Engineered human dicer polypeptides having restored helicase function

Engineered human Dicer polypeptides with enhanced ATP hydrolysis and helicase activity address the limitations of wild-type Dicer, improving antiviral defense and therapy by increasing functional activity and reducing viral load.

WO2026161524A1PCT designated stage Publication Date: 2026-07-30UNIV OF UTAH RES FOUND
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
UNIV OF UTAH RES FOUND
Filing Date
2026-01-22
Publication Date
2026-07-30

AI Technical Summary

Technical Problem

Human Dicer proteins lack functional ATP hydrolysis and helicase activity, limiting their effectiveness in antiviral defense and therapy.

Method used

Engineered human Dicer polypeptides with functional ATP hydrolysis motifs, dsRNA binding motifs, and Hel2-Hel2i-pincer hinge regions, enhancing ATP hydrolysis, helicase activity, and translocation.

Benefits of technology

The engineered Dicer polypeptides exhibit increased functional ATP hydrolysis, helicase activity, and translocation, effectively reducing viral load in subjects.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2026012104_30072026_PF_FP_ABST
    Figure US2026012104_30072026_PF_FP_ABST
Patent Text Reader

Abstract

Described herein are isolated engineered human Dicer polypeptides having functional ATP hydrolysis and helicase activity. Also described herein are methods of making engineered human Dicer polypeptides and methods of treating a viral infection in a subject using such engineered human Dicer polypeptides. The isolated engineered human Dicer polypeptides may comprise one or more functional motif regions or amino acid substitutions derived from ancestral or extant species having functional Dicer ATPase and helicase activity.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] ENGINEERED HUMAN DICER POLYPEPTIDES HAVING RESTORED HELICASE FUNCTION

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Provisional Patent Application No. 63 / 748,643 filed on January 23, 2025, which is incorporated by reference herein in its entirety.

[0004] FEDERALLY SPONSORED RESEARCH

[0005] This invention was made with government support under R01 CA260414 awarded by the National Institutes of Health. The government has certain rights in the invention.

[0006] REFERENCE TO SEQUENCE LISTING

[0007] This application was filed with a Sequence Listing XML in ST.26 XML format in accordance with 37 C.F.R. § 1.831 and PCT Rule 13ter. The Sequence Listing XML file submitted in the USPTO Patent Center, “026389-9336- WO01_sequence_listing_xml_19- JAN-2026.xml,” was created on January 19, 2026, contains 25 sequences, has a file size of 35.4 kilobytes (36,342 bytes), and is incorporated by reference in its entirety into the specification.

[0008] BACKGROUND

[0009] Antiviral defense in vertebrates involves RIG-l-like receptors (RLRs; Retinoic acid-Inducible Gene-like receptors) that recognize viral dsRNA to trigger an interferon response, while invertebrates of the arthropod and nematode phyla use Dicer to cleave viral dsRNA and trigger antiviral RNA interference (RNAi). RLRs and Dicer have related Superfamily 2 (SF2) helicase domains, suggesting this helicase domain was involved in antiviral defense in a common ancestor. Helicase domains of extant Dicer enzymes have widely different activities that likely reflect an evolutionary arms race with viruses, and the need to acquire new functions, such as the microRNA (miRNA) processing required for gene regulation in extant animals.

[0010] Drosophila melanogaster Dicer- 1 (dmDcrl) has a defunct helicase domain incapable of ATP hydrolysis and instead uses its Platform / PAZ (Piwi-Argonaute-Zwille) domains to recognize miRNA precursors (pre-miRNAs), which are cleaved by Dicer’s RNase III domains to produce mature miRNAs. By contrast, Dicer-2 (dmDcr2), encoded by a duplicated Dicer gene specific to arthropods, has a specialized helicase domain that couples ATP-driven dsRNA translocation to processive cleavage of long viral dsRNAs (FIG. 1A). Humans have a single Dicer (hsDcr) that is specialized for miRNA production, but its helicase domain lacks the ability to hydrolyze ATP (FIG.

[0011] 1B). Phylogenetic analyses indicate this loss occurred at the onset of vertebrate evolution.Accordingly, most evidence indicates mammalian Dicers only play a role in antiviral defense in special conditions, such as in mammalian germ and stem cells, where processing is ATP-independent.

[0012] The lack of helicase function in hsDcr may have arisen due to competition between helicase domains of Dicer and RLRs, as both recognize viral dsRNAs in the cytoplasm. Indeed, RNAi and RLR-stimulated interferon pathways antagonize one another in mammals. Also, arthropods like Drosophila, where extant dmDcr2’s helicase domain retains a role in antiviral defense, do not have RLRs. Alternatively, loss of Dicer helicase function may have begun early in animal evolution, driven by competition for RNA binding between Dicer’s helicase domain and its own Platform / PAZ domains. Here, dominance of RLRs in viral dsRNA recognition, rather than causing loss of Dicer helicase function, would be an evolutionary consequence of its decline. Caenorhabditis elegans Dicer (ceDCR-1) functions in antiviral defense with an RLR called DRH-1, which is crucial for dsRNA cleavage in vitro and for antiviral defense in vivo (FIG. 10). This suggests that ceDCR-Ts helicase domain was subject to the same evolutionary pressures that led to loss of vertebrate Dicer helicase function, and that Dicer began to lose helicase function early in animal evolution, before divergence of vertebrates and invertebrates.

[0013] What is needed is engineered human Dicer proteins having functional ATP hydrolysis and helicase activity for antiviral defense and therapy.

[0014] SUMMARY

[0015] One embodiment described herein is an isolated engineered human Dicer polypeptide comprising: one or more functional ATP hydrolysis motifs comprising: an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5; one or more functional double-stranded RNA (dsRNA) binding motifs comprising: a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5; a dsRNA bindingmotif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif I b of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; or a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and one or more functional Hel2-Hel2i-pincer hinge regions having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5. In one aspect, the isolated engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, K160N, K160Q, N161Q, N161H, L171V, L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H, P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, I479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13. In another aspect, the isolated engineered human Dicer polypeptide has at least 90-99% amino acid sequence identity to any one of SEQ ID NO: 1-5. In another aspect, the isolated engineered human Dicer polypeptide has one or more of increased functional ATP hydrolysis activity, increased helicase activity, increased translocation, or increased processivity relative to a wild-type human Dicer protein of SEQ ID NO: 13.

[0016] Another embodiment described herein is an isolated nucleic acid comprising a polynucleotide sequence encoding an engineered human Dicer polypeptide described herein.

[0017] Another embodiment described herein is an mRNA comprising an isolated nucleic acid described herein.

[0018] Another embodiment described herein is a vector comprising an isolated nucleic acid described herein. In one aspect, the vector comprises a lentiviral vector, a retroviral vector, an adenoviral vector, or an adeno-associated virus (AAV) vector.

[0019] Another embodiment described herein is a cell comprising a vector described herein. Another embodiment described herein is a pharmaceutical composition comprising an isolated nucleic acid described herein, and one or more pharmaceutically acceptable excipients.Another embodiment described herein is a pharmaceutical composition comprising the isolated engineered human Dicer polypeptide described herein, and one or more pharmaceutically acceptable excipients.

[0020] Another embodiment described herein is a method of engineering a human Dicer protein to have functional ATP hydrolysis and helicase activity, the method comprising: modifying a wildtype human Dicer protein to have one or more functional ATP hydrolysis motifs, one or more functional double-stranded RNA (dsRNA) binding motifs, and one or more functional Hel2— Hel2i— pincer hinge regions to generate an engineered human Dicer polypeptide having functional ATP hydrolysis and helicase activity, wherein: the one or more functional ATP hydrolysis motifs comprise: an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5; the one or more functional dsRNA binding motifs comprise: a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; or a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and the one or more functional Hel2-Hel2i-pincer hinge regions have at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5. In one aspect, the engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, K160N, K160Q, N161Q, N161H, L171V,L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H, P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, I479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13. In another aspect, modifying the wild-type human Dicer protein comprises site-directed mutagenesis, random mutagenesis, amino acid insertion or deletion, protein fusion, or combinations thereof. In another aspect, the engineered human Dicer polypeptide has increased helicase translocation and processivity relative to the wild-type human Dicer protein.

[0021] Another embodiment described herein is a method of treating a viral infection in a subject in need thereof, the method comprising: administering a therapeutically effective amount of an engineered human Dicer polypeptide or a nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide to the subject, the engineered human Dicer polypeptide comprising: one or more functional ATP hydrolysis motifs comprising: an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5; one or more functional double-stranded RNA (dsRNA) binding motifs comprising: a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; or a dsRNA binding motif having at least 90-99% amino acidsequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and one or more functional Hel2-Hel2i-pincer hinge regions having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5. In one aspect, the engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, KWON, K160Q, N161Q, N161H, L171V, L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H, P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, I479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13. In another aspect, the engineered human Dicer polypeptide or nucleic acid comprising the polynucleotide sequence encoding the engineered human Dicer polypeptide is administered to the subject intravenously, intravascularly, intraarterially, intramuscularly, subcutaneously, intranasally, intraperitoneally, or combinations thereof. In another aspect, the engineered human Dicer polypeptide or nucleic acid comprising the polynucleotide sequence encoding the engineered human Dicer polypeptide is administered to the subject as a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients. In another aspect, the polynucleotide sequence encoding the engineered human Dicer polypeptide is comprised in a vector. In another aspect, the vector comprises a lentiviral vector, a retroviral vector, an adenoviral vector, or an adeno-associated virus (AAV) vector. In another aspect, the viral infection produces viral dsRNA that is recognized by the engineered human Dicer polypeptide in the subject. In another aspect, the engineered human Dicer polypeptide reduces viral load in the subject.

[0022] Another embodiment described herein is a kit for treating a viral infection in a subject in need thereof, the kit comprising: the isolated engineered human Dicer polypeptide described herein or an isolated nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide described herein; optionally, injection or infusion materials or devices; optionally, buffers and receptacles; and optionally, one or more of packaging, a label, or instructions for use.

[0023] Another embodiment described herein is the use of an engineered human Dicer polypeptide for treating a viral infection in a subject in need thereof, the engineered human Dicer polypeptide comprising: one or more functional ATP hydrolysis motifs comprising: an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one ofSEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5; one or more functional double-stranded RNA (dsRNA) binding motifs comprising: a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; or a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and one or more functional Hel2-Hel2i-pincer hinge regions having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5.

[0024] DESCRIPTION OF THE DRAWINGS

[0025] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[0026] FIG. 1 A-E shows a phylogenetic analysis of diversity in Dicer helicase function. FIG. 1 A-C show cartoon depictions of dmDcr-2 binding long dsRNA with helicase domain (FIG. 1A), hsDcr binding pre-miRNA with Platform / PAZ domains (FIG. 1 B), and ceDCR-1 antiviral complex binding pre-miRNAand long dsRNA using Platform / PAZ domains and DRH-1 helicase, respectively RDE-4 is shown with dsRNA-binding domains in maroon (FIG. 1C). FIG. 1D shows domain organization of AncD1D2, with colored rectangles showing conserved domain boundaries indicated by amino acid number. FIG. 1E shows a summarized phylogenetic tree constructed byconstraining maximum likelihood tree to known species relationships in Dicer-1 clade. Font colors at nodes correlate with data for ancestral protein.

[0027] FIG. 2A-B show phylogenetic trees constructed from extant metazoan Dicer HEL-DUF amino acid sequences. FIG. 2A shows Dicer HELDUF phylogenetic tree with Dicer-1 clade constrained to species relationships, visualized and annotated with FigTree. Resurrected ancestral nodes are depicted with black circles with transfer bootstrap values indicated in parentheses. Width of cartooned triangle bases represents species sampling depth, i.e., number of species. Scale bar represents total amino acid substitutions divided by the number of amino acids, i.e., amino acid substitutions per site. Species tree-gene tree incongruent nodes are depicted with red labels. FIG. 2B shows maximum likelihood Dicer HELDUF phylogenetic gene tree, visualized and annotated with FigTree. Resurrected ancestral nodes are depicted with black circles with transfer bootstrap values indicated in (parentheses). Width of cartooned triangle bases represents species sampling depth, i.e., number of species. Scale bar represents total amino acid substitutions divided by number of amino acid sites, i.e., amino acid substitutions per site. Species tree-gene tree incongruent nodes are depicted with red labels.

[0028] FIG. 3A-F show ancient metazoan Dicer translocates along dsRNA. FIG. 3A shows schema depicting streptavidin-displacement assay for translocation. Green oval, biotin covalently linked to RNA; Maroon circle, tetravalent streptavidin. Color-coded Dicer domains as labeled. FIG. 3B shows streptavidin-displacement assays for AncD1D2 on BLT (Left) and 3'ovr (Right) dsRNA in the absence and presence of 5 mM ATP. Yellow highlighted P, 5'-32P-label. FIG. 3C shows a graph illustrating streptavidin displacement for ancestral constructs from species-constrained tree for BLT (bold) and 3'ovr (dashed) 42-bp dsRNA with 5 mM ATP. Data were fit to a pseudo-first-order rate equation. Data points, mean ± SD (n > 3). FIG. 3D shows a graph illustrating quantification of TLC analyses monitoring hydrolysis of ATP (100 pM) by select ancestral helicases with BLT (bold) and 3'ovr (dashed) 42-bp dsRNA (400 nM). Data are fit as in (C) (n > 3). FIG. 3E shows Michaelis-Menten curves of ATP hydrolysis by AncD1D2, AncD1BiLAT, and AncD1DEUT with BLT (bold) and 3'ovr (dashed) dsRNA. FIG. 3F shows binding isotherms for ancestral helicase-DUF283 proteins (HELDUF; FIG. 1D) from gel-shift assays where fraction bound was determined from radioactivity of dsRNAfreeand dsRNAbound. Data were fit to calculate dissociation constant, Kd, using the Hill formalism, where fraction bound = 1 / (1 + [Kdn / [P]n]). Data points, mean ± SD (n > 3).

[0029] FIG. 4 shows RNA duplexes. The 5'-and 3'-ends are labeled. Deoxynucleotides are shown in bod font. P- is a 5'-phosphate; BIO- is a 5'-covalently linked biotin. Sequences are shown in Table 2.FIG. 5A-D show ancestral Dicer helicases translocate on dsRNA. Representative phosphorimages of streptavidin-displacement assays for (FIG. 5A) AOCDI BILAT (FIG. 5B) AncD1DEu-r(FIG. 5C) AncD1 VERT and (FIG. 5D) AHCDINEM, measuring translocation along BLT (left) and 3'ovr (right) dsRNA in the absence and presence of 5 mM ATP.

[0030] FIG. 6A-E shows ancient Dicer helicases hydrolyze ATP. FIG. 6A shows the quantification of TLC analyses monitoring hydrolysis of ATP (100 pM) by selected ancestral Dicer helicases in the absence of dsRNA. Data points are mean ± SD (n > 3) and were fit to a pseudo-first order equation. FIG. 6B-E show phosphorimages of representative TLC plates showing hydrolysis of ATP (100 pM spiked with o-32P-ATP) by 200 nM ancestral HEL-DUFs for various times as indicated, at 37 °C, in the absence of dsRNA (left) or in the presence of 400 nM 42-bp dsRNA with BLT or 3'ovr termini (right).

[0031] FIG. 7 shows ancient Dicer helicases bind dsRNA. Representative phosphorimages of electrophoretic mobility shift assays for AncD1D2, AncD1BiLAT, and AncDloEUT.

[0032] FIG. 8A-F show that ancient Dicer helicases from maximum likelihood tree translocate on dsRNA. FIG. 8A-E show representative phosphorimages of streptavidin-displacement assays for (FIG. 8A) AncD1D2 (FIG. 8B) AncD2ARTH (FIG. 8C) AncD1 ARTH / LOPH / DEUT (FIG. 8D) AncD1 LOPH / DEUT and (FIG. 8E) AHCDIDEUT measuring translocation along BLT 42-bp dsRNA in the presence of 5 mM ATP. FIG. 8F shows a graph illustrating streptavidin-displacement data for ancestral Dicer constructs from the maximum likelihood tree for BLT dsRNA. Data were fit to a pseudo-first order rate equation. Data points are mean ± SD (n > 3).

[0033] FIG. 9A-F show extant invertebrate antiviral Dicers translocate along dsRNA. FIG. 9A shows streptavidin-displacement assay for ceDCR-1RIII / DRH-1 / RDE-4 with BLT 42-bp dsRNA, with and without 5 mM ATP. FIG. 9B shows a graph quantifying streptavidin displacement data for 50 nM ceDCR-1RIII / DRH-1 / RDE-4 and 200 nM dmDcr2RI", for BLT and 3'ovr dsRNA with 5 mM ATP. Data were fit to a pseudo-first-order rate equation. Data points, mean ± SD (n = 3). FIG.

[0034] 9C shows a streptavidin-displacement assay for ceDCR-1 / DRH-1 / RDE-4 with BLT 42-bp dsRNA with deoxynucleotide patch, with and without 5 mM ATP. Cartoons indicate deoxynucleotides (red) and gel migration of different species. FIG. 9D shows a streptavidin-displacement assay for ceDCR-1 / DRH-1K320A / RDE-4 and ceDCR-1G36R / DRH-1 / RDE-4 with BLT 42-bp dsRNA with deoxynucleotide patch with 5 mM ATP. Cartoons as in FIG. 9C. FIG. 9E shows a streptavidin-displacement assay for ceDCR-1 / DRH-1 with BLT 42-bp dsRNA containing deoxynucleotides with 5 mM ATP. Cartoons as in FIG. 9C. FIG. 9F shows a graph quantifying streptavidin displacement data for ceDCR-1 / DRH-1 / RDE-4 and indicated mutants, using BLT 42-bp dsRNA with deoxynucleotides and 5 mM ATP. Data were fit as in FIG. 9B.FIG. 10A-B show invertebrate Dicers translocate along dsRNA. FIG. 10A shows a representative phosphorimage of streptavidin-displacement assay for ceDCR-1RIII / DRH-1 / RDE-4 translocation along 42-bp 3'ovr dsRNA in the absence and presence of 5 mM ATP. FIG. 10B shows a representative phosphorimage of streptavidin-displacement assay for dmDcr2RI" translocation along 42-bp BLT and 3'ovr dsRNA in the presence of 5 mM ATP.

[0035] FIG. 11A-B show streptavidin-displacement assay design shows that ceDCR-1 antiviral complex translocates along dsRNA. FIG. 11A shows a representative phosphorimage of streptavidin-displacement assay for ceDCR-1 / DRH-1 / RDE-4 translocation along BLT 42-bp dsRNA in the presence of 5 mM ATP. dsRNA is cleaved instantly before translocation can be tracked. This showed that regular 42-bp dsRNA cannot be used to assay translocation of a wildtype Dicer as cleavage from the left side will precede streptavidin displacement from the right side. Cartoons indicate gel migration of different species. FIG. 11 B shows a representative phosphorimage of streptavidin-displacement assay for ceDCR-1 / DRH-1 / RDE-4 translocation along BLT 42-bp dsRNA with deoxynucleotides, in the presence of 5 mM ATP without free biotin sink for displaced streptavidin. Displaced streptavidin rapidly rebinds dsRNA and ceDCR-1 is unable to cleave dsRNA. This demonstrates that the deoxy patch effectively blocks cleavage from the left side. This assay also shows that streptavidin displacement is required for cleavage from the right side, which only occurs after free dsRNA reengages with the Dicer complex. Cartoons indicate deoxynucleotides (red) and gel migration of different species.

[0036] FIG. 12A-E show cryo-EM structures of AncD1D2 in complex with BLT 27-dsRNA in different stages of ATPase cycle. Colored atomic models of AncD1D2 in complex with BLT 27-dsRNA in (FIG. 12A) state A°9round, ground state without nucleotide, (FIG. 12B) state Bend* transition state following ADP-AIFXbinding to ground state, (FIG. 12C) state Cpost closed, post hydrolysis closed state following state Bend*, (FIG. 12D) state DP°st’9round, post hydrolysis semiclosed state in internal dsRNA segment following state Cp°st closed, (FIG. 12E) state Einternal:|:, transition state after initial ATPase cycle at dsRNA terminus. Hel2i is invisible in states A°9roundand Bend* likely due to subdomain flexibility. Colors: Hell (purple), Hel2 (sea green), Hel2i (yellow), Pincer (red), DUF283 (dark gray), dsRNA (cornflower blue). Distance across ATPase cleft calculated by measuring distance between central point of Hell spring helix and Hel2 loop helix. The dsRNA position column shows zoom-in of contacts between spring and loop helices and dsRNA 3'-tracking strand. Polar contact between V70 from spring helix, and labeled PO4 group in state A, was used to benchmark helicase position on dsRNA for all states. The nucleotide state column shows ATPase pocket and occupying nucleotide.FIG. 13A-E show schematic representation of AncD1D2-dsRNA interactions. FIG. 13A shows the A state, A°9round. FIG. 13B shows the B state, Bendt. FIG. 13C shows the C state, Cpost, dosed pig -|30 shows the D state, Dpost'9round. FIG. 13E shows the E state, Einternal*. Key protein residues and motifs are highlighted, and sites of interaction are indicated with colored boxes. Residues used to monitor helicase movement along 3-tracking strand in FIG. 5 are underlined and corresponding phosphate positions (P1-P4) are indicated. Bold lines depict hydrogen bonds while dashed lines depict high confidence polar contacts. Nucleotide state is depicted with chemical structure showing position of aluminum fluoride in ATP mimics.

[0037] FIG. 14A-E show cryo-EM image processing workflow of AncD1 D2 in state A0ground. FIG.

[0038] 10A shows a representative cryo-EM micrograph of AncD1D2 bound to 27-bp dsRNA in state A0ground. FIG. 14B shows representative views of 2D class averages of AncD1D2 state A0ground. FIG. 14C shows a flowchart of cryo-EM data processing of the AncD1D2 state A0ground. FIG. 14D shows gold standard FSC of the final map of AncD1D2 state A0ground. FIG. 14E shows particle distribution orientation.

[0039] FIG. 15A-E show cryo-EM image processing workflow of AncD1D2 in state Bendt. FIG.

[0040] 15A shows representative cryo-EM micrograph of AncD1D2 bound to 27-bp dsRNA in state Bend*. FIG. 15B shows representative views of 2D class averages of AncD1D2 state Bend*. FIG. 15C shows a flowchart of cryo-EM data processing of the AncD1D2 state Bend*. FIG. 15D shows a gold standard FSC of the final map of AncD1D2 state Bendt. FIG. 15E shows particle distribution orientation.

[0041] FIG. 16A-C show cryo-EM image processing workflow of AncD1D2 in post hydrolysis states Cpost closedand Dpost'ground. FIG. 16A shows a flowchart of cryo-EM data processing of AncD1D2 bound to 27-bp dsRNA in post hydrolysis states Cpost olosedand Dpost'ground. FIG. 16B shows a representative cryo-EM micrograph of AncD1D2 bound to 27-bp dsRNA in post hydrolysis states Cpost closedand Dpost’ground. FIG. 16C shows representative views of 2D class averages of AncD1D2 in post hydrolysis states Cpost’ ci°sedand Dposl'ground.

[0042] FIG. 17A-E show cryo-EM image processing workflow of AncD1 D2 in state Einternal:|:. FIG.

[0043] 17A shows a representative cryo-EM micrograph of AncD1D2 bound to 27-bp dsRNA in state Eternal* FIG. 17B shows representative views of 2D class averages of AncD1D2 internal state Fintemait FIG. 17C shows a flowchart of cryo-EM data processing of the AncD1D2 internal state E'ntemaii FIG. 17D shows a gold standard FSC of the final map of AncD1 D2 internal state Einternal:|:. FIG. 17E shows particle distribution orientation.

[0044] FIG. 18A-E show the chronology of AncD1D2 ATPase cycle coupled to translocation on dsRNA tracking strand. FIG. 18A-E show zoom-in of RecA-dsRNA interface, showing selectHell and Hel2 motifs in contact with dsRNA 3'-tracking strand for states A-E. Phosphates (red and yellow) connect RNA bases (tubes). Key residues are shown in spring and loop helices. Motifs are labeled and highlighted with lines depicting position in helicase. Phosphate position is benchmarked by assigning PO4group contacting V70 in state A0groundas P2, and correlating helicase movement on dsRNA to stages of ATPase cycle, as determined by nucleotide state in ATPase pocket and state of ATPase cleft. Interactions between protein and RNA, dashed lines. Distance (in A) between center of spring helix and center of loop helix was used to depict semiclosed or closed state. Arrows represent chronological transition from state to state.

[0045] FIG. 19A-C show cryo-EM image processing workflow of AncD1DEUT in endbound state. FIG. 19A shows a representative cryo-EM micrograph of AncD1DEuT bound to 27-bp BLT dsRNA in endbound state with added ATP. FIG. 19B shows a flowchart of cryo-EM data processing of the AncDlDEUT in endbound state with added ATP. Processing terminates with 2D classification. FIG. 19C shows schema depicting inability of AHCDIDEUT to translocate despite preservation of ATP hydrolysis.

[0046] FIG. 20A-D show that Hel2 loop flexibility is important for helicase function. FIG. 20A shows a zoom-in view of the RecA-dsRNA interface comparing state D.3 (Hell , purple; Hel2, sea green) and state D.4 (Hell, pink; Hel2, blue), showing Hel2 motifs in proximity to dsRNA tracking strand. dsRNA is colored gray with orange and red for phosphate backbone; 3'- and 5'-directions indicated. Key protein residues and corresponding motifs are highlighted. Lines show connection between P3, H409 of IVa and Q427 of IVb in state D.3. These contacts are absent in state D.4. Flexible movement of Hel2 loop as it relaxes to ground state affects position of flanking motifs IVa and IVb. FIG. 20B shows a multiple sequence alignment of ancient and modern Dicer helicase-DUF283 constructs illustrated with ESPRIPT, showing a portion of Hel2 containing the loop helix and the connected Hel2 loop. Motifs IVa (containing H409) and IVb (containing Q427 in the loop helix) flank Hel2 loop. H409 is conserved in all active helicases or replaced by an arginine in the modern dmDcr2. Inverted blue triangles indicate residues involved in ATPase and translocation activity. Red shading / white text indicates identity, no shading / red text indicates similarity, and black text indicates no conservation. Columns with black and red text have at least 70% conservation, represented by red text, while black text indicates the non-conserved or variant amino acids. Q427 is conserved in all displayed helicases. Extant proteins: CEDCRWT, Caenorhabditis elegans DCR-1; DMDCR2, Drosophila melanogaster Dicer-2; HSDCR, Homo sapiens Dicer. Ancestors (ANC) are from the Maximum likelihood gene tree unless designated as SPECIES. ANCD1 D2SRECIES isAncD1D2 used in this paper, generated from species tree of life. FIG. 20C shows a zoom-in view of the Hel2 loop interface with Hel2i in state Dpost ground.dsRNA is colored cornflower blue. Key protein residues are highlighted. Interactions between sidechains from Hel2 loop and Hel2i are depicted by dashed lines. S419 is in a cluster of conserved serines and threonines in active Dicer and RLR helicases. Hel2 loop flexibility likely creates different connections with Hel2i as translocation progresses. FIG. 20D shows a multiple sequence alignment showing Hel2 loop from Dicer helicases described in FIG. 15B and the RIG-l-Like helicases, RIG-I, DRH-1 and LGP2. Red shading / white text indicates identity, no shading / red text indicates similarity, and black text indicates no conservation. Columns with black and red text have at least 70% conservation, represented by red text, while black text indicates the non-conserved or variant amino acids. Blue triangles indicate threonine residues essential for RIG-I translocation and signaling. Hel2 loop sequence shows low conservation but RIG-I T667 and T671 are either conserved or replaced with serine at the same position / adjacent positions (S414 / 415 and S419 / T420 in AncD1 D2SPECIES) in all functional Dicer and RLR helicases. Vertebrate Dicer helicases lack conservation at this site. Abbreviations as in (FIG. 20B).

[0047] FIG. 21A-D show that Hel2 loop distorts dsRNA structure and enables extensive contact with DUF283. FIG. 21A shows a front-view of colored model of AncD1 D2 bound to 27-bp dsRNA in state Dpostgroundshowing Hel2 (sea green) and DUF283 (gray). Hel2 loop is inserted into expanded dsRNA major groove (blue) compared with predicted structure of ideal A-form dsRNA (forest green). Helicase bound dsRNA is bent towards DUF283 (gray) during translocation in internal dsRNA segments. Inset: zoom-in view showing predicted clash between loop helix and A-form dsRNA during translocation. FIG. 21 B shows a zoom-in view of overlaid state CP°st closed(gray) and state DP°st'ground(blue) models showing Hel2 loop transition from terminus capping position to major groove insertion position. FIG. 21 C shows a zoom-in view of extensive DUF283-dsRNA interface enabled by Hel2 loop (sea green) inserted into dsRNA major groove of state DPost, ground contacts between DUF283 (gray) and dsRNA backbone (blue with yellow and red for PO4) are highlighted. FIG. 21 D shows a multiple sequence alignment of ancestral and modern Dicer Helicase-DUF283 constructs illustrated with ESPRIPT. Shown is the DUF283 segment depicting conservation of DUF283-dsRNA contact sites. Red shading / white text indicates identity, no shading / red text indicates similarity, and black text indicates no conservation. Columns with black and red text have at least 70% conservation, represented by red text, while black text indicates the non-conserved or variant amino acids. Blue triangles indicate residues involved in contact between DUF283 and dsRNA backbone in state Einternalt. Regions 1 and 3 are canonical contact sites between the dsRBM fold and internal dsRNA segments. Conservation of contact residues is sporadic with loss of K618 and R619 correlating with decline in efficiency of dsRNA binding and translocation. K615 is conserved in all active helicases. K614 is replaced with V indmDcr-2 but is otherwise conserved in all active ancestral helicases. Abbreviations are the same as in FIG. 20B.

[0048] FIG. 22A-B show a structural comparison of Hel2i domain between AncD1D2 and dmDcr2. FIG. 22A shows a top view of AncD1 D2 state DP°s,'groundmodel (left) and dmDcr2-Loqs-PD model (PDB:7W0A) (right). FIG. 22B shows an overlay of AncD1D2 state DP°stgroundand dmDcr2-Loqs-PD, top view (left) and front view (right). Relative Hel2 position is depicted with distance and angle differences.

[0049] FIG. 23A-C show contact between Hell and Hel2 is mediated by closure of ATPase pocket. Zoom-in of ATPase pocket (left) and Hel1-Hel2 interface (right) for (FIG. 23A) Einternal:|:, (FIG. 23B) cpost'closedand (FIG. 23C) Dpost ground. Hell, purple; Hel2, sea green. Select sidechains colored according to motif. Left panel: Sidechains important for ATPase function. ADR magnesium ion and aluminum-fluoride are shown. Right panel: Side chain interactions between Hell and Hel2 interface residues represented by dashed lines. Non-ATPase pocket sidechains are colored according to subdomains Hell and Hel2.

[0050] FIG. 24A-B show structural comparison of Hel1-Hel2 interface between AncD1D2 and RIG-I. FIG. 24A shows a top view (left) and front view (right) of colored atomic model of state Dpost, ground The |nsetshows Hel1-Hel2 interface in state DP°st ground(left) and state Einternal* (right). FIG. 24B shows the RIG-I Hel1-Hel2 interface showing semi-closed (PDB:7TOO) and closed (PDB:4A36) conformations. Equivalent residues between AncD1D2 and RIG-I are indicated, H145:H375, H146:N376, S177:S411, D450:E702.

[0051] FIG. 25 shows a model of metazoan Dicer helicase evolution. AncD1D2 possessed helicase function: efficient ATP hydrolysis coupled to dsRNA binding and translocation. AncD2ARTH retains helicase function, and core functions are passed down to extant dmDcr2 for antiviral defense and endo-siRNA processing. AncD1BiLAT retains ATP hydrolysis function but is diminished in dsRNA binding and translocation, presumably due to mutations at Hel2— Hel2i— pincer hinge (Inset), (see FIG. 26). Further degeneration at hinges and at dsRNA contact sites (yellow) lead to loss of helicase function in nematode clade. Deuterostome Dicer helicase accumulates hinge mutations, losing translocation function. AncDIvERT helicase accumulates additional hinge mutations as well as dsRNA contact mutations leading to inability to form semiclosed conformation and hydrolyze ATP (see FIG. 26). All models apart from AncD1D2 are AlphaFold 3 predictions.

[0052] FIG. 26 shows structure-function analysis of metazoan Dicer helicase-DUF283. Multiple sequence alignment (MAFFT) of ancestral and modern Dicer helicase-DUF283 constructs illustrated with ESPRIPT. Sequences of the aligned Dicer proteins are shown in Table 1 and areDrosophila melanogaster Dicer-2 (DMDCR2); ancestor of arthropod Dicer-2 (AncD2ARTH); pregene duplication ancestor of metazoan dicer (AncD1D2); pre-gene duplication ancestor of metazoan Dicer from species tree (AncD1D2SpEciEs); common ancestor of arthropod, lophotrochozoan and deuterostome Dicer-1 (AncD1ARTHROLOPDEui); common ancestor of bi laterian Dicer-1 (AncD1BiLATSPEciEs); common ancestor of nematode Dicer-1 (AncD1 NEMATODESPECIES); Caenorhabditis elegans Dicer-1 (CEDCRWT); common ancestor of lophotrochozoan and deuterostome Dicer-1 (AncD1i_opHDEUT); common ancestor of deuterostome Dicer-1 (AncDlDEirr); common ancestor of deuterostome Dicer-1 (AncD1DEUTSPEciEs); common ancestor of vertebrate Dicer-1 (AOCDIVERT); and Homo sapiens Dicer-1 (HSDCR), which correspond to SEQ ID NO: 1-13, respectively. The top 5 sequences have complete helicase function: Efficient ATP hydrolysis coupled with dsRNA binding and translocation. The bottom 8 sequences have diminished helicase capacity in one capacity or another. Shown is entire helicase-DUF283 segment depicting conservation and divergence of various components of complete helicase function. Red shading / white text indicates identity, no shading / red text indicates similarity, and black text indicates no conservation. Columns with black and red text have at least 70% conservation, represented by red text, while black text indicates the non-conserved or variant amino acids. The Pincer KNK motif is predicted to be in epistatic interaction with Hel2-Hel2i interface. Green boxes represent ATPase motifs and brown boxes represent dsRNA contact motifs. The red ovals above the alignments indicate additional amino acid positions that may contribute to functional helicase activity.

[0053] DETAILED DESCRIPTION

[0054] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. For example, any nomenclatures used in connection with, and techniques of biochemistry, molecular biology, and protein and nucleic acid chemistry described herein are well known and commonly used in the art. In case of conflict, the present disclosure, including definitions, will control the interpretation of terms. Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can be used in practice or testing of the embodiments and aspects described herein.

[0055] As used herein, the terms “amino acid,” “nucleotide,” “polynucleotide,” “vector,” “polypeptide,” and “protein” have their common meanings as would be understood by a biochemist of ordinary skill in the art. Standard single letter nucleotides (A, C, G, T, U) andstandard single letter amino acids (A, C, D, E, F, G, H, I, K, L, M, N, P, Q, R, S, T, V, W, or Y) are used herein.

[0056] As used herein, terms such as “include,” “including,” “contain,” “containing,” “having,” and the like mean “comprising.” The present disclosure also contemplates other embodiments “comprising,” “consisting essentially of,” and “consisting of” the embodiments or elements presented herein, whether explicitly set forth or not. As used herein, “comprising,” is an “open-ended” term that does not exclude additional, unrecited elements or method steps. As used herein, “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed invention. As used herein, “consisting of” excludes any element, step, or ingredient not specified in the claim.

[0057] As used herein, the term “a,” “an,” “the” and similar terms used in the context of the disclosure (especially in the context of the claims) are to be construed to cover both the singular and plural unless otherwise indicated herein or clearly contradicted by the context. In addition, “a,” “an,” or “the” means “one or more” unless otherwise specified.

[0058] As used herein, the term “or” can be conjunctive or disjunctive.

[0059] As used herein, the term “and / or” refers to both the conjunctive and disjunctive.

[0060] As used herein, the term “substantially” means to a great or significant extent, but not completely.

[0061] As used herein, the term “about” or “approximately” as applied to one or more values of interest, refers to a value that is similar to a stated reference value, or within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, such as the limitations of the measurement system. In one aspect, the term “about” refers to any values, including both integers and fractional components that are within a variation of up to ± 10% of the value modified by the term “about.” Alternatively, “about” can mean within 3 or more standard deviations, per the practice in the art. Alternatively, such as with respect to biological systems or processes, the term “about” can mean within an order of magnitude, in some embodiments within 5-fold, and in some embodiments within 2-fold, of a value. As used herein, the symbol means “about” or “approximately.” All ranges disclosed herein include both end points as discrete values as well as all integers and fractions specified within the range. For example, a range of 0.1-2.0 includes 0.1, 0.2, 0.3, 0.4 . . . 2.0. If the end points are modified by the term “about,” the range specified is expanded by a variation of up to ±10% of any value within the range or within 3 or more standard deviations, including the end points, or as described above in the definition of “about.”As used herein, the terms “room temperature,” “RT,” or “ambient temperature” refer to the typical temperature in an indoor laboratory setting. In one aspect, the laboratory setting is climate controlled to maintain the temperature at a substantially uniform temperature or with a specific range of temperatures. In one aspect, “room temperature” refers a temperature of about 15-30 °C, including all integers and endpoints within the specified range. In another aspect, “room temperature” refers a temperature of about 15-30 °C; about 20-30 °C; about 22-30 °C; about 25-30 °C; about 27-30 °C; about 15-22 °C; about 15-25 °C; about 15-27 °C; about 20-22 °C; about 20-25 °C; about 20-27 °C; about 22-25 °C; about 22-27 °C; about 25-27 °C; about 15 °C ± 10%; about 20 °C ± 10%; about 22 °C ± 10%; about 25 °C ± 10%; about 27 °C ± 10%; ~20 °C, ~22 °C, ~25 °C, or ~27 °C, at standard atmospheric pressure.

[0062] As used herein, the terms “control,” or “reference” are used herein interchangeably. A “reference” or “control” level may be a predetermined value or range, which is employed as a baseline or benchmark against which to assess a measured result. “Control” also refers to control experiments or control cells.

[0063] As used herein, the terms “active ingredient” or “active pharmaceutical ingredient” refer to a pharmaceutical agent, active ingredient, compound, or substance, compositions, or mixtures thereof, that provide a pharmacological, often beneficial, effect.

[0064] As used herein, the term “dose” denotes any form of an active ingredient formulation or composition, including cells, that contains an amount sufficient to initiate or produce a therapeutic effect with at least one or more administrations. “Formulation” and “composition” are used interchangeably herein.

[0065] As used herein, the term “prophylaxis” refers to preventing or reducing the progression of a disorder, either to a statistically significant degree or to a degree detectable by a person of ordinary skill in the art.

[0066] As used herein, the terms “effective amount” or “therapeutically effective amount,” refers to a substantially non-toxic, but sufficient amount of an action, agent, composition, or cell(s) being administered to a subject that will prevent, treat, or ameliorate to some extent one or more of the symptoms of the disease or condition being experienced or that the subject is susceptible to contracting. The result can be the reduction or alleviation of the signs, symptoms, or causes of a disease, or any other desired alteration of a biological system. An effective amount may be based on factors individual to each subject, including, but not limited to, the subject’s age, size, type or extent of disease, stage of the disease, route of administration, the type or extent of supplemental therapy used, ongoing disease process, and type of treatment desired.As used herein, the term “subject” refers to an animal. Typically, the subject is a mammal. A subject also refers to primates (e g., humans, male orfemale; infant, adolescent, or adult), nonhuman primates, rats, mice, rabbits, pigs, cows, sheep, goats, horses, dogs, cats, fish, birds, and the like. In one embodiment, the subject is a primate. In one embodiment, the subject is a human.

[0067] As used herein, a subject is “in need of treatment” if such subject would benefit biologically, medically, or in quality of life from such treatment. A subject in need of treatment does not necessarily present symptoms, particular in the case of preventative or prophylaxis treatments.

[0068] As used herein, the terms “inhibit,” “inhibition,” or “inhibiting” refer to the reduction or suppression of a given biological process, condition, symptom, disorder, or disease, or a significant decrease in the baseline activity of a biological activity or process.

[0069] As used herein, “treatment” or “treating” refers to prophylaxis of, preventing, suppressing, repressing, reversing, alleviating, ameliorating, or inhibiting the progress of biological process including a disorder or disease, or completely eliminating a disease. A treatment may be either performed in an acute or chronic way. The term “treatment” also refers to reducing the severity of a disease or symptoms associated with such disease prior to affliction with the disease. “Repressing” or “ameliorating” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject after clinical appearance of such disease, disorder, or its symptoms. “Prophylaxis of’ or “preventing” a disease, disorder, or the symptoms thereof involves administering a cell, composition, or compound described herein to a subject prior to onset of the disease, disorder, or the symptoms thereof. “Suppressing” a disease or disorder involves administering a cell, composition, or compound described herein to a subject after induction of the disease or disorder thereof but before its clinical appearance or symptoms thereof have manifested.

[0070] As used herein, “homology” or “identical”, percent “identity” or “similarity”, when used in the context of two or more nucleic acids or polypeptide sequences, refers to two or more sequences or subsequences that are the same or have a specified percentage of nucleotides or amino acid residues that are the same, e.g., at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher identity over a specified region (e.g., nucleotide sequence encoding an antibody described herein or amino acid sequence of an antibody described herein). Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same base or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. The alignment and the percent homology orsequence identity can be determined using software programs known in the art, for example those described in Current Protocols in Molecular Biology, Ausubel et al., eds. (1987) Supp 30, section 7.7.18, Table 7.7.1. Default parameters may be used for alignment. For example, an alignment program is BLAST, using default parameters. In particular, preferred programs are BLASTN and BLASTP. The terms “homology,” “identical,” percent “identity,” or “similarity” also refer to, or can be applied to, the complement of a test sequence. The terms also include sequences that have deletions and / or additions, as well as those that have substitutions. As described herein, the preferred algorithms can account for gaps and the like. Preferably, identity exists over a region that is at least about 25 amino acids or nucleotides in length, or over a region that is at least 50-100 amino acids or nucleotides in length. An “unrelated” or “non-homologous” sequence shares less than 40% identity, or alternatively less than 25% identity, with one of the sequences of the present disclosure.

[0071] As used herein, a “peptide” or “polypeptide” is a linked sequence of two or more amino acids linked by peptide bonds. The polypeptide can be natural, synthetic, or a modification or combination of natural and synthetic. Peptides and polypeptides include proteins such as binding proteins, receptors, and antibodies. The terms “polypeptide,” “protein,” and “peptide” are used interchangeably herein. “Primary structure” refers to the amino acid sequence of a particular peptide. “Secondary structure” refers to locally ordered, three dimensional structures within a polypeptide. Certain structures within proteins are commonly referred to as domains, for example, enzymatic domains, extracellular domains, transmembrane domains, pore domains, and cytoplasmic tail domains. “Domains” are portions of a polypeptide that form a compact unit of the polypeptide and are typically 15 to 350 amino acids long. Exemplary domains include domains with enzymatic activity or ligand binding activity. Typical domains are made up of sections of lesser organization such as stretches of beta-sheet and alpha-helices. “Tertiary structure” refers to the complete three-dimensional structure of a polypeptide monomer. “Quaternary structure” refers to the three-dimensional structure formed by the noncovalent association of independent tertiary units. A “motif” is a portion of a polypeptide sequence and includes at least two amino acids. A motif may be 2 to 20, 2 to 15, or 2 to 10 amino acids in length. A motif may include 3, 4, 5, 6, or 7 sequential amino acids. A domain may comprise a series of motifs, such as the same motif, similar motifs, or different motifs.

[0072] As used herein, a “functional ATP hydrolysis motif’ refers to a Dicer protein motif that is capable of hydrolyzing ATP. In one aspect, the functional ATP hydrolysis motif comprises an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q, motif I, motif II, motif III, or motif VI of any one of SEQ ID NO: 1-5, as shown in FIG. 26. In another aspect, thefunctional ATP hydrolysis motif comprises the ATP hydrolysis motif of motif Q, motif I, motif II, motif III, or motif VI of any one of SEQ ID NO: 1-5 as shown in FIG. 26.

[0073] As used herein, a “functional dsRNA binding motif” refers to a Dicer protein motif that is capable of binding double-stranded RNA (dsRNA). In one aspect, the functional dsRNA binding motif comprises a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la, motif lb, motif Ic, motif Ila, motif IV, motif IVa, motif IVb, motif V, motif Va, or motif DUF283 of any one of SEQ ID NO: 1-5 as shown in FIG. 26. In another aspect, the functional dsRNA binding motif comprises the dsRNA binding motif of motif la, motif lb, motif Ic, motif Ila, motif IV, motif IVa, motif IVb, motif V, motif Va, or motif DUF283 of any one of SEQ ID NO: 1-5 as shown in FIG. 26.

[0074] As used herein, a “functional Hel2-Hel2i-pincer hinge region” refers to a Dicer protein region capable of conformational change between multiple Dicer domains including Hel2 (Helicase domain 2), Hel2i (Helicase insertion domain), and pincer (bridging domain). In one aspect, the functional Hel2-Hel2i-pincer hinge region comprises a Hel2-Hel2i-pincer hinge region having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5 as shown in FIG. 26. In another aspect, the functional Hel2-Hel2i-pincer hinge region comprises one or more of a Hel2-Hel2i-pincer hinge (1), Hel2-Hel2i-pincer hinge (2), KNK motif, or pincer motif of any one of SEQ ID NO: 1-5 as shown in FIG. 26.

[0075] Among animals, the contribution of Dicer’s helicase to recognition and elimination of viral double-stranded RNA (dsRNA) varies from phylum to phylum. Vertebrate Dicers show no helicase activity, while an arthropod ortholog uses helicase translocation to efficiently move dsRNA into Dicer’s cleavage site. The biochemical and structural basis of Dicer’s helicase function, and the evolutionary events that contribute to divergence in function, have remained unknown. Results described herein show how ancient Dicer helicase tightly binds dsRNA and couples adenosine triphosphate (ATP) hydrolysis to movement along dsRNA. The data reveal how components of this intricate system declined along different clades of animal evolution.

[0076] Described herein are biochemical and phylogenetic analyses to map evolution of dsRNA translocation by Dicer’s helicase domain (FIG. 1D). This analysis, together with cryo-EM analyses of an ancient Dicer helicase domain, produced a more comprehensive understanding of Dicer evolution. Early metazoan Dicer helicase bound dsRNA with high affinity and coupled dsRNA binding with efficient ATP hydrolysis to drive robust translocation along dsRNA. Helicase affinity for dsRNA began to decline in the Dicer-1 clade before onset of bilaterians, declining further in deuterostome and protostome lineages. While ATP hydrolysis activity is progressively lost along both clades, the work disclosed herein suggests that loss of dsRNA binding is the primarymechanism underlying loss of translocation in the Dicer- 1 clade. Structural analyses of ancient Dicer helicase translocating on dsRNA provide previously unrecognized details in SF2 helicase function, likely operative in modern RLRs.

[0077] A fully functional Dicer helicase, present in the modern arthropod, uses energy from ATP hydrolysis to power translocation on bound dsRNA, enabling the processive dsRNA cleavage required for efficient antiviral defense. However, modern Dicer orthologs exhibit divergent helicase functions that affect their ability to contribute to antiviral defense. Moreover, mechanisms that couple ATP hydrolysis to Dicer helicase movement on dsRNA remain enigmatic. As described herein, biochemical and structural analyses of ancestrally reconstructed Dicer helicases were used to map evolution of dsRNA binding affinity, ATP hydrolysis, and translocation. Loss of affinity for dsRNA occurred early in Dicer evolution, coinciding with a decline in translocation activity, despite preservation of ATP hydrolysis activity. Ancestral nematode Dicer also exhibited significant decline in ATP hydrolysis and translocation, but studies of antiviral activities in the modern nematode Caenorhabditis elegans indicate Dicer retained a role in antiviral defense by recruiting a second helicase. Cryogenic electron microscopy (cryo-EM) analyses of an ancient Metazoan Dicer allowed capture of multiple helicase states revealing the mechanism that connects each step of ATP hydrolysis to unidirectional movement along dsRNA. The studies disclosed herein rationalize the diversity in modern Dicer helicases by connecting ancestral functions to observations in extant enzymes.

[0078] Engineered Human Dicer Polypeptides

[0079] Described herein are isolated engineered human Dicer polypeptides.

[0080] As described herein, in many cases the amino acid substitutions, mutations, additions, or deletions are preferably of a minor nature, such as conservative amino acid substitutions that do not significantly affect the folding or activity of the protein or additions or deletions to the N- or C-termini. Of course, the number of amino acid substitutions, additions, or deletions a skilled artisan would make depends on many factors, including those described herein. Generally, the number of substitutions, additions, or deletions for any given polypeptide will not be more than about 100, 90, 80, 70, 60, 50, 40, 30, 25, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, 8, 7, 5, 6, 4, 3, 2, or 1.

[0081] The polypeptides described herein include encoding polynucleotides or variants that have substitutions, deletions, and / or additions that can involve one or more nucleotides. The variants can be altered in coding regions, non-coding regions, or both. Alterations in the coding regions can produce conservative or non-conservative amino acid substitutions, deletions, or additions.Especially preferred among these are silent substitutions, additions, and deletions, which do not alter the properties and activities of the binding.

[0082] Further embodiments described herein include nucleic acid molecules comprising polynucleotides having nucleotide sequences about 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical, and more preferably at least about 90-99% or 100% identical to (a) nucleotide sequences, or degenerate, homologous, or codon-optimized variants thereof, encoding polypeptides having the amino acid sequences in SEQ ID NO: 1-13; (b) nucleotide sequences, or degenerate, homologous, or codon-optimized variants thereof, encoding polypeptides having the amino acid sequences in SEQ ID NO: 1-13; and (c) nucleotide sequences capable of hybridizing to the complement of any of the nucleotide sequences in (a) or (b) above and capable of expressing functional polypeptides of amino acid sequences in SEQ ID NO: 1-13.

[0083] By a polynucleotide having a nucleotide sequence at least, for example, 90-99% “identical” to a reference nucleotide sequence encoding a functional antibody binding domain or fragment thereof is intended that the nucleotide sequence of the polynucleotide be identical to the reference sequence except that the polynucleotide sequence can include up to about 10 to 1 point mutations, additions, or deletions per each 100 nucleotides of the reference nucleotide sequence encoding the functional antibody binding domain or fragment thereof.

[0084] In other words, to obtain a polynucleotide having a nucleotide sequence about at least 90-99% identical to a reference nucleotide sequence, up to 10% of the nucleotides in the reference sequence can be deleted, added, or substituted, with another nucleotide, or a number of nucleotides up to 10% of the total nucleotides in the reference sequence can be inserted into the reference sequence. These mutations of the reference sequence can occur at the 5'- or 3'-terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence. The same is applicable to polypeptide sequences about at least 90-99% identical to a reference polypeptide sequence.

[0085] As noted above, two or more polynucleotide sequences can be compared by determining their percent identity. Two or more amino acid sequences likewise can be compared by determining their percent identity. The percent identity of two sequences, whether nucleic acid or peptide sequences, is generally described as the number of exact matches between two aligned sequences divided by the length of the shorter sequence and multiplied by 100. An approximate alignment for nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman, Adv. App. Mathematics 2: 482-489 (1981). This algorithm can be extended to usewith peptide sequences using the scoring matrix developed by Dayhoff, Atlas of Protein Sequences and Structure, Dayhoff ed., Vol. 5 Suppl. 3: 353-358 (1979), National Biomedical Research Foundation, Washington, D.C., USA, and normalized by Gribskov, Nucl. Acids Res.

[0086] 14(6): 6745-6763 (1986).

[0087] For example, due to the degeneracy of the genetic code, one having ordinary skill in the art will recognize that a large number of the nucleic acid molecules having a sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to the nucleic acid sequence shown in SEQ ID NO: 1-13, or degenerate, homologous, or codon-optimized variants thereof, will encode a functional antibody binding domain or fragment thereof.

[0088] The polynucleotides described herein include those encoding mutations, variations, substitutions, additions, deletions, and particular examples of the polypeptides described herein. For example, guidance concerning how to make phenotypically silent amino acid substitutions is provided in Bowie et al., Science 247(4948): 1306-1310 (1990), wherein the authors indicate that proteins are surprisingly tolerant of amino acid substitutions.

[0089] Thus, fragments, derivatives, or analogs of the polypeptides of SEQ ID NO: 1-13 can be (i) ones in which one or more of the amino acid residues (e.g., 1, 2, 3, 4, 5, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 25, 30, 35, 40, 45, or 50 residues, or even more) are substituted with a conserved or non-conserved amino acid residue (preferably a conserved amino acid residue). Such substituted amino acid residues may or may not be one encoded by the genetic code, or (ii) ones in which one or more of the amino acid residues includes a substituent group (e.g., 1, 2, 3, 4, 5, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, or 50 residues or even more), or (iii) ones in which the mature polypeptide is fused with another polypeptide or compound, such as a compound to increase the half-life of the polypeptide (for example, polyethylene glycol), or (iv) ones in which the additional amino acids are fused to the mature polypeptide, such as an IgG Fc fusion region peptide or leader or secretory sequence or a sequence which is employed for purification of the mature polypeptide or a proprotein sequence. Such fragments, derivatives, and analogs are deemed to be within the scope of those skilled in the art from the teachings herein.

[0090] In addition, fragments, derivatives, or analogs of the polypeptides of SEQ ID NO: 1-13 can be substituted with one or more conserved or non-conserved amino acid residue (preferably a conserved amino acid residue). In some cases, these polypeptides, fragments, derivatives, or analogs thereof will have a polypeptide sequence at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical to the polypeptide sequence shown in SEQ ID NO: 1-13 and will comprise functional or non-functionalproteins or enzymes. Similarly, additions or deletions to the polypeptides can be made either at the N- or C-termini or within non-conserved regions of the polypeptide, which are assumed to be non-critical because they have not been photogenically conserved.

[0091] Another embodiment described herein is a polynucleotide vector comprising one or more nucleotide sequences described herein. In one aspect, the vector comprises one or more nucleotide sequences having at least 85% to 100% identity, including all integers and endpoints of the specified range, of nucleotide sequences capable of encoding SEQ ID NO: 1-13.

[0092] Another embodiment described herein is a cell comprising one or more nucleotide sequences described herein, or a polynucleotide vector described herein. In one aspect, the cell comprises one or more nucleotide sequences having at least 85% to 100% identity, including all integers and endpoints of the specified range, of nucleotide sequences capable of encoding SEQ ID NO: 1-13.

[0093] Another embodiment is a polypeptide encoded by a nucleotide sequence described herein. In one aspect, the polypeptide has at least 85% to 99% identity, including all integers and endpoints of the specified range, of nucleotide sequences capable of encoding SEQ ID NO: 1-13. In another aspect, the polypeptide is selected from SEQ ID NO: 1-13.

[0094] Methods of Treatment

[0095] Also described herein are methods of treating a viral infection in a subject in need thereof. The methods comprise administering a therapeutically effective amount of an engineered human Dicer polypeptide or a nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide to the subject.

[0096] In some embodiments, the pharmaceutical compositions may further comprise one or more pharmaceutically acceptable excipients. In some aspects, the pharmaceutically acceptable excipients may comprise buffers, salts, carriers, diluents, or combinations thereof. In some embodiments, the pharmaceutical compositions may be formulated for various routes of administration. In some aspects, the pharmaceutical compositions may be formulated for intravenous injection or infusion. In some aspects, the pharmaceutical compositions may be formulated as solutions or suspensions suitable for parenteral administration.

[0097] Kits

[0098] Also described herein are kits for treating a viral infection in a subject in need thereof. The kits comprise an engineered human Dicer polypeptide as described herein. The kits mayoptionally further comprise one or more of injection or infusion materials or devices, buffers and receptacles, and packaging, a label, or instructions for use.

[0099] The kits described herein may be designed for use in various clinical settings. In some embodiments, the kit may be designed for use in a hospital or infusion center, where trained healthcare professionals can administer the compositions under close supervision. In other embodiments, the kit may be designed for use in an outpatient clinic or physician’s office. The kit may include all necessary components and detailed instructions to facilitate safe and effective administration in these settings. The instructions may be tailored to the level of expertise expected of the user, with more detailed guidance provided for settings where less specialized personnel may be involved in preparation or administration. The kits described herein may comprise protective packaging to ensure the integrity of the components during storage and transport. In some embodiments, the kit may comprise cushioning materials, such as foam inserts or bubble wrap, to protect glass vials or ampoules from breakage. The kit may comprise tamper-evident seals or packaging to ensure that the kit has not been opened or tampered with prior to use. Instructions included in kits may be affixed to packaging material or may be included as a package insert. While the instructions are typically written on printed materials, they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this disclosure. Such media include, but are not limited to, electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. As used herein, the term “instructions” may include the address of an internet site that provides the instructions.

[0100] One embodiment described herein is an isolated engineered human Dicer polypeptide comprising: one or more functional ATP hydrolysis motifs comprising: an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5; one or more functional double-stranded RNA (dsRNA) binding motifs comprising: a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif I b of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; or a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and one or more functional Hel2-Hel2i-pincer hinge regions having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5. In one aspect, the isolated engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, K160N, K160Q, N161Q, N161H, L171V, L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H, P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, I479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13. In another aspect, the isolated engineered human Dicer polypeptide has at least 90-99% amino acid sequence identity to any one of SEQ ID NO: 1-5. In another aspect, the isolated engineered human Dicer polypeptide has one or more of increased functional ATP hydrolysis activity, increased helicase activity, increased translocation, or increased processivity relative to a wild-type human Dicer protein of SEQ ID NO: 13.

[0101] Another embodiment described herein is an isolated nucleic acid comprising a polynucleotide sequence encoding an engineered human Dicer polypeptide described herein.

[0102] Another embodiment described herein is an mRNA comprising an isolated nucleic acid described herein.

[0103] Another embodiment described herein is a vector comprising an isolated nucleic acid described herein. In one aspect, the vector comprises a lentiviral vector, a retroviral vector, an adenoviral vector, or an adeno-associated virus (AAV) vector.

[0104] Another embodiment described herein is a cell comprising a vector described herein. Another embodiment described herein is a pharmaceutical composition comprising an isolated nucleic acid described herein, and one or more pharmaceutically acceptable excipients.Another embodiment described herein is a pharmaceutical composition comprising the isolated engineered human Dicer polypeptide described herein, and one or more pharmaceutically acceptable excipients.

[0105] Another embodiment described herein is a method of engineering a human Dicer protein to have functional ATP hydrolysis and helicase activity, the method comprising: modifying a wildtype human Dicer protein to have one or more functional ATP hydrolysis motifs, one or more functional double-stranded RNA (dsRNA) binding motifs, and one or more functional Hel2— Hel2i— pincer hinge regions to generate an engineered human Dicer polypeptide having functional ATP hydrolysis and helicase activity, wherein: the one or more functional ATP hydrolysis motifs comprise: an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5; the one or more functional dsRNA binding motifs comprise: a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; or a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and the one or more functional Hel2-Hel2i-pincer hinge regions have at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5. In one aspect, the engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, K160N, K160Q, N161Q, N161H, L171V,L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H, P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, I479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13. In another aspect, modifying the wild-type human Dicer protein comprises site-directed mutagenesis, random mutagenesis, amino acid insertion or deletion, protein fusion, or combinations thereof. In another aspect, the engineered human Dicer polypeptide has increased helicase translocation and processivity relative to the wild-type human Dicer protein.

[0106] Another embodiment described herein is a method of treating a viral infection in a subject in need thereof, the method comprising: administering a therapeutically effective amount of an engineered human Dicer polypeptide or a nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide to the subject, the engineered human Dicer polypeptide comprising: one or more functional ATP hydrolysis motifs comprising: an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5; one or more functional double-stranded RNA (dsRNA) binding motifs comprising: a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; or a dsRNA binding motif having at least 90-99% amino acidsequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and one or more functional Hel2-Hel2i-pincer hinge regions having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5. In one aspect, the engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, KWON, K160Q, N161Q, N161H, L171V, L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H, P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, I479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13. In another aspect, the engineered human Dicer polypeptide or nucleic acid comprising the polynucleotide sequence encoding the engineered human Dicer polypeptide is administered to the subject intravenously, intravascularly, intraarterially, intramuscularly, subcutaneously, intranasally, intraperitoneally, or combinations thereof. In another aspect, the engineered human Dicer polypeptide or nucleic acid comprising the polynucleotide sequence encoding the engineered human Dicer polypeptide is administered to the subject as a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients. In another aspect, the polynucleotide sequence encoding the engineered human Dicer polypeptide is comprised in a vector. In another aspect, the vector comprises a lentiviral vector, a retroviral vector, an adenoviral vector, or an adeno-associated virus (AAV) vector. In another aspect, the viral infection produces viral dsRNA that is recognized by the engineered human Dicer polypeptide in the subject. In another aspect, the engineered human Dicer polypeptide reduces viral load in the subject.

[0107] Another embodiment described herein is a kit for treating a viral infection in a subject in need thereof, the kit comprising: the isolated engineered human Dicer polypeptide described herein or an isolated nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide described herein; optionally, injection or infusion materials or devices; optionally, buffers and receptacles; and optionally, one or more of packaging, a label, or instructions for use.

[0108] Another embodiment described herein is the use of an engineered human Dicer polypeptide for treating a viral infection in a subject in need thereof, the engineered human Dicer polypeptide comprising: one or more functional ATP hydrolysis motifs comprising: an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one ofSEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5; one or more functional double-stranded RNA (dsRNA) binding motifs comprising: a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; or a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and one or more functional Hel2-Hel2i-pincer hinge regions having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5.

[0109] It will be apparent to one of ordinary skill in the relevant art that suitable modifications and adaptations to the compositions, formulations, methods, processes, and applications described herein can be made without departing from the scope of any embodiments or aspects thereof. The compositions and methods provided are exemplary and are not intended to limit the scope of any of the specified embodiments. All of the various embodiments, aspects, and options disclosed herein can be combined in any variations or iterations. The scope of the compositions, formulations, methods, and processes described herein include all actual or potential combinations of embodiments, aspects, options, examples, and preferences herein described. The exemplary compositions and formulations described herein may omit any component, substitute any component disclosed herein, or include any component disclosed elsewhere herein. The ratios of the mass of any component of any of the compositions or formulations disclosed herein to the mass of any other component in the formulation or to the total mass of the other components in the formulation are hereby disclosed as if they were expressly disclosed.Should the meaning of any terms in any of the patents or publications incorporated by reference conflict with the meaning of the terms used in this disclosure, the meanings of the terms or phrases in this disclosure are controlling. Furthermore, the foregoing discussion discloses and describes merely exemplary embodiments. All patents and publications cited herein are incorporated by reference herein for the specific teachings thereof.

[0110] Various embodiments and aspects of the inventions described herein are summarized by the following clauses:

[0111] Clause 1. An isolated engineered human Dicer polypeptide comprising:

[0112] one or more functional ATP hydrolysis motifs comprising:

[0113] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5;

[0114] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5;

[0115] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5;

[0116] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5;

[0117] one or more functional double-stranded RNA (dsRNA) binding motifs comprising:

[0118] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5;

[0119] dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5;

[0120] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5;

[0121] dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5;

[0122] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5;

[0123] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5;

[0124] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5;

[0125] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; or a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and

[0126] one or more functional Hel2-Hel2i-pincer hinge regions having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5.

[0127] Clause 2. The isolated engineered human Dicer polypeptide of clause 1 , wherein the isolated engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, K160N, K160Q, N161Q, N161H, L171V, L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H, P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, I479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13.

[0128] Clause 3. The isolated engineered human Dicer polypeptide of clause 1 or 2, wherein the isolated engineered human Dicer polypeptide has at least 90-99% amino acid sequence identity to any one of SEQ ID NO: 1-5.

[0129] Clause 4. The isolated engineered human Dicer polypeptide of any one of clauses 1-3, wherein the isolated engineered human Dicer polypeptide has one or more of increased functional ATP hydrolysis activity, increased helicase activity, increased translocation, or increased processivity relative to a wild-type human Dicer protein of SEQ ID NO: 13. Clause 5. An isolated nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide of any one of clauses 1-4.

[0130] Clause 6. An mRNA comprising the isolated nucleic acid of clause 5.

[0131] Clause 7. A vector comprising the isolated nucleic acid of clause 5.

[0132] Clause 8. The vector of clause 7, wherein the vector comprises a lentiviral vector, a retroviral vector, an adenoviral vector, or an adeno-associated virus (AAV) vector.

[0133] Clause 9. A cell comprising the vector of clause 7.Clause 10. A pharmaceutical composition comprising the isolated nucleic acid of clause 5, and one or more pharmaceutically acceptable excipients.

[0134] Clause 11. A pharmaceutical composition comprising the isolated engineered human Dicer polypeptide of any one of clauses 1-5, and one or more pharmaceutically acceptable excipients.

[0135] Clause 12. A method of engineering a human Dicer protein to have functional ATP hydrolysis and helicase activity, the method comprising:

[0136] modifying a wild-type human Dicer protein to have one or more functional ATP hydrolysis motifs, one or more functional double-stranded RNA (dsRNA) binding motifs, and one or more functional Hel2-Hel2i-pincer hinge regions to generate an engineered human Dicer polypeptide having functional ATP hydrolysis and helicase activity, wherein:

[0137] the one or more functional ATP hydrolysis motifs comprise:

[0138] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or

[0139] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1- 5;

[0140] the one or more functional dsRNA binding motifs comprise:

[0141] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1- 5;

[0142] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1- 5;

[0143] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif I a of any one of SEQ ID NO: 1- 5;

[0144] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1- 5;

[0145] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5;

[0146] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1- 5; or

[0147] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and

[0148] the one or more functional Hel2-Hel2i-pincer hinge regions have at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5.

[0149] Clause 13. The method of clause 12, wherein the engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, KWON, K160Q, N161Q, N161H, L171V, L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H, P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, I479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13.Clause 14. The method of clause 12 or 13, wherein modifying the wild-type human Dicer protein comprises site-directed mutagenesis, random mutagenesis, amino acid insertion or deletion, protein fusion, or combinations thereof.

[0150] Clause 15. The method of any one of clauses 12-14, wherein the engineered human Dicer polypeptide has increased helicase translocation and processivity relative to the wild-type human Dicer protein.

[0151] Clause 16. A method of treating a viral infection in a subject in need thereof, the method comprising:

[0152] administering a therapeutically effective amount of an engineered human Dicer polypeptide or a nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide to the subject, the engineered human Dicer polypeptide comprising:

[0153] one or more functional ATP hydrolysis motifs comprising:

[0154] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or

[0155] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1- 5;

[0156] one or more functional double-stranded RNA (dsRNA) binding motifs comprising:

[0157] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5; a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1- 5;

[0158] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1- 5;

[0159] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif I a of any one of SEQ ID NO: 1- 5;

[0160] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1- 5;

[0161] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5;

[0162] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1- 5; or

[0163] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and

[0164] one or more functional Hel2-Hel2i-pincer hinge regions having at least 90- 99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5.

[0165] Clause 17. The method of clause 16, wherein the engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, KWON, K160Q, N161Q, N161H, L171V, L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H, P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, I479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13.Clause 18. The method of clause 16 or 17, wherein the engineered human Dicer polypeptide or nucleic acid comprising the polynucleotide sequence encoding the engineered human Dicer polypeptide is administered to the subject intravenously, intravascularly, intraarterially, intramuscularly, subcutaneously, intranasally, intraperitoneally, or combinations thereof.

[0166] Clause 19. The method of any one of clauses 16-18, wherein the engineered human Dicer polypeptide or nucleic acid comprising the polynucleotide sequence encoding the engineered human Dicer polypeptide is administered to the subject as a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients.

[0167] Clause 20. The method of any one of clauses 16-19, wherein the polynucleotide sequence encoding the engineered human Dicer polypeptide is comprised in a vector.

[0168] Clause 21. The method of clause 20, wherein the vector comprises a lentiviral vector, a retroviral vector, an adenoviral vector, or an adeno-associated virus (AAV) vector.

[0169] Clause 22. The method of any one of clauses 16-21 , wherein the viral infection produces viral dsRNAthat is recognized by the engineered human Dicer polypeptide in the subject. Clause 23. The method of any one of clauses 16-22, wherein the engineered human Dicer polypeptide reduces viral load in the subject.

[0170] Clause 24. A kit for treating a viral infection in a subject in need thereof, the kit comprising:

[0171] the isolated engineered human Dicer polypeptide of clause 1 or an isolated nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide of any one of clauses 1-5;

[0172] optionally, injection or infusion materials or devices;

[0173] optionally, buffers and receptacles; and

[0174] optionally, one or more of packaging, a label, or instructions for use.

[0175] Clause 25. Use of an engineered human Dicer polypeptide for treating a viral infection in a subject in need thereof, the engineered human Dicer polypeptide comprising:

[0176] one or more functional ATP hydrolysis motifs comprising:

[0177] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5;

[0178] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5;

[0179] an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5;an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5;

[0180] one or more functional double-stranded RNA (dsRNA) binding motifs comprising:

[0181] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5;

[0182] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5;

[0183] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5;

[0184] dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5;

[0185] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5;

[0186] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5;

[0187] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1-5;

[0188] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5;

[0189] a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; or a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and

[0190] one or more functional Hel2-Hel2i-pincer hinge regions having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5.

[0191] EXAMPLES

[0192] Phylogenetic Tree Construction and Ancestral Sequence Reconstruction

[0193] Tree construction and prediction of ancestral sequences was as described. See Aderounmu et al., eLife 12, e85120 (2023). In addition, the Bilaterian Dicer-1 clade of the gene tree was manually constrained to a phylogeny resembling the consensus bilaterian speciesphylogeny. Tree editing was performed with Archaeopteryx software. The species-constrained tree was then rerun through RaxML-NG in evaluation mode to compute likelihood and transfer bootstrap values. The species tree was then used to predict amino acid sequences at select nodes.

[0194] Table 1. Extant and Ancestrally Reconstructed Dicer Helicase Sequences

[0195] >

[0196]

[0197]

[0198]

[0199]

[0200] Cloning, Overexpression and Purification of Recombinant Proteins

[0201] Production of ancestral and extant recombinant constructs was as described in Aderounmu et al. eLife 12: e85120 (2023); Sinha and Bass, Methods 126: 54-65 (2017); Consalvoetal., eLife 13: RP93979 (2024). DNA sequences were codon-optimized forexpression in Spodoptera frugiperda (Sf9) insect cells using Integrated DNA Technologies’ (IDT) codon optimization tool. cDNA sequences were synthesized by IDT with flanking primer sites for subcloning into a modified pFastBac plasmid containing 2x-Strep Flag tag, with NEB HiFi DNA Assembly Kit. Plasmid sequence was confirmed by sequencing (Plasmidsaurus) and transformed into DhIOBac E. coli cells to generate bacmids, for transfection into Sf9 cells to produce baculovirus vectors for protein expression. After 2 rounds of baculovirus scale-up, “P2” baculovirus was used to infect large scale Sf9 cultures for protein production. Baculovirus titer was tracked after each virus amplification step using flow cytometry. Ancestral HELDUF constructs were purified using Strep-Tactin affinity chromatography, heparin chromatography or ion exchange chromatography, and size exclusion chromatography. Ancestral constructs eluted as monomers except ANCDIVERT, which eluted as a mixture of monomers and dimers. Purified constructs were identified with LC / MS / MS at the University of Utah Metabolomics Core.

[0202] ceDCR-1 complexes and dmDcr2 were expressed and purified as described by Sinha and Bass, Methods 126: 54-65 (2017) and Consalvo et al., eLife 13: RP93979 (2024).RNA Synthesis and Sequences

[0203] RNA sequences were produced by chemical synthesis at IDT. Equimolar amounts of ssRNAs were annealed in annealing buffer (50 mM Tris HCI, pH 8.0, 20 mM KCI) by placing the reaction on a heat block (95 °C) and slow cooling > 2 hrs. dsRNAs were gel purified after 8% polyacrylamide native PAGE and quantified using a Nanodrop or scintillation counter for32P-labeled dsRNA.

[0204] Table 2. RNA Sequences

[0205] Name RNA Sequence (5' >3')

[0206]

[0207] 42-nt BLT-BLT GGGAAGCUCAGAAUAUUGCACAAGUAGAGCUUCUCGAUCCCC 14 sense ssRNA

[0208] 42-nt BLT-BLT GGGGAUCGAGAAGCUCUACUUGUGCAAUAUUCUGAGCUUCCC 15 antisense ssRNA

[0209] 42-nt 3'ovr-3'ovr GGGAAGCUCAGAAUAUUGCACAAGUAGAGCUUCUCGAUCCCC 16 antisense ssRNA

[0210] 40-nt 3'ovr-BLT GGAUCGAGAAGCUCUACUUGUGCAAUAUUCUGAGCUUCCCGG 17 sense ssRNA

[0211] 42-nt BLT-BLT

[0212] sense ssRNA 5'- P-GGGAAGCUCAGAAUAUUGCACAAGUAGAGCUUCUCGAUCCCC 18 Phosphate

[0213] 42-nt BLT-BLT

[0214] antisense ssRNA 5'- BIO-GGGGAUCGAGAAGCUCUACUUGUGCAAUAUUCUGAGCUUCCC 19 Biotin

[0215] 42-nt 3'ovr-3'ovr

[0216] antisense ssRNA 5'- P-GGGAAGCUCAGAAUAUUGCACAAGUAGAGCUUCUCGAUCCCC 20 Phosphate

[0217] 40-nt 3'ovr-BLT

[0218] sense ssRNA 5'- BIO-GGAUCGAGAAGCUCUACUUGUGCAAUAUUCUGAGCUUCCCGG 21 Biotin

[0219] 42-nt BLT-BLT P— GGGAAGCUCAGAAUAUUGCACAdAdGdUdAdGdAGCUUCUCGAUCCCC 22 deoxy sense ssRNA

[0220] 42-nt BLT-BLT

[0221] deoxy antisense BIO-GGGGAUCGAGAAGCUCUdAdCdUdUGUGCAAUAUUCUGAGCUUCCC 23 ssRNA

[0222] 27-nt BLT-BLT AUACGUCCUGAUAGUUAGUAUCCAUCG 24 sense ssRNA

[0223] 27-nt BLT-BLT CGAUGGAUACUAACUAUCAGGACGUAU 25 antisense ssRNA

[0224] P- indicates a phosphate moiety; BIO- indicates a biotin moiety;dN indicates a deoxyribonucleotide.

[0225] Thin-layer Chromatography ATP Hydrolysis Assay

[0226] All reactions were performed at 37°C. Reaction mixtures containing 5x cleavage assay buffer (final concentrations: 25 mM Tris HCI, pH 8.0, 100 mM KCI, 10 mM MgCh, 1 mM TCEP) was mixed with 5x ATP (500 pM) and 5x [a-32P] ATP (3000 Ci / mmol, 500 nM). Reactions werestarted by mixing previous solution with 5* dsRNA (2 pM) and 5x protein (1 M). Mixing equal volumes of all listed ingredients resulted in reaction with the following final conditions: 200 nM protein, 400 nM dsRNA, 100 pM ATP and [a-32P] ATP (3000 Ci / mmol, 100 nM). Final reaction volume was incubated and aliquots of 2 pL were removed at indicated times, quenched by addition of 3 pL 500 mM EDTA. 3 pL of stopped reaction was spotted onto pre-washed 20 x 20 cm PEI-cellulose plates (Cel 300 PEI / UV 254 thin-layer chromatography (TLC) Plates 20 x 20, Machery-Nagel, Ref 801063), and chromatographed with 0.75 M KH2PO4 (adjusted to pH 3.3 with H3PO4) until solvent front reached the top of the plate. Plates were dried, visualized on a phosphorimager screen (Molecular Dynamics), and quantified using ImageQuant version 8 software. Data was analyzed and visualized with GraphPad Prism Version 10.2.3.

[0227] Colorimetric ATP Hydrolysis Assay

[0228] These ATP hydrolysis reactions used the Quantichrom ATPase / GTPase Assay Kit (BioAssay Systems). Reactions were at 37 °C in 108 pL with cleavage assay buffer (final: 25 mM Tris HCI, pH 8.0, 100 mM KCI, 10 mM MgCI2, 1 mM TCEP), 2 pM dsRNA and 0.05-2 mM ATP; AncD1D2 was 25 nM due to high ATP hydrolysis observed in TLC plate assays, but AncDlsnAT and AncDlDEUT were 100 nM. Reaction mix of protein and dsRNA was preincubated at 37 °C for 5 minutes before addition of ATP to start reaction. At timepoints, 18 pL was removed and added to 2 pL of 500 mM EDTA to quench. As control, reaction mix of cleavage buffer and ATP was incubated alongside. 20 pL reactions were plated on 96-well plates, and control was plated in duplicate. Phosphate standards were prepared as specified in assay kit, and 20 pL of each were plated. After plating, 100 pL of colorimetric reagent from the assay kit was added to each well, incubated for 30 minutes, and read on a Biotek Synergy Neo2 plate reader at 620 nm. If necessary to fall within standard curve, reactions were diluted by four with water when plating. OD62O values were fit to a linear regression, where velocity is equal to slope: ADP produced (pM) = velocity (pM / min) x time (min).

[0229] Velocities for each ATP concentration were fit to the Michaelis-Menten equation: Y - Etkcat / ( / <M + ), where Etis protein concentration (pM); feat is turnover number; X is ATP concentration (mM); and KM is the Michaelis-Menten constant. The analysis was performed usingGraphPad Prism Version 10.2.3.

[0230] Streptavidin-Displacement Assay

[0231] Reactions were at 37 °C in 100 pL translocation assay buffer (final: 25 mM HEPES, 10 mM Mg(OAc)2, 1 mM TCEP). Reaction mixtures were prepared by incubating 1 nM32P-labeleddsRNA with 2 pM tetravalent streptavidin for 30 minutes. For reactions with ATP excluded, 0.010 units of hexokinase and 10 mM glucose were added to deplete contaminating ATP. For reactions with ATP, 5 mM ATP was added.

[0232] Reactions were started by adding 1 mM biotin and 200 nM protein, except ceDCR-1 complexes which were 50 nM protein. At indicated times, 12 pL was removed and added to 3 pL of 5x stop buffer (final: 25 mM EDTA, 0.2% SDS, 10% glycerol, xylene cyanol, bromophenol blue). For AncD1D2, 2 pM unlabeled trap dsRNA was added to stopping buffer to dislodge helicasebound dsRNA and facilitate quantification of streptavidin-bound dsRNA. For ceDCR-1 / DRH-1 / RDE-4 complexes and dmDcr2RI", reactions were at 20 °C and 25 °C respectively. Stopping reaction mix was fractionated on 10% native 19:1 polyacrylamide gel, visualized on a phosphorimager screen, and quantified with ImageQuant version 8.

[0233] Radioactivity in gels was quantified to determine fraction of streptavidin-bound and free dsRNA. The percentage of streptavidin displaced = (free dsRNA / streptavidin-bound dsRNA) x 100.

[0234] The rate constant, kobs, was determined by fitting data to a pseudo-first order rate equation: y = yo + A x (1-e-w). where y is % streptavidin displaced; yo is baseline (~0); k is rate constant; t is time in min; and A is amplitude.

[0235] Electrophoretic Mobility Shift Assay

[0236] Electrophoretic mobility shift assays (EMSAs) were conducted with 500 pM 42-basepair BLT dsRNA, with the 5'-terminus of the sense strand labeled with32P. Ancestral helicases were serially diluted in binding buffer (25 mM Tris HCI, pH 8.0, 100 mM KCI, 10 mM MgCl2, 10% [vol / vol] glycerol, 1 mM TCEP) to reach final concentrations of 0-1 pM for AncD1D2, 0-5 pM for AncD1BiLAT, 0-10 pM for AncD1DEUT- Labelled dsRNA was incubated with helicase dilutions in the presence of 5 mM ATP-Mg(OAc)2for 30 minutes at 37 °C, and the reaction was stopped by loading directly onto a 5% native polyacrylamide gel (19:1 acrylamide / bisacrylamide) in 0.5x Tris-borate-EDTA (TBE) running buffer. Gels were pre-run for 30 minutes before loading. Gels were electrophoresed (2 hr) at room temperature to resolve HELDUF bound to dsRNA from free dsRNA, dried (80 °C, 1 hr) and exposed overnight to a phosphorimager screen (Molecular Dynamics). The dsRNA fraction that ran most slowly in the gel was attributed to bound dsRNA.

[0237] Radioactivity in gels corresponding to dsRNAtotal and dsRNAfree was quantified using ImageQuant version 8 software to determine the fraction of dsRNA bound (Fraction bound = 1 -(dsRNAfree / dsRNAtotal). To determine Kdvalues, binding isotherms were fit using the Hill equation, where fraction bound = 1 / (1 + [ d', / [P]n]); Kd- equilibrium dissociation constant; n - Hillcoefficient; and [P] = protein concentration. GraphPad Prism version 10.3.1 was used for the curve-fitting analysis.

[0238] Cryo-EM Sample Preparation and Data Collection

[0239] Samples were prepared by mixing AncD1D2 with 27-bp BLT dsRNA and incubating with appropriate nucleotide as described. For A0ground(AncD1D2 with dsRNA, no nucleotide), sample was prepared by mixing 6 pM AncD1D2 with 7 pM 27-bp BLT dsRNA and incubated on ice for ~30 minutes before application to grid. For Bend* (AncD1D2 with dsRNA, ADP-AIFX), 3 pM AncD1 D2 was incubated with 5 pM 27-bp BLT dsRNA and a cocktail containing MgCL, AI(NC>3)3, NaF and ATP at 37 °C for 30 minutes. For Cpost'closedand Dpost ground(AncD1 D2 with dsRNA, ATP), 6 pM AncD1D2 was incubated with 15 pM 27-bp BLT dsRNA and 2 mM ATP at 37 °C for -5 minutes and then transferred to ice for ~30 minutes before application to grid for blotting. For E'ntemait (AncD1D2 with dsRNA, ADP-AIFx), 3 pM AncD1D2 was incubated with 5 pM 27-bp BLT dsRNA and a cocktail containing MgCL, AI(NO3)3, NaF and ATP at 37 °C for ~20 minutes and transferred to ice before application to grid. For AncD1DEUT, 4.5 pM was incubated with 15 pM 27-bp BLT dsRNA and 2 mM ATP at 37 °C for -10 minutes and transferred to ice or incubated on ice overnight, before application to grid.

[0240] For AncD1D2 cpost groundand Dpost closed, Quantifoil R1.2 / 1.3 Cu300 mesh grids (SPT Labtech) were glow discharged for 100 s at 25 mA using a Pelco easiGlow unit (Ted Pella, Inc.) and 3 pL of freshly prepared sample was applied to grids and blotted with filter paper (595 Filter Paper, Ted Pella, Inc.) for 7 s using a Mk II Vitrobot (Thermo Fisher Scientific). For AHCDIDEUT and AncD1D2 A0ground, Bend* and Einternal*, 3 pL of freshly prepared sample was applied to glow discharged Quantifoil R1.2 / 1.3 Cu400 mesh grids and blotted with filter paper (595 Filter Paper, Ted Pella, Inc.) for 5 s using a Mk IV Vitrobot (Thermo Fisher Scientific). Vitrobot conditions were set to 100% humidity, 4 °C temperature, 25s wait time and -1 mm offset. Grids were plunged into liquid ethane and frozen grids were transferred and stored in liquid nitrogen until data collection.

[0241] Cryo-EM Data Acquisition

[0242] Cryo-EM movies for all samples were recorded using EPU automated software (Thermo Fisher Scientific) on a 300 keV Titan Krios transmission electron microscope (Thermo Fisher Scientific) equipped with a post-GIF K3 direct detector (Gatan, Inc). State A (no nucleotide) and states C-E samples were collected at super-resolution with a nominal magnification of 105,000* corresponding to a calibrated pixel size of 0.436 A / pix. State B samples were collected at a nominal magnification of 105,000* in counting mode, corresponding to a calibrated pixel size of0.872 A / pix. All samples were imaged with a defocus range of -0.8 pm to -2.4 pm at a total dose of 40 electrons / A2and 50 frames per movie.

[0243] Cryo-EM Data Processing

[0244] All datasets were processed through cryoSPARC v4. Cryo-EM movie frames were dose-weighted and beam-induced motion corrected (super-resolution movies were Fourier binned 2x). CTF parameter estimation was performed with Patch CTF Estimation. Motion-corrected micrographs were based on CTF fit resolution with a 5 A cutoff and manual inspection.

[0245] For state A0ground, a total of 12,548,917 particles were selected from 11,003 micrographs, with a blob picker with particle diameter restraints of 60-120 A. Particles were initially extracted with a box size of 320 pixels and Fourier cropped 4* to 80 pixels. After multiple rounds of 2D classification to discard junk and low-resolution particles, 951,277 particles were re-extracted at a box size of 320 pixels and used to generate 3D volumes with Ab initio 3D reconstruction. Volumes corresponding to a singlet and doublet helicase on 27-bp BLT dsRNA were used to perform heterogeneous reconstructions. 260,444 particles sorted into the doublet helicase volume were used as input for Topaz to identify more particles in this doublet state. Particles from the other heterogenous refinement classes were also independently used to train Topaz. Newly extracted particles from Topaz were combined to run another round of heterogeneous refinement which yielded a doublet helicase class containing 303,540 particles. Non-uniform refinement followed by local refinement was then performed with a mask around the higher resolution helicase in the doublet resulting in a 3.4 A map.

[0246] For state Bend*, a total of 23,429,138 particles were selected from 11,834 micrographs, with a blob picker with particle diameter restraints of 60-120 A. Particles were initially extracted with a box size of 288 pixels and Fourier cropped 4* to 72 pixels. After multiple rounds of 2D classification to discard junk and low-resolution particles, 435,015 particles were re-extracted at a box size of 288 pixels and used to generate 3D volumes with Ab initio 3D reconstruction. Two volumes corresponding to a singlet helicase on 27-bp BLT dsRNA were used to perform heterogenous reconstructions. 240,370 particles were sorted into a class with intact helicase features bound to the end of dsRNA. This particle set was used to train Topaz and the reextracted particles were subject to a second round of heterogeneous refinement. The resulting 380,191 particles were used as input for non-uniform refinement followed by local refinement around the helicase domain to generate a density map with 3.4 A global resolution at 0.143 FSC threshold.

[0247] For states cpos, closedand Dpost ground, a total of21,532,216 particles were picked from 15,138 micrographs, with a blob picker with particle diameter restraints of 60-120 A. Particles wereextracted with a 288-pixel box size, Fourier-binned 4* to 72 pixels and subjected to multiple rounds of 2D classification. The resulting 2,256,542 particles were reextracted at a box size of 288 pixels and used to generate eight heterogeneous refinement classes after ab initio reconstruction. Four of the classes contained intact AncD1D2 helicases bound to dsRNA while the remaining particles contained AncD1D2 bound to dsRNA but missing Hel2i, likely due to flexibility of Hel2i as observed with the state A°9roundand Bend* structures. The intact AncD1D2 particles were subjected to focused 3D classification resulting in 4 classes, 2 of which were combined to form the consensus state D density map after non uniform refinement and local refinement. Of the remaining two classes, state C and state D.3 were generated after non uniform and local refinement. AncD1D2 particles missing Hel2i were also subject to 3D refinement, and a single class (state D.4) was subject to non-uniform refinement followed by local refinement to generate a high-quality density map with a global resolution of 3.2 A at 0.143 FSC threshold.

[0248] For state Einternal:t, a total of 12,806,533 particles were selected from 7,335 micrographs, with a blob picker with particle diameter restraints of 60-120 A. Particles were initially extracted with a box size of 320 pixels and Fourier cropped 4* to 80 pixels. After multiple rounds of 2D classification to discard junk and low-resolution particles, 639,691 particles were re-extracted at a box size of 320 pixels and used to generate 3D volumes with Ab initio 3D reconstruction. Volumes corresponding to a singlet and doublet helicase on 27-bp BLT dsRNA were used to perform heterogeneous reconstructions. 261,953 particles sorted into the doublet helicase volume were used as input for Topaz to identify more particles in this doublet state. Particles from the other heterogeneous refinement classes were also independently used to train Topaz. Newly extracted particles from Topaz were combined to run another round of heterogeneous refinement which yielded a doublet helicase class containing 171,095 particles. Non-uniform refinement followed by local refinement was then performed with a mask around the higher resolution helicase in the doublet resulting in a 3.1 A map.

[0249] Model Building Refinement and Validation

[0250] The AlphaFold 2 predicted model of AncD1D2 (Table 3) was used as starting point for initial model building followed by manual adjustment in Chimera, ChimeraX and COOT. ADR Mg and AIFXwere built and refined in PHENIX using the Ligand Fit tool. RNA nucleotides were fit manually using DeepEMhancer sharpened maps. All models were refined and validated against their respective density maps in PHENIX using the real space refinement tool and Molprobity.

[0251] Table 3. Cryo-EM Data Collection, Refinement and Validation StatisticsStructure State A State B State C State D State E EMDB Accession EMD-48678 EMD-48691 EMD-48697 EMD-48708 EMD-48710 PDB Accession ID 9MW6 9MW7 9MW8 9MX3 9MX5 Data Collection and Processing

[0252] Microscope Titan Krios G3

[0253] Voltage (kV) 300

[0254] Detector Gatan K3

[0255] Nominal Magnification

[0256]

[0257] Total Number of

[0258]

[0259] Frames

[0260] Total Electron

[0261]

[0262] Exposure (e_ / A2)

[0263] Defocus Rangen„9 A

[0264] (pM) -0.8 to -2.4

[0265] Number of 15,138 15,138 7,335 Micrographs

[0266]

[0267] 0.436 0.436 0.436 0.436 Pixel size (A) (super- 0.872 (super- (super- (superresolution) resolution) resolution) resolution) Symmetry Imposed Ci Ci Ci Ci Ci Initial Number of 12,548,917 23,429,138 21,532,216 21,532,216 13,806,533 Particles ’ ’ ’ ’ ’ ’ ’ ’ ’ ’ Final Number of 303,540 380,191 315,941 510,474 171,095 Particles ’

[0268] Map Resolution

[0269] (masked, 3.4 3.4 3.3 3.0 3.1 corrected) (A)

[0270] FSC Threshold 0.143 0.143 0.143 0.143 0.143Map Resolutlon2.0-11.9 2.0—41.0 1.9-8.7 1.9-31.8 1.9-7.0 range (A)

[0271] Refinement

[0272] Initial Model Used AlphaFold 2 AlphaFold 2 AlphaFold 2 AlphaFold 2 AlphaFold 2

[0273] 4.2 4.4 4.2 3.4 3.5

[0274]

[0275] Model Composition

[0276] Non-hydrogen 54735,504 6,419 5929 6,463 Atoms

[0277] Protein Residues 535 535 647 641 652 RNA Residues 54 54 54 33 54 ADP / AF3 / Mg / 0 / 0 / 0 1 / 1 / 0 1 / 0 / 1 1 / 0 / 0 1 / 1 / 1R.M.S Deviations

[0278] Bond Lengths (A) 0.002 0.002 0.002 0.003 0.003 Bond Angles (°) 0.566 0.619 0.634 0.634 0.555 Validation

[0279] Molprobity Score 1.92 2.25 1.96 1.81 1.91Clashscore 10.04 16.09 13.58 6.90 10.04 Poor / Outher o.41 1.01 1.33 1.68 1.32 rotamers (%)

[0280] Ramachandran Plot

[0281] Favored (%) 94.16 90.58 96.59 96.24 95.69 Allowed (%) 5.84 9.23 3.26 3.76 4.15 Outliers (%) 0.00 0.19 0.16 0.00 0.15

[0282] Ancestral Protein Reconstruction Using Alternative Dicer Helicase Phylogeny

[0283] The maximum likelihood (ML) phylogenetic tree of prior studies fit best with a model where an early metazoan Dicer (AncD1 D2) underwent a gene duplication to produce Dicer-1 and Dicer-2, and one copy was lost in most modern animals. While this model is supported by multiple lines of phylogenetic evidence, finer details of the ML tree did not fit the species tree of life, either due to incomplete lineage sorting or long branch attraction. This is not unexpected since the ML tree, or “gene” tree, was based on phylogenetic analyses of only two domains (helicase and DUF283, FIG. 1D) of the Dicer gene, while species trees are typically built from multigene or whole genome datasets. Dicer gene duplications and subsequent gene loss could also explain the gene treespecies tree incongruence.

[0284] To identify the evolutionary windows where Dicer helicase functions were lost, phylogenetic tree reconstruction was repeated using the helicase domain and DUF283 (henceforth referenced as helicase) and the Dicer-1 clade of the tree was constrained to match evolutionary relationships from the consensus tree of life (FIG. 1E). While the species tree recapitulated some clade relationships of the gene tree, some nodes were replaced by new nodes in the species tree, providing the opportunity to perform additional analyses FIG. 2A-B). Addition of the hypothetical ancestor of bilaterian Dicer-1 (AOCDIBILAT) was particularly advantageous, offering the opportunity to determine whether loss of ATP-dependent functions is unique to deuterostomes and their vertebrate descendants, or if the trend extends into invertebrate protostomes. Interestingly, ancestral vertebrate Dicer-1 (AOCDIVERT) primary sequence remained identical when predicted from either tree. APR is inherently inexact as phylogenies and reconstructed enzymes are statistical hypotheses with a degree of uncertainty. Here, the similarity in biochemical trends between ancestral constructs from gene and species trees, even when equivalent nodes produce different sequences, lends additional confidence to the conclusions drawn from these trends.

[0285] Ancestral Animal Dicer Helicase Translocates on dsRNATo determine whether ancient animal Dicers translocate on dsRNA, a gel-based streptavidin-displacement assay was adopted that monitors the ability of translocating helicases to remove dsRNA-bound streptavidin (FIG. 3A). dsRNA was32P-labeled at the 5'-end of the sense (top) strand to allow visualization of radioactive species on a native gel and conjugated with biotin at the 5'-end of the antisense (bottom) strand to allow streptavidin binding (FIG. 3B, FIG. 4).

[0286] AncD1D2 displayed robust translocation on dsRNAs with blunt (BLT) and 3'-overhang (3'ovr) ends (FIG. 3B-C, Table 4). With BLT dsRNA, some ATP-independent streptavidin displacement was observed (FIG. 3B, Left). Possibly AncD1D2 binds to ends as well as internal regions of BLT dsRNA, leading to stacking of multiple helicases, even without ATP, which in turn displaces streptavidin. This phenomenon was not observed with 3'ovr (FIG. 3B, Right), or any other ancestral proteins. Quantification of multiple assays revealed that the bilaterian ancestor, AncDlBiLAT, also exhibited translocation activity, albeit reduced from AncD1D2, for both BLT and 3'ovr dsRNA (FIG. 3C, FIG. 5A and Table 4). AncD1 DEUT, the deuterostome descendant of bilaterian Dicer-1, showed minimal displacement activity, with or without ATP (FIG. 3C, FIG. 5B). In these assays, dsRNA with a 5'-monophosphate was used, based on observations from invertebrate Dicers, which do not require a specific 5'-phosphorylation state. Further, while a 5'-triphosphorylated BLT dsRNA terminus is optimal for RIG-I, the domain responsible for recognition of triphosphates in RIG-I, the CTD, is not found in Dicers. BLT dsRNA was used to mimic viral dsRNA and 3'ovr to mimic cellular pre-miRNA for in vitro Dicer helicase assays. A third class of Dicer substrates, the endogenous (endo) siRNA precursors, typically have structured, frayed or closed loop ends that require cofactors like Loqs-PD to promote helicase engagement.

[0287] Table 4. Parameters for ATP Hydrolysis, dsRNA Affinity, and Translocation

[0288] Amlit r'nnrli inn Condition " (RNA) ' ' >

[0289] c

[0290]

[0291] AncD1D2 _ 0.07 ±

[0292] (none) 0.03

[0293] AncD1D2 19.7 ± 0.18 ± 358 ± 293 ±7R0.20 ±

[0294]

[0295]

[0296] (BLT) 3.5 0.04 51 128 0.05 AncD1D2 17.6 ± 0.24 ± 203 ± 106 ± 0.18 ±

[0297]

[0298]

[0299] (3'ovr) 1.3 0.03 30 62 0.06 AncD1BiLAT 0.08 ±

[0300] (none) " 0.04

[0301] AncD1BiLAT 13.3 ± 0.17 ± 172 ± 284 ±

[0302]

[0303] 0.03 ±

[0304]

[0305] (BLT) 3.4 0.02 20 104 0.03AncD1BiLAT 11.8 ± 0.12 ±7,i in126 ± 0.03 ± (3'ovr) 3.6 0.0173 ± 1° 720 570.0325AOCDIDEUT 0.07 ±

[0306] (none) 0.02

[0307] AOCDIDEUT 10.0 ± 0.09 ±7„ Q 114 ± _ QGC ,, H

[0308] (BLT) 1.0 0.0276 1 9520 66 965 u d' AncD1DEUT 5.8 ± 0.07 ± 129 ± 700 ± , ,o.

[0309] (3'ovr ) 1.2 0.02 23 2960 18 U dAHCDINEM 0.04 ±

[0310] (none) " 0.01

[0311] AHCDINEM 1.5 ± 0.04 ±

[0312]

[0313] (BLT) 0.9 0.02 AHCDINEM 1.2 ± 0.04 ± .

[0314] (3'ovr) 1.0 0.02u a- u.d. - undetectable

[0315] AncDIvERT did not translocate on dsRNA, consistent with the absence of ATPase activity (FIG. 3C, FIG. 5C). A similar loss of translocation was observed with AHCDINEM, the common ancestor of protostome nematode Dicer-1 (FIG. 3C, FIG. 5D). This independent loss along two descendant lineages of AncD1BiLAT suggests the decline in helicase function between AncD1 D2 and AncD1BiLAT progressed until dsRNA translocation activity was lost in modern Dicer-1. While the ancestor of Arthropod Dicer-1 was not tested, loss of helicase function can be confidently predicted based on the degeneration of Dicer-1 ATPase sequences in modern arthropods.

[0316] ATP hydrolysis and dsRNA binding assays were performed to determine how these reactions underpin the trends in dsRNA translocation. Using a thin-layer chromatography (TLC) assay, multiple-turnover ATPase assays were performed with 100 pM ATP and the ancestral protein, with and without excess dsRNA. Like the gene tree constructs, ancestral Dicer helicases from the species tree required dsRNA to catalyze robust ATP hydrolysis (FIG. 3D, FIG. 6A). However, subtle differences in hydrolysis efficiency did not mirror the larger differences observed in dsRNA translocation between AncD1D2, AncD1B|LAT, and AncD1DEUT (FIG. 3C-D, FIG. 6 and Table 4). Michaelis-Menten analyses on select ancestral helicases were also performed. A -twofold to three-fold decrease in the efficiency of hydrolysis ( / rCat / / <M) was observed from AncD1D2 to AncD1BiLAT (FIG. 3E, Table 4). For AHCDIDEUT, the net kcat / KMvalue was similar to AncD1BiLAT for BLT dsRNA but reduced by -threefold for 3'ovr (FIG. 3E, Table 4). The preservation of some ATP hydrolysis in AncD1 DEUT suggested its lack of translocation could not be entirely explained by loss of hydrolysis.

[0317] Both ATP hydrolysis assays were performed with excess dsRNA compared to protein (multiple turnover conditions) to minimize contributions of dsRNA affinity to observed differences. Due to practical limitations, the translocation assay was performed with excess protein (singleturnover). To assess effects of dsRNA binding on translocation trend, gel shift assays incubating AncD1D2, AncD1BiLAT, or AHCDIDEUT with BLT dsRNA in the presence of ATP were performed, using conditions similar to the translocation assay. AncD1D2 had a dissociation constant (D) of 79 nM compared to 140 nM for AOCDIBILAT and 942 nM for AncDloEUT (FIG. 3F, FIG. 7). The gel shift results indicate that progressive decline in translocation from AncD1D2 to AOCDIBILAT to AncD1DEUT is related to loss of dsRNA affinity as the Dicer-1 helicase evolved. Thus, while ATP hydrolysis also declines along the Dicer-1 clade, the inability to detect translocation in ADCDIDEUT may also be attributed to reduction of dsRNA affinity. Possibly, the streptavidin-displacement assay is not sensitive enough to capture translocation below a certain limit of detection. However, as discussed subsequently, cryo-EM analyses suggest AOCDIDEUT is truly incapable of translocation even when bound to dsRNA. Importantly, ancestral Dicer helicases from the gene tree show a similar trend in streptavidin displacement activity. Ancient AncD1D2 and AncDl RTH / LOPH / DEUT helicases translocate along dsRNA (FIG. 8), but this activity is progressively lost along the Dicer-1 clade, mirroring decline in dsRNA affinity and ATP hydrolysis and accounting for some of the inherent uncertainty in APR.

[0318] C. elegans Dicer Recruits an RLR, DRH-1, for Translocation in the Antiviral Complex ceDCR-1 functions in multiple pathways in vivo, and when targeting viral dsRNA, functions in the antiviral complex with an RLR helicase, DRH-1 , and a dsRNA binding protein, RDE-4 (FIG.

[0319] 1C). ATP hydrolysis by both helicases is required for cleavage, but ceDCR-1 hydrolysis is far less efficient than DRH-1 hydrolysis, consistent with the decline in hydrolysis and translocation observed in AncDlNEM. Structural data in the recent study show DRH-1 localized to internal regions of dsRNA, suggesting that it fuels translocation of the antiviral complex. To understand how modern C. elegans antiviral complex translocates, the streptavidin-displacement assay was used. Translocation was quantified with the C. elegans antiviral complex using extant dmDcr2 as control. dmDcr2 acts as a single protein to cleave viral dsRNA in fruit flies, and in vitro studies show it couples ATP hydrolysis to translocation. To focus on translocation, for both organisms, mutations were made in Dicer to eliminate RNase III cleavage activity (FIG. 9A-B). Robust ATP-dependent translocation was observed for the ceDCR-1RIII / DRH-1 / RDE-4 complex, as well as dmDcr2RI", although the C. elegans antiviral complex was more efficient, showing similar levels of translocation at lower protein concentrations (FIG. 9A-B, FIG. 10A-B). Consistent with prior studies of cleavage and ATP hydrolysis catalyzed by the ceDCR-1 antiviral complex and dmDcr2, translocation was more efficient with BLT than 3'ovr dsRNA (FIG. 9B).To delineate contributions of each protein of the antiviral complex to translocation, a version of the assay was developed that did not require RNase III mutation, using 42-bp dsRNAs with deoxynucleotides at predicted ceDCR-1 cleavage sites (FIG. 4 and FIG. 11). Wildtype C. elegans antiviral complex showed ATP-dependent streptavidin displacement on this substrate, with minimal dsRNA cleavage (FIG. 9C). A point mutation in the Walker A motif of DRH-Ts helicase domain (DRH-1K320A) abolished all translocation activity, while mutating the Walker A motif in ceDCR-1 (ceDCR-1G36R), or omitting RDE-4 from the complex, did not affect translocation (FIG. 9D-F). Thus, DRH-1 , not ceDCR-1, is responsible for translocation by the antiviral complex. While ceDCR-1 helicase mutant retained streptavidin displacement activity, it did not cleave dsRNA (compare FIG. 9C-D), suggesting that ceDCR-Ts helicase retains an ATP-dependent activity important for cleavage.

[0320] AncD1 D2 Undergoes ATP-Dependent Conformational Changes That Are Coupled to Translocation

[0321] To understand how active ancient Dicer helicase used ATP hydrolysis to move on dsRNA, cryo-EM structures of AncD1D2 bound to 27-bp BLT dsRNA were determined without nucleotide, with ADP-aluminum fluoride (ADP-AIFx), and with ATP, at resolutions 3.0 to 3.5 A (FIG. 12-17 and Table 2). Image processing recovered five structural snapshots: state A0ground(no nucleotide, ground state), state Bendt(endbound transition state), state cpost closed(post hydrolysis closed state), state Dpos,’9round(post hydrolysis ground state) and state Einterna|t (internal transition state) (FIG. 12). Each state represented a unique conformation of the helicase as it cycles through ATP hydrolysis and couples this to motor function. Consistent with prior models, the tandem RecA domains, Hell and Hel2, were wrapped around dsRNA in a C-shape with the C-terminal dsRBM fold, DUF283, which is connected to Hel2 by a pincer domain (FIG. 12A-E, far left column). Hel2i, an SF2 helicase-specific insertion between Hell and Hel2, was not visible in states A0groundand Bendt, likely due to flexibility, but was observed in states C-E. As AncD1D2 progresses through the ATPase cycle, the Hell a-helix containing motif la, termed the spring helix, and the Hel2 helix containing motif IVa, termed the loop helix for its connection to the Hel2 loop, moved relative to each other to switch between semiclosed and closed conformations (FIG. 12A-E, second column).

[0322] In state A0ground, AncD1 D2 was bound near the dsRNA terminus with backbone amines of G93 of motif lb and V70 of motif la contacting phosphate oxygens of the 3'-terminal P27 and P26 respectively (FIG. 12A, dsRNA position column). In Bendt, cpost closedand Eintemall:, V70 was shifted, but still interacting near the dsRNA terminus, while Dpost ground, was positioned at an internal dsRNAsegment, with V70 contacting P19 (FIG. 12A-E, dsRNA position column). Combining information from the position of AncD1D2 on dsRNA, the relative positions of spring and loop helices, and the orientation of nucleotide in the ATPase pocket, allowed correlation of each snapshot with stages of theATPase cycle (FIG. 12A-E, nucleotide state column).

[0323] ATP-Stimulated Closure of the Helicase Is the First Step in AncD1 D2 Translocation

[0324] In state A0ground, Hell (motifs la, lb) and Hel2 (motifs IVa, IVb, V) contact the end of 27-bp dsRNA with ~8-bp footprint (FIG. 18A, FIG. 13A). To interpret helicase movement along dsRNA as AncD1D2 cycles through ATP binding, hydrolysis, and product release, initial Hell-bound 3'-strand phosphates were assigned as P1 and P2. In A0ground, motif lb (92-VGDMD-96 of SEQ ID NO: 3) binds the first 3'-phosphate (P1, equivalent to P27 in FIG. 12) and motif la (68-NTV-70 of SEQ ID NO: 3) binds the adjacent phosphate (P2) while motif IVa (406-IVGH-409 of SEQ ID NO: 3) binds P3 (FIG. 18A). Motif V contacts the next phosphate and ribose (FIG. 13A). This contiguous interaction between the helicase domain and the first four phosphates on the 3'-strand is the ground state configuration prior to addition of ATP. In this conformation, the ATPase cleft between Hell and Hel2 is semiclosed, as determined by the distance separating the spring helix and loop helix (FIG. 18A).

[0325] ATP, NaF, and AI(NO3)s were added to generate ADP-AIFx and mimic the transition state of a helicase-bound ATP. This led to state Bendtand showed closure of the ATPase cleft around the ATP analog, switching the helicase from the ground state to the transition state (compare FIG.

[0326] 5A with FIG. 18B). The spring and loop helices moved closer together to bridge ATP, causing Hell to move 3'-to-5’ to form the high energy transition state (FIG. 18A-B, FIG. 13A-B). V70 and H409 are moved into proximity in the transition state where they both contact P2.

[0327] ATP Hydrolysis Is Coupled to Helicase Movement Along 3'-Tracking Strand

[0328] For Dicer’s helicase to translocate, it needs to progress beyond the transition state by coupling ATP hydrolysis to motion that results in net 3'-to-5' movement. To visualize active translocation, AncD1 D2 was incubated with 27-bp BLT dsRNA and ATP at 37 °C for 5 to 10 min before freezing grids. Multiple cryo-EM structures were solved that showed AncD1 D2 in internal dsRNA segments with ADP in theATPase pocket indicating a post-ATP hydrolysis state. Focused 3D classification yielded a unique class density depicting a helicase conformation close to the dsRNA terminus, cpostclosed, where Hell and Hel2 remained in the closed conformation. V70 and H409 contact P3 instead of P2, indicating movement of the helicase by one nucleotide in the 3'-to-5’ direction compared to Bend* (FIG. 18C, FIG. 13C; FIG. 16A). The presence of ADP indicatesthat cpost closedrepresents the helicase conformation following removal of the scissile y-PCU from ATP. CP°st closedis a structural snapshot not previously reported, and establishes that the helicase moves in the 3'-to-5' direction while the ATPase cleft is still closed. This observation offers insight relevant to other dsRNA-stimulated SF2 helicases.

[0329] Multiple attempts to capture AOCDIDEUT in the translocation state yielded 2D classes with density for the helicase exclusively at the dsRNA terminus. Orientation bias of the frozen sample prevented reconstruction of high-resolution 3D density maps, but 2D classes support biochemical assays and show a lack of translocation despite conditions promoting dsRNA terminus binding (FIG. 19A-B). Possibly AncD1DEUT is missing an essential helicase component that enables coupling of hydrolysis to translocation or is incapable of sustaining binding to internal dsRNA regions and dissociates rapidly FIG. 19C).

[0330] AncD1 D2’s Transition from Closed to Semiclosed Completes Translocation Along One Base-Pair Remaining 3D classes from the post-ATP hydrolysis dataset show AncD1D2 in internal dsRNA regions (FIG. 13D and 16A). The consensus model, with all subdomains visible, is assigned as state Dpost ground(FIG. 18D, FIG. 16A). In Dpost ground, spring and loop helices are in the semiclosed conformation of the ground state, despite presence of ADP in the ATPase pocket (FIG.

[0331] 18D, FIG. 13D). This observation suggests progression from C to D is the final stage of the ATPase cycle: relaxation to ground state. The return of Hell and Hel2 to ground state changes contacts between spring and loop helices, and the dsRNA tracking strand (FIG. 18C-D). In Cpost, dosed H409 sidechain (IVa) contacts the same P3 backbone phosphate as V70, but in Dpost, ground H409 has drifted away from P3 in the 3'-to 5' direction (FIG. 18D). Hell, now disconnected from Hel2, appears to pull on P3 as it relaxes in the 5'-to-3' direction, while Hel2 drifts back to its ground state in the opposite direction.

[0332] Comparison of Dpost’groundsubclasses (D.1 to D.4) showed the Hel2 loop adopting different positions, while the remainder of the helicase remained roughly identical (FIG. 16Aand FIG. 20A). These Hel2 loop movements changed H409 contacts in different state D subclasses (FIG. 20A-B). The Hel2 loop also contacts the Hel2i bundle via salt bridges in proximity to conserved residues (FIG. 20C-D) and widens the dsRNA major groove as it transitions from the dsRNA terminus to internal segments (FIG. 21A-B). dsRNA bending caused by major groove expansion enables extensive contacts between internal dsRNA and DUF283 that may contribute to AncD1 D2 translocation by facilitating binding to internal dsRNA (FIG. 13D, FIG. 21C-D). AncD1D2 DUF283, as in dmDcr2, contacts the dsRNA minor groove and major groove with dsRBM region 1 and region 3 residues respectively (FIG. 21C-D). Previous analysis of dmDcr2 structuresattributed dsRNA bending to an extended Hel2i loop contacting dsRNA at the expanded major groove. However, AncD1D2 lacks the extended Hel2i loop, suggesting that dmDcr2’s Hel2i loop is a modern adaptation for improving dsRNA contact. Indeed, Hel2i in structures of dmDcr2 bound to Loqs-PD, a Dicer cofactor, is rotated ~9.4 A toward dsRNA at an angle of -12.5° compared to Hel2i from AncD1D2 (FIG. 22). Loqs-PD binds dmDcr2 at the Hel2-Hel2i-pincer junction where it modulates helicase function, possibly by coordinating Hel2i movement. Hel2i’s proximity to dsRNA in the dmDcr2 structure permits contact with the dsRNA terminal 5' phosphate, and the absence of anchoring interactions mediated by either the extended Hel2i loop or the presence of Loqs-PD may explain why AncD1D2 Hel2i is too flexible for cryo-EM observation in endbound states A and B. Conversely, Hell, Hel2, and DUF283 adopt similar positions for dmDcr2 and AncD1D2 (FIG. 22).

[0333] To further visualize the impact of ATPase pocket closure on Hell and Hel2, a 3.1 A cryo-EM structure of AncD1D2 bound to ADP-AIFXin Eintematt:was solved, a state that depicts the start of the second ATPase cycle (FIG. 18E, FIG. 13E). In Einternal:|:, the helicase returns to the closed conformation of the transition state as a new ATP mimic is bound to initiate a second round of hydrolysis and continue translocation along dsRNA. V70 and H409 are again in position to bind the same phosphate, this time the adjacent P4 phosphate. The use of one ATP to move one base pair on dsRNA is consistent with prior studies showing dmDcr2 hydrolyses ~23 ATP molecules to produce one 21-bp siRNA.

[0334] The higher quality of the Einterna|t electron density map allowed closer analysis of AncD1D2 RecA movement during hydrolysis. Comparing Bend* and Cpost closedsuggests that the two RecA domains move as one rigid body during or immediately after ATP y-PO4 bond cleavage (FIG. 18B-C). Examination of the ATPase pocket in Einternal* confirmed the AIFXmimic of the Y-PO4 in proximity to motif VI, while E143 (DECH of SEQ ID NO: 3) is poised to coordinate water for attack on the 3-Y-PO4 bond (FIG. 23A, Left). Closure of the ATPase cleft creates a network of polar interactions between Hell and Hel2, similar to contacts observed in RIG-1 (FIG. 23A, Right, FIG.

[0335] 24). In Cpost closed, hydrolysis of the Y-PC disrupts connection between the nucleotide and Hel2 (FIG. 23B, Left). However, the network of interactions between Hell and Hel2 was largely maintained, causing the helicase to remain closed despite the inability of ADP to bridge the RecA domains (FIG. 23B, Right). In the transition between cpost closedand Dpost ground, the network breaks down as Hel2 drifts away from Hell (FIG. 23C). This order of events suggests that formation of these contacts during closure of the RecA domains enables the helicase to move as a single body during the hydrolysis step of the ATPase cycle. Subsequent disruption of these contacts coincideswith Hell and Hel2 returning to the semiclosed state, adopting a conformation primed for the next round of ATP binding and hydrolysis.

[0336] Biochemical Properties of Ancient Dicer-1 Helicases Explain Diversity in Modern Helicase Function

[0337] Subfunctionalization of Dicer-1 ’s helicase domain in bilaterians was likely stochastic, beginning with progressive loss of dsRNA binding and translocation, while ATP hydrolysis remained relatively intact (FIG. 3). Decline in dsRNA binding and translocation may have been sufficient to render Dicer’s helicase defunct as a competitor with RLRs for viral dsRNAs or with Platform / PAZ for endogenous dsRNAs. This would remove selection pressure for helicase nonfunctionalization and allow retention of vestigial ATP hydrolysis up toAncDlDEUT, before being lost entirely in AHCDIVERT and hsDcr. Thus, components of Dicer helicase distant from the ATPase pocket were initially lost and this loss was sufficient to disable helicase function, inadvertently resulting in vestigial retention of ATPase motifs in nonfunctional helicases like hsDcr. In the protostome clade, minimal ATP hydrolysis is retained by AHCDINEM helicase (FIG. 3D). Possibly this ATP hydrolysis is also vestigial, but it clearly serves a function in modern ceDCR-1 where it is required for proper dsRNA cleavage, but not translocation (FIG. 9). Conversely, the ATPase pocket of modern dmDcrl is degenerate and incapable of hydrolysis, possibly because retention of the dmDcr2 duplicate hastened the nonfunctionalization of dmDcrl Thus, the stochastic nature of Dicer- 1’s evolution is reflected in diverse modern adaptations to competition for cellular or viral dsRNA and loss of helicase function.

[0338] Mechanistic Basis of AncD1 D2 Translocation Along dsRNA

[0339] Variation in helicase translocation is governed by the capacity to bind dsRNA, hydrolyze ATP, and couple these activities to movement. The streptavidin-displacement assay correlates with translocation for related RLRs, but this correlation is not assured for the quasi-artificial Dicer helicase constructs. However, cryo-EM analysis of select ancestral helicases, in combination with observations for modern dmDcr2 and ceDCR-1, supports the notion that streptavidin displacement is caused by Dicer helicase translocation. Structural analyses of AncD1 D2 helicase in multiple states (FIG. 12 and FIG. 18) provide insights into helicase function that can be extended to modern Dicers and RLRs. The ground state of AncD1D2, A°9round, captured without nucleotide, exists in a similar semiclosed state to structures of modern dmDcr2 bound to dsRNA termini (FIG. 12A). ATP binding caused Hell and Hel2 RecA domains to close further to form a high-energy transition state observed in Bend* and Ein,ernal* AncD1D2 (FIG. 18A, E). Closedtransition states have been observed in RLR helicases containing transition state mimics and in AAA+ helicases, but the mechanism that governs coupling of ATP binding and hydrolysis in Dicer to successive transitions between semiclosed and closed states, and the resulting unidirectional translocation, had remained enigmatic. By isolating Cpost closed, the post hydrolytic closed state, and Dpost ground, the post hydrolytic semiclosed state, it was found that that movement of the helicase on dsRNA occurs in the closed state, concurrent with ATP hydrolysis. Conformational changes in Hel2 as the y-PCU is cleaved and dislodged from motif VI drive movement of Hel2 in the 5'-direction, while interactions between Hel2 and Hell ensure that Hell is pulled in the same direction (FIG. 23). The cryo-EM snapshots depict 3'-to-5' movement as the transition from Bend* to cpost closed, which is followed by relaxation from cpost closedto Dpost ground(FIG. 18B-D). Structural analysis of AncD1D2 helicase thus provides insight into the second half of the ATPase cycle, revealing movement of the closed helicase on dsRNA, followed by relaxation of the closed post hydrolysis state to the semiclosed ground state.

[0340] Combining Cryo-EM with Evolutionary Biochemistry Enables Comprehensive Structure-Function Analysis of Dicer Helicase

[0341] Cryo-EM analyses of AncD1 D2 revealed mechanistic insights into translocation, but components of this mechanism were progressively lost in different Dicer-1 clades, eventually resulting in the decline of helicase function in hsDcr and ceDCR-1 (FIG. 25). AncDlBiLAT and AncD1DEUT contain conserved motifs for hydrolyzing ATP (Q, I, II, III, and VI) and contacting dsRNA (la, lb, Ic, IV, IVa, IVb, V, Va, and DUF283) despite the decline in helicase function. Integrating biochemical and structural insights with sequence conservation data enables identification of amino acid substitution events that may explain this decline (FIG. 26).

[0342] Between AncD1D2 and AncD1BiLAT, substitutions at the Hel2-Hel2i-pincer hinge (227-SYN-229 and 495-KNK-497 of SEQ ID NO: 4) appear to have driven early loss of helicase function. The KNK motif of SEQ ID NO: 4 in AncD1D2’s pincer domain is substituted to MEK of SEQ ID NO: 6 in AncD1BiL Tand further degenerated to LEA of SEQ ID NO: 10 in AOCDIDEUT (FIG.

[0343] 25, FIG. 26). Mutations in the equivalent KEK motif in mammalian RIG-I disrupt interferon signaling, underlining its importance to helicase function. Moreover, mutation of F225 of SEQ ID NO: 1 at the dmDcr2 Hel2-Hel2i-pincer hinge compromises dsRNA binding but spares ATP hydrolysis. Hel2i is too flexible to be visible in the endbound states A and B but is observed once AncD1 D2 progresses into the dsRNA stem in states C-E, suggesting that the Hel2-Hel2i-pincer hinge enables helicase attachment to internal dsRNA segments (FIG. 12). The conserved contacts between pincer, Hel2, and Hel2i possibly mediate helicase function by enablingconformational changes important for helicase movement, and loss of these contacts in AncD1BiLAT and AncD1DEUT may explain decline in dsRNA affinity and translocation. The inability of AncD1DEUT to progress into internal dsRNA segments can be explained by an intact Hel1-Hel2 interface which is capable of ATP hydrolysis but is rendered unproductive by a nonfunctional Hel2-Hel2i-pincer hinge (FIG. 25, FIG. 19). The cryo-EM structures indicate that ATP hydrolysis occurs before the completion of the translocation cycle during the relaxation step, supporting a model where AOCDIDEUT undergoes futile hydrolysis, uncoupled from unidirectional helicase movement (FIG. 18).

[0344] Alternatively, the loss of conservation at this Hel2-Hel2i-pincer hinge may reflect changes in the requirement for binding helicase cofactors. In dmDcr2, Loqs-PD, a cofactor that is important for dmDcr2 activity on endo-siRNA precursors, binds at the Hel2-Hel2i-pincer hinge. The changes observed in AncDlBiLAT and AncDlDEUT may reflect the evolution of unique binding interfaces for ancestral cofactors whose absence in the analysis would explain decline in helicase function. This caveat extends to all conclusions gleaned from the biochemical and structural assays, which may not mimic optimal in vivo conditions where these ancestral enzymes existed. AncDlDEUT as well as its descendants, AncDI ERT and hsDcr, also contain solvent-exposed loops inserted into Hel2 that may play a role in binding cofactors or inhibiting helicase function as Dicer-1 transitions into its role in regulating miRNA processing (FIG. 25).

[0345] Further loss of helicase function along the nematode clade is explained by the degeneration of dsRNA contact motifs combined with loss of Hel2-Hel2i-pincer contacts, a phenomenon also observed in AncD1 VERT and hsDcr (FIG. 26). However, unlike vertebrates which lost all Dicer helicase function and conceded their role in innate immunity to RLRs, nematodes developed a unique adaptation by recruiting a second helicase, DRH-1, to specifically aid in viral dsRNA translocation while maintaining miRNA processing (FIG. 9). This analysis reveals multiple transitions in helicase evolution explaining how an intricate helicase mechanism that couples ATP hydrolysis and dsRNA binding to movement along dsRNA has progressively degraded during animal evolution to yield a diverse set of modern Dicers.

Claims

CLAIMSWhat is claimed:

1. An isolated engineered human Dicer polypeptide comprising:one or more functional ATP hydrolysis motifs comprising:an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5;an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5;an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5;an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; oran ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5;one or more functional double-stranded RNA (dsRNA) binding motifs comprising:a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5;dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; ora dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; andone or more functional Hel2-Hel2i-pincer hinge regions having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5.

2. The isolated engineered human Dicer polypeptide of claim 1, wherein the isolated engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, K160N, K160Q, N161Q, N161H, L171V, L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H, P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, I479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13.

3. The isolated engineered human Dicer polypeptide of claim 1, wherein the isolated engineered human Dicer polypeptide has at least 90-99% amino acid sequence identity to any one of SEQ ID NO: 1-5.

4. The isolated engineered human Dicer polypeptide of claim 1, wherein the isolated engineered human Dicer polypeptide has one or more of increased functional ATP hydrolysis activity, increased helicase activity, increased translocation, or increased processivity relative to a wild-type human Dicer protein of SEQ ID NO: 13.

5. An isolated nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide of claim 1.

6. An mRNA comprising the isolated nucleic acid of claim 5.

7. A vector comprising the isolated nucleic acid of claim 5.

8. The vector of claim 7, wherein the vector comprises a lentiviral vector, a retroviral vector, an adenoviral vector, or an adeno-associated virus (AAV) vector.

9. A cell comprising the vector of claim 7.

10. A pharmaceutical composition comprising the isolated nucleic acid of claim 5, and one or more pharmaceutically acceptable excipients.

11. A pharmaceutical composition comprising the isolated engineered human Dicer polypeptide of claim 1, and one or more pharmaceutically acceptable excipients.

12. A method of engineering a human Dicer protein to have functional ATP hydrolysis and helicase activity, the method comprising:modifying a wild-type human Dicer protein to have one or more functional ATP hydrolysis motifs, one or more functional double-stranded RNA (dsRNA) binding motifs, and one or more functional Hel2-Hel2i-pincer hinge regions to generate an engineered human Dicer polypeptide having functional ATP hydrolysis and helicase activity, wherein:the one or more functional ATP hydrolysis motifs comprise:an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; oran ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1- 5;the one or more functional dsRNA binding motifs comprise:a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1- 5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1- 5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif I a of any one of SEQ ID NO: 1- 5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1- 5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1- 5; ora dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; andthe one or more functional Hel2-Hel2i-pincer hinge regions have at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5.

13. The method of claim 12, wherein the engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, K160N, K160Q, N161Q, N161H, L171V, L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H,P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, 1479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13.

14. The method of claim 12, wherein modifying the wild-type human Dicer protein comprises site-directed mutagenesis, random mutagenesis, amino acid insertion or deletion, protein fusion, or combinations thereof.

15. The method of claim 12, wherein the engineered human Dicer polypeptide has increased helicase translocation and processivity relative to the wild-type human Dicer protein.

16. A method of treating a viral infection in a subject in need thereof, the method comprising:administering a therapeutically effective amount of an engineered human Dicer polypeptide or a nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide to the subject, the engineered human Dicer polypeptide comprising:one or more functional ATP hydrolysis motifs comprising:an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5; an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; oran ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1- 5;one or more functional double-stranded RNA (dsRNA) binding motifs comprising:a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1- 5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1- 5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif I a of any one of SEQ ID NO: 1- 5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1- 5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1- 5; ora dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; andone or more functional Hel2-Hel2i-pincer hinge regions having at least 90- 99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5.

17. The method of claim 16, wherein the engineered human Dicer polypeptide comprises one or more amino acid substitutions selected from K46G, K46P, N65P, N65G, T78L, T78I, N92G, S102T, A103V, Q105L, S111M, S111K, S125V, S125T, N126G, L128E, L128D, E129Q, E129M, V130G, V130N, C152A, Y153Q, K160T, K160N, K160Q, N161Q, N161H, L171V, L179H, D183H, D183N, C193F, C193Y, A207G, S208V, E221T, E221K, Q224K, Q224R, K225E, I229T, Q249K, D256S, D256E, C257F, D257Y, G258P, G258N, P259H,P259S, F260Q, F260Y, F260S, F372Y, V373S, T374S, I479M, 1479V, T480V, H482R, E502K, E503S, A510D, A510K, A510R, T519S, 1521V, V526I, T541K, E542T, E542N, T566D, T566E, I569R, I569K, K570E, K570N, S571K, A581K, A581E, R587K, R587L, V687K, or R688K, relative to a wild-type human Dicer protein of SEQ ID NO: 13.

18. The method of claim 16, wherein the engineered human Dicer polypeptide or nucleic acid comprising the polynucleotide sequence encoding the engineered human Dicer polypeptide is administered to the subject intravenously, intravascularly, intraarterially, intramuscularly, subcutaneously, intranasally, intraperitoneally, or combinations thereof.

19. The method of claim 16, wherein the engineered human Dicer polypeptide or nucleic acid comprising the polynucleotide sequence encoding the engineered human Dicer polypeptide is administered to the subject as a pharmaceutical composition comprising one or more pharmaceutically acceptable excipients.

20. The method of claim 16, wherein the polynucleotide sequence encoding the engineered human Dicer polypeptide is comprised in a vector.

21. The method of claim 20, wherein the vector comprises a lentiviral vector, a retroviral vector, an adenoviral vector, or an adeno-associated virus (AAV) vector.

22. The method of claim 16, wherein the viral infection produces viral dsRNA that is recognized by the engineered human Dicer polypeptide in the subject.

23. The method of claim 16, wherein the engineered human Dicer polypeptide reduces viral load in the subject.

24. A kit for treating a viral infection in a subject in need thereof, the kit comprising:the isolated engineered human Dicer polypeptide of claim 1 or an isolated nucleic acid comprising a polynucleotide sequence encoding the engineered human Dicer polypeptide of claim 1 ;optionally, injection or infusion materials or devices;optionally, buffers and receptacles; andoptionally, one or more of packaging, a label, or instructions for use.

25. Use of an engineered human Dicer polypeptide for treating a viral infection in a subject in need thereof, the engineered human Dicer polypeptide comprising:one or more functional ATP hydrolysis motifs comprising:an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif Q of any one of SEQ ID NO: 1-5;an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif I of any one of SEQ ID NO: 1-5;an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif II of any one of SEQ ID NO: 1-5;an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif III of any one of SEQ ID NO: 1-5; or an ATP hydrolysis motif having at least 90-99% amino acid sequence identity to motif VI of any one of SEQ ID NO: 1-5;one or more functional double-stranded RNA (dsRNA) binding motifs comprising:a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif la of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif lb of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ic of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Ila of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IV of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVa of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif IVb of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif V of any one of SEQ ID NO: 1-5;a dsRNA binding motif having at least 90-99% amino acid sequence identity to motif Va of any one of SEQ ID NO: 1-5; ora dsRNA binding motif having at least 90-99% amino acid sequence identity to motif DUF283 of any one of SEQ ID NO: 1-5; and one or more functional Hel2-Hel2i-pincer hinge regions having at least 90-99% amino acid sequence identity to a Hel2-Hel2i-pincer hinge region of any one of SEQ ID NO: 1-5.