Production of bioplastics from acetate

A cascade of enzymatic reactions using acetate as a starting material and regenerating cofactors addresses the inefficiencies of bacterial fermentation in PHA polymer production, achieving high-yield and cost-effective biopolymer synthesis.

WO2026161655A1PCT designated stage Publication Date: 2026-07-30KIMBERLY CLARK WORLDWIDE INC
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
KIMBERLY CLARK WORLDWIDE INC
Filing Date
2026-01-23
Publication Date
2026-07-30

AI Technical Summary

Technical Problem

Conventional methods for producing polyhydroxyalkanoate (PHA) biopolymers, such as PHB, rely on bacterial fermentation, which are time-intensive, costly, and result in low yields due to the need for additional steps and post-processing, making it difficult to recycle petroleum-based plastics effectively.

Method used

A method involving a cascade of enzymatic reactions using acetate as a sole starting material, with enzymes like acetate-CoA ligase, acetyl-CoA C-acetyltransferase, and poly(R)-hydroxyalkanoic acid synthase, operates without bacterial fermentation, regenerating cofactors like ATP and NADH, and optimizing pH and enzyme selection for higher yields.

Benefits of technology

This approach allows for efficient, high-yield production of PHB biopolymers, reducing reliance on bacterial fermentation and enabling continuous operation, thus providing an economically viable alternative to petroleum-based plastics.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure US2026012291_30072026_PF_FP_ABST
    Figure US2026012291_30072026_PF_FP_ABST
Patent Text Reader

Abstract

A method for forming a biopolymer is disclosed herein. The method comprises a cascade of enzymatic reactions that may form a polyhydroxybutyrate from a sole starting material of acetate. The method includes reacting an acetate with a first cofactor and an Acetate--CoA ligase to form an Acetyl-CoA, reacting the Acetyl-CoA with an Acetyl-CoA C-acetyltransferase to form an Acetoacetyl-CoA, reacting the Acetoacetyl-CoA with a second cofactor and an Acetoacetyl-CoA reductase to form a (R)-3-hydroxybutryl-CoA, and reacting the (R)-3-hydroxybutryl-CoA with a Poly(R)-hydroxyalkanoic acid synthase to form a polyhydroxybutyrate. The method can occur in a single vessel reactor or in multiple reactors. The cascade of enzymatic reactions described herein may produce biopolymers, such as polyhydroxybutyrate, without the reliance on bacterial reactions.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] PRODUCTION OF BIOPLASTICS FROM ACETATE CROSS REFERENCE TO RELATED APPLICATIONS

[0002] This application claims priority to the benefit of U.S. Provisional Application No. 63 / 749,983, filed January 27, 2025, which is expressly incorporated herein by reference in its entirety.

[0003] INCORPORATION BY REFERENCE OF A SEQUENCE LISTING XML A Sequence Listing is provided herewith as a Sequence Listing XML with a file name “KCX-2177-P_SL.xml” with a creation date of January 24, 2025, and a size of 9,927 bytes. This Sequence Listing submitted via EFS-Web is part of the specification and is herein incorporated by reference in its entirety.

[0004] BACKGROUND

[0005] Global production of petroleum-based plastics continues to increase every year. In recent years, for instance, over 300,000,000 metric tons of petroleum-based polymers have been produced. A significant portion of the above produced polymers are used to produce single-use products, such as plastic drinking bottles, straws, packaging, and absorbent articles, including wearable absorbent articles. Most of these plastic products are discarded and do not enter the recycle stream.

[0006] Particularly, absorbent articles, including personal care and child care garments, are currently made from predominantly petroleum-based plastics, such as films and nonwoven materials formed of polyethylene or polypropylene. Due to the nature of these articles, and the function they perform, it is difficult, if not impossible, to partially or completely recycle the polypropylene or polyethene materials used.

[0007] It has long been hoped that biodegradable polymers produced from renewable resources (hereinafter termed "biopolymers”) would hold great promise in reducing the global accumulation of petroleum-based plastics in the environment. For example, significant research has been done on biologically derived polymers and on polymers that biodegrade in suitable environments. One such class of biopolymers are the polyhydroxyalkanoates (PHA). Much work has been accomplished on the PHA family, most notably the polyhydroxybutyrate (PHB) polymers including poly-3-hydroxybutyrate (P3HB), poly-4-hydroxybutyrate (P4HB), polyhydroxyvalerate (PHV), polyhydroxyhexanoate (PHH), polyhydroxyoctanoate (PHO) and their copolymers. Specifically, PHB shows promise in that the polymer is derived from natural sources, can be bio-degraded by several mechanisms, and is biocompatible with human tissues. Of particular advantage, PHA family biopolymers exhibitthermoplastic properties that are very similar to some petroleum-based polymers and thus represent viable replacements for petroleum-based polymers such as polypropylene and polyethylene.

[0008] Conventionally, it is known that PHA family biopolymers can be synthesized using a variety of bacterial and archaea genera, including Halobacillus, Bacillus, Salinobacter, Flavobacterium, Chromohalobacter, Halomonas, Marinobacter, Vibrio, Pseudomonas, Halococcus, Halorhabdus, Haladaptatus, Natrialba, Haloterrigena, and Halorussus. The polyhydroxyalkanoates may serve as an energy sink for these organisms. Known methods of production of polyhydroxyalkanoate polymers by the above microorganisms involves a three-step enzymatic mechanism, and the resulting biosynthesized polyhydroxyalkanoates accumulate in the bacterial cell as large molecular weight granules, such that they can account for about 60% to about 90% of the cellular dry mass.

[0009] However, many drawbacks remain with the bacterial synthesis of PHA family biopolymers. For instance, these conventional approaches require additional steps of culturing and growing bacteria and isolating the bacteria from the fermentation culture. For instance, successful bacterial growth may require many additional steps and experiments to be performed to determine the appropriate culture media and carbon sources for bacterial growth. Additionally, once the bacteria have grown, the additional step of devising a fermentation environment that balances PHA family biopolymer yield and bacterial growth kinetics must also be performed. Then, if the fermentation process is successful, the bacteria must also be subjected to a tedious post processing that includes rupturing the bacteria and isolating the PHA family biopolymer material away from the cell debris, which can be both time intensive and expensive. Even then, the yield of PHA family biopolymer may be hindered by the post processing.

[0010] Accordingly, a need exists for a method of producing PHA family biopolymers, such as PHB, that does not rely on bacterial reactions. It would be a further benefit to provide a method for producing PHA family biopolymers that allows for easier isolation of PHA family biopolymers and higher yields of PHA family biopolymers.

[0011] SUMMARY OF THE DISCLOSURE

[0012] In general, the present disclosure is directed towards a method for forming a biopolymer, such as a polyhydroxybutyrate, from a sole starting material. The method comprises a cascade of enzymatic reactions, including reacting an acetate with a first cofactor and an acetate-CoA ligase to form an acetyl-CoA, reacting the acetyl-CoA with an acetyl-CoA C-acetyltransferase to form an acetoacetyl-CoA, reacting the acetoacetyl-CoA with a second cofactor and an acetoacetyl-CoA reductase to form a (R)-3-hydroxybutryl-CoA, and reacting the (R)-3-hydroxybutryl-CoA with a poly(R)-hydroxyalkanoic acidsynthase to form a polyhydroxybutyrate. In certain embodiments, the first cofactor is an ATP and the second cofactor is a NADH. In some example embodiments, the method of the present disclosure is not reliant on any bacterial reactions to form or isolate the biopolymer, thus in certain example embodiments no bacterial fermentation occurs during the method.

[0013] In certain example embodiments, the method further comprises hydrolyzing the ATP to form an AMP during the reaction between the acetate and the acetate-CoA ligase. In other example embodiments, the method further comprises reacting the AMP with an ATP and an adenylate kinase to form two ADP. In some example embodiments, the method further comprises reacting the two ADP with a polyphosphate kinase and a polyphosphate including at least two phosphate units to regenerate a supply of ATP.

[0014] In other example embodiments, the method further comprises oxidizing the NADH during the reaction between the acetoacetyl-CoA and the acetoacetyl-CoA reductase to form a NAD+. In certain example embodiments, the NADH donates a hydride ion to a pyruvate, and thus the method further comprises reacting the pyruvate with a lactate dehydrogenase to form a lactate. Thus, in some example embodiments, the NADH is regenerated, such that the first cofactor (e.g ., ATP) and the second cofactor (e.g., NADH) are both regenerated throughout the cascade of enzymatic reactions.

[0015] In certain example embodiments, acetate is the sole starting material for the cascade of enzymatic reactions. Because acetate is extremely acidic, in some example embodiments the method further comprises producing the acetate-CoA ligase, the acetyl-CoA C-acetyltransferase, the acetoacetyl-CoA reductase, the poly(R)-hydroxyalkanoic acid synthase, the lactate dehydrogenase, the adenylate kinase, and the polyphosphate kinase recombinantly from an Acetobacter spp. bacteria or an Acidiphilium spp. bacteria. In some example embodiments, the Acetobacter spp. bacteria or the Acidiphilium spp. bacteria is an Acetobacter aceti, an Acetobacter peroxydans, an Acetobacter oeni, and / or Acidiphilium acidophilum. Further, in certain example embodiments, the the acetoacetyl-CoA reductase has been genetically modified to favor a NADH cofactor.

[0016] The present disclosure is also generally directed towards a process for forming a polyhydroxybutyrate in a single vessel. The process comprises contacting a solution comprising sodium acetate, acetate, coenzyme A, ATP, and pyruvate with a plurality of enzymes in a single vessel. The plurality of enzymes comprise an acetate-CoA ligase, an acetyl-CoA C-acetyltransferase, an acetoacetyl-CoA reductase, a poly(R)-hydroxyalkanoic acid synthase, a lactate dehydrogenase, an adenylate kinase, and a polyphosphate kinase. The process further comprises reacting the solution and the plurality of enzymes to form the polyhydroxybutyrate, and precipitating the polyhydroxybutyrate outof the solution. In some example embodiments, the plurality of enzymes are immobilized on a substrate that is placed inside of the single vessel.

[0017] In certain example embodiments, the solution has a pH of about 3.3 to about 6.0, such as about 3.6 to about 5.6, such as about 4.0 to about 5.3, such as about 4.3 to about 5.0, such as about 4.7 to about 4.9. In some example embodiments, the solution and the plurality of enzymes are reacted at a temperature of about 15°C to about 35°C and are mixed at about 40 rpm to about 80 rpm.

[0018] The present disclosure is also generally directed towards a process for forming a polyhydroxybutyrate with a multi-vessel reactor. The process comprises contacting a first solution comprising a sodium acetate, an acetate, a coenzyme A, and an ATP with a first plurality of enzymes in a first vessel to form a first product including an acetoacetyl-CoA. The first plurality of enzymes comprises acetate— CoA ligase, polyphosphate kinase, adenylate kinase, and acetyl-CoA C-acetyltransferase. The process further comprises flowing the first product of the first vessel into a second vessel and contacting a second solution comprising the acetoacetyl-CoA, the sodium acetate, the acetate, a pyruvate, and a NADH with a second plurality of enzymes in the second vessel to form a second product including a hydroxybutyryl-CoA. The second plurality of enzymes comprises acetoacetyl-CoA reductase and lactate dehydrogenase. The process further comprises flowing the second product of the second vessel into a third vessel and contacting a third solution comprising the hydroxybutyryl-CoA, the sodium acetate, and the acetate with a poly(R)-hydroxyalkanoic acid synthase in the third vessel to form the polyhydroxybutyrate. The process also comprises precipitating the polyhydroxybutyrate out of the third solution.

[0019] In certain example embodiments, the process also comprises flowing at least a part of the solution in the third vessel back to the first vessel to resupply the first vessel with liberated CoA. In some example embodiments, the process further comprises flowing the pyruvate from a pyruvate reservoir into the second vessel. In other example embodiments, the process further comprises regenerating the ATP in the first vessel and the NADPH in the second vessel. In some example embodiments, the first plurality of enzymes, the second plurality of enzymes, and / or the third plurality of enzymes are immobilized on a substrate.

[0020] In some example embodiments, the flow rates of the solutions from vessel to vessel may be optimized to help drive the kinetics of the reaction. In certain example embodiments, the acetate is added to the first vessel by flowing the acetate from an acetate reservoir into the first vessel. In some example embodiments, the flow of the acetate from the acetate reservoir to the first vessel has a first flow rate and the flow of the first product of the first vessel into the second vessel has a second flowrate, wherein the ratio of the first flow rate to the second flow rate is from about 0.15 to about 0.5, such as from about 0.25 to about 0.4, such as from about 0.3 to about 0.35. In certain example embodiments, the flow of the at least a part of the solution in the third vessel back to the first vessel has a third flow rate, wherein the third flow rate is about 4.0 mL / min to about 9.0 mL / min, such as about 5.0 mL / min to about 8.0 mL / min, such as about 6.0 mL / min to about 7.0 mL / min.

[0021] These and other features, aspects and advantages of the present disclosure will become better understood with reference to the following description and appended claims. The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate embodiments of the disclosure and, together with the description, serve to explain the principles of the disclosure.

[0022] BRIEF DESCRIPTION OF THE DRAWINGS

[0023] A full and enabling disclosure of the present disclosure is set forth more particularly in the remainder of the specification, including reference to the accompanying figures, in which:

[0024] Figure 1 graphically illustrates the enzymatic pathway for the conversion of acetate to polyhydroxybutyrate (PHB) including the regeneration of NADH and ATP.

[0025] Figure 2A is a sequence of a lactate dehydrogenase (e.g., "SEQ ID NO: 1”) that may be used in the enzymatic pathway of Figure 1 ;

[0026] Figure 2B is a sequence of an adenylate kinase (e.g., “SEQ ID NO: 2”) that may be used in the enzymatic pathway of Figure 1 ;

[0027] Figure 20 is a sequence of a polyphosphate kinase (e.g., “SEQ ID NO: 3”) that may be used in the enzymatic pathway of Figure 1 ;

[0028] Figure 2D is a sequence of an acetate-CoA ligase (e.g., “SEQ ID NO: 4”) that may be used in the enzymatic pathway of Figure 1 ;

[0029] Figure 2E is a sequence of an acetyl-CoA C-acetyltransferase (e.g., “SEQ ID NO: 5”) that may be used in the enzymatic pathway of Figure 1 ;

[0030] Figure 2F is a sequence of an acetoacetyl-CoA reductase (e.g., “SEQ ID NO: 6”) that may be used in the enzymatic pathway of Figure 1 ;

[0031] Figure 2G is a sequence of a poly(R)-hydroxyalkanoic acid synthase (e.g., “SEQ ID NO: 7") that may be used in the enzymatic pathway of Figure 1 ;

[0032] Figure 3 is a plain view of a single vessel reactor as described in Example 3;Figure 4 is a plain view of a multi-vessel reactor as described in Example 4;

[0033] Figure 5 graphically illustrates the PHB concentration in a single vessel reactor as described in Example 3;

[0034] Figure 6 graphically illustrates the PHB concentration in a multi-vessel reactor as described in Example 5; and

[0035] Figure 7 graphically illustrates the PHB concentration in a multi-vessel reactor as described in Example 6.

[0036] Repeat use of reference characters in the present specification and the drawings is intended to represent same or analogous features or elements of the invention.

[0037] DEFINITIONS

[0038] When introducing elements of the present disclosure or the preferred embodiment(s) thereof, the articles “a", “an”, “the” and “said” are intended to mean that there are one or more of the elements. As used herein, the terms “includes” and “including” are intended to be inclusive in a manner similar to the term “comprising.” Similarly, the term “or” is generally intended to be inclusive (i.e., “A or B” is intended to mean “A or B or both”). Approximating language, as used herein throughout the specification and claims, is applied to modify any quantitative representation that could permissibly vary without resulting in a change in the basic function to which it is related. Accordingly, a value modified by a term or terms, such as “about,” “approximately,” and “substantially,” are not to be limited to the precise value specified. In at least some instances, the approximating language may correspond to the precision of an instrument for measuring the value. For example, the approximating language may refer to being within a ten percent (10%) margin.

[0039] As used herein, the term “comprising” or “including" or “having” are inclusive or open-ended and do not exclude additional unrecited elements, compositional components, or method steps. Accordingly, the terms “comprising" or “including” or “having” encompass the more restrictive terms “consisting essentially of and “consisting of.”

[0040] As used herein, the terms "about," “approximately,” or “generally,”, when used herein to modify a value, indicates that the value can be raised or lowered by 10%, such as 75%, such as 5%, such as 4%, such as 3%, such as 2%, or such as 1%, and remain within the disclosed aspect.

[0041] As used herein, the term “biodegradable” or “biodegradable polymer” generally refers to a material that degrades from the action of naturally occurring microorganisms, such as bacteria, fungi,archaea, and algae; environmental heat; moisture; or other environmental factors. The biodegradability of a material may be determined using ASTM Test Method 5338.92.

[0042] As used herein, the term “enzyme” generally refers to an enzyme that includes but is not limited to the following: native enzyme, purified enzyme, wildtype enzyme, modified enzyme, or combination thereof.

[0043] As used herein, the term “microorganism” includes bacteria, fungi, archaea, and algae, wildtype or modified, that expresses or produces one or more enzymes discussed herein

[0044] As used herein, the terms “poly hydroxy alkanoate” or “hydroxyalkanoate” generally refer to a chemical family of biopolymers that includes but is not limited to the following members: the poly hydroxy butyrate (PHB) polymers including poly-3-hydroxybutyrate (P3HB), poly-4-hydroxy butyrate (P4HB), polyhydroxyvalerate (PHV), polyhydroxyhexanoate (PHH), polyhydroxyoctanoate (PHO), each of their monomers and copolymers.

[0045] As used herein the term “ferment” refers to the metabolic by-products and components produced by microorganisms, such as bacteria, during fermentation. Thus, ferments may include byproducts of fermentation, components of bacteria, including, but not limited to, cell wall fragments, membrane components, surface proteins and peptides, extracellular polysaccharides, DNA fragments, RNA fragments, and any other fermentation products.

[0046] DETAILED DESCRIPTION OF THE DISLOSURE

[0047] It is to be understood by one of ordinary skill in the art that the present disclosure is a description of exemplary embodiments only and is not intended as limiting the broader aspects of the present disclosure.

[0048] In general, the present disclosure is directed towards a method for forming a biopolymer from a cascade of enzymatic reactions. Notably, the method may allow for the formation of a biopolymer, such as a polydroxybutryate, from a single starting material and without the reliance on bacterial reactions, such as bacterial fermentation. The method comprises reacting an acetate with a first cofactor and an acetate-CoA ligase to form an acetyl-CoA, reacting the acetyl-CoA with an acetyl-CoA C-acetyltransferase to form an acetoacetyl-CoA, reacting the acetoacetyl-CoA with a second cofactor and an acetoacetyl -Co A reductase to form a (R)-3-hydroxybutryl-CoA, and then reacting the (R)-3-hydroxybutryl-CoA with a poly(R)-hydroxyalkanoic acid synthase to form a polyhydroxybutyrate.

[0049] The method of the present disclosure may be a cell-free, all-enzyme based approach for the production of biopolymers and bioplastics that can have both environmental and economic benefits. Biopolymers, for instance, may provide an alternative to non-sustainable polymers, such as those formedfrom polypropylene or polyethylene. Biopolymers, such as those in the polyhydroxyalkanoates (PHA) family, like polyhydroxybutyrate (PHB), may be produced from natural starting materials, such as enzymes and bacteria, and can be easily degraded by bacteria. Most notably, PHB is similar to polypropylene in physical and processing characteristics. Further, in addition to petroleum plastic replacement, PHA family biopolymers, such as PHB, have a wide variety of other uses, and thus, biofermentation strategies have been well studied and utilized in industrial settings to facilitate production of the PHA family biopolymers. PHB has conventionally been metabol ically synthesized starting with the pyruvate that is produced by glycolysis. However, forming PHB utilizing bacterial reactions, such as biofermentation, often results in low yields and inefficient post processing.

[0050] Without intending to be limited by theory, the present inventors have found that the method as described herein can form PHB without the use of any biofermentation (e.g., "bacterial fermentation"). Further, the present inventors have found that selectively controlling the formation of the enzymes used in the method can also result in higher amounts of PHB yield. Additionally, the method as described herein may be able to run continuously, as the cascade of enzymatic reactions facilitates regeneration of the first and second cofactors. In certain example embodiments, the reaction may run for about 140 hours or more, such as about 160 hours or more, such as about 180 hours or more, such as about 200 hours or more, such as about 220 hours or more, and generally less than about 320 hours, such as less than about 300 hours, such as less than about 280 hours, such as less than about 260 hours.

[0051] Referring now to FIG.1, the sole starting material is acetate. Acetate is reacted with a first cofactor, an ATP, and an acetate-CoA ligase (e.g., “E.C.6.2.1.1”) to form an acetyl-CoA. During the reaction between the acetate and the acetate-CoA ligase, the ATP is condensed with the acetate to form acetyl-AMP and inorganic pyrophosphate (“PPi”), and then the acetyl-AMP reacts with the CoA to form acetyl-CoA and the AMP is released. The AMP is then phosphorylated by a reaction with an adenylate kinase (e.g., “E.C. 2.7.4.3”) and an ATP phosphate donor to form two ADP. The two ADP may then react with a polyphosphate kinase (e.g., "E. C.2.7.4.1”), which utilize the high-energy phosphate bonds in inorganic polyphosphate (e.g., “PPn”), to phosphorylate ADP to regenerate ATP. The polyphosphate includes at least two phosphate units. Notably, the ability to regenerate ATP may provide many benefits to the overall cascade of enzymatic reactions. The ability to regenerate ATP, for instance, may have many economic advantages, as only a single initial input of ATP is needed, and no further ATP exogenous addition is required because the initial input of ATP is constantly being regenerated. Further, the ability to constantly regenerate ATP also increases the yield of PHB that may be formed. Without the ability to regenerate ATP, the final yield of PHB would be limited to the amount of initial ATP added at the start of the reaction or to the amount that is subsequently added. Having to constantly add additional ATP wouldnot only be inefficient and cost prohibitive, but would present many other challenges, as having to continuously add ATP would be impractical at a commercial, industrial scale.

[0052] The acetyl-CoA is then reacted with an acetyl-CoA C-acetyltransferase (e.g., “E.C.2.2.1 .9”), also known as a thiolase, to form an acetoacetyl-CoA. The acetyl-CoA C-acetyltransferase transfers an acetyl group from one molecule of acetyl-CoA to another to form a four-carbon intermediate, acetoacetyl-CoA. The acetoacetyl -CoA is then reacted with a second cofactor, NADH, and an acetoacetyl-CoA reductase (e.g., “E.C. 1.1.36") to form a (R)-3-hydroxybutryl-CoA. The NADH donates electrons as a hydride ion, and the acetoacetyl-CoA reductase adds the hydride ion from NADH to reduce acetoacetyl-CoA. Notably, the NADH is oxidized during the reaction between the acetoacetyl-CoA and the acetoacetyl-CoA reductase to form a NAD+. While NADH is oxidized to form NAD+, pyruvate is simultaneously reacting with lactate dehydrogenase (e.g., “E.C.1.1.1.27”) to form lactate. The reduction-oxidation reactions occur such that NADH may donate a hydride ion to the pyruvate to reduce the pyruvate to lactate, and then lactate later becomes oxidized to pyruvate when it donates an ion to NAD+to regenerate NADH. The ability to utilize simultaneous reactions of NADH to NAD+and pyruvate to lactate allows for only one cofactor, NADH, to drive the reaction of acetoacetyl-CoA to (R)-3-hydroxybutyryl-CoA. Further, the ability to regenerate NADH utilizing the simultaneous reactions may allow for additional industrial or economic benefits, as utilizing pyruvate is cheaper than utilizing NADH.

[0053] The last step of the method is to react the (R)-3-hydroxybutryl-CoA with a poly(R)-hydroxyalkanoic acid synthase (e.g., “E.C.3.1.1.75”) to form a PHB. The poly(R)-hydroxyalkanoic acid synthase cleaves the CoA from the (R)-3-hydroxybutryl-CoA, thus leaving the PHB monomer.

[0054] Acetate is utilized as the sole starting material for the cascade of enzymatic reactions. Without intending to be limited by theory, the present inventors believe acetate may be the most efficient starting material for the synthesis reaction to form PHB, as the pathway had the shortest number of steps. Notably, however, acetate is extremely acidic (pKa = 4.76). Thus, the present inventors have found that selectively identifying and controlling the formation of the above-discussed enzymes that carry out the cascade of enzymatic reactions at a low pH is critical for the method of the present disclosure. This is not a trivial task, as not all acidophilic bacteria maintain an acidic cytoplasm. For instance, some acidophiles conventionally used to produce enzymes may actively transport excess H+out of the cytoplasm, thus maintaining a higher internal pH than the pKa of acetate. Common members of the acidophilic consortia include, but are not limited to, Acidithiobacillus, Acetobacter, Leptospirillium, Sulfobacillus, Acidiphilium, Alicyclobacillus, Acidimicrobium, and Thiobacillus. In certain example embodiments, the enzymes of the present disclosure, including the acetate-CoA ligase, the acetyl-CoA C-acetyltransferase, the acetoacetyl-CoA reductase, the poly(R)-hydroxyalkanoic acid synthase, the lactate dehydrogenase, theadenylate kinase, and the polyphosphate kinase, are recombinantly produced from an Acetobacter spp. bacteria or an Acidiphilim spp. bacteria. In some example embodiments, the lactate dehydrogenase, the adenylate kinase, the polyphosphate kinase, the acetate-CoA ligase, the acetyl-CoA C-acetyltransferase, and the acetoacetyl-CoA reductase are recombinantly produced from Acetobacter spp. bacteria and the poly(R)-hydroxyalkanoic acid synthase is recombinantly produced from an Acidiphilium spp. bacteria.

[0055] Acetobact er spp. bacteria may have a very low cytoplasmic pH. In certain example embodiments, the Acetobact er spp. bacteria may have a cytoplasmic pH of about 5 to about 6.7, such as about 5.2 to about 6.5, such as about 5.4 to about 6.3. In addition to having a low cytoplasmic pH, Acetobacter spp. bacteria also are distinguished from other acidophilic consortia because they may have the ability to oxidize lactate and acetate into carbon dioxide and water. Acetobacter spp. bacteria include, but are not limited to, Acetobacter aceti, Acetobacter pasteurianus, Acetobacter cerevisiae, Acetobacter maiorum, Acetobacter oeni, Acetbacter pomorum, Acetobacter cibinongensis, Acetobacter diazotrophicus, Acetobacter estunensis, Acetobacter indonesiensis, Acetobacter lovaniensis, Acetobacter orientalis, Acetobacter orleanensis, Acetobacter peroxydans, Acetobacter polyoxogenes, Acetobacter syzygii, and Acetobacter tropicalis. It should be understood by one of ordinary skill in the art that the species of Acetobacter spp. bacteria that is chosen to recombinantly produce the enzymes might depend on the chemical and metabolomic properties of the desired specific enzyme. For instance, referring now to FIG.

[0056] 2 and the Sequence Listing, in certain example embodiments, the lactate dehydrogenase, the adenylate kinase, the polyphosphate kinase, the and acetate-CoA ligase may be recombinantly produced from Acetobacter aceti. In other example embodiments, the acetyl-CoA C-acetyltransferase is recombinantly produced from Acetobacter peroxydans and the acetoacetyl-CoA is recombinantly produced from Acetobacter oeni.

[0057] Acidiphilium spp. bacteria are other members of the acidophilic consortia that may be useful in recombinantly creating the enzymes used in the present disclose. Acidiphilium spp. bacteria may also have a very low cytoplasmic pH. In certain example embodiments, the Acidiphilium spp. bacteria may have a cytoplasmic pH of about 3.5 to about 6.5, such as about 4 to about 6, such as about 4.5 to about 5.5. Acidiphilium spp. bacteria include, but are not limited to, Acidiphilium acidophilum, Acidiphilium angustum, Acidiphilium cryptum, Acidiphilium multivorum, Acidiphilium organovorum, and Acidiphilium rubrum. In some example embodiments, the poly(R)-hydroxyalkanoic acid synthase is recombinantly produced from Acidiphilium acidophilum.

[0058] The present inventors have surprisingly found that utilizing a bacteria with a low cytoplasmic pH to recombinantly produce the enzymes required to convert acetate to PHB, such as Acetobact er spp.bacteria or Acidiphilium spp. bacteria, allows for the enzymatic reactions of the present disclosure to be run at pH values that are within the range of acetate buffer. For instance, the enzymatic reactions of the present disclosure may occur at a pH of about 3 to about 6.5, such as about 3.3 to about 6.0, such as about 3.6 to about 5.6, such as about 4.0 to about 5.0, such as about 4.8. Without intending to be limited by theory, the present inventors believe that the ability to run the enzymatic reactions at a low pH diminishes the need for other buffer components and allows for significantly higher amounts of acetate starting material, thus resulting in higher yields of PHB. Further, the ability to run the enzymatic reactions at a low pH allows for optimization of the ratio of acetate to acetic acid.

[0059] In addition to selectively choosing the bacteria which are used to recombinantly produce the enzymes, the present inventors have also found that constructing a NADH-favoring acetoacetyl-CoA reductase is critical to facilitate the cascade of enzymatic reactions. Without intending to be limited by theory, the present inventors believe that producing a variant of the Acetobacter enzyme acetoacetyl-CoA reductase that favors a NADH cofactor over the usual NADPH cofactor eliminates the need for a system to regenerate NADPH from the produced NADP+, which is generally more complicated than the NAD+to NADH reaction catalyzed by the reverse lactate dehydrogenase reaction. Thus, the reengineered Acetobacter acetoacetyl-CoA reductase allows the liberated NAD+to be utilized by lactate dehydrogenase to reform NADH. Thus, the use of the reengineered Acetobacter acetoacetyl-CoA reductase allows for only one cofactor (e.g., NADH) to be utilized in the reaction from Acetoacetyl-CoA to (R)-3-hydroxybutyryl-CoA. In certain example embodiments, the reengineered Acetobacter acetoacetyl-CoA reductase prefers NADH greater than about 20 fold, such as greater than about 25 fold, such as greater than about 30 fold, such as greater than about 35 fold, such as greater than about 40 fold, such as greater than about 45 fold, such as greater than about 50 fold, such as greater than about 52.5 fold, and generally less than about 70 fold, such as less than about 65 fold, such as less than about 60 fold, such as less than about 55 fold more than it prefers NADPH. In some example embodiments, the reengineered Acetobacter acetoacetyl-CoA reductase prefers NADH about 2 fold more, such as about 2.5 fold more, such as about 3 fold more, such as about 3.5 fold more, such as about 4 fold more, such as about 4.5 fold more, such as about 5 fold more, and generally less than about 7 fold, such as less than about 6.5 fold, such as less than about 6 fold, such as less than about 5.5 fold than the wildtype Acetobacter acetoacetyl-CoA reductase prefers NADPH. Thus, genetically engineering acetoacetyl-CoA reductase to favor a NADH cofactor may increase the efficiency of cofactor utilization, helping to sufficiently drive the cascade of enzymatic reactions towards the final PHB product.

[0060] The cascade of enzymatic reactions may take place within a single vessel reactor or within a multi-vessel reactor. For instance, in some embodiments, the reactions may take place in one or morevessels, such as in two or more vessels, such as in three or more vessels, such as in four or more vessels, and generally in about six or less vessels, such as about five or less vessels. Referring now to FIG. 3, a one vessel bioreactor design may be utilized. The vessel 100 may include a gas port 102, a buffer exchange port 104, and a product sample port 106. The solution 108 in the vessel 100 may be transported out of the buffer exchange port 104 via a flow path 112 and out of the product sample port via a flow path 114. The sole starting substrate, acetate, is stored in a reservoir 116 outside of the vessel 100. The acetate flows from the acetate reservoir 116 to the vessel 100 via a flow path 118.

[0061] The present disclosure is also directed to a process for forming a polyhydroxybutyrate in a single vessel, as demonstrated by FIG. 3. The process includes contacting a solution 108 including sodium acetate, acetate, coenzyme A, ATP, and pyruvate with a plurality of enzymes in a single vessel. As described above, the plurality of enzymes include an acetate-CoA ligase, an acetyl-CoA C-acetyltransferase, an acetoacetyl-CoA reductase, a poly(R)-hydroxyalkanoic acid synthase, a lactate dehydrogenase, an adenylate kinase, and a polyphosphate kinase. Within the vessel, the enzymes required for the series of enzymatic reactions may be free in solution or may be immobilized on a substrate. As demonstrated by FIG. 3, all seven enzymes produced from acidophilic bacteria as described above are immobilized on a substrate 120. The substrate 120 may be any known substrate as conventionally used to immobilized enzymes. In certain example embodiments, the enzymes are immobilized on a Ni-NTA polystyrene film.

[0062] The solution 108 is then reacted with the plurality of enzymes to form the polyhydroxybutyrate. In certain example embodiments, the solution 108 has a pH of about 3.3 to about 6.0, such as about 3.6 to about 5.6, such as about 4.0 to about 5.3, such as about 4.3 to about 5.0, such as about 4.7 to about 4.9. In other example embodiments, the solution 108 and the plurality of enzymes may be reacted at a temperature of about 10°C or more, such as about 15°C or more, such as about 20°C or more, such as about 25°C or more, and generally less than about 40°C, such as generally less than about 35°C, such as less than about 30°C. In some example embodiments, the reaction is run at a temperature of about 15°C to about 35°C, such as about 25°C. For instance, in certain example embodiments, the vessel has a stirring device 130 and the reaction may be stirred or mixed at a rate of about 30 rpm or more, such as about 35 rpm or more, such as about 40 rpm or more, such as about 45 rpm or more, such as about 50 rpm or more, and generally less than about 100 rpm, such as less than about 95 rpm, such as less than about 90 rpm, such as less than about 85 rpm, such as less than about 80 rpm. Thus, in some example embodiments, the reaction may be stirred or mixed at a rate of about 40 rmp to about 80 rpm, such as about 60 rpm. Once formed, the polyhydroxybutyrate will precipitate out of the solution 108 when it reaches a certain molecular weight.The present disclosure is also directed towards a process for forming a polyhydroxybutyrate with a multi-vessel reactor. Referring now to FIG. 4, a three-vessel reactor may be utilized to conduct the cascade of enzymatic reactions. Of course, it should be understood by one of ordinary skill in the art that the number of vessels may be selectively controlled to further optimize intermediate byproducts of the process or for any other optimization desired. As shown in FIG.4, the multi-vessel reactor 200 includes a first vessel 202, a second vessel 204, and a third vessel 206. The sole starting substrate, acetate, is stored in a reservoir 210 outside of the first vessel 202. The acetate flows from the acetate reservoir 210 to the first vessel 202 via a first flow path 208. The process comprises contacting a first solution 212 including a sodium acetate, an acetate, a coenzyme A, and an ATP with a first plurality of enzymes in the first vessel 202 to form a first product including an acetoacetyl-CoA. The first plurality of enzymes include acetate-CoA ligase, polyphosphate kinase, adenylate kinase, and acetyl-CoA C-acetyltransferase. The first plurality of enzymes may be free in the first solution 212 or may immobilized on a substrate, as described above. As demonstrated by FIG. 4, the first plurality of enzymes are immobilized on a first substrate 214. In certain embodiments, the first substrate 214 may be a Ni-NTA polystyrene film.

[0063] In certain example embodiments, ATP is regenerated in the first vessel 202. Thus, in some embodiments, the steps including reacting an acetate with a first cofactor (e.g., ATP) and an Acetate- CoA ligase to form an Acetyl-CoA and reacting the Acetyl-CoA with an Acetyl-CoA C-acetyltransferase to form an Acetoacetyl -CoA occur within the first vessel 202.

[0064] The first product, acetoacetyl-CoA, is formed within the first vessel 202. The acetoacetyl-CoA is flowed via the first solution 212 to the second vessel 204 through a second flow path 216 to form a second solution 218. The second solution 218 includes the acetoacetyl-CoA, the sodium acetate, and the acetate from the first solution 212 and additionally a pyruvate and a NADH. The pyruvate is stored in a reservoir 220 outside of the second vessel 204. The pyruvate flows from the pyruvate reservoir 220 to the second vessel 204 via a third flow path 222. The second solution 218 is reacted with a second plurality of enzymes in the second vessel 204 to form a second product including a hydroxybutyryl-CoA. The second plurality of enzymes includes acetoacetyl-CoA reductase and lactate dehydrogenase. The second plurality of enzymes may be free in the first solution 218 or may immobilized on a substrate, as described above. As demonstrated by FIG. 4, the second plurality of enzymes are immobilized on a second substrate 224. In certain embodiments, the second substrate 224 may be a Ni-NTA polystyrene film.

[0065] In certain example embodiments, NADH is regenerated in the second vessel 204. Thus, in some embodiments, the steps including reacting the Acetoacetyl-CoA with a second cofactor (e.g., NADH) and an Acetoacetyl-CoA reductase to form a (R)-3-hydroxybutryl-CoA occurs within the second vessel 204.Thus, the simultaneous reaction of pyruvate and lactate dehydrogenase to form lactate may also occur in the second vessel 204.

[0066] The second product, including a hydroxybutyryl-CoA, is flowed from the second vessel 204 via the second solution 218 to the third vessel 206 through a fourth flow path 226 to form a third solution 228. The third solution 228 includes the hydroxybutyryl-CoA, sodium acetate, and acetate. In certain embodiments, no additional components are added to the second solution 218 removed from the second vessel to form the third solution 228 (including the second product of hydroxybutyryl-CoA). The third solution 228 is contacted with a poly(R)-hydroxyalkanoic acid synthase in the third vessel 206 to form the biopolymer polyhydroxybutyrate. The poly(R)-hydroxyalkanoic acid synthase can be free in the third solution 228 or may be immobilized on a third substrate 234. In certain embodiments, the third substrate 234 may be a Ni-NTA polystyrene film.

[0067] As demonstrated in FIG. 4, at least a part of the third solution 228 in the third vessel 206 is flowed back to the first vessel 202 via a fifth flow path 230. In certain embodiments, flowing a part of the third solution 228 back to the first vessel 202 resupplies the first solution 212 with liberated CoA. The third solution 228 including the final polyhydroxybutyrate product may also be easily removed from the third vessel 206 via port 240 and sixth flow path 242. As described above, the polyhydroxybutyrate will precipitate out of the third solution 228 when it reaches a certain molecular weight.

[0068] In certain example embodiments, the first vessel 202, the second vessel 204, and the third vessel 206 include stirring devices 252, 254, and 256, respectively, and the reaction may be stirred or mixed at a rate of about 30 rpm or more, such as about 35 rpm or more, such as about 40 rpm or more, such as about 45 rpm or more, such as about 50 rpm or more, and generally less than about 100 rpm, such as less than about 95 rpm, such as less than about 90 rpm, such as less than about 85 rpm, such as less than about 80 rpm. Thus, in some example embodiments, the reaction may be stirred or mixed at a rate of about 40 rpm to about 80 rpm, such as about 60 rpm.

[0069] In other example embodiments, the cascade of reactions within the multi-vessel reactor 200 may occur at a temperature of about 10°C or more, such as about 15°C or more, such as about 20°C or more, such as about 25°C or more, generally less than about 40°C, such as generally less than about 35°C, such as less than about 30°C. In some example embodiments, the reaction is run at a temperature of about 15°C to about 35°C, such as about 25°C. In certain example embodiments, the first solution 212, the second solution 218, and / or the third solution 228 may have a pH of about 3.3 to about 6.0, such as about 3.6 to about 5.6, such as about 4.0 to about 5.3, such as about 4.3 to about 5.0, such as about 4.7 to about 4.9.Without intending to be limited by theory, the present inventors have found that the flow of the solutions from one vessel to another helps to sustain the enzymatic reaction, and further, that the flow rates may be utilized to optimize kinetics towards more yield. Flow rates may be controlled by any known means in the art, such as being controlled via gravity and regulated with a stopcock or being driven by a peristaltic pump. Generally, the flow rates may be about 0 mL / min or greater, such as about 0.25 mL / min or greater, such as about 0.5 mL / min or greater, such as about 1 .0 mL / min or greater, such as about 2.0 mL / min or greater, such as about 3.0 mL / min or greater, such as about 4.0 mL / min or greater, such as about 5.0 mL / min or greater, such as about 60 mL / min or greater, and generally less than about 200 mL / min, such as less than about 10.0 mL / min, such as less than about 9.0 mL / min, such as less than about 8.0 mL / min, such as less than about 7.0 mL / min.

[0070] For instance, the present inventors have found that there is a relationship between the flow rates of the flow of the acetate from the acetate reservoir 210 to the first vessel 202 (e.g., first flow path 208) and the flow of the first product of the first vessel into the second vessel 204 (e.g., second flow path 216).

[0071] In certain embodiments, the flow of the acetate from the acetate reservoir to the first vessel has a first flow rate and the flow of the first product of the first vessel into the second vessel has a second flow rate, wherein the ratio of the first flow rate to the second flow rate is from about 0.15 or greater, such as about 0.2 or greater, such as about 0.25 or greater, such as about 0.3 or greater, such as about 0.33 or greater, and generally less than about 0.5, such as less than about 0.45, such as less than about 0.4, such as less than about 0.35. Thus, in certain example embodiments, the ratio of the first flow rate (e.g., the flow rate of flow path 208) to the second flow rate (e.g., the flow rate of flow path 216) is about 0.15 to about 0.5, such as from about 0.25 to about 0.4, such as from about 0.3 to about 0.35. In preferred embodiments, the ratio of the first flow rate to the second flow rate is about 0.33 (e.g., 1 / 3).

[0072] The present inventors also surprisingly discovered that selectively controlling additional flow rates helped improve the overall reaction. For instance, the present inventors discovered that by controlling the flow rate of the at least part of the third solution 228 that flows from the third vessel 206 back to the first vessel 202 via the flow path 230 may also increase the linear phase of the overall reaction. Thus, in certain example embodiments, the flow rate of the solution 228 that is being transported to the first tank 202 via flow path 230 is about 4.0 mL / min or greater, such as about 4.5 mL / min or greater, such as about 5.0 mL / min or greater, such as about 5.5 mL / min or greater, such as about 6.0 mL / min or greater, and generally less than about 9.0 mL / min, such as less than about 8.5 mL / min, such as less than about 8.0 mL / min, such as less than about 7.5 mL / min, such as less than 7.0 mL / min. In some example embodiments, the flow rate of the solution 228 that is being transported to the first tank 202 via flow path230 is about 4.0 mL / min to about 9.0 mL / min, such as about 5.0 mL / min to about 8.0 mL / min, and in preferred example embodiments, such as about 6.0 mL / min to about 7.0 mL / min.

[0073] The present invention may be better understood by reference to the following examples.

[0074] EXAMPLES EXAMPLE ONE: ENZYME PRODUCTION, PURIFICATION, AND IMMOBILIZATION Seven enzymes required for the production of PHB from acetate were recombinantly created utilizing the protein expression constructs as shown in the sequences of FIG. 2 and pursuant to the Sequence Listing submitted herewith. On each of the seven sequences in FIG.2, a C-ter extension was formed on each sequence to tether the resulting enzyme to a substrate for immobilization. The C-ter extension was GSLEVLFQGPGSGSHHHHHH. The hexahistidine tag was employed for both one-step purification as well as tethering to a nickle modified solid substrate.

[0075] Optimized codon usage for E.coli resulted in the DNA sequence for the tag:

[0076] GGCTCTCTGGAAGTGCTGTTTCAGGGCCCG(GGCAGC)3(CAT)6 Standard molecular biology PCR techniques were employed to produce the seven sequences as detailed in FIG. 2 and the accompanying Sequence Listing. The inserts were cloned into the expression vector pET-11d. The insert was verified by DNA sequencing after construction. A NADH-favoring acetoacetyl-CoA reductase was constructed following the method of Olavarria et al. (2021 , 2022) and compared to other modeled variants (Chohan et al., 1998; de Las Heras et al., 2016).

[0077] Each expression plasmid was used to transform chemically competent BL21 (DE3) bacteria. Single colonies were selected from LB-Amp plates and used for expression screening. Colonies were grown at 37°C for 12 hours in LB media supplemented with 100 pig / mL ampicillin. This culture was used to inoculate fresh LB-Amp flasks at a 1 :100 inoculum. These cultures were grown at 30°C until OD595=0.4, which was around 4 hours. Then, IPTG was added to a final concentration of 1 mM. Growth was continued for 16 hours.

[0078] Cells were harvested by centrifugation at 10,000 xg for 15 minutes and frozen at -80°C until use (minimal time frozen was 24 hours). Cells were thawed on ice and were resuspended in a buffer including 0.5 M NaCI, 20 mM Tris-HCI, 5mM imidazole, pH 7.9. Cells were disrupted and centrifuged at 30,000 x g for 30 minutes. The supernatant was slowly passed over a 5 cm x 4.9 cc His-Bind resin column with bead heights of 3-4 cm The column was washed with 10 column volumes of wash buffer (0.5 M NaCI, 20 mM Tris-HCI, 60 mM imidazole, pH 7.9) at a flow rate of 0.4 mL / min. The enzymeswere eluted from their respective columns with the addition of 3 column volumes of 0.5 M NaCI, 20 mM Tris-HCI, 1.0 M imidazole, pH 7.9. The pooled fractions were applied to a 70 cm x 4.9 cc Sephadex G-100 column (10 mM Tris-HCI, pH 7.5, 1mM EDTA). Fractions containing homogeneous enzyme were pooled after inspection by SDS PAGE and concentrated to 10 mg / mL via Centricon filters. The enzymes were then stored frozen at -20°C until use.

[0079] The enzymes were then immobilized by coupling the enzymes to a solid substrate. Ni-NTA modified polystyrene film was prepared according to Jeon et al (2017) Films were allowed to react with 10 mg / mL of each enzyme in a buffer composed of 10 mM Tris-HCI (pH 7.5), 100 mM NaCI, and 20 mM imidazole. The reaction was incubated at 25°C for five hours. Films were removed from the coupling reaction, gently washed in coupling buffer, and were stored in 10 mM acetate buffer (pH 5.0) until transferred into a reactor.

[0080] EXAMPLE TWO: REENGINEERING THE ACETOBACTER ACETOACETYL-COA REDUCTASE TO PREFER NADH COFACTOR OVER NADPH COFACTOR

[0081] One of the seven enzymes produced in Example 1 is a genetically engineered acetoacetyl-CoA reductase according to the sequence as demonstrated by by FIG. 2F. Without intending to be limited by theory, the present inventors believe that reeingineering the Acetobacter acetoacetyl-CoA reductase to prefer a NADH cofactor over its usual NADPH cofactor is critical to the success of the enzyme-based reaction. Notably, the liberated NAD+can be utilized by lactate dehydrogenase to reform NADH. The use of a NADH preferring reductase is more straightforward, as only one such cofactor (e.g ., NADH) is needed to drive the overall process. Table 1 shows the kinetic constants for NADH and NADPH cofactor utilization for the wild-type Acetobacter enzyme and the genetically-modified variant utilized in the present disclosure.Table 1 : Kinetic constants for NADH and NADPH cofactor utilization in both the wild-type acetoacetyl-CoA reductase and the engineered acetoacetyl-CoA reductase variant.

[0082]

[0083] D = (kcat / Km)NADH / (kcat / Km)NADPH

[0084] As demonstrated by Table 1 , the engineered enzyme of the present disclosure has a 54.5-fold preference for NADH over the native NADPH cofactor, which is significantly more than the wild-type prefers NADPH (e.g., about 5-fold more).

[0085] EXAMPLE THREE: SINGLE VESSEL REACTOR

[0086] 1.5 L of an initial reaction buffer including 100 mM sodium acetate, 100 mM acetate (for a pH of 4.8), 1.0-5.0 M coenzyme A (e.g., CoA), 1.0-50 mM ATP, and 1.0-50 mM pyruvate were added to a single vessel reactor. As demonstrated by FIG. 3, the single vessel reactor included a gas port, a bufferexchange port, and a product sample port. The reaction was run at 25°C. The reaction was stirred at a rate of 60 rpm.

[0087] All seven enzymes created in Examples 1-2 were coupled to a Ni-NTA polystyrene film and were placed in the single vessel reactor. The flow rates of the acetate from the acetate reservoir into the first reactor and the buffer exiting the first vessel reactor were set to 0.5 mL / min. Additional sodium acetate / acetate was flowed into the reactor at rates ranging from 1.0 to 20 mL / hour. Samples of precipitated PHB was harvested every 12 hours and weighed As demonstrated by FIG. 5, the mass of PHB increased over a 100-hour period before beginning to level off at a value of 32 g / L.

[0088] EXAMPLE FOUR: MULTI-VESSEL REACTOR

[0089] A three-vessel enzyme cascade reactor design was utilized to test the reaction within a multivessel reactor, as demonstrated by FIG.4. 500 mL of an initial reaction buffer including 100 mM sodium acetate, 100 mM acetate (for a pH of 4.8), 10-50 mM coenzyme A (e.g., CoA), and 10-50 mM ATP was added to the first vessel reactor. The first vessel reactor catalyzed the conversion of acetate to acetoacetyl-CoA, the first two steps in the process of forming PHB from acetate, while regenerating the ATP cofactor. The enzymatic reactions are sustained by the flow of the acetate from the acetate reservoir into the first vessel and the flow of product from the first vessel into the second vessel reactor.

[0090] The second vessel reactor catalyzed the formation of hydroxybutyryl-CoA as well as the NADH regenerating system (via the lactate dehydrogenase) in a 500 mL buffer of 50 mM sodium acetate / acetate (pH 4.8) and 50 mM pyruvate. The enzymatic reactions are sustained by the flow of the pyruvate from the pyruvate reservoir into the second vessel reactor to regenerate the cofactor and the flow of the product from the second vessel reactor into the third vessel reactor.

[0091] The third vessel reactor formed PHB from the inflow of hydroxybutyryl-CoA via PHB polymerase and contained a 500 mL buffer of 50 mM sodium acetate / acetate (pH 4.8). The reaction mixture from the third vessel reactor (excluding precipitated PHB) was flowed back into the first vessel reactor to resupply the first reactor vessel with liberated CoA.

[0092] EXAMPLE FIVE: OPTIMIZATION OF THE F1 / F2 FLOW RATES OF THE MULTI-VESSEL REACTOR The flow rates of the flow of acetate from the acetate reservoir (“F1”) and the flow of product from the first vessel reactor into the second vessel reactor (“F2”) were tested to determine theoptimized kinetics for formation of acetoacetyl -CoA. Various flow rates of F1 and F2 of the mulit-vessel reactor were tested and measured utilizing the assay kit output of fluorescence emission intensity at 587 nm as a surrogate for acetoacetyl-CoA concentration. Various flow rates of F1 and F2 were tested according to Table 2:

[0093] Table 2: Optimization of the F1 / F2 flow rates to maximize PHB yield.

[0094]

[0095] As demonstrated by Table 2, the present inventors have found that the outflow rate of F2 needs to be higher than the inflow rate of F1 and that the F1 flow needs to be sufficient to provide new substrate into the first reactor. Thus, a F1 / F2 ratio of 1 / 3 provided the highest fluorescence emission intensity value, and thus the most acetoacetyl-CoA formed.

[0096] A multi-vessel reaction with this optimized F1 / F2 flow rate was conducted. The F1 flow rate and the flow rate of the pyruvate from the pyruvate reservoir into the second vessel reactor (“F3”) were 1.0 mL / min, the flow of the product from the second vessel reactor to the third vessel reactor (“F4”) , the flow of the product from the third vessel reactor back to the first vessel reactor (“F5”) and the F2 flow rates were 3.0 mL / min, and the flow of the buffer out of the third vessel reactor (“F6”) flow rate was 0 mL / min. These flow rates maintained an overall nearly equal volume of reactant in each of the vessels. Flow from F1 and F3 were gravity driven and regulated via a stopcock while the other flows were driven by a peristaltic pump. As demonstrated by FIG. 6, there is a linear continuous increase in PHB yielduntil t=100 hours, followed by a period of smaller PHB yield increase, when the system is run for 144 hours.

[0097] EXAMPLE SIX: OPTIMIZATION OF THE F5 FLOW RATE OF THE MULTI-VESSEL REACTOR A second optimization experiment was conducted to determine if the linear phase of the overall reaction could be improved. It was discovered that linearity (at the fixed F1-F4 flow rates) was dependent on F5, which is primarily used to return CoA back to R1.

[0098] Various flow rates of F5 were tested according to Table 3:

[0099] Table 3: PHB Yield (at t=144 h) as a function of F5 flow rate.

[0100]

[0101] As demonstrated by Table 2, CoA in the first vessel reactor is exhausted quickly when F5 is set to 0 mL / min, confirming the need to resupply the CoA cofactor. As the rate of F5 increased, the yield of PHB increases until it begins to plateau at approximately 6-7 mLs / min. Thus, the F5 flow rate for further experiments was set to 6.0 mL / min to maximize PHB yield while minimizing reactor volume differences over the course of a typical run.

[0102] A multi-vessel reaction with this F5 flow rate was conducted. The F1 and F3 flow rates were 1.0 mL / min, the F2 and F4 flow rates were 3.0 mL / min, the F6 flow rate was 1.0 mL / min, and the F5 flowrate was 6.0 mL / min. As demonstrated by FIG. 7, optimizing the F5 flow rate in addition to the F1 / F2 flow rat ratio resulted in the linear portion of the reaction being extended by nearly 40 hours. Without intending to be limited by theory, the present inventors believe that extending the linearity of the reaction is most likely dependent on the stability of the coupled enzyme system or to maintaining some component initially found in the reaction volume, such as pH.

[0103] EXAMPLE SEVEN: STABILITY TESTING

[0104] To test the stability of the three immobilized enzyme systems in the multi-vessel reaction, a longer run was performed with and without substitution of a new immobilized enzyme sheet to the reactors. Table 3 illustrates the results of providing fresh immobilized enzyme to one bioreactor at a time over a 300-hour run Enzyme packs were exchanged at t=150 hours.

[0105] Table 4: PHB yield { at t=300 hours) with and without refreshed Enzyme Packs

[0106]

[0107] As demonstrated by Table 4, the plateau that is observed in earlier experiments is alleviated when the immobilized PHB polymerase in the third reactor is replaced. Thus, without intending to be limited by theory, the present inventors believe that a major contributor to the plateau in the PHB yield is due to PHB polymerase reduction in specific activity. Although replacing the enzyme pack in the third vessel reactor shows the most dramatic increase, there is also a noticeable increase in PHB yield when the second vessel reactor enzyme pack is replaced. Replacing the second vessel reactor enzyme pack refreshes the amount of acetoacetyl-CoA reductase monomers, which may be disassociating over the reaction time course.An immobilized enzyme-based bioreactor approach produces more PHB / L per unit time than do even the best methods that utilize bacteria. For instance, studies using the genera Pseudomonas and Alcaligenes form roughly 10 g PHB per liter of culture in 24 hours from a 20 g / L feedstock (Sayyed et al., 2021). This is approximately 50% of the yields shown here at an equivalent time point. Even compared to the most utilized genus, Cupriavidus, yields of the present disclosure are higher (Zhang et al., 2022). Notably, the productivity of the system, as measured in units of g / (L h), is from 2 to 50 fold higher using an enzyme-based system, as demonstrated by the present disclosure, compared to systems utilizing Rubrobacter species (Obruca et al., 2021), the 25 bacterial species reviewed in Chavan et al. (2021), and the 16 species reviewed in Koller (2017).

[0108] EXAMPLE EMBODIMENTS

[0109] Example Embodiment 1 : A method for forming a biopolymer, the method comprising a cascade of enzymatic reactions: reacting an acetate with a first cofactor and an Acetate-CoA ligase to form an Acetyl-CoA; reacting the Acetyl-CoA with an Acetyl-CoA C-acetyltransferase to form an Acetoacetyl-CoA; reacting the Acetoacetyl-CoA with a second cofactor and an Acetoacetyl-CoA reductase to form a (R)-3-hydroxybutryl-CoA; and reacting the (R)-3-hydroxybutryl-CoA with a Poly(R)-hydroxyalkanoic acid synthase to form a polyhydroxybutyrate.

[0110] Example Embodiment 2: The method of example embodiment 1 , wherein the first cofactor is an ATP. Example Embodiment 3: The method as in any preceding embodiment , wherein the second cofactor is a NADH.

[0111] Example Embodiment 4: The method as in any preceding embodiment, wherein no bacterial fermentation occurs during the method.

[0112] Example Embodiment 5: The method as in any preceding embodiment, further comprising hydrolyzing the ATP to form an AMP during the reaction between the acetate and the acetate-CoA ligase.

[0113] Example Embodiment 6: The method as in any preceding embodiment, further comprising reacting the AMP with an ATP and an adenylate kinase to form two ADP.

[0114] Example Embodiment 7: The method as in any preceding embodiment, further comprising reacting the two ADP with a polyphosphate kinase and a polyphosphate including at least two phosphate units to regenerate a supply of ATP.Example Embodiment 8: The method as in any preceding embodiment, further comprising oxidizing the NADH during the reaction between the acetoacetyl-CoA and the acetoacetyl-CoA reductase to form a NAD+.

[0115] Example Embodiment 9: The method as in any preceding embodiment, wherein the NADH donates a hydride ion to a pyruvate, further comprising reacting the pyruvate with a lactate dehydrogenase to form a lactate.

[0116] Example Embodiment 10: The method as in any preceding embodiment, wherein the acetate is the sole starting material for the cascade of enzymatic reactions.

[0117] Example Embodiment 11: The method as in any preceding embodiment, wherein the first cofactor and the second cofactor are regenerated.

[0118] Example Embodiment 12: The method as in any preceding embodiment, further comprising producing the acetate-CoA ligase, the acetyl-CoA C-acetyltransferase, the acetoacetyl-CoA reductase, the poly(R)-hydroxyalkanoic acid synthase, the lactate dehydrogenase, the adenylate kinase, and the polyphosphate kinase recombinantly from an Acetobacter spp. bacteria or an Acidiphilium spp. bacteria.

[0119] Example Embodiment 13: The method as in any preceding embodiment, wherein the Acetobacter spp bacteria or the Acidiphilium spp. bacteria is an Acetobacter aceti, an Acetobacter peroxydans, an Acetobacter oeni, and / or Acidiphilium acidophilum.

[0120] Example Embodiment 14: The method as in any preceding embodiment, wherein the acetoacetyl-CoA reductase has been genetically modified to favor a NADH cofactor.

[0121] Example Embodiment 15: A process for forming a polyhydroxybutyrate in a single vessel, the process comprising: contacting a solution comprising a sodium acetate, an acetate, a coenzyme A, an ATP, and a pyruvate with a plurality of enzymes in a single vessel, the plurality of enzymes comprising an Acetate-CoA ligase, an Acetyl-CoA C-acetyltransferase, an Acetoacetyl-CoA reductase, a Poly(R)-hydroxyalkanoic acid synthase, a lactate dehydrogenase, an adenylate kinase, and a polyphosphate kinase; reacting the solution and the plurality of enzymes to form the polyhydroxybutyrate; and precipitating the polyhydroxybutyrate out of the solution.

[0122] Example Embodiment 16: The process of embodiment 15, wherein the solution has a pH of about 3.3 to about 6.0, such as about 3.6 to about 5.6, such as about 4.0 to about 5.3, such as about 4.3 to about 5.0, such as about 4.7 to about 4.9Example Embodiment 17: The process as in any preceding embodiment, wherein the plurality of enzymes are immobilized on a substrate that is placed inside of the single vessel.

[0123] Example Embodiment 18: The process as in any preceding embodiment, wherein the solution and the plurality of enzymes are reacted at a temperature of about 15°C to about 35°C and are mixed at about 40 rpm to about 80 rpm.

[0124] Example Embodiment 19: A process for forming a polyhydroxybutyrate with a multi-vessel reactor, the process comprising:contacting a first solution comprising a sodium acetate, an acetate, a coenzyme A, and an ATP with a first plurality of enzymes in a first vessel to form a first product including an acetoacetyl-CoA, the first plurality of enzymes comprising acetate— CoA ligase, polyphosphate kinase, adenylate kinase, and acetyl-CoA C-acetyltransferase; flowing the first product of the first vessel into a second vessel ;contacting a second solution comprising the acetoacetyl-CoA, the sodium acetate, the acetate, a pyruvate, and a NADH with a second plurality of enzymes in the second vessel to form a second product including a hydroxybutyryl-CoA, the second plurality of enzymes comprising acetoacetyl-CoA reductase and lactate dehydrogenase; flowing the second product of the second vessel into a third vessel; contacting a third solution comprising the hydroxybutyryl-CoA, the sodium acetate, and the acetate with a poly(R)-hydroxyalkanoic acid synthase in the third vessel to form the polyhydroxybutyrate; and precipitating the polyhydroxybutyrate out of the third solution.

[0125] Example Embodiment 20: The process of embodiment 19, further comprising flowing at least a part of the solution in the third vessel back to the first vessel to resupply the first vessel with liberated CoA. Example Embodiment 21: The process as in any preceding embodiment, further comprising regenerating the ATP in the first vessel.

[0126] Example Embodiment 22: The process as in any preceding embodiment, wherein the acetate is added to the first vessel by flowing the acetate from an acetate reservoir into the first vessel.

[0127] Example Embodiment 23: The process as in any preceding embodiment, wherein the flow of the acetate from the acetate reservoir to the first vessel has a first flow rate and the flow of the first product of the first vessel into the second vessel has a second flow rate, wherein the ratio of the first flow rate to the second flow rate is from about 0.15 to about 0.5, such as from about 0.25 to about 0.4, such as from about 0.3 to about 0.35.

[0128] Example Embodiment 24: The process as in any preceding embodiment, further comprising regenerating the NADH in the second vessel.Example Embodiment 25: The process as in any preceding embodiment, wherein the pyruvate is added to the second vessel by flowing the pyruvate from a pyruvate reservoir into the second vessel.

[0129] Example Embodiment 26: The process as in any preceding embodiment, wherein the flow of the at least a part of the solution in the third vessel back to the first vessel has a third flow rate, wherein the third flow rate is about 4.0 mL / min to about 9.0 mL / min, such as about 5.0 mL / min to about 8.0 mL / min, such as about 6.0 mL / min to about 7.0 mL / min.

[0130] Example Embodiment 27: The process as in any preceding embodiment, wherein the first plurality of enzymes, the second plurality of enzymes, and / or the third plurality of enzymes are immobilized on a substrate.

Claims

WHAT IS CLAIMED IS:

1. A method for forming a biopolymer, the method comprising a cascade of enzymatic reactions:reacting an acetate with a first cofactor and an acetate-CoA ligase to form an acetyl-CoA;reacting the acetyl-CoA with an acetyl-CoA C-acetyltransferase to form an acetoacetyl- CoA;reacting the acetoacetyl-CoA with a second cofactor and an acetoacetyl-CoA reductase to form a (R)-3-hydroxybutryl-CoA; andreacting the (R)-3-hydroxybutryl-CoA with a poly(R)-hydroxyalkanoic acid synthase to form a polyhydroxybutyrate.

2. The method of claim 1 , wherein the first cofactor is an ATP.

3. The method of claim 1, wherein the second cofactor is a NADH.

4. The method of claim 1 , wherein no bacterial fermentation occurs during the method.

5. The method of claim 2, further comprising hydrolyzing the ATP to form an AMP during the reaction between the acetate and the acetate-CoA ligase.

6. The method of claim 5, further comprising reacting the AMP with an ATP and an adenylate kinase to form two ADP.

7. The method of claim 6, further comprising reacting the two ADP with a polyphosphate kinase and a polyphosphate including at least two phosphate units to regenerate a supply of ATP.

8. The method of claim 3, further comprising oxidizing the NADH during the reaction between the acetoacetyl-CoA and the acetoacetyl-CoA reductase to form a NAD+.

9. The method of claim 8, wherein the NADH donates a hydride ion to a pyruvate, further comprising reacting the pyruvate with a lactate dehydrogenase to form a lactate.

10. The method of claim 1 , wherein the acetate is the sole starting material for the cascade of enzymatic reactions.

11. The method of claim 1 , wherein the first cofactor and the second cofactor are regenerated.

12. The method of any preceding claim, further comprising producing the acetate-CoA ligase, the acetyl-CoA C-acetyltransferase, the acetoacetyl-CoA reductase, the poly(R)-hydroxyalkanoic acid synthase, the lactate dehydrogenase, the adenylate kinase, and the polyphosphate kinase recombinantly from an Acetobacter spp. bacteria or an Acidiphilium spp. bacteria.

13. The method of claim 12, wherein the Acetobact er spp. bacteria or the Acidiphilium spp.bacteria is an Acetobacter aceti, an Acetobacter peroxydans, an Acetobacter oeni, and / or Acidiphiiium acidophilum.

14. The method of claim 12, wherein the acetoacetyl-CoA reductase has been genetically modified to favor a NADH cofactor.

15. A process for forming a polyhydroxybutyrate in a single vessel, the process comprising:contacting a solution comprising a sodium acetate, an acetate, a coenzyme A, an ATP, and a pyruvate with a plurality of enzymes in a single vessel, the plurality of enzymes comprising an acetate-CoA ligase, an acetyl-CoA C-acetyltransferase, an acetoacetyl-CoA reductase, a poly(R)-hydroxyalkanoic acid synthase, a lactate dehydrogenase, an adenylate kinase, and a polyphosphate kinase;reacting the solution and the plurality of enzymes to form the poly hydroxy butyrate; and precipitating the polyhydroxybutyrate out of the solution.

16. The process of claim 15, wherein the solution has a pH of about 3.3 to about 6.0, such as about 3.6 to about 5.6, such as about 4.0 to about 5.3, such as about 4.3 to about 5.0, such as about 4.7 to about 4.9.

17. The process of claim 15, wherein the plurality of enzymes is immobilized on a substrate that is placed inside of the single vessel.

18. The process of claim 15, wherein the solution and the plurality of enzymes are reacted at a temperature of about 15°C to about 35°C and are mixed at about 40 rpm to about 80 rpm.

19. A process for forming a polyhydroxybutyrate with a multi-vessel reactor, the process comprising:contacting a first solution comprising a sodium acetate, an acetate, a coenzyme A, and an ATP with a first plurality of enzymes in a first vessel to form a first product including an acetoacetyl-CoA, the first plurality of enzymes comprising acetate-CoA ligase, polyphosphate kinase, adenylate kinase, and acetyl-CoA C-acetyltransferase;flowing the first product of the first vessel into a second vessel;contacting a second solution comprising the acetoacetyl-CoA, the sodium acetate, the acetate, a pyruvate, and a NADH with a second plurality of enzymes in the second vessel to form a second product including a hydroxybutyryl-CoA, the second plurality of enzymes comprising acetoacetyl-CoA reductase and lactate dehydrogenase;flowing the second product of the second vessel into a third vessel;contacting a third solution comprising the hydroxybutyryl-CoA, the sodium acetate, and the acetate with a poly(R)-hydroxyalkanoic acid synthase in the third vessel to form the polyhydroxybutyrate; andprecipitating the polyhydroxybutyrate out of the third solution.

20. The process of claim 19, further comprising flowing at least a part of the third solution in the third vessel back to the first vessel to resupply the first vessel with liberated CoA.

21. The process of claim 19, further comprising regenerating the ATP in the first vessel.

22. The process of claim 19, wherein the acetate is added to the first vessel by flowing the acetate from an acetate reservoir into the first vessel.

23. The process of claim 22, wherein the flow of the acetate from the acetate reservoir to the first vessel has a first flow rate and the flow of the first product of the first vessel into the second vessel has a second flow rate, wherein the ratio of the first flow rate to the second flow rate is from about 0.15 to about 0.5, such as from about 0.25 to about 0.4, such as from about 0.3 to about 0.35.

24. The process of claim 19, further comprising regenerating the NADH in the second vessel.

25. The process of claim 19, wherein the pyruvate is added to the second vessel by flowing the pyruvate from a pyruvate reservoir into the second vessel.

26. The process of claim 20, wherein the flow of the at least a part of the solution in the third vessel back to the first vessel has a third flow rate, wherein the third flow rate is about 4.0 mL / min to about 9.0 mL / min, such as about 5.0 mL / min to about 8.0 mL / min, such as about 6.0 mL / min to about 7.0 mL / min.

27. The process of claim 19, wherein the first plurality of enzymes, the second plurality of enzymes, and / or the third plurality of enzymes are immobilized on a substrate.