Methods for diagnosing als

Abstract

Disclosed is a method of diagnosing a subject with ALS, the method including measuring the amount of OxPL on apolipoprotein E, E2, E3 and / or E4.

Description

Docket No. 00015-444WO1METHODS FOR DIAGNOSING ALSCROSS REFERENCE TO RELATED APPLICATION(S)

[0001] This application claims priority to U. S. Provisional Application No.63 / 747,769, filed on January 21. 2025, the disclosures of which are incorporated herein by reference in their entirety.TECHNICAL FIELD

[0002] The disclosure provides methods for amyotrophic lateral sclerosis (ALS) diagnosis or progression based upon measuring the levels of oxidized phospholipids (OxPL) in cerebral fluid or neurological tissue. In a specific embodiment, the disclosure provides method for ALS diagnosis and / or progression based upon the levels of OxPL associated with apolipoprotein E in cerebral fluid and / or neurological tissue.SEQUENCE LISTING INCORPORATION BY REFERENCE

[0003] Accompanying this filing is a Sequence Listing entitled “00015-444W01.xml” created on January 21, 2026 and having 11,011 bytes of data machine formatted on IBM-PC, MS-Windows operating system. The sequence listing is hereby incorporated by reference in its entirety for all purposes.BACKGROUND

[0004] Amyotrophic lateral sclerosis (ALS) is a degenerative neuromuscular disease characterized by the progressive degeneration of motor neurons in the brain and spinal cord. Most patients die within three to five years of diagnosis, typically due to respiratory failure. Current treatments largely focus on symptom management. While a small subset of ALS cases are linked to mutations in genes such as SOD1, C9orf72, or FUS. the majority are classified as sporadic ALS (sALS). TDP-43 pathology or proteinopathy, present in 97% of all ALS patients, involves the mislocalization of TDP-43 from the nucleus to the cytoplasm, leading to the formation of toxic aggregates. TDP-43 is essential for chromatin remodeling, RNA metabolism, proteostasis, stress granule formation, and mitochondrial function and dysfunction of TDP-43 has been shown to impact motor health negatively.

[0005] Several mechanisms of programmed cell death including apoptosis, necroptosis and ferroptosis have been proposed to cause motor neuron death in ALS.However, evidence does not support apoptosis as a key driver, and a recent clinical trial targeting of RIPK1, a critical necroptosis mediator, failed to show therapeutic benefits in ALS patients (Phase 2 HIMALAYA; SAR443820). Conversely, ferroptosis - a form of cellDocket No. 00015-444WO1death driven by iron-dependent reactive oxygen species (ROS) formation - has been shown to selectively affect motor neurons in ALS. Glutathione peroxidase 4 (GPX4), the main intracellular inhibitor of ferroptosis, plays a crucial role, and GPX4-deficient mice exhibit motor neuron-specific degeneration. A distinct feature of ferroptosis is the extensive oxidation of poly-unsaturated fatty acids (PUFA) in comparison to other forms of cell death. In ALS, motor neurons exhibit increased glycerophospholipid metabolism compared to unaffected ocular motor neurons.SUMMARY

[0006] The disclosure provides methods and compositions for measurement of the amount of oxidized phospholipids (OxPL) on a protein called apolipoprotein E (APOE). APOE is a hereditary protein associated with diseases that can cause dementia or muscle weakness. Measurement of oxidized phospholipids on apoE (OxPL-APOE) with a simple laboratory test allows the detection of people at risk for dementia or muscle weakness. It may also be used to ascertain the effectiveness of therapies. For example, one would predict if the levels of OxPL-APOE decline with therapy, the patient is responding to treatment.

[0007] The disclosure provides a method for determining and / or distinguishing an ALS disease or disorder in a subject, the method comprising: a) obtaining a sample from the subject; b) contacting the sample with a substrate comprising an antibody, antibody fragment or non-immunoglobulin binding domains that bind to PC-OxPL under conditions such that PC-OxPL binds to the antibody, antibody fragment or non-immunoglobulin binding domains; c) contacting bound PC-OxPL with an agent that binds to ApoE and / or ApoE4; d) comparing the levels of ApoE-PC-OxPL and / or ApoE4-PC-OxPL to a standard curve; e) identifying an amount of PC-OxPL bound to ApoE and / or ApoE4 in the sample based upon the standard curve, wherein the amount is indicative of an ALS disease or disorder. In one embodiment, the sample is neurological tissue or cerebral fluid. In another embodiment, the agent comprises a label selected from the group consisting of a fluorescent molecule, a luminescent molecule, an enzyme, and a radiolabel. In another embodiment, the antibody, antibody fragment or non-immunoglobulin binding domains that bind to PC-OxPL is an EO6 antibody or a fragment thereof.

[0008] The disclosure also provides a method for determining whether a subject has or is at risk of having ALS, the method comprising: (a) determining the subject's OxPL levels in plasma, cerebral spinal fluid, neurological tissue or the like, wherein a level of OxPL higher than a normal control is indicative of ALS or a risk of having ALS. In oneDocket No. 00015-444WO1embodiment, the OxPL is associated with apolipoprotein E (ApoE) particles. In another embodiment, the OxPL is associated with ApoE or ApoE4. In still another embodiment, the subject is a human subject. In yet another embodiment, the OxPL and apoE is measured in an immunoassay using an antibody the interacts with OxPL and an antibody that interacts with apoE. In another embodiment, the antibody that interacts with OxPL is E06.

[0009] The disclosure also provides a kit or article of manufacture for determining ALS in a subject or a subject's predisposition to ALS, the kit comprising: (a) agents suitable for determining a subject's cerebral fluid OxPL level; (b) agents suitable for determining the subject's cerebral fluid ApoE content; (c) instructions for using the kit to determine the level of OxPL on ApoE in cerebral fluid. In one embodiment, the agents are antibodies. In a further embodiment, the antibodies are monoclonal antibodies. In still a further embodiment, one antibody is E06 or has the binding affinity of an E06 antibody. In still another embodiment, the kit further comprises one or more detectable labels that can be conjugated or are conjugated to one or more agents.BRIEF DESCRIPTION OF THE DRAWINGS

[0010] Figure 1A-F shows PC-OxPL accumulates in the brain and spinal cord of ALS patients. (A) Representative images of PC-OxPL pathology, as recognized using the hE06 full-length antibody, across the different stages that characterize ALS pathology and progression. Scale bar= 100 pM. (B) Left panel. Representative images of PC-OxPL accumulation in the spinal cord of ALS patients and non-demented controls (NDC). Scale bar = 100 pM. Right panel. Quantification of PC-OxPL accumulation in the spinal cord of ALS patients and non-demented controls (NDC), as per infrared (IR) area and mean signal intensity. Values are expressed as means ± SEM. N = 2 individuals per group. (C) Left panel. Representative images of PC-OxPL and ChAT co-localization in the grey matter region of the spinal cord. Scale bar = 100 pM. Right panel. Line profiling of hE06 / PC-OxPL and ChAT or DAPI co-localization in the grey matter region of the spinal cord. The profile is plotted as the intensity of each channel (AF 647, AF 488 or DAPI) per pixel. (D) Colocalization profile of hE06 / PC-OxPL with ChAT (upper panel) and DAPI (lower panel). (E) FC of individual (Ox)PC species in CSF from ALS patients compared to HC. Values are expressed as means (n = 15). (F) FC of individual (Ox)PC species in plasma from ALS patients compared to HC. Values are expressed as means (n = 15). Individual data points / SDs are omitted in (E) and (F) for clarity. Two-tailed Welch’s t-test, ***p < 0.001: ’"’^p < 0.01, *p < 0.05, ns, p > 0.05.Docket No. 00015-444WO1

[0011] Figure 2A-F shows PONPC induces ALS-like signatures in motor neurons.(A) Dot plot representation of the 20 most enriched independent processes among the DE genes in wt motor neurons exposed to PONPC. Gene expression data from both Neuroinflammation and Neuropathology were used in the analysis. All pathways are sorted by Fold Enrichment value. (B) Venn diagram depicting overlapping transcripts changed following PONPC treatment of wt and ALS (TDP-43M337Vand SOD1G93A) motor neurons according to the deregulated neuropathology (top) and neuroinflammation (bottom) NanoString nCounter panels. (C) Venn diagram showing ALS-like transcriptome signatures in wt neurons exposed to PONPC. D’ Erchia et al (2017) and ALSoD were used as reference ALS-relevant databases for overlap comparison. (D) Heatmap representation of PONPC / ALS-related expression changes following wt motor neuron exposure to PSPC or PONPC. Transcripts derived from neuropathology NanoString nCounter panels overlap with ALS databases. Expression changes are displayed as FC and normalized to the wt + PSPC condition. (E) PC-OxPL (PONPC) treatment of wt motor neurons impairs neuronal outgrowth. Left panel: Values are expressed as means ± SEM and were normalized to 25 pM PSPC condition. Two-way ANOVA, *p=0.0368; n = three independent experiments, one to four replicates. Right panel: Representative images showing decreased neuronal outgrowth following PC-OxPL (PONPC) treatment of Axol motor neurons. Scale bar = 100 pM (Tuj-1 (Neuron-specific class III beta-tubulin), Cy5). (F) TDP-43 aggregation in wt and TDP-43M337Vmotor neurons exposed to PSPC or PC-OxPL. TDP-43 aggregation is shown as the ratio of aggregation measured by the HTRF TDP-43 assay. Values are expressed as means ± SEM, normalized to the assay positive control. Ordinary one-way ANOVA with Tukey’s multiple comparison test, ***p < 0.001; n= two independent experiments, six replicates.

[0012] Figure 3A-E shows that exposure to PC-OxPL triggers APOE expression, which is the main carrier of PC-OxPL in the CSF. (A) APOE transcript expression in motor neurons exposed to either PSPC or PONPC, as determined by NanoString nCounter analysis. Values are expressed as means ± SEM. (B) Upper panel: Elevated APOE profile (% positive cells and average intensity) in wt motor neurons exposed to PONPC according to different washout periods. Values are expressed as means ± SEM. Two-way ANOVA with Sidak’s multiple comparisons test, **p=0.0064, *p = 0.0167, ns, p > 0.05; n = four, two independent experiments. Lower panel: Representative images showing increased APOE profile in wt motor neurons at 24 h PONPC treatment + 24 h washout. Scale bar = 20 LIM (APOE, FITC).(C) PC-OxPL levels as detected on the surface of different apolipoprotein particles asDocket No. 00015-444WO1measured in paired CSF and plasma from ALS patients. Values are expressed as means ± SEM and each dot represents a single individual (n = 15). One-way ANOVA with Dunnett's multiple comparisons test, ****p < 0.0001, ***p = 0.0007, **p = 0.0015, ns, p > 0.05. (D) Upper panel. Representative images of APOE profile in the spinal cord regions (grey and white matter) of NDC and ALS individuals. Scale bar = 100 pM. Lower panel. APOE expression, as determined by infrared (IR) area and mean signal intensity in the spinal cord regions (grey and white matter) of NDC and ALS individuals. Values are expressed as means ± SEM; n = NDC or ALS individuals per group. (E) APOE concentrations as detected in paired CSF and plasma from ALS patients compared to HC. Values are expressed as means ± SEM and each dot represents a single individual (n = 15). Mann-Whitney U test, ****p < 0.0001. ns. p > 0.05.

[0013] Figure 4A-B shows (A) Morphological representation of Axol motor neurons exposed to frozen- or freshly prepared lipid species (PSPC, PONPC and PaZPC) at a dose range (25, 50 and 100 pM) at 24 h post PC-OxPL exposure, based on Calcein TM (Invitrogen) live imaging. Displayed images were selected from a panel of six replicates per condition. Scale bar = 100 pm. (B) % of PC-OxPL+ cells following wt motor neurons exposure to PONPC (25 pM). Values are expressed as means ± SEM. Two-way ANOVA, ns, p > 0.05; n= two independent experiments, six replicates. Scale bar = 100 pm.

[0014] Figure 5A-E shows (A) TDP-43 aggregation in wt and TDP-43M337Vmotor neurons exposed to 0.1% DMSO or 0.1 pM of MG- 132. TDP-43 aggregation is shown as the ratio of aggregation measured by the HTRF TDP-43 assay. Values are expressed as means ± SEM, normalized to the assay positive control. Ordinary one-way ANOVA with Tukey’s multiple comparison test, ***p < 0.001; n = two independent experiments, six replicates. (B) pTDP-43 expression following PSPC or PONPC exposure of wt Axol motor neurons. Values are expressed as means ± SEM, normalized to the control condition (24 h 25 pM PSPC + 6 or 24 h washout). Two-way ANOVA, ns, p > 0.05; n= two independent experiments, 12 replicates. Scale bar = 100 pm. Alterations on mitochondrial profile following wt motor neurons exposure to PONPC, including (C) % of mitochondria+ cells and (D) mitochondria expression, as assessed with immunostaining using mouse anti-mitochondrial (ab92824) antibody. Values are expressed as means ± SEM, normalized to the control condition (24 h 25 pM PSPC). (E) PC-OxPL levels as detected on the surface of different apolipoprotein particles as measured in paired CSF from HC and ALS patients. Values are expressed as means ± SEM; each dot represents a single individual (n = 15).Docket No. 00015-444WO1

[0015] Figure 6A-H shows AAV-delivered PC-OxPL-VecTab®, targeting PC-OxPL, prevents neurotoxicity in iPSC-derived motor neurons. (A) Schematic representation of AAV5.2-CBh- PC-OxPL-VecTab® cassette (ITR, inverted terminal repeats; CBh, CBA hybrid; SV40 pA, simian virus 40 Poly A). (B) AAV5.2-GFP exhibits differential tropism among human-derived cells: cortical neurons, motor neurons, astrocytes, and motor neuronal:astrocytic co-culture. Values are expressed as means ± SEM; n = 3. Representative images are found on the right panel (GFP (FITC), green fluorescent protein). Scale bar = 300 pM. (C) PC-OxPL-VecTab® transcript expression following AAV transduction of motor neurons and astrocytes. Both cell types were transduced with AAV5.2-Control at different MOIs, and cell lysate collected at eight days post-transduction. The scatter plot displays gene expression mean, normalized to GAPDH and relative to non-transduced condition (background); n = three. (D) PC-OxPL-VecTab® protein expression following AAV transduction of motor neurons and astrocytes. Both cell types were transduced with AAV5.2-CBh-PC-OxPL-VecTab® at different MOIs and extracellular medium collected at eight days post-transduction. The scatter plot displays protein concentration. Maximum signal (OD450) using a 4x dilution was used to estimate scFv concentration; n = three. (E) Correlation analysis of PC-OxPL-VecTab® transcript expression and protein concentration in motor neurons and astrocytes. Both cell types were transduced with AAV5.2-Control at different MOIs, and cell lysate collected at eight days post-transduction; n = three. (F) Network analysis following AAV5.2-PC-OxPL-VecTab® transduction of wt motor neurons exposed to PC-OxPL (PONPC). Gene expression data from both Neuroinflammation and Neuropathology were used in the analysis. All pathways are sorted by Fold Enrichment value. (G) Heatmap representation of transcriptome recovery following AAV5.2-Control transduction of wt motor neurons exposed to PC-OxPL (PONPC). (H) TDP-43 aggregation in wt and TDP-43M337Vmotor neurons transduced with either mouse or humanized AAV5.2-PC-OxPL-VecTab® and exposed to PSPC or PC-OxPL. TDP-43 aggregation is shown as the ratio of aggregation measured by the HTRF TDP-43 assay. Values are expressed as means ± SEM, normalized to the assay positive control. Ordinary’ one-way ANOVA with Dunnett's multiple comparison test, ***p < 0.001; n = 2 independent experiments, six replicates.

[0016] Figure 7A-H shows PC-OxPL-VecTab® attenuates sALS CSF-induced motor disability and motor neuron degeneration. (A) Left panel. Representative images of PC-OxPL immunostaining in the cervical spinal cord at one day post intrathecal injection of saline or sALS CSF. Mice received intrathecal injections of saline or AAV5-2-PC-OxPL-VecTab®Docket No. 00015-444WO1four weeks prior to sALS CSF injection. Scale bar = 100 pm. Right panel. Quantification of PC-OxPL immunostaining intensity in the ventral grey matter at one day post sALS / saline injection and four weeks days post AAV5.2-PC-OxPL-VecTab® injection. Values are expressed as means ± SEM. One-way ANOVA with Bonferroni’s test, ns, p > 0.05. Saline + Saline (n = five mice), Saline + sALS (n = eight mice), AAV5.2-PC-OxPL-VecTab® + sALS (n = 10 mice). (B) Motor deficit scores and (C) Normalized forelimb grip strength force at one day post intrathecal injection of saline or sALS CSF. Mice received intrathecal injections of saline or AAV5.2-Control four weeks prior to sALS CSF injection. Values are expressed as means ± SEM. One-way ANOVA with Bonferroni’s test. One-way ANOVA with Bonferroni’s test, ****p < 0.0001, *p < 0.05. Saline + Saline (n = 11 mice), Saline + sALS (n = 11 mice), AAV5-2-PC-OxPL-VecTab® + sALS (n = 18 mice). (D) Upper panel.Representative images of cervical spinal cords immunostained for ChAT at one day post intrathecal injection of saline or sALS CSF. Lower panel. Quantification of the number of ChAT+ motor neurons in cervical ventral horns at one day post sALS / saline injection and four weeks days post AAV5.2-PC-OxPL-VecTab® injection. Mice received intrathecal injections of saline or AAV5.2- PC-OxPL- VecTab® four weeks prior to sALS CSF injection. One-way ANOVA with Bonferroni’s test, ****p < 0.0001, ***p < 0.001. Saline + Saline (n = 11 mice), Saline + sALS (n = 11 mice), AAV5-2-PC-OxPL-VecTab + sALS (n = 18 mice).(G) Representative images of PC-OxPL immunostaining in the cervical spinal cord at one day post intrathecal injection of Saline or sALS CSF, previously incubated with PC-OxPL-VecTab®. Scale bar = 100 pm. (E) Quantification of PC-OxPL immunostaining intensity in the ventral grey matter after intrathecal injection of Saline or sALS CSF, previously incubated with PC-OxPL-VecTab® or Control-VecTab®. Values are expressed as means ± SEM. One-way ANOVA with Bonferroni’s test, **p < 0.01, *p < 0.05. Saline / Control-VecTab® + Saline (n = two mice), Control-VecTab® + sALS / PC-OxPL-VecTab® + sALS (n = five mice). (F) Motor deficit scores and (G). Normalized forelimb grip strength force after intrathecal injection of saline or sALS CSF, previously incubated with PC-OxPL-VecTab® or Control-VecTab®. Values are expressed as means ± SEM. One-way ANOVA with Bonferroni’s test, **p < 0.01, *p < 0.05. Saline (n = two), Control-VecTab® + Saline (n = three mice), Control-VecTab® + sALS / PC-OxPL-VecTab® + sALS (n = five mice). (H) Upper panel. Representative images of cervical spinal cords immunostained for ChAT after intrathecal injection of saline or sALS CSF, previously incubated with PC-OxPL-VecTab® or Control-VecTab®. Scale bar = 100 pm. Lower panel. Quantification of the number ofDocket No. 00015-444WO1ChAT+ motor neurons in cervical ventral horns after intrathecal injection of saline or sALS CSF, previously incubated with PC-OxPL-VecTab® or Control-VecTab®. Values are expressed as means ± SEM. One-way ANOVA with Bonferroni’s test, **p < 0.01, *p < 0.05. Saline (n = two mice), Control-VecTab® + Saline (n = two mice), Control-VecTab® + sALS / PC-OxPL-VecTab® + sALS (n = five mice).DETAILED DESCRIPTION

[0017] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. In case of conflict, the present document, including definitions, will control. Preferred methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the present invention. All publications, patent applications, patents and other references mentioned herein are incorporated by reference in their entirety. The materials, methods, and examples disclosed herein are illustrative only and not intended to be limiting. The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.

[0018] The terms “compnse(s),” “include(s),” “having,” “has,” “can,” “contain(s),” “may” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that do not preclude the possibility of additional acts or structures.

[0019] The singular forms “a,” “an” and “the” include plural references unless the context clearly dictates otherwise.

[0020] The present disclosure also contemplates other embodiments “comprising,” “consisting of’ and “consisting essentially of,” the embodiments or elements presented herein, whether explicitly set forth or not.

[0021] The modifier “about” used in connection with a quantity is inclusive of the stated value and has the meaning dictated by the context (for example, it includes at least the degree of error associated with the measurement of the particular quantity). The modifier “about” should also be considered as disclosing the range defined by the absolute values of the two endpoints. For example, the expression “from about 2 to about 4” also discloses the range “from 2 to 4.” The term “about” may refer to plus or minus 10% of the indicated number. For example, “about 10%” may indicate a range of 9% to 11%, and “about 1” may mean from 0.9-1.1. Other meanings of “about” may be apparent from the context, such as rounding off, so, for example “about 1” may also mean from 0.5 to 1.4.

[0022] For the recitation of numeric ranges herein, each intervening number thereDocket No. 00015-444WO1between with the same degree of precision is explicitly contemplated. For example, for the range of 6-9, the numbers 7 and 8 are contemplated in addition to 6 and 9, and for the range 6.0-7.0, the number 6.0, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, and 7.0 are explicitly contemplated.

[0023] The terms "antibody" and "immunoglobulin" are used interchangeably in the broadest sense and include monoclonal antibodies (e.g. full length or intact monoclonal antibodies), polyclonal antibodies, multivalent antibodies, multispecific antibodies (e.g., bispecific antibodies so long as they exhibit the desired biological activity) and may also include certain antibody fragments (e.g., single chain antibodies, scFv). An antibody can be human, humanized and / or affinity matured.

[0024] Depending on the amino acid sequence of the constant domain of their heavy chains, immunoglobulins can be assigned to different classes. There are five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, and several of these can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3, IgG4, IgA1, and IgA2. The heavy -chain constant domains that correspond to the different classes of immunoglobulins are called α, δ, ε, γ, and μ, respectively. The subunit structures and three-dimensional configurations of different classes of immunoglobulins are well known.

[0025] " Antibody fragments" comprise only a portion of an intact antibody, wherein the portion typically retains at least one, more commonly most or all, of the functions normally associated with that portion when present in an intact antibody. Examples of antibody fragments include Fab, Fab', F(ab')2, and Fv fragments; diabodies; linear antibodies; single-chain antibody molecules; and multispecific antibodies formed from antibody fragments. In one embodiment, an antibody fragment comprises an antigen binding site of the intact antibody and thus retains the ability to bind antigen. In another embodiment, an antibody fragment, is linked directly or indirectly to a substrate.

[0026] The term "anti-OxPL antibody" or "an antibody that binds to OxPL" or "‘anti-OxPL binding domain'’ refers to an antibody, non-immunoglobulin binding agent or other molecule that is capable of binding OxPL with sufficient affinity such that the antibody, molecule or agent can reversibly or irreversibly attach to or bind OxPL and is useful as a diagnostic and / or therapeutic agent in targeting OxPL. One exemplar anti-OxPL antibody is EO6.

[0027] The IgM natural antibody EO6, which binds the PC headgroup of OxPL, but does not bind unoxidized PL, has been cloned. EO6 blocks the uptake of OxLDL byDocket No. 00015-444WO1macrophages and inhibits proinflammatory properties of OxPL (Friedman et al., 2002; Shaw et al., 2000). To determine the role of OxPL in vivo in the context of atherosclerosis, transgenic mice have been generated in the Ldlr- / -background that expressed a single-chain variable fragment of EO6 (EO6-scFv) (Que et al., 2018; see also W02014 / 131034, the disclosure of which are incorporated herein by reference). W02014 / 131034 provides antibody and antibody sequences that can bind OxPL with the binding specificity of EO6. Because the EO6-scFv lacks the Fc effector functions of antibodies, biological effects observed are predicted to be due solely to blocking biological effects of OxPL.

[0028] The term “anti-MDA-derived-OxPL” or “anti-MAA-derived-OxPL” refers to antibodies that bind to unique epitopes on OxPL that comprise MDA or MAA epitopes, respectively.

[0029] " Binding affinity" generally refers to the strength of the sum total of non-covalent interactions between a single binding site of a molecule (e.g, an antibody) and its binding partner (e.g, an antigen). Unless indicated otherwise, as used herein, "binding affinity" refers to intrinsic binding affinity which reflects a 1:1 interaction between members of a binding pair (e.g, antibody and antigen). The affinity of a molecule X for its partner Y can generally be represented by the dissociation constant (Kd). Affinity can be measured by common methods known in the art, including those described herein. Low-affinity antibodies generally bind antigen slowly and tend to dissociate readily, whereas high-affinity antibodies generally bind antigen faster and tend to remain bound longer. A variety of methods of measuring binding affinity are known in the art, any of which can be used for purposes of this disclosure.

[0030] A "biological sample" encompasses a variety of sample types obtained from an individual and can be used in a diagnostic or monitoring assay. The definition encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom, and the progeny thereof. The definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components, such as proteins or polynucleotides, or embedding in a semi-solid or solid matrix for sectioning purposes. The term "biological sample" encompasses aclinical sample, and also includes cells in culture, cell supernatants, cell lysates, serum, plasma, biological fluid, and tissue samples. The source of the biological sample may be solid tissue as from a fresh, frozen and / or preserved organ or tissue sample or biopsy or aspirate; blood, plasma orDocket No. 00015-444WO1any blood constituents; bodily fluids such as cerebral spinal fluid, amniotic fluid, peritoneal fluid, or interstitial fluid; cells from any time in gestation or development of the subject. In some embodiments, the biological sample is obtained from cerebral fluid (e.g., cerebral spinal fluid) or neurological tissue (biopsy). The biological sample may contain compounds which are not naturally intermixed with the tissue or sample in nature such as preservatives, anticoagulants, buffers, fixatives, nutrients, antibiotics, or the like.

[0031] The term " Fc region" as used herein refers to the C-terminal region of an immunoglobulin heavy chain, including native sequence Fc regions and variant Fc regions.

[0032] A "native sequence Fc region" comprises an amino acid sequence that is identical to the amino acid sequence of an Fc region found in nature. Native sequence human Fc regions include a native sequence human IgGl Fc region (non-A and A allotypes); native sequence human IgG2 Fc region; native sequence human IgG3 Fc region; and native sequence human IgG4 Fc region as well as naturally occurring variants thereof.

[0033] " Fv" is the minimum antibody fragment, which contains a complete antigenrecognition and -binding site. In a two-chain Fv species, this region consists of a dimer of one heavy- and one light-chain variable domain in tight, non-covalent association. In a singlechain Fv species (scFv), one heavy- and one light-chain variable domain can be covalently linked by a flexible peptide linker such that the light and heavy chains can associate in a "dimeric" structure analogous to that in a two-chain Fv species. It is in this configuration that the three hypervariable regions (HVRs) of each variable domain interact to define an antigenbinding site on the surface of the VH-VL dimer. Collectively, the six HVRs confer antigenbinding specificity to the antibody. However, even a single variable domain (or half of an Fv comprising only three HVRs specific for an antigen) has the ability to recognize and bind antigen, although at a lower affinity than the entire binding site.

[0034] A Fab fragment contains the constant domain of the light chain and the first constant domain (CHI) of the heavy chain. Fab' fragments differ from Fab fragments by the addition of a few residues at the carboxy terminus of the heavy chain CHI domain including one or more cysteines from the antibody hinge region. Fab'-SH is the designation herein for Fab' in which the cysteine residue(s) of the constant domains have a free thiol group. F(ab')2 antibody fragments originally were produced as pairs of Fab' fragments which have hinge cysteines between them. Other chemical couplings of antibody fragments are also known.

[0035] " Framework" or " FR" residues are those variable domain residues other than the hypervariable region residues as herein defined.Docket No. 00015-444WO1

[0036] The term "hypervariable region," " HVR," or " HV," when used herein refers to the regions of an antibody variable domain which are hypervariable in sequence and / or form structurally defined loops. Generally, antibodies comprise six HVRs; three in the VH chain (Hl, H2, H3), and three in the VL chain (LI, L2, L3). In native antibodies, H3 and L3 display the most diversity of the six HVRs, and H3 in particular is believed to play a unique role in conferring fine specificity to antibodies. See, e.g., Xu et al., Immunity 13:37-45 (2000); Johnson and Wu, Methods in Molecular Biology 248: 1-25 (Lo, ed., Human Press, Totowa, N. J., 2003). Indeed, naturally occurring camelid antibodies consisting of a heavy chain only are functional and stable in the absence of light chain. See, e.g., Hamers-Casterman et al., Nature 363:446-448 (1993); Sheriff et al., Nature Struct. Biol. 3:733-736 (1996).Hypervariable regions (HVRs) are sometimes referred to as complementarity determining regions (CDRs).

[0037] The term "interact" as used herein is meant to include detectable relationships or associations (e.g. biochemical interactions) between molecules, such as interactions between protein-protein (e.g., antibody -protein), protein-lipid (e.g., antibody-lipid), protein-nucleic acid, antibody -OxPL and the like.

[0038] An "isolated" antibody is one that has been identified and separated and / or recovered from a component of its environment (e.g.., natural environment, cell culture etc.). Contaminant components of its environment are materials that would interfere with diagnostic or therapeutic uses for the antibody, and may include enzymes, hormones, and other proteinaceous or nonproteinaceous solutes. In some embodiments, the antibody will be purified (1) to greater than 95% by weight of antibody as determined by the Lowry method, and typically more than 99% by weight, (2) to a degree sufficient to obtain at least 15 residues of N-terminal or internal amino acid sequence by use of a spinning cup sequenator, or (3) to homogeneity by SDS-PAGE under reducing or nonreducing conditions using Coomassie blue or silver stain. An isolated antibody includes the antibody in situ within recombinant cells since at least one component of the antibodys natural environment will not be present. Ordinarily, however, an isolated antibody will be prepared by at least one purification step.

[0039] The word "label" when used herein refers to a compound or composition which is conjugated or fused directly or indirectly to a reagent such as a nucleic acid probe or an antibody or phosphocholine etc. and facilitates detection of the reagent to which it is conjugated or fused. The label may itself be detectable (e.g., radioisotope labels, a magneticDocket No. 00015-444WO1metal (e.g., paramagnetic) or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable.

[0040] The "light chains" of antibodies (immunoglobulins) from any vertebrate species can be assigned to one of two clearly distinct types, called kappa (K) and lambda (X), based on the amino acid sequences of their constant domains.

[0041] The term "marker" refers to a biological factor (e.g., OxPL) in a sample of a subject, wherein such markers vary among individuals and can be associated with a particular disease or disease risk or disease progression. In some embodiments, the abundance, expression or presence of a marker may change during disease progression or treatment. The change in such markers are useful in diagnostics and prognostics.

[0042] The term "monoclonal antibody" as used herein refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e., the individual antibodies comprising the population are identical except for possible mutations, e.g., naturally occurring mutations, that may be present in minor amounts. Thus, the modifier term "monoclonal" indicates the character of the antibody as not being a mixture of discrete antibodies. In certain embodiments, such a monoclonal antibody typically includes an antibody comprising a polypeptide sequence that binds a target, wherein the target-binding polypeptide sequence was obtained by a process that includes the selection of a single target binding polypeptide sequence from a plurality of polypeptide sequences. For example, the selection process can be the selection of a unique clone from a plurality of clones, such as a pool of hybridoma clones, phage clones, or recombinant DNA clones. It should be understood that a selected target binding sequence can be further altered, for example, to improve affinity for the target, to improve its production in cell culture, to create a multispecific antibody, etc., and that an antibody comprising the altered target binding sequence is also a monoclonal antibody for purposes of this disclosure. In contrast to polyclonal antibody preparations, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody of a monoclonal antibody preparation is directed against a single determinant on an antigen. In addition to their specificity, monoclonal antibody preparations are advantageous in that they are typically uncontaminated by other immunoglobulins.

[0043] The modifier term "monoclonal" indicates the character of the antibody as being obtained from a substantially homogeneous population of antibodies, and is not to be construed as requiring production of the antibody by any particular method. For example, aDocket No. 00015-444WO1monoclonal antibodies to be used in accordance with the disclosure may be made by a variety of techniques, including, for example, the hybridoma method (e.g., Kohler and Milstein, Nature, 256:495-97 (1975); Hongo et al., Hybridoma, 14 (3): 253-260 (1995), Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed. 1988); Hammerling et al., in: Monoclonal Antibodies and T-Cell Hybridomas 563-681 (Elsevier, N.Y., 1981)), recombinant DNA methods (see, e.g., U. S. Pat. No. 4,816,567), phage-display technologies (see, e.g., Clackson et al., Nature, 352: 624-628 (1991); Marks et al., J. Mol. Biol. 222: 581-597 (1992); Sidhu etal., J. Mol. Biol. 338(2): 299-310 (2004); Lee etal., J. Mol. Biol. 340(5): 1073-1093 (2004); Fellouse, Proc. Natl. Acad. Sci. USA 101(34): 12467-12472 (2004); and Lee et al., J. Immunol. Methods 284(1-2): 119-132 (2004), and technologies for producing human or human-like antibodies in animals that have parts or all of the human immunoglobulin loci or genes encoding human immunoglobulin sequences (see, e.g., WO 1998 / 24893; WO 1996 / 34096; WO 1996 / 33735; WO 1991 / 10741; Jakobovits et al., Proc. Natl. Acad. Sci. USA 90: 2551 (1993); Jakobovits et al., Nature 362: 255-258 (1993); Bruggemann etal., Year in Immunol. 7:33 (1993); U. S. Pat. Nos. 5,545,807;5,545,806; 5,569,825; 5,625,126; 5,633,425; and 5,661,016; Marks etal., Bio / Technology 10: 779-783 (1992); Lonberg et al., Nature 368: 856-859 (1994); Morrison, Nature 368: 812-813 (1994); Fishwild et al., Nature Biotechnol. 14: 845-851 (1996); Neuberger, Nature Biotechnol. 14: 826 (1996); and Lonberg and Huszar, Intern. Rev. Immunol. 13: 65-93 (1995).

[0044] As used herein a “normal control” refers to a subject that does not show any neurological deficits (e.g., ALS, MS, Alzheimer’s ete.). Thus, in the context of the disclosure a “normal control” refers to the amount of OxPL in a subject or a population of subjects that do not have ALS or a neurological deficit. These “normal control amounts of OxPL” can be expressed as relative light units (RLUs), nM or mg / dL.

[0045] The term “oxidized LDL” is used to describe a wide variety of low density lipoprotein (LDL) preparations that have been oxidatively modified including ex vivo under defined conditions, or isolated from biological sources.

[0046] “Oxidized phospholipids (OxPL)” refer to phospholipids with a phosphocholine (PC) headgroup (PC-OxPL). OxPL are highly pro-inflammatory and proatherogenic. Phosphocholine, a polar head group on certain phospholipids, has been extensively implicated in cardiovascular disease. Reactive oxygen species generated during coronary inflammation causes the oxidation of low density lipoprotein (LDL) to generateDocket No. 00015-444WO1oxidized LDL (OxLDL). In fact, cardiovascular diseases (CVD) such as atherosclerosis, unstable angina, or acute coronary syndrome have been shown to be associated with elevated plasma levels of OxLDL (Itabe and Ueda. 2007).

[0047] During oxidation of LDL, PC containing neo-epitopes that are not present on unmodified LDL are generated. Newly exposed PC on OxLDL is recognized by scavenger receptors on macrophages, such as CD36, and the resulting macrophage-engulfed oxLDL proceeds towards the formation of proinflammatory foam cells in the vessel wall. Oxidized LDL is also recognized by receptors on endothelial cell surfaces and has been reported to stimulate a range of responses including endothelial dysfunction, apoptosis, and the unfolded protein response. PC neo-epitopes are also exposed on LDL following modification with phospholipase A2 or amine reactive disease metabolites, such as aldehydes generated from the oxidation of glycated proteins. These alternately modified LDL particles are also pro-inflammatory factors in CVD.

[0048] As mentioned, oxidized phospholipids (OxPL) (phospholipids with a phosphocholine (PC) headgroup) are highly pro-inflammatory and are present in a wide spectrum of inflammatory diseases, including atherosclerosis, rheumatoid arthritis, diabetic nephropathy, CNS diseases including multiple sclerosis, fatty liver diseases including nonalcoholic fatty liver disease (NAFLD) and non-alcoholic steatohepatitis (NASH), and a spectrum of acute and chronic pulmonary diseases. For example, OxPL are present in the lungs of both mice and humans infected with a wide variety of viral and bacterial pathogens. OxPL are abundant in bronchial alveolar lavage (BAL) of mice with these infections as well as in acute respiratory distress syndrome following acid installation, or in BAL of mice with COPD secondary to smoking. OxPL are proinflammatory mediators for macrophages, by inducing IL-6 for example, or alternatively inhibit the capacity of macrophages to phagocytize bacteria. OxPL are prevalent in livers of patients and mice with NASH, and have been shown to be involved in the pathogenesis in murine models of NASH. OxPL are also extensively present in atherosclerotic lesions, and in vulnerable plaques of human coronary arteries. They are also released into the circulation during interventional procedures such as PCI and stenting, where they likely mediate downstream proinflammatory and vasoactive effects.

[0049] Antibodies towards phosphocholine (PC) have been shown to bind oxidized, or otherwise modified, LDL and block the pro-inflammatory activity of OxLDL in in vivo models or in vitro studies (Shaw et al. 2000; Shaw et al. 2001).Docket No. 00015-444WO1

[0050] In the context of the disclosure, ‘"population"’ refers to any selected group of individuals, such as individuals that live in a particular geographic region, country or state; age-related groups; sex-related groups; weight-related groups; risk factor groups, disease related groups etc. In some cases, the population is a group of subjects, such as a group of subjects that participated in a clinical study. In another embodiment, a population can comprise an ethnic group, an age group or can be based on sex.

[0051] The term "propensity to disease," also "predisposition" or "susceptibility" to disease or any similar phrase, means that certain markers are associated with or predictive of a subject's incidence of developing a particular disease (e.g., ALS). The biomarker (e.g., the presence of a particular ratio or level of phospholipid or apoprotein) are thus over-represented or under expressed (depending upon the marker) in frequency in individuals with disease as compared to healthy individuals.

[0052] A "risk factor" is a factor identified to be associated with an increased risk of a disease or disorder. For example, an increase in the presence of PC-OxPL on APOE (e.g., ApoE2, ApoE3, ApoE4) compared to a control or as changed in the same subject over time, is indicative or a risk of ALS.

[0053] An "individual," "subject," or "patient" is a vertebrate. In certain embodiments, the vertebrate is a mammal. Mammals include, but are not limited to, farm animals (such as cows), sport animals, pets (such as cats, dogs, and horses), primates, mice and rats. In certain embodiments, a mammal is a human.

[0054] The term ’‘substantially” as used herein refers to a majority of, or mostly, as in at least about 51%, 60%, 70%, 80%, 90%, 95%, 96%, 97%, 98%, 99%, 99.5%, 99.9%, 99.99%, or at least about 99.999% or more.

[0055] The term "substantially similar" or "substantially the same," as used herein, denotes a sufficiently high degree of similarity between two numeric values, such that one of skill in the art would consider the difference between the two values to be of little or no biological and / or statistical significance within the context of the biological characteristic measured by the values. The difference between said two values is, for example, less than about 50%. less than about 40%. less than about 30%. less than about 20%, less than about 10%, less than about 5%, less than about 2% and / or less than about 1%.

[0056] The phrase "substantially reduced," "substantially increased," or "substantially different," as used herein, denotes a sufficiently high degree of difference between two numeric values such that one of skill in the art would consider the difference between the twoDocket No. 00015-444WO1values to be of statistical significance within the context of the biological characteristic measured by said values. The difference between said two values is, for example, greater than 5%, greater than about 10%, greater than about 20%, greater than about 30%, greater than about 40%, and / or greater than about 50%.

[0057] In ALS, motor neurons exhibit increased glycerophospholipid metabolism compared to unaffected ocular motor neurons. In particular, elevated levels of phosphatidylcholine (PC) containing native phospholipids, precursors of PC -containing oxidized phospholipids (PC-OxPL), in cerebrospinal fluid (CSF) correlate with disease progression. Furthermore, histological studies have shown PC-OxPL accumulation in upper motor neurons of ALS patients, and high systemic levels of oxidized low-density lipoproteins (OxLDL), enriched in PC-OxPL, are associated with rapid ALS progression.

[0058] Mice possess natural IgM EO6 antibodies at birth, which specifically recognize the PC headgroup of oxidized, but not native phospholipids. Transgenic mice overexpressing a single chain variant of EO6 have been documented to have amelioration of a variety of pathogenic states, including atherosclerosis, hepatic steatosis, ischemia reperfusion injury in the heart and liver, improvements in bone density and nociceptive pain syndromes. The central nervous system (CNS) is not known to contain these innate antibodies, and growing evidence suggests that OxPL are linked to neurotoxicity in neurodegenerative diseases. The complementary determining regions of EO6 and scFvs, humanized antibodies of EO6 have been identified and generated (see, WO 2014 / 131034, the disclosure and sequences of which are incorporated herein by references for all purposes). For example, an EO6 scFv antibody fragment can comprise:>EO6scFv antibody fragment(From 1 to 930. Translation 309 a.a. MW=33.65 kDa)(Nucleic acid – SEQ ID NO:1; Polypeptide – SEQ ID NO:2)1 ATGGAGACAGACACACTCCTGCTATGGGTACTGCTGCTCTGGGTTCCAGGTTCCACTGGTGACGCGGCCCAGCCG 1 M E T D T L L L W V L L L W V P G S T G D A A Q P 76 GCCAGGCGCGCCGTACGAAGCTTAGACAT7GTGATGACTCAGTCTCCATCTTCCCTTTCTGTGTCAGCAGGTAAG 26 A R R A V R S L D I V M T Q S P S S 2 S V S A G K 1 51 AAGGTCACCATTAGTTGCACGGCCAGTGAGAGCCTTTATTCAAGCAAACACAAGGTGCACTACTTGGCTTGGTAC51 K V T I S C C A S E S L Y S S K H K V H Y L A W Y 226 CAGAAGAAACCAGAGCAATCTCCTAAACTGCTGATATACGGGGCATCCAACCGATACATTGGGGTCCCTGATCGC 76 Q K K P E Q S P K L L I Y G A S N R Y I G V P D R 301 TTCACAGGCAGTGGATCTGGGACAGATTTCACTCTGACCATCAGCAGTGTACAGGTTGAAGACCTCACACATTAT 101 F T G S G S G T D F T L T I S S V Q V E D L T H Y 376 TACTGTGO C GTTTTACAGCT TCCGCTCACGTTCGGTGCTGGGACCAAGCTGGAAATC AGGTGGTGGAGGA 126 Y C A Q F Y S Y P L T F G A G T K L E I K G G G GDocket No. 00015-444WO14 51 TCAGGTGGAGGTGGTTCAGGAGGTGGCGGATCCGAGGTGAAGCTGGTGGAGTCTGGAGGAGGCTTGGTACAGCCT 151 S G G G G S G G G G S E YrK L V E S G G G L V Q P 526 GGGGGTTCTCTGAGACTCTCCTGTGCAACTCTGGGTTCACCTTCAGTGATTTCTACATGGAGTGGGTCCGCCAG176 G G S L R L S C A T S G F T F S D F Y M E W V R Q 601 GCTCCAGGGAAGAGACTGGAGTGGATTGCTGCAAGTAGAAACAAAGCTAATGATTATACAACAGAGTACGCTGAC 201 A P G K R E E W I A A S R N K A N D Y T T E Y A D 676 TCTGTGAAGGGTCGGTTCATCGTCTCCAGAGACACTTCGCAAAGCATCCTCTACCTTCAGATGAATGCCGTGAGA226 S V K G R F I V S R D T S Q S I L Y L Q M N A L R 751 GCCGAGGACACTGCCATTTATTACTGTGCAAGAGATTACTACGGTAGTAGCTACTGGTACTTCGATGTCTGGGGC251 A E D T A I Y Y C A R D Y Y G S S Y W Y F D V W G 826 GCAGGGACCACGGTCACCGTCTCCTCTCGAGGAGGGCCCGAACAAAAACTCATCTCAGAAGAGGATCTGAATAGC276 A G T T V T V S S R G G P E Q K L I S E E D L N S 901 GCCGT CGACCAT CAT CAT CATCAT CAT T GA301 A V D H H H H H H *Annotat ion:A.A. 1 … 33 = Ig kappa chain leader sequence for antibody secretion.A.A. 34 … 146 = EO6 light-chain variable region.A.A. 42 … 49 = FW1 region TFLAVTAS (SEQ ID NO:3) mutated to SSLSVSAG (SEQ ID NO:4) to enhance affinity to OxPL-PC / OxLDL and functional activity.A. A. 57... 73 = " TASESLYSRR VHY LA" ( SEQ ID NO: b ) E O b E-chain CDR1.A.A. 89 … 95 = "GASNRYI" (SEQ ID NO:6) EO6 L-chain CDR2.A.A. 127 … 136 = "CAQFYSYPLT" (SEQ ID NO:7) EO6 L-chain CDR3.A.A. 147 … 161 = (Gly4Ser)x3 flexible linker peptides.A.A. 162 … 284 = EO6 heavy-chain variable region with triple mutations of P201A, S224A and A225D to increase antibody affinity to OxPL-PC / OxLDL.A.A. 187 … 193 = "GFTFSDF" (SEQ ID NO:8) EO6 H-chain CDR1.A.A. 213 … 220 = "RNKANDYT" (SEQ ID NO:9) EO6 H-chain CDR2.A.A. 259 … 274 = "CARDYYGSSYWYFDVW" (SEQ ID NO:10) EO6 H-chain CDR3.A.A. 289 … 298 = myc epitope tagA.A. 304 … 309 = polyHis tag.In certain embodiments, the antibody or antibody fragment that binds to OxPL comprises SEQ ID NO:2 or an antibody that comprises the CDRs of SEQ ID NOs:5, 6, 7, 8, 9 and 10.

[0059] In another embodiment, the antibody that binds OxPL is a biotin-labelled E03 IgM, the capture antibody is a polyclonal rabbit anti-human APOE (ThermoFisher Scientific, Waltham, MA). The EO3 antibody can be purchased at Absolute antibody, Cayman and Millipore. The EO3 antibody is identical to the EO6 antibody. ApoE4 antibody can be purchased from Novus Biologics, product # NBP1-49529B.

[0060] The disclosure demonstrates that PC-OxPL species are increased in the brain of ALS patients with APOE identified as the primary PC-OxPL carrier in the CNS and upregulated in ALS. The disclosure further shows that PC-OxPL exposure in wild-type (wt) and ALS (TDP-43M337V) motor neurons induced ALS-relevant gene expression, triggered TDP-43 aggregation, and resulted in motor neuron toxicity. This shows the accumulation ofDocket No. 00015-444WO1PC-OxPL as a key pathological mechanism in ALS, suggesting that diagnosing PC-OxPL neurotoxicity is a promising strategy for as a diagnostic.

[0061] The disclosure provides several levels of evidence that PC-OxPL are integrally associated with the pathology present in motor neurons in the brain and spinal cord in patients with ALS. PC-OxPL levels on apoE were enriched in the in the CSF relative to plasma suggesting local generation. Exposure of PC-OxPL to iPSC-derived motor neurons recapitulated the gene expression aTDP-43 pathology known to be associated with ALS. These findings provide a rationale for PC-OxPL diagnostics for determining ALS.

[0062] TDP-43 proteinopathy is a primary hallmark of sALS, driving extensive missplicing, the formation of “cryptic” transcripts and peptides, and the loss of key proteins essential for motor neuron homeostasis. Further, TDP-43 aggregation impairs axonal transport and disrupts neuromuscular synapses eventually causing detrimental effects on motor neurons. While oxidative stress and aging have been proposed to contribute to motor neuron degeneration in ALS, the mechanisms underlying TDP-43 misfolding and aggregation remain elusive. Ferroptosis, a programmed cell death pathway characterized by PUFA oxidation, has gained recognition as a mechanism contributing to selective motor death in ALS. PC-OxPL accumulation is tightly linked to ferroptosis and their association with multiple pathologies has sparked interest in the potential role of PC-OxPL in neurodegenerative diseases, such as ALS.

[0063] The disclosure identified PC-OxPL accumulation in the most affected brain and spinal cord regions in ALS. Notably, the presence of PC-OxPL in the brain aligns with disease progression and mirrors the spread of TDP-43 pathology. This is the first evidence linking PC-OxPL to TDP-43 proteinopathy and ALS pathology. PC-OxPL accumulation was predominantly associated with motor neurons in ALS spinal cord samples and reflected by elevated PC-OxPL levels in CSF from ALS patients compared to healthy control (HC). Interestingly, the PC-OxPL signatures in ALS CSF differed from those observed in multiple sclerosis (MS), possibly reflecting differences in glial activation and disease-specific processes. Also, PC abundance is somewhat tissue-specific and it is likely that PC-OxPL generation is not a stochastic event. Given the distinct profiles in affected regions across different pathologies, these findings demonstrate that specific PC-OxPL may contribute to the unique pathophysiology of various neurodegenerative conditions.

[0064] PC-OxPL in CSF, but not in plasma, was primarily associated with ApoE in healthy and ALS-affected brains. Unlike plasma, where a variety of lipoproteins are present.Docket No. 00015-444WO1CSF mainly contains ApoE particles. These particles are locally produced and reflect lipid changes within the CNS. due to the restrictive nature of the blood-brain barrier. Notably, only ApoA-I particles are able to cross this barrier. The differential distribution of PC-OxPL in apolipoproteins in brain in comparison to the periphery is suggestive of specific OxPL metabolism in the CNS, including locally-restricted generation and distribution within CNS regions and cell types. In prior studies of OxPL on Lp(a), it was demonstrated that OxPL can be present both in the LDL-like moiety of Lp(a) as well as covalently bound to the apolipoprotein(a) component. Glial cells are the main source of CNS ApoE, but under pathological conditions, neurons can also secrete ApoE, increasing the ability for lipid transfer to astrocytes. Notably. ApoE was the most upregulated gene in motor neurons exposed to l-palmitoyl-2-(9-oxononanayl)-phosphocholine (PONPC). It has been recently reported that ApoE isoforms differ in their capacity to transfer cholesteryl-PUFA esters to neuronal cells, related to their affinity for the LDL receptor, ApoE4 having the highest affinity and ApoE2 the lowest. Conversely, TDP-43 pathology is more severe in mice with a human ApoE2 background as compared to the other isoforms. The acute upregulation of APOE following exposure to PC-OxPL may constitutes a protective response of diseased neurons to excessive fatty acid (FA) oxidation. The mechanism by which primary mouse astrocytes metabolize excessive neuronal FA contained in ApoE particles via P-mitochondrial oxidation has been described. However, it is also possible that ApoE particles carrying PC-OxPL induce or exacerbate motor neuron toxicity when taken up by receptors such as low-density lipoprotein receptors (LDLR or LRP).

[0065] Intrathecal transfer of sALS CSF into wt mice induces profound motor neuron loss, TDP-43 mislocalization, and significant motor dysfunction. Interestingly, while CSF from familial ALS (fALS) patients with SOD1, C9orf72, or TARDBP mutations did not consistently trigger these effects, sALS CSF reliably caused motor impairment, degeneration of upper and lower motor neurons, TDP-43 cytoplasmic translocation, and other ALS-like hallmarks in mice. In this study, an sALS CSF sample that elicited motor disability and histochemical signatures associated with ALS was used. Remarkably, the observed toxicity markedly affected the degeneration of ChAT+ motor neurons and was accompanied by TDP-43 mislocalization, suggesting that these neurons are particularly susceptible to PC-OxPL-induced damage. TDP-43 regulates thousands of transcripts, most of which encode proteins involved in synaptic homeostasis (e.g. STMN2, UNC13A), and this has been shown to underline TDP-43 loss-of-function. Intriguingly, previous work by Wong et al. has shownDocket No. 00015-444WO1that APOB mediates the spread of sALS pathology using sALS CSF mouse model. This appears contradictory to the findings that ApoE is the main contributor to PC-OxPL neurotoxicity in ALS. It could indicate a more negligible contribution of ApoB to PC-OxPL transport and neurotoxicity which is in line with PC-OxPL detection on APOB particles in ALS CSF.

[0066] The exact mechanism by which PC-OxPL mediates TDP-43 proteinopathy and eventual motor neuron degeneration remains elusive. Others have demonstrated that TDP-43 (in)solubility and misfolding are regulated by cysteine oxidation and disulfide bond formation. More recently, it was reported that TDP-43 contains a domain similar to the FERM, ARH / RhoGEF And Pleckstrin Domain Protein 1 (FARP1) lipid-binding domain and exposure of TDP-43 to cholesterol or PC induced in vitro fibrillation of recombinant TDP-43 constructs. Hence, the binding of TDP-43 to PC may directly be involved in TDP-43 aggregation. The fact that PC-OxPL may be a contributing mechanism to another underlying process in ALS cannot be ruled out. As far as the field is concerned, it is plausible to assume that PC-OxPL may act as mediators of general oxidative stress or, in particular, ferroptosis-associated mechanisms.

[0067] The disclosure provides the first evidence that PC-OxPL accumulation is a critical driver of ALS pathology, primarily by triggering TDP-43 proteinopathy, which leads to extensive downstream damage, including neuronal death and motor disabilities. In the brain, PC-OxPL are predominantly carried by ApoE particles, which are significantly elevated in ALS CSF and place ApoE at the center of PC-OxPL metabolism in ALS.

[0068] An exemplary biochemical test for identifying ApoE associated PC-OxPL employs a standardized test format, such as the Enzyme Linked Immunosorbent Assay or ELISA test, although the information provided herein may apply to the development of other biochemical or diagnostic tests and is not limited to the development of an ELISA test (see, e.g., Molecular Immunology: A Textbook, edited by Atassi et al. Marcel Dekker Inc., New York and Basel 1984, for a description of ELISA tests).

[0069] In one embodiment, the disclosure provides a method of determining PC-OxPL in a biological sample (e.g., spinal fluid, serum, plasma, blood etc.) from a subject. The method includes providing an antibody or antibody fragment or non-immunoglobulin binding molecule, that binds to OxPL, at a known concentration (e.g., 2 pg / ml), spiking a biological sample with a phosphocholine-detectably labeled composition of known concentration; contacting the antibody or antibody fragment or non-immunoglobulin bindingDocket No. 00015-444WO1molecule with the spiked sample, determining the amount of detectably labeled phosphocholine in the sample, determining the amount of OxPL in the sample and comparing the quantified amounts to standard curves to determine the concentration of OxPL in the biological sample. For example, the method can be considered a competition assay to measure phosphocholine on oxidized phospholipids using an antibody (e.g., EO6) in serum, plasma or cell culture. It will be recognized that the assay described above can be modified by ‘"reversing” the plated molecule. The methods of the disclosure provide the ability to measure OxPL in cerebral spinal fluid or neurological tissue using, e.g., an ELISA assay.

[0070] The diagnostic methods of the disclosure allow for the immunochemical determination of the quantity of oxidized phospholipid (OxPL) (phosphocholine containing OXPL) in spinal fluid, neurological tissue plasma, serum or fluid such as cell culture.

[0071] As described further herein, the disclosure demonstrates that OxPL on ApoE and ApoE4 can be used to identify and differentiation patients with ALS disease. For example, the disclosure demonstrates that OxPL on ApoE is increased in subjects with ALS compared to controls.

[0072] The methods of the disclosure can be used with an array (i. e., "biochip" or "microarray") that includes immobilized reagents such as antibodies or fragments against OxPL, ApoE or ApoE4 that facilitate the detection of PC-OxPL on ApoE and / or ApoE4 in a biological sample.

[0073] The term "array," generally refers to a predetermined spatial arrangement of binding islands, biomolecules, or spatial arrangements of binding islands or biomolecules. Arrays according to the disclosure that include biomolecules (e.g., antibodies or antibody fragments) immobilized on a surface may also be referred to as "biomolecule arrays." Arrays according to the disclosure that comprise surfaces activated, adapted, prepared, or modified to facilitate the binding of biomolecules to the surface may also be referred to as "binding arrays." The disclosure also contemplates surfaces bearing multiple arrays, referred to as "multiple arrays" or "repeating arrays." The use of the term "array" herein may encompass biomolecule arrays, binding arrays, multiple arrays, and any combination thereof, the appropriate meaning will be apparent from context. The biological sample can include fluid or solid samples from any tissue of the body including plasma.

[0074] An array of the disclosure or a solid phase comprises a substrate. By "substrate" or "solid support" or other grammatical equivalents, herein is meant any material appropriate for the attachment of biomolecules and is amenable to at least one detectionDocket No. 00015-444WO1method. As will be appreciated by those in the art, the number of possible substrates is very large. Possible substrates include, but are not limited to. glass and modified or functionalized glass, plastics (including acrylics, polystyrene and copolymers of styrene and other materials, polypropylene, polyethylene, polybutylene, polyurethanes, TEFLON®, etc.), polysaccharides, nylon or nitrocellulose, resins, silica or silica-based materials including silicon and modified silicon, carbon, metals, inorganic glasses, plastics, ceramics, and a variety of other polymers. In addition, as is known the art, the substrate may be coated with any number of materials, including polymers, such as dextrans, acrylamides, gelatins or agarose. Such coatings can facilitate the use of the array with a biological sample derived from serum or plasma.

[0075] A planar array of the disclosure can contain addressable locations (e.g., "pads", "addresses," or "micro-locations") of biomolecules in an array format. The size of the array will depend on the composition and end use of the array. Arrays containing from about 2 different biomolecules to many thousands can be made. In some embodiments, the compositions of the disclosure may not be in an array format; that is, for some embodiments, compositions comprising a single biomolecule may be made as well. In addition, in some arrays, multiple substrates may be used, either of different or identical compositions. Thus, for example, large planar arrays may comprise a plurality of smaller substrates. Parallel microfluidic devices comprising arrays would be useful for parallel measurements of OxPL and total OxPL content of a biological sample or for the measurement of OxPL.

[0076] In one embodiment, a substrate is labeled with a biomolecule that binds to PC-OxPL, the sample is then contact with a neurological tissue sample or cerebral fluid under conditions that PC-OxPL in the sample are bound to the biomolecule, the bound molecules are then washed (to remove unbound material) and a second, labeled, biomolecule that binds to the ApoE and / or ApoE4 is then contacted with the bound OxPL such that the amount of ApoE / ApoE4 comprising PC-OxPL in the sample can be quantified. The amount is then compared to standard curve(s). The curve(s) will then provide an indication as to the amount of OxPL bound to ApoE and / or ApoE4 in the biological sample. It will be recognized in the art, that the binding molecule attached to the substrate can be reversed (i.e., the binding molecule on the substrate can be an anti-ApoE and / or anti-ApoE4 binding molecule, e.g., antibody, and the second antibody can be an antibody that binds to PC-OxPL, e.g., EO6).

[0077] As an alternative to planar arrays, bead based assays in combination with flow cytometry have been developed to perform multiparametric immunoassays. In bead basedDocket No. 00015-444WO1assay systems the biomolecules can be immobilized on addressable microspheres. Each biomolecule for each individual immunoassay is coupled to a distinct type of microsphere (z.e., "microbead") and the immunoassay reaction takes place on the surface of the microspheres. Dyed microspheres with discrete fluorescence intensities are loaded separately with their appropriate biomolecules. The different bead sets carrying different binding agents can be pooled as necessary to generate custom bead arrays. Bead arrays are then incubated with the sample in a single reaction vessel to perform the immunoassay. Product formation of the biomarker with their immobilized binding agent can be detected with fluorescence based reporter systems. Biomarkers can either be labeled directly by a fluorogen or detected by a second fluorescently labeled antibody.

[0078] The signal intensities derived from captured biomarkers are measured in a flow cytometer. The flow cytometer first identifies each microsphere by its individual color code. Second the amount of captured biomarkers on each individual bead is measured by the second color fluorescence specific for the bound target. This allows multiplexed quantitation of multiple targets from a single sample within the same experiment. Sensitivity, reliability’ and accuracy are compared to standard microtiter ELISA procedures. With bead based immunoassay systems serum components can be simultaneously quantified from biological samples. An advantage of bead-based systems is the individual coupling of the capture biomolecule to distinct microspheres.

[0079] Surfaces useful according to the disclosure may be of any desired shape (form) and size. Non-limiting examples of surfaces include chips, continuous surfaces, curved surfaces, flexible surfaces, films, plates, sheets, tubes, and the like. Surfaces have areas ranging from approximately a square micron to approximately 500 cm2. The area, length, and width of surfaces according to the disclosure may be varied according to the requirements of the assay to be performed. Considerations may include, for example, ease of handling, limitations of the material(s) of which the surface is formed, requirements of detection systems, requirements of deposition systems (e.g., arrayers), and the like.

[0080] In certain embodiments, it is desirable to employ a physical means for separating groups or arrays of binding islands or immobilized biomolecules: such physical separation facilitates exposure of different groups or arrays to different solutions of interest. Therefore, in certain embodiments, arrays are situated within wells of 96, 384, 1536, or 3456 microwell plates or within chambers of a microfluidic plate / system. In such embodiments, theDocket No. 00015-444WO1bottoms of the wells may serve as surfaces for the formation of arrays, or arrays may be formed on other surfaces and then placed into wells.

[0081] Depending upon the format of the assay system and / or substrates used, the detection of bound reagents can be detected using any number of methods known in the art. Examples of such techniques include immunological techniques such as competitive binding assays and sandwich assays; fluorescence detection using instruments such as confocal scanners, confocal microscopes, or CCD-based systems and techniques such as fluorescence, fluorescence polarization (FP), fluorescence resonant energy transfer (FRET), total internal reflection fluorescence (TIRF), fluorescence correlation spectroscopy (FCS); colorimetric / spectrometric techniques; surface plasmon resonance, by which changes in mass of materials adsorbed at surfaces may be measured; techniques using radioisotopes, including conventional radioisotope binding and scintillation proximity assays (SPA); mass spectroscopy, such as matrix-assisted laser desorption / ionization mass spectroscopy (MALDI) and MALDI-time of flight (TOF) mass spectroscopy; ellipsometry, which is an optical method of measuring thickness of protein films; quartz crystal microbalance (QCM), a very sensitive method for measuring mass of materials adsorbing to surfaces; scanning probe microscopies, such as AFM and SEM; and techniques such as electrochemical, impedance, acoustic, microwave, and IR / Raman detection. See, e.g., Mere L, et al., " Miniaturized FRET assays and microfluidics: key components for ultra-high-throughput screening," Drug Discovery Today 4(8):363-369 (1999), and references cited therein;Lakowicz J R, Principles of Fluorescence Spectroscopy, 2nd Edition, Plenum Press (1999).

[0082] Arrays of the disclosure suitable for identifying ALS disease, disease progression and / or the efficacy of a treatment may be included in kits. In another embodiment, a pre-packaged diagnostic kit for determining the presence, risk of, or progression of ALS disease is provided. The kit may include an array as described above, instructions for using the array, and instructions for calculating risk based upon the level of total OxPL on ApoE and / or ApoE4 in a test sample when compared to standardized samples.

[0083] In other embodiments, a method for identifying progression or regression of ALS disease is provided. The method includes obtaining a first sample comprising neurological tissue (e.g., cerebral fluid) from a subject; administering a therapy to the subject; obtaining a second sample from the subject following administration of the therapy; determining the level of PC-OxPL on ApoE and / or ApoE4 in the first sample and second sample and comparing the change in values to one another or to a normal control valueDocket No. 00015-444WO1wherein an increase in PC-OxPL on ApoE and / or ApoE4 is indicative of disease progression. The information may be provided to a caregiver in various means including directly, paper print-out over, computer screen or over the internet to a remote location.

[0084] For diagnostic applications, the assay provides a molecule which can be used to detect the amount of bound PC-OxPL in the sample. Such molecules are referred to as a detectable moiety or detectable label. The detectable moiety can be any label which is capable of producing, either directly or indirectly, a detectable signal. For example, the detectable moiety may be a radioisotope, such as, but not limited to,3H,14C,32P,35S, ”C,1?N,15N,150,35B,18F,33P,47SC,51Cr,57Co,58Co,59Fe,62Cu,64Cu,67Cu,67Ga,68Ga,75Se,76Br,77Br,86Y,89Zr,90Y,94Tc,95Ru,97Ru,99Tc,103Ru,105Rh,105Ru,107Hg,109Pd, '" Ag, "’in, H3in 121Te?122Te, 123L124L125^ 125^ 126J 13 lj 133j 142pr, 143pr153pb153^ 161^ 165^166Dy,166Ho,167Tm,168Tm,169Yb,177Lu,186Re,188Re,189Re,197Pt,198Au,199Au,201Tl,203Hg,21’At,212Bi,212Pb,21-’Bi,223Ra,224Ac, or225Ac; a fluorescent or chemiluminescent compound, such as fluorescein isothiocyanate, rhodamine, or luciferin; a magnetic or paramagnetic element or compound, or an enzyme, such as alkaline phosphatase, beta-galactosidase or horseradish peroxidase. In some embodiments, therapeutic or diagnostic radioisotopes or other labels (e g., PET or SPECT labels) can be incorporated in the agent for conjugation to antibodies as described herein.

[0085] Any method known in the art for conj ugating an antibody or fragment or binding conjugate (e.g., biotin and streptavidin) to the detectable moiety may be employed, including those methods described by Hunter, et al., Nature 144:945 (1962); David, et al., Biochemistry 13:1014 (1974); Pain, et al., J. Immunol. Meth. 40:219 (1981); and Nygren, J. Histochem. and Cytochem. 30:407 (1982).

[0086] In other embodiments, the disclosure provides databases and computerized methods of analyzing and storing data associated with treatment regimens for ALS disease and related diseases. A database generated by the methods and analyses described herein can be included in, or associated with, a computer system for determining whether a treatment is successful. The database can include a plurality of digitally encoded "reference" (or "control") profiles. Each reference profile of the plurality can have a plurality of values, each value representing a level of, for example, PC-OxPL on ApoE and / or ApoE4 in an individual having, or predisposed to having, an ALS disease or disorder. Alternatively, a reference profile can be derived from an individual who is normal. Both types of profiles can be included in the database for consecutive or simultaneous comparison to a subject profile. TheDocket No. 00015-444WO1computer system can include a server containing a computer-executable code for receiving a profile and identifying from the database a matching reference profile that is diagnostically relevant to the subject profile. The identified profile can be supplied to a caregiver for diagnosis or further analysis.

[0087] Using standard programs, electronic medical records (EMR) can be accumulated to provide a database that combines, for example, index data with additional information such as the age of a patient or any other parameter useful for predicting whether or not a subject will or is responding to a treatment. Patient information can be randomly assigned a numerical identifier to maintain anonymity with testing laboratories and for security purposes. All data can be stored on a network that provides access to multiple users from various geographic locations.

[0088] Thus, the various techniques, methods, and aspects of the disclosure described herein can be implemented in part or in whole using computer-based systems and methods. Additionally, computer-based systems and methods can be used to augment or enhance the functionality described herein, increase the speed at which the functions can be performed, and provide additional features and aspects as a part of, or in addition to, those of the disclosure described herein.

[0089] The following examples are intended to illustrate but not limit the disclosure. While they are typical of those that might be used, other procedures known to those skilled in the art may alternatively be used.EXAMPLES

[0090] Immunohistochemistry and imaging of human tissue samples. FFPE tissue samples were obtained from the Netherlands Brain Bank (NBB). FFPE tissues were sectioned with Leica Biosystems Cryostat (Leica RM2255). Samples were trimmed until the entire section profile was visible. Sectioning continued until 30 consecutive 7 pm sections were retained.

[0091] For deparaffmization and rehydration, sections were incubated in Tissue Clear for 10 minutes (min). Then, sections were incubated in Tissue Clear / 100 % Ethanol (ETOH) (1:1) for five min, 100% ETOH for two min, 96% ETOH for two min, 70% ETOH for two min, and 50% ETOH for two min. Finally, the sections were washed in phosphate-buffered saline (PBS) for five minutes and incubated with ddH2O for two minutes.

[0092] A Tris-based buffer was prepared by adding 2.5 ml of Antigen Unmasking Solution (Tris-based) to 250 ml of ddH2O and pH-adjusting to 9.0. Slides were incubated in aDocket No. 00015-444WO1pressure cooker at 95 °C for 40 min and then cooled for 20 min. Sections were washed two times in PBS for three min.

[0093] Sections were encircled with a grease pen, and slides were sorted into a damp chamber. Sections were incubated with lx TrueBlack (Biotinum, cat. No. 23007) in 70% ETOH for 30 seconds (s) (100-150 pL per section) and washed two times for five min in PBS. Sections were blocked for 30 min with 10% donkey-blocking serum solution at room temperature (RT). The blocking buffer was wiped away, and sections were incubated with primary antibodies overnight at RT. Sections were washed three times for five min in PBS and incubated with secondary antibodies for one hour (h) at RT. Sections were washed twice for five min in PBS, followed by staining for 20 min with 4',6-diamidino-2-phenylindole (DAPI) solution. Sections were washed twice for five min in ddH2O and finally embedded in Mowiol (stored in a briefcase). Antibody details and experimental conditions are listed in detail in Table 1.Docket No. 00015-444WO1

[0094] Table 1:Docket No. 00015-444WO1

[0095] For imaging, Zeiss Axio Scan Z1 was used with 10 x lens, Plan Apochromatic (NA 0.45) or Fluar (NA 0.5) air.

[0096] Image processing and analysis. Images were initially obtained in. czi format. For image export, the original 16-bit format was converted to an 8-bit format. Images were processed using the following software: Zen Blue Edition (v 3.1 or higher), Image Pro Premier (v 9.3 or higher), and Fiji / Image J (v 1.54f). Line profile was generated in Zen lite using distance and intensity measurements for the channels of interest.

[0097] ApoE enzyme-linked immunosorbent assay (ELISA). Samples were assayed using the RayBio® Human APOE ELISA Kit. The assay was run following the manufacturer’s instructions; kit lot 0301240061 was used for the analysis. Samples were diluted at 1:3000 and 1:500 for plasma and CSF, respectively. In brief, after incubation with ApoE standard or plasma / CSF samples the wells were sequentially treated with biotinylated anti-ApoE, streptavidin and TMB One-step substrate reagent with buffer washes in between each step. After adding the TMB substrate, the plate was incubated for 30 min at RT under gentle shaking (450 rpm), after which 50 pL stop solution was added. Signals were acquired after five min by using the EnVision Reader at 450 nm. To determine ApoE concentrations, standard curve signals were log-log transformed and fitted by a 5-parameter logistic fitting model by using the GraphPad Prism V 9.5.1 Software. The back-calculated analyte amount was adjusted for the dilution factor to determine its concentration in the CSF samples.Relative APOE amount in ALS samples was calculated as a percentage concerning the average amount measured in healthy controls (HC) (defined as 100%).

[0098] Quantitation of PC-OxPL in human CSF on lipoproteins. Established and novel chemiluminescent enzyme linked assays were used to quantitate PC-OxPL on ApoB-100 (ApoB), Apo(a). ApoE, ApoE4. ApoC-III and ApoA-I in plasma. OxPL-ApoB, OxPL-Apo(a) and OxPL-ApoAI have been validated and previously described in detail. Briefly, antibodies MB47 binding to APOB, capture antibody to ApoE4 (product # NBP1-49529B, Novus Biologics), LPA4 binding to Apo(a) and sheep anti-human ApoA-I (The Binding Site, Birmingham. UK) are plated overnight at pg / ml to microtiter well plates, plasma is added at 1:50 dilution and OxPL-ApoB, OxPL- ApoE4 and OxPL-Apo(a) are detected by b-EO6 IgM and measured by chemiluminescence as relative light units per 100 milliseconds (RLU). A standard curve of PC equivalents using a linear range of PC-BSA is then used to convert RLU to nmol / L PC-OxPL which is additionally adjusted for the plasma dilution. To detect OxPL-ApoE and OxPL-ApoC-III, microtiter well plates were coated polyclonal rabbit antiDocket No. 00015-444WO1human ApoE (ThermoFisher Scientific, Waltham, MA) that recognizes all 3 ApoE isoforms at 5 pg / ml and a rabbit monoclonal antibody to ApoC-III (Abgent, San Diego, CA) at 2 pg / ml after documenting these concentrations were saturating. Plasma was added at 1:50 dilution and OxPL-ApoE and OxPL-ApoC-III were detected and reported in nmol / L as above. For CSF, because the concentration of analytes is lower, a 1:10 dilution of CSF was used and OxPL-ApoB. OxPL-Apo(a), OxPL-ApoE, OxPL-ApoE4, OxPL-ApoC-III and OxPL-ApoA-I were measured and reported after adjusting for appropriate dilution in a similar fashion to the plasma assays.

[0099] Targeted lipidomics analysis of human CSF and plasma. A targeted LC -MS assay covering 31 PC-OxPL species and their precursors was used to quantify their levels in the plasma of ALS patients and HC. The complete list of lipid species monitored and detected can be found in Table 2. In short, lipids were extracted using a modified methyl tert-butyl ether-based protocol from 25 pL of CSF or 25 pL of plasma after the addition of 20 pL of an internal standard mix (100 ng / mL DNPC and d5-PC 17:0 / 22:4 in methanol). After drying and reconstitution, samples were analyzed on a Shimadzu Nexera LC40 system coupled to a Sciex 6500+ QTrap mass spectrometer, following published protocols.Docket No. 00015-444WO1 L Wdiid F PCteawecp namreit

[0100] Table 2:MCMS2k4 FC)(t;- vtv•-.G? C':KOdFACt- CSEtaI2 WC8$«PC*(4)i ps;;- « S3 Sfc «Jg Jg Jgta CSET SACpas'dGJ SC B.. O 'S O ’S Bd SAKOE' ii. H00HMGS d SAPCOOH!i.. mmaa dftoisg §|§ $ <f B hA al sC & 4ft -Z? 3Z? 1Z2a’« "g•S1 sg -g-§• s if I I J 3| g O ’ JfN ■ = •i■$7.7 §H00. WS PtatsmrI Og E SDPCA fta? ’-■ * MS5 g 5 7 d O i S) 3<mi «- I - 2? di f Lit* ■ f ]L? O«i:s §3E js p' 7J5 a?o i i h | g§?ddi Ksci - >.§ § §I IDocket No. 00015-444WO1

[0101] Immunocytochemistry in vitro assays. In all immunocytochemistry experiments, cells were initially fixed with 4% (w / v) paraformaldehyde (PF A) (11586711. ThermoFisher Scientific) for 20 min at RT. Depending on the downstream target, further immunocytochemistry procedures were performed.

[0102] ApoE, pTDP-43, β-tubulin III and mitochondria detection. After washing with PBS (14190-094, Gibco) cells were permeabilized with 0,1% Triton X-100 (M236-10ML, VWR) for 15min at RT, washed three times with PBS, and incubated with blocking solution (3% BSA [422371X, VWR]) for 30 min at RT. Cells were incubated with the primary antibodies diluted in blocking solution overnight at 4 °C, or for one h at RT.Following three washes in PBS, cells were incubated with the secondary antibody diluted in blocking solution in the dark for Ih at RT. Cells were washed two times with PBS and incubated with Hoechst (H3570, Invitrogen) diluted 1:10000 in PBS in the dark for 10 min at RT. After one wash with PBS, cells w ere stored at 4 °C until imaging. For phosphorylated TDP-43 (pTDP43) and ApoE detection, tris-buffered Saline (TBS) was used instead of PBS. Further antibody details and experimental conditions are listed in detail in Table 1.

[0103] PC-OxPL detection. After washing with PBS, cells were permeabilized for 15 min with 0.5% Saponin (47036-50G-F, Sigma), washed three times with PBS, and incubated with blocking solution (5% goat serum [31873, ThermoFisher Scientific]) for 45 min at RT. Cells were incubated w ith the humanized EO6 full-length IgGl protein primary antibody (hEO6) diluted in blocking solution (1: 100) for one h at RT. Following three washes in 1% goat serum, cells w ere incubated with the goat anti-human IgG Alexa 647 (Invitrogen) diluted in blocking solution (1:750) in the dark for 1 h at RT. Cells were washed two times with PBS and incubated with Hoechst (1:10000 in PBS) in the dark for 10 min at RT. After one wash with PBS, cells were stored at 4 °C until imaging.

[0104] Imaging. Images of the cells w ere captured using the ImageXpress Pico system (Molecular Devices) with 10x / 20x / 40x magnification and up to four detection channels (FITC, TRITC, Cy5, and DAPI), depending on the secondary antibodies and dyes used in each experiment.

[0105] Analysis. Analyses were carried out using predefined analysis protocols in the CellReporterXpress Software. Average neurite outgrowth was quantified by running the neurite tracing protocol. The percentage of positive cells and all cell average intensities (shown graphically as ‘expression’) were quantified by running the cell scoring protocol. Mitochondria analysis was performed using an ImageJ (v1.53q) plugin to isolate soma-Docket No. 00015-444WO1specific mitochondrial signals. This was done by creating a mask (threshold = 32-255) from the original mitochondrial channel and excluding the neurite signal based on size range through the particles’ analysis tool (size 60-100000). The resultant mask, containing the area occupied by mitochondria within the soma, was then merged with the original fluorescence image using the Image Calculator tool, creating an image with mitochondrial fluorescence in the soma region only. This image was analyzed by setting and applying the Measure tool for the Mean Gray value.

[0106] HTRF TDP-43 Aggregation assay. The HTRF kit (TDP-43 aggregation kit, Cisbio) was used to measure TDP-43 aggregation, which is defined as insoluble cytoplasmic inclusions, according to the manufacturer's instructions. Briefly, 125.000 / 25.000 iCell Motor Neurons / Astrocytes (Fujifilm) were seeded in a co-culture setting on a Cytoview 96-well plate (M768-tMEA-96B, Axion Biosystems). Cells were cultured in BrainPhys™ Neuronal Medium (05790, STEMCELL TECHNOLOGIES), supplemented with and without DAPT (week one and two-three, respectively). AAV transduction was performed on day seven postcell seeding, and PSPC or PC-OxPL treatment (25 pM) was performed on day 21 for 24 h. followed by 24 h washout. On days 21-22 in vitro, two cellular lysates (wells) were pulled for each condition, and the assay ran with three technical replicates. For each sample, the ratio of acceptor and donor emission signals was calculated as follows: Ratio = (Signal 665 nm / Signal 620 nm) x 10E4. The aggregated ratio was calculated for each sample according to the following: Aggregated Ratio = Ratio Disaggregated Sample / Ratio Control Sample.

[0107] Generation and transduction of AAV5.2-ControI. Mouse PC-OxPL-VecTab® sequences were identical to a previously reported design (Que etal., Nature, 558:301-306, 2018) with minor modifications, including a different promotor (chicken -actin hybrid, CBh) and poly(A) tail. Humanized PC-OxPL-VecTab® sequences were generated to present a lower immunogenic profile and similar or slightly better binding in relation to mouse PC-OxPL-VecTab® formats.

[0108] A A V generation. AAV 5.2 carry ing the sequences for the various PC-OxPL- VecTabs® (i.e. the mouse or humanized scFv sequence) or the reporter gene green fluorescent protein (GFP) (i.e., AAV5.2-CBh-GFP) were produced in the Baculovirus-insect cell production system utilizing the artificial intron technology developed by ViroVek Inc. (Chen et al., Mol. Therapy, 16:924-930, 2008). To this end, two recombinant baculoviruses were generated and subsequently used for AAV production in Spodoptera frugiperda SI9 cells (Invitrogen). The first recombinant Baculovirus (Bac-CapRep) carried both the AAV5.2Docket No. 00015-444WO1Capsid (Cap5.2) and AAV2 Replication (Rep) sequences and was generated using the Bac-to-Bac system (Invitrogen). The second recombinant Baculovirus (Bac-Transgene) carried a transgene cassette containing the mouse, humanized PC-OxPL-VecTab® or GFP transgenes flanked by the AAV2 Inverted Terminal Repeat (ITR) sequences. The baculoviruses with the mE06 and GFP transgenes were produced with the Bac-to-Bac system. In contrast, the baculovirus with the hE06 transgene was produced by homologous recombination in Sf9 cells using the FlashBac-Ultra kit (Oxford Expression Technologies). Recombinant AAV production was performed by co-infection of Sf9 cells with Bac-CapRep and Bac-Transgene. Following harvest, the AAV vectors were purified using two rounds of CsCl density ultracentrifugation. The CsCl was removed through buffer exchange and the AAV vectors were filter sterilized. Purified AAV vectors were titrated using qPCR.

[0109] AA V transduction. Human iPSC-derived cultures were transduced with different AAV constructs at a multiplicity of infection (MOI) of 1E05, 1E06 and 1E07 in culturing medium seven to 10 days post-seeding. Half of the medium was removed from the wells before adding the AAV mixture. The same volume of fresh medium was added to the cells at four h post-transduction.

[0110] sALS CSF mouse model. Experiments were performed as described in Wong et al. (Brain Commun. 4, 2022), with minor modifications.

[0111] Patient demographics and CSF collection. CSF was obtained from one sALS patient diagnosed by board-certified neurologists with a subspeciality interest in ALS. CSF from one sALS patient seen at the Larry G. Gluck Division of ALS Research at the Tisch MS Research Center of New York (Tisch Center) was selected for this study. Information on patient demographics can be found in Wong et al., supra.

[0112] Institutional Review Board approval and informed consent according to the Declaration of Helsinki was granted prior to CSF collection. Samples were collected using sterile techniques either by lumbar puncture or access port aspiration of surgically implanted pumps. CSF samples w ere centrifuged at 200 x g for 15 min to remove cells, confirmed to be free of red blood cell contamination by microscopy, and then stored in aliquots at -80°C.

[0113] Intrathecal injection into cervical subarachnoid space. Adult female C57BL / 6J mice (aged nine weeks at the time of first surgery) purchased from The Jackson Laboratory (Bar Harbor, ME) were used. All procedures were approved by the Institutional Animal Care and Use Committee at Mispro Biotech Services (New York). Prior to surgery, mice were anaesthetized with ketamine (110 mg / kg) and xylazine (10 mg / kg) cocktail andDocket No. 00015-444WO1received subcutaneous injections of 0.1 mg / kg buprenorphine, 2.5 mg / kg baytril and 1 rnL 0.9% saline. Laminectomies at cervical levels 4 (C4) and 5 (C5) were performed to expose the underlying spinal cord. A 32-gauge Hamilton syringe was inserted underneath the dura mater and 5 pL of AAV5.2-PC-OxPL-VecTab® (1.3E12 gc / mouse) or saline were slowly injected into the subarachnoid space. After four weeks, a second surgery was performed and 3 pL of sALS CSF or saline were injected into the subarachnoid space. At least three mice were injected per group at each round and three independent rounds were performed. Mice were assigned to different treatment groups in a randomized manner.

[0114] Preincubation ofPC-OxPL- VecTab® with sALS CSF prior to intrathecal injection. To allow preincubation of sALS CSF, Control-VecTab® or PC-OxPL-VecTab® were produced at a concentration > 0.5 mg / mL. All buffers used were made using Versylene (endotoxin-free and sterile) water. Endotoxin was removed from instruments by incubation with 0.1 MNaOH for at least 16 h. HEK293E-253 cells were transfected with endotoxin-free plasmid DNA containing the sequences of interest using the rPEx technology (RPEXBIO). At six days post transfection conditioned medium containing recombinant protein was harvested by centrifugation and the samples stored at 4 °C. Using IMAC purification, the recombinant proteins were bound in batch to 0.5 mL Nickel Excel Sepharose for four to five h at 20 °C. Then, Nickel Excel Sepharose containing bound protein was harvested by centrifugation and transferred into a gravity flow column. A-specific bound proteins were removed by washing the column with IMAC buffer A containing 0 mM and 10 mM imidazole. The protein was eluted with IMAC buffer A containing 500 mM imidazole and collected into 2.5 rnL fractions. Recombinant protein-containing fractions were pooled. The conditioned medium and the unbound IMAC fraction were analyzed by LabChip capillary electrophoresis. Next, the buffer was exchanged for PBS by desalting using a HiPrep 26 / 10 desalting column equilibrated in PBS. Recombinant protein-containing fractions were pooled. If necessary, the sample was concentrated using an Amicon4 10 kDa spin filter. For formulation purposes, the pool was sterilized by filtration over a 0.22 pm syringe filter, and the product was stored in 0.5 mL aliquots at 4°C. Finally, both scFvs were analyzed by Labchip capillary electrophoresis.

[0115] Adult female C57BL / 6J mice (aged 13 weeks at the time of surgery) purchased from The Jackson Laboratory (Bar Harbor, ME) were used. Prior to intrathecal injection, two pg of purified recombinant scFv control -VecTab® or PC-OxPL-VecTab® were mixed with either saline or sALS CSF and kept on ice then at RT for 10 min prior toDocket No. 00015-444WO1injection. The intrathecal procedures were performed as described above. Two to five mice were injected per experimental group and one round of experiments was performed.

[0116] Motor deficit score testing. Following intrathecal delivery of CSF, all mice underwent motor testing at one day post-injection (DPI). Forelimb reaching, gripping and tail flaccidity were evaluated on a three-point scale. Mice were held by their tails above their cage bars and allowed to reach and grip the bars for five trials. Mice displaying no motor deficits were given a score of 0. Any deficits in either reaching or gripping were each given a score of 1. Specifically, inaccurate reach was considered a reaching deficit, and weakness in grip strength or clenched forepaws were scored as gripping deficits. Tail flaccidity was also given a score of 1. All motor testing was performed blinded with respect to treatment groups.

[0117] Grip strength testing. Mice were habituated to the grip strength meter (TSE systems) for three days prior to surgery. Each mouse was given one min to explore the grip strength meter, then held by their tails and allowed to grip the bar with both forelimbs for five consecutive trials. After a 30 s rest period, the mice were given another five trials to grip and then returned to their home cage. Baseline grip strength force was measured at one day prior to surgery and grip strength was also measured at one DPI. The mean grip strength force was calculated from five trials. Normalized grip strength values were calculated by dividing mean grip strength force on post-injection testing day by mean baseline grip strength force.

[0118] Tissue harvesting. Mice were overdosed with ketamine (300 mg / kg) and xylazine (30 mg / kg) and then perfused transcardially with phosphate-buffered saline (PBS) followed by 4% paraformaldehyde in 0.1 M PBS, pH 7.4. Spinal cords were dissected, postfixed in 4% paraformaldehyde overnight and then placed in 30% sucrose overnight for cryoprotection.

[0119] Cervical spinal cords were cut half cm rostral and half cm caudal to the injection site. The one cm segments were then embedded and frozen in Tissue Tek® (VWR International, PA). Spinal cords were sectioned sagittally at 20 pm thickness using a cryostat (Leica) and then slide-mounted onto Histobond® slides (VWR International, PA). The anatomical orientation of tissue sections and the order and position in which they were mounted onto the slides were kept consistent to facilitate unbiased histological comparisons, as described in further detail below.

[0120] Immunohistochemistry sALS CSF mouse model. Immunostaining was performed on a series of spinal cord sections at 100 pm intervals throughout the cervical spinal cord. Details on the antibodies used and experimental conditions are listed in Table 1.Docket No. 00015-444WO1

[0121] ChAT, TDP-43, GFAP and IBA1 detection. Slides with spinal cord sections were washed three times in 0.1% triton X-100 in PBS (PBS / T). then incubated in 10% normal goat serum (NGS) or normal donkey serum (NDS) in PBS / T for 1 h at RT. Primary antibodies were diluted in 10% NGS or NDS in PBS / T and incubation occurred overnight at 4°C. After incubation, slides were rinsed three times in PBS and incubated in the appropriate Alexa-Fluor secondary antibodies (Invitrogen) in 10% NGS or NDS in PBS / T for 1.5 h at RT. Slides were rinsed three times in PBS and then counterstained with 1:2500 DAPI in PBS (Invitrogen) for five min. After two final washes in PBS, free-floating brain sections were mounted onto slides, and slides were mounted using Fluoromount (Sigma).

[0122] PC-OxPL detection. Slides with spinal cord sections were washed three times in PBS, then incubated in blocking buffer (10% NGS in PBS / T) for one h at RT. The hE06 protein was used to detect PC-OxPL, which was diluted blocking buffer and incubated overnight at 4°C. After incubation, slides were rinsed three times in PBS for 10 min and incubated in the appropriate dilution of goat anti-human IgG Alexa 647 (Invitrogen) in blocking buffer for 1.5 h at RT. Slides were rinsed three times in PBS and then counterstained with 1:2500 DAPI in PBS (Invitrogen) for five min. After two final washes in PBS, slides were mounted using Fluoromount (Sigma).

[0123] Histological analyses. Images were captured at 20X magnification using a Zeiss Axio Imager. Acquisition parameters and exposure times were kept consistent for each antibody stain. To ensure unbiased comparisons between experimental groups, spinal cord images were captured from similar tissue section numbers on the slides and matching anatomical regions w ere verified by experimenters. The number of motor neurons and immunostaining intensifies w ere quantified using Imaged software. Three images w ere quantified per mouse for cell counts to calculate the mean motor neuron number.Fluorescence intensities were measured as mean grey values in regions of interest. Both imaging and quantification were performed by experimenters blinded to treatment groups.

[0124] Wt Mini pigs. Intrathecal delivery of AA V and tissue collection. All experiments were carried out according to the guidelines for the care and use of experimental animals and approved by the State Veterinary. Ten nine-month-old wt mini pigs were selected at the Institute of Animal Physiology and Genetics in Libechov (Czech Republic). For intrathecal administration, under deep sedation and after cleaning and disinfection of skin in the lumbar region of animals, a polyethylene tubing (PE 10, 427401, Intramedic Clay Adams) attached to a 5-mL syringe passed through a spinal needle (Spinocan; 4501195-13;Docket No. 00015-444WO11.188 mm; B. Braun Melsungen) was used. After tubing insertion into the intrathecal space, approximately one to two mL of CSF was collected to ensure precise localization of the tubing. Next, four mL of AAV5.2-CBh-GFP (4.5E13 gc / mL) or AAV5.2-CBh-PC-OxPL-VecTab® (2.9E13 gc / mL) were injected in five mini pigs per group. After administration all animals in all groups were under observation until awakening. For at least three days postapplication, animals were delivered daily analgesics for pain relief.

[0125] Eight weeks after treatment, mini pigs were euthanized under deep sedation followed by anesthesia overdosing with Propofol and whole-body PBS perfusion of the animal. Once removed from the skull, the brain was coronally sliced into three to four mm blocks from frontal to caudal. The right hemisphere was used for biomolecular analyses, where 38 brain punches were taken, snap-frozen in liquid nitrogen and stored at 80°C. The right hemisphere was fixed by 4% paraformaldehyde (PFA) overnight and then transferred to 30% sucrose with sodium azide for sectioning. The spinal cord was separated into the cervical, thoracic and lumbar segments and each segment was divided into three pieces, two were snap- frozen in liquid nitrogen for molecular analysis, and one was PFA-fixed and transferred to 30% sucrose with sodium azide for immunohistochemistry purposes.

[0126] DNA isolation and vector (vDNA) quantification. DNA isolation from brain tissue punches was performed using the DNeasy blood and tissue kit (QIAGEN, Germany). DNA concentrations were determined using the NanoDrop ONEc (Thermo Scientific).Primers specific for the CBh promoter sequence were used to measure the vector genome copies (gcs) by TaqMan qPCR (Thermo Fisher Scientific). The amount of vector DNA was calculated based on a plasmid standard curve. Results were reported as gc / ug genomic DNA.

[0127] RNA isolation and transgene mRNA quantification. RNA isolation was performed using the RNeasy Mini kit (74104, Qiagen) according to the manufacturer's protocol and eluted in 30 pl of RNase-free water. RNA concentrations were determined using NanoDrop ONEC (Thermo Scientific).

[0128] cDNA synthesis and qPCR were performed using the same protocol as for the cells (see above). Real-time PCR amplification was performed with customized TaqMan primers for GFP or PC-OxPL-VecTab® expression and with TaqMan primers for Sus scrofa Hypoxanthine Phosphoribosyl transferase 1 (Hprtl) porcine housekeeping gene (Ss03388274_ml, Thermo Fisher). The transgene mRNA expression levels were calculated as FC to ss Hprtl expression.Docket No. 00015-444WO1

[0129] Immunohistochemistry wt mini pig study. PFA-fixed brain slices were cut into 20-mm sections (10-15 sections / slice), spread on a microscopic slide and air-dried. For immunostaining analysis, the sections on glass were antigen-retrieved by treating in citrate buffer (pH = 6) at 90°C for 30 min. Subsequently, endogenous peroxidase activity was blocked with a solution of 0.3% hydrogen peroxide in methanol for 20 min. The brain sections were immunostained using the rabbit primary’ antibody anti-GFP (1:1.000), incubated with a biotinylated donkey anti-rabbit secondary antibody (1:400, RPN 1004V; GE Healthcare), followed by an avidin-peroxidase complex (1:400, A31 1; Sigma-Aldrich). The avidin-peroxidase complex w as visualized by incubation with a solution containing a dissolved 3,30-diaminobenzidine tablet (4170; Kementec Diagnostics). The sections were dehydrated and mounted with DePeX (Sigma). Images were acquired using a histological scanner (VS 120-5 Virtual Slide Microscope fluorescence; Olympus).

[0130] Statistical analysis. Statistical analysis was performed with GraphPad Prism (versions 9.2.0 and 10.2.3). Differences in (Ox)PCs measured by LC-MS in CSF and plasma were determined using a two-tailed Welch’s t-test. Differences in neurite outgrowth (TUBB3), PC-OxPL and pTDP-43 profile as measured by immunohistochemistry were evaluated using tw o-w ay ANOVA. Differences in the TDP-43 aggregation profile w ere assessed using one-w ay ANOVA with Tukey's or Dunnett’s multiple comparison test.

[0131] Differences in PC-OxPL content on different apolipoproteins were assessed with a one-way ANOVA with Dunnett’s multiple comparison test. Differences in the APOE profile as measured by immunohistochemistry were evaluated using a two-way ANOVA with Sidak’s multiple comparison test. Normalized APOE concentrations in motor neurons, plasma, and CSF w ere determined according to a tw o-tailed Mann- Whitney test.

[0132] Motor deficit scores, normalized grip strength, motor neuron numbers, and immunostaining intensities were analyzed using a one-way ANOVA with Bonferroni post hoc analyses.

[0133] All values are expressed as mean ± the standard error of the mean (SEM). No statistical predictions were used to determine sample size (n) but the n used resembled published literature and what is generally performed in the field. Statistical significance was considered for p-values (p) < 0.05 (p < 0.0001: ****; p < 0.001: ***; p < 0.01: **; p < 0.05: *; p > 0.05: ns or not significant).

[0134] PC-OxPL accumulates in the diseased ALS brain and spinal cord. TDP-43 pathology is present in 97% of all ALS patients and spreads differentially throughout brainDocket No. 00015-444WO1areas with disease progression. The presence of PC-OxPL across different human brain regions in patients with ALS, was assessed. Evaluation of spinal cord, frontal cortex, thalamus, hippocampus and occipital cortex areas showed the presence of PC-OxPL, primarily within cell bodies and with variable signal intensities, depending on the brain area and individual (Fig. 1A). Overall, more PC-OxPL signal was retrieved in the spinal cord ventral horn and white matter areas (where ALS pathology is usually most predominant), of ALS patients in comparison to non-demented controls (NDC) (Fig. 1B). Considering the central role of motor neuron pathology in ALS onset and progression, the subtype cell specificity of PC-OxPL accumulation was investigated by analyzing the hE06, ChAT (motor neuron) and DAPI (all cells) signal profile in the spinal cord. Specific PC-OxPL accumulation was found in ChAT+ neurons in the spinal cord ventral horn regions, as shown by the co-localization of hE06 with ChAT, but not with DAPI (Fig. 1C-D).

[0135] Next, the profile of PC-OxPL species in ALS was analyzed. To address this, targeted lipidomics analysis was performed on CSF and plasma collected from ALS patients and HC. Six precursor families (PC) and their corresponding PC-OxPL products was analyzed. Analysis of CSF collected from ALS patients revealed an overall increase in 16 / 18 PC-OxPL detected species, out of w hich 10 / 18 found to be significantly changed (Fig. 1E).Notably, this upregulation trend was replicated in their precursors profile in comparison to HC (Fig. 1E). The same species displayed an opposite profile in matched ALS plasma, with 12 / 18 found to be significantly downregulated in comparison to HC (Fig. 1F).

[0136] PC-OxPL induces ALS-like phenotypes in healthy motor neurons. Having established the pathological PC-OxPL phenotype in ALS, experiments were performed to understand what molecular mechanisms are activated by PC-OxPL in relevant brain cell types. 16:0 / 18:1, l-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC). is found to be the most abundant PC species in the rat, porcine and human brain and its oxidation results in two main 16:0 / 09:0 PC-OxPL species: PONPC and PAzPC, which were also found to be the most elevated PC -OxPLs in reactive lesions in the multiple sclerosis (MS) brain. Hence, a comparison of the effects of PONPC and PAzPC on wt motor neurons was performed. Both PC-OxPL species showed clear effects on neuronal toxicity compared to a non-oxidized PC (PSPC). Yet PAzPC showed a higher level of toxicity leading to irreparable cell death which could compromise further analysis (FIG. 4A-B). Thus, PONPC was the selected PC-OxPL agent in subsequent in vitro assays.Docket No. 00015-444WO1

[0137] Transcriptome analysis of iPSC-derived motor neurons using Nano String Technology was performed to understand the molecular mechanisms activated by PC-OxPL exposure, using two pre-designed gene expression panels: ‘Neuropathology’ and ‘Neuroinflammation’. Of the 770 transcripts on each panel, exposure of wt neurons to PONPC led to 173 (Neuropathology) and 138 (Neuroinflammation) differently expressed (DE) genes, which accounted for approximately 25% transcriptome alterations in response to PONPC exposure. Gene Ontology (GO) analysis of the same gene list revealed ‘Response to stimulus’, ‘Programmed cell death’, ‘apoptosis’, ‘regulation of molecular functions’, ‘transcriptome remodeling’ and ‘protein phosphorylation' to be among the most representative pathways in motor neurons following PONPC exposure (Fig. 2A). Next, commercially available iPSC-derived motor neurons harboring known ALS-associated mutations were used to replicate part of ALS pathophysiology in vitro. The transcriptomic profile of extensively characterized ALS motor neurons carrying TDP-43M337Vand SOD1G93Awas compared to one of wt motor neurons exposed to PONPC. Overlapping dysregulation in gene expression was observed between TDP-43M337Vand SOD1G93Atranscriptome (NP = 35.08%; NI = 34.35%), as was expected considering that these genes are related to ALS pathogenesis (Fig. 2B). Considerable transcriptome overlap was found between wt motor neurons exposed to PONPC and SOD1G93Amotor neurons (NP = 39.69%; NI = 50.31%) and, to a lesser extent, TDP-43M337Vmotor neurons (NP = 28.48%; NI = 50.31%) (Fig. 2B). Of all DE transcripts. 31.03% (NP) and 22.58% (NI) were found to be deregulated among all three iPSC-derived motor neuron lines (wt exposed to PONPC, TDP-43M337Vand SOD1G93A). To further validate these findings in a broader ALS context and to exclude effects of general oxidative stress and inflammatory hallmarks, a comparison of the changes observed in wt motor neurons exposed to PONPC with two independent datasets: (1) ALSoD and (2) Postmortem spinal cord tissue from patients with sporadic ALS (D’Erchia etal., Sci. Rep. 7, 2017) was performed (Fig. 2C). The analyses revealed that 5% (n = 36) of the transcripts that were previously related to ALS according to selected databases (1, 2) clearly altered expression following PONPC treatment (Fig. 2D). This is likely an underestimation as the NanoString panels include a limited number of genes (n = 770), instead of a complete transcriptome analysis. The overlapping transcripts between databases (1, 2) and with altered expression following PONPC exposure in motor neurons are listed in Table 3, along with a brief description of their function.Docket No. 00015-444WO1

[0138] Table 3: PONPC-sensitive transcripts in motor neurons with a role in ALS. The Human Protein Atlas was used to describe gene names and functions.Gene Description FunctionACTN1 Actinin alpha 1 Actin bindingLipid metabolism, cholesterol APOE Apolipoprotein E metabolism, lipid transport, steroid metabolismGTPase activation, exploratory dendritic ARHGAP44 Rho GTPase activating protein 44filopodiaATPase plasma membrane Ca2+ATP2B3 Intracellular calcium homeostasis transporting 3ATPase phospholipid transportingATP8A2 Lipid flipping, lipid transport8A2ATXN2 Ataxin 2 Endocytosis, mTOR signals, ribosomal translation, mitochondrial function Autophagy, endosomal trafficking, C9orf72 C9orf72-SMCR8 complex subunitendocytic transportCABLES1 Cdk5 and Abl enzyme substrate 1 Neuronal outgrowthCalcium voltage-gated channelCACNA1B Calcium neuronal signalingsubunit alphal BCalcium dependent secretion Vesicular exocytosis of neurotransmitters CADPSactivator and neuropeptidesCALB2 Calbindin 2 Calcium signalingCHAT Choline O-acetyltransferase Biosynthesis of acetylcholine Endosomal transport, lysosomal Charged multivesicular bodyCHMP2B degradation of membrane proteins, protein 2Blysosomal enzy mes, and lipids Cholinergic receptor nicotinic Acety lcholine receptor, ligand-gated ion CHNA7alpha 7 subunit channelCholinergic receptor nicotinic beta Acetylcholine receptor, ligand-gated ion CHNB22 subunit channelSurvival factor, prevention of motor CNTF Ciliary neurotrophic factoraxons degenerationAngiogenesis, extracellular matrix COL4A1 Collagen type IV alpha 1 chainhomeostasisCTSS Cathepsin S Protein degradationApoptosis, Differentiation, Endocytosis, DAB2 DAB adaptor protein 2Protein transport, Wnt signaling pathway Immunoregulation, protein folding and FKBP5 FKBP prolyl isomerase 5traffickingFERM and PDZ domainFRMPD4 Excitatory synaptic transmissioncontaining 4Docket No. 00015-444WO1Glutamate ionotropic receptorGRIN2B Calcium permeability, synaptic plasticity NMDA type subunit 2BGRM3 Glutamate metabotropic receptor 3 G-protein coupled receptor for glutamate Lysosomal regulation, Inflammatory GRN Granulin precursorresponseInterleukin 10 receptor subunitIL10RA Inflammatory responsealphaInterleukin 13 receptor subunitIL13RA1 Inflammatory responsealpha 1Inositol 1,4,5-trisphosphateITPR2 Calcium transportreceptor type 2MYD88 innate immune signalMYD88 Inflammatory response transduction adaptorRAB3C, member RAS oncogeneRAB3C Protein transportfamilySLC12A5 Solute carrier family 12 member 5 Potassium-chloride cotransport SYP Synaptophysin Synaptic plasticity Metalloproteinase inhibitor, cell TIMP1 TIMP metallopeptidase inhibitor 1proliferation, anti-apoptotic function TNF receptor superfamily memberTNFRSF1A Inflammation, apoptosis1AUNC13A Unc-13 homolog A Neurotransmitter releaseCell shape maintenance, cytoskeletal VIM Vimentinhomeostasis, cytoplasm integrity

[0139] Given the increasing focus on TDP-43 loss-of-function in ALS an investigation of the overlap in signatures between PONPC-sensitive transcripts and the genome landscape following neuronal TDP-43 depletion was performed. To do so, an available RNA-sequencing dataset of iPSC-derived neurons displaying reduced TDP-43 expression following CRISPRi approach was used (Brown et al., Nature 603: 131 - 137, 2022). Of the total PONPC-sensitive transcripts, approximately 40% (111 / 311) were found to be altered in neurons with reduced TDP-43 expression. Among other relevant genes, UNC13A, known to underline ALS pathology was identified and further strengthen the relevance of PC-OxPL neurotoxicity7to the molecular signatures that characterize ALS.

[0140] Because ferroptosis is closely linked to lipid oxidation and PC-OxPL neurotoxicity, experiments were performed to investigate the presence of ferroptosisDocket No. 00015-444WO1signatures in the transcriptomic data. To do so, both the (1) DE transcripts following wt motor neurons + PONPC and (2) ALS-related DE transcripts following wt motor neurons + PONPC were cross-checked with FerrDb, an online curated database for ferroptosis markers and associations. Significant ferroptosis-related hits were found among the DE following wt motor neurons + PONPC, while no statistically significant ferroptosis hits were found among the ALS-related DE following wt motor neurons + PONPC.

[0141] Next, the phenotypic consequences of motor neuron exposure to PONPC was assessed by focusing on general neuronal health, TDP-43 aggregation and phosphorylation, as relevant processes underlying ALS pathology'. Exposure of wt motor neurons to PONPC led to neuronal toxicity', as shown by changes in neurite outgrowth and network organization (Fig. 2E). Notably, PONPC exposure caused marked and clear TDP-43 aggregation both in wi and ALS (TDP-43M337V) motor neurons after 24 h of PONPC exposure followed by a 24 h washout (Fig. 2F). In general, the effects were comparable for both iPSC-derived motor neuron lines and more significant than the effect of the commonly used proteasome inhibitor carbobenzoxy-Leu-Leu-leucinal (MG- 132) (FIG.5A). No significant alterations in TDP-43 phosphorylation were observed under similar conditions with immunohistochemistry using a selected anti-pTDP-43 (FIG. 5B). Finally, mitochondrial dysfunction is an essential marker of oxidative stress and, particularly, of cellular ferroptosis.. Yet, when considering the percentage of mitochondria+ cells or overall mitochondria expression, no differences in the mitochondrial phenotypes of motor neurons following PONPC exposure were observed (Fig.5C-D)

[0142] PONPC-exposed motor neurons developed ALS-associated transcriptomic changes, extensive TDP-43 aggregation, and altered neurite outgrowth, all of w hich are established ALS hallmarks.

[0143] APOE is the main carrier of PC-OxPL in the CNS. While ALS motor neurons greatly overproduce glycerophospholipids precursors of PC-OxPL they are not efficient at metabolizing fatty7acids, and depend on lipid metabolism by neighboring astrocytes. Lipid redistribution in the CNS is mostly facilitated by APOE. In plasma, PC-OxPL are mainly carried by apoB-100 containing particles such as Lp(a) and LDL particles, but LDL particles are present in CSF only at very low concentrations.

[0144] Interestingly, APOE was among the most DE genes in wt and ALS motor neurons in response to PONPC exposure (Fig. 3A). This pattern was mirrored by increased protein expression, as shown by the increase in the number of APOE+ cells in a time-Docket No. 00015-444WO1dependent manner (Fig. 3B, left panel) and average intensity (Fig. 3B, right panel). To better understand the apolipoprotein / PC-OxPL profile in ALS biofluids from ALS patients were analyzed and the respective PC-OxPL content across different apolipoproteins (ApoB-100, Apo(a), ApoE, ApoE4, ApoC-III, ApoA-I). PC-OxPL were detected predominantly on APOE particles in the CSF derived from ALS patients (Fig. 3C), and this was replicated in HC biofluids. A distinct profile was observed in the plasma collected from the same patients, where a homogenous distribution of PC-OxPL on the different apolipoproteins was observed, with the exception of APOA-I (Fig.3C). Since these observations are consistent with a contributing role for APOE in PC-OxPL metabolism in ALS experiments w ere performed to further investigated the APOE pattern and profile in ALS. Quantitative and qualitative analysis revealed increased APOE expression in white and grey matter regions of the ALS spinal cord in comparison to NDC (Fig. 3D). Similarly to the trend observed in the apolipoprotein / PC-OxPL profile, APOE concentration was significantly increased in CSF, but not plasma, of ALS patients in comparison to HC (Fig. 3E). Taken together, these results place APOE at the center of PC-OxPL metabolism in the CNS.

[0145] AAV5.2-delivered PC-OxPL-VecTab®, prevents neurotoxicity in wt motor neurons. The histological characterization and in vitro assays described above suggest that PC-OxPL neutralization is an attractive upstream approach to target ALS-related phenotypes.

[0146] An AAV5.2-delivered approach was used based on a vectorized scFv that exclusively binds to the PC headgroup of oxidized phospholipids (PC-OxPL-VecTab®) (Fig.6a). The transduction efficiency of the AAV5.2 construct was assessed in cortical and motor neurons, astrocytes, and motor neuronal and astrocytic co-culture, with green fluorescent protein (GFP). AAV5.2-GFP successfully transduced ALS-relevant cell types including motor neurons, astrocytes, or co-cultures at higher transduction rates (50-90%). In particular, 40-60% of all motor neurons were successfully targeted by AAV5.2-GFP at a MOI = 1E06 (Fig.6b). Transduction and expression of the transgene of interest (PC-OxPL-VecTab®) were correlated in a dose-dependent manner (Fig. 6E) as shown by the evaluation of PC-OxPL-VecTab® mRNA (Fig.6C) and protein (Fig. 6D) content at three different doses in motor neurons and astrocytes.

[0147] Next, the efficacy of PC-OxPL-VecTab® was evaluated in neutralizing the effects of PONPC toxicity in wt motor neurons. The transcripts influenced by PC-OxPL-VecTab® included molecular pathways such as regulation of cell death, apoptotic processes,Docket No. 00015-444WO1protein metabolic processes, molecular function and response to endogenous stimulus (Fig.6F). Approximately 50% of all PONPC-sensitive transcripts previously associated with ALS (Fig. 2D) (n = 18 out of 36) showed partial or complete restoration (>0.1 FC) following treatment with PC-OxPL-VecTab® (Fig. 6G).

[0148] To further determine the effect of PC-OxPL-VecTab® on ALS-associated motor neuron pathology, experiments focused on the mechanisms relevant to ALS. such as TDP-43 proteinopathy. To avoid artifacts or observations resulting from AAV transduction rather than specific AAV5.2-PC-OxPL-VecTab® effects, a qualitatively evaluation of the coculture phenotypes was performed under non-transduced and AAV5.2-Control conditions. Microscopic observation of the neuronal network of both wt and ALS motor neurons did not reveal any noticeable differences upon AAV5.2 transduction over time in culture. This same AAV construct did not affect TDP-43 aggregation, as measured by the HTRF assay, in comparison to a non-transduced condition (Fig. 6H). Notably, it was found that both mouse and humanized PC-OxPL-VecTab® were able to entirely prevent TDP-43 aggregation caused by PONPC exposure of wt or ALS motor neurons (Fig. 6H).

[0149] PC-OxPL-VecTab® neutralizes PC-OxPL toxicity in a sALS CSF mouse model. While the evaluation of PC-OxPL-VecTab® in vitro offers a preliminary indication of its potential in neutralizing PC-OxPL toxicity, understanding its value in different models with added complexity is crucial from a therapeutic standpoint. To examine whether single dosing of AAV5.2-PC-OxPL-VecTab® could lead to in vivo functional improvements an sALS CSF mouse model was selected which has been shown to display several pathological features of ALS.

[0150] Adult female C57BL / 6J wt mice were first inj ected with AAV5.2-PC-OxPL-VecTab® into the mid-cervical subarachnoid space. Four weeks after the AAV injection, the same mice were injected w ith sALS patient-derived CSF according to the same route of administration. A moderate but clear increase in PC-OxPL signal in motor neurons was observed following sALS CSF exposure (Fig. 7A). This was accompanied by the onset of functional disabilities, as shown by developed forelimb motor deficits and decreased grip strength, though the effects on the latter readout did not reach statistical significance (Fig. 7B-C), and motor neuron degeneration (Fig. 7D).

[0151] In parallel, the protective effect of AAV5.2-PC-OxPL-VecTab® administration in reverting these phenotypes was examined. Intrathecal injection with AAV5.2-PC-OxPL-VecTab® and subsequent sALS CSF led to a normalization of PC-OxPLDocket No. 00015-444WO1levels in the spinal cord (Fig. 7A). At the same time, it prevented motor impairments, as shown by the motor deficit scores and grip strength levels comparable to those injected with saline (Fig. 7B-C). Furthermore, it completely abolished motor neuron death caused by sALS CSF injection, as shown by a similar number of ChAT+ motor neurons as saline-injected mice (Fig. 7D)

[0152] Thus far, the results described underscore a link between PC-OxPL and CSF-mediated toxicity in ALS. However, these findings do not rule out the possibility that sALS CSF toxicity may result from phospholipid oxidation products (e g., 4’-HNE or MDA) rather than direct PC-OxPL toxicity. Hence, the effect of purified non-vectorized PC-OxPL-VecTab® preincubation with sALS CSF prior to intrathecal injection was assessed. This approach revealed that preincubation of sALS CSF with PC-OxPL-VecTab®, but not with Control -VecTab®, prevented overall sALS CSF toxicity, including PC-OxPL accumulation (Fig. 7E), motor deficits (Fig. 7F), grip strength decline (Fig. 7G), and motor neuron degeneration (Fig. 7H). Also, preincubation with PC-OxPL-VecTab® prevented TDP-43 mislocalization induced by sALS CSF treatment, however, the effects were not statistically significant. No differences were found in GFAP / IBA1 expression upon sALS CSF preincubation with either Control- or PC-OxPL-VecTab®.

[0153] Altogether, these findings demonstrate that PC-OxPL are key contributors to sALS pathology via CSF transfer and that PC-OxPL-VecTab® effectively reverses this toxicity.

[0154] Having established the efficacy of PC-OxPL-VecTab® in neutralizing PC-OxPL toxicity using in vitro and in vivo approaches, experiments were performed to determine its therapeutic feasibility.

[0155] Due to large differences in anatomy, brain size, and spinal cord length between rodents and humans, studies in large animals are key to establishing a clinical development trajectory7. In ALS, the spinal cord and motor cortex are the primary' affected regions and, upon intrathecal injection, the CSF flow7contributes to the distribution of the AAV5.2 vector along the spinal cord and cortical regions.

[0156] To investigate the feasibility of intrathecal injection to target the spinal cord and motor cortex, experiments investigated the biodistribution and expression level of AAV5.2-PC-OxPL-VecTab® in the CNS of large animals upon a one-time administration. Five wt mini pigs were injected with AAV5.2-PC-OxPL-VecTab® or AAV5.2-GFP via intrathecal administration in the lumbar region of the spinal cord. After injection, the animalsDocket No. 00015-444WO1were followed for eight weeks before necropsy. The biodistribution of AAV5.2 was determined by vector DNA (vDNA) genome copies (gc) in the different segments of the spinal cord (cervical, thoracic and lumbar), in the motor cortex, temporal cortex and occipital cortex. Consistent with the route of injection and CSF flow, high levels of vDNA were detected in the spinal cord, being the highest in the lumbar region, and in all cortical areas. AAV5.2-PC-OxPL-VecTab® and -GFP mRNA expression levels were measured in the same regions and quantified as FC to the porcine housekeeping gene Hprtl. The highest levels of transgene expression (>1 FC to Hprtl) were detected in the lumbar spinal cord. Correlation analysis between vector DNA levels and mRNA levels showed a significant positive correlation between transduction levels and transgene expression in both spinal cord and brain cortex tissues. To visualize the AAV distribution in the brain. GFP immunohistochemical analysis was performed. The motor cortex, particularly large pyramidal neurons in layer V, showed GFP signal. In the cervical and in lumbar spinal cord, a high number of large cells in the ventral horn, potentially motor neurons, were positive for GFP staining. Taken together, these results show that the intrathecal administration of AAV5.2-PC-OxPL-VecTab® is an effective route of administration to target the primary ALS-affected areas - spinal cord and cortex -, in large animals.

[0157] It will be understood that various modifications may be made without departing from the spirit and scope of this disclosure. Accordingly, other embodiments are within the scope of the following claims.

Claims

Docket No. 00015-444WO1IN THE CLAIMS:

1. A method for determining and or distinguishing an ALS disease or disorder in a subject, the method comprising:a) obtaining a sample from the subj ect;b) contacting the sample with a substrate comprising an antibody, antibody fragment or non-immunoglobulin binding domains that bind to PC-OxPL under conditions such that PC-OxPL binds to the antibody, antibody fragment or non-immunoglobulin binding domains;c) contacting bound PC-OxPL with an agent that binds to ApoE and / or ApoE4; d) comparing the levels of ApoE-PC-OxPL and / or ApoE4-PC-OxPL to a standard curve;e) identifying an amount of PC-OxPL bound to ApoE and / or ApoE4 in the sample based upon the standard curve, wherein the amount is indicative of an ALS disease or disorder.

2. The method of claim 1, wherein the sample is neurological tissue or cerebral fluid.

3. The method of claim 1, wherein the agent comprises a label selected from the group consisting of a fluorescent molecule, a luminescent molecule, an enzyme, and a radiolabel.

4. The method of claim 1, wherein the antibody, antibody fragment or non-immunoglobulin binding domains that bind to PC-OxPL is an EO6 antibody or a fragment thereof or an antibody, antibody fragment that has the binding specificity of an EO6 antibody.

5. A method for determining whether a subject has or is at risk of having ALS, the method comprising:(a) determining the subject's level of OxPL in a biological sample,wherein a level of OxPL higher than a normal control is indicative of ALS or a risk of having ALS.

6. The method of claim 5, wherein the OxPL is associated with apolipoprotein E (ApoE) particles.Docket No. 00015-444WO17. The method of claim 5, wherein the OxPL is associated with ApoE or ApoE4.

8. The method of claim 5, wherein the subject is a human subject.

9. The method of claim 7, wherein the OxPL and ApoE is measured in an immunoassay using an antibody the interacts with OxPL and an antibody that interacts with ApoE.

10. The method of claim 9, wherein the antibody that interacts with OxPL is EO6 or an antibody that has the binding specificity of EO6.

11. A kit for determining ALS in a subject or a subject's predisposition to ALS, the kit comprising:(a) agents suitable for determining a subject's cerebral fluid OxPL level;(b) agents suitable for determining the subject's cerebral fluid ApoE content;(c) instructions for using the kit to determine the level of OxPL on ApoE in cerebral fluid.

12. The kit of claim 11, wherein the agents are antibodies.

13. The kit of claim 12, wherein the antibodies are monoclonal antibodies.

14. The kit of claim 13, wherein the one antibody is E06 or has the binding affinity of an EO6 antibody.

15. The kit of claims 11, further comprising one or more detectable labels that can be conjugated or are conjugated to one or more agents.

Images