Methods of producing high levels of betalain pigments and l-DOPA in plant tissues
Constructs expressing DODA, cDOPA5GT, and CYP76AD1 proteins enhance betalain biosynthesis in plants, addressing inefficiencies and cost issues, achieving high betalain levels suitable for industrial applications.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- WISCONSIN ALUMNI RES FOUND
- Filing Date
- 2026-01-21
- Publication Date
- 2026-07-30
AI Technical Summary
Current methods for producing betalain pigments are inefficient and costly, limiting their widespread adoption despite consumer preference for natural dyes due to safety and sustainability concerns, with existing breeding efforts plateauing in betalain content in table beets.
The development of constructs comprising polynucleotides encoding L-DOPA 4,5-dioxygenase (DODA), cDOPA 5-O-glucosyltransferase (cDOPA5GT), and CYP76AD1 proteins, expressed in plants to enhance betalain biosynthesis, using a 'push-and-pull' strategy to increase tyrosine supply and convert it into betalains.
The constructs significantly boost betalain production in transgenic plants, achieving levels surpassing those of elite beet cultivars, offering cost-effective and stable natural red pigments for industrial use.
Smart Images

Figure US2026012049_30072026_PF_FP_ABST
Abstract
Description
[0001] METHODS OF PRODUCING HIGH LELVELS OF BETALAIN PIGMENTS AND L-DOPA IN PLANT TISSUES AND USES THEREOF CROSS-REFERENCE TO RELATED APPLICATIONS This patent application claims the benefit of U. S. Provisional Application No. 63 / 747,808 filed on January 21, 2025, the entire contents of which are incorporated herein by reference.
[0002] STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0003] This invention was made with government support under grant number 20206701330898 awarded by the USDA / NIFA and under grant number 1917138 awarded by the National Science Foundation. The government has certain rights in the invention.
[0004] SEQUENCE LISTING A Sequence Listing accompanies this application and is submitted as an XML file of the sequence listing named “96029604731_SL.xml” which is 72,060 bytes in size and was created on January 20, 2026. The sequence listing is electronically submitted via Patent Center with the application and is incorporated herein by reference in its entirety.
[0005] FIELD OF INVENTION
[0006] The present disclosure relates to constructs, plants, and methods for the production of food dye, consumer products and beneficial compounds and uses thereof.
[0007] BACKGROUND
[0008] The global market for food dyes is valued at over 2 billion USD. Food dyes are currently derived primarily from petroleum-based industrial chemical synthesis. However, increasing concerns over safety and the need for fossil fuel independence are driving a growing demand for more sustainable and safe alternatives, such as natural plant pigments.
[0009] Red dyes are the most widely used food colorings as they mimic colors of many natural pigments, such as anthocyanins, which are found in strawberries, grapes, and apples. The demand for natural dyes is rapidly increasing due to safety concerns regarding synthetic red dyes, such as Red #3 and Red #40 (Downham and Collins, 2000; Kobylewski and Jacobson,2012; Wrolstad and Culver, 2012), some of which are banned in Europe, Australia, and certain states within the US.
[0010] Betalains are tyrosine-derived red and yellow pigments (i.e., betacyanins and betaxanthins, respectively) that are uniquely found in the plant order Caryophyllales. They are water-soluble, nitrogen-containing alkaloids that have antioxidant activities (Kanner et al., 2001; Tesoriere et al., 2009), and they have been associated with a number of beneficial health-related properties, such as anticancer and antidiabetic properties (Lee et al., 2005; Khan and Giridhar, 2015). Betalains are currently the primary natural red dyes used in the food and cosmetic industries in the United States due to their high water solubility and higher extinction coefficient as compared to artificial dyes. Betalain colorations are stable under high sugar solution over a broad range of pH (3 to 7) (Khan and Giridhar, 2015), unlike highly pH sensitive anthocyanins.
[0011] Chemical synthesis of betalains has been reported but requires lengthy steps with very low final yield (Buchi et al., 1978; Hilpert and Dreiding, 1984). Currently, table beet and cactus have production acreage devoted to pigment production for food and fabric dyes, respectively. Betalains are sold in the form of beetroot extract (E number E162) at ~$100 / kg (Grewal et al., 2018), which is ~10 times more expensive than the synthetic dye Red #40 (Allura Red, E129). This significant price difference hampers widespread adoption of betalain pigments, despite consumer preferences and the potential long-term health benefits of natural pigments.
[0012] Breeding efforts have been made to elevate and improve the levels of betalains in table beets since 1970s (Gaertner and Goldman, 2005), resulting in 5-fold increase in pigmentation with beet cultivars accumulating up to 5,600 nmol / g tissue (3.08 mg / g tissue) of red betacyanins. However, the gain has plateaued in the last 10 years.
[0013] Accordingly, there is a need in the art for more efficient methods for producing betalains that would reduce the cost of these pigments.
[0014] SUMMARY
[0015] In a first aspect, the present invention provides constructs comprising a first polynucleotide encoding a L-DOPA 4,5-dioxygenase (DODA) protein, a second polynucleotide encoding a cDOPA 5-O-glucosyltransferase (cDOPA5GT) protein, and a third polynucleotide encoding a CYP76AD1 protein. Within these constructs, the first polynucleotide is directly and operably linked to a promoter.In a second aspect, the present invention provides plants and plant parts that comprise the constructs and / or over-expression of the proteins as compared to a control plant as described herein.
[0016] In a third aspect, the present invention provides methods of growing a plant described herein.
[0017] In a fourth aspect, the present invention provides methods of using the plant or plant parts described herein to make food products, dyes, consumer products or other products. Methods of using the plant, plant parts or products produced from the plant or plant parts to treat a condition in a subject by administering a plant, plant part or product produced from a plant or plant part as described herein to the subject to treat the condition.
[0018] BRIEF DESCRIPTION OF THE DRAWINGS FIG. 1 is a schematic of the betalain biosynthetic pathway that shows how the “push-and-pull” strategy efficiently produces betalains. Arogenate dehydrogenase (TyrA) catalyzes the last step of the L-tyrosine biosynthetic pathway and is feedback inhibited by L-tyrosine in most plant species. BvTyrAa from beet shows relaxed feedback inhibition by L-tyrosine and was therefore used to “push” the supply of tyrosine. Expression of three betalain biosynthetic pathway enzymes was used to “pull” the enhanced L-tyrosine supply into the betalain biosynthesis pathway. Cytochrome P450 CYP76AD1 catalyzes the first step of converting L-tyrosine to L-DOPA, which is then converted into betalamic acid by L-DOPA 4,5-dioxygenase (DODA) or into cyc / o-DOPA (cDOPA) by CYP76AD1. cDOPA 5-O-glucosyltransferase (cDOPA5GT) glucosylates cDOPA to generate cDOPA 5-O-glucoside. Stars denote the spontaneous condensation of betalamic acid with amino acids or amines to form yellow betaxanthins, or with cDOPA 5-O-glucoside to form purple betacyanins. The three compounds shown in bold and with chemical structures are the major focus of this study.
[0019] FIG. 2 demonstrates that BvTyrAa expression reduces betalain production in Nicotiana benthamiana. (A) Schematic diagram of recombinant DNA constructs generated using Golden Gate cloning for testing the “push-and-pull” strategy. Arabidopsis actin2 promoter (PAtAct ) and nopaline synthase terminator (NosT) were used for expressing the BvTyrAa coding sequence flanked with an N-terminal petunia chloroplast transit peptide (CTP) and a C-terminal FLAG tag; Arabidopsis Rubisco small subunit 3B promoter (PAtRbcSSB) and terminator (AtRbcS3BT)were used for expressing BvCYP76AD1 coding sequence flanked with a C-terminal Myc tag; Arabidopsis UbiquitinlO promoter (PAtUbi10 and Arabidopsis Actin2 terminator (AtAct2T) were used for expressing MjcDOPA5GT coding sequence flanked with a C-terminal HA tag;
[0020] Arabidopsis light-harvesting chlorophyll-protein complex II subunit Bl promoter (PAtLHB1B1 and Agrobacterium tumefaciens octopine synthase terminator (AtuOcsT) were used for expressing BvDODA flanked with a C-terminal His tag. (B) Infiltrated N. benthamiana phenotype at 3 days- post-infiltration (dpi) expressing the constructs from (A). Purple pigmentation was induced in both “pull” and “push / pull”-expressing leaves, but not in empty vector (EV) control or “push”- expressing leaves. (C) Metabolite analysis using the infiltrated N. benthamiana samples. L- tyrosine and L-DOPA levels were analyzed using LC-MS and total betacyanins was quantified using a spectrophotometer. (D) Transcript levels of each transgene in infiltrated N. benthamiana samples detected by RT-qPCR. Letters denote significant differences in a pairwise comparison (p < 0.05, student’s two-tailed t-test). Bars represent expression level relative to the sample with the highest expression. Data are means of five biological replicates ± standard deviation (SD). EV, empty vector; N.D, not detectable
[0021] FIG. 3 demonstrates that the conversion from L-DOPA to betalains is still limited with the RUBY “pull” construct. (A) Schematic diagram of recombinant DNA constructs used in this co-infiltration assay. 35S promoter (P35S) and Nicotiana benthamiana heat shock protein terminator (NbHSPT) were used for expressing the push construct; the Glycine max elongation factor la promoter PGmElf1a) and Nicotiana benthmiana actin terminator (NbActT) were used for expressing the RUBY construct. (B) Phenotype of N. benthamiana co-infiltrated with the constructs from (A) at 3 dpi. EV, empty vector. (C) Metabolite analysis using infiltrated A. benthamiana samples. L-tyrosine and L-DOPA levels were analyzed using LC-MS and total betacyanins was quantified using a spectrophotometer. Letters denote significant differences in a pairwise comparison (p < 0.05, student’s two-tailed t-test). Data are means of five biological replicates ± standard deviation (SD). EV, empty vector; N.D, not detectable.
[0022] FIG. 4 demonstrates that additional BvDODA expression together with the “push” and “pull” constructs boosts betalain production. (A) Schematic diagram of additional betalain gene constructs used in this co-infiltration assay. Arabidopsis light-harvesting chlorophyll-protein complex II subunit Bl promoter (PAtLHB1B1 and Arabidopsis Rubisco small subunit 3B terminator (AtRbcS3BT) were used for expressing BvCYP76AD1 coding sequence flanked witha C-terminal Myc tag; tomato Rubisco promoter (SlRbcS2 ) and Agrobacterium tumefaciens octopine synthase terminator (AtuOcsT) were used for expressing BvDODA flanked with a C-terminal His tag; Arabidopsis UbiquitinlO promoter (PAtUbi10) and Arabidopsis Actin2 terminator (AtAct2T) were used for expressing MjcDOPA5GT coding sequence flanked with a C-terminal HA tag. (B) Infiltrated N. benthamiana phenotype at 3 dpi expressing the constructs from (A). EV, empty vector. (C) Metabolite analysis using infiltrated TV. benthamiana samples. L-tyrosine and L-DOPA levels were analyzed using LC-MS and total betacyanins was quantified using a spectrophotometer. (D) Transcript levels of each transgene in the infiltrated N. benthamiana samples detected by RT-qPCR. Letters denote significant differences in a pairwise comparison (p < 0.05, student’s two-tailed t-test). Bars represent expression level relative to the sample with the highest expression. Data are means of four or five biological replicates ± standard deviation (SD). N.D, not detectable.
[0023] FIG. 5 demonstrates that DODA catalyzes a rate limiting step in the betalain biosynthetic pathway. (A) Schematic diagram of additional betalain gene constructs used in this coinfiltration assay. Tomato Rubisco promoter (SlRbcS2) was used in all three additional betalain synthesis enzyme-expressing constructs. Arabidopsis Rubisco small subunit 3B terminator (AtRbcS3BT), Agrobacterium tumefaciens octopine synthase terminator (AtuOcsT), and Arabidopsis Actin2 terminator (AtAct2T) were used for the BvCYP76AD1, BvDODA, and MjcDOPA5GT expression constructs, respectively. Transcript levels of each transgene in infiltrated N. benthamiana samples detected by RT-qPCR. Bars represent expression level relative to the sample with the highest expression. (B) Infiltrated N. benthamiana phenotype at 3 dpi expressing the constructs from (A). EV, empty vector. (C) Metabolite analysis using infiltrated N. benthamiana samples. L-tyrosine and L-DOPA levels were analyzed using LC-MS and total betacyanins was quantified using a spectrophotometer. Letters denote significant differences in a pairwise comparison (p < 0.05, student’s two-tailed t-test). Data are means of five biological replicates ± standard deviation (SD). N.D, not detectable.
[0024] FIG. 6 demonstrates that betalain pigmentation became stronger over a period but the difference between constructs persisted. The phenotype of infiltrated N. benthamiana leaves expressing either “Pull” or “P35Sh / pull” constructs at different time points, i.e., 2, 3, 4, or 6 days-post-infiltration (dpi).FIG. 7 shows reduced betalain production with the push / pull construct expressing N. benthamiana even with the pl 9 silencing suppressor expression. (A) N. benthamiana leaf phenotype infiltrated with the constructs with either pl9 silencing suppressor or empty vector (EV) at 3 dpi. (B) Total betacyanins levels quantified with a spectrophotometer using infiltrated N. benthamiana samples. (C) Transcript levels of each transgene in infiltrated N. benthamiana samples detected by RT-qPCR. Letters denote significant differences (p < 0.05, student’s two-tailed t-test). Bars represent expression level relative to the sample with the highest expression. Data are means of five biological replicates ± standard deviation (SD). ND, not detectable.
[0025] FIG. 8 demonstrates that co-infiltration of mixed Agrobacterium cultures separately harboring “push” or “pull” construct still reduces betalain production in Nicotiana benthamiana.
[0026] (A) Schematic diagram of DNA constructs used in this co-infiltration assay. 35S promoter (P35S) and N. benthamiana heat shock protein terminator (NbHSPT) were used for expressing the P35Sh construct; Arabidopsis Rubisco small subunit 3B promoter (PAtRbcS3B) and terminator (AtRbcS3BT) were used for expressing BvCYP76AD1 coding sequence flanked with C-terminal Myc tag; Arabidopsis UbiquitinlO promoter (PAtUbi10) and Arabidopsis Actin2 terminator (AtAct2T) were used for expressing MjcDOPA5GT coding sequence flanked with C-terminal HA tag; Arabidopsis light-harvesting chlorophyll-protein complex II subunit Bl promoter (PAtLHB1B1) and Agrobacterium tumefaciens octopine synthase terminator (AtuOcsT) were used for expressing BvDODA flanked with C-terminal His tag. (B) Infiltrated A benthamiana phenotype at 3 dpi. (C) L-tyrosine and L-DOPA levels were analyzed using LC-MS and total betacyanins was quantified using a spectrophotometer. (D) Transcript levels of each transgene in infiltrated N. benthamiana samples detected by RT-qPCR. Bars represent expression level relative to the sample with the highest expression. Stars denote significant differences (*,p < 0.05; **,p < 0.01, student’s two-tailed t-test). Data are means of five biological replicates ± standard deviation (SD). EV, empty vector; N.D, not detectable.
[0027] FIG. 9 demonstrates that additional betalain gene expression driven by the same promoter dramatically increases betalain production only when the additional BvDODA was expressed. (A) Schematic diagram of DNA constructs used in this co-infiltration assay. Tomato Rubicso promoter (SlRbcS2 ) was used for expressing all three additional betalain gene constructs. Arabidopsis Rubisco small subunit 3B terminator (AtRbcS3BT), Agrobacterium tumefaciens octopine synthase terminator (AtuOcsT) and Arabidopsis Actin2 terminator (AtAct2T) wereused for BvCYP76AD1, BvDODA, MjcDOPA5GT expression construct respectively. (B) Infiltrated N. benthamiana phenotype at 3 dpi. EV, empty vector. (C) L-tyrosine and L-DOPA levels were analyzed using LC-MS and total betacyanins was quantified using a spectrophotometer. (D) Transcript levels of each transgene in infiltrated N. benthamiana samples detected by RT-qPCR. Bars represent expression level relative to the sample with the highest expression. Letters denote significant differences in a pairwise comparison (p < 0.05, student’s two-tailed t-test). Data are means of four or five biological replicates ± standard deviation (SD). N.D, not detectable.
[0028] FIG. 10 shows that betalain accumulation was detected in the vacuole of mesophyll cells. Brightfield images were taken using the cross section of the infiltrated N. benthamiana leaves expressing either a single EV, “Pull”, or “P35Sh / pull” construct. (A) Adaxial side of infiltrated leaf at 3 dpi focused on mesophyll cell layer. (B) Cross leaf sections at 4 dpi.
[0029] FIG. 11 demonstrates that the formation of side products, tyramine and dopamine, was slightly increased with the “push” and / or “pull” expression. The levels of tyramine and dopamine, derived from L-tyrosine and L-DOPA, respectively, were analyzed using LC-MS with the samples from the co-infiltration assay using the RUBY “pull” construct (FIG. 5). The expression of the “push” construct significantly increased the levels of tyramine and dopamine but only by 2 to 3 -fold compared to ones without the “push” expression. Letters denote significant differences in a pairwise comparison (p < 0.05, student’s two-tailed t-test). Data are means of five biological replicates ± standard deviation (SD).
[0030] FIG. 12 shows details of the recombinant DNA parts used in this study, which were generated via Golden Gate reactions.
[0031] FIGs. 13A-13B show photographs of soybean seeds (both whole and powdered) expressing the RUBYv2 construct. Seeds from two transgenic events, i.e., 6A (A) and 18A (B) are shown. Based on seed size, coloration, and shape, segregated seeds were categorized as null (N), large brown full (LBF), small brown full (SBF), small brown wrinkle (SBW), and black seeds (BS).
[0032] FIG. 14 shows photographs of extracts prepared from soybean seeds expressing the RUBYv2 construct. Extracts from the first and second extractions, third and fourth extractions, and fifth and sixth extractions were combined, as indicated.FIG. 15 shows a quantification of metabolite (i.e., tyrosine, L-DOPA, and betacyanins) levels in soybean seeds expressing the RUBYv2 construct.
[0033] FIG. 16 shows optimized betalain constructs with additional tyrosine supply boost betalain production in N. benthamiana leaves. (A) A simplified biosynthetic pathway of betalain pigments illustrating the push / pull strategy. (B) Schematic diagrams of "push", "pull", and "push+pull" constructs. (C) Agrobacterium-mediated transient expression of constructs in N. benthamiana leaves. Photos taken at 3 day-post-infiltration (dpi). (D) Quantification of tyrosine, L-DOPA, and betacyanin levels in infiltrated leaves.
[0034] FIG. 17 shows that previous push / pull constructs failed to generate stable transgenic lines. (A) Schematic of initial push, pull, and push / pull constructs described in Example 1. (B) Photographs of transgenic tobacco (N tabacum) expressing the previous versions of the constructs.
[0035] FIGs. 18A-18B show photographs of tobacco plants expressing the constructs shown in FIG. 16 (A) and a quantification of metabolites (i.e., tyrosine, L-DOPA, and betacyanins) in these plants (B). The photographs were taken at 6 weeks after transplantation to soil from rooting media.
[0036] FIGs. 19A-19B show photographs of soybean plants expressing the constructs shown in FIG. 16 (A) and a quantification of metabolites (i.e., tyrosine, L-DOPA, and betacyanins) in these plants (B).
[0037] FIGs. 20A-20C show heritability of betalain pigments in tobacco T1 lines, through photographs of plants (A) and flowers (B), and quantification of metabolites (i.e., tyrosine, L-DOPA, and betacyanins) in the plants (C).
[0038] FIG. 21 shows betalain pigmentation of / Lv / v / -push+pull lines through photographs (A) and quantification of metabolites (i.e., tyrosine, L-DOPA, and betacyanins) in these plants (B).
[0039] FIG. 22 shows cross-species (Arabidopsis, tobacco, and soybean) comparisons of betalain production, depicting metabolic tolerances and life-cycle outcomes.
[0040] FIG. 23 shows seed counts yielded by single-copy inserted soybean To lines expressing different constructs. Letters denote significant differences based on one-way ANOVA followed by Tukey’s HSD test (p < 0.05). EV, empty vector.FIG. 24 shows that pigmentation gradually fades in Ti homozygous pull lines. (A) Phenotypes of hemizygous or homozygous lines of stable Ti soybean seedlings expressing pull constructs together. Homo, homozygous; Hemi, hemizygous. (B) Phenotypes of fully expanded leaves in hemizygous or homozygous lines of stable Ti soybean expressing pull constructs. Homo, homozygous; Hemi, hemizygous. (C) Phenotypes of hemizygous or homozygous lines of fully mature stable Ti soybean lines expressing pull constructs together. Homo, homozygous; Hemi, hemizygous.
[0041] FIG. 25 shows quantification of phenylalanine, / ?-coumarate, homogentisate and dopamine levels in mature leaves of Ti soybean stable transgenic lines using LC-MS.
[0042] DETAILED DESCRIPTION
[0043] The present invention provides constructs for introducing the betalain biosynthetic pathway and producing high levels of betalain pigments in plants. The plants may be plants that natively do not produce betalains or they may natively produce betalains, but introduction of the constructs may increase the amount of betalains made by the plant as compared to a control plant that does not include the constructs. The constructs comprise one or more polynucleotides encoding the enzymes L-DOPA 4,5-dioxygenase (DODA), cDOPA 5-O-glucosyltransferase (cDOPA5GT), and CYP76AD1. Plants comprising the constructs and methods of using the plants or products made from the plants are also provided.
[0044] Recent discoveries of betalain biosynthetic genes have provided novel opportunities to produce betalain pigments in heterologous hosts. For example, engineered yeasts have achieved pigment production at up to 28.7 mg / L (DeLoache et al., 2015; Grewal et al., 2018; Zhang et al., 2023), but considerable improvements are still needed to render such yeast competitive with beetroot extract (Grewal et al., 2018; Zhang et al., 2023). Betalain pigments have also been produced in transformed plants of various species including Arabidopsis, tobacco, tomato, potato tubers, eggplant, cotton, and carrot (Polturak et al., 2017; He et al., 2020; Grützner et al., 2021; Deng et al., 2023; Ge et al., 2023). However, the highest yield, 1,820 nmol / g tissue (1.0 mg / g tissue), which was observed in tomato fruits (Grützner et al., 2021), is still ~2.5 times lower than the betalain content of elite beet cultivars (<5,600 nmol / g tissue; ~5 g / L) (Gaertner and Goldman, 2005; Sawicki et al., 2016; Wang et al., 2017; Skalicky et al., 2020). Thus, the levelsof betalains previously achieved in transgenic plants have not been high enough to be industrially competitive.
[0045] The present inventors have developed novel constructs and methods for increasing the betalain content of transgenic plants. As is described in Example 1, the inventors discovered that increasing the expression of L-DOPA 4,5-dioxygenase (DODA), i.e., the enzyme that catalyzes the second step of the betalain biosynthesis pathway, alleviates a major bottleneck in this pathway and boosts betalain production. This discovery was made by expressing three enzymes necessary for betalain production, i.e., CYP76AD1, DODA, and cDOPA 5-0-glucosyltransferase (cDOPA5GT) in aNicotiana benthamiana transient expression system. These enzymes were expressed both individually and from a previously published polycistronic betalain production construct called RUBY (SEQ ID NO: 12; He et al., 2020), in which the genes encoding these enzymes are included in a single transcriptional unit.
[0046] As is described in Example 2, the inventors have used their discovery to engineer soybean plants that produce red-colored seeds containing high levels of red pigments. To increase DODA gene expression in these plants, they rearranged the genes included in the RUBY construct to place DODA in the first position immediately downstream of the promoter, creating a new construct that is referred to herein as “RUBYv2,” and they transformed this new construct into soybean using a seed specific promoter. The resulting red soybean seeds exhibit several advantages compared to previous efforts. First, the seeds contain extremely high levels of betalains (5,900 to 10,500 nmol / g soybean seed tissue) that surpass the levels found in red table beets (-2,900 to 4,900 nmol / g beet tissue) (Sawicki et al., 2016; Skalicky et al., 2020). Second, these seeds offer improved storage capabilities because, unlike beets, they are dry and are easily transported at room temperature. Third, the seeds contain “non-extractable” pigments that may offer greater stability compared to soluble betalains, the use of which is limited to low-heat applications, such as ice cream and yogurt.
[0047] As is described in Example 3, the inventors have generated additional constructs that comprise RUBYv2 an additional transcriptional unit encoding DODA (i.e., to further increase DODA expression), and a transcriptional unit encoding a version of the enzyme arogenate dehydrogenase (TyrA) that is resistant to feedback inhibition (i.e., to drive the synthesis of tyrosine, which is a betalain precursor). They show that introducing these constructs intosoybean and tobacco plants results in high levels of L-DOPA and betalain production in the leaves of these plants.
[0048] Constructs:
[0049] In a first aspect, the present invention provides constructs comprising a first polynucleotide encoding a L-DOPA 4,5-dioxygenase (DODA) protein, a second polynucleotide encoding a cDOPA 5-O-glucosyltransferase (cDOPA5GT) protein, and a third polynucleotide encoding a CYP76AD1 protein. Within these constructs, the first polynucleotide is directly and operably linked to a promoter.
[0050] The terms “polynucleotide,” “nucleic acid,” and “oligonucleotide” are used interchangeably to refer a polymer of DNA or RNA. A polynucleotide may be single-stranded or double-stranded and may represent the sense or the antisense strand. A polynucleotide may be synthesized or obtained from a natural source. A polynucleotide may contain natural, nonnatural, or altered nucleotides, as well as natural, non-natural, or altered internucleotide linkages (e.g., phosphoroamidate linkages, phosphorothioate linkages).
[0051] As used herein, the term “construct” refers to a recombinant polynucleotide, i.e., a polynucleotide that was formed by combining at least two polynucleotide components from different sources, natural or synthetic. For example, a construct may comprise the coding region of one gene operably linked to a promoter that is (1) associated with another gene found within the same genome (a soybean gene linked to a soybean promoter for a distinct gene), (2) from the genome of a different species (a soybean promoter linked to a Arabidopsis gene), or (3) synthetic. Constructs can be generated using conventional recombinant DNA methods. Construct may include only the expression cassette and may include sequences that allow for homologous recombination into a genome such as by CRISPR / Cas gene editing or may include a self-replicating or other vector sequence, such as a plasmid, transposon, or viral vector to allow for delivery of the construct.
[0052] The enzymes DODA, cDOPA5GT, and CYP76AD1 are necessary for the production of betalains in plants. (See FIG. 1 for a schematic depiction of the betalain biosynthetic pathway.) CYP76AD1 is a cytochrome P450 enzyme that catalyzes the conversion of L-tyrosine to L-DOPA, which is then converted into betalamic acid by DODA or into cyclo-DOPA (cDOPA) by CYP76AD1. cDOPA5GT glucosylates cDOPA to generate cDOPA 5-O-glucoside. The DODA, cDOPA5GT, and CYP76AD1 proteins used with the present invention may be from any plantspecies. In the Examples, the inventors utilized the specific proteins BvDODAal from Beta vulgaris (SEQ ID NO: 1), MjcDOPA5GT from Mirabilis jalapa (SEQ ID NO: 2), and BvCYP76AD1 from Beta vulgaris (SEQ ID NO: 3). Thus, in some embodiments, one or more of these specific enzymes or a variant thereof is utilized. In specific embodiments, the DODA protein comprises SEQ ID NO: 1 or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 98%, or 99% sequence identity to SEQ ID NO: 1; the cDOPA5GT protein comprises SEQ ID NO: 2 or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 98%, or 99% sequence identity to SEQ ID NO: 2; and / or the CYP76AD1 protein comprises SEQ ID NO: 3 or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 98%, or 99% sequence identity to SEQ ID NO: 3.
[0053] “Percentage of sequence identity” is determined by comparing two optimally aligned sequences over a comparison window. The aligned sequences may comprise insertions or deletions (i.e., gaps) relative to each other for optimal alignment. The percentage is calculated by determining the number of matched positions at which an identical nucleic acid base or amino acid residue occurs in both sequences, dividing the number of matched positions by the total number of positions in the window of comparison and multiplying the result by 100. Protein and nucleic acid sequence identities can be evaluated using the Basic Local Alignment Search Tool (" BLAST"), which is well known in the art (Karlin and Altschul, Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes. Proc. Natl. Acad. Sci. USA (1990) 87: 2267-2268; Altschul et al. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucl. Acids Res. (1997) 25: 3389-3402). The BLAST programs identify homologous sequences by identifying similar segments between a query amino acid or nucleic acid sequence and a test sequence, which is preferably obtained from a protein or nucleic acid sequence database. The BLAST programs can be used with the default parameters or with modified parameters provided by the user.
[0054] In the Examples, the inventors tested constructs in which the first polynucleotide, the second polynucleotide, and the third polynucleotide are each included in separate transcriptional units (see, e.g., FIG. 8) as well as constructs in which these three polynucleotides are all included in a single transcription unit (see, e.g., FIG. 16B). Thus, in some embodiments, the first polynucleotide, the second polynucleotide, and the third polynucleotide are each included in two or three separate transcriptional units. In other embodiments, the first polynucleotide, the secondpolynucleotide, and the third polynucleotide are included in a single transcriptional unit. As used herein, the term “transcriptional unit” refers to a stretch of DNA that is transcribed into a single RNA molecule. Each transcriptional unit comprises its own promoter. Thus, in embodiments in which the three polynucleotides are each included in separate transcriptional units, the first polynucleotide is operably linked to a first promoter, the second polynucleotide is operably linked to a second promoter, and the third polynucleotide is operably linked to a third promoter. The transcriptional units may be within a single DNA molecule or present in more than one DNA molecule.
[0055] As is described in Example 2, the inventors developed a polycistronic construct, referred to herein as RUBYv2, in which the three polynucleotides are included in a single transcriptional unit with the polynucleotide encoding DODA in the 5 ’-most position to increase DODA expression relative to cDOPA5GT and CYP76AD1 expression. Accordingly, the first polynucleotide (i.e., the polynucleotide encoding DODA) is directly linked to a promoter in some of the constructs of the present invention. As used herein, the term “directly linked” is used to describe a polynucleotide that is linked to a promoter such that there is no intervening sequence between the polynucleotide and the promoter that will be transcribed and translated into a separate protein before the polynucleotide is transcribed. In RUBYv2, the polynucleotide encoding DODA is included in the first position after the promoter, the polynucleotide encoding cDOPA5GT is included in the second position, and the polynucleotide encoding CYP76AD1 is included in the third position. Thus, in some embodiments, the first polynucleotide, the second polynucleotide, and the third polynucleotide are included in that 5’ to 3’ order within a single transcriptional unit. In specific embodiments, the single transcriptional unit comprises RUBYv2 (SEQ ID NO: 5) or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 98%, or 99% sequence identity to SEQ ID NO: 5.
[0056] The three enzyme-encoding polynucleotides included in RUBYv2 are codon optimized (He et al., 2020). Thus, in some embodiments, one or more of the first polynucleotide, the second polynucleotide, and the third polynucleotide are codon optimized. “Codon optimization” is a process used to increase expression of a polynucleotide in a particular host cell by altering the sequence of the polynucleotide to accommodate the codon bias of the host cell. Computer programs for generating codon-optimized sequences for use in a particular host cell are known inthe art. The polynucleotides used with the present invention may be codon-optimized for expression in any host plant.
[0057] In embodiments in which the polynucleotide encoding DODA, the polynucleotide encoding cDOPA5GT, and the polynucleotide encoding CYP76AD1 are included in a single transcriptional unit, these polynucleotides may be separated by sequences encoding cleavable linker peptides. Specifically, in some embodiments, the first polynucleotide and the second polynucleotide are separated by a sequence encoding a first cleavable linker peptide, and the second polynucleotide and the third polynucleotide are separated by a sequence encoding a second cleavable linker peptide. A “cleavable linker peptide” is a peptide that is cleaved under specific conditions. For example, a cleavable linker peptide may be cleaved by a particular protease, chemical, or condition (e.g., light, redox). In the Examples, the inventors utilized two 2A peptides as cleavable linker peptides, one called “F2A” from foot-and-mouth disease virus (SEQ ID NO: 6) and one called “T2A” from Thosea asigna virus (SEQ ID NO: 7). Thus, in some embodiments, the cleavable linker peptide is a 2A peptide. “2A peptides” are a class of 18-22 amino-acid-long polypeptides that induce ribosomal skipping during translation of a protein, resulting in the production of multiple proteins from a single RNA transcript. Self-cleaving 2A polypeptides are known in the art as described, for example, in Kim, J. H. et al., PLOS ONE, 6(4), e18556. Suitable self-cleaving 2A polypeptides include, but are not limited to, foot-and-mouth disease virus (FMDV) 2 A (F2A), equine rhinitis A virus (ERAV) 2 A (E2A), porcine teschovirus-1 2A (PTV1-2A), and Thosea asigna virus 2A (T2A). In some embodiments, the cleavable linker comprises the 2A peptide of SEQ ID NO: 6 or SEQ ID NO: 7 or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 98%, or 99% sequence identity to SEQ ID NO: 6 or SEQ ID NO: 7.
[0058] In some embodiments, at least one additional transcriptional unit is included along with the construct encoding DODA, cDOPA5GT, and CYP76AD1. The additional transcriptional unit(s) may either be included in the construct encoding DODA, cDOPA5GT, and CYP76AD1 or be included in separate constructs.
[0059] In some embodiments, the at least one additional transcriptional unit comprises a polynucleotide encoding an arogenate dehydrogenase (TyrA) protein. TyrA catalyzes the last step of the L-tyrosine biosynthetic pathway. Thus, the inclusion of this additional transcriptional unit is meant to increase the supply of L-tyrosine available for conversion into betalains. In theExamples, the inventors utilized the TyrAa enzyme from Beta vulgaris (BvTyrAa). TyrA enzymes are feedback inhibited by L-tyrosine in most plant species, but BvTyrAa has relaxed feedback inhibition by L-tyrosine. Thus, in some embodiments, the TyrA protein is BvTyrAa (SEQ ID NO: 4) or an enzyme with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 98%, or 99% sequence identity to SEQ ID NO: 4.
[0060] In the Example 3, the inventors inserted the potato ST-LS1 intron sequence of SEQ ID NO: 8 into the BvTyrAa coding sequence. ST-LS1 contains a stop codon that prevents expression in agrobacterium but not plants, because bacteria cannot remove introns by splicing. Thus, in some embodiments, the polynucleotide encoding the TyrA protein comprises an intron. In specific embodiments, the intron comprises SEQ ID NO: 8 or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 98%, or 99% sequence identity to SEQ ID NO: 8.
[0061] In Example 3, the inventors generated a construct comprising both a transcriptional unit encoding DODA, cDOPA5GT, and CYP76AD1 and a transcriptional unit encoding TyrA, and they separated these two transcriptional units using the Petunia x hybrida TBS-1 insulator of SEQ ID NO: 9. Thus, in some embodiments, the at least one additional transcriptional unit is separated from the transcriptional unit(s) encoding the DODA protein, the cDOPA5GT protein, and the CYP76AD1 protein via an insulator. In some embodiments, the insulator comprises SEQ ID NO: 9 or a sequence with at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 98%, or 99% sequence identity to SEQ ID NO: 9.
[0062] In some embodiments, the at least one additional transcriptional unit comprises one or more additional polynucleotide encoding the DODA protein. In the Examples, the inventors used two different polynucleotide sequences encoding the same DODA protein (SEQ ID NO: 1) to avoid recombination issues. They used the DODA-encoding polynucleotide of SEQ ID NO: 10 in their transcriptional unit encoding DODA, cDOPA5GT, and CYP76AD1, and they used the DODA-encoding polynucleotide of SEQ ID NO: 11 in a separate transcriptional unit (see FIG.
[0063] 16B for a schematic depiction). Thus, in some embodiments, the sequence of the additional polynucleotide encoding the DODA protein is different from the sequence of the first polynucleotide. In other embodiments, the sequence of the additional polynucleotide encoding the DODA protein is the same as the sequence of the first polynucleotide. In some embodiments, multiple additional transcriptional units encoding DODA are included in the constructs. Forexample, one, two, three, four, or more additional transcriptional units encoding DODA may be included.
[0064] Each transcriptional unit included in the constructs of the present invention comprises its own promoter and terminator. As used herein, the term “promoter” refers to a DNA sequence that defines where transcription of a polynucleotide begins. RNA polymerase and the necessary transcription factors bind to the promoter to initiate transcription. Promoters are typically located directly upstream (i.e., at the 5' end) of the transcription start site. However, a promoter may also be located at the 3’ end, within a coding region, or within an intron of a gene that it regulates. Promoters may be derived in their entirety from a native or heterologous gene, may be composed of elements derived from multiple regulatory sequences found in nature, or may comprise synthetic DNA. A promoter is “operably linked” to a polynucleotide if the promoter is positioned such that it can affect transcription of the polynucleotide. Suitable promoters for use with the present invention include, but are not limited to, constitutive, inducible, temporally regulated, developmentally regulated, chemically regulated, tissue-preferred, and tissue-specific promoters.
[0065] Any promoter that is functional in the intended host plant cell may be utilized in the constructs of the present invention. However, in some embodiments, one of the promoters that was tested by the inventors is utilized. Specifically, in some embodiments, the transcriptional unit(s) encoding DODA, cDOPA5GT, and CYP76AD1 comprise a promoter selected from a Glycine max Scream6 (GmScream6) promoter, Arabidopsis thaliana Rubisco small subunit 3B (AtRbcS3B) promoter (SEQ ID NO: 18), Arabidopsis thaliana ubiquitin 10 (AtUbilO) promoter (SEQ ID NO: 22), Arabidopsis thaliana light-harvesting chlorophyll-protein complex II subunit Bl (AtLHBIBl) promoter (SEQ ID NO: 17), Glycine max elongation factor la promoter, tomato Rubisco (SlRbcS2) promoter (SEQ ID NO: 14), and Zea Mays a-zein promoter. In some embodiments, the additional transcriptional unit encoding TyrA comprises a promoter selected from Arabidopsis thaliana N ADH dehydrogenase ubiquinone 1 beta subcomplex unit (CL1) promoter (SEQ ID NO: 15; Zhou et al., 2023), AtLHBIBl promoter (SEQ ID NO: 17), Arabidopsis thaliana actin2 (AtAct2) promoter (SEQ ID NO: 20), and cauliflower mosaic virus (CaMV) 35S promoter. In some embodiments, the additional transcriptional unit encoding DODA comprises a Solanum lycopersicum Rubisco (SlRbcS2) promoter.
[0066] Terminator sequences can strongly enhance gene expression in plants (Plant Biotech J 16(12): 1971-1982, 2018). Any terminator that is functional in the intended host plant cell may beutilized in the constructs of the present invention. However, in some embodiments, one of the terminators that was tested by the inventors is utilized. Specifically, in some embodiments, the transcriptional unit(s) encoding DODA, cDOPA5GT, and CYP76AD1 comprise a terminator selected from an intronless tobacco extension terminator (EU terminator), Agrobacterium tumefaciens nopaline synthase (AtuNOS) terminator (SEQ ID NO: 16), cauliflower mosaic virus (CaMV) 35S terminator, tobacco heat shock protein terminator (NbHSP terminator), Nicotiana benthamiana actin terminator, Glycine max Scream6 (GmScream6) terminator, Arabidopsis thaliana Rubisco small subunit 3B (AtRbcS3B) terminator, Solanum lycopersicum Rubisco (SlRbcS3) terminator (SEQ ID NO: 21), Arabidopsis thaliana actin 2 (AtAct2) terminator (SEQ ID NO: 23), Nicotiana benthmiana actin 3 (NbAct3) terminator (SEQ ID NO: 19), and Agrobacterium tumefaciens octopine synthase (AtuOcs) terminator (SEQ ID NO: 24). In some embodiments, the additional transcriptional unit encoding TyrA comprises a terminator selected from a nopaline synthase (Nos) terminator and Nicotiana benthamiana heat shock protein terminator (NbHSPT). In some embodiments, the additional transcriptional unit encoding DODA comprises a terminator selected from a combination of the EU terminator and NbHSP terminator (EU / HSPT terminator; SEQ ID NO: 13) or the AtuOcs terminator (SEQ ID NO: 24). Those of skill in the art are aware of various promoters, terminators, insulators, cleavable linker peptides and the like to generate the constructs for use in various plant species or to allow for expression in various plants or plant tissues.
[0067] Plants:
[0068] In a second aspect, the present invention provides plants and plant parts that comprise the constructs described herein. The term “plant” is used herein to refer to a plant at any stage of development. The term “plant part” refers to any part of a whole plant, including a plant cutting, a plant cell, a plant cell culture, a plant organ, a plant tissue, a plant seed, or a plantlet. In some embodiments, the plant part is a harvestable plant part, such as a flower, pollen, seedling, tuber, leaf, stem, fruit, seed, root, and the like. In some embodiments, the plant or plant part is selected from soybean, tobacco, sorghum, hemp, poplar, and maize.
[0069] As is described in Example 1, the inventors discovered that increasing the expression of DODA alleviates a major bottleneck in the betalain synthesis pathway and boosts betalain production. Thus, in preferred embodiments, the plants have higher DODA activity than a control plant comprising the RUBY construct or a wild-type control plant. “DODA activity” refersto the conversion of L-DOPA to betalamic acid. Methods for measuring DODA activity, include but are not limited to assays that measure the oxidation of L-DOPA or betanin production (Soares et al., J Chem Inf Model 62 (22), 5317-5320, 2022; Guerrero-Rubio et al., New Phytol 239(6):2265-2276, 2023). The DODA activity of a plant may be increased using several different approaches. For example, DODA activity may be increased by increasing the expression of DODA protein (e.g., by including DODA in the first position within a polycistronic construct, by using a strong promoter to drive DODA expression, and / or by including multiple copies of a polynucleotide encoding DODA) or by expressing a DODA enzyme that is more active or that exhibits reduced substrate inhibition as compared to a control plant.
[0070] As used herein, a “control plant” is a comparable plant (e.g., of the same species, variety, and age) that was grown under substantially similar conditions but that comprising the RUBY construct (SEQ ID NO: 12; He et al., 2020) or no construct rather than the constructs described herein. Plants that are grown in “substantially similar conditions” are grown in similar locations and soil conditions, are planted with similar timing, are subjected to similar abiotic stresses, and the like.
[0071] The plants and plant parts include polynucleotides that encode the betalain synthesis enzymes DODA, cDOPA5GT, and CYP76AD1. The polynucleotides encoding these enzymes may be included in either a single transcriptional unit or in two or three separate transcriptional units. In some embodiments, the plants and plant parts further comprise at least one additional transcriptional unit. For example, in some embodiments, the at least one additional transcriptional unit comprises another polypeptide encoding the DODA protein. In some embodiments, the at least one additional transcriptional unit comprises a polynucleotide encoding a TyrA protein. The additional transcriptional unit(s) may either be included in the construct encoding DODA, cDOPA5GT, and CYP76AD1 or be included in separate constructs.
[0072] As is described in the Examples, the inventors have generated plants that express high levels of betacyanins (a class of betalain pigment) and L-DOPA. In some embodiments, the levels of betacyanins are between 1 mg / gram fresh weight (FW) of leaf tissue (gFW) and 10 mg / gFW in at least one part of the plant. The term “gram fresh weight (FW) (gFW) of leaf tissue” refers to the weight of a sample of leaf tissue measured immediately after harvesting, including all its water content. In some embodiments, the levels of betacyanins are higher than those produced in beet roots and hypocotyls (i.e., 1.57 - 2.70 mg / gFW). For example, the levelsof betacyanins may be in a range of 1.6 to 9 mg / gFW, 2 to 8 mg / gFW, or 3 to 7 mg / gFW. In some embodiments, the levels of L-DOPA are between 50 nmol / gFW and 2,500 nmol / gFW (0.49 mg / gFW) in at least one part of the plant. The part may be a leaf or a seed in some embodiments.
[0073] Methods of growing plants; uses of the plants or plant parts and products made therefrom:
[0074] In a third aspect, the present invention provides methods comprising growing a plant described here. As used herein, “growing” describes a process in which suitable conditions (i.e., light, soil, water, nutrients, temperature) for plant growth are established and maintained to grow a plant from planted seeds or cuttings. The plants may be grown using any method available to those of skill in the art and may be grown in a traditional agriculture environment (as a row crop), in home or specialty gardens as an ornamental or home garden plot, or in a hydroponic or other growing environment.
[0075] The plants of the present invention produce high levels of betalain pigments. As a result, the plants or parts of the plants may be differently colored (e.g., more red, more yellow) than their natural counterparts. These colorful plants may be useful for ornamental purposes.
[0076] In some embodiments, the methods further comprise harvesting a plant part from the plant. Preferably, the plant part is a part that contains high levels of betalains and / or L-DOPA. In some embodiments, the plant part is a seed, leaf, root, hypocotyl, stem, or fruit of the plant.
[0077] In some embodiments, the harvested plant or plant part is used for food or as an additive to food. Betalains are useful as natural food dyes and offer several potential health benefits. Thus, the plant part may be included in a food to provide color or as a source of antioxidants. The harvested plant part may be either used directly as food or may be processed and optionally mixed with other food ingredients in a processed food to provide health, cosmetic or food dye applications. For example, the soybean seeds described herein may be utilized directly as edamame, powderized for use as a food additive, or processed and used in a product like tofu, soymilk, miso, tempeh, natto, soy sauce, smoothie, cereal, protein bar, or meat alternatives.
[0078] In some embodiments, the methods further comprise extracting juice from plant tissues in which betalain pigments and / or L-DOPA have accumulated. The extracted juice can be used in a variety of food preparations to provide coloration and / or increase the health benefits (e.g., antioxidants or L-DOPA) of the food. Suitable methods for extracting juice containing betalainsand L-DOPA include, without limitation, extraction using pure water or buffered water with adjusted pH.
[0079] In some embodiments, the methods further comprise isolating a betalain or L-DOPA from the plant or plant part. As used herein, the term “isolating” refers to the process of separating a desired product from other cellular components and impurities. Suitable methods for purifying betalains and L-DOPA include, without limitation, extraction (e.g., using methanol), high performance liquid chromatography (HPLC), other chromatographic techniques, spectrophotometry, and nuclear magnetic resonance (NMR). An “isolated” product may be at least 85% pure, at least 95% pure, or at least 99% pure. These isolated products may be used in food, cosmetics, pharmaceutical, consumer products or other applications.
[0080] In some embodiments, the methods further comprise using the isolated betalains to produce a food colorant, dietary supplement, or pharmaceutical agent. The isolated betalains may also be used as a dye or colorant for non-food items. For example, the betalains produced by the plants may be used as a dye for fabric or other non-food consumer products, such as children’s toys, cosmetics and the like.
[0081] Methods of treatment:
[0082] In a fourth aspect, the present invention provides methods of treating a condition in a subject by administering a plant, plant part or product produced therefrom as described herein to the subject to treat the condition. Betalains have many potential health benefits due to their antioxidant and anti-inflammatory properties. Evidence suggests that betalains may reduce the risk of cancer, cardiovascular, and cerebrovascular diseases, as well as reduce damage to organs such as the heart, lungs, liver, kidneys, gut, brain, and reproductive organs. L-DOPA is used to treat Parkinson's disease as well as other conditions characterized by dopamine deficiency, such as dopa-responsive dystonia and depression. Thus, in some embodiments, the condition is cancer, cardiovascular disease, cerebrovascular disease, organ damage, dopa-responsive dystonia, Parkinson’s or depression. In some embodiments, the method reduces blood pressure, inflammation, and / or oxidative stress in the subject to treat the condition in the subject.
[0083] As used herein, the term “administering” refers to the introduction of a substance into a subject's body. Methods of administration are well known in the art and include, but are not limited to, oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intravaginal administration, ophthalmic administration,intraoral administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-arterial administration, intramuscular administration, intradermal administration, intrathecal administration, and subcutaneous administration.
[0084] Administration can be performed in multiple doses and may be continuous or intermittent. In preferred embodiments, administration is oral. In some embodiments, the plant or plant part is formulated as a food product, powder, or pill for administration.
[0085] The “subject” to which the methods are applied may be a mammal or a non-mammalian animal, such as a bird. Suitable mammals include, but are not limited to, humans, cows, horses, sheep, pigs, goats, rabbits, dogs, cats, bats, mice, and rats. In certain embodiments, the methods may be performed on lab animals (e.g., mice and rats) for research purposes. In other embodiments, the methods are used to treat commercially important farm animals (e.g., cows, horses, pigs, rabbits, goats, sheep, and chickens) or companion animals (e.g., cats and dogs). In preferred embodiments, the subject is a human.
[0086] The present disclosure is not limited to the specific details of construction, arrangement of components, or method steps set forth herein. The compositions and methods disclosed herein are capable of being made, practiced, used, carried out and / or formed in various ways that will be apparent to one of skill in the art in light of the disclosure that follows. The phraseology and terminology used herein is for the purpose of description only and should not be regarded as limiting to the scope of the claims. Ordinal indicators, such as first, second, and third, as used in the description and the claims to refer to various structures or method steps, are not meant to be construed to indicate any specific structures or steps, or any particular order or configuration to such structures or steps. All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. The use of any and all examples or exemplary language (e.g., “such as”) provided herein, is intended merely to facilitate the disclosure and does not imply any limitation on the scope of the disclosure unless otherwise claimed. No language in the specification, and no structures shown in the drawings, should be construed as indicating that any non-claimed element is essential to the practice of the disclosed subject matter. The use herein of the terms “including,” “comprising,” or “having,” and variations thereof, is meant to encompass the elements listed thereafter and equivalents thereof,as well as additional elements. Embodiments recited as “including,” “comprising,” or “having” certain elements are also contemplated as “consisting essentially of’ and “consisting of’ those certain elements.
[0087] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if a concentration range is stated as 1% to 50%, it is intended that values such as 2% to 40%, 10% to 30%, or 1% to 3%, etc., are expressly enumerated in this specification. These are only examples of what is specifically intended, and all possible combinations of numerical values between and including the lowest value and the highest value enumerated are to be considered to be expressly stated in this disclosure. Use of the word “about” to describe a particular recited amount or range of amounts is meant to indicate that values very near to the recited amount are included in that amount, such as values that could or naturally would be accounted for due to manufacturing tolerances, instrument and human error in forming measurements, and the like. All percentages referring to amounts are by weight unless indicated otherwise.
[0088] No admission is made that any reference, including any non-patent or patent document cited in this specification, constitutes prior art. In particular, it will be understood that, unless otherwise stated, reference to any document herein does not constitute an admission that any of these documents forms part of the common general knowledge in the art in the United States or in any other country. Any discussion of the references states what their authors assert, and the applicant reserves the right to challenge the accuracy and pertinence of any of the documents cited herein. All references cited herein are fully incorporated by reference unless explicitly indicated otherwise. The present disclosure shall control in the event there are any disparities between any definitions and / or descriptions found in the cited references.
[0089] The following examples are meant only to be illustrative and are not meant as limitations on the scope of the invention or of the appended claims.
[0090] EXAMPLES
[0091] Example 1:
[0092] In the following example, the inventors describe their work showing that increasing the expression of L-DOPA 4,5-dioxygenase (DODA), i.e., the enzyme that catalyzes the second stepof the betalain biosynthesis pathway, alleviates a major bottleneck in this pathway and boosts betalain production.
[0093] Synthetic biology provides emerging tools to produce valuable compounds in plant hosts as sustainable chemical production platforms. However, little is known about how supply and utilization of precursors is coordinated at the interface of plant primary and specialized metabolism, limiting our ability to efficiently produce high levels of target specialized metabolites in plants. L-tyrosine is an aromatic amino acid precursor of diverse plant natural products including betalain pigments, which are used as the major natural food red colorants and more recently as a visual marker for plant transformation. Here, we studied the impact of enhanced L-tyrosine supply on the production of betalain pigments by expressing arogenate dehydrogenase (TyrA) from table beet (Beta vulgaris, BvTyrAa), which has relaxed feedback inhibition by L-tyrosine. Unexpectedly, betalain levels were reduced when BvTyrAa was coexpressed with the betalain pathway genes in Nicotiana benthamiana leaves; L-tyrosine and 3,4-dihydroxy-L-phenylalanine (L-DOPA) levels were drastically elevated, but this precursor was not efficiently converted into betalains. Additional expression of L-DOPA 4,5-dioxygenase (DODA), but not CYP76AD1 or cyclo-DOPA 5-O-glucosyltransferase, together with BvTyrAa and the betalain pathway genes, drastically enhanced betalain production, indicating that the DODA step is a major rate-limiting step of betalain biosynthesis in this system. Learning from this initial test and further debottlenecking the DODA step maximized betalain yield to an equivalent or higher level than that in table beet. Our data suggest that balancing between enhanced supply (“push”) and effective utilization (“pull”) of betalain precursors by alleviating a bottleneck step is critical for producing high levels of target compounds via plant synthetic biology.
[0094] Plants produce over one million plant natural products (Afendi et al., 2012; Shi et al., 2024), which play important roles in plant growth, development, and adaptation to surrounding environments (Fang et al., 2019; Erb and Kliebenstein, 2020; Zhao and Rhee, 2022).
[0095] Additionally, plant natural products are critical in human health as many of them have pharmaceutical and nutritional properties. Roughly 65% of small molecule drugs approved for cancer treatments are derived from natural products, mainly from plants (Newman and Cragg, 2020). Many of these plant-derived drugs are chemically synthesized using fossil fuels since those compounds are produced in small quantities in native plants, some of which are not easy toaccess geographically. However, plant natural products often have complex structures with multiple chiral centers, not suitable for being chemically synthesized. Recent advances in synthetic biology, an approach to reengineer biological systems through iterative “design-build-test-learn (DBTL)” cycles (Nielsen and Keasling, 2016; Pouvreau et al., 2018), have accelerated metabolic engineering processes, providing alternative bio-based production methods for plant natural products. Thus far, microbial systems, such as Escherichia coli and yeast (Saccharomyces cerevisiae), have been used as a favored host for production of plant natural products (Ro et al., 2006; Pyne et al., 2019; Jamil et al., 2022) due to their rapid generation cycle, ease of genetic modification, and well-established large-scale fermentation systems (Cravens et al., 2019).
[0096] Microbial hosts, however, are not always suitable to produce plant natural products, as many of these chemicals have evolved to exert antimicrobial activities (Simões et al., 2009; Monte et al., 2014). Also, phytochemicals are often synthesized through a complex biosynthetic pathway spanning across different subcellular compartments, and some plant enzymes (e.g., cytochrome P450 enzymes) are difficult to express in unicellular microbial systems (Zurbriggen et al., 2012; Barnum et al., 2021). While efforts and progress have been made to overcome some of these issues in producing plant natural products in microbial hosts (Montaño López et al., 2022; Zhang et al., 2022), plants are naturally tailored for those enzymes and have a larger storage capacity. Additionally, plants can produce these complex compounds directly from CO₂ using sunlight energy and do not require expensive fermentation methods, which require sugar and energy inputs. Therefore, plants could be an attractive alternative chassis for a sustainable large-scale production of various beneficial plant natural products.
[0097] Recent advances in multi-omics approaches accelerated the identification of enzymes leading to the complete elucidation of many complex plant natural product pathways (Itkin et al., 2013; Lou et al., 2021; Bryson et al., 2023; Li et al., 2023). Many of these studies have reconstructed entire biosynthetic pathways through plant synthetic biology as a proof-of-concept (Nett et al., 2020; Hong et al., 2022; De La Peña et al., 2023; Sonawane et al., 2023). Nicotiana benthamiana has been mostly used as a heterologous plant chassis, where multiple target genes can be transiently co-expressed using the Agrobacterium-mediated infiltration method (Sainsbury et al., 2009; Bally et al., 2018). Thus far, the majority of studies have mainly focused on the design-build-test components of the DBTL cycle (Nett et al., 2020; Hong et al., 2022;Sonawane et al., 2023). However, as the throughput of “build” and “test” stages are much more limited in plants than in microbes (Shih, 2018), carefully evaluating and incorporating the “learning” component of the DBTL cycle to the next “design” phase (Jullesson et al., 2015; Choi et al., 2019) will be crucial for effectively optimizing a target biosynthetic pathway for large-scale production of target compounds in planta.
[0098] L-tyrosine is one of the three aromatic amino acids and is a precursor for various beneficial plant natural products, including tocopherols (vitamin E), benzylisoquinoline alkaloids (e.g., morphine), isoquinoline alkaloids (e.g., colchicine), and catecholamines (e.g., dopamine) (Schenck and Maeda, 2018). The enzyme arogenate dehydrogenase catalyzes the last step of L-tyrosine biosynthetic pathway and is feedback inhibited by L-tyrosine in most plant species (Fig.
[0099] 1) (Rippert and Matringe, 2002a; Rippert and Matringe, 2002b; Maeda and Dudareva, 2012). However, BvTyrAa from table beet (Beta vulgaris) has been reported to have relaxed feedback inhibition (Lopez-Nieves et al., 2018), and overexpression of BvTyrAa results in hyperaccumulation of L-tyrosine in planta (Lopez-Nieves et al., 2018; de Oliveira et al., 2019; Lopez-Nieves et al., 2022).
[0100] Betalain pigments are tyrosine-derived compounds that are widely used for natural food dye, with a growing interest due to their potential health benefits and the desire to replace synthetic dyes (Azeredo, 2009; Calva-Estrada et al., 2022). The first step of the betalain biosynthetic pathway is catalyzed by cytochrome P45076AD1 / 5 / 6 (CYP76AD1 / 5 / 6), which hydroxylates L-tyrosine to form L-DOPA, from which the pathway diverges (Fig. 1) (Hatlestad et al., 2012; Polturak et al., 2016; Sunnadeniya et al., 2016). L-DOPA can be cleaved by L-DOPA 4,5-dioxygenase (DODA) to form a 4,5-scca-DOPA intermediate which is then spontaneously cyclized to betalamic acid (Christinet et al., 2004). Alternatively, L-DOPA can be oxidized and cyclized to cyc / o-DOPA (cDOPA) by the second activity of the bifunctional CYP76AD1 enzyme, which is then converted to cDOPA 5-O-glucoside by cDOPA 5-O-glucosyltransferase (cDOPA5GT) (Vogt et al., 1999). Then, betalamic acid can be spontaneously condensed either with cDOPA 5-(9-glucoside to form red betacyanins or with amino acids or amines to form yellow betaxanthins (Fig. 1) (Schliemann et al., 1999; Sasaki et al., 2004; Sasaki et al., 2005). Identification of enzymes in the betalain biosynthetic pathway enabled engineering of different plant species to heterologously produce betalains (Harris et al., 2012; Sunnadeniya et al., 2016; Polturak et al., 2017; Grützner et al., 2021; Deng et al., 2023; Ge et al., 2023). Due totheir coloration and the fact that their biosynthetic pathway requires relatively few enzymes, betalains have recently been widely used as visual markers, for example in plant transformation or protein-protein interaction studies (He et al., 2020; Chen et al., 2023; Wang et al., 2023). Despite these wide uses of betalains, it remains to be investigated how different pathway enzymes are coordinated with each other for efficient production of betalain pigments.
[0101] Here, we aimed to increase the production of target downstream compounds by supplying enhanced levels of precursor using a “push-and-pull” strategy (Fig. 1, Kacser and Acerenza, 1993) that has been implemented successfully in different systems (Zhang et al., 2015; Broker et al., 2018). The deregulated BvTyrAa was expressed for “pushing” the metabolic flux toward the L-tyrosine biosynthetic pathway, and simultaneously, betalain biosynthetic pathway genes were expressed to “pull” the increased levels of L-tyrosine into betalain production in N. benthamiana. Unexpectedly, however, betalain production was reduced, rather than increased, when the betalain pathway genes were co-expressed with BvTyrAa. To decipher this puzzling result, we conducted detailed metabolite and transcript analyses, which suggested that DODA is a major rate limiting step of the betalain biosynthetic pathway in this system. Learning from the first DBTL cycle, we then alleviated the rate limiting step by expressing additional BvDODA together with expression of BvTyrAa, which drastically increased betalain levels up to 2.87 mg / gFW (5.21 μmol / gFW). Our findings demonstrate that optimizing a target biosynthetic pathway by alleviating a bottleneck step, coupled with enhancing precursor supply, can substantially increase the production of target compounds in planter The gained knowledge will be useful for successful implementation of plant synthetic biology to increase chemical production.
[0102] Results:
[0103] Expression of BvTyrAa with betalain pathway genes unexpectedly reduced betalain production in Nicotiana benthamiana.
[0104] To test if the “push-and-pull” strategy (Fig. 1) works for efficient betalain production in N. benthamiana, we generated four DNA constructs: i) a BvT vla-expressing “push” construct, ii) a “pull” construct overexpressing three betalain biosynthetic genes from either Beta vulgaris or Mirabilis jalapa — BvCYP76AD1, BvDODAal (hereafter simply termed BvDODA), and MjcDOPA5GT (Polturak et al., 2016; Polturak et al., 2017; Timoneda et al., 2018) —, iii) a “push / pull” construct expressing both BvTyrAa and three betalain biosynthetic genes, and iv) an empty vector (EV) as a negative control (Fig. 2A). The modular Golden Gate cloning method(Engler et al., 2014) was used to assemble Level 1 and 2 constructs, using different promoters, terminators, and tags in each transcriptional unit to avoid possible recombination between identical sequences (Fig. 2A).
[0105] To quickly test their functionality, we transiently expressed these four constructs in N. benthamiana using the agroinfiltration method (Sparkes et al., 2006). Betalain pigments were observed in the leaves expressing either the “pull” or “push / pull” construct but not in those expressing the “push” or EV construct (Fig.2B), confirming that the assembled betalain constructs are functional in N. benthamiana leaves. Unexpectedly, weaker pigmentation was observed in the leaves infiltrated with the “push / pull” construct than in those infiltrated with the “pull” construct (Fig. 2B). Betalain pigmentation became stronger over time in the leaves expressing either “push / pull” or “pull” construct; however, the clear differences between two constructs persisted throughout the time points after 2 days-post-infiltration (dpi) (Fig. 6).
[0106] To quantitatively analyze metabolic impacts, infiltrated leaf spots were sampled directly into liquid nitrogen at 3 dpi to quickly stop the metabolic reactions in the leaves. To quantify total levels of betacyanins, the dominant class of betalains in plants (Delgado- Vargas et al., 2000), metabolites were extracted from the frozen samples, and their absorbance at 538 nm was measured using spectrophotometer (Calva-Estrada et al., 2022). Corresponding to the visual phenotype (Fig. 2B), the total betacyanin level was significantly lower in the leaves expressing the “push / pull” construct than in those expressing the “pull” construct (p < 0.05), whereas no betalains were detectable in the leaves expressing either the “push” or EV construct (Fig. 2C).
[0107] Since we did not see an expected increase in total betacyanins with the “push / pull” construct, we sought to examine the levels of L-tyrosine and L-DOPA, an intermediate of betalain biosynthesis (Fig. 1). When infiltrated leaves were analyzed using liquid chromatography-mass spectrometry (LC-MS), L-tyrosine levels were the highest in the leaves expressing the “push” construct, followed by those expressing “push / pull”, EV, and “pull”. The significantly increased L-tyrosine accumulation by either the “push” or “push / pull” construct compared to the EV construct (p < 0.01, Fig. 2C) confirmed that the expression of deregulated BvTyrAa increased L-tyrosine levels in planta (Lopez-Nieves et al., 2018; de Oliveira et al., 2019). The “push / pull” or “pull” construct expression reduced L-tyrosine levels significantly compared to the “push” or EV construct, respectively (p < 0.05, Fig. 2C), suggesting that the expression of the betalain pathway genes led to the consumption of L-tyrosine for betalainproduction in N. benthamiana.
[0108] L-DOPA, which is derived from L-tyrosine via a ring hydroxylation (Fig. 1), was the highest in the leaves expressing “push / pull”, followed by “pull”, “push”, and then EV constructs (Fig. 2C). The higher L-DOPA levels in the “push / pull” and “pull” constructs than in the other constructs confirmed that the expression of BvCYP76AD1 can convert L-tyrosine to L-DOPA in planta (Hatlestad et al., 2012; Polturak et al., 2016; Polturak et al., 2017). The “push / pull” or “push” construct expression significantly increased L-DOPA levels compared to the “pull” or EV construct, respectively (p < 0.01, Fig. 2C), suggesting that the additional L-tyrosine precursor supplied by the BvTyrAa expression increased L-DOPA levels in N. benthamiana. This result suggests that the elevated levels of L-DOPA were not efficiently directed to downstream betalain biosynthesis, since the expression of the “push / pull” construct led to lower betacyanin accumulation than that of the “pull” only construct (Fig. 2, B and C),
[0109] Using the same leaf samples, RT-qPCR was conducted to investigate the transcript levels of different transgenes expressed in N. benthamiana leaves. BvTyrAa expression was detected only in the leaves infiltrated with either the “push” or “push / pull” construct, as expected (Fig. 2D) Likewise, the expression levels of three betalain genes were only detected in the leaves expressing either “pull” or “push / pull” construct (Fig. 2D). Notably, the expression levels of all transgenes in the leaves expressing the “push / pull” construct were significantly or somewhat lower than those expressing either the “push” or “pull” construct (p < 0.05, BvTyrAa, BvDODA, p < 0.01, BvCYP76AD1, Fig. 2D). Therefore, the reduced transgene expression levels might have contributed to the lower accumulation of L-tyrosine and betacyanins in the “push / pull” compared to the “push” or “pull” only construct, respectively.
[0110] Co-infiltration of the “push” and “pull” independent constructs rescued low transgene expression but still showed low betalains.
[0111] To test if the low transgene expression in the “push / pull” construct is due to post-transcriptional gene silencing, we co-expressed the p19 silencing suppressor (Sainsbury et al., 2009; Brophy et al., 2022; Dudley et al., 2022) together with the generated constructs in N. benthamiana. Even with the p19 expression, lower pigmentation (Fig. 7A) and betacyanin accumulation (Fig. 7B) were still observed in the “push / pull” expressing leaf samples as compared to the “pull” expressing leaves. The RT-qPCR analyses showed that the p!9 expression somewhat enhanced the transgene expression in the leaves expressing the “push” or“pull” construct, but not in the “push / pull”-expressing leaves (Fig. 7C). Importantly, the transgene levels were still significantly lower in the leaves expressing the “push / pull” construct than in those expressing the “push” or “pull” construct, even with the pl9 co-expression (p < 0.05, Fig. 7C).
[0112] Previous studies have reported that high levels of aromatic compounds, including L-DOPA, can cause toxicity in microbes (Gosset, 2009; Eisenman et al., 2011). Therefore, we speculated that potential accumulation of aromatic intermediates (e.g., L-tyrosine, L-DOPA) might have negatively affected the viability of Agrobacterium containing the “push / pull” construct, leading to the reduced transgene expression upon infiltration. To this end, we tested if co-infiltration of separate Agrobacterium strains harboring each “push” and “pull” construct would alleviate this potential issue (Fig. 8A). Consistent with the earlier result of expressing the single “push / pull” construct (Fig. 2B), betalain pigmentation was again weaker when the “pull” construct was co-expressed with the “push” construct than when the “pull” construct was coexpressed with the EV construct (Fig. 8B). LC-MS metabolite quantification showed that the coinfiltration of the “push” and “pull” constructs led to significantly higher L-tyrosine and L-DOPA levels (p < 0.01), but lower betacyanin levels (p < 0.05) than that with the co-infiltration of EV and “pull” constructs (Fig. 8C). Importantly, RT-qPCR analysis of BvCYP76AD1 and BvDODA transcript levels showed that these genes were similarly expressed in the leaves coexpressing the “push” and “pull” construct as compared to those in the leaves co-expressing the EV and “pull” constructs (Fig. 8D). Still, the highly accumulated L-DOPA in the “push” and “pull” co-expressing leaves were not efficiently converted to betalains (Fig. 8B). These results demonstrate that although the co-infiltration of the “push” and “pull” constructs alleviates the reduced expression of BvCYP76AD1 and BvDODA, betalain production remains lower compared to that in the leaves co-expressing EV and “pull” constructs. These findings together suggest that the expression of BvTyrAa and BvCYP76AD1 produced high amounts of L-tyrosine and L-DOPA, respectively; however, this high level of L-DOPA was not converted to betalains efficiently, likely due to the presence of a limiting enzymatic step(s) within betalain biosynthesis.
[0113] The conversion from L-DOPA to betalains is still limited with the RUBY construct.
[0114] The RUBY construct, which includes the three betalain biosynthetic genes in a single polycistronic expression unit, has recently been used to produce betalains in different plant species, such as Arabidopsis (Arabidopsis thaliana), rice (Oryza sativa calli, carrot Daucuscar ota ssp. Sativus), and cotton (Gossypium hirsutuni) (He et al., 2020; Deng et al., 2023; Ge et al., 2023). To test if this widely used betalain biosynthetic construct can overcome the limited conversion of L-DOPA into betalains, the RUBY construct was used as a new “pull” construct and was co-expressed with either EV or the “push” construct in N. benthamiana leaves (Fig. 3 A). The expression of the RUBY “pull” construct resulted in expected pigment production; however, the additional co-expression of the “push” with the RUBY “pull” constructs did not significantly increase the betalain production (Fig. 3, B and C). Again, the co-expression of the “push” and the RUBY “pull” constructs led to hyperaccumulation of both L-tyrosine and L-DOPA (Fig. 3C), similarly to the earlier results (Fig. 2C and Fig. 8C). Therefore, these accumulated precursors were not efficiently converted to betalain pigments, suggesting that the conversion of L-DOPA to betacyanin is also limited with the RUBY construct.
[0115] Additional L-DOPA 4,5-dioxygenase (DODA) expression boosts betalain production when co-infiltrated with the “push” and the “pull” constructs.
[0116] Incorporating the learned knowledge from the initial DBTL cycle above, we designed the next experiment to test if an additional expression of BvDODA could rescue this reduced betalain production phenotype observed with the “push” and “pull” co-expression. To this end, we generated an additional construct and used it to individually overexpress each one of the three betalain pathway genes — BvCYP76AD 1, BvDODA, or MjcDOPA5GT (Fig. 4A). An Agrobacterium strain containing each one of these constructs, or the EV construct as a negative control, was mixed with those containing the “pull” construct together with the “push” or EV construct and infiltrated into N. benthamiana.
[0117] The additional expression of BvDODA, but not of BvCYP76AD1 or MjcDOPA5GT, showed significantly higher betalain accumulation, and the most drastic increase in betalain accumulation was observed when both the “push” and the “pull” constructs were co-infiltrated with the additional BvDODA (1,272 ± 430 nmol / gFW) (Fig. 4, B and C). Again, L-tyrosine and L-DOPA were highly accumulated only when the “push” construct was co-infiltrated with the “pull” construct (Fig. 4C). Notably, L-DOPA levels were significantly decreased (p < 0.05) when the “push” and the “pull” constructs were co-expressed with the additional BvDODA, but not with the additional BvCYP76AD1 or MjcDOPA5GT constructs (Fig. 4C). These results suggest that the high levels of L-DOPA, resulting from co-expression of the “push” and the “pull” constructs, were efficiently converted to betalains upon additional BvDODA expression.RT-qPCR analyses showed that the transcript levels of BvDODA were substantially elevated in the leaves expressing additional BvDODA (Fig. 4D), whereas those of BvCYP76AD1 or MjcDOPA5GT were significantly lower when additional BvCYP76AD1 or MjcDOPA5GT was expressed (p < 0.05), potentially due to the transgene silencing (Fig. 4D). As BvCYP76AD1 and MjcDOPA5GT were driven by different promoters (AtLHBIBl and AtUbHO, respectively) than BvDODA (SlRbcS2) in this experiment, we next generated additional constructs of BvCYP76AD1 and MjcDOPA5GT driven under the same SlRbcS2 promoter (Fig. 9A) and conducted a coinfiltration assay. However, the resulting BvCYP76AD1 and MjcDOPA5GT transcript levels were still decreased when either of those was additionally expressed (Fig. 9D). Also, the strongest pigmentation and the highest betacyanin levels were again observed only when additional BvDODA was expressed with the “push” and “pull” constructs (Fig. 9, B and C).
[0118] We also conducted a similar experiment using the RUBY “pull” construct, which is codon optimized and thus could escape homology-mediated gene suppression (Grzech et al., 2023). The additional expression o BvCYP76AD 1, BvDODA, or MjcDOPA5GT genes led to expected increases in expression (Fig. 5A). This time, the additional betalain gene expression did not cause silencing of the f / BT-derived betalain pathway gene expression (Fig. 5A), suggesting that we successfully avoided the homology-mediated gene suppression. Still, the strongest pigmentation and betacyanin levels were observed only when the additional BvDODA was expressed with the “push” and RUBY “pull” constructs (Fig. 5, B and C). Additional BvCYP76AD1 or MjcDOPA5GT expression did not alter betacyanin production when the RUBY “pull” was expressed either with or without “push” expression (Fig. 5C). Consistent with other experiments, L-tyrosine and L-DOPA levels were highly accumulated only when the “push” construct was co-expressed. This time the average accumulation of betacyanins with the expression of the “push”, RUBY “pull”, and additional BvDODA constructs reached 3,339 ± 1,058 nmol / gFW (Fig. 5C) with the highest sample producing at 5,211 nmol / gFW, which is equivalent to 2.87 mg / gFW of betacyanin pigments. These data together indicate that DODA was the rate limiting enzyme of the reconstructed betalain biosynthetic pathway in N. benthamiana. Once the betalain pathway is optimized by alleviating this rate limiting step, additional L-tyrosine precursor supply can drastically increase the production of betalain pigments.
[0119] Discussion:Combined strategies to increase in planta betalain production by “learning” from a previous DBTL cycle
[0120] Betalains are tyrosine-derived pigments with yellow or red coloration, uniquely found in plants within the Caryophyllales order. Not only do betalains have potential health benefits including anticancer, anti-inflammatory, and antidiabetic activities (Gandia-Herrero et al., 2016; Khan, 2016), they are also widely used as natural food colorants due to their stability in a wide pH range (Azeredo, 2009; Calva-Estrada et al., 2022). Core enzymatic steps of betalain biosynthetic pathway have been elucidated throughout various studies (Vogt et al., 1999;
[0121] Christinet et al., 2004; Hatlestad et al., 2012; Polturak et al., 2016; Sunnadeniya et al., 2016), which has enabled engineering of various plant species, including Arabidopsis, tomato (Solanum lycopersicum), potato (Solanum tuberosum, cotton, and carrot (Harris et al., 2012; Sunnadeniya et al., 2016; Polturak et al., 2017; Grützner et al., 2021; Deng et al., 2023; Ge et al., 2023) to heterologously produce betalains. Due to its visual property, the RUBY betalain-biosynthetic construct has recently been widely used as a reporter for selecting early transformation events, haploid identification, protein-protein interactions, and DNA-protein interactions (He et al., 2020; Chen et al., 2023; Sun et al., 2023; Wang et al., 2023). However, prior studies primarily focused on the formation of the final product, betalains, without monitoring the intermediates (Polturak et al., 2017; Timoneda et al., 2018; Grützner et al., 2021). In our work, by carefully analyzing changes of upstream intermediate metabolites upon expression of various betalain constructs, we identified a key bottleneck step of the betalain biosynthetic pathway.
[0122] Prior studies reported that L-tyrosine availability is a limiting factor for producing betacyanins in Arabidopsis (Sunnadeniya et al., 2016), and the expression of BvTyrAa increased the betalain production in N. benthamiana and tomato fruit by around 7- and 10-fold, respectively (Timoneda et al., 2018; Grützner et al., 2021). However, with our first method of introducing the betalain pathway into N. benthamiana, we unexpectedly observed that BvTyrAa expression negatively impacts betalain production. As the betalain pigments were mostly detected in the vacuoles of mesophylls (Fig 10, A and B), endogenous transport systems appear to be able to shuttle the non-native betalain pigments into vacuoles in N. benthamiana leaves. Further detailed analyses of the pathway intermediates showed that both the “push / pull” expression and co-expression of the “push” with “pull” constructs led to high accumulation of L-tyrosine and L-DOPA in N. benthamiana; however, the further conversion from L-DOPA tobetalains was limited, resulting in lower betalain production (Fig. 2C and Fig. 8C). The decarboxylated products of L-tyrosine and L-DOPA, tyramine and dopamine, respectively, were increased but only slightly (around 3-fold, Fig. 11) and at much lower quantities than tyrosine and L-DOPA (around 28- or 69-fold increase), suggesting that the formation of these side products by endogenous N. benthamiana enzymes is likely minimal.
[0123] These results together revealed that, at least in our tested system, the conversion of the accumulated L-DOPA is a major rate limiting step of the betalain biosynthetic pathway.
[0124] Furthermore, the additional expression of the BvDODA gene together with the “push” and “pull” constructs drastically increased betalain production (by over 35-fold, Fig. 4C), which was also the case when the BvDODA gene was expressed with the “push” and RUBY “pull” constructs (Fig. 5C). Given that L-DOPA is a branch point of the betalain biosynthetic pathway (Fig. 1), enhancing the L-DOPA oxidation to form cDOPA can also accelerate L-DOPA conversion towards betalain production. However, increased expression of the bifunctional CYP76AD1 enzyme will not only enhance L-DOPA oxidase activity but also tyrosine hydroxylase activity. A prior study has identified mutations that alter the L-tyrosine hydroxylation and L-DOPA oxidation activity of CYP76AD1, but none of them increased only L-DOPA oxidase activity (DeLoache et al., 2015). Therefore, searching for such mutation could further alleviate L-DOPA accumulation and boost betalain production, especially with the DODA overexpression.
[0125] Our finding illuminated that even in the betalain pathway that requires expression of a few enzymes, it is critical to optimize the relative expression of the target biosynthetic genes to achieve an optimal “pull” strategy. Only then, additional engineering to “push” the upstream precursor supply can enable efficient and high-level production of the final product. As a result, this study reached a maximum betacyanin production of 2.87 mg / gFW, which is higher than those in earlier studies and the native plant host, red beet, in which it can accumulate in the range of 1.57 to 2.70 mg / gFW (Sawicki et al., 2016). Therefore, careful “testing” of the engineering outcome provides valuable knowledge to “learn” and then “redesign” to further increase the in planta production of target products.
[0126] Regulatory mechanisms of DODA that potentially limit betalain production
[0127] DODA enzymes catalyze the ring cleavage of L-DOPA to form unstable 4,5-seco-DOPA, which is then spontaneously cyclized to betalamic acid (Brockington et al., 2015; Bean et al., 2018; Sheehan et al., 2020). A very recent study showed that the in vitro activity of BvDODAalenzyme from Beta vulgaris, which was used in our study, is subjected to a strong substrate inhibition as L-DOPA concentration increases beyond 0.28 mM (Guerrero-Rubio et al., 2023). In our study, the expression of the “push / pull” construct, as compared to the “pull” only construct, led to higher levels of L-DOPA but not betalains. Therefore, this unexpected result could be due to the inhibition of the DODA enzyme activity when L-DOPA is highly accumulated upon coexpressing BvTyrAa and betalain biosynthetic genes.
[0128] Previous studies, however, did not observe the reduced betalain production when BvTyrAa was co-expressed with the betalain pathway genes in tomato fruit and N. benthamiana leaves (Timoneda et al., 2018; Grützner et al., 2021), which somewhat contradicts our current findings. In these prior studies the same constitutive promoters (e.g., 35S and UbilO) were used multiple times to express all three betalain biosynthetic genes, whereas our study used different promoters for each betalain biosynthetic gene to avoid a potential unwanted recombination event during the transformation process. Unintentionally, we used a relatively weaker promoter (i.e., AtLHBIBl) to drive expression of BvDODA than of the other two genes in the “pull” construct (Fig.2A) (Klepikova et al., 2016). Therefore, it is possible that the prior studies likely had a strong DODA expression, which might have prevented the accumulation of L-DOPA to a level high enough to inhibit DODA activity.
[0129] To overcome this issue in the future, we can use either a strong promoter to drive DODA and / or a different DODA enzyme with a weak to no substrate inhibition for better betalain production. Although only a few DODA enzymes have been characterized so far (Girod and Zryd, 1991; Gandia-Herrero and Garcia-Carmona, 2012; Contreras-Llano et al., 2019; Guerrero-Rubio et al., 2023), the DODA enzyme from Anabaena cylindrica showed substrate inhibition by L-DOPA but at a much higher concentration than BvDODAal (beyond 1.5 mM) (Guerrero-Rubio et al., 2020). The other characterized DODA enzyme from Gluconacetobacter diazotrophicus did not show substrate inhibition by L-DOPA up to 4 mM, although it was inhibited by alternative substrates, such as catechol and dihydrocaffeic acid (Contreras-Llano et al., 2019). Exploring biochemical diversity of DODA enzymes from various betalain-producing species may further reveal differences in DODA regulation and identify useful DODA enzymes that can be used for high production of betalains.
[0130] A potential intermediate toxicity in Agrobacterium and heterologous plant hostsIn this study, transgene expression was reduced when the single “push / pull” construct, rather than either the individual “push” or “pull” construct, was expressed in N. benthamiana (Fig. 2D). Even the co-expression of pl9 silencing suppressor (Sainsbury et al., 2009; Brophy et al., 2022; Dudley et al., 2022) could not rescue this reduced expression (Fig. 7C); however, coexpressing both “push” and “pull” constructs by mixing and co-infdtrating separate Agrobacterium cultures, rather than expressing a single “push / pull” construct, resolved this issue (Fig. 8D). A recent study also observed reduced transgene expression when multi-transcriptional units required for biosynthesis of precondylocarpine acetate, a late stage precursor of vinblastine, were expressed in a single construct, as compared to when separate constructs of individual transcriptional units were mixed (Grzech et al., 2023). The use of different regulatory elements (i.e., promoters and terminators) for each of four transcriptional units in the single construct improved the transgene expression and the final product yield, suggesting that homology-mediated epigenetic silencing may be an underlying issue in the prior study (Grzech et al., 2023). However, this may not be the case in our study since we used different promoters and terminators for each transcriptional unit.
[0131] Instead, it is possible that leaky expression of the set of transgenes from the “push / pull” construct in Agrobacterium might have resulted in accumulation of toxic intermediates, such as L-DOPA or its derivatives, negatively affecting the viability of Agrobacterium (Gosset, 2009; Eisenman et al., 2011). Mixing several Agrobacterium strains containing different transcriptional units, as conducted here (Fig. 8) and in many studies for rapid combinatorial testing in the transient expression system (Nett et al., 2020; Brophy et al., 2022; Sonawane et al., 2023), might have prevented this issue. However, when the mixing strategy is not feasible or ideal, such as for coordinated expression of multiple pathway genes, an alternative solution could be to insert introns in the coding sequences, which prevents the expression of functional transgenes in prokaryotes and hence avoid potential accumulation of toxic intermediates in Agrobacterium (Vancanneyt et al., 1990; Ibrahim et al., 2001; Brophy et al., 2022).
[0132] L-DOPA can also negatively affect plant viability, as it is one of the allelochemicals that suppress the growth of neighboring plants (Soares et al., 2014). In a previous study, to avoid possible L-DOPA toxicity, CYP76AD6 was expressed under a tomato fruit-specific promoter, together with MYB12 to enhance L-tyrosine supply, resulting in high accumulation of L-DOPA (Breitel et al., 2021). During the engineering of the cyanogenic glycoside dhurrin biosyntheticpathway, transgenic Arabidopsis expressing first two out of three enzymes, CYP79A1 and CYP71E1, showed stunted and stressed phenotypes due to the accumulation of the toxic cyanohydrine intermediate, which was rescued by the additional expression of UGT85B1, catalyzing the third step (Kristensen et al., 2005). Our study also demonstrated that the additional expression of a later step enzyme, i.e., DODA, efficiently converted the L-DOPA intermediate and drastically improved overall production of betalains (Figs. 4C and 5C). Therefore, optimizing the overall biosynthetic pathway by ensuring strong activity of a rate limiting step enzyme(s) to avoid accumulation of potentially toxic intermediates will be important to prevent negative physiological impacts that can complicate our engineering effort and / or diminish overall yield of plant biomass and target compounds.
[0133] Conclusions and Future Directions:
[0134] In this study we successfully optimized the “push-and-pull” strategy for high production of betalains in plants by balancing the enhanced L-tyrosine precursor supply with efficient precursor utilization. We found that once the betalain biosynthetic pathway is optimized by alleviating a rate limiting step, the enhanced L-tyrosine precursor can drastically increase the production of betalains. Although blocking side branches from intermediates might result in further improvement, this study reached a maximum betacyanin yield of 2.87 mg / gFW, which is higher than that in previous studies or betalain-producing red beets. Although it remains to be tested if similar strategies work in other plant systems, the gained knowledge and the “push-and-pull” strategy established in this study will be useful for in planta production of other tyrosinederived compounds as well, especially for those not having an alternative production method other than extracting from native plant hosts, such as morphine or colchicine (Glenn et al., 2013; Diamond and Desgagne-Penix, 2016). While plant synthetic biology tools are becoming available to efficiently design and build constructs, we still need to work around the limited throughput of testing these constructs due to longer plant life cycles and limited plant transformation capacity. Our findings highlight that the rigorous analysis and learning from the impact of initially designed and built constructs will be crucial, especially in plants, for effective implementation of synthetic biology.
[0135] Materials and Methods:
[0136] Plasmid constructionAll recombinant DNAs were generated using the Golden Gate cloning method. The full-length coding sequences of BvCYP76AD1, BvDODAal, and MjcDOPA5GT were provided by Dr. Alfonso Timoneda and Dr. Samuel Brockington at University of Cambridge, UK. The level 1 RUBY construct under the control of the soybean (Glycine max)' Elongation factor la promoter and Nicotiana benthamiana actin terminator and pAGM4673 with the aadal part for spectinomycin resistant were provided by Dr. Ray Collier from Wisconsin crop innovation center (WCIC). The coding sequences of BvCYP76AD 1, BvDODA, and MjcDOPA5GT were amplified using cDNA specific primers flanked with Bsa restriction site and overhangs compatible with the vector pAGM1287 (level 0 vector) from the plant modular cloning (MoClo) toolkit (Engler et al., 2014) (Table 1). The coding sequence of BvTyrAa was synthesized into the pUC57 vector with overhangs and Bsal site (El-Azaz et al., 2023). These level 0 parts were assembled into level 1 acceptors using the Golden Gate reaction with promoter, C-terminal tag, and terminator parts as described in Fig. 12 and used for co-infiltration assay. The “push” construct used for co-infiltration assays (Figs.3, 4, and 5; Figs. 8, 9, and 11) was made in our previous study (El-Azaz et al., 2023). The generated level 1 parts were further used for level 2 assembly to generate EV, “push”, “pull”, and “push / pull” constructs as described in Fig. 12. The final level 2 vectors also include the aadla gene driven by CaMV 35S promoter and a C-terminal red fluorescence protein (RFP) fusion protein driven by a seed-specific Oleosinl (At4g25140) native promoter (Fig. 12).
[0137] Table 1. Primers used in this study
[0138] Primer name _ Sequence (5' - 3') _ Purpose GACCCTGATGTTGATGTTCGCT
[0139] pHM2101
[0140]
[0141] (SEQ ID NO: 25)
[0142] RT-qPCR (Protein phosphatase 2A) GAGGGATTTGAAGAGAGATTTC
[0143] pHM2102
[0144] (SEQ ID NO: 26)
[0145] CATTGGTTCAGGAAGTGCAA
[0146] pHM0003
[0147] (SEQ ID NO: 27)
[0148] RT-qPCR (BvDODA) CCTTTGATTCATGGCTTCGT
[0149] pHM0004
[0150] (SEQ ID NO: 28)
[0151] CCCAATATCTTCCATAATGTTCCA
[0152] pHM0006
[0153] (SEQ ID NO: 29)
[0154] RT-qPCR (BvCYP76AD1) pHM0885 GCTGTTGATATTGGCAAAGCTGC
[0155] (SEQ ID NO: 30)
[0156] TTTAGGAATGCCGGGTGTAG
[0157] pHM0399
[0158] (SEQ ID NO: 31)
[0159] RT-qPCR (BvTyrAa) pHM0400 TCTCCAAAACTCGTCCCATC
[0160]
[0161] (SEQ ID NO: 32)TGCGGICATGCAAGCTAAGT
[0162] pHM2590
[0163] (SEQ ID NO: 33)
[0164] RT-qPCR (MjcDOPA5GT)
[0165] AGTCCGGGACGTCATAGGGA
[0166] pHM2591
[0167] (SEQ ID NO: 34)
[0168] GAGAGACTCGCCCCAGATTCCT
[0169] pHM2910
[0170] (SEQ ID NO: 35)
[0171] RT-qPCR (RUBYCYP76AD1) CTCGCCCATCGTCAGCTCGTTC
[0172] pHM2911
[0173] (SEQ ID NO: 36)
[0174] TCCGGCCACTGGGAGACAGTGA
[0175] pHM2912
[0176] (SEQ ID NO: 37)
[0177] RT-qPCR (RUBYDODA) CTTGAACTGGTACATGGCGGCT
[0178] pHM2913
[0179] (SEQ ID NO: 38)
[0180] CTTATGGCACATCCGCCTACGT
[0181] pHM2914
[0182] (SEQ ID NO: 39)
[0183] RT-qPCR (RUBYcDOPA6GT) TATGGTTCTCTGGGAAGCCTGG
[0184] pHM2915
[0185] (SEQ ID NO: 40)
[0186] pHM2440 cactctgtggtctcaAatggatcatgcaacattagca
[0187] (SEQ ID NO: 41)
[0188] IvO cloning of BvCYP76AD1 ccacttcgtggtctcaCGAActatacctaggtattggaataA
[0189] pHM2441
[0190] (SEQ ID NO: 42)
[0191] pHM2442 cactctgtggtctcaAatgaaaatgatgaatggag
[0192] (SEQ ID NO: 43)
[0193] IvO cloning of BvDOD A ccacttcgtggtctcaCGAActggctgaagtgaact
[0194] pHM2443
[0195] (SEQ ID NO: 44)
[0196] pHM2444 cactctgtggtctcaAatgatgaccgccattaaaat
[0197] (SEQ ID NO: 45)
[0198] IvO cloning of MjcDOPA5GT ccacttcgtggtctcaCGAActttgaagagaaggttccaa
[0199] pHM2445
[0200]
[0201] (SEQ ID NO: 46)
[0202]
[0203] Transient expression of generated DNA constructs in N. benthamiana
[0204] N. benthamiana plants were grown under approximately 200 µE of light intensity with a 12 hr light, 12 hr dark cycle at 24°C and 60% humidity. The generated binary vectors were transformed into Agrobacterium tumefaciens strain GV3101 using electroporation. A. tumefaciens strains harboring each construct were grown in 10 ml of LB media with antibiotics at 28°C in a shaking incubator at 250 rpm for approximately 24 hr. Overnight saturated cultures were centrifuged at 3000 g for 5 min at room temperature. The pellets were washed twice with 3 mL of induction media [10 mM 2-(N-morpholine)-ethanesulphonic acid (MES) pH 5.6, 0.5% (w / v) glucose, 2 mM NaH2PO4, 20 mM NH4Cl, 1 mM MgSO4, 2 mM KC1, 0.1 mM CaCl₂, 0.01 mM FeSO4, and 0.2 mM acetosyringone] and incubated in the induction media for 2-3 hr at room temperature in dark. After the incubation, the cells were pelleted at 3000 g for 5 min at room temperature and resuspended into 3 mL of 10 mM MES pH 5.6 with 0.2 mM acetosyringone. All resuspended cultures were diluted to OD600nmof 1.0 and mixed in equal ratios as described by theexperimental condition for co-infiltration assay and diluted to OD600nmof 0.5 for level 2 singleconstruct infiltration. Four- week-old plants were infiltrated on the abaxial side of the leaf using a 1 mL needleless syringe (Becton, Dickinson and Company, 309659) and grown for three days under the same condition as described above.
[0205] Metabolite analyses
[0206] To measure metabolite levels in infiltrated N. benthamiana leaves, infiltrated spots were collected at three days post-infiltration (dpi), flash-frozen in liquid nitrogen, ground to powder, and kept at -80°C until use. Approximately 20-30 mg of frozen powders were mixed in 400 µL of the extraction buffer containing 2: 1 (v / v) of methanol and chloroform. After adding 300 μL of H₂O and then 125 μL of chloroform, samples were centrifuged at 10,000 g for 5 min. 450 µL of the polar phase was transferred to a fresh tube, dried down overnight in a SpeedVac at room temperature, and resuspended into 100 µL of LC-MS grade water before LC-MS analysis.
[0207] For LC-MS analysis, 1 µL of each resuspended sample was injected onto a HSS T3 C18 reversed phase column (100 x 2.1 mm i.d., 1.8 μm particle size; Waters, Milford, USA) and eluted using a 25-minute gradient comprising 0.1 % (v / v) formic acid in LC-MS grade water (solvent A) and 0.1 % (v / v) formic acid in 90% (v / v) LC-MS-grade acetonitrile (solvent B) at a flow rate of 0.4 mL / min and column temperature of 40 °C. The binary linear gradient with the following ratios of solvent B was used: 0-1 min, 1 %; 1-10 min, 1-10 %; 10-13 min, 10-30 %; 13-14.5 min, 30-70 %; 14.5-15.5 min, 70-99 %; 15.5-20 min, 99 %; 20-20 min, 99-1 %; 20- 25 min, 1 %. The MS spectra were recorded using the full scan in positive mode, covering a mass range from 100 to 1000 mass / charge ratio (m / z). The resolution was set to 140,000, and the maximum scan time was set to 200 ms. The transfer capillary temperature was set to 150°C, while the heater temperature was adjusted to 300°C. The spray voltage was fixed at 3 kV, with a capillary voltage and a skimmer voltage of 25 and 15 V, respectively. The identity of L-tyrosine and L-DOPA peaks were confirmed by comparing their accurate masses and retention times with those of the corresponding authentic standards. Quantification was based on the standard curves of L-tyrosine and L-DOPA generated by injecting different concentrations of authentic chemical standards.
[0208] For betacyanin quantification, 30 µL of the same resuspended samples used for LC-MS were transferred to individual wells of a 96 Greiner transparent plate, flat bottom, half well size (#675101) with five times serial dilutions. Absorbance at 538 nm was measured using a platereader (Infinite 200 PRO, TECAN). Multiple data points in the linear range were used for further analysis. Absorbance values were converted to betacyanin content using the molar extinction coefficient e = 60,000 M-1cm-1(Stintzing et al., 2003). Statistical significance was determined using a two-tailed student’s / -test with a / rvalue threshold of 0.05 or 0.01 as indicated in the figure legends.
[0209] RT-qPCR expression analysis
[0210] To test the expression levels of transgenes in the infiltrated N. benthamiana leaves, transcript levels of transgenes were analyzed by reverse-transcription quantitative PCR (RT-qPCR) from the same frozen tissues used for corresponding metabolite analyses. Total RNA was isolated from approximately 50-100 mg of frozen ground tissue using TRIzol (Invitrogen), treated with deoxyribonuclease I (Thermo Fisher Scientific), and reverse-transcribed to synthesize cDNA with M-MLV reverse transcriptase and random hexamer primers (Promega) according to the manufacturer’s protocol. qPCR was conducted in a Stratagene Mx3000P (Agilent Technologies) thermocycler using GoTaq qPCR Master Mix (Promega). Specific primers used for the target genes are listed in Fig. 12. Expression of the NbPP2A gene was used to normalize the sample-to-sample variations between different cDNA preparations (Liu et al., 2012). Relative expression levels among different infiltrated leaves were analyzed for each transgene using the 2-ΔCtmethod (Livak and Schmittgen, 2001). Statistical significance was determined using a two-tailed student’s / -test with a / ?- value threshold of 0.05 or 0.01 as indicated in the figure legends.
[0211] Accession Numbers
[0212] Sequence data from this Example can be found in the GenBank data libraries under the following accession numbers: KY207372 (BvTyrAa), MH836617 (BvCYP76AD1), MH836616 (BvDODA), and MH836618 (MjcDOPA5GT).
[0213] References:
[0214] Afendi FM, Okada T, Yamazaki M, Hirai -Morita A, Nakamura Y, Nakamura K, Ikeda S, Takahashi H, Altaf-Ul-Amin Md, Darusman LK, et al (2012) KNApSAcK Family Databases: Integrated Metabolite-Plant Species Databases for Multifaceted Plant Research. Plant Cell Physiol 53: el
[0215] Azeredo HMC (2009) Betalains: properties, sources, applications, and stability - a review. Int J Food Sci Technol 44: 2365-2376Bally J, Jung H, Mortimer C, Naim F, Philips JG, Hellens R, Bombarely A, Goodin MM, Waterhouse PM (2018) The Rise and Rise of Nicotiana benthamiana: A Plant for All Reasons. Annu Rev Phytopathol 56: 405-426
[0216] Barnum CR, Endelman BJ, Shih PM (2021) Utilizing Plant Synthetic Biology to Improve Human Health and Wellness. Front. Plant Sci. 12:
[0217] Bean A, Sunnadeniya R, Akhavan N, Campbell A, Brown M, Lloyd A (2018) Gain-of-function mutations in beet DODA2 identify key residues for betalain pigment evolution. New Phytol 219: 287-296
[0218] Breitel D, Brett P, Alseekh S, Fernie AR, Butelli E, Martin C (2021) Metabolic engineering of tomato fruit enriched in L-DOPA. Metab Eng 65: 185-196
[0219] Brockington SF, Yang Y, Gandia-Herrero F, Covshoff S, Hibberd JM, Sage RF, Wong GKS, Moore MJ, Smith SA (2015) Lineage-specific gene radiations underlie the evolution of novel betalain pigmentation in Caryophyllales. New Phytol 207: 1170-1180
[0220] Bröker JN, Müller B, van Deenen N, Prüfer D, Schulze Gronover C (2018) Upregulating the mevalonate pathway and repressing sterol synthesis in Saccharomyces cerevisiae enhances the production of triterpenes. Appl Microbiol Biotechnol 102: 6923-6934 Brophy JAN, Magallon KJ, Duan L, Zhong V, Ramachandran P, Kniazev K, Dinneny JR (2022) Synthetic genetic circuits as a means of reprogramming plant roots. Science 377: 747- 751
[0221] Bryson AE, Lanier ER, Lau KH, Hamilton JP, Vaillancourt B, Mathieu D, Yocca AE, Miller GP, Edger PP, Buell CR, et al (2023) Uncovering a miltiradiene biosynthetic gene cluster in the Lamiaceae reveals a dynamic evolutionary trajectory. Nat Commun 14: 343 Calva-Estrada SJ, Jiménez-Fernández M, Lugo-Cervantes E (2022) Betalains and their applications in food: The current state of processing, stability and future opportunities in the industry. Food Chem Mol Sci 4: 100089
[0222] Chen J, Luo M, Hands P, Rolland V, Zhang J, Li Z, Outram M, Dodds P, Ayliffe M (2023) A split GAL4 RUBY assay for visual in planta detection of protein-protein interactions. Plant J 114: 1209-1226
[0223] Choi KR, Jang WD, Yang D, Cho JS, Park D, Lee SY (2019) Systems Metabolic Engineering Strategies: Integrating Systems and Synthetic Biology with Metabolic Engineering.
[0224] Trends Biotechnol 37: 817-837Christinet L, Burdet FX, Zaiko M, Hinz U, Zryd J-P (2004) Characterization and Functional Identification of a Novel Plant 4,5-Extradiol Dioxygenase Involved in Betalain Pigment Biosynthesis in Portulaca grandiflora. Plant Physiol 134: 265-274
[0225] Contreras-Llano LE, Guerrero-Rubio MA, Lozada-Ramírez JD, García-Carmona F, Gandía-Herrero F (2019) First Betalain-Producing Bacteria Break the Exclusive Presence of the Pigments in the Plant Kingdom. mBio 10: 10.1128 / mbio.00345-19
[0226] Cravens A, Payne J, Smolke CD (2019) Synthetic biology strategies for microbial biosynthesis of plant natural products. Nat Commun 10: 2142
[0227] De La Pena R, Hodgson H, Liu JC-T, Stephenson MJ, Martin AC, Owen C, Harkess A, Leebens- Mack J, Jimenez LE, Osbourn A, et al (2023) Complex scaffold remodeling in plant triterpene biosynthesis. Science 379: 361-368
[0228] Delgado-Vargas F, Jiménez AR, Paredes-López O (2000) Natural Pigments: Carotenoids, Anthocyanins, and Betalains — Characteristics, Biosynthesis, Processing, and Stability. Crit Rev Food Sci Nutr 40: 173-289
[0229] DeLoache WC, Russ ZN, Narcross L, Gonzales AM, Martin VJJ, Dueber JE (2015) An enzyme- coupled biosensor enables (S)-reticuline production in yeast from glucose. Nat Chem Biol 11: 465-471
[0230] Deng Y-J, Duan A-Q, Liu H, Wang Y-H, Zhang R-R, Xu Z-S, Xiong A-S (2023) Generating colorful carrot germplasm through metabolic engineering of betalains pigments. Hortic Res 10: uhad024
[0231] Diamond A, Desgagne-Penix I (2016) Metabolic engineering for the production of plant isoquinoline alkaloids. Plant Biotechnol J 14: 1319-1328
[0232] Dudley QM, Jo S, Guerrero DAS, Chhetry M, Smedley MA, Harwood WA, Sherden NH, O’Connor SE, Caputi L, Patron NJ (2022) Reconstitution of monoterpene indole alkaloid biosynthesis in genome engineered Nicotiana benthamiana. Commun Biol 5: 1—12 Eisenman HC, Chow S-K, Tse KK, McClelland E, Casadevall A (2011) The effect of L-DOPA on Cryptococcus neoformans growth and gene expression. Virulence 2: 329-336 El-Azaz J, Moore B, Takeda-Kimura Y, Yokoyama R, Wijesingha Ahchige M, Chen X, Schneider M, Maeda HA (2023) Coordinated regulation of the entry and exit steps of aromatic amino acid biosynthesis supports the dual lignin pathway in grasses. Nat Commun 14: 7242Engler C, Youles M, Gruetzner R, Ehnert T-M, Werner S, Jones JDG, Patron NJ, Marillonnet S (2014) A Golden Gate Modular Cloning Toolbox for Plants. ACS Synth Biol 3: 839-843 Erb M, Kliebenstein DJ (2020) Plant Secondary Metabolites as Defenses, Regulators, and Primary Metabolites: The Blurred Functional Trichotomy. Plant Physiol 184: 39-52 Fang C, Fernie AR, Luo J (2019) Exploring the Diversity of Plant Metabolism. Trends Plant Sci 24: 83-98
[0233] Gandía-Herrero F, Escribano J, García-Carmona F (2016) Biological Activities of Plant Pigments Betalains. Crit Rev Food Sci Nutr 56: 937-945
[0234] Gandía-Herrero F, García-Carmona F (2012) Characterization of recombinant Beta vulgaris 4,5- DOPA-extradiol-dioxygenase active in the biosynthesis of betalains. Planta 236: 91-100 Ge X, Wang P, Wang Y, Wei X, Chen Y, Li F (2023) Development of an eco-friendly pink cotton germplasm by engineering betalain biosynthesis pathway. Plant Biotechnol J 21: 674-676
[0235] Girod P-A, Zryd J-P (1991) Biogenesis of betalains: Purification and partial characterization of dopa 4,5-dioxygenase from Amanita muscaria. Phytochemistry 30: 169-174
[0236] Glenn WS, Runguphan W, O’Connor SE (2013) Recent progress in the metabolic engineering of alkaloids in plant systems. Curr Opin Biotechnol 24: 354-365
[0237] Gosset G (2009) Production of aromatic compounds in bacteria. Curr Opin Biotechnol 20: 651–658
[0238] Grützner R, Schubert R, Horn C, Yang C, Vogt T, Marillonnet S (2021) Engineering Betalain Biosynthesis in Tomato for High Level Betanin Production in Fruits. Front. Plant Sci. 12: Grzech D, Hong B, Caputi L, Sonawane PD, O’Connor SE (2023) Engineering the Biosynthesis of Late-Stage Vinblastine Precursors Precondylocarpine Acetate, Catharanthine, Tabersonine in Nicotiana benthamiana. ACS Synth Biol 12: 27-34
[0239] Guerrero-Rubio MA, García-Carmona F, Gandía-Herrero F (2020) First description of betalains biosynthesis in an aquatic organism: characterization of 4,5-DOPA-extradiol- di oxygenase activity in the cyanobacteria Anabaena cylindrica. Microb Biotechnol 13: 1948-1959
[0240] Guerrero-Rubio MA, Walker-Hale N, Guo R, Sheehan H, Timoneda A, Gandia-Herrero F, Brockington SF (2023) Are seven amino acid substitutions sufficient to explain the evolution of high l-DOPA 4,5-dioxygenase activity leading to betalain pigmentation?Revisiting the gain-of-function mutants of Bean et al. (2018). New Phytol 239: 2265- 2276
[0241] Harris NN, Javellana J, Davies KM, Lewis DH, Jameson PE, Deroles SC, Calcott KE, Gould KS, Schwinn KE (2012) Betalain production is possible in anthocyanin-producing plant species given the presence of DOPA-di oxygenase and L-DOPA. BMC Plant Biol 12: 34 Hatlestad GJ, Sunnadeniya RM, Akhavan NA, Gonzalez A, Goldman IL, McGrath JM, Lloyd AM (2012) The beet R locus encodes a new cytochrome P450 required for red betalain production. Nat Genet 44: 816-820
[0242] He Y, Zhang T, Sun H, Zhan H, Zhao Y (2020) A reporter for noninvasively monitoring gene expression and plant transformation. Hortic Res 7: 1-6
[0243] Hong B, Grzech D, Caputi L, Sonawane P, Lopez CER, Kamileen MO, Hernandez Lozada NJ, Grabe V, O’Connor SE (2022) Biosynthesis of strychnine. Nature 607: 617-622 Ibrahim AFM, Watters JA, Clark GP, Thomas CJR, Brown JWS, Simpson CG (2001) Expression of intron-containing GUS constructs is reduced due to activation of a cryptic 5' splice site. Mol Genet Genomics 265: 455-460
[0244] Itkin M, Heinig U, Tzfadia O, Bhide AJ, Shinde B, Cardenas PD, Bocobza SE, Unger T, Malitsky S, Tinkers R, et al (2013) Biosynthesis of Antinutritional Alkaloids in Solanaceous Crops Is Mediated by Clustered Genes. Science 341: 175-179
[0245] Jamil OK, Cravens A, Payne JT, Kim CY, Smolke CD (2022) Biosynthesis of tetrahydropapaverine and semisynthesis of papaverine in yeast. Proc Natl Acad Sci 119: e2205848119
[0246] Jullesson D, David F, Pfleger B, Nielsen J (2015) Impact of synthetic biology and metabolic engineering on industrial production of fine chemicals. Biotechnol Adv 33: 1395-1402 Kacser H, Acerenza L (1993) A universal method for achieving increases in metabolite production. Eur J Biochem 216: 361-367
[0247] Khan MI (2016) Plant Betalains: Safety, Antioxidant Activity, Clinical Efficacy, and Bioavailability. Compr Rev Food Sci Food Saf 15: 316-330
[0248] Klepikova AV, Kasianov AS, Gerasimov ES, Logacheva MD, Penin AA (2016) A high resolution map of the Arabidopsis thaliana developmental transcriptome based on RNA- seq profiling. Plant J 88: 1058-1070Kristensen C, Morant M, Olsen CE, Ekstrom CT, Galbraith DW, Lindberg Moller B, Bak S (2005) Metabolic engineering of dhurrin in transgenic Arabidopsis plants with marginal inadvertent effects on the metabolome and transcriptome. Proc Natl Acad Sci 102: 1779- 1784
[0249] Li C, Wood JC, Vu AH, Hamilton JP, Rodriguez Lopez CE, Payne RME, Serna Guerrero DA, Gase K, Yamamoto K, Vaillancourt B, et al (2023) Single-cell multi-omics in the medicinal plant Catharanthus roseus. Nat Chem Biol 19: 1031-1041
[0250] Liu D, Shi L, Han C, Yu J, Li D, Zhang Y (2012) Validation of Reference Genes for Gene Expression Studies in Virus-Infected Nicotiana benthamiana Using Quantitative Real- Time PCR. PLOS ONE 7: e46451
[0251] Livak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCTMethod. Methods 25: 402-408
[0252] Lopez-Nieves S, El-Azaz J, Men Y, Holland CK, Feng T, Brockington SF, Jez JM, Maeda HA (2022) Two independently evolved natural mutations additively deregulate TyrA enzymes and boost tyrosine production in planta. Plant J 109: 844-855
[0253] Lopez-Nieves S, Yang Y, Timoneda A, Wang M, Feng T, Smith SA, Brockington SF, Maeda HA (2018) Relaxation of tyrosine pathway regulation underlies the evolution of betalain pigmentation in Caryophyllales. New Phytol 217: 896-908
[0254] Lou Y-R, Anthony TM, Fiesel PD, Arking RE, Christensen EM, Jones AD, Last RL (2021) It happened again: Convergent evolution of acylglucose specialized metabolism in black nightshade and wild tomato. Sci Adv 7: eabj8726
[0255] Maeda H, Dudareva N (2012) The Shikimate Pathway and Aromatic Amino Acid Biosynthesis in Plants. Annu Rev Plant Biol 63: 73-105
[0256] Montaño López J, Durán L, Avalos JL (2022) Physiological limitations and opportunities in microbial metabolic engineering. Nat Rev Microbiol 20: 35-48
[0257] Monte J, Abreu AC, Borges A, Simões LC, Simões M (2014) Antimicrobial Activity of Selected Phytochemicals against Escherichia coli and Staphylococcus aureus and Their Biofilms. Pathogens 3: 473-498
[0258] Nett RS, Lau W, Sattely ES (2020) Discovery and engineering of colchicine alkaloid biosynthesis. Nature 584: 148-153Newman DJ, Cragg GM (2020) Natural Products as Sources of New Drugs over the Nearly Four Decades from 01 / 1981 to 09 / 2019. J Nat Prod 83: 770-803
[0259] Nielsen J, Keasling JD (2016) Engineering Cellular Metabolism. Cell 164: 1185-1197 de Oliveira MVV, Jin X, Chen X, Griffith D, Batchu S, Maeda HA (2019) Imbalance of tyrosine by modulating TyrA arogenate dehydrogenases impacts growth and development of Arabidopsis thaliana. Plant J 97: 901–922
[0260] Polturak G, Breitel D, Grossman N, Sarrion-Perdigones A, Weithorn E, Pliner M, Orzaez D, Granell A, Rogachev I, Aharoni A (2016) Elucidation of the first committed step in betalain biosynthesis enables the heterologous engineering of betalain pigments in plants. New Phytol 210: 269-283
[0261] Polturak G, Grossman N, Vela-Corcia D, Dong Y, Nudel A, Pliner M, Levy M, Rogachev I, Aharoni A (2017) Engineered gray mold resistance, antioxidant capacity, and pigmentation in betalain-producing crops and ornamentals. Proc Natl Acad Sci 114: 9062-9067
[0262] Pouvreau B, Vanhercke T, Singh S (2018) From plant metabolic engineering to plant synthetic biology: The evolution of the design / build / test / learn cycle. Plant Sci 273: 3-12 Pyne ME, Narcross L, Martin VJJ (2019) Engineering Plant Secondary Metabolism in Microbial Systems. Plant Physiol 179: 844-861
[0263] Rippert P, Matringe M (2002a) Purification and kinetic analysis of the two recombinant arogenate dehydrogenase isoforms of Arabidopsis thaliana. Eur J Biochem 269: 4753–4761
[0264] Rippert P, Matringe M (2002b) Molecular and biochemical characterization of an Arabidopsis thaliana arogenate dehydrogenase with two highly similar and active protein domains. Plant Mol Biol 48: 361-368
[0265] Ro D-K, Paradise EM, Ouellet M, Fisher KJ, Newman KL, Ndungu JM, Ho KA, Eachus RA, Ham TS, Kirby J, et al (2006) Production of the antimalarial drug precursor artemisinic acid in engineered yeast. Nature 440: 940-943
[0266] Sainsbury F, Thuenemann EC, Lomonossoff GP (2009) pEAQ: versatile expression vectors for easy and quick transient expression of heterologous proteins in plants. Plant Biotechnol J 7: 682-693Sasaki N, Adachi T, Koda T, Ozeki Y (2004) Detection of UDP-glucose:cyclo-DOPA 5-0- glucosyltransferase activity in four o’ clocks (Mirabilis jalapa L.). FEBS Lett 568: 159— 162
[0267] Sasaki N, Wada K, Koda T, Kasahara K, Adachi T, Ozeki Y (2005) Isolation and Characterization of cDNAs Encoding an Enzyme with Glucosyltransferase Activity for cyclo-DOPA from Four O’clocks and Feather Cockscombs. Plant Cell Physiol 46: 666- 670
[0268] Sawicki T, Bączek N, Wiczkowski W (2016) Betalain profde, content and antioxidant capacity of red beetroot dependent on the genotype and root part. J Funct Foods 27: 249-261 Schenck CA, Maeda HA (2018) Tyrosine biosynthesis, metabolism, and catabolism in plants.
[0269] Phytochemistry 149: 82-102
[0270] Schliemann W, Kobayashi N, Strack D (1999) The Decisive Step in Betaxanthin Biosynthesis Is a Spontaneous Reaction. Plant Physiol 119: 1217-1232
[0271] Sheehan H, Feng T, Walker-Hale N, Lopez-Nieves S, Pucker B, Guo R, Yim WC, Badgami R, Timoneda A, Zhao L, et al (2020) Evolution of 1-DOPA 4,5-dioxygenase activity allows for recurrent specialisation to betalain pigmentation in Caryophyllales. New Phytol 227: 914-929
[0272] Shi H, Wu X, Zhu Y, Liang T, Wang Z, Li X, Liu J, Zhang Y, Chen F, Gao J, et al (2024) RefMetaPlant: a reference metabolome database for plants across five major phyla. Nucleic Acids Res 52: D1614-D1628
[0273] Shih PM (2018) Towards a sustainable bio-based economy: Redirecting primary metabolism to new products with plant synthetic biology. Plant Sci 273: 84-91
[0274] Simoes M, N. Bennett R, S. Rosa EA (2009) Understanding antimicrobial activities of phytochemicals against multidrug resistant bacteria and biofilms. Nat Prod Rep 26: 746- 757
[0275] Soares A, Marchiosi R, de Cassia Siqueira-Soares R, Barbosa de Lima R, Dantas dos Santos W, Ferrarese-Filho O (2014) The role of L-DOPA in plants. Plant Signal Behav 9: e28275 Sonawane PD, Gharat SA, Jozwiak A, Barbole R, Heinicke S, Almekias-Siegl E, Meir S, Rogachev I, Connor SEO, Giri AP, et al (2023) A BAHD-type acyltransferase concludes the biosynthetic pathway of non-bitter glycoalkaloids in ripe tomato fruit. Nat Commun 14: 4540Sparkes IA, Runions J, Kearns A, Hawes C (2006) Rapid, transient expression of fluorescent fusion proteins in tobacco plants and generation of stably transformed plants. Nat Protoc 1: 2019-2025
[0276] Stintzing FC, Schieber A, Carle R (2003) Evaluation of colour properties and chemical quality parameters of cactus juices. Eur Food Res Technol 216: 303-311
[0277] Sun H, Wang S, Yang K, Zhu C, Liu Y, Gao Z (2023) Development of dual-visible reporter assays to determine the DNA-protein interaction. Plant J 113: 1095-1101 Sunnadeniya R, Bean A, Brown M, Akhavan N, Hatlestad G, Gonzalez A, Symonds VV, Lloyd A (2016) Tyrosine Hydroxylation in Betalain Pigment Biosynthesis Is Performed by Cytochrome P450 Enzymes in Beets (Beta vulgaris). PLOS ONE 11: e0149417 Timoneda A, Sheehan H, Feng T, Lopez-Nieves S, Maeda HA, Brockington S (2018) Redirecting Primary Metabolism to Boost Production of Tyrosine-Derived Specialised Metabolites in Planta. Sci Rep 8: 17256
[0278] Vancanneyt G, Schmidt R, O’Connor-Sanchez A, Willmitzer L, Rocha-Sosa M (1990) Construction of an intron-containing marker gene: Splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Mol Gen Genet MGG 220: 245-250
[0279] Vogt T, Grimm R, Strack D (1999) Cloning and expression of a cDNA encoding betanidin 5-O- glucosyltransferase, a betanidin- and flavonoid-specific enzyme with high homology to inducible glucosyltransferases from the Solanaceae. Plant J 19: 509-519
[0280] Wang D, Zhong Y, Feng B, Qi X, Yan T, Liu J, Guo S, Wang Y, Liu Z, Cheng D, et al (2023) The RUBY reporter enables efficient haploid identification in maize and tomato. Plant Biotechnol J 21: 1707-1715
[0281] Zhang J, Hansen LG, Gudich O, Viehrig K, Lassen LMM, Schröbbers L, Adhikari KB, Rubaszka P, Carrasquer-Alvarez E, Chen L, et al (2022) A microbial supply chain for production of the anti-cancer drug vinblastine. Nature 609: 341-347
[0282] Zhang Y, Butelli E, Alseekh S, Tohge T, Rallapalli G, Luo J, Kawar PG, Hill L, Santino A, Fernie AR, et al (2015) Multi-level engineering facilitates the production of phenylpropanoid compounds in tomato. Nat Commun 6: 8635
[0283] Zhao K, Rhee SY (2022) Omics-guided metabolic pathway discovery in plants: Resources, approaches, and opportunities. Curr Opin Plant Biol 67: 102222Zurbriggen MD, Moor A, Weber W (2012) Plant and bacterial systems biology as platform for plant synthetic bio(techno)logy. JBiotechnol 160: 80-90
[0284] Example 2:
[0285] In the following example, the inventors describe the development of a new construct, referred to herein as RUBYv2 that encodes three enzymes necessary for betalain synthesis in plants. They demonstrate that introducing this construct into soybean produces plants with red-colored seeds containing high levels of red pigments.
[0286] Results:
[0287] RUBYv2 is a polycistronic construct that is based on the RUBY construct that was previously described (He et al., 2020) and was utilized in part of Example 1. RUBY comprises polynucleotides encoding three enzymes necessary for betalain synthesis. Ordered from 5’ to 3’ within the construct, these enzymes are: CYP76AD1, L-DOPA 4,5-dioxygenase (DODA), and cDOPA 5-O-glucosyltransferase (cDOPA5GT).
[0288] To generate RUBYv2, we moved the polynucleotide encoding DODA from the second position to the first position within the transcriptional unit to increase DODA expression relative to other two genes in view of the findings of Example 1. We used the seed-specific promoter GmScream6 (Zhang et al., 2015) to drive expression of the RUBYv2 construct and the Nicotiana tabacum intronless extensin (EU) terminator for polyadenylation in this experiment.
[0289] The RUBYv2 cassette was part of a larger construct generated in ArPORTl using the GAANTRY system (Collier et al, 2018). The T-DNA of RUBYv2 was introduced into soybean (Glycine max William 82 background) via Agrobacterium mediated transformation. Soybean is abundant in nitrogen and tyrosine, which are both required for efficient synthesis of betalains. These unique metabolic properties are due to soybean’s ability to form nodules with nitrogen-fixing bacteria and to synthesize tyrosine via two pathways (Schenck et al., 2015; Maeda and Schenck, 2017; Schenck et al., 2017; Maeda and Schenck, 2021). We obtained multiple independent transgenic events displaying intense coloration throughout the entire soybean seeds (FIG. 13A, FIG. 13B) without widespread red coloration in other plant tissues.
[0290] Pigment was extracted using 80% methanol, and quantification of the extracted pigment revealed that many RUBYv2 soybean seeds accumulated red betacyanins at up to 10,500 nmol / g tissue (5.77 mg betacyanin / g tissue) (FIG. 14, FIG. 15), surpassing the levels that accumulate in highly pigmented red table beet cultivars (up to 5,600 nmol / g tissue, 3.08 mg / g tissue (Gaertnerand Goldman, 2005; Sawicki et al., 2016). Some pigments remained unextracted, even after 6 rounds of extraction, indicating that non-extractable red pigments are present in the seed tissue. These pigments may be conjugated to soy proteins or aggregated somehow, and they may prove to be more stable than the extractable pigments.
[0291] These red soybean seeds may prove to be a valuable and innovative source of both soluble and insoluble food colorants for use in a diverse range of food applications, and thus may offer a safer and more sustainable alternative to petroleum-based colorants.
[0292] Materials and Methods:
[0293] Construct generation
[0294] The polycistronic cassettes, comprised of the aforementioned CYP76AD, DODA, and GST genes, were assembled using the RIGGER system (part of the HARBOR system, which is used for Golden Gate mediated assembly of plant transformation plasmids from synthetic DNA parts). Each gene was first “domesticated”, meaning that silent mutations were made in the sequence to eliminate internal occurrences of the recognition sequences of specific restriction endonucleases, to eliminate recognition sequences of Bsal, BbsI, Esp3I, BspMI, AhdI, and PaqCI. “Domestication” is necessary to ensure that the synthetic parts are compatible with our Golden Gate assembly pipeline (which is mediated by a TypellS restriction endonuclease). Each gene was ordered as a synthetic molecule as a CDSlns (Coding DNA Sequence 1 “no stop” module) following the Level 0 parts vocabulary as described in Engler et al., 2014. The CDSlns modules were used with the RIGGER system acceptors to add the 2A sequences (F2A between gene 1 and 2, and T2A between gene 2 and 3, with a STOP codon added at the 3’ end of gene 3) and render the polycistron a CDS1 module. The RUBYvl or RUBYv2 CDS1 modules were then used in Level 1 Golden Gate assembly to generate transcriptional units (TU) with either constitutive (cestrum yellow leaf curling virus (CmYLCV) or GmScreamM8) or seed specific (GmScream6) promoters, as well as terminators, which are needed for polyadenylation of the polycistronic mRNA. The completed Level 1 TU were then integrated into either a GAUNTRY system B or P CONTAINER plasmid, or into the WCIC-DICOT-RK2 binary plasmid. The WCIC-DICOT-RK2 binary plasmid contains the AtdTP-aadAla plant selectable marker, which confers resistance to spectinomycin to transgenic plant cells, as well as the Petunia x hybrida TBS-1 insulator, which protects the seed specific promoter driving RUBY cassette expressionfrom the bidirectional enhancers of the 2X enhanced Cauliflower Mosaic Virus 35S promoter used for driving expression of the AtdTP-aadAla plant selectable marker.
[0295] Metabolite analysis
[0296] Dried soybean seeds were ground using a mortar and pestle. To fully extract betalains from soybean seed samples, approximately 30 mg of powdered seed samples were rapidly mixed with 300 pL of LC-MS grade water first and then incubated overnight at 4°C. After the incubation, 400 pL of chloroform: methanol (2:1, v / v) metabolite extraction buffer together with 0.5 pg / ml of isovitexin were added. Then, 125 pL of chloroform were added, and samples were vortexed vigorously and centrifuged at 10,000 g for 5 min. Subsequently, 450 pL of the polar phase was transferred to a fresh 1.5 ml Eppendorf tube. The extraction part was conducted once more to fully extract betalains from within the soybean seeds, and the next 450 pL of the polar phase was pooled together in the same 1.5 ml tube. The supernatant was dried down overnight in a SpeedVac at room temperature and resuspended into 100 µL of LC-MS grade water for LC-MS analysis and total betacyanin quantification.
[0297] LC-MS analysis of plant metabolites was performed using a Vanquish Horizon Binary UHPLC (Thermo Scientific, Waltham, MA, USA) coupled to a Q Exactive Orbitrap mass spectrometer (Thermo Scientific, Waltham, MA, USA). One micro liter of each resuspended sample was injected onto a HSS T3 C18 reversed phase column (100 x 2.1 mm i.d., 1.8 μm particle size; Waters, Milford, USA) and eluted using a 25-minute gradient comprising 0.1 % (v / v) formic acid (Fisher Scientific, Hampton, NH, USA) in LC-MS grade water (solvent A) and 0.1 % (v / v) formic acid in 90% (v / v) LC-MS grade acetonitrile (solvent B; Fisher Scientific, Hampton, NH, USA) at a flow rate of 0.4 mL / min and column temperature of 40°C. The binary linear gradient with the following ratios of solvent B was used: 0-1 min, 1 %; 1-10 min, 1-10 %; 10-13 min, 10-30 %; 13-14.5 min, 30-70 %; 14.5-15.5 min, 70-99 %; 15.5-20 min, 99 %; 20-20 min, 99-1 %; 20- 25 min, 1 %. MS spectra were recorded using full scan in positive mode, covering a mass range from 100 to 1000 mass / charge ratio (m / z). The resolution was set to 140,000, and the maximum scan time was set to 200 ms. The transfer capillary temperature was set to 150°C, while the heater temperature was adjusted to 300°C. The spray voltage was fixed at 3 kV, with a capillary voltage and a skimmer voltage of 25 and 15 V, respectively. The identity of tyrosine and L-DOPA peaks were confirmed by comparing their accurate masses and retention times with those of the corresponding authentic standards. The quantification wasbased on the standard curves of tyrosine or L-DOPA generated by injecting different concentrations of authentic chemical standards.
[0298] For quantification of total betacyanins, 30 µL of the same resuspended samples used for the LC-MS analysis were transferred to individual wells of a 96 transparent plate, flat bottom, half well size (#675101, Greiner Bio-One, Kremsmunster, Austria) with five times serial dilutions. The absorbance at 538 nm was measured using a plate reader (Infinite 200 PRO, TECAN, Mannedorf, Switzerland), and multiple data points in the linear range were used to quantify total betacyanin content. These absorbance values were converted to betacyanin contents using the molar extinction coefficient 8 = 60,000 M’1cm’1.
[0299] References:
[0300] Buchi G, Fliri H, Shapiro R (1978) Synthesis of Betalains. J Org Chem 43: 4765-4769 Collier R, Thomson JG, Thilmony R (2018) A versitile and robust Agrobacterium-based gene stacking system generates high-quality transgenic Arabidopsis plants. Plant J, 95:573-583 DeLoache WC, Russ ZN, Narcross L, Gonzales AM, Martin VJJ, Dueber JE (2015) An enzyme- coupled biosensor enables (S)-reticuline production in yeast from glucose. Nat Chem Biol 11: 465-471
[0301] Deng Y-J, Duan A-Q, Liu H, Wang Y-H, Zhang R-R, Xu Z-S, Xiong A-S (2023) Generating colorful carrot germplasm through metabolic engineering of betalains pigments. Hortic Res 10: uhad024
[0302] Downham A, Collins P (2000) Colouring our foods in the last and next millennium. Int J of Food Sci Tech 35: 5-22
[0303] Engler C, Youles M, Gruetzner R, Ehnert T-M, Werner S, Jones JDG, Patron NJ, Marillonnet S (2014) A Golden Gate Modular Cloning Toolbox for Plants. ACS Synthetic Biology 3(11): 839-843
[0304] Gaertner VL, Goldman IL (2005) Pigment Distribution and Total Dissolved Solids of Selected Cycles of Table Beet from a Recurrent Selection Program for Increased Pigment. J Amer SocHort Sci 130: 424-433
[0305] Ge X, Wang P, Wang Y, Wei X, Chen Y, Li F (2023) Development of an eco-friendly pink cotton germplasm by engineering betalain biosynthesis pathway. Plant Biotechnol J 21: 674-676Grewal PS, Modavi C, Russ ZN, Harris NC, Dueber JE (2018) Bioproduction of a betalain color palette in Saccharomyces cerevisiae. Metab Eng 45: 180-188
[0306] Grützner R, Schubert R, Horn C, Yang C, Vogt T, Marillonnet S (2021) Engineering Betalain Biosynthesis in Tomato for High Level Betanin Production in Fruits. Front Plant Sci 12: 682443
[0307] He Y, Zhang T, Sun H, Zhan H, Zhao Y (2020) A reporter for noninvasively monitoring gene expression and plant transformation. Hortic Res 7: 152
[0308] Hilpert H, Dreiding A (1984) On the Total Synthesis of Betalains. Helv Chim Acta 67: 1547— 1561
[0309] Kanner J, Harel S, Granit R (2001) Betalains--a new class of dietary cationized antioxidants. J Agric Food Chem 49: 5178–5185
[0310] Khan MI, Giridhar P (2015) Plant betalains: Chemistry and biochemistry. Phytochemistry 117:
[0311] 267-295
[0312] Kobylewski S, Jacobson MF (2012) Toxicology of food dyes. Int J Occup Environ Health 18:
[0313] 220-246
[0314] Lee C-H, Wettasinghe M, Bolling BW, Ji L-L, Parkin KL (2005) Betalains, phase II enzymeinducing components from red beetroot (Beta vulgaris L.) extracts. Nutr Cancer 53: 91- 103
[0315] Schenck C. A. and Maeda H. A. (2017) Prephenate Dehydrogenases and Arogenate Dehydrogenases that Are Insensitive to Tyrosine Inhibition and Methods of Using the Same, US patent US9701917B2. Approved 2017
[0316] Schenck C. A. and Maeda H. A. (2021) Engineered prephenate dehydrogenases and arogenate dehydrogenases and methods of using the same. U. S. patent US11136559B2. Approved 2021
[0317] Polturak G, Grossman N, Vela-Corcia D, Dong Y, Nudel A, Pliner M, Levy M, Rogachev I, Aharoni A (2017) Engineered gray mold resistance, antioxidant capacity, and pigmentation in betalain-producing crops and ornamentals. Proc Natl Acad Sci USA 114: 9062-9067
[0318] Sawicki T, Bączek N, Wiczkowski W (2016) Betalain profile, content and antioxidant capacity of red beetroot dependent on the genotype and root part. Journal of Functional Foods 27: 249–261Schenck CA, Chen S, Siehl DL, Maeda HA (2015) Non-plastidic, tyrosine-insensitive prephenate dehydrogenases from legumes. Nat Chem Biol 11: 52–57
[0319] Schenck CA, Holland CK, Schneider MR, Men Y, Lee SG, Jez JM, Maeda HA (2017) Molecular basis of the evolution of alternative tyrosine biosynthetic routes in plants. Nat Chem Biol 13: 1029–1035
[0320] Skalicky M, Kubes J, Shokoofeh H, Tahjib-Ul-Arif M, Vachova P, Hejnak V (2020) Betacyanins and Betaxanthins in Cultivated Varieties of Beta vulgaris L. Compared to Weed Beets. Molecules 25: 5395
[0321] Tesoriere L, Allegra M, Gentile C, Livrea MA (2009) Betacyanins as phenol antioxidants.
[0322] Chemistry and mechanistic aspects of the lipoperoxyl radical-scavenging activity in solution and liposomes. Free Radic Res 43: 706-717
[0323] Wang M, Lopez-Nieves S, Goldman IL, Maeda HA (2017) Limited Tyrosine Utilization Explains Lower Betalain Contents in Yellow than in Red Table Beet Genotypes. J Agric Food Chem 65: 4305-4313
[0324] Wrolstad RE, Culver CA (2012) Alternatives to Those Artificial FD& C Food Colorants. Annual Review of Food Science and Technology 3: 59-77
[0325] Zhang L, Liu X, Li J, Meng Y, Zhao G-R (2023) Improvement of betanin biosynthesis in Saccharomyces cerevisiae by metabolic engineering. Synth Syst Biotechnol 8: 54-60 Zhang N, McHale LK, Finer JJ (2015) Isolation and characterization of “GmScream” promoters that regulate highly expressing soybean (Glycine max Merr.) genes. Plant Sci 241: 189— 198
[0326] Example 3:
[0327] Synthetic biology enables efficient production of valuable compounds in biological systems, including plants that capture atmospheric CO2 to synthesize and accumulate abundant and diverse specialized metabolites. Most plant synthetic biology studies to produce specialized metabolites have primarily used Nicotiana benthamiana as an underpinning metabolic chassis, due to its rapid agroinfiltration method, leaving much of the metabolic potential of other plant species underexplored. Here we engineered three distinct plant chassis — Arabidopsis, tobacco and soybean — by stably introducing an optimized betalain biosynthetic pathway and analyzed their metabolic impacts. Betalains are tyrosine-derived pigments, which are used as natural red and yellow food dyes with rapidly growing demand following a recent regulatory shift. We fine-tunedmetabolic balances by redesigning the RUBY betalain construct (RUBYv2), adding an extra DODA enzyme (“pull”) and modulating tyrosine precursor supply (“push”) using two different promoters. The “push-and-pull (push+pull)” lines produced higher betalain levels than the “pull” lines in all three species, even exceeding those of beet roots. While Arabidopsis and tobacco “push+pull” lines driven by a strong promoter showed severe growth defects, corresponding soybean lines did not show severe growth defects, suggesting greater tolerance of soybean to the engineered pathway. This study demonstrates that careful plant chassis selection, coupled with precise control of pathway expression, is important for maximizing the yield of target specialized metabolites, such as betalain pigments, without impairing overall plant growth.
[0328] Betalain pigments are tyrosine-derived specialized metabolites with yellow or red coloration and in plants are uniquely produced in members of the Caryophyllales order. In addition to their vivid hues, betalains exhibit potential health benefits including anticancer, antiinflammatory, or antidiabetic activities (Gandia-Herrero et al., 2016; Khan, 2016; Nirmal et al., 2024). Due to their high stability across a broad pH range, betalains are widely used as natural food colorants (Calva-Estrada et al., 2022; Carreon-Hidalgo et al., 2022; Martins et al., 2024). As of 2024, the global food dye market exceeds 4 billion USD (Towards FnB, 2025) and is largely dominated by petroleum-derived synthetic dyes. However, growing health and environmental concerns are accelerating the rapid shift towards safer, sustainable, natural alternatives. In January 2025, the U. S. Food and Drug Administration (FDA) banned the use of synthetic Red No. 3 in food and ingested drugs (U. S. FDA, 2025a), reflecting similar restrictions already in place across Europe and California. More recently, in April 2025, the FDA announced forthcoming regulations to phase out additional synthetic dyes, including Red No. 40, from the U. S. food industry (U. S. FDA, 2025b). Despite increasing demand, natural betalains are much more expensive than synthetic counterparts, such as Red No. 40, largely due to the limited yield currently available from natural sources like beets (Beta vulgaris, Novais et al., 2022; Thomsen et al., 2023). Furthermore, cultivation of major sources of betalains, such as beets, is seasonal and cannot provide year-round supply, necessitating reliance on beet cultivation in other countries to meet continuous demands (Akan et al., 2021). These challenges underscore the urgent need for a scalable and sustainable production method for betalains.
[0329] Synthetic biology enables engineering of biological systems through iterative “design-build-test-1 earn (DBTL)” cycles (Nielsen and Keasling, 2016; Pouvreau et al., 2018). Thisapproach offers alternative bio-based production methods for a wide array of plant specialized metabolites by accelerating the metabolic engineering processes. Plants are emerging as promising and sustainable hosts for chemical production using synthetic biology. Although still in early stages, plant synthetic biology offers distinct advantages over microbial platforms (Barnum et al., 2021; Wang and Demirer, 2023). Plants naturally synthesize and tolerate toxic compounds, possess complex pathways distributed across multiple cellular compartments, and have high storage capacities — especially in vacuoles that can occupy up to 90% of plant cells (Dünser et al., 2022; Xiao et al., 2025). In addition, plants grow by fixing atmospheric CO2 using sunlight energy and do not require costly fermentation infrastructure, reducing the need for external carbon inputs and operational costs. These advantages make plants an attractive platform for large-scale, sustainable production of valuable plant specialized metabolites.
[0330] Red beet roots, the primary commercial sources of betalains, typically accumulate 1.6 to 2.7 mg / g fresh weight (g FW) (10 to 17 mg / g dry weight (g DW)) of total betalains and 1.3 to 1.8 mg / g FW (8 to 14 mg / g DW) of betacyanins, the dominant red pigments (Sawicki et al., 2016). Betalain biosynthesis has been successfully reconstituted in multiple heterologous plant hosts. Polturak et al. (2017) generated stable pigment accumulation in Solanaceae crops — tomato, potato, and eggplant — with betacyanin levels of 0.065-0.12 mg / g FW in eggplant fruit and potato tuber and up to 0.25 mg / mL in tomato juice. The RUBY construct (He et al., 2020), which employs a polycistronic expression system, further simplified pathway engineering and enabled betalain pigmentation in multiple plant species, including carrot (0.94 mg / g DW, Deng et al., 2023) and Nicotiana benthamiana leaves (up to 1.03 mg / g FW, Pramanik et al., 2024). To enhance the yield of betalains, subsequent strategies introduced the deregulated arogenate dehydrogenase from beets (BvTyrAa, Lopez-Nieves et al., 2018) to “push” tyrosine precursor supply together with expressing betalain genes. This approach enabled tomato fruit to accumulate over 1.0 mg / g FW (Grützner et al., 2021) and N. benthamiana leaves up to 0.86 mg / g FW (Timoneda et al., 2018) of betalains, representing 15- and 7-fold increase, respectively, compared to lines lacking BvTyrAa expression. More recently, the QRUBY construct expressing four genes (i.e., BvTyrAa, CYP76AD1, DODA, 5GT) polycistronically enabled generating betalain-producing rice endosperm up to 0.308 mg / g DW (Tan et al., 2025) and maize kernel up to 11.40 mg / g DW (Xue et al., 2025). Jung and Maeda (2024) further demonstrated that debottlenecking the DODA step, when combined with the enhanced tyrosine precursor supply, substantially increases betacyaninyields, reaching up to 2.87 mg / g FW in N. benthamiana leaves, surpassing levels typically found in beet roots.
[0331] One of the major challenges of plant synthetic biology stems from the high complexity of biosynthetic pathways (Sweetlove and Fernie, 2013; Yang and Reyna-Llorens, 2023). To reconstitute this complexity in heterologous plant hosts, fine-tuning the expression level of target genes is crucial to balance metabolic flux within the pathway and thus help increasing final yields (Rizzo et al., 2023; Wang and Demirer, 2023). Yet, most plant synthetic biology studies, including the aforementioned betalain production, have relied on repetitive uses of a small set of “strong constitutive” promoters, rather than employing promoters with diverse strengths of expression as are observed in native plants. In addition, repeated use of identical promoters can increase the risk of recombination (Grützner et al., 2021; Golubova et al., 2024). Therefore, choosing appropriate promoters is essential to accurately regulate target genes in heterologous plant hosts.
[0332] Selecting an appropriate plant chassis is also critical for optimizing heterologous compound production through synthetic biology, given the vast metabolic diversity that exists among plant species (Owen et al., 2017; Maeda, 2019). Although primary metabolism is generally well conserved across plant lineages, certain variations exist and can affect precursor availability (Maeda, 2019). For example, legumes possess an additional cytosolic tyrosine biosynthetic pathway beyond the canonical plastidial route, which may enhance the production of tyrosinederived compounds including betalains (Schenck et al., 2015; Schenck et al., 2017). However, most plant synthetic biology studies have relied on N. benthamiana, largely due to the ease of the Agrobacterium-mediated transient expression system, not necessarily because N. benthamiana has been validated as the most suitable production host. Chassis choice, however, must be treated as a core design parameter. Transformation ease alone does not ensure efficient metabolite production if the endogenous metabolism of heterologous host cannot support engineered pathways. Therefore, evaluating species-specific precursor pools or metabolic tolerance can help identify hosts more capable of stable, high-level metabolite accumulation. Expanding plant synthetic biology beyond N. benthamiana to include diverse, stably transformable crops is essential for leveraging host-specific metabolic advantages and achieving scalable biosynthesis of valuable target compounds.
[0333] To address these limitations of plant synthetic biology, in terms of chassis selection and fine-tuning a synthetic pathway and its expression, here, we engineered three distinct plantchassis — Arabidopsis, tobacco and soybean — by stably transforming them with a series of DNA constructs. We aimed to enhance betalain production by combining increased supply of tyrosine precursor (“push”) with a debottlenecking DODA step (“pull”). Relative to the “pull” lines across all three species, the “push+pull” lines exhibited substantially higher betacyanins levels, which surpassed the concentration of betacyanins typically accumulated in red beet roots. While these results were compelling, the Arabidopsis and tobacco “push+pull” lines showed severe growth defects, likely due to elevated accumulation of tyrosine and the intermediate L-DOPA. Remarkably, however, soybean “push+pull” lines still maintained robust growth despite similarly high metabolite levels. These findings suggest that soybean, relative to Arabidopsis and tobacco, is more tolerant to integration and engineering of a tyrosine-derived specialized metabolite synthesis pathway, highlighting its potential as a robust and scalable chassis for betalain production. Furthermore, we demonstrated the importance of promoter choice for fine-tuning “push” expression for maintaining high pigment production while concurrently mitigating growth defects. Our results underscore both the importance of plant chassis selection as well as the need for precise regulation of transgene expression in synthetic biology efforts aimed at optimizing heterologous production of valuable plant specialized metabolites.
[0334] RESULTS
[0335] The initial “push / pull” construct failed to generate stable tobacco and soybean transgenic lines.
[0336] To test whether the “push-and-pull” strategy enhances betalain production in heterologous plant hosts (Fig. 16A), four initial constructs were generated to express either i) an empty vector (EV), ii) enhanced tyrosine production through overexpression of BvTyrAa (“push”), iii) three betalain genes (“pull”), or iv) BvTyrAa and three betalain genes (“push / pull”) (Fig. 17A, Jung and Maeda, 2024). Because the metabolic bottleneck in the betalain pathway had not yet been identified, our initial design used the constitutive promoters available at that time, without tailoring expression levels of individual genes. Tobacco and soybean, among the three species, were initially used for stable transformation, as betalain pigmentation could be visually detected during the early stages of tissue culture (e.g., callus and shoot regeneration, or emerging meristematic tissues and early shoots). Transgenic To tobacco lines were successfully generated from the EV, push, and pull constructs; however, no stable transgenic lines were obtained with the push / pull construct (Fig.
[0337] 17B). Similarly, in soybean, while multiple stable To lines were generated for EV, push, and pullconstructs, no push / pull lines were obtained. Sequencing confirmed that there was no recombination or errors within the binary vector constructs. Given the consistent failure in both tobacco and soybean, these constructs were not tested in Arabidopsis.
[0338] To investigate the underlying cause of the unsuccessful outcome, these constructs were transiently expressed in N. benthamiana and a series of experiments were carried out, as we reported earlier (Jung and Maeda, 2024). The “push / pull” constructs showed limited conversion from L-DOPA to betalains, resulting in hyperaccumulation of L-DOPA. The highest betalain production was achieved when the / ? DBF“puH” construct (He et al., 2020) was co-expressed with the “push” and an additional copy of the DODA gene (Jung and Maeda, 2024). These results suggest that an imbalance between “push” and “pull” engineering leads to excess L-DOPA and / or its derivatives, which likely interfered with successful generation of stable transgenic lines.
[0339] New betalain constructs to balance push and pull for optimized betalain production
[0340] To further alleviate the bottleneck step catalyzed by the DODA enzyme, a new RUBYv2 construct was designed by rearranging the betalain biosynthetic genes to place DODA upstream of the other two betalain genes (Fig. 16B). This design leverages the assumed higher translational efficiency and expression level of the first gene in polycistronic expression systems (de Felipe et al., 2006; Jiao et al., 2018). Additionally, an extra DODA transcriptional unit was included in the new “pull” construct (Fig. 16B). To prevent possible recombination between two identical sequences, we used a BvDODA transcriptional unit with a distinct DNA sequence from the codon-optimized DODA in the RUBY construct, encoding the same DODA protein.
[0341] We also inserted the potato ST-LS1 intron sequence containing an in-frame premature stop codon (Eckes et al., 1986; Vancanneyt et al., 1990; Brophy et al., 2022) in the BvTyrAa coding sequence of the new “push” and “push+pull” constructs (Fig. 16B). This is to allow expression of functional BvTyrAa only in planta, as our prior work suggested that leaky BvTyrAa transgene expression in Agrobacterium might compromise the bacterial viability and transformation efficiency (Jung and Maeda, 2024). Additionally, BvTyrAa was expressed under two different promoters to find optimal levels of the “push” effect. The PAtLHB1B1 promoter from Arabidopsis light-harvesting chlorophyll-protein complex II subunit B 1 (AT2G34430) (Engler et al., 2014) was used to express BvTyrAa ^PAtLHB1B1-^U^' at high levels and in same photosynthetic tissues with the new “pull” construct where two rubisco promoters (i.e., PAtRbcSi and PsiRbcS?) were used to express RUBYv2 and BvDODA. We also used a weak constitutive PCL1 promoter from ArabidopsisNADH dehydrogenase ubiquinone 1 beta subcomplex subunit (AT1G76200) for expressing BvTyrAa (“ z. / -push”) (Zhou et al., 2023) (Fig. 16B). Accordingly, two new “push+pull” constructs were generated (i.e., ‘774iZ / B7B7-push+pull” and “EcL7-push+puH”), each expressing BvTyrAa, RUBYv2, and an additional BvDODA (Fig. 16).
[0342] The functionality of the newly generated constructs was first tested by transiently expressing them in N. benthamiana leaves. No visible pigmentation was observed in leaves expressing EV, PAtLHB1B1-push, or M / . -push constructs as expected. In contrast, strong pigmentation was observed in pull-, PAtLHB1B1-push+pull-, or PCL1-push+pull-expressing leaves (Fig. 16C). The infiltration spots were harvested at 3 days-post-infiltration (dpi) and subjected to metabolite profiling using liquid chromatography-mass spectrometry (LC-MS). The levels of tyrosine were the highest in PAtLHB1B1-push expressing leaves, followed by PCL1-push, reflecting the different expression levels between these two promoters (Fig. 16D). In the push+pull-expressing leaves, tyrosine levels were slightly or significantly lower than in their corresponding push-only lines, suggesting that tyrosine was utilized for the downstream betalain pathway (Fig.
[0343] 16D) L-DOPA levels in these push+pull-expressing leaves were detected at much lower levels than in those expressing the previous push / pull construct (Fig. 17A, Jung and Maeda, 2024), indicating enhanced efficiency in converting L-DOPA to betalains in the new pull construct by rearranging the order in the RUBYv2 and adding an additional DODA transcriptional unit (Fig.
[0344] 16D). When the betacyanins content was quantified using a spectrophotometer, betacyanin levels in PCL1-push+pull-expressing leaves were slightly lower than in pull expressing leaves. The highest betacyanin levels were achieved in the PAtLHB1B1-push+pull-expressing leaves, up to 4.54 mg / g FW, even exceeding betacyanin production in beet roots / hypocotyls (1.29 to 1.84 mg / g FW; Sawicki et al., 2016) (Fig. 16D). These results validated that these new “push+pull” constructs produced high levels of betacyanins, without substantial accumulation of L-DOPA in N. benthamiana leaves.
[0345] Tobacco To lines with the Pczr-push+pull construct showed high betacyanin levels without a plant growth penalty.
[0346] To evaluate whether the modified betalain constructs could be used to generate stable transgenic plants, Agrobacterium-mediated stable transformation was performed in tobacco (Nicotiana tabacum L. cv. “Petit Havana” SRI). In contrast to earlier results (Fig. 17B), stable To lines were successfully obtained for all constructs (i.e., EV, / <l7 / 7 / / / / / / / -push, Pcz -push, pull, PAtLHB1B1-push+pull, and PCL1-push+pull) (Fig. 18A). Betalain pigmentation was visible in stems, leaves, roots, and flowers of the tobacco lines expressing pull, PAtLHB1B1 -push+pull, and PCLI -push+pull constructs, with pigments primarily localized in the central vacuoles of mesophyll cells. Both push+pull constructs enhanced pigmentation intensity relative to the pull construct (Fig. 18A), indicating that increased precursor supply boosts betalain production with the new betalain construct in tobacco. Transgenic lines expressing the P / if7J7B7B7-push construct exhibited severely stunted growth and curled leaves; however, these growth defects were partially alleviated in / + ( / . / / / / / / / / -push-pull lines, showing improved growth, larger leaves, and strong betalain pigmentation despite residual dwarfism (Fig. 18A). Lines expressing Pci. / -push construct showed a milder growth penalty than the / Tv / m / v-push construct, including slightly reduced height and a reticulate leaf pattern. The 777. / -push+pull lines exhibited no observable growth defects despite their strong pigmentations (Fig. 18A). These results revealed that modulating BvTyrAa “push” expression through promoter selection can influence the severity of growth penalties, which can be further mitigated by expressing the pull construct that redirects the accumulated tyrosine toward betalain biosynthesis.
[0347] To assess metabolic changes in these transgenic tobacco lines, leaf tissues were harvested six weeks after transplanting from rooting media to soil, and metabolites were extracted from the harvested tissues. Both push+pull lines showed elevated betacyanin accumulation, reaching up to 7.31 mg / g FW in the PAtLHB1B1 -push+pull line and 4.38 mg / g FW in the PCLI -push+pull line, exceeding betacyanin levels typically found in beet roots / hypocotyls (Fig. 18B). Tyrosine levels were significantly higher in both push and push+pull constructs compared to the EV control (Fig.
[0348] 18B), consistent with the results from transient expression assays (Figure 16D). Between the two push+pull lines, cz -push+pull exhibited significantly lower tyrosine levels than the PAUHBIBI- push+pull. Likewise, L-DOPA levels were significantly lower in the cT.i-push+pull lines compared to the PAtLHB1B1 -push+pull lines (Fig. 18B). These differences in tyrosine and / or L-DOPA may explain the growth defect observed only in the / T / / .™'«'-push+pull lines, not in PCLI-push+pull lines, as their high accumulation may be detrimental to the plant (Soares et al., 2014; Schenck and Maeda, 2018; de Oliveira et al., 2019).
[0349] Tyramine is a decarboxylated derivative of tyrosine. Tyramine levels were significantly increased in both push and push+pull lines compared to the EV control and were significantly reduced in push+pull lines relative to push-only lines, suggesting that excess tyrosine issuccessfully directed toward betalain production rather than toward tyramine biosynthesis when the betalain gene expression is carefully controlled. The levels of dopamine, a decarboxylated L-DOPA, were the highest in / N / m / .o / -push+pull followed by / V / -push+pull but overall remained much lower than tyramine. Further untargeted metabolomics analysis predicted that tyrosine derivatives such as homogentisate (HGA), an intermediate of the tyrosine-degradation pathway, as well as some phenylpropanoids (e.g., -coumarate) were decreased, while L-DOPA-derived compounds (e.g., norepinephrine) were likely elevated in push+pull lines compared to push lines.
[0350] RT-qPCR analysis of the same leaf samples showed that transcript levels of the betalain pathway genes were similar between the pull and push+pull lines, yet the push+pull lines accumulated substantially higher levels of betalains. This indicates that increased precursor availability, rather than differences in betalain gene expression, drives the elevated pigment production in the push+pull lines. Furthermore, BvTyrAa transcripts were detected only in lines expressing push or push+pull constructs as expected, with PAtLHB1B1 -driven lines exhibiting higher transcript abundance than their P -driven counterparts, consistent with the expected difference in promoter strength. Taken together, these results demonstrate that enhanced precursor availability contributes to the efficient production of betalains in the push+pull lines.
[0351] Transgenic T0 soybean lines showed higher tolerance than tobacco against elevated tyrosine and L-DOPA levels
[0352] To evaluate metabolic impacts of expressing the modified constructs across different plant species, the same set of constructs was also introduced into soybean (Glycine max), which has an additional cytosolic tyrosine biosynthetic pathway (Schenck et al., 2015; Schenck et al., 2017). As in tobacco, stronger pigmentation was observed in both soybean PAEEBIBI- andPCL1-push+pull lines compared to the pull lines (Fig. 19A). Both push lines exhibited slightly stunted growth, which became more pronounced at the later developmental stages. Notably, unlike tobacco, none of the push+pull lines showed severe growth penalties, even in the PAEEBIBI -push+pull soybean To lines (Fig. 19A). Both push+pull soybean To lines were able to finish their life cycle, although they showed reduced seed yields (Fig.23).
[0353] Betacyanin accumulation was also slightly or significantly higher in both “push+pull” lines relative to the “pull” lines, consistent with the visual phenotype. The highest betacyanin level was 1.28 mg / g FW in a PAEEBIBI -push+pull line, comparable to levels in beet roots / hypocotyls (Fig.
[0354] 19B). Both push and push+pull lines accumulated significantly increased tyrosine levels comparedto its wildtype, Williams 82 (Wm82). The highest L-DOPA levels were observed in PAtLHB1B1-push+pull, followed by Pm-push+pull lines, with levels reaching up to 2,232 nmol / g FW (440 pg / g FW) in a / <ii / . / ra / / / / -push+pull. substantially exceeding those observed in transgenic tobacco (Fig. 19B). Similar to the results shown in tobacco To lines, untargeted metabolite analysis showed that tyrosine, tyrosine-derived compounds, and phenylpropanoids were down-regulated, whereas L-DOPA and its derivatives were up-regulated in push+pull lines compared to push-only lines. Given that these soybean push+pull lines exhibited high L-DOPA and betacyanin levels without a severe growth penalty, soybean may possess greater tolerance to L-DOPA and its derivatives and thus could serve as a platform with greater flexibility with a wider dynamic range for betalain production than might be possible in tobacco.
[0355] RT-qPCR revealed higher BvTyrAa expression in the PAtLHB1B1 -push or PAtLHB1B1 -push+pull lines than in their / V / . / -driven counterparts as expected. Betalain biosynthetic gene expression did not significantly differ between push+pull or pull constructs in soybean, consistent with the results observed in tobacco. We then selected To lines with a single-copy insertion, analyzed by digital PCR (Collier et al., 2017), and harvested their seeds for further propagation. While both push-only lines produced almost no seeds (Fig. 23), the push+pull lines produced substantial numbers of seeds (average of 123 and 249 for PCL1- and PAiLHB1B1-push+pull lines, respectively), though they remained lower than those of EV or pull lines (average of 290 or 337 seeds per plant respectively, Fig. 23). These results suggest that redirecting the accumulated tyrosine towards betalain production by expressing the pull construct can mitigate compromised seed yields in soybean push lines.
[0356] Betalain-producing Arabidopsis lines exhibited severe growth defects, did not produce seeds, or failed to germinate.
[0357] The new constructs (Fig. 16B) were also introduced into Arabidopsis to further evaluate crossspecies transformability of the betalain pathway engineering. Ti seeds were collected following floral dipping and only RFP marker-positive Ti seeds were selected for germination. Both push lines showed typical tyrosine-hyperaccumulating phenotypes (e.g., dwarf plants with reticulate leaves, de Oliveira et al., 2019), whereas Ti pull lines exhibited betalain pigmentation without any noticeable growth defects. Notably, much fewer RFP-positive push+pull lines were obtained than with other constructs, which showed severe growth defects, except one PCLI -push+pull line that grew normally. However, none of the T2 seeds harvested from this m -push+pull line germinated.These results showed that Arabidopsis lines expressing the push+pull constructs exhibit severe growth defects, sterility, or compromised seed viability, suggesting that Arabidopsis may not be a suitable plant host for betalain production.
[0358] Strong pigmentation in push+pull lines is heritable in tobacco Ti generation
[0359] To determine whether betalain production is heritable in tobacco, Ti seeds harvested from To plants were assessed for segregation using seed-specific RFP signals. Only Ti lines showing a 3:1 ratio of RFP+: RFP- were classified as single-copy insertions and selected for germination. Because PAILHB IB 7 -push+pull To lines exhibited growth defects, Ti seeds were available from only two iv. TO / / < / -push-pull lines and were germinated without copy number selection. Consistent with the previous generation, both push+pull lines exhibited stronger pigmentation than pull lines in the Ti generation, and E.4tzjffi7B7-push+pull Ti plants continued to display delayed development and smaller size compared to EV, with severity increased as the plants matured (Fig.20A). In contrast, PCLI -push+pull lines of tobacco successfully germinated, unlike in the corresponding Arabidopsis lines, and exhibited only slightly delayed development relative to EV while overall maintaining a normal growth phenotype with high betalain pigmentation in all tissues (Fig. 20A, B). Total betacyanin levels were higher in both push+pull lines compared to pull-only lines (Fig. 20C).
[0360] Targeted metabolite analysis further revealed elevated levels of tyrosine and L-DOPA in PA(LHBIBI-push+pull lines compared to PCL1-push+pull lines (Fig.20C). These results suggest that promoter choice can impact the levels of precursor, intermediates, and their derivatives as well as host growth outcome.
[0361] Soybean Ti lines maintain high betalain levels by redirecting metabolic flux towards the tyrosine-derived pathway with minimal growth penalty.
[0362] To evaluate the heritability of soybean transgenics, Ti seeds derived from single-copy To lines were germinated, and digital PCR (Collier et al., 2017) was used to determine their zygosity. In the Ti pull lines, homozygous individuals exhibited stronger pigmentation in the hypocotyls at early germination compared to hemizygous lines (Fig. 24A). However, as the plants developed, pigmentation in homozygous pull lines gradually faded, resulting in a patchy pigmentation phenotype in the leaves, which was not observed in hemizygous lines(Fig. 24B). This contrast became more pronounced at maturity, with homozygous pull lines displaying a near wild-type phenotype with green leaves and pods, whereas hemizygous lines retained betalain pigmentation throughout vegetative and reproductive tissues(Fig. 24C). This may be attributed to ribosomestalling and No-Go RNA Decay due to the three-consecutive-histidine motif within the 5GT coding sequence (Kramer et al., 2025).
[0363] Unlike in tobacco transgenics,. PCL1-push+pull lines mostly failed to germinate, except for two individuals. Conversely, all / <i< / .™ / / n-push+pull lines germinated but they were hemizygous, implicating that homozygosity of the rtHBYBr-push+pull transgene appears to impede germination. The hemizygous 7NrL / rs / B / -push+pull lines exhibited stronger pigmentation than the hemizygous pull lines without showing severe growth defects as seen in tobacco, except for slight reduced seed yields and thinner leaves (Fig.21A).
[0364] Consistent with their visual phenotype, PAiLHB1B1-push+pull lines accumulated the highest betacyanin levels, followed by the cz -push+pull lines and pull-only lines (Fig. 21B). Targeted metabolite analysis further revealed elevated tyrosine and tyrosine-derived metabolites such as HGA, as well as increased levels of L-DOPA and its derivatives (e g., dopamine) in PAtLHB1B1- push+pull lines. Conversely, phenylalanine and phenylpropanoids (e.g., / ?-coumarate) were reduced in T’.4zz, / / B7B7-push+pull lines, suggesting a redirection of metabolic flux toward tyrosinederived pathways in these lines (Fig. 25). Although such imbalances often lead to detrimental growth effects in other plant species (de Oliveira et al., 2019) including tobacco (Fig. 20A), soybean / <.™ / / ; / -push-pull lines largely tolerated these metabolic shifts while producing high levels of betalains (Fig.21 A).
[0365] DISCUSSION
[0366] Betalain production can be scaled up using stable transgenic lines
[0367] Betalains are tyrosine-derived pigments, which are unique to the Caryophyllales in plants, and include chromogens which are either yellow (betaxanthins) or red-violet (betacyanins). They are widely used as natural food colorants due to their high pH stability (Calva-Estrada et al., 2022; Carreon-Hidalgo et al., 2022; Martins et al., 2024). Although the global food dye market remains dominated by petroleum-derived synthetic dyes, a combination of growing health and environmental concerns and increasing regulatory pressure is rapidly accelerating the shift toward natural alternatives. For example, the U. S. FDA recently banned Red No. 3 and announced forthcoming restrictions on additional dyes, including Red No. 40, prompting industry-wide reformulation (U. S. FDA, 2025a; 2025b). However, natural betalains remain costly because beetroot, the primary commercial source, provides limited and highly seasonal yields (Akan et al., 2021; Novais et al., 2022; Thomsen et al., 2023). These constraints highlight the need for scalable,year-round, and economically viable plant-based production platforms for betalains. Betalain pathways have been successfully reconstructed using synthetic biology approaches in several plant species. Early stable transgenic work in Solanaceae generated modest pigment levels, 0.065-0.12 mg / g FW in eggplant, potato, and up to 0.248 mg / mL in tomato juice (Polturak et al., 2017). The polycistronic RUBY system (He et al., 2020) simplified pathway assembly and expanded betalain production to carrot (0.94 mg / g DW; Deng et al., 2023) and N. benthamiana (-1.03 mg / g FW; Pramanik et al., 2024). Flux enhancement using deregulated BvTyrAa increased betalain yields to >1.0 mg / g FW in tomato fruit (Grützner et al., 2021) and -0.86 mg / g FW in N. benthamiana (Timoneda et al., 2018). Further debottlenecking of the DODA step elevated N. benthamiana betacyanin yields to 2.87 mg / g FW (Jung and Maeda, 2024), exceeding levels typically observed to accumulate in beet storage roots.
[0368] In this study, we advance betalain engineering by demonstrating that stable transgenic expression can drive whole-plant, high-yield betalain production across three plant species — Arabidopsis, tobacco, and soybean. By combining the rearranged RUBY construct with an extra DODA enzyme (“pull”) and enhancing tyrosine precursor supply through BvTyrAa (“push”) and fine-tuning promoter strength (Fig. 16B), we achieved pigment levels that match or even exceed previous stable and transient systems. In tobacco, PAtLHB1B1-d ven push+pull lines accumulated up to 7.31 mg / g FW (Fig. 18B), surpassing beetroot pigmentation (1.29 to 1.84 mg / g FW of betacyanins; Sawicki et al., 2016) and exceeding the highest previous betacyanin levels in N. benthamiana (2.87 mg / g FW; Jung and Maeda, 2024). Using the weaker Pen promoter maintained high yields (up to 4.38 mg / g FW) while mitigating growth defects (Fig. 18), underscoring the importance of balanced expression for sustained production.
[0369] Soybean push+pull lines produced up to 1.28 (To) and 1.56 (Ti) mg / g FW betacyanins in leaves and displayed strong pigment accumulation across different tissues, while maintaining robust growth and producing T₁ progeny with stable pigmentation (Fig. 19). Beyond yield, the pigment profiles of stable tobacco and soybean lines revealed two betacyanin peaks (i.e., betanin and isobetanin) (Sawicki et al., 2016; Xue et al., 2025), which are also two major betalain species accumulated in beetroot, though our transgenics showed a higher proportion of betanin relative to isobetanin than beetroot. Recent studies demonstrated that an expanded QRUBY construct expressing CYP76AD1, DODA, 5GT and BvTyrAa enabled stable betalain accumulation in cereals, producing 0.308 mg / g DW in rice endosperm (Tan et al., 2025) and 6.88 mg / g DW and11.40 mg / g DW in maize kernels, depending on their background cultivar (Xue et al., 2025). These studies reinforce that supplying additional tyrosine precursor is essential for achieving high betalain accumulation in stable crops. Together with our results, this highlights that balancing precursor flux, rather than simply maximizing precursor levels, is essential to achieve high pigment accumulation. Our findings establish a framework for scaling betalain production through stable transgenic plants, offering a sustainable platform that addresses the global need for safe, natural alternatives to synthetic food dyes.
[0370] Transgene silencing and potential cytotoxicity hamper engineering efforts in homozygous transgenic lines
[0371] Engineering metabolic pathways using multi gene constructs in plants often encounters two major limitations: post-transcriptional transgene silencing (PTGS) and metabolic cytotoxicity. Recent work on the RUBY system demonstrated that an unusual three-consecutive-histidine motif within the 5GT coding sequence can cause ribosome stalling and activate No-Go RNA Decay, generating aberrant RNA fragments that feed into siRNA biogenesis and trigger PTGS (Kramer et al., 2025). In our study, the homozygous soybean “pull” lines behaved consistently with this mechanism: they produced strong betalain pigmentation during early germination but gradually lost pigmentation during vegetative development, ultimately showing patchy or nearly pigment-free leaves at maturity, whereas their hemizygous siblings maintained stable pigmentation throughout(Fig.24).
[0372] This progressive loss of pigment in homozygous “pull” soybean lines closely resembles the “Red-to-Green” phenotype described by Kramer et al. (2025), in which RUBY expression diminishes due to PTGS. Because soybean “pull” lines did not accumulate elevated levels of tyrosine or L-DOPA (Fig. 21B), their pigment decline is unlikely to reflect metabolic toxicity and instead is consistent with PTGS becoming more problematic as transgene dosage increases. To mitigate this issue, future construct designs should replace the cDOPA5GT enzyme with homologs from other betalain-producing species that lack the three-histidine motif, which may help reduce ribosome stalling and improve pigment stability across developmental stages.
[0373] In contrast to the absence of red “pull” homozygous lines, the inability to recover homozygous soybean “push+pull” lines is likely attributed to metabolic cytotoxicity, which occurs when precursors or intermediates accumulate to levels that impose a metabolic burden on plant hosts. Soybean displayed greater tolerance to elevated tyrosine and L-DOPA than tobacco or Arabidopsis, yet even in soybean, all recovered push+pull Ti plants were hemizygous, andhomozygous individuals could not be recovered. Their failure to germinate or survive past early seedling stages, even before visible pigmentation or strong transgene expression had occurred, suggests that embryo- or germination-stage lethality likely resulted from precursor / intermediate cytotoxicity rather than silencing. Although we cannot pinpoint which metabolite is responsible, this is consistent with our earlier push / pull construct (Fig. 17; Jung and Maeda, 2024), which also failed to generate stable lines when DODA activity was insufficient to metabolize L-DOPA. High L-DOPA levels are known to be deleterious because L-DOPA acts as an allelochemical and can impair plant viability and seed germination (Soares et al., 2014). Previous studies have similarly shown that even small perturbations in metabolic flux can cause unexpected physiological consequences. For instance, thiamine pathway engineering in Arabidopsis caused developmental abnormalities linked to toxic pyrimidine byproducts (Strobbe et al., 2021), while altering steroidal glycoalkaloid biosynthesis in tomato resulted in cholesterol overaccumulation and impaired development (Jozwiak et al., 2024). These findings highlight that metabolic flux must be carefully balanced when engineering plants to prevent cytotoxicity and enable stable, heritable production of target metabolites.
[0374] Although hemizygous “pull” and “push+pull” soybean lines in this study maintained strong pigment production even in their Ti generation (Fig. 21), obtaining homozygous lines would be desirable to eliminate segregation in future generations. Towards this next goal of achieving homozygous lines without negative pleiotropic effects, several strategies could be implemented. One approach is to use weaker, tissue-specific promoters (Zhang et al., 2015), or to delay “push” expression to later developmental stages by using developmentally regulated promoters (e.g., senescence-specific promoters; Gan and Amasino, 1995). Enhancing “pull” capacity by using more active or compartmentalized DODA enzymes may also help prevent lethal early-stage accumulation of L-DOPA. Additionally, compartmentalizing toxic intermediates, by targeting pathway enzymes and products to vacuoles, plastids, or synthetic storage structures, could further reduce potential toxicity of intermediates (Zhao et al., 2018). Therefore, in the future, additional efforts such as promoter tuning, terminator choice (Diamos and Mason, 2018), enzyme choice, and intracellular compartmentalization can be implemented to achieve homozygous lines with high pigment yield.
[0375] Promoter selection mitigates growth penalty while maintaining betalain productionPromoter choice plays a central role in shaping both metabolic flux and physiological tolerance in engineered plants (Huang et al., 2021; Jores et al., 2021; Yaschenko et al., 2022), particularly for pathways in which precursor imbalance or intermediate accumulation can impose substantial fitness costs. Despite this, most plant synthetic biology studies still rely on a narrow set of strong constitutive promoters, which maximizes expression but restricts fine control and increases the likelihood of recombination between repeated promoter sequences (Belcher et al., 2020; Zhou et al., 2023; Golubova et al., 2024). In this study, we systematically evaluated the impact of promoter strength on betalain production by expressing BvTyrAa under two promoters with distinct strengths, PAtLHB1B1 and PC I, to modulate tyrosine precursor supply across multiple plant species (Fig. 16B)
[0376] The PAtLHB1B1 promoter consistently drove higher tyrosine accumulation and stronger pigmentation than the PCL1 promoter, reflecting the higher expression level driven by PAUHBIBI, but these elevated “push” activities also resulted in more severe detrimental effects, especially in tobacco (Fig. 18A). This effect became even more pronounced when combined with the “pull” module: jit / ffi / 5 / -push+pull lines accumulated high betalain levels but exhibited severe growth defects, including stunting, delayed development, and failure to complete life cycles in Arabidopsis and tobacco (Fig. 18A). By contrast, T’cz -push+pull lines in all three species produced robust pigmentation while maintaining substantially healthier growth than their PAtLHB1B1 counterparts. These outcomes demonstrate that promoter strength directly influences the balance between pathway productivity and plant fitness, reinforcing that fine-tuning metabolic balance through controlled expression is essential to prevent precursor overload, toxic intermediate accumulation, and the physiological penalties associated with imbalanced metabolic flux.
[0377] Importantly, our results also underscore that promoter selection must consider not only promoter strength but also spatiotemporal expression patterns. Although / f v. / -push l pull lines of Arabidopsis and tobacco exhibited milder growth defects and successfully produced seeds, unlike their PAtLHB1B1 -driven counterparts (Fig. 18A), none of the CZJ -push+pull seeds germinated in the next generation in Arabidopsis and soybean (Fig. 22). This likely reflects unintended high expression of PCLI in germinating seeds, especially in the early stages of germination (Klepikova et al., 2016), which may have increased tyrosine levels during embryogenesis or early germination, ultimately impairing seed viability. Thus, even promoters with desirable average strength mayimpose unintended developmental bottlenecks if their activity is not spatially and developmentally restricted.
[0378] These results highlight that promoter choice should be treated as a core design decision during the Design phase of the DBTL cycle of plant synthetic biology. Recent technological advances including constitutive promoter libraries with graded strengths (Zhou et al., 2023), synthetic promoters with tunable output (Cai et al., 2023), transcriptional repression toolkits (Markel et al., 2024), and synthetic regulatory circuits enabling spatial patterning or logic-based control (Brophy et al., 2022) offer powerful opportunities to regulate biosynthetic gene expression more precisely. Given the intricate spatial and temporal complexity of plant specialized metabolism (Sweetlove and Fernie, 2013), integrating such regulatory tools into pathway engineering will enable more balanced flux distribution, reduced metabolic burden, and enhanced stability and scalability of target compound production in plants. Overall, our findings demonstrate that strategic promoter selection is essential for maximizing betalain yields while minimizing unintended growth defects.
[0379] Species-dependent differences in metabolic tolerance against synthetic engineered pathways underscore the importance of chassis selection
[0380] Different species vary widely in their background metabolism (e.g., precursor availability) and their responses to the introduction of an engineered pathway. Although primary metabolism is largely conserved across plant lineages, species-specific differences in precursor biosynthesis, feedback regulation, and metabolic compartmentalization can influence heterologous metabolite production (Maeda, 2019; Maeda and Fernie, 2021; Selma et al., 2023). Consistent with this notion, the cross-species comparison in this study revealed substantial variations in tolerance to the engineered betalain pathway (Fig. 22). Arabidopsis exhibited the lowest tolerance, showing severe dwarfism, sterility, or germination failure in “push+pull” lines. Tobacco displayed moderate tolerance, supporting high betalain production in To push+pull lines, yet experiencing promoter-dependent growth defects, particularly under strong PAtLHB1B1-driven “push+pull” expression (Fig. 18). In contrast, soybean demonstrated the highest tolerance among three plant species tested to the introduced betalain pathway (Fig. 22). Soybean push+pull lines accumulated high levels of tyrosine, L-DOPA, and downstream derivatives, yet maintained robust vegetative growth, completed life cycles, and produced viable hemizygous T₁ progeny with strong pigmentation (Fig. 19 and 21).This elevated tolerance in soybean may derive from its dual-tyrosine biosynthetic pathways, which include both the canonical plastidial route and a cytosolic pathway with a feedback-insensitive TyrA prephenate dehydrogenase (Schenck et al., 2015; Schenck et al., 2017). This unique pathway configuration likely enhances tolerance to elevated levels of precursor, intermediates, and their derivatives. Similar species-dependent effects have been observed in other engineered pathways, such as vanillin production, where rice and pepper differ in ferulic acid precursor availability and tolerance (Chee et al., 2017; Arya et al., 2022). Together, these observations demonstrate that inherent metabolism strongly influences the performance of introduced pathways across plant species.
[0381] These results emphasize that chassis selection must be viewed as a critical design parameter; just because a plant is amenable to an easier form of plant transformation (floral dipping for Arabidopsis, Agro-infiltration of leaves for N. benthamiana and N. tabacum) does not help achieve ultimate goals of efficient chemical production if the underpinning molecular physiology within these plants does not support the experimental approach. Early screening of candidate species for precursor pool size and unique endogenous primary metabolism can help identify hosts with greater intrinsic metabolic tolerance, thereby reducing the risk of developmental defects and improving production stability. Ultimately, expanding plant synthetic biology beyond N. benthamiana to include diverse, stably transformable crops will be crucial for leveraging hostspecific metabolic compatibilities and enabling efficient, large-scale biosynthesis of valuable specialized metabolites.
[0382] Conclusion and future perspectives
[0383] Plant synthetic biology provides an exciting opportunity to harness and reprogram plant metabolism for sustainable and scalable production of high-value natural compounds (Liu and Stewart, 2015; Zhu et al., 2021). Betalains represent ideal target compounds for developing and evaluating such engineering strategies given their relatively simple pathway, visual traceability, and commercial value with increasing demand due to both regulatory and consumer-driven shifts away from synthetic dyes (Polturak and Aharoni, 2019; Khan and Polturak, 2025). Despite rapid advances in plant synthetic biology, generating stable transgenic lines expressing a multi-gene metabolic pathway remains a major bottleneck, leaving unresolved challenges such as metabolic balancing, host metabolic tolerance, and heritable plant-based betalain production. This study addressed these limitations by rationally redesigning and optimizing the betalain biosyntheticpathway across three diverse plant hosts, Arabidopsis, tobacco, and soybean. By debottlenecking the DODA step (“pull”), enhancing tyrosine precursor supply via BvTyrAa (“push”), and fine-tuning promoter strength, we developed balanced “push+pull” constructs capable of driving strong pigmentation in stable transgenic lines. These engineered plants achieved pigment levels comparable to or exceeding those in previous stable and transient systems, as well as those found in the native host beetroot. Notably, cross-species comparison revealed clear differences in metabolic tolerance. While strong push+pull expression caused growth defects in Arabidopsis and tobacco, soybean maintained near-normal development, completed its life cycle, and produced T₁ progeny with stably inherited pigmentation, underscoring the suitability of soybean as a chassis for scalable betalain production.
[0384] Looking forward, chassis selection will be a critical design consideration. Different crop species or even different cultivars within a species are likely to vary in their metabolic tolerance, precursor availability, and capacity to produce high levels of target compounds. Incorporating chassis selection into early design and screening will be essential for optimizing yield and stability. Importantly, engineered lines must also be integrated into real agricultural systems. For example, one interesting possibility with soybean is that pigment extraction could occur alongside conventional processing pipelines. Such dual-use value streams could greatly enhance the economic feasibility of plant-based pigment production.
[0385] Engineered plants generated in this study offer a potential carbon-neutral platform for the production of natural pigments, converting sunlight and atmospheric CO₂ into valuable compounds without reliance on fossil-fuel-based processes. As plant synthetic biology continues to advance, future progress will depend on integrating tunable promoters, dynamic regulation, and chassisspecific optimization with rigorous assessment of metabolic burden. Expanding these design principles across diverse, high-biomass crop species will be critical for establishing reliable, climate-aligned, and commercially scalable production systems for betalains and other high-value compounds using plants as chemical production platforms.
[0386] MATERIALS AND METHODS
[0387] Generation of recombinant DNA constructs
[0388] All recombinant DNAs were generated using the Golden Gate (GG) cloning method (Engler et al., 2008; Weber et al., 2011; Werner et al., 2012; Engler et al., 2014; Patron et al., 2015). The intron insertion site within the BvTyrAa coding sequence was predicted using the NetGene2 server( / / services. healthtech. dtu.dk / services / NetGene2-2.42 / ). The full BvTyrAa coding sequence containing the potato ST-LS1 intron sequence (Eckes et al., 1986; Vancanneyt et al., 1990; Brophy et al., 2022) was synthesized in pUC57-Kan vector (Synbio technologies, NJ, USA).
[0389] The rearranged RUBY polycistron, named in this work as RUBYv2, was generated using the RIGGERv2 system within the HARBOR system (manuscript in preparation) designed and used for GG mediated plasmid assembly in the Molecular Technologies Department within the Wisconsin Crop Innovation Center (WCIC) at the University of Wisconsin - Madison. Briefly, genes included within the tri-cistronic RUBYv2 were integrated as CDS Ins Level 0 parts, into RIGGER receiver plasmids which have partial 2A peptide sequences on their termini. Due to RIGGERv2 system design constraints all incoming synthetic CDS Ins molecules (Genscript, Piscataway, New Jersey; kanamycin resistance backbones) were first liberated from their subtending plasmids via restriction digestion with & MHFv2 (New England Biolabs (NEB), Ipswich, Massachusetts) followed by SB buffered (Brody and Kern, 2004) agarose gel mediated size separation and purification of the linear fragments. Specifically, the 828 basepair (bp) DODA gene (from plasmid GS-0529) was installed, via T4 DNA ligase mediated ligation, in the BbsIHF (NEB) digested RIGGER F2A Position 1 receiver (plasmid stock number RC5821-RCGG5030, chloramphenicol resistance backbone; 1781 bp fragment purified away from released lacZ promoter driven P-galactosidase scorable marker gene, which occupies the cloning interval in all unmodified RIGGER receivers); the Postion 1 DODA plasmid was named RC7279A-RCGG7044. The 1503 bp GT fragment (from plasmid GS-0530) was installed, in a BbsIHF (NEB) mediated GG reaction, in the RIGGER F2A Position 2 receiver (plasmid stock number RC5822-RCGG5031, carbenicillin (ampicillin) resistance backbone); the reaction also included the RIGGER T2A triscistronic module (plasmid stock number RC5818-RCGG5027, gentamicin resistance backbone) which provides the ability to connect a downstream gene in the subsequent multifragment assembly (detailed below); the completed GT in the Position 2 receiver was named RC7280A-RCGG7045. The 1494 bp CYP76AD1 fragment from plasmid GS-0528 was ligated with BbsIHF digested, gel purified 1966 bp backbone of the RIGGER T2A Position 3 receiver (RC5823-RCGG5032, carbenicillin (ampicillin) resistance backbone) and the BbsIHF digested, gel purified 963 bp fragment, containing the L-rhamnose inducible promoter driven monomeric Red Fluorescent Protein (mRFP), of the RIGGER STOP module (plasmid stock number RC5820-RCGG5029, gentamicin resistance backbone). Escherichia coli colonies containing thesuccessfully assembled CYP76AD1 fragment in the RIGGER T2A Position 3 receiver (and with the RIGGER STOP) exhibited a red color when cultured on solid LB medium supplemented with carbenicillin and 100 mM L-rhamnose; the completed CYP76AD1 plasmid was named RC7281A-RCGG7046. The aforementioned RIGGER receiver plasmids which had been modified with the DODA, GT, and CYP76AD1 molecules were then combined in an Esp3I (NEB) mediated multifragment GG reaction. The resulting RUBYv2 polycistronic Level 0 (L0) part in plasmid RC7282A-RCGG7047, which produces a red colored colony on solid LB supplemented with chloramphenicol and 100 mM L-rhamnose, features a pair of convergently oriented Bsal recognition sequences that produce the AATG - GCTT overhangs necessary for successful integration of the RUBYv2 CDS1 in transcriptional units produced in Level 1 (LI) GG reactions in concordance with standard MoClo system GG reactions that were subsequently executed to build the transcriptional units described below.
[0390] Since the PCL1 promoter contained an internal BbsI restriction site, the promoter was amplified as two separate fragments to domesticate the internal BbsI site using primers listed in Table 2. The resulting domesticated promoter, flanked with BbsI sites and overhangs compatible with the pAGM1251 were assembled into the L0 acceptor pAGM1251. All other L0 parts were obtained from either the MoClo toolkit (Engler et al., 2014) or Jung and Maeda, 2024. These L0 parts were assembled into LI acceptors using the Golden Gate reaction with promoter, C-terminal tag, and terminator parts. The generated LI parts were further used for Level 2 (L2) assembly to generate EV, “push”, “pull”, and “push+pull” constructs and used for transient expression assay, floral dipping and tissue culture.
[0391] Binary plasmid constructs were assembled using the WCIC AtdTP-SPEC BASE plasmid (RC4836-RCGG3779; also in Maeda stock as bHM1450). This RK2 replicon contains a constitutively expressed aadAla (Hollingshead and Vapnek, 1985; synthetic L0 CDS1 part, codon optimized for use in soybean, stock number S018030-7), which confers to transgenic plant cells the ability to resist spectinomycin selection. Additionally, the aadAla is fused with the At2g04842 bi-organellar targeting sequence (Berglund et al., 2009; synthetic L0 NT1 part stock number S018030-5), which was previously shown to direct fused proteins to both plastids and mitochondria; the use of the AtdTP as a targeting signal for aadAla results in increased transformation efficiency for multiple plant taxa and is the core of a recent WCIC patent application (Petersen et al., 2022). Expression of the AtdTP-aadAla is controlled by the 2Xenhanced Cauliflower Mosaic Virus (CaMV) 35S promoter (LO Pro part, pICH45089; Odell et al., 1985; Kay et al., 1987), in conjunction with the Tobacco Mosaic Virus Q translational enhancer (LO NT1 part, pAGT707; Gallie et al., 1987; polyadenylation of the spectinomycin resistance gene is controlled by the CaMV 35S terminator (Hirt et al., 1990; Irniger et al., 1992; LO 3U + TER part, stock number pICH41414). The 2X enhanced CaMV35S promoter TMV driven AtdTP-aadAla CaMV35S terminator transcriptional unit (TU) was assembled in the MoClo pLIR-l LI acceptor (plasmid stock number pICH47802), which results in the unit being adjacent to, with transcriptional progress directed towards, the T-DNA Left Border sequence; the completed LI plasmid stock number is RC4025-RCGG2915. The WCIC AtdTP-SPEC BASE was completed by installation of the aforementioned LI TU, along with the MoClo pELB-2 unit (which features a pair of divergently oriented Bsa sites flanking the lacZ promoter driven P-galactosidase scorable marker gene; this allows for subsequent modification of the L2 plasmid) in the MoClo RK2 base L2 plasmid (stock number pAGM4673) in a BsaI mediated GG reaction to produce RC4836-RCGG3779. The sequences of final L2 constructs were verified by whole-plasmid sequencing (Plasmidsaurus, KY, USA).
[0392] Transient expression of generated DNA constructs in N. benthamiana
[0393] Transient expression of recombinant DNA constructs in N. benthamiana leaves was conducted following Jung and Maeda (2024). N. benthamiana plants were grown under approximately 200 µE of light intensity with a 12 h / 12 h (light / dark) at 24 °C and 60 % humidity. The generated binary vectors were transformed into Agrobacterium tumefaciens strain GV3101::pMP90 (Koncz and Schell, 1986) using electroporation (McCormac et al., 1998). A. tumefaciens strains harboring each construct were grown in 10 mL of lysogeny broth (LB) (Bertani, 1951; Bertani, 2004) with antibiotics at 28 °C in a shaking incubator at 250 rpm for approximately 24 h. Overnight saturated cultures were centrifuged at 3000 g for 5 min at room temperature. The pellets were washed twice with 3 mL of induction media [10 mM 2-(N-morpholine)-ethanesulphonic acid (MES) pH 5.6, 0.5 % (w / v) glucose, 2 mM NaH2PO4, 20 mM NH4Cl, 1 mM MgSO4, 2 mM KC1, 0.1 mM CaCl₂, 0.01 mM FeSO4, and 0.2 mM acetosyringone] and incubated in the induction medium for 2-3 h at room temperature in dark. After the incubation, the cells were pelleted at 3000 g for 5 min at room temperature and resuspended in 3 mL of 10 mM MES pH 5.6 with 0.2 mM acetosyringone. All resuspended cultures were diluted to OD600nmof 0.5 for infdtration. Four-week-old plants were infiltrated on the abaxial side of the leaf using a 1 mL needleless syringe (Becton, Dickinson andCompany, 309659) and grown for three days under the same condition as described above before sample collection.
[0394] Generation of stable transgenic lines
[0395] After sequencing the level 2 binary vectors, plasmids were transformed into Agrobacterium tumefaciens GV3101::pMP90 by electroporation. Colonies were confirmed by PCR and then stored in -80 °C until further use. Stable transgenic Arabidopsis lines were generated using a modified floral dip method (Yokoyama et al., 2021) with 5-6-week-old Arabidopsis Col-0 plants. The plasmids were also used to produce clones of Agrobacterium rhizogenes strain 18rl2v (Collier and Taylor, unpublished) for use in the dicot meristem soybean transformation protocol used for generation of transgenic Williams 82 cultivar soybean lines at the WCIC.
[0396] Stable transgenic lines of tobacco were generated following Yau et al. (2020) with minor modifications. Seeds of transgenic tobacco (Nicotiana tabacum L. cultivar “Petit Havana” SRI) were sterilized with 70 % (v / v) ethanol for 2 min, bleached with 30 % (v / v) sodium hypochlorite and drops of Triton X-100 for 20 min and washed thoroughly with autoclaved distilled water. Sterilized seeds were germinated on germination medium (MS medium with vitamin (Research Products International, Cat. No. M10400), 3 % (w / v) sucrose, 0.8 % (w / v) agar, pH 5.8). Plates were sealed with medical air-permeable tape and placed in a 25 °C growth chamber with 12 h / 12 h (light / dark) photoperiod for two weeks. The day before inoculation, Agrobacterium strains were streaked on LB plates containing antibiotics and allowed to grow at 30 °C for 1 day. Agrobacterium colonies were suspended in transformation medium (MS medium with vitamin (Research Products International, Cat. No. M10400), 3% (w / v) sucrose, pH 5.8, 3 μg / mL 6-benzylaminopurine (PhytoTechnology Laboratories, Product No. 1885), and 100 μM acetosyringone (AS) (Thermo Scientific, Cat. No. 115540010)) and were then diluted ten times with the same medium for genetic transformation. Cotyledons of two-week-old seedlings were gently bruised with a sterilized toothpick dipped into the desired Agrobacterium suspension. After inoculation, the cotyledons were placed abaxial on co-cultivation medium (Transformation Medium + 0.8% agar) for 3 days in the dark and then transferred to selection medium (Transformation Medium + 0.8% agar + carbenicillin (500 pg / mL) + spectinomycin (50 pg / mL)) with the leftover stem sticking into the medium. Plates were sealed with medical air-permeable tape and placed in a 25 °C growth chamber with 12 h / 12 h (light / dark) photoperiod. Subculturing was carried out every 2 weeks. After shoots were regenerated, shoots were excised from the callus and transferred into rooting medium, MSmedium with vitamin (Research Products International, Cat. No. M10400), 3% (w / v) sucrose, 0.8% agar, 1-Naphthaleneacetic acid (NAA, 1 μg / mL), + carbenicillin (500 pg / mL) + Spectinomycin (50 pg / mL). After roots were regenerated, each transgenic plant was carefully moved to soil and grown in a 25 °C growth chamber with 12 h / 12 h (light / dark) photoperiod. Metabolite extraction and analysis
[0397] To measure metabolite levels, leaf discs were harvested, flash-frozen in liquid nitrogen, ground to powder, and kept at -80 °C until use. Approximately 20-30 mg of frozen powder was mixed in 400 µL of the extraction buffer containing 2:1 (v / v) methanol: chloroform including13C ring-labeled phenylalanine as an internal standard. After adding 300 μL of H₂O and then 125 μL of chloroform, samples were centrifuged at 10,000 g for 5 min. Each 225 μL of the polar phase was transferred to two fresh tubes, dried down overnight in a SpeedVac at room temperature, and resuspended in either 100 μL of LC-MS grade water or 100 μL of 50% (v / v) methanol before spectrophotometry or LC-MS analysis, respectively.
[0398] For LC-MS analysis, 1 μL of each sample resuspended with 50% (v / v) methanol was injected onto a HSS T3 C18 reversed phase column (100 x 2.1 mm i.d., 1.8 μm particle size; Waters, Milford, USA) and eluted using a 27-minute gradient comprising 0.1 % (v / v) formic acid in LC-MS grade water (solvent A) and 0.1 % (v / v) formic acid in 90 % (v / v) LC-MS-grade acetonitrile (solvent B) at a flow rate of 0.4 mL / min and column temperature of 40 °C. The binary linear gradient with the following ratios of solvent B was used: 0-1 min, 1 %; 1-10 min, 1-10 %; 10-13 min, 10-25 %; 13-18 min, 25-99 %; 18-22 min, 99 %; 22-23.5 min, 99-1 %; 23.5-27 min, 1 %. The MS spectra were recorded using the full scan in positive mode, under the following parameters: mass range, 100 to 1500 mass / charge ratio (m / z); resolution, 70,000; maximum scan time, 100 ms; AGC target, 1 × 106; capillary temperature, 350 °C; heater temperature, 150 °C; spray voltage, 3.5 kV. For MS2, the MS spectra were recorded under the following parameters: resolution, 17,500; maximum scan time, 50 ms; minimum AGC target, 8 × 103; AGC target, 2 × 105; collision energies, normalized to m / z 500, z=1; apex trigger: 1 to 180 s. The identity of each metabolite peak was confirmed by comparing their accurate masses and retention times with those of the corresponding authentic standards. Quantification was based on the standard curves generated by injecting different concentrations of authentic chemical standards.
[0399] Untargeted metabolite analysis was conducted following (El-Azaz and Maeda, 2024), with minor modifications. High-throughput integration was conducted in MZmine v4.1.0 (Schmid etal., 2023) using full-range TIC (m / z 100 to 1500) positive ionization data collected between 1 and 27 min. For feature detection, the noise threshold was set to 1.0 × 104and 2.0 × 103for MSI and MS2, respectively. Chromatograms were built with the LC-MS chromatogram builder tool for mass features with a minimum absolute height of >2.0 × 105and detected in at least five consecutive scans, with a minimum intensity of 1.0 × 106between peaks. Local minimum resolver was applied for a minimum ratio of peak top / edge of three and a maximum peak duration of 1 min. Carbon-13 isotopes were then removed using the13C isotope filter tool. Features were aligned with the join aligner tool using a retention time and mlz tolerance of 0.2 min and 10 ppm, respectively. Redundant features were consolidated using the duplicate feature filter. Features present in at least three out of all individuals within same genotype were subtracted from the feature list, except for features at least three times more abundant in the plant samples compared with the blank, which were kept. Gaps in the blank-subtracted feature list were filled using the feature finder tool. After gap-filling, features not present in at least five plant samples were removed using the list rows filter tool, and a correlation analysis of the remaining features was performed in metaCorrelate. The final feature list was then exported as both molecular networking files and SIRIUS outputs with merged MS2 spectra. The exported feature list was further analyzed in MS excel, the integrated peak area divided by the mass of the plant sample (in g FW), and the recovery factor of13C ring labeled phenylalanine (determined in a manual integration) to perform statistical analysis across the dataset. The SIRIUS output file was used to predict feature identity and structure in SIRIUS v5.8.6 (Dührkop et al., 2019), allowing [M + H+], [M + Na+] and [M + K+] as possible ionizations. ZODIAC (Ludwig et al., 2020) was enabled at default parameters to improve the search. A structure search was performed with the CSIFingerID (Dührkop et al., 2015) in all available databases.
[0400] Betacyanin quantification was conducted following Jung and Maeda, 2024. Briefly, 30 μL of sample resuspended in LC-MS grade water were transferred to individual wells of a 96 Greiner transparent plate, flat bottom, half well size (#675101) with five times serial dilutions. Absorbance at 538 nm was measured using a plate reader (Infinite 200 PRO, TEC AN). Multiple data points in the linear range were used for further analysis. Absorbance values were converted to betacyanin content using the molar extinction coefficient ε = 60,000 M-1cm-1(Stintzing et al., 2003).
[0401] RT-qPCR expression analysis
[0402] To test the expression levels of transgenes in the stable transgenic lines, transcript levels oftransgenes were analyzed by reverse-transcription quantitative PCR (RT-qPCR) from the same frozen tissues used for corresponding metabolite analyses. Total RNA was isolated from approximately 50-100 mg of frozen ground tissue using TRIzol (Invitrogen), treated with deoxyribonuclease I (Thermo Fisher Scientific) and reverse-transcribed to synthesize cDNA with M-MLV reverse transcriptase and random hexamer primers (Promega) according to the manufacturer’s protocol. qPCR was conducted in a Stratagene Mx3000P (Agilent Technologies) thermocycler using GoTaq qPCR Master Mix (Promega). Specific primers used for the target genes are listed in Table 2. Expression of the NtPP2A gene and GmUbi3 gene were used to normalize the sample-to-sample variations between different cDNA preparations in N. tabacum and G. max, respectively (Schmidt and Delaney, 2010; Beyer et al., 2021). Relative expression levels among different infiltrated leaves were analyzed for each transgene using the 2V Ctmethod (Livak and Schmittgen, 2001).
[0403] Table 2. Primers used in this study
[0404] Primer name Sequence (5' - 3') Purpose pHM3495 GTGAAGCTGTAGGGCCTGAGC (SEQ ID NO: 47) RT-qPCR (NtPP2A) PHM3496 CATAGGCAGGCACCAAATCC (SEQ ID NO: 48) pHM3528 GTGTAATGTTGGATGTGTTCCC (SEQ ID NO: 49) RT-qPCR (GmUbi3) pHM3529 (SEQ ID NO: 50) pHM0003 CATTGGTTCAGGAAGTGCAA (SEQ ID NO. 27) RT-qPCR (BvDODA) CCTTTGATTCATGGCTTCGT RT-qPCR (BvDODA) pHM0004 (SEQ ID NO: 28) pHM0399 TTTAGGAATGCCGGGTGTAG (SEQ ID NO: 31) RT-qPCR (BvTyrAa) TCTCCAAAACTCGTCCCATC RT-qPCR (BvTyrAa) pHM0400 (SEQ ID NO: 32) pHM2910 GAGAGACTCGCCCCAGATTCCTpHM2911 CTCGCCCATCGTCAGCTCGTTC RT-qPCR (RUBYCYP76AD1) PHM2911 (SEQ ID NO: 36) pHM2912 TCCGGCCACTGGGAGACAGTGA (SEQ ID NO. 37) RT-qPCR (RUBYDODA) CTTGAACTGGTACATGGCGGCT RT-qPCR (RUBYDODA) pHM2913 (SEQ ID NO: 38) pHM2914 CTTATGGCACATCCGCCTACGTpHM2915 TATGGTTGTGTGGAAGGGTGC RT-qPCR (RUBYcDOPA6GT)
[0405] (SEQ ID NO: 40) pHM3219 GC GCg aa g a cGCg g a gTTTCAAGGCTTAGCTTAGAC AAA
[0406]
[0407] (SEQ ID NO: 51) pHM3220 GCGCgaagacGCAAGAGTTCTCCACATCATCATAATCATGGGA. LO cloning of PCL1
[0408] (SEQ ID NO: 52) IvO cloning of PCL1 pHM3221 GCGCgaagacGCTCTTCCACGAGCAGCACCTG
[0409] (SEQ ID NO: 53) _GCGCgaagacGCatggTATCTCTCTCTCGAAACCCTAGATTCC
[0410]
[0411] pHM3261| (SEQ ID NO: 54)
[0412] REFERENCES
[0413] Akan S, Tuna Gunes N, Erkan M (2021) Red beetroot: Health benefits, production techniques, and quality maintaining for food industry. J Food Process Preserv 45: el5781
[0414] Arya SS, Mahto BK, Sengar MS, Rookes JE, Cahill DM, Lenka SK (2022) Metabolic Engineering of Rice Cells with Vanillin Synthase Gene (VpVAN) to Produce Vanillin. Mol Biotechnol 64: 861— 872
[0415] Barnum CR, Endelman BJ, Shih PM (2021) Utilizing Plant Synthetic Biology to Improve Human Health and Wellness. Front Plant Sci. doi: 10.3389 / fpls.2021.691462
[0416] Belcher MS, Vuu KM, Zhou A, Mansoori N, Agosto Ramos A, Thompson MG, Scheller HV, Loque D, Shih PM (2020) Design of orthogonal regulatory' systems for modulating gene expression in plants. Nat Chem Biol 16: 857-865
[0417] Berglund A-K, Spanning E, Biverstahl H, Maddalo G, Tellgren-Roth C, Maier L, Glaser E (2009) Dual Targeting to Mitochondria and Chloroplasts: Characterization of Thr-tRNA Synthetase Targeting Peptide. Mol Plant 2: 1298-1309
[0418] Bertani G (1951) Studies on lysogenesis i. J Bacteriol 62: 293-300
[0419] Bertani G (2004) Lysogeny at Mid-Twentieth Century: Pl, P2, and Other Experimental Systems. J Bacteriol 186: 595-600
[0420] Beyer SF, Bel PS, Flors V, Schultheiss H, Conrath U, Langenbach CJG (2021) Disclosure of salicylic acid and jasmonic acid-responsive genes provides a molecular tool for deciphering stress responses in soybean. Sci Rep 11: 20600
[0421] Brophy JAN, Magallon KJ, Duan L, Zhong V, Ramachandran P, Kniazev K, Dinneny JR (2022) Synthetic genetic circuits as a means of reprogramming plant roots. Science 377: 747-751 Cai Y-M, Witham S, Patron NJ (2023) Tuning Plant Promoters Using a Simple Split Luciferase Method to Assess Transcription Factor-DNA Interactions. ACS Synth Biol 12: 3482-3486 Calva-Estrada SJ, Jiménez-Fernández M, Lugo-Cervantes E (2022) Betalains and their applications in food: The current state of processing, stability and future opportunities in the industry. Food Chem Mol Sci 4: 100089
[0422] Carreon-Hidalgo JP, Franco- Vasquez DC, Gomez-Linton DR, Perez-Flores LJ (2022) Betalain plant sources, biosynthesis, extraction, stability enhancement methods, bioactivitv, and applications. Food Res Int 151: 110821
[0423] Chee MJY, Lycett GW, Khoo T-J, Chin CF (2017) Bioengineering of the Plant Culture of Capsicum frutescens with Vanillin Synthase Gene fortlie Production of Vanillin. Mol Biotechnol 59: 1-8Collier R, Dasgupta K, Xing Y-P, Hernandez BT, Shao M, Rohozinski D, Kovak E, Lin J, de Oliveira MLP, Stover E, et al (2017) Accurate measurement of transgene copy number in crop plants using droplet digital PCR. Plant J 90: 1014-1025
[0424] Deng Y-J, Duan A-Q, Liu H, Wang Y-H, Zhang R-R, Xu Z-S, Xiong A-S (2023) Generating colorful carrot germplasm through metabolic engineering of betalains pigments. Hortic Res 10: uhad024 Diamos AG, Mason HS (2018) Chimeric 3’ flanking regions strongly enhance gene expression in plants.
[0425] Plant Biotechnol J 16: 1971-1982
[0426] Dührkop K, Fleischauer M, Ludwig M, Aksenov AA, Melnik AV, Meusel M, Dorrestein PC, Rousu J, Böcker S (2019) SIRIUS 4: a rapid tool for turning tandem mass spectra into metabolite structure information. Nat Methods 16: 299–302
[0427] Dührkop K, Shen H, Meusel M, Rousu J, Böcker S (2015) Searching molecular structure databases with tandem mass spectra using CSI:FingerID. Proc Natl Acad Sci 112: 12580–12585 Dünser K, Schöller M, Rößling A-K, Löfke C, Xiao N, Parízková B, Melnik S, Rodriguez-Franco M, Stöger E, Novák O, et al (2022) Endocytic trafficking promotes vacuolar enlargements for fast cell expansion rates in plants. eLife 11: e75945
[0428] Eckes P, Rosahl S, Schell J, Willmitzer L (1986) Isolation and characterization of a light-inducible, organ-specific gene from potato and analysis of its expression after tagging and transfer into tobacco and potato shoots. Mol Gen Genet MGG 205: 14-22
[0429] El- Azaz J, Maeda HA (2024) A simplified liquid chromatography-mass spectrometry methodology to probe the shikimate and aromatic amino acid biosynthetic pathways in plants. Plant J 120: 2286- 2304
[0430] Engler C, Kandzia R, Marillonnet S (2008) A One Pot, One Step, Precision Cloning Method with High Throughput Capability. PLOS ONE 3: e3647
[0431] Engler C, Youles M, Gruetzner R, Ehnert T-M, Werner S, Jones JDG, Patron NJ, Marillonnet S (2014) A Golden Gate Modular Cloning Toolbox for Plants. ACS Synth Biol 3: 839-843 de Felipe P, Luke GA, Hughes LE, Gani D, Halpin C, Ryan MD (2006) E unum pluribus', multiple proteins from a self-processing polyprotein. Trends Biotechnol 24: 68-75
[0432] Gallie DR, Sleat DE, Watts JW, Turner PC, Wilson TMA (1987) The 5’-leader sequence of tobacco mosaic virus RNA enhances the expression of foreign gene transcripts in vitro and in vivo.
[0433] Nucleic Acids Res 15: 3257-3273
[0434] Gan S, Amasino RM (1995) Inhibition of Leaf Senescence by Autoregulated Production of Cytokinin.
[0435] Science 270: 1986-1988
[0436] Gandía-Herrero F, Escribano J, García-Carmona F (2016) Biological Activities of Plant Pigments Betalains. Crit Rev Food Sci Nutr 56: 937-945
[0437] Golubova D, Tansley C, Su H, Patron NJ (2024) Engineering Nicotiana benthamiana as a platform for natural product biosynthesis. Curr Opin Plant Biol 81: 102611Grützner R, Schubert R, Horn C, Yang C, Vogt T, Marillonnet S (2021) Engineering Betalain Biosynthesis in Tomato for High Level Betanin Production in Fruits. Front. Plant Sci. 12:
[0438] He Y, Zhang T, Sun H, Zhan H, Zhao Y (2020) A reporter for noninvasively monitoring gene expression and plant transformation. Hortic Res 7: 152
[0439] Hirt H, Kögl M, Murbacher T, Heberle-Bors E (1990) Evolutionary conservation of transcriptional machinery between yeast and plants as shown by the efficient expression from the CaMV 35S promoter and 35S terminator. Curr Genet 17: 473–479
[0440] Hollingshead S, Vapnek D (1985) Nucleotide sequence analysis of a gene encoding a streptomycin / spectinomycin adenyltransferase. Plasmid 13: 17-30
[0441] Huang D, Kosentka PZ, Liu W (2021) Synthetic biology approaches in regulation of targeted gene expression. Curr Opin Plant Biol 63: 102036
[0442] Irniger S, Sanfaçon H, Egli CM, Braus GH (1992) Different Sequence Elements Are Required for Function of the Cauliflower Mosaic Virus Polyadenylation Site in Saccharomyces cerevisiae Compared with in Plants. Mol Cell Biol 12: 2322–2330
[0443] Jiao X, Sun W, Zhang Y, Liu X, Zhang Q, Wang Q, Zhang S, Zhao ZK (2018) Exchanging the order of carotenogenic genes linked by porcine teschovirus-1 2A peptide enable to optimize carotenoid metabolic pathway in Saccharomyces cerevisiae. RSC Adv 8: 34967-34972
[0444] Jores T, Tonnies J, Wrightsman T, Buckler ES, Cuperus JT, Fields S, Queitsch C (2021) Synthetic promoter designs enabled by a comprehensive analysis of plant core promoters. Nat Plants 7: 842–855
[0445] Jozwiak A, Panda S, Akiyama R, Yoneda A, Umemoto N, Saito K, Yasumoto S, Muranaka T, Gharat SA, Kazachkova Y, et al (2024) A cellulose synthase-like protein governs the biosynthesis of Solanum alkaloids. Science 386: eadq5721
[0446] Jung S, Maeda HA (2024) Debottlenecking the L-DOPA 4,5-dioxygenase step with enhanced tyrosine supply boosts betalain production in Nicotiana benthamiana. Plant Physiol 195: 2456-2471 Kay R, Chan A, Daly M, McPherson J (1987) Duplication of CaMV 35S Promoter Sequences Creates a Strong Enhancer for Plant Genes. Science 236: 1299-1302
[0447] Khan MI (2016) Plant Betalains: Safety, Antioxidant Activity, Clinical Efficacy, and Bioavailability.
[0448] Compr Rev Food Sci Food Saf 15: 316-330
[0449] Khan MI, Polturak G (2025) Biotechnological production and emerging applications of betalains: A review. Biotechnol Adv 81: 108576
[0450] Klepikova AV, Kasianov AS, Gerasimov ES, Logacheva MD, Penin AA (2016) A high resolution map of the Arabidopsis thaliana developmental transcriptome based on RNA-seq profiling. Plant J 88: 1058-1070
[0451] Koncz C, Schell J (1986) The promoter of TL-DNA gene 5 controls the tissue-specific expression of chimaeric genes carried by a novel type of Agrobacterium binary vector. Mol Gen Genet MGG 204: 383–396Kramer MC, Ratnayake TS, Edwards SA, Lowrey HL, Klaas G, Sidorenko L, Rowan BA, Michelmore R, Meyers BC, Slotkin RK (2025) Identification of a cleaved aberrant RNA associated with the initiation of transgene silencing. Plant Cell 37: koaf219
[0452] Lopez-Nieves S, Yang Y, Timoneda A, Wang M, Feng T, Smith SA, Brockington SF, Maeda HA (2018) Relaxation of tyrosine pathw ay regulation underlies the evolution of betalain pigmentation in Caryophyllales. New Phytol 217: 896-908
[0453] Liu W, Stewart CN (2015) Plant synthetic biology. Trends Plant Sci 20: 309-317
[0454] Livak KJ, Schmittgen TD (2001) Analysis of Relative Gene Expression Data Using Real-Time Quantitative PCR and the 2-ΔΔCTMethod. Methods 25: 402-408
[0455] Ludwig M, Nothias L-F, Duhrkop K, Koester I, Fleischauer M, Hoffmann MA, Petras D, Vargas F, Morsy M, Aluwihare L, et al (2020) Database -independent molecular formula annotation using Gibbs sampling through ZODIAC. Nat Mach Intell 2: 629-641
[0456] Maeda HA (2019) Harnessing evolutionary diversification of primary metabolism for plant synthetic biology. J Biol Chem 294: 16549-16566
[0457] Maeda HA, Fernie AR (2021) Evolutionary History of Plant Metabolism. Annu Rev Plant Biol 72: 185— 216
[0458] Markel K, Sabety J, Wijesinghe S, Shih PM (2024) Design and Characterization of a Transcriptional Repression Toolkit for Plants. ACS Synth Biol 13: 3137-3143
[0459] Martins IR, Martins LH da S, Chiste RC, Picone CSF, Joele MRSP (2024) Betalains from vegetable peels: Extraction methods, stability, and applications as natural food colorants. Food Res Int 195:
[0460] 114956
[0461] McCormac AC, Elliott MC, Chen DF (1998) A simple method for the production of highly competent cells ofAgrobacterium for transformation via electroporation. Mol Biotechnol 9: 155-159 Nielsen J, Keasling JD (2016) Engineering Cellular Metabolism. Cell 164: 1185-1197
[0462] Nirmal NP, Medhe S, Dahal M, Koirala P, Nirmal S, Al-Asmari F, Xu B (2024) Betalains protect various body organs through antioxidant and anti-inflammatory pathways. Food Sci Hum Wellness 13: 1109-1117
[0463] Novais C, Molina AK, Abreu RMV, Santo-Buelga C, Ferreira ICFR, Pereira C, Barros L (2022) Natural Food Colorants and Preservatives: A Review, a Demand, and a Challenge. J Agric Food Chem 70: 2789-2805
[0464] Odell JT, Nagy F, Chua N-H (1985) Identification of DNA sequences required for activity of the cauliflower mosaic virus 35S promoter. Nature 313: 810-812
[0465] de Oliveira MVV, Jin X, Chen X, Griffith D, Batchu S, Maeda HA (2019) Imbalance of tyrosine by modulating TyrA arogenate dehydrogenases impacts growth and development of Arabidopsis thaliana. Plant J 97: 901–922Owen C, Patron NJ, Huang A, Osbourn A (2017) Harnessing plant metabolic diversity. Current Opinion in Chemical Biology 40: 24-30
[0466] Patron NJ, Orzaez D, Marillonnet S, Warzecha H, Matthewman C, Youles M, Raitskin O, Leveau A, Farré G, Rogers C, et al (2015) Standards for plant synthetic biology: a common syntax for exchange of DNA parts. New Phytol 208: 13–19
[0467] Petersen M, Collier R, Williams E (2022) Alternative transit peptides to increase plant transformation efficiency. U. S. Patent No. US 20220389440A1.
[0468] Polturak G, Aharoni A (2019) Advances and future directions in betalain metabolic engineering. New Phytol 224: 1472-1478
[0469] Polturak G, Grossman N, Vela-Corcia D, Dong Y, Nudel A, Pliner M, Levy M, Rogachev I, Aharoni A (2017) Engineered gray mold resistance, antioxidant capacity, and pigmentation in betalain-producing crops and ornamentals. Proc Natl Acad Sci 114: 9062-9067
[0470] Pouvreau B, Vanhercke T, Singh S (2018) From plant metabolic engineering to plant synthetic biology:
[0471] The evolution of the design / build / test / learn cycle. Plant Sci 273: 3–12
[0472] Pramanik D, Lee K, Wang K (2024) A simple and efficient method for betalain quantification in RUBY-expressing plant samples. Front Plant Sci. doi: 10.3389 / fpls.2024.1449409
[0473] Rizzo P, Chavez BG, Leite Dias S, D’Auria JC (2023) Plant synthetic biology: from inspiration to augmentation. Curr Opin Biotechnol 79: 102857
[0474] Sawicki T, Bączek N, Wiczkowski W (2016) Betalain profile, content and antioxidant capacity of red beetroot dependent on the genoty pe and root part. J Funct Foods 27: 249-261
[0475] Schenck CA, Chen S, Siehl DL, Maeda HA (2015) Non-plastidic, tyrosine-insensitive prephenate dehydrogenases from legumes. Nat Chem Biol 11: 52–57
[0476] Schenck CA, Holland CK, Schneider MR, Men Y, Lee SG, Jez JM, Maeda HA (2017) Molecular basis of the evolution of alternative tyrosine biosynthetic routes in plants. Nat Chem Biol 13: 1029–1035
[0477] Schenck CA, Maeda HA (2018) Tyrosine biosynthesis, metabolism, and catabolism in plants.
[0478] Phytochemistry 149: 82-102
[0479] Schmid R, Heuckeroth S, Korf A, Smirnov A, Myers O, Dyrlund TS, Bushuiev R, Murray KJ, Hoffmann N, Lu M, et al (2023) Integrative analysis of multimodal mass spectrometry data in MZmine 3. Nat Biotechnol 41: 447-449
[0480] Schmidt GW, Delaney SK (2010) Stable internal reference genes for normalization of real-time RT-PCR in tobacco (Nicotiana tabacum) during development and abiotic stress. Mol Genet Genomics 283:
[0481] 233-241
[0482] Selma S, Ntelkis N, Nguyen TH, Goossens A (2023) Engineering the plant metabolic system by exploiting metabolic regulation. Plant J 114: 1149-1163Soares A, Marchiosi R, de Cassia Siqueira-Soares R, Barbosa de Lima R, Dantas dos Santos W, Ferrarese-Filho O (2014) The role of L-DOPA in plants. Plant Signal Behav 9: e28275 Stintzing FC, Schieber A, Carle R (2003) Evaluation of colour properties and chemical quality parameters of cactus juices. Eur Food Res Technol 216: 303-311
[0483] Strobbe S, Verstraete J, Stove C, Van Der Straeten D (2021) Metabolic engineering provides insight into the regulation of thiamin biosynthesis in plants. Plant Physiol 186: 1832-1847 Sweetlove LJ, Fernie AR (2013) The Spatial Organization of Metabolism Within the Plant Cell. Annu Rev Plant Biol 64: 723-746
[0484] Tan J, Wang Y, Lin Z, Chai N, Xue Y, Chen L, Liu Y-G, Zhu Q (2025) eRUBY rice: Co-expression of a feedback-insensitive TyrA arogenate dehydrogenase with RUBY enhances endosperm betalain levels. Plant Physiol 199: kiaf416
[0485] Thomsen PT, Meramo S, Ninivaggi L, Pasutto E, Babaei M, Avila-Neto PM, Pastor MC, Sabri P, Rago D, Parekh TU, et al (2023) Beet red food colourant can be produced more sustainably with engineered Yarrowia lipolytica. Nat Microbiol 8: 2290-2303
[0486] Timoneda A, Sheehan H, Feng T, Lopez-Nieves S, Maeda HA, Brockington S (2018) Redirecting Primary Metabolism to Boost Production of Tyrosine-Derived Specialised Metabolites in Planta. Sci Rep 8: 17256
[0487] Towards FnB (2025), Global Food Colors Market: Industry Trends, Growth Drivers, and Future Outlook, / / www.towardsfnb.com / insights / food-colors-market
[0488] U. S. Food and Drug Administration (2025a) FD& C Red No. 3. https: / / www. fda.gov / industry / color- additives / fde -red-no-3
[0489] U. S. Food and Drug Administration (2025b) HHS and FDA to Phase Out Petroleum-Based Synthetic Dyes from Nation's Food Supply, https: / / www.fda.gov / news-events / press-announcements / hhs- fda-phase-out-petroleum-based-synthetic-dyes-nations-food-supply
[0490] Vancanneyt G, Schmidt R, O’Connor-Sanchez A, Willmitzer L, Rocha-Sosa M (1990) Construction of an intron-containing marker gene: Splicing of the intron in transgenic plants and its use in monitoring early events in Agrobacterium-mediated plant transformation. Mol Gen Genet MGG 220: 245-250
[0491] Wang Y, Demirer GS (2023) Synthetic biology for plant genetic engineering and molecular farming.
[0492] Trends Biotechnol 41: 1182-1198
[0493] Weber E, Engler C, Gruetzner R, Werner S, Marillonnet S (2011) A Modular Cloning System for Standardized Assembly of Multigene Constructs. PLOS ONE 6: e16765
[0494] Werner S, Engler C, Weber E, Gruetzner R, Marillonnet S (2012) Fast track assembly of multigene constructs using Golden Gate cloning and the MoClo system. Bioengineered 3: 38-43 Xiao C, Zhou G, He T, Li C (2025) Transport of secondary metabolites in plants: Mechanistic insights and transporter engineering for crop improvement. Plant Commun. doi:
[0495] 10.1016 / j.xplc.2025.101536Xue Y, Deng Q, Chai N, Li X, Li T, Luo W, Yan X, Chen L, Tan J, Liu Y-G, et al (2025) Development of eRUBY maize with betalain-enriched endosperm using a push-and-pull synthetic metabolic engineering strategy. Crop J. doi: 10.1016 / j.cj.2025.10.005
[0496] Yang J-S, Reyna-Llorens I (2023) Plant synthetic biology: exploring the frontiers of sustainable agriculture and fundamental plant biology. J Exp Bot 74: 3787-3790
[0497] Yaschenko AE, Fenech M, Mazzoni-Putman S, Alonso JM, Stepanova AN (2022) Deciphering the molecular basis of tissue-specific gene expression in plants: Can synthetic biology help? Curr Opin Plant Biol 68: 102241
[0498] Yau Y-Y, Easterling M, Brennan L (2020) Rapid Agrobacterium-Mediated Transformation of Tobacco Cotyledons Using Toothpicks. In A Kumar, Y-Y Yau, S Ogita, R Scheibe, eds, Clim. Change Photosynth. Adv. Biofuels Role Biotechnol. Prod. Value-Added Plant Bio-Prod. Springer, Singapore, pp 407-423
[0499] Yokoyama R, de Oliveira MW, Kleven B, Maeda HA (2021) The entry reaction of the plant shikimate pathway is subjected to highly complex metabolite -mediated regulation. Plant Cell 33: 671-696 Zhang N, McHale LK, Finer JJ (2015) Isolation and characterization of “GmScream” promoters that regulate highly expressing soybean (Glycine max Merr.) genes. Plant Sci 241: 189-198 Zhao C, Kim Y, Zeng Y, Li M, Wang X, Hu C, Gorman C, Dai SY, Ding S-Y, Yuan JS (2018) Co-Compartmentation of Terpene Biosynthesis and Storage via Synthetic Droplet. ACS Synth Biol 7: 774–781
[0500] Zhou A, Kirkpatrick LD, Ornelas IJ, Washington LJ, Hummel NFC, Gee CW, Tang SN, Barnum CR, Scheller HV, Shih PM (2023) A Suite of Constitutive Promoters for Tuning Gene Expression in Plants. ACS Synth Biol 12: 1533-1545
[0501] Zhu X, Liu X, Liu T, Wang Y, Ahmed N, Li Z, Jiang H (2021) Synthetic biology of plant natural products: From pathway elucidation to engineered biosynthesis in plant cells. Plant Commun. doi: 10.1016 / j.xplc.2021.100229
Claims
CLAIMSWhat is claimed:
1. A construct comprising a first polynucleotide encoding a L-DOPA4,5-dioxygenase (DODA) protein, a second polynucleotide encoding a cDOPA 5-O-glucosyltransferase (cDOPA5GT) protein, and a third polynucleotide encoding a CYP76AD1 protein; wherein the first polynucleotide is directly and operably linked to a promoter.
2. The construct of claim 1, wherein the first polynucleotide, the second polynucleotide, and the third polynucleotide are included in a single transcriptional unit.
3. The construct of claim 2, wherein the transcriptional unit comprises from 5’ to 3’: the first polynucleotide, the second polynucleotide, and the third polynucleotide.
4. The construct of claim 3, wherein the first polynucleotide and the second polynucleotide are separated by a sequence encoding a first cleavable linker peptide, and the second polynucleotide and the third polynucleotide are separated by a sequence encoding a second cleavable linker peptide.
5. The construct of claim 4, wherein the first and / or second cleavable linker peptide is a 2A peptide.
6. The construct of claim 5, wherein the single transcriptional unit comprises RUBY>2 (SEQ ID NO: 5) or a sequence having at least 95% identity to SEQ ID NO:5.
7. The construct of claim 1, wherein the first polynucleotide, the second polynucleotide, and the third polynucleotide are included in three separate transcriptional units.
8. The construct of any one of the preceding claims, wherein the construct comprises one or more promoter selected from a Glycine max Scream6 (Gm Scream6) promoter, Arabidopsis thaliana Rubisco small subunit 3B (AtRbcS3B) promoter, Arabidopsis thaliana ubiquitin 10promoter (AtUbilO), Arabidopsis thaliana light-harvesting chlorophyll-protein complex II subunit Bl (AtLHBIBl) promoter, Glycine max elongation factor la promoter, tomato Rubisco (SIRbcS2) promoter, and Zea Mays a-zein promoter.
9. The construct of any one of the preceding claims, wherein the construct comprises one or more terminator selected from an EU terminator, Agrobacterium tumefaciens nopaline synthase (AtuNOS) terminator, cauliflower mosaic virus (CaMV) 35S terminator, NbSHP terminator, Nicotiana benthamiana actin terminator, Glycine max Scream6 (Gm Scream6) terminator, Arabidopsis thaliana Rubisco small subunit 3B (AtRbcS3B) terminator, Arabidopsis thaliana actin2 (AtAct2) terminator, and Agrobacterium tumefaciens octopine synthase (AtuOcs) terminator.
10. The construct of any one of the preceding claims, wherein the DODA protein is BvDODAal from Beta vulgaris (SEQ ID NO: 1) or a sequence having at least 95% identity to SEQ ID NO: 1.
11. The construct of any one of the preceding claims, wherein the cDOPA5GT protein is MjcDOPA5GT from Mirabilis Jalapa (SEQ ID NO: 2) or a sequence having at least 95% identity to SEQ ID NO: 2.
12. The construct of any one of the preceding claims, wherein the CYP76AD1 protein is BvCYP76AD1 from Beta vulgaris (SEQ ID NO: 3) or a sequence having at least 95% identity to SEQ ID NO: 3.
13. The construct of any one of the preceding claims, wherein one or more of the first polynucleotide, the second polynucleotide, and the third polynucleotide are codon optimized for at least one plant.
14. One or more constructs comprising the construct of any of the preceding claims and at least one additional transcriptional unit.
15. The one or more construct of claim 14, wherein the at least one additional transcriptional unit comprises a polynucleotide encoding an arogenate dehydrogenase (TyrA) protein.
16. The one or more construct of claim 15, wherein the TyrA protein is BvTyrAa from Beta vulgaris TyrAa (SEQ ID NO: 4) or a sequence having at least 95% identity to SEQ ID NO: 4.
17. The one or more construct of claim 15 or 16, wherein the polynucleotide encoding the TyrA protein comprises an intron.
18. The one or more construct of any one of claims 15-17, wherein the at least one additional transcriptional unit comprises a promoter selected from a CL1 promoter, AtLHBIBl promoter, AtAct2 promoter, and CaMV 35S promoter.
19. The one or more construct of any one of claims 15-18, wherein the at least one additional transcriptional unit comprises a terminator selected from a nopaline synthase (Nos) terminator and Nicotiana benthamiana heat shock protein terminator (NbHSPT).
20. The one or more construct of any one of claims 14-19, wherein the at least one additional transcriptional unit comprises another polypeptide encoding the DODA protein.
21. The one or more construct of claim 20, wherein the at least one additional transcriptional unit comprises a Solanum lycopersicum Rubisco (SlRbcS2) promoter.
22. The one or more construct of claim 20 or 21, wherein the at least one additional transcriptional unit comprises an EU / HSPT terminator ox Agrobacterium tumefaciens octopine synthase (AtuOcs) terminator.
23. The one or more construct of any one of claims 14-22, wherein the at least one additional transcriptional unit is included in the same construct as the transcriptional unit(s) encoding the DODA protein, the cDOPA5GT protein, and the CYP76AD1 protein.
24. The one or more construct of claim 23, wherein the at least one additional transcriptional unit is separated from the transcriptional unit(s) encoding the DODA protein, the cDOPA5GT protein, and the CYP76AD1 protein via an insulator.
25. The one or more construct of any one of claims 14-22, wherein the at least one additional transcriptional unit is included in a different construct from the transcriptional unit(s) encoding the DODA protein, the cDOPA5GT protein, and the CYP76AD1 protein.
26. A plant or plant part comprising the construct s) of any one of the preceding claims.
27. A plant or plant part comprising a first polynucleotide encoding a DODA protein, a second polynucleotide encoding a cDOPA5GT protein, and third a polynucleotide encoding a CYP76AD1 protein; wherein the plant has higher DODA activity than a control plant, optionally wherein the control plant comprises the construct of SEQ ID NO: 12.
28. The plant or plant part of claim 27, wherein the first polynucleotide, the second polynucleotide, and the third polynucleotide are included in a single transcriptional unit.
29. The plant or plant part of claim 27, wherein the first polynucleotide, the second polynucleotide, and the third polynucleotide are included in three separate transcriptional units.
30. The plant or plant part of any one of claims 26-29, wherein the plant further comprises at least one additional transcriptional unit.
31. The plant or plant part of claim 30, wherein the at least one additional transcriptional unit comprises another polypeptide encoding the DODA protein.
32. The plant or plant part of claim 30 or 31, wherein the at least one additional transcriptional unit comprises a polynucleotide encoding a TyrA protein.
33. The plant or plant part of any one of claims 30-32, wherein the at least one additional transcriptional unit is included in the same construct as the transcriptional unit(s) encoding the DODA protein, the cDOPA5GT protein, and the CYP76AD1 protein.
34. The plant or plant part of any one of claims 30-32, wherein the at least one additional transcriptional unit is included in a different construct from the transcriptional unit(s) encoding the DODA protein, the cDOPA5GT protein, and the CYP76AD1 protein.
35. The plant or plant part of any one of claims 26-34, wherein the plant is a soybean plant, a tobacco plant, a sorghum plant, a hemp plant, a poplar plant, or a maize plant.
36. The plant or plant part of any one of claims 26-35, wherein the levels of betalain are between 1 mg / gFW and 10 mg / gFW in at least one part of the plant.
37. The plant or plant part of any one of claims 26-36, wherein the levels of L-DOPA are between 50 nmol / gFW and 2,500 nmol / gFW in at least one part of the plant.
38. A method of using the plants or plant parts of any one of claims 26-37 to make a product.
39. The method of claim 38, wherein the product is a dye or includes a dye.
40. The method of claim 38 or 39, wherein the product is a food product, a consumer product, a fabric, a pharmaceutical product or a cosmetic product.
41. A method comprising growing the plant of any one of claims 26-37.
42. The method of claim 41, further comprising harvesting a plant part from the plant.
43. The method of claim 42, wherein the plant part is a seed, leaf, root, hypocotyl, stem, or fruit.
44. The method of claim 42 or 43, wherein the plant part is used for food or in a food product.
45. The method of any one of claims 41-44, further comprising isolating a betalain or L-DOPA from the plant or plant part.
46. The method of claim 45, further comprising using the isolated betalain or L-DOPA to produce a colorant, dye, dietary supplement, or pharmaceutical agent.
47. A method of treating a condition in a subject by administering the plant or plant part of any one of claims 26-37 to the subject or by administering the product produced by any one of claims 38-40 to the subject.
48. The method of claim 47, wherein the condition is a cancer, cardiovascular disease, cerebrovascular disease, organ damage, or a neurological disorder.
49. The method of claim 47 or 48, wherein the method reduces blood pressure, inflammation, and / or oxidative stress in the subject.
50. The method of any one of claims 47-49, wherein administration is oral.
51. The method of claim 50, wherein the plant or plant part is formulated as a food product, powder, or pill.