assembled from amine 1-20 were chosen for the further screening

[1167] Example 3: In vivo screening identifies multiple ILs for superior mRNA delivery To accelerate the identification of optimal amines and reduce the usage of animals, a batch screening method was used. mLuc-LNPs with the same amine structure were pooled into 20 batches (10 LNPs per batch), which were then used to treat HepG2 cells or intravenously (i.v.) injected into mice. Amine 12 was identified as the most effective based on in vitro results, followed by amine 20, 8 and 5 (FIG. IE). However, none of these pooled LNPs reached the transfection efficiency of C12-200 LNP, a potent benchmark for the delivery of mRNA therapeutics and gene editors. Interestingly, in vivo batch screening results showed that amine 8 and 5 were the best performers and achieved higher (3.6-fold) and slightly lower (0.6-fold) transfection efficiency relative to C12-200 LNP (FIG. IF and FIG 5), respectively.

[1168] Taking the above results into consideration, all amine 8-derived ILs, except 8D4, were selected for individual screening in mice. For rigid comparison, these ILs were purified (FIGs. 6A-6C), and formulated into mLuc-loaded LNPs using a microfluidic device. In vivo results demonstrated that LNPs formulated with 8D6.2, 8D8, 8D8i, 8D9.2 or 8D11.1 achieved comparable or higher transfection efficiency than C12-200 LNP (FIG. 1G). Notably, ILs with increased tail and branch length tended to show decreased transfection activity (e., 8D8 vs 8D18; 8D9.2 vs 8D9.8). These results are in line with previous studies, where potentAttorney Docket No. 046483-7495WO1(04120)

[1169] ILs often contain multiple short tails. Following this discovery, 5-derived ILs with multiple short tails (FIG. 1G). all of which were comparable or superior to Cl 2-200, were further tested. Due to the strong in vitro transfection activity, amine 12-derived five ILs with multiple short tails were also tested in vivo, but all of them were slightly inferior to C12-200.

[1170] Example 4: Lead IL-formulated LNP confers robust gene editing without hepatotoxicity Inspired by the ease of synthesis and highly efficient mRNA delivery in vivo, the utility of these ILs to deliver CRISPR mRNA therapeutics for in vivo gene editing was tested. Ten superior ILs from amine 5 and 8 w ere screened for liver genome editing by co-delivering Cas9 mRNA and sgRNA targeting the transthyretin TTR) gene in mice (FIGs. 2A-2B). Five ILs of reduced efficiency in this initial screen were also tested for comparison.

[1171] Encouragingly, all ten superior ILs achieved more than 27% on-target editing efficiency. The lead 5D8-formulated LNP achieved the highest on-target editing efficiency (-61%), which was higher than C12-200 LNP (-51%, FIG. 2A) and other industry benchmark LNPs, including SM-102 LNP (-20%), MC3 LNP (-5%), and LP-01 LNP (-3%) (FIG. 7).

[1172] Correspondingly, serum TTR protein was reduced by -90% in mice treated with 5D8 LNP (FIG. (FIG. 2B). In contrast, all inferior ILs barely facilitated liver gene editing and serum TTR reduction. Therefore, 5D8 (FIGs. 8-9 and Table 3) was identified as the top-performing ionizable lipid for CRISPR gene editing. Of note, 5D8 LNP is also highly potent for siRNA delivery, achieving -100% reduction of serum TTR after delivery of TTR siRNA at a very low' dose (0.05 mg / kg, FIG. 10), which is superior to industry benchmark MC3 LNP at the same experimental conditions. One possible reason for the high potency of 5D8 LNP could be its enrichment of apolipoprotein E on the surface (FIG. 11), which is implicated in the active targeting of hepatocytes.

[1173] Table 3. Physiochemical parameters of 5D8 LNP and C12-200 LNP

[1174] LNP Size (nm) PDI Zeta potential (mV) EE (%) p / ta 5D8 87.2 ± 2.4 0.144 0.71 ± 0.91 96.9 ± 1.5 6.58

[1175]

[1176] C12-200 101.8 ± 0.8 0.142 -1.82 ± 0.60 93.1 ± 1.7 6.76 The hydrodynamic size, PDI and zeta potential of LNPs were obtained by dynamic light scattering (DLS) measurement in PBS (pH 7.4). The mRNA encapsulation efficiency (EE) was determined using a modified Quant-iT RiboGreen RNA assay. The pKa of LNP were determined using a 6-(p-toluidinyl)naphthalene-2-sulfonic acid (TNS) assay. Data are presented as mean ± SD (n=3 independent biological replicates).

[1177] The relationship of mLuc delivery efficiency, gene editing efficiency and serum TTRAttorney Docket No. 046483-7495WO1(04120)

[1178] reduction was next analyzed (FIGs. 12A-12C). There was a moderate positive correlation between mLuc delivery efficiency and gene editing efficiency or serum TTR reduction, suggesting that the potency of LNPs for mLuc delivery generally predict gene editing outcome. Unsurprisingly, gene editing efficiency correlated well with serum TTR reduction. The hepatotoxicity of 5D8 LNP following in vivo gene editing was further examined (FIG.

[1179] 13). There was no observable increase of alanine transaminase (ALT) or aspartate aminotransferase (AST) level following 5D8 LNP treatment. In contrast, C12-200 LNP treatment resulted in the slight elevation of both ALT and AST levels. Taken together, 5D8 is a superior ionizable lipid that enables potent mRNA delivery and gene editing with a favorable safety profile. Of note, 5D8 LNP is also highly potent for siRNA delivery', achieving -10$ reduction of serum TTR after delivery’ of TTR siRNA at a very low dose (0.05 mg / kg, FIG. 10, which is superior to clinical approved MC3 LNP at the same experimental conditions.

[1180] Next, an understanding as to why 5D8 LNP exhibited such high in vivo transfection efficiency was sought. 5D8 LNP was -87 nm in hydrodynamic size with a neutral surface charge, and had an acid disassociation constant (pKa) of 6.58 (Table 3 and FIG. 9). Cryogenic electron microscopy (Cryo-EM) images revealed that it displayed a polyhedral morphology with a lamellar shell and an amorphous core (FIG. 8), which is implicated in improved endosomal escape. Moreover, 5D8 LNP was enriched with apolipoprotein E (apoE) on the surface compared to C12-200 LNP (FIGs. 11A-11B), which is known to mediate active hepatocyte targeting. Therefore, the strong transfection potency of 5D8 LNP could result from the synergistic effect of multiple favorable physicochemical properties, including sub-100-nm size, neutral surface, suitable pKa, polyhedral shape and apoE adsorption.

[1181] Example 5: Lead IL-formulated LNP confers superior base editing

[1182] It was next investigated whether 5D8 LNP could serve as a universal delivery platform for other mRNA-based gene editing tools, such as CRISPR base editors. Unlike CRISPR / Cas9-based gene editors, base editors enable precise and efficient base changes without the introduction of double stranded DNA breaks. Base editing can be used to permanently turn off disease-associated genes or correct pathogenic point mutations to treat single-nucleotide genetic diseases. The ability of 5D8 LNP to deliver adenine base editors (ABEs), which convert A*T base pairs to G*C base pairs, was tested. Mice were i.v. injected with LNPs encapsulating mRNA encoding an ABE version 8.8m (ABE8.8) and a sgRNA targeting the PCSK9 (proprotein convertase subtilisin / kexin type 9) gene, a well-validatedAttorney Docket No. 046483-7495WO1(04120)

[1183] therapeutic target for the treatment of atherosclerotic cardiovascular disease (FIG. 2C). 5D8 LNP induced -42% liver PCSK9 base-editing efficiency with a concomitant -74% reduction of PCSK9 serum protein (FIGs. 2D-2E). In contrast, C12-200 LNP resulted in significantly lower PCSK9 editing efficiency (-23%) and less serum PCSK9 reduction (-52%) at the same dose. These results demonstrate the promise of 5D8 LNP for in vivo base editing.

[1184] Finally, the potential of 5D8 LNP for gene editing therapy in mice with a genetic disease was explored. Hereditary tyrosinaemia type I (HT1) results from a loss of function mutation in FAH (fumarylacetoacetate hydrolase) gene, blocking the tyrosine catabolic pathway. Pharmacological inhibition of the upstream HPD (4-hydroxyphenylpyruvic acid dioxy genase) enzyme with nitisinone or knockout of HPD gene by base editing prevents the build-up of toxic metabolites and lethal liver failure. LNPs comprising mRNA encoding a cytosine base editor version 4max (CBE4max) and a sgRNA targeting the HPD gene to introduce a C — > T nonsense mutation were formulated and i.v. administrated into adult FAH / -mice. 5D8 LNP resulted in -6.5% on-target editing, which was significantly higher than that (-1.6%) achieved by C12-200 LNP. Consequently, mice receiving 5D8 LNP had a greater median survival time after nitisinone withdrawal (32 days), in comparison with PBS group (5 days) and C12-200 LNP group (18 days). Taken together, these results support that 5D8 LNP is a universal platform for efficient gene editing applications.

[1185] In summary, the disclosure relates in one aspect to the development of a simple and robust combinatorial chemistry for the plug-and-play assembly of biodegradable ILs. Amine 5- and 8-derived ILs with multiple short tails showed superior in vivo mRNA delivery capability, among which 5D8 was identified as the lead candidate for liver gene editing with good tolerability. At clinically relevant doses, 5D8 LNP achieved higher gene editing efficiency or base editing efficiency than benchmark LNPs in wild-type and transgenic mice. This study demonstrates the great value of this plug-and-play assembly strategy and 5D8 LNP as a general platform for potent in vivo gene editing.

[1186] Example 6: LNPs formulated with ionizable lipid 12D6.2 effectively deliver circular RNA (circRNA) cargo

[1187] While circRNA delivery using LNPs has been reported previously, relatively little optimization of the lipid components has been performed, with the bulk of previous optimization work focusing on the RNA cargo. As different nucleic acid cargoes have demonstrated varying optima in lipid makeup for cargo delivery, it was reasoned that tailoring LNPs for circRNA could yield improved encapsulation and transfectionAttorney Docket No. 046483-7495WO1(04120)

[1188] characteristics compared to simply adopting existing LNP formulations optimized for mRNA delivery. As a starting point for circRNA LNP optimization, identification of an ionizable lipid capable of facilitating circRNA transfection in immune cells was first sought.

[1189] Piperazine-derived ionizable lipids C14-482, C14-488, and C14-494 were evaluated these lipids for circRNA delivery'. The biodegradable ionizable lipids 5D6.2, 8D6.2, 12D6.2, 12T-014, and 11-10-8, were also evaluated. All nine ionizable lipids were compared against three clinical LNP formulations: Spikevax (Modema), an mRNA LNP formulation containing the SM-102 ionizable lipid; Comimaty (Pfizer / BioNTech), an mRNA LNP formulation containing the ALC-0315 ionizable lipid; and Onpattro (Alnylam), an siRNA LNP formulation containing the DLin-MC3-DMA (MC3) ionizable lipid.

[1190] LNPs were formulated by encapsulating circRNA encoding the NanoLuc engineered luciferase using microfluidic mixing. After assessing size distribution and entrapment efficiency of the resultant LNPs (Table 4), DC2.4 murine dendritic cells (DCs), Jurkat human T cells, and RAW 264.7 murine macrophages were transfected and bioluminescence was assessed 24 h later using a plate reader. In all immune cell lines tested, novel ionizable lipids substantially outperformed clinical controls in terms of cir-cRNA transfection (FIGs. 18A-18C). Of particular note were the ionizable lipids C14-488, C14-494, 5D6.2, and 12D6.2, each of which significantly outperformed MC3 for circRNA transfection in at least two of the three cell lines tested.

[1191] Table 4. Physicochemical characterization of circRNA lipid nanoparticles (LNPs) with novel ionizable lipid structures. Hydrodynamic diameter and polydispersity index are reported as mean ± SD (n = 5 measurements). Encapsulation efficiency is reported as mean ± SD (n = 4 measurements). _

[1192] LNP Diameter (nm) Polvdispersitv index Encapsulation efficiency Cl 4-482 77.1 ± 1.6 0.20 ± 0.02 63.2 ± 0.6%

[1193] Cl 4-488 244.7 ± 73 0.34 ± 0.03 76.6 ± 0.2%

[1194] Cl 4-494 116.0 ± 17.8 0.36± 0.10 67.6 ± 0.3%

[1195] Cl 4-497 188.8 ± 9.0 0.41 ± 0.02 59.8 ± 2.2% 5D6.2 128.5 ± 1.0 0.24 ± 0.03 81.3 ± 0.1% 8D6.2 153.9 ± 29 0.32 ± 0.08 82.4 ± 0.2% 12D6.2 127.1 ± 6.5 0.20 ± 0.04 78.0 ± 0.3%

[1196] 12T-O14 161.5 ± 21 0.29 ± 0.03 81.0 ± 0.2%

[1197] 11-10-8 82.8 ± 6.0 0.32 ± 0.02 81.2 ± 0.3%

[1198] SM-102 110.9 ± 26 0.23 ± 0.03 95.0 ± 1.2% ALC-0315 166.1 ± 4.5 0.26 ± 0.02 84.1 ± 0.2% DLin-MC3- 103.3 ± 19.8 0.30 ± 0.08 78.6 ± 0.3%

[1199]

[1200] DMA

[1201] As relationships between in vitro and in vivo LNP performance are often weak, theAttorney Docket No. 046483-7495WO1(04120)

[1202] performance of candidate circRNA LNPs was further evaluated in vivo. Twelve hours after i.m. administration of NanoLuc circRNA LNPs to mice, whole-body bioluminescence imaging was performed to evaluate transfection profiles (FIGs. 18D-18E). Here, C14-482, 5D6.2, 8D6.2, 12D6.2, SM-102, and ALC-0315 were identified as promising candidate ionizable lipids for in vivo circRNA transfection. Notably, the C 14-488 ionizable lipid, which emerged as a lead candidate from in vitro screening, demonstrated poor in vivo performance, establishing its status as a false positive and underscoring the importance of in vivo validation of LNP performance. Conversely, the ALC-0315 and SM-102 lipids, which performed poorly in vitro, demonstrated moderate-to-strong in vivo transfection, making them apparent examples of false negatives and poor candidates for subsequent in vitro LNP optimization experiments. However, several ionizable lipids emerged as true positives, demonstrating strong transfection both in vitro and in vivo (FIG. 18F). While some of these (C 14-482, 8D6.2) demonstrated clear transfection of the liver, 12D6.2 LNPs demonstrated apparent transfection of the lymph nodes. Based on its promising in vitro and in vivo screening results, 12D6.2 (FIG. 18G) emerged as the lead ionizable lipid candidate for further optimization for circRNA delivery.

[1203] Example 7: DoE Optimization Identifies Key Parameters for Enhanced circRNA LNP Transfection

[1204] Having identified 12D6.2 as a promising ionizable lipid for circRNA transfection, improvement of performance with formulation optimization was sought. Previous studies have shown that the composition of LNP lipid components can strongly influence delivery ex vivo and in vivo and that the optimal LNP makeup can vary across cargo types. To refine the LNP composition for circRNA delivery, the influence of several factors on circRNA LNP performance was investigated. The first factor investigated was the weight ratio of ionizable lipid to RNA cargo. Historically, siRNA LNP formulations have employed a 5: 1 weight ratio, while many preclinical mRNA LNPs have used a ratio of 10: 1 and more recently developed LNPs use a ratio as high as 20:1. As circRNA is a relatively large, covalently closed nucleic acid cargo, investigation of DOPC and SOPC helper lipids, previously employed for plasmid DNA (pDNA) delivery, was pursued in addition to the typical DSPC and DOPE helper lipids often employed for siRNA and mRNA delivery applications. The influence of relative amount of both 12D6.2 ionizable lipid and helper lipid on LNP performance was further investigated, as it was reasoned that coordination with circRNA cargo could play an important role in improving circRNA encapsulation and delivery.Attorney Docket No. 046483-7495WO1(04120)

[1205] A Taguchi orthogonal DoE approach was used to reduce the initial design space of 256 distinct LNP formulations to a more manageable 16 formulations (FIGs. 19A-19B). These LNPs encapsulating NanoLuc circRNA (‘'library A”) were formulated and, after physical characterization (Table 5), were again used them to transfect immune cell lines, comparing their transfection performance to the unoptimized 12D6.2 LNP based on typical mRNALNP formulations (FIGs. 19C-19E). This screen identified four LNP formulations with significantly greater NanoLuc transfection than the unoptimized 12D6.2 formulation in Jurkat cells (FIG. 19D) and two LNP formulations with significantly greater transfection in RAW 264.7 cells (FIG. 19E). It was noted that the LNPs formulated with the SOPC helper lipid and greater lipid:RNA weight ratios generally performed best in all three cell lines (FIGs. 19F-19K). This finding is consistent with the hit formulations identified, as the lead Al 4 LNP formulation is formulated with the SOPC helper lipid and at an ionizable lipid:RNA weight ratio of 20:1. Furthermore, these findings are consistent with the theory of ionizable lipid / helper lipid coordination with RNA cargo playing an important role in circRNA LNP performance.

[1206] Table 5. Physicochemical characterization of circRNA lipid nanoparticles (LNPs) in design-of-experiments (DoE) Library A. Hydrodynamic diameter and polydispersity index are reported as mean ± SD (n = 5 measurements). Encapsulation efficiency is reported as mean ± SD (n = 4 measurements). _ _ _

[1207] LNP Diameter (nm) Polydispersity index Encapsulation efficiency Al 88.5 ± 1.3 0.13 ± 0.03 18.5 ± 2.3%

[1208] A2 114.6 ± 1.6 0.10 ± 0.04 26.8 ± 1.1%

[1209] A3 105.0 ± 1.8 0.18 ± 0.02 22.5 ± 1.5%

[1210] A4 138.6 ± 1.9 0.12 ± 0.02 29.9 ± 3.0%

[1211] A5 119.7± 1.9 0.10 ± 0.04 24.2 ± 0.9%

[1212] A6 107.0 ± 1.6 0.16 ± 0.02 62.6 ± 0.3%

[1213] A7 121.5 ± 1.8 0.08 ± 0.04 48.6 ± 1.2%

[1214] A8 110.9 ± 0.5 0.10 ± 0.03 69.2 ± 0.6%

[1215] A9 124.7 ± 2.0 0.11 ± 0.03 34.9 ± 1.5% A10 109.0 ± 0.9 0.16 ± 0.03 68.7 ± 0.5% All 104.4 ± 0.7 0.07 ± 0.02 76.2 ± 0.7% A12 105.0 ± 0.9 0.13 ± 0.02 74.4 ± 0.6% A13 122.2 ± 1.0 0.05 ± 0.02 32.5 ± 2.8% A14 112.6 ± 0.7 0.16 ± 0.02 68.6 ± 1.1% A15 91.9 ± 0.8 0.05 ± 0.03 83.2 ± 1.0%

[1216]

[1217] A16 85.6 ± 1.1 0.10 ± 0.02 89.8 ± 0.3%

[1218] Having identified favorable compositional parameters for circRNA encapsulation and delivery, efforts to further refine the LNP composition were undertaken. The SOPC helper lipid and 20: 1 weight ratio were selected for all subsequent LNP formulations and it wasAttorney Docket No. 046483-7495WO1(04120)

[1219] decided to again vary ionizable lipid and helper lipid amount. In this optimization study, cholesterol content was also selected as a potentially interesting factor due to the role of cholesterol in lipid membrane rigidity and fusion. A DoE approach was again employed, formulating another 9 LNPs (“library B”) to probe this refined design space (FIGs. 19A-19B and Table 6). Evaluating these LNPs in immune cell lines using NanoLuc, additional potent LNP formulations and a greater hit rate was observed than was observed in library A (FIGs.

[1220] 19C-19E). Strikingly, in Jurkat and RAW 264.7 cells, every formulation in library B exhibited significantly greater transfection than the mRNA-optimized base 12D6.2 LNP formulation (FIGs. 19D-19E). Based on these results, the B7 formulation was selected, which demonstrated at least fivefold greater cir-cRNA transfection than the unoptimized 12D6.2 LNP formulation in all immune cell types tested and outperformed the base formulation at all tested doses in DC2.4 cells, as a lead candidate for further evaluation (FIGs. 19L-19M).

[1221] Interestingly, it was observed that B7 circRNA LNPs, which demonstrated strong immune cell transfection, possessed atypical physicochemical properties for potent RNA LNPs. Namely, B7 circRNA LNPs were relatively large and demonstrated relatively low RNA entrapment efficiency (Table 6). Future work should more closely evaluate the relationship between circRNA LNP physicochemical characteristics and immune transfection to determine whether optimal LNP properties for circRNA vaccines may differ from those of mRNA drugs and possible mechanisms responsible for these differences, which could potentially include factors such as differences in endocytic pathway, endosomal escape, or interactions with intracellular vesicles. It is also likely that these parameters exhibit synergistic effects with e.g., ionizable lipid structure, as evidenced by preliminary data demonstrating differential effects of the B7 formulation when combined with clinical ionizable lipids (FIG. 24A). For instance, the substantial structural differences between the multibranched-tail 12D6.2 ionizable lipid (FIG. 18G) and the clinical SM-I02, ALC-0315, and DLin-MC3-DMA ionizable lipids could play a role in the impact of the B7 formulation on circRNA transfection.

[1222] Table 6. Physicochemical characterization of circRNA lipid nanoparticles (LNPs) in design-of-experiments (DoE) Library B. Hydrodynamic diameter and polydispersity index are reported as mean ± SD (n = 5 measurements). Encapsulation efficiency is reported as mean ± SD (n = 4 measurements). _

[1223] LNP Diameter (nm) Polydispersity index Encapsulation efficiency Bl 110.8± 3.0 0.27 ± 0.13 51.7 ± 1.9%

[1224] B2 196.5 ± 2.9 0.32 ± 0.04 64.9 ± 0.5%

[1225]

[1226] B3 207.6 ± 4.5 0.21 ± 0.05 72.7 ± 0.6%Attomey Docket No. 046483-7495W01(04120)

[1227] B4 197.4 ± 3.6 0.20 ± 0.04 64.4 ± 0.3%

[1228] B5 227.1 ± 3.8 0.20 ± 0.04 67.2 ± 0.1%

[1229] B6 215.2 ± 2.5 0.18 ± 0.04 59.8 ± 0.6%

[1230] B7 220.1 ± 6.4 0.27 ± 0.04 64.6 ± 0.4%

[1231] B8 193.9 ± 2.3 0.19 ± 0.04 57.4 ± 0.3%

[1232]

[1233] B9 218.7± 4.3 0.19 ± 0.02 57.1 ± 1.3%

[1234] Table 7. LNP formulation parameters for novel ionizable lipid library.

[1235] Ionizable lipid (molar Helper lipid (molar Cholesterol molar Lipid-PEG (molar ratio) ratio) ratio ratio)

[1236] C14-482 (35) DOPE (16) 46.5 C14-PEG2000 (2.5)C14-488 (35) DOPE (16) 46.5 C14-PEG2000 (2.5)C14-494 (35) DOPE (16) 46.5 C14-PEG2000 (2.5)C14-497 (35) DOPE (16) 46.5 C14-PEG2000 (2.5)5D6.2 (35) DOPE (16) 46.5 C14-PEG2000 (2.5)8D6.2 (35) DOPE (16) 46.5 C14-PEG2000 (2.5)12D6.2 (35) DOPE (16) 46.5 C14-PEG2000 (2.5)12T-O14 (35) DOPE (16) 46.5 C14-PEG2000 (2.5)11-10-8 (35) DOPE (16) 46.5 C14-PEG2000 (2.5) SM-102 (50) DSPC (10) 38.5 DMG-PEG2000 (1.5) ALC-0315 (46.3) DSPC (9.4) 42.7 ALC-0159 (1.6)

[1237]

[1238] DLin-MC3-DMA (50) DSPC (10) 38.5 DMG-PEG2000 (1.5)

[1239] Table 8. LNP formulation parameters for design-of-experiments (DoE) Library

[1240] All LNPs in Library A are formulated with the 12D6.2 ionizable lipid, holding the molar ratio of cholesterol (46,5), and the molar ratio of C14-PEG200Q (2,5) constant. _

[1241] LNP Lipid: RNA Helper lipid Ionizable lipid Helper lipid molar weight ratio molar ratio ratio Al 5:1 DSPC 40 16

[1242] A2 5:1 SOPC 50 20

[1243] A3 5:1 DOPE 60 24

[1244] A4 5:1 DOPC 70 28

[1245] A5 10:1 DSPC 50 24

[1246] A6 10:1 SOPC 40 28

[1247] A7 10:1 DOPE 70 16

[1248] A8 10:1 DOPC 60 20

[1249] A9 15:1 DSPC 60 28

[1250] A10 15:1 SOPC 70 24

[1251] All 15:1 DOPE 40 20

[1252] A12 15:1 DOPC 50 16

[1253] A13 20:1 DSPC 70 20

[1254] A14 20:1 SOPC 60 16

[1255] A15 20:1 DOPE 50 28

[1256]

[1257] A16 20:1 DOPC 40 24

[1258] Table 8. LNP formulation parameters for design-of-experiments (DoE) Library B. All LNPs in Library B are formulated with the 12D6.2 ionizable lipid, holding the lipid:RNA weight ratio (20:1), helper lipid (SOPC), and the molar ratio of C14-PEG2000 (2.5) constant.

[1259] | LNP | Ionizable Lipid | Helper Lipid | Cholesterol

[1260]

[1261] Attorney Docket No. 046483-7495WO1(04120)

[1262] Molar Ratios Molar Ratio Molar Ratio Bl 55 12 35

[1263] B2 55 14 45

[1264] B3 55 16 55

[1265] B4 60 12 45

[1266] B5 60 14 55

[1267] B6 60 16 35

[1268] B7 65 12 55

[1269] B8 65 14 35

[1270]

[1271] B9 65 16 45

[1272] Example 8: Optimized circRNA LNP Formulations Accumulate in and Transfect Secondary Lymphoid Organs Following i.m. Administration

[1273] RNA vaccines depend on the translation of antigen and its presentation in secondary lymphoid organs. While the precise mode of antigen production and transport is not fully understood, localization within the secondary lymphoid organs is crucial. The in vivo translation and biodistribution profiles of the optimized circRNA LNP formulations were then evaluated. B7 LNPs were formulated by encapsulating NanoLuc circRNA along with unoptimized 12D6.2 LNPs encapsulating either NanoLuc mRNA or NanoLuc circRNA. LNPs were tagged with the lipophilic fluorescent dye DiD, then administered LNPs i.m. to mice, collecting organs 12 h later for bioluminescence and fluorescence imaging. Using fluorescence imaging, significant LNP accumulation in the inguinal and iliac lymph nodes was observed (FIG. 20A and FIGs. 20D-20E) and apparent but not statistically significant accumulation in the spleen (FIG. 20C). A marked accumulation of unoptimized 12D6.2 circRNA LNPs were also observed in the liver, which appeared to be reduced for the optimized B7 circRNA LNPs (FIGs. 20A-20B).

[1274] Bioluminescence imaging of mouse organs show ed apparent transfection in the liver, inguinal and iliac lymph nodes, and spleen (FIGs. 20F-20J). Interestingly, optimized B7 circRNA LNPs displayed significantly greater liver transfection than either of the other LNP groups, despite demonstrating less accumulation. Optimized B7 circRNA LNPs demonstrated apparent increases in mean transfection compared to unoptimized 12D6.2 circRNA LNPs in the liver, spleen, and both types of lymph node (~4.7-fold increase in inguinal lymph nodes and ~4.4-fold increase in iliac lymph nodes), consistent with observed in vitro potency increases. While still lower than the expression induced by mRNA LNPs, this apparent partial rescue of protein production by LNP optimization is promising for circRNA vaccines, where strong and prolonged antigen production is desirable.

[1275] To better understand cellular interactions with the LNPs in secondary lymphoidAttorney Docket No. 046483-7495WO1(04120)

[1276] organs, flow cytometric analysis of DiD fluorescence was performed in cells isolated from the inguinal and iliac lymph nodes (FIGs. 20K-20R) as well as from the spleen and peripheral blood (FIGs. 25A-25H). A significant and uniform accumulation of the optimized B7 circRNA LNPs was observed in B cells, myeloid cells, and conventional DCs in both sets of lymph nodes, with roughly 10 to 15% DiD positivity across cell types in the inguinal lymph nodes (FIGs. 20K-20N) and roughly 40% DiD positivity in the iliac lymph nodes (FIGs. 200-20R). Whereas unoptimized 12D6.2 mRNA / circRNA LNPs demonstrated significant accumulation within T cells in the inguinal lymph nodes, optimized B7 circRNA LNPs did not, suggesting preferential accumulation in APCs, a promising phenomenon for vaccine applications. Analy sis of spleens and blood also demonstrated LNP accumulation in splenic leukocytes, though with somewhat less bias toward APC accumulation (FIGs. 25 A-25D), as well as strong accumulation of circRNA LNPs within circulating APCs (FIGs. 25E-25H). This enhanced accumulation in APCs may be in part due to the size of B7 circRNA LNPs, which may promote phagocytosis in immune tissues. All told, these data suggest that optimized B7 circRNA LNPs can localize in APCs in secondary lymphoid organs following i.m. administration and that they induce strong transfection within these tissues.

[1277] Example 9: circRNA LNPs induce durable transgene expression

[1278] A major advantage of circRNA over linear RNA species is its potential for long-lived gene expression. To assess the expression kinetics elicited by the optimized circRNA LNPs, NanoLuc expression was first evaluated in DC2.4 cells. Cells were transfected with one of four LNP formulations: 1) clinical standard ALC-0315 LNPs encapsulating mRNA, 2) 12D6.2 LNPs encapsulating mRNA, 3) unoptimized 12D6.2 LNPs encapsulating circRNA, or 4) optimized B7 LNPs encapsulating circRNA. Daily for the next 10 d, bioluminescence signal was measured using a plate reader (FIG. 21 A). Strikingly, both circRNA LNPs tested demonstrated substantially greater transgene expression than either mRNA LNP formulation, even at earlier timepoints when cap-dependent mRNA translation — which is rapid-onset and would be expected to continue until substantial RNase-mediated cargo degradation occurs — would be expected to outpace relatively slow cap-independent circRNA translation. The optimized B7 circRNA LNP formulation demonstrated remarkable transgene expression, with an area-under-the-curve (AUC) analysis identifying a nearly fourfold increase in cumulative translation compared to the unoptimized 12D6.2 circRNA formulation and an over 20-fold increase in cumulative expression compared to the 12D6.2 mRNA formulation (FIG. 21B). The relative persistence of gene expression was also assessed by comparing bioluminescenceAttorney Docket No. 046483-7495WO1(04120)

[1279] measurements to the performance of each group on the first day after transfection, observing greater expression durability in both circRNA treatment groups than in either mRNA treatment group, as expected (FIG. 21 C).

[1280] As optimized B7 circRNA LNPs demonstrated favorable in vitro expression kinetics, evaluation of the in vivo expression kinetics of the LNP formulations was undertaken. mRNA or circRNA LNPs were administered to mice i.m. and whole-body bioluminescence measurements were performed over the course of 28 d (FIGs. 21D and 21G-21 J). Here, it was observed that mRNA LNPs conferred generally higher NanoLuc expression levels, contrary to in vitro results (FIG. 21D). Notably, however, while 12D6.2 mRNA LNPs demonstrated roughly order-of-magnitude greater cumulative gene expression than unoptimized 12D6.2 circRNA LNPs throughout the study, gene expression characteristics more comparable to mRNA LNPs with optimized circRNA LNPs were observed, achieving a 2.6-fold improvement in NanoLuc expression compared to unoptimized circRNA LNPs (FIGs. 21E). This finding is consistent with prior transfection data suggesting that LNP optimization can partially rescue decreased protein production from circRNA cargo relative to mRNA (FIGs.

[1281] 20F-20J). Moreover, an apparently slower decay of luminescence signal was again observed for circRNA LNPs relative to mRNA LNPs containing the same ionizable lipid, particularly at short time points (up to seven days post-transfection) (FIGs. 21F-21G). All told, these data suggest strong durability of transgene expression lasting up to 28 d after administration, with circRNA LNP optimization substantially bolstering in vivo transgene expression.

[1282] Example 10: circRNA LNPs promote in vivo DC maturation in draining inguinal lymph nodes

[1283] Having demonstrated the transfection potential of the circRNA LNP formulations in secondary lymphoid organs and strong expression kinetics. Evaluation of the LNP immune interactions was next sought. RNA encoding the spike (S) glycoprotein of SARS-CoV-2 variant B.1.617.2 (Delta) was encapsulated in LNPs and delivered to mice via i.m. administration. The following day. iliac and inguinal lymph nodes were isolated and flow cytometric analysis of lymph node DCs, was performed, evaluating expression of the DC maturation markers CD80 and CD86 (FIG. 22A). In the iliac lymph nodes, a significant increase in CD86 expression was observed by DCs following treatment with ALC-0315 mRNA LNPs but no other significant differences (FIGs. 22D-22E). However, in the inguinal lymph nodes, significant increases in both CD80 and CD86 expression were observed by¬ DCs following treatment with B7 circRNA LNPs (FIGs. 22B-22C). These increases wereAttorney Docket No. 046483-7495WO1(04120)

[1284] comparable to those observed for clinical standard ALC-0315 mRNA LNPs, and CD86 expression was significantly greater following treatment with optimized B7 circRNA LNPs than after 12D6.2 mRNA LNP treatment. These results indicate that B7 circRNA LNPs can promote DC maturation, suggestive of effective self-adjuvanticity, an attractive property for vaccine applications.

[1285] Example 11: circRNA LNP Vaccine Against SARS-CoV-2 Produces Strong Cellular and Humoral Immune Responses

[1286] As B7 circRNA LNPs had demonstrated their potential for immune stimulation, exploration of their use for vaccination against infectious diseases was sought. LNPs encapsulating mRNA or circRNA encoding SARS-CoV-2 B.1.617.2 (Delta) S glycoprotein were formulated, immunizing mice on days 0 and 21 with one of three LNP formulations: 1) ALC-0315 mRNA LNPs, 2) 12D6.2 mRNA LNPs, or 3) optimized B7 circRNA LNPs. To investigate the potential for dose sparing, a single administration of optimized B7 circRNA LNPs on day 0 was also tested, reasoning that prolonged antigen expression following circRNA transfection might obviate the need for a second administration. On day 35. mice were euthanized and SARS-CoV-2 receptor binding domain (RBD)-specific T cell responses and serum levels of anti-RBD antibody were assessed as measures of cellular and humoral immunity, respectively (FIG. 23 A). All vaccination schemes produced high levels of anti-RBD IgG (FIGs. 23B-23D); however, the single-administration circRNA LNP vaccination approach yielded significantly lower total IgG serum levels than the prime-boost circRNA vaccination scheme (FIG. 23D). Nonetheless, optimized B7 circRNA LNPs engendered comparable levels of anti-RBD IgG2c and IgGl to clinical standard ALC-0315 mRNA LNPs (FIGs. 23C-23d) and apparently higher levels of total anti-RBD IgG than either mRNA LNP tested, demonstrating roughly 3.8-fold greater total IgG titers than ALC-0315 mRNA LNPs and roughly fivefold greater titers than 12D6.2 mRNA LNPs (FIG. 23B). Moreover, all LNP treatments following a prime-boost immunization scheme induced a Th1-skewed response as reflected by IgG2c / IgGl ratio (FIG. 23E), favorable for strong immune protection that avoids disease enhancement. In sum, optimized B7 circRNA LNPs appeared to induce a stronger humoral immune response than ALC-0315 mRNA LNPs, demonstrating the promise of this platform for circRNA vaccination.

[1287] Cellular immune responses to LNP vaccination were next evaluated by stimulating splenocytes from vaccinated mice with SARS-CoV-2 B.1.617.2 (Delta) RBD peptide.

[1288] Intracellular staining was performed to facilitate flow cytometric analysis of cytokineAttorney Docket No. 046483-7495WO1(04120)

[1289] production. Among CD4+T cells, comparable levels of Th1-associated cytokines (FIGs. 23F-23H) were observed following vaccination with ALC-0315 mRNALNPs or with optimized B7 circRNA LNPs, either with or without the boost dose. However, similar or lower levels of Th2-associated cytokines (FIGs. 23I-23K) were generally observed following vaccination with optimized B7 circRNA LNPs compared to ALC-0315 mRNALNPs, again suggestive of a Th1-shifted immune response. Cytokine production by CD8+T cells was also evaluated, observing similar or lower levels of interferon (IFN)-γ (FIG. 23L), interleukin (IL)-2 (FIG.

[1290] 23M), and tumor necrosis factor (TNF) (FIG. 23N) in groups receiving optimized B7 circRNA LNPs compared to those receiving mRNA LNPs. Similar or higher rates of CD8 IFN-';’ CD 107a T cells were also obser ed in groups receiving optimized B7 circRNA LNPs compared to mRNALNPs (FIG. 230). Moreover, increases in polyfunctional T cell frequency were observed following RNALNP vaccination (FIGs. 26A-26B). Interestingly, cytokine production was generally higher in groups receiving only a single administration of circRNA LNPs compared to those receiving a boost dose. Together with serum antibody analysis, these data suggest a Th1-biased cellular immune response to vaccination with circRNA LNPs with comparable or superior levels of humoral immunity to clinical-standard ALC-0315 mRNALNPs.

[1291] Sequence Listing

[1292] SEQ ID NO: 1

[1293] cccauaccuuggagcaacgg

[1294] SEQ ID NO: 2

[1295] cauucaacgucacaaccacc)

[1296] SEQ ID NO: 3

[1297] 5' -CGGTTTACTCTGACCCATTTC-3 '

[1298] SEQ ID NO: 4

[1299] 5' -GGGCTTTCTACAAGCTTACC-3 '

[1300] SEQ ID NO: 5

[1301] 5' -GGCTGCACTTAGAGACCACC-3 '

[1302] SEQ ID NO: 6

[1303] 5' -ATGAAGAGCTGATGCTCGCC-3 '

[1304] SEQ ID NO: 7

[1305] 5' -CCTTCCTTTAACAGAGCCCACT-3 '

[1306] SEQ ID NO: 8Attorney Docket No. 046483-7495WO1(04120)

[1307] 5' -TGGGTAAGATTTCGCAGGCA-3 '

[1308] Enumerated Embodiments

[1309] The following exemplary' embodiments are provided, the numbering of which is not to be construed as designating levels of importance:

[1310] Embodiment 1: A compound of formula (1), or a salt, stereoisomer, or isotopologue thereof

[1311] R

[1312]

[1313] -ia pib

[1314]

[1315] therein:

[1316] A is selected from the group consisting of:

[1317] N N 'N— (-L1j-N' 'N—

[1318]

[1319] R2, 'S', R1c mR1d, and R1c m; each occurrence of L1, if present, is independently selected from the group consisting of -(optionally substituted C1-C12 alkylenyl)-, -(optionally substituted C2-C12 alkenylenyl)-, -(optionally substituted C1-C12 alkynylenyl)-, -(optionally substituted C1-C12 heteroalkylenyl)-, -(optionally substituted C3-C8 cycloalkylenyl)-, -(optionally substituted C2-C8 heterocycloalkylenyl)-, -(optionally substituted C₆-C₁₀ arylenyl)-, -(optionally substituted C2-Cs heteroarylenyl)-, -(optionally substituted C1-C12 alkylenyl)-X-, -(optionally substituted C2-C12 alkenylenyl)-X-. -(optionally substituted C1-C12 alkynylenyl)-X-. -(optionally substituted C1-C12 heteroalkylenyl)-X-, -(optionally substituted C3-C8 cycloalkylenyl)-X-, -(optionally substituted C2-C8 heterocycloalkylenyl)-X-, -(optionally substituted C6-C10 arylenyl)-X-. and -(optionally substituted C2-C8 heteroarylenyl)-X-;

[1320] each occurrence of X, if present, is independently selected from the group consisting of -N(Rle)-, -[N(CH2)1-3N(R1e)(R1e)]-, -[N(CH2)1-3(C(=O))N(RA)(CH2)1-3N(R1e)(R1e)]-, - N(RA)-, -O-, and -S-;

[1321] R1a, R1b, R1c, R1d, and each occurrence of R1e, if present, are each independently selected from the group consisting of H, optionally substituted Ci-Ce alky l, and

[1322]

[1323] , wherein each of the following apply:

[1324] (i) at least one of R1a, R1b, and R1c, if present, is

[1325]

[1326] s

[1327] (ii) no more than one R1a, R1b, R1c, R1d, or R1ebonded to the same atom isAttorney Docket No. 046483-7495WO1(04120)

[1328]

[1329] (iii) one of R1aand R1bcan combine with R2to form an optionally substituted C2-C8 heterocycloalkyl, and

[1330] (iv) one of R1a, R1b, R1c, and R1dcan combine with one occurrence of L1to form an optionally substituted C2-C8 heterocycloalkyl;

[1331] R2is selected from the group consisting of optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C6 heteroalkyl, optionally substituted C3-C6 heteroalkenyl, optionally substituted C2-C8 heterocycloalkyl, and N(RA)(RB);

[1332] each occurrence of R3aand R3bis independently selected from the group consisting of optionally substituted C1-C24 alkyl, optionally substituted C2-C24 alkenyl, optionally substituted C2-C24 alkynyl, optionally substituted C1-C24 heteroalkyl, optionally substituted C2-C24 heteroalkenyl, optionally substituted C2-C24 heteroalkynyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C6-C10 aryl, and optionally substituted C2-C8 heteroaryl;

[1333] each occurrence of R4a, R4b, and R4cis independently selected from the group consisting of H and optionally substituted Ci-Ce alkyl;

[1334] Y is selected from the group consisting of -O- and -S-;

[1335] m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; and

[1336] each occurrence of RAand RBis independently selected from the group consisting of H and optionally substituted C1-C6 alkyl.

[1337] Embodiment 2: The compound of Embodiment 1, wherein R2is selected from the group consisting of:

[1338]

[1339] Embodiment 3: The compound of Embodiment 1, wherein R1band R2combine with the N atom to which they are bound to form a moiety selected from the group consisting of:

[1340]

[1341] Attorney Docket No. 046483-7495W01(04120)

[1342] _-N N— ~

[1343]

[1344] and / Embodiment 4: The compound of any one of Embodiments 1-3, wherein one of R1aand R1bis CH3or CH2CH3.

[1345] Embodiment 5: The compound of any one of Embodiments 1 -4, wherein each occurrence of L1is independently selected from the group consisting of -(CH2)I-4-, -(CH2)1-3C(=O)N(RA)-, -N(CH3)-, -N(R1e)-, -N[(CH2)1-3N(R1e)(R1e)]-, -O-, \, and

[1346]

[1347] H Embodiment 6: The compound of any one of Embodiments 1-5, wherein -(L'lm- is

[1348]

[1349] Embodiment 7: The compound of any one of Embodiments 1 -6, wherein the compound of formula (I) is selected from the group consisting of:

[1350]

[1351] Attorney Docket No. 046483-7495WO1(04120)

[1352]

[1353] Attorney Docket No. 046483-7495W01(04120)

[1354]

[1355] Embodiment 8: The compound of any one of Embodiments 1-7, wherein at least one occurrence of R1a, R1b, R1c, R1d, and R1eis independently R3aO(C=O)OR3b.

[1356] Embodiment 9: The compound of any one of Embodiments 1-8, wherein each occurrence of R3aand R3bis independently selected from the group consisting of n-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, and n-dodecyl, wherein the n-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, and n-dodecyl is optionally substituted with at least one selected from the group consisting of methyl, ethyl, n-propyl, i-propyl, n-butyl, i-butyl, t-butyl, n-pentyl, n-hexyl, n-heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, and n-dodecyl.

[1357] Embodiment 10: The compound of any one of Embodiments 1-9, wherein each occurrence of R3aand R3bis independently selected from the group consisting of:

[1358]

[1359] Attorney Docket No. 046483-7495W01(04120)

[1360]

[1361] Embodiment 11: The compound of any one of Embodiments 1-10, wherein at least one occurrence of Rla, Rlb, Rlc, Rld, and Rleis independently selected from the group consisting of:

[1362] O

[1363]

[1364] Embodiment 12: The compound of any one of Embodiments 1-11, wherein the compound is selected from the group consisting of 1D4, 1D6.2, 1D8, lD8i, 1D9.2, 1D9.8, 1D11.1, 1D11.10, 1D12.8, 1D18, 2D4, 2D6.2, 2D8, 2D8i, 2D9.2, 2D9.8, 2D11.1, 2D11.10, 2D12.8, 2D18, 3D4, 3D6.2, 3D8, 3D8i, 3D9.2, 3D9.8, 3D11.1, 3D11.10, 3D12.8, 3D18, 4D4, 4D6.2, 4D8, 4D8i, 4D9.2, 4D9.8, 4D11.1, 4D11.10. 4D12.8, 4D18. 5D4, 5D6.2, 5D8, 5D81, 5D9.2, 5D9.8, 5D11.1, 5D11.10, 5D12.8, 5D18, 6D4, 6D6.2, 6D8, 6D81, 6D9.2,Attorney Docket No. 046483-7495WO1(04120)

[1365] 6D9.8. 6D11.1. 6D11.10. 6D12.8. 6D18. 7D4. 7D6.2. 7D8. 7D81. 7D9.2. 7D9.8. 7D11.1 7D11.10. 7D12.8, 7D18. 8D4, 8D6.2, 8D8, 8D8i, 8D9.2, 8D 9.8, 8D11.1. 8D11.10. 8D12.8, 8D18, 9D4, 9D6.2, 9D8, 9D8i. 9D9.2, 9D9.8, 9D11.1, 9D11.10, 9D12.8, 9D18, 10D4, 10D6.2, 10D8, 10D8i, 10D9.2, 10D9.8, 10D11.1, 10D11.10, 10D12.8, 10D18, 11D4, 11D6.2, 11D8, 11D8i, 11D9.2, 11D9.8, 11D11.1, 11D11.10, 11D12.8, 11D18, 12D4, 12D6.2, 12D8, 12D8i, 12D9.2, 12D9.8, 12D11.1, 12D11.10, 12D12.8, 12D18, 13D4, 13D6.2, 13D8. 13D8i, 13D9.2, 13D9.8, 13D11.1. 13D11.10, 13D12.8, 13D18, 14D4, 14D6.2, 14D8, 14D8i, 14D9.2, 14D9.8, 14D11.1, 14D11.10, 14D12.8, 14D18, 15D4, 15D6.2, 15D8, 15D8i, 15D9.2, 15D9.8, 15D11.1, 15D11.10, 15D12.8, 15D18, 16D4, 16D6.2, 16D8, 16D8i, 16D9.2, 16D9.8, 16D11.1, 16D11.10, 16D12.8, 16D18, 17D4, 17D6.2, 17D8. 17D8i, 17D9.2, 17D9.8, 17D11.1. 17D11.10, 17D12.8, 17D18. 18D4, 18D6.2, 18D8, 18D8i, 18D9.2, 18D9.8, 18D11.1, 18D11.10, 18D12.8, 18D18, 19D4, 19D6.2, 19D8, 19D8i, 19D9.2, 19D9.8, 19D11.1, 19D11.10, 19D12.8, 19D18, 20D4, 20D6.2, 20D8, 20D8i, 20D9.2, 20D9.8, 20D11.1, 20D11.10, 20D12.8, 20D18, 21D4, 21D6.2, 21D8, 21D8i, 21D9.2, 21D9.8, 21D11.1, 21D11.10, 21D12.8, 21D18, 22D4, 22D6.2, 22D8. 22D81. 22D9.2, 22D9.8. 22D11.1. 22D11.10, 22D12.8. 22D18. 23D4, 23D6.2, 23D8, 23D81, 23D9.2, 23D9.8, 23D11.1, 23D11.10, 23D12.8, 23D18, 24D4, 24D6.2, 24D8, 24D8i, 24D9.2, 24D9.8, 24D11.1, 24D11.10, 24D12.8, 24D18, 25D4, 25D6.2, 25D8, 25D8i, 25D9.2, 25D9.8, 25D11.1, 25D11.10, 25D12.8, 25D18, 26D4, 26D6.2, 26D8. 26D8i, 26D9.2, 26D9.8, 26D11.1. 26D11.10, 26D12.8, 26D18. 27D4, 27D6.2, 27D8, 27D8i, 27D9.2, 27D9.8, 27D11.1, 27D11.10, 27D12.8, 27D18, 28D4, 28D6.2, 28D8, 28D8i, 28D9.2, 28D9.8, 28D11.1, 28D11.10, 28D12.8, 28D18, 29D4, 29D6.2, 29D8, 29D8i, 29D9.2, 29D9.8, 29D11.1, 29D11.10, 29D12.8, 29D18, 30D4, 30D6.2, 30D8, 30D8i, 30D9.2, 30D9.8, 30D11.1, 30D11.10, 30D12.8, 30D18, 31D4, 31D6.2, 31D8, 31D81, 31D9.2, 31D9.8, 31D11.1, 31D11.10, 31D12.8, 31D18, 32D4, 32D6.2, 32D8, 32D8i, 32D9.2, 32D9.8, 32D11.1, 32D11.10, 32D12.8, 32D18, 33D4, 33D6.2, 33D8, 33D8i, 33D9.2, 33D9.8, 33D11.1, 33D11.10, 33D12.8, 33D18, 34D4, 34D6.2, 34D8, 34D8i, 34D9.2, 34D9.8, 34D11.1, 34D11.10, 34D12.8, 34D18, 35D4, 35D6.2, 35D8. 35D8i, 35D9.2, 35D9.8, 35D11.1, 35D11.10, 35D12.8, 35D18. 36D4, 36D6.2, 36D8, 36D8i, 36D9.2, 36D9.8, 36D11.1, 36D11.10, 36D12.8, 36D18, 37D4, 37D6.2, 37D8, 37D8i, 37D9.2, 37D9.8, 37D11.1, 37D11.10, 37D12.8, 37D18, 38D4, 38D6.2, 38D8, 38D8i, 38D9.2, 38D9.8, 38D11.1, 38D11.10, 38D12.8, 38D18, 39D4, 39D6.2, 39D8. 39D8i, 39D9.2, 39D9.8, 39D11.1. 39D11.10, 39D12.8, 39D18. 40D4, 40D6.2. 40D8, 40D8i, 40D9.2. 40D9.8, 40D11.1, 40D11.10, 40D12.8, 40D18, 41D4.Attorney Docket No. 046483-7495WO1(04120)

[1366] 41D6.2, 41D8, 41D8i, 41D9.2, 41D9.8, 41D11.1, 41D11.10, 41D12.8, 41D18, 42D4, 42D6.2, 42D8, 42D8i, 42D9.2, 42D9.8, 42D11.1, 42D11.10, 42D12.8, 42D18, 43D4, 43D6.2, 43D8, 43D8i, 43D9.2, 43D9.8, 43D11.1, 43D11.10, 43D12.8, 43D18, 44D4, 44D6.2, 44D8, 44D8i, 44D9.2, 44D9.8, 44D11.1, 44D11.10, 44D12.8, 44D18, 45D4, 45D6.2, 45D8, 45D8i, 45D9.2, 45D9.8, 45D11.1, 45D11.10, 45D12.8, 45D18, 46D4, 46D6.2, 46D8, 46D8i, 46D9.2, ...

Claims

Attorney Docket No. 046483-7495W01(04120)CLAIMSWhat is claimed is:

1. A compound of formula (I), or a salt, stereoisomer, or isotopologue thereof:R1a— A— R1b),wherein:A is selected from the group consisting of:N? N— 'N— (-L1-)-SZR2, 'S', R1c mR1d, and R1c m; each occurrence of L1, if present, is independently selected from the group consisting of -(optionally substituted C1-C12 alkylenyl)-, -(optionally substituted C2-C12 alkenylenyl)-, -(optionally substituted C1-C12 alkynylenyl)-, -(optionally substituted C1-C12 heteroalkylenyl)-, -(optionally substituted C3-C8 cycloalkylenyl)-, -(optionally substituted C2-C8 heterocycloalkylenyl)-, -(optionally substituted C₆-C₁₀ arylenyl)-, -(optionally substituted C2-Cs heteroarylenyl)-, -(optionally substituted C1-C12 alkylenyl)-X-, -(optionally substituted C2-C12 alkenylenyl)-X-, -(optionally substituted C1-C12 alkynylenyl)-X-, -(optionally substituted C1-C12 heteroalkylenyl)-X-, -(optionally substituted C3-C8 cycloalkylenyl)-X-, -(optionally substituted C2-C8 heterocycloalkylenyl)-X-, -(optionally substituted C₆-C₁₀ arylenyl)-X-, and -(optionally substituted C2-C8 heteroarylenyl)-X-;each occurrence of X, if present, is independently selected from the group consisting of -N(Rle)-, -[N(CH2)1-3N(R1e)(R1e)]-, -[N(CH2)1-3(C(=O))N(RA)(CH2)1-3N(R1e)(R1e)]-, - N(RA)-, -O-, and -S-;R1a, R1b, R1c, R1d, and each occurrence of R1e, if present, are each independently selected from the group consisting of H. optionally substituted Ci-Ce alkyl, and, wherein each of the following apply:(i) at least one of Rla, Rlb, and Rlc, if present,is(ii) no more than one R1a, R1b, R1c, R1d, or R1ebonded to the same atom isAttorney Docket No. 046483-7495W01(04120)(iii) one of R1aand R1bcan combine with R2to form an optionally substituted C2-C8 heterocycloalkyl, and(iv) one of R1a, R1b, R1c, and R1dcan combine with one occurrence of L1to form an optionally substituted C2-C8 heterocycloalkyl;R2is selected from the group consisting of optionally substituted C1-C6 alkyl, optionally substituted C2-C6 alkenyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C6 heteroalkyl, optionally substituted C3-C6 heteroalkenyl, optionally substituted C2-C8 heterocycloalkyl, and N(RA)(RB);each occurrence of R3aand R3bis independently selected from the group consisting of optionally substituted C1-C24 alkyl, optionally substituted C2-C24 alkenyl, optionally substituted C2-C24 alkynyl, optionally substituted C1-C24 heteroalkyl, optionally substituted C2-C24 heteroalkenyl, optionally substituted C2-C24 heteroalkynyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C6-C10 aryl, and optionally substituted C2-C8 heteroaryl;each occurrence of R4a, R4b, and R4cis independently selected from the group consisting of H and optionally substituted Ci-Ce alkyl;Y is selected from the group consisting of -O- and -S-;m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; andeach occurrence of RAand RBis independently selected from the group consisting of H and optionally substituted C1-C6 alkyl.

2. The compound of claim 1, wherein R2is selected from the group consisting of:

3. The compound of claim 1, wherein Rlband R2combine with the N atom to which they are bound to form a moiety selected from the group consisting of:Attorney Docket No. 046483-7495W01(04120)4. The compound of any one of claims 1-3, wherein one of Rlaand Rlbis CHs or CH2CH3.

5. The compound of any one of claims 1-4. wherein each occurrence of L1is independently selected from the group consisting of -(CH2)I-4-, -(CH2)I-3C(=O)N(RA)-, - H--N N-- O N N(CH3)-, -N(Rle)-, -N[(CH2)i-3N(Rle)(Rle)]-, -0-,, and H6. The compound of any one of claims 1-5, wherein -(L^m- is selected from the group consisting of:-(CH2)2-, -(CH2)3-, -(CH2)6-,7. The compound of any one of claims 1-6, wherein the compound of formula (I) is selected from the group consisting of:Attorney Docket No. 046483-7495WO1(04120)Attorney Docket No. 046483-7495W01(04120)8. The compound of any one of claims 1-7. wherein at least one occurrence of Rla, Rlb,Rlc, Rld, and Rleis independently9. The compound of any one of claims 1-8, wherein each occurrence of R3aand R3bis independently selected from the group consisting of w-butyl, n-pentyl, n-hexyl, w-heptyl, n-octyl, n-nonyl, M-decyl, n-undecyl, and n-dodecyl, wherein the n-butyl, n-pentyl, n-hexyl, n-heptyl, zz-octyl, / ?-nony I. rz-decyl, n-undecyl. and n-dodecyl is optionally substituted with at least one selected from the group consisting of methyl, ethyl, w- propyl, z-propyl, «-butyl, z-Attorney Docket No. 046483-7495W01(04120)buty l, t-butyl, n-pentyl, n -hexyl, n-heptyl, n-octyl, n-nonyl, n-decyl, w-undecyl, and n-dodecyl.

10. The compound of any one of claims 1-9, wherein each occurrence of R3aand R3bis independently selected from the group consisting of:

11. The compound of any one of claims 1-10, wherein at least one occurrence of Rla, Rlb, Rlc, Rld, and Rleis independently selected from the group consisting of:Attorney Docket No. 046483-7495W01(04120)12. The compound of any one of claims 1-11, wherein the compound is selected from the group consisting of 1D4. 1D6.2, 1D8, lD8i. 1D9.2, 1D9.8, 1D11.1, 1D11.10, 1D12.8, 1D18, 2D4, 2D6.2, 2D8, 2D8i, 2D9.2, 2D9.8, 2D11.1, 2D11.10, 2D12.8, 2D18, 3D4, 3D6.2, 3D8, 3D8i, 3D9.2, 3D9.8, 3D11.1, 3D11.10, 3D12.8, 3D18, 4D4, 4D6.2, 4D8, 4D8i, 4D9.2, 4D9.8, 4D11.1, 4D11.10, 4D12.8, 4D18, 5D4, 5D6.2, 5D8, 5D8i, 5D9.2, 5D9.8, 5D11.1, 5D11.

10. 5D12.8, 5D18. 6D4, 6D6.2, 6D8, 6D8i, 6D9.2, 6D9.8, 6D11.1, 6D11.10, 6D12.8, 6D18, 7D4, 7D6.2, 7D8. 7D8i, 7D9.

2. 7D9.

8. 7D11.1, 7D11.10, 7D12.

8. 7D18, 8D4, 8D6.2, 8D8, 8D8i, 8D9.2, 8D9.8, 8D11.1, 8D11.10, 8D12.8, 8D18, 9D4, 9D6.2, 9D8, 9D8i, 9D9.2, 9D9.8, 9D11.1, 9D11.10, 9D12.8, 9D18, 10D4, 10D6.2, 10D8, 10D8i, 10D9.2, 10D9.8, 10D11.1, 10D11.10, 10D12.8, 10D18. 11D4, 11D6.

2. 11D8, 11D81, 11D9.2, 11D9.8, 11D11.

1. 11D11.10, 11D12.

8. 11D18. 12D4, 12D6.

2. 12D8, 12D8i, 12D9.

2. 12D9.8, 12D11.1, 12D11.10, 12D12.8, 12D18, 13D4, 13D6.2, 13D8, 13D8i, 13D9.2, 13D9.8, 13D11.1, 13D11.10, 13D12.8, 13D18, 14D4, 14D6.2, 14D8, 14D81, 14D9.2, 14D9.8, 14D11.1, 14D11.10, 14D12.8, 14D18, 15D4, 15D6.2, 15D8, 15D81, 15D9.2, 15D9.8, 15D11.

1. 15D11.10, 15D12.8, 15D18. 16D4, 16D6.

2. 16D8, 16D8i, 16D9.2, 16D9.8, 16D11.

1. 16D11.

10. 16D12.

8. 16D18. 17D4, 17D6.

2. 17D8, 17D81, 17D9.

2. 17D9.8, 17D11.1, 17D11.10, 17D12.8, 17D18, 18D4, 18D6.2, 18D8, 18D8i, 18D9.2, 18D9.8, 18D11.1, 18D11.10, 18D12.8, 18D18, 19D4, 19D6.2, 19D8, 19D81, 19D9.2, 19D9.8, 19D11.1, 19D11.10, 19D12.8, 19D18. 20D4, 20D6.

2. 20D8, 20D81, 20D9.2, 20D9.8, 20D11.

1. 20D11.10, 20D12.

8. 20D18. 21D4, 21D6.

2. 21D8, 21D8i, 21D9.

2. 21D9.8, 21D11.1, 21D11.10, 21D12.8, 21D18, 22D4, 22D6.2, 22D8, 22D8i, 22D9.2, 22D9.8, 22D11.1, 22D11.10, 22D12.8, 22D18, 23D4, 23D6.2, 23D8, 23D81, 23D9.2, 23D9.8, 23D11.1, 23D11.10, 23D12.8, 23D18, 24D4, 24D6.2, 24D8, 24D81, 24D9.2, 24D9.8,Attomey Docket No. 046483-7495W01(04120)24D11.1, 24D11.10, 24D12.8, 24D18, 25D4, 25D6.2, 25D8, 25D81, 25D9.2, 25D9.8, 25D11.

1. 25D11.10, 25D12.

8. 25D18. 26D4, 26D6.

2. 26D8, 26D8i, 26D9.

2. 26D9.8, 26D11.1, 26D11.10, 26D12.8, 26D18, 27D4, 27D6.2, 27D8, 27D8i, 27D9.2, 27D9.8, 27D11.1, 27D11.10, 27D12.8, 27D18, 28D4, 28D6.2, 28D8, 28D8i, 28D9.2, 28D9.8, 28D11.1, 28D11.10, 28D12.8, 28D18, 29D4, 29D6.2, 29D8, 29D8i, 29D9.2, 29D9.8, 29D11.

1. 29D11.10, 29D12.8, 29D18. 30D4, 30D6.

2. 30D8, 30D8i, 30D9.2, 30D9.8, 30D11.

1. 30D11.

10. 30D12.

8. 30D18. 31D4, 31D6.

2. 31D8, 31D81, 31D9.

2. 31D9.8, 31D11.1, 31D11.10, 31D12.8, 31D18, 32D4, 32D6.2, 32D8, 32D8i, 32D9.2, 32D9.8, 32D11.1, 32D11.10, 32D12.8, 32D18, 33D4, 33D6.2, 33D8, 33D81, 33D9.2, 33D9.8, 33D11.1, 33D11.10, 33D12.8, 33D18. 34D4, 34D6.

2. 34D8, 34D81, 34D9.2, 34D9.8, 34D11.

1. 34D11.10, 34D12.

8. 34D18. 35D4, 35D6.

2. 35D8, 35D8i, 35D9.

2. 35D9.8, 35D11.1, 35D11.10, 35D12.8, 35D18, 36D4, 36D6.2, 36D8, 36D8i, 36D9.2, 36D9.8, 36D11.1, 36D11.10, 36D12.8, 36D18, 37D4, 37D6.2, 37D8, 37D81, 37D9.2, 37D9.8, 37D11.1, 37D11.10, 37D12.8, 37D18, 38D4, 38D6.2, 38D8, 38D81, 38D9.2, 38D9.8, 38D11.

1. 38D11.10, 38D12.8, 38D18. 39D4, 39D6.

2. 39D8, 39D8i, 39D9.2, 39D9.8, 39D11.

1. 39D11.

10. 39D12.

8. 39D18. 40D4, 40D6.

2. 40D8, 40D81, 40D9.

2. 40D9.8, 40D11.1, 40D11.10, 40D12.8, 40D18, 41D4, 41D6.2, 41D8, 41D8i, 41D9.2, 41D9.8, 41D11.1, 41D11.10, 41D12.8, 41D18, 42D4, 42D6.2, 42D8, 42D8i, 42D9.2, 42D9.8, 42D11.

1. 42D11.10, 42D12.8, 42D18. 43D4, 43D6.

2. 43D8, 43D8i, 43D9.2, 43D9.8, 43D11.

1. 43D11.10, 43D12.

8. 43D18. 44D4, 44D6.

2. 44D8, 44D8i, 44D9.

2. 44D9.8, 44D11.1, 44D11.10, 44D12.8, 44D18, 45D4, 45D6.2, 45D8, 45D8i, 45D9.2, 45D9.8, 45D11.1, 45D11.10, 45D12.8, 45D18, 46D4, 46D6.2, 46D8, 46D81, 46D9.2, 46D9.8, 46D11.1, 46D11.10, 46D12.8, 46D18, 47D4, 47D6.2, 47D8, 47D81, 47D9.2, 47D9.8, 47D11.

1. 47D11.10, 47D12.

8. 47D18. 48D4, 48D6.

2. 48D8, 48D8i, 48D9.

2. 48D9.8, 48D11.1, 48D11.10, 48D12.8, 48D18, 49D4, 49D6.2, 49D8, 49D81, 49D9.2, 49D9.8, 49D11.1, 49D11.10, 49D12.8, 49D18, 50D4, 50D6.2, 50D8, 50D8i, 50D9.2, 50D9.8, 50D11.1, 50D11.10, 50D12.8, and 50D18.

13. The compound of any one of claims 1-12, wherein the compound is selected from the group consisting of:Attorney Docket No. 046483-7495W01(04120)dioctyl (3-((1,4-bis(octyloxy)-1,4-dioxobutan-2-yl)(3- (dimethylamino)propyl)amino)propyl)aspartate (5D8), andtetrakis(2-ethylhexyl) 2,2'-((piperazine-l,4-diylbis(propane-3,l- diyl))bis(azanediyl))disuccinate (12D6.2).

14. A lipid nanoparticle (LNP) composition comprising:(a) at least one ionizable lipid, wherein the at least one ionizable lipid comprises at least one compound of formula (I) of any one of claims 1-13; (b) at least one neutral lipid;(c) at least one cholesterol lipid and / or a modified derivative thereof; and (d) at least one polymer-conjugated lipid and / or a modified derivative thereof.

15. The LNP of claim 14, wherein the at least one ionizable lipid compound comprises about 10 mol% to about 90 mol% of the LNP, optionally wherein the at least one ionizable lipid compound comprises about 40 mol% or about 48.3 mol% of the LNP.

16. The LNP of claim 14 or 15, wherein the at least one neutral lipid comprises about 1 mol% to about 40 mol% of the LNP, optionally wherein the at least one neutral lipid comprises about 8.9 mol% or about 10 mol% of the LNP.Attorney Docket No. 046483-7495W01(04120)17. The LNP of any one of claims 14-16, wherein the neutral lipid comprises or consists essentially of at least one neutral lipid selected from the group consisting of ddioleoylphosphatidylethanolamine (DOPE), distearoylphosphatidylcholine (DSPC), 1-stearoyl-2-oleoyl-5n-glycero-3-phosphocholine (SOPC), and dioleoylphosphatidylcholine (DOPC), optionally wherein the neutral lipid comprises or consists essentially of ddioleoylphosphatidylethanolamine (DOPE) or l-stearoyl-2-oleoyl-i7?-glycero-3-phosphocholine (SOPC).

18. The LNP of any one of claims 14-17, wherein the at least one cholesterol lipid and / or modified derivative thereof comprises about 20 mol% to about 75 mol% of the LNP, optionally wherein the at least one cholesterol lipid and / or modified derivative thereof comprises about 40.9 mol% or about 48.5 mol% of the LNP.

19. The LNP of any one of claims 14-18, wherein the at least one cholesterol lipid and / or modified derivative thereof comprises or consists essentially of cholesterol.

20. The LNP of any one of claims 14-19, wherein the at least one polymer-conjugated lipid comprises about 0.1 mol% to about 15 mol% of the LNP, optionally wherein the at least one polymer-conjugated lipid comprises about 1.5 mol% or about 1.9 mol% of the LNP.

21. The LNP of any one of claims 14-20, wherein the at least one polymer-conjugated lipid comprises or consists essentially of l,2-dimyristoyl-rac-glycero-3-methoxypoly ethylene gly col-2000 (DMG-PEG 2000) or 1.2-dimyristoyl-sn-glycero-3-phosphoethanolamine-N-[methoxy(polyethylene glycol)-2000] (C14-PEG 2000).

22. The LNP of any one of claims 14-21, wherein the LNP has a molar ratio of (a): (b): (c): (d) of about 40:10:48.5:1.5 or about 65:12:55:2.5.

23. The LNP of any one of claims 14-22, wherein the LNP further comprises at least one cargo selected from the group consisting of a nucleic acid molecule and a therapeutic agent.

24. The LNP of claim 23, wherein the therapeutic agent is at least one selected from the group consisting of a small molecule, a protein, and an antibody.Attorney Docket No. 046483-7495W01(04120)25. The LNP of claim 24, wherein the LNP comprises a nucleic acid molecule.

26. The LNP of claim 25, wherein the nucleic acid molecule is a DNA molecule or an RNA molecule.

27. The LNP of claim 25 or 26, wherein the nucleic acid molecule is selected from the group consisting of cDNA, circRNA, mRNA, miRNA, siRNA, modified RNA, antagomir, antisense molecule, and a targeted nucleic acid, or any combination thereof.

28. The LNP of any one of claims 25-27, wherein the nucleic acid molecule encodes a chimeric antigen receptor (CAR).

29. The LNP of claim 28, wherein the CAR is specific for binding to a surface antigen of a pathogenic cell.

30. The LNP of any one of claims 25-29, wherein the nucleic acid molecule encodes at least one selected from the group consisting of mRNA, sgRNA, and circRNA.

31. The LNP of claim 30, wherein the mRNA encodes a therapeutic protein, optionally wherein the therapeutic protein is a CRISPR-associated protein, and optionally wherein the CRISPR-associated protein is CRISPR-associated protein 9 (Cas9).

32. The LNP of claim 29, wherein the therapeutic agent is a CRISPR-associated protein, optionally wherein the CRISPR-associated protein is CRISPR-associated protein 9 (Cas9).

33. The LNP of claim 30, wherein the circRNA encodes a therapeutic protein, optionally wherein the therapeutic protein comprises an antigen.

34. The LNP of claim 33, wherein the circRNA encodes a SARS-CoV glycoprotein, optionally wherein the SARS-CoV glycoprotein is a SARS-CoV-2 glycoprotein, and optionally wherein the SARS-CoV glycoprotein is SARS-CoV-2 B.1.6.17.2 (Delta) S glycoprotein.

35. A pharmaceutical composition comprising the lipid nanoparticle (LNP) of any one ofAttorney Docket No. 046483-7495W01(04120)claims 14-34 and at least one pharmaceutically acceptable carrier.

36. A method of treating, ameliorating, and / or preventing at least one disease, disorder, or condition in a subject in need thereof, the method comprising administering a therapeutically effectively amount of at least one LNP of any one of claims 14-34 and / or the pharmaceutical composition of claim 35 to the subject.

37. The method of claim 36, wherein the disease, disorder, or condition is selected from the group consisting of cancer, immune-mediated diseases, cardiovascular disease, a viral infection, a bacterial infection, and a metabolic disease.

38. The method of claim 36 or 37, wherein the viral infection comprises SARS-CoV-2.

39. The method of any one of claims 36-38, wherein the LNP comprises circRNA.

40. The method of claim 39, wherein the circRNA encodes a therapeutic protein, optionally wherein the therapeutic protein comprises an antigen.

41. The method of claim 40, wherein the circRNA encodes a S ARS-CoV glycoprotein, optionally wherein the S ARS-CoV glycoprotein is a SARS-CoV-2 glycoprotein, and optionally wherein the SARS-CoV glycoprotein is SARS-CoV-2 B.1.6.17.2 (Delta) S glycoprotein.

42. A method of genome editing a mutated gene sequence associated with a disease or disorder in a subject, the method comprising administering to the subject at least one lipid nanoparticle (LNP) of any one of claims 14-34 and / or the pharmaceutical composition of claim 35.

43. The method of claim 42, wherein the nucleic acid cargo comprises a mRNA encoding a base editor and a single guide RNA (sgRNA).

44. The method of claim 43, wherein the sgRNA is targeted to a DNA sequence of the mutated gene sequence associated with the disease or disorder in the subject.Attorney Docket No. 046483-7495W01(04120)45. The method of any one of claims 36-44, wherein the subject is a mammal.

46. The method of any one of claims 36-45, wherein the subject is a human.

47. A method for delivering a therapeutic cargo to an immune cell of a subject, the method comprising administering to the subject at least one lipid nanoparticle (LNP) of any one of claims 14-34 and / or the pharmaceutical composition of claim 35.

48. The method of claim 47, wherein the LNP comprises circRNA.

49. The method of claim 48, wherein the circRNA encodes a therapeutic protein, optionally wherein the therapeutic protein comprises an antigen.

50. The method of any one of claims 47-49, wherein the LNP comprises LNP B7.

51. A method for preparing a compound of formula (I), or a salt, stereoisomer, or isotopologue thereofR1a— A — R1b(i).the method comprising:contacting a compound of formula (A): R5aB R5b(A), andR4aOR3, Yy\AYR3ba compound of formula (B): O R;wherein:7ZN — (" L1j — A is selected from the group consisting ofR6, S', R1cR1d, and 'N— (L1-)— SZR1< / each occurrence of L1, if present, is independently selected from the group consisting of -(optionally substituted C1-C12 alkylenyl)-, -(optionally substituted C2-C12 alkenylenyl)-, -(optionally substituted C1-C12 alkynylenyl)-, -(optionally substituted C1-C12 heteroalkylenyl)-, -(optionally substituted C3-C8 cycloalkylenyl)-, -(optionally substituted C2-C8 heterocycloalkylenyl)-, -(optionally substituted C₆-C₁₀ arylenyl)-, -(optionally substituted C2-Attorney Docket No. 046483-7495W01(04120)C's heteroarylenyl)-, -(optionally substituted C1-C12 alkylenyl)-X-, -(optionally substituted C2-C12 alkenylenyl)-X-, -(optionally substituted C1-C12 alkynylenyl)-X-. -(optionally substituted C1-C12 heteroalkylenyl)-X-, -(optionally substituted Cs-Cs cycloalkylenyl)-X-, -(optionally substituted C2-C8 heterocycloalkylenyl)-X-, -(optionally substituted C₆-C₁₀ arylenyl)-X-, and -(optionally substituted C2-C8 heteroarylenyl)-X-;each occurrence of X, if present, is independently selected from the group consisting of -N(Rle)-, -[N(CH2)1-3N(R1e)(R1e)]-. -[N(CH2)1-3(C(=O))N(RA)(CH2)1-3N(R1e)(R1e)]-. - N(RA)-, -O-, and -S-;R1a, R1b, R1c, R1d, and each occurrence of R1e, if present, are each independently selected from the group consisting of H, optionally substituted Ci-Ce alkyl, and, wherein each of the following apply:(1) at least one of Rla, Rlb, and Rlc, if present, is(ii) no more than one R1a, R1b, R1c, R1d, or R1ebonded to the same atom is(iii) one of R1aand R1bcan combine with R2to form an optionally substituted C2-C8 heterocycloalkyl, and(iv) one of R1a, R1b, R1c, and R1dcan combine with one occurrence of L1to form an optionally substituted C2-C8 heterocycloalkyl;each occurrence of R3aand R3bis independently selected from the group consisting of optionally substituted C1-C24 alkyl, optionally substituted C2-C24 alkenyl, optionally substituted C2-C24 alkynyl, optionally substituted C1-C24 heteroalkyl, optionally substituted C2-C24 heteroalkenyl, optionally substituted C2-C24 heteroalkynyl, optionally substituted C3-C8 cycloalkyl, optionally substituted C2-C8 heterocycloalkyl, optionally substituted C6-C10 aryl, and optionally substituted C2-C8 heteroaryl;each occurrence of R4a, R4b, and R4cis independently selected from the group consisting of H and optionally substituted Ci-Ce alkyl;Y is selected from the group consisting of -O- and -S-;Attomey Docket No. 046483-7495W01(04120)m is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10;B is selected from the group consisting of:? 'K 'N— (-L2)-NZ'N— (-L2)-SZR2, 'S', R5C / n\5d, and R5c / m; each occurrence of L2, if present, is independently selected from the group consisting of -(optionally substituted C1-C12 alkylenyl)-, -(optionally substituted C2-C12 alkenylenyl)-, -(optionally substituted C1-C12 alkynylenyl)-, -(optionally substituted C1-C12 heteroalkylenyl)-, -(optionally substituted Cs-Cs cycloalkylenyl)-, -(optionally substituted C2-C8 heterocycloalkylenyl)-, -(optionally substituted C₆-C₁₀ arylenyl)-, -(optionally substituted C2-Cs heteroarylenyl)-, -(optionally substituted C1-C12 alkylenyl)-Z-, -(optionally substituted C2-C12 alkenylenyl)-Z-, -(optionally substituted C1-C12 alkynylenyl)-Z-, -(optionally substituted C1-C12 heteroalkylenyl)-Z-, -(optionally substituted C3-C8 cycloalkylenyl)-Z-, -(optionally substituted C2-C8 heterocycloalkylenyl)-Z-, -(optionally substituted C₆-C₁₀ arylenyl)-Z-, and -(optionally substituted C2-C8 heteroarylenyl)-Z-;each occurrence of Z, if present, is independently selected from the group consisting of -N(R5e)-, -[N(CH2)i-3N(R5e)(R5e)]-, -[N(CH2)i-3(C(=O))N(RA)(CH2)i-3N(R5e)(R5e)]-, - N(RA)-, -O-, and -S-;R5a, R5b, R5C, R5d, and each occurrence of R5e, if present, are each independently selected from the group consisting of H and optionally substituted Ci-Ce alkyl, wherein at least one of R5a, R5b, and R5c, if present, is H,one of R5aand R5bcan combine with R6to form an optionally substituted C2-C8 heterocycloalkyl, andone of R5a, R5b, R3c, and R5dcan combine with one occurrence of L2to form an optionally substituted C2-C8 heterocycloalkyl;R6is selected from the group consisting of optionally substituted Ci-Ce alky l, optionally substituted C2-C6 alkenyl, optionally substituted Cs-Cs cycloalkyd, optionally substituted C2-C6 heteroalkyl, optionally substituted C3-C6 heteroalkenyl, optionally substituted C2-C8 heterocycloalkyl, and N(RA)(RB);n is 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10; andeach occurrence of RAand RBis independently selected from the group consisting of H and optionally substituted C1-C6 alkyl.

52. The method of claim 51, wherein at least one of the following applies:Attorney Docket No. 046483-7495W01(04120)(a) the contacting occurs at a temperature of about 85 °C.(b) the contacting occurs for a period of about 24-48 hours.

53. The method of claim 51 or 52, wherein R6is selected from the group consisting of:

54. The method of any one of claims 51-53, wherein R5ais H and R5band R6combine with the N atom to which they are bound to form a moiety selected from the group consisting of:and55. The method of any one of claims 51-54, wherein one of R5aand R5bis CH3 or CH2CH3.

56. The method of any one of claims 51-55, wherein each occurrence of L2is independently selected from the group consisting of -(CH2)I-4-, -(CH2)I-3C(=O)N(RA)-, - H'N^O--N Cr K '' N(CHs)-, -N(R5e)-, -N[(CH2)i-3N(R5e)(R5e)]-, -O-, \, and H57. The method of any one of claims 51-56, wherein -(L2)n- is selected from the group consisting of:N-(CH2)2-, -(CH2)3-, -(CH2)6-, R5eAttorney Docket No. 046483-7495W01(04120)58. The method of any one of claims 1-57, wherein the compound of formula (A) is selected from the group consisting of:I H KI _ NHn zN\ / N^Ns^\ / NH2'^^NH2H2N^^2I | ^NHo I H2N2H2N ^^ NH2H2N^ / X^N^^^NH2Attorney Docket No. 046483-7495W01(04120)^^^ ^ H2N^O-^O^NH20H59. The method of any one of claims 1-58, wherein the compound of formula (B) is selected from the group consisting of:

60. The method of any one of claims 51-59, wherein each occurrence of R3aand R3bis independently selected from the group consisting of w-butyl. n-pentyl, n-hexyl, / / -heptyl, n-octyl, n-nonyl, n-decyl, n-undecyl, and n-dodecyl, wherein the n-butyl, -pentyl, -hexyl, n-heptyl, w-octyl, / / -nonyl. / / -decyl, / / -undecyl. and / / -dodecyl is optionally substituted with at least one selected from the group consisting of methyl, ethyl, n- propyl, z-propyl, / / -butyl, i-butyl, / -butyl, n-pentyl, / / -hexyl, / / -heptyl, / / -octyl, / / -nonyl, / / -decyl, / / -undecyl, and n-dodecyl.

61. The method of any one of claims 51-60. wherein each occurrence of R3aand R3bis independently selected from the group consisting of:Attomey Docket No. 046483-7495W01(04120)62. The method of any one of claims 51-61, wherein the compound of formula (B) is selected from the group consisting of: