TREG specific synthetic promoters

Abstract

Synthetic promoters that preferentially upregulate expression in Treg cells comprise a plurality of transcription regulatory elements recognized by selected transcription factors, functionally coupled to a core promoter. The synthetic promoters are useful for expressing proteins, such as T cell receptors, preferentially in Treg cells compared with other cells, such as Teff cells.

Description

Docket No.: 237752001140TREG SPECIFIC SYNTHETIC PROMOTERS CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to and benefit of U.S. Provisional Application No.63 / 749,446, filed January 24, 2025, U.S. Provisional Application No. 63 / 803,526, filed May 9, 2025, and U.S. Provisional Application No. 63 / 888,987, filed September 26, 2025, the contents of each of which are incorporated herein by reference in their entireties.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The content of the electronic sequence listing (237752001140SeqList.xml; Size: 57,977 bytes; and Date of Creation: January 20, 2026) is herein incorporated by reference in its entirety.TECHNICAL FIELD

[0003] The present disclosure relates to synthetic promoters that preferentially upregulate expression in Treg cells. The synthetic promoters of the present disclosure comprise a plurality of transcription regulatory elements recognized by selected transcription factors, operably linked to a core promoter. The synthetic promoters are useful for expressing proteins, such as T cell receptors, preferentially in Treg cells compared with other cells, such as Teff cells.BACKGROUND

[0004] The immune system plays a critical role in maintaining organismal homeostasis, poised between the elimination of foreign antigens and the self-tolerance of autoantigens. In particular, hyperactive immune dysregulation can lead to various autoimmune disorders (e.g., irritable bowel syndrome, systemic lupus erythematosus, alopecia areata, multiple sclerosis), which is often the result of overactive effector T lymphocytes or underactive regulatory T lymphocytes (i.e., Tregs). Current therapies for autoimmune diseases involve the administration of steroids, which can cause serious side-effects in patients and often offer little relief.

[0005] Regulatory T cells are a key player in the maintenance of organismal homeostasis to prevent the destruction of otherwise healthy tissues. Tregs are a unique subset of T cells that inhibit the cytotoxic or pro-inflammatory activity of effector CD4+ or effector CD8+ T cells. Tregs differentiate from the parent T lymphocyte lineage upon the upregulation of key1MF-365941982Docket No.: 237752001140Treg genes, in particular CD25 and F0XP3 (see, e.g., Chen, ML et al. (2005), Proc Natl Acad Sci USA 102(2):419-424; and Liu, VC et al. (2007), J Immunol 178(5):2883-2892, hereby incorporated by reference in their entirety). Upon T cell receptor (TCR) activation, these Tregs are responsible for directly suppressing effector T cell activity via cytokine production, e.g., TGF-P and IL- 10 (see, e.g., Chen, J et al. (2019), Trends Mol Med 25(11): 1010-1023, hereby incorporated by reference in its entirety), and the engagement of immune checkpoint receptors, e.g., TIGIT- or CTLA-4-engagement (see, e.g., Knochelmann, HM et al. (2018), Cell Mol Immunol', 15(5):458-469, hereby incorporated by reference in its entirety). While effector T cells are able to produce the cytokine IL-2 upon TCR activation to support their own expansion, Treg cells are dependent upon exogenous IL-2 to promote Treg survival and maintenance, as Tregs are unable to produce their own IL-2. This biological mechanism ensures that Tregs are maintained in tissue niches that are enriched with active effector T cells, thus creating a cellular negative feedback mechanism whereby the increased IL-2 production by the target effector T cell promotes the expansion of the Tregs that then act to inhibit effector T cell activity and thus downstream inhibit their own expansion and survival (see, e.g., Shevyrev, D & Tereshchenko, V (2020), Front Immunol; 10:3100, 1-13). Targeting of the IL-2 receptor signaling pathway in Tregs is one area of interest in the effort to promote Treg cell maintenance and proliferation in order to develop therapies for immune-related disorders.

[0006] Numerous trials have shown the promise of Treg therapy as an alternative to immunosuppressive therapy. However, the development of Treg therapy is more challenging than conventional T cell therapy due to the limited Treg cell number in the blood, the stringency on cell purity, and the potential instability of Treg cells under certain circumstances. Expression of an antigen specific chimeric antigen receptor (“CAR”) or T cell receptor (“TCR”) on a few effector T-cells (Teff cells) contaminated in purified Treg cells at the beginning of cell production can cause detrimental effects in autoimmune disease treatment. More contamination of Teff cells in a Treg product can lead to a low-quality or even a forfeit product. Moreover, Treg cells may destabilize and convert into Teff like cells in an inflammatory microenvironment. When this occurs, the CAR / TCR modified Treg cells will attack the antigen positive tissue and release inflammatory cytokines, which could worsen an existing autoimmune condition.2MF-365941982Docket No.: 237752001140

[0007] FOXP3 is a gold standard biomarker for Treg cells. FOXP3 gene regulatory sequences extend across several thousand base pairs in the genome. Recently, endogenous regulatory elements from the promoter of this gene were rearranged and cloned into a lentiviral vector to control FOXP3 expression in a preclinical research for immune dysregulation, polyendocrinopathy, enteropathy, X-linked (IPEX). Masiuk et al., 2019, Cell Stem Cell 24: 309-317. However, while this suggests that synthetic promoters offer promise for rescue of Treg deficiency, the non-trivial expression in Teff means that their application for CAR-T gene therapy in Treg cells remains an unmet need.SUMMARY

[0008] Provided herein are synthetic promoters that preferentially promote transcription in Treg cells. The percentage of Treg cells expressing a transgene under the control of Treg-specific promoters (“TRSP”) can be 20-fold higher than in Teff cells. That is, about twenty times more Treg cells than Teff cells express the transgene. The synthetic promoters of this disclosure comprise a plurality of transcription factor response elements (“TREs”) that, together, result in Treg-cell specificity. TREs that can be included in the promoters include, without limitation, one or more TREs that are recognized by transcription factors selected from: FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOX10, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1, and AHRIF. In particular, synthetic promoters that comprise at least four TREs selected from FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG demonstrate Treg specificity. Typically, the TRE cassette comprising the TREs includes the TRE consensus sequence for FOXP3, which is included in TREs recognized by FOXP1. Exemplary nucleotide sequences of these TREs are provided in Table 2. Treg-specific promoters can comprise between six and 18 TREs functionally coupled or operably linked to a core promoter.

[0009] The synthetic promoters of this disclosure can be used in Treg cells to promote the expression of transgenes to which they are operably linked. Such transgenes can include, for example, a chimeric antigen receptor (“CAR”), a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker. Cells comprising these expression constructs can be used, for example, in the treatment of a disorder associated with Treg cell dysfunction, such as an autoimmune disease, an allergy, an inflammatory condition or a transplant rejection.3MF-365941982Docket No.: 237752001140

[0010] In one aspect, provided herein is a synthetic promoter that preferentially promotes transcription in Treg cells, including a plurality of transcription factor response elements (TREs) wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, wherein the TREs are operably linked to a core promoter.

[0011] In another aspect, provided herein is a synthetic promoter that preferentially promotes transcription in Treg cells, including a plurality of transcription factor response elements (TREs), wherein each TRE in the plurality is recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG, wherein the TREs are operably linked to a core promoter.

[0012] In some embodiments of any of the preceding aspects, the plurality of TREs includes a TRE recognized by FOXP3. In some embodiments, the plurality of TREs includes a TRE recognized by FOXP3 and a TRE recognized by ELFE In some embodiments, the plurality of TREs further includes at least one TRE recognized by a transcription factor selected from the group consisting of SOX4, AR, and TBX2Related. In some embodiments, the plurality of TREs further includes at least one copy of at least one TRE recognized by a transcription factor selected from the group consisting of FOSL1, MAFK, and MAFG. In some embodiments, the plurality of TREs includes at least 1, at least 2, at least 3, or 4 TREs recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, and FOSL1. In some embodiments, the plurality of TREs further includes 1, 2, 3 or 4 TREs recognized by a transcription factor selected from the group consisting of AR, MAFK, TBX2Related, and MAFG. In some embodiments, the TREs are recognized by at least 4, at least 5, at least 6, at least 7, or 8 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG. In some embodiments, SOX4 is present only if FOXP3 and AR are also present; TBX2Related is absent only if JUNBFRA is present; NKX3A and ATF3 are each present only if the other is present; or CEBPE, ETV5CEBPD_01, NFATC1 are each present only if the others are present. In some embodiments, the synthetic promoter includes a TRE having a FOXP3 consensus sequence RTAAACA. In some embodiments, the plurality of TREs includes a4MF-365941982Docket No.: 237752001140TRE recognized by FOXP3. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3 and ELFE In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1 and AR. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, and TBX2Related. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, and MAFK. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, and FOSL1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, and MAFG. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, TBX2Related and AR. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3 (optionally 4 copies), ELF1 (optionally 3 copies), TBX2Related (optionally 3 copies), AR (optionally 3 copies), SOX4, MAFK, and FOSL1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3 (optionally 3 copies), ELF1, TBX2Related (optionally 3 copies), AR, SOX4 (optionally 2 copies), MAFK (optionally 2 copies), FOSL1, and MAFG. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3 (optionally 3 copies), ELF1 (optionally 6 copies), TBX2Related (optionally 3 copies), AR (optionally 2 copies), SOX4, MAFK (optionally 2 copies), and MAFG. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and ELF1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and FOSL1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and AR. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and MAFK. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and TBX2Related. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and MAGF. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4, ELF1 (optionally in two copies), AR (optionally in two copies), JUNBFRA, ATF3, FOXP1, R0RA2 and NKX3A. In some embodiments, the synthetic promoter includes, in 5'-to-3' order, the TREs recognized by SOX4, ELF1, ATF3, FOXP1, R0RA2, FOXP3, AR, NX3A, JUNBFRA2, AR, ELF1. In some embodiments, the synthetic promoter further includes restriction enzyme cleavage sites Mlul and Avril. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4, FOSL1, AR, MAFK, TBX2Related, MAFG, JUNBFRA, IRF3, RARB and PEA3 (optionally in 2 or 3 copies). In some embodiments, the synthetic promoter includes, in 5'-to-3' order, the TREs recognized by FOSL1, SOX4, TBX2Related, JUNBFRA2, MAFK, IRF3, PEA3, PEA3, IRF3, AR,5MF-365941982Docket No.: 237752001140RARB, F0XP3, MAFG. In some embodiments, the synthetic promoter further includes restriction enzyme cleavage sites Mini and Avril. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4, ELF1, AR (optionally in two or three copies), MAFK, TBX2Related, SOXIO, and PEA3. In some embodiments, the synthetic promoter includes, in 5'-to-3' order, the TREs recognized by SOX4, SOXIO, AR, FOXP3, MAFK, PEA3, TBXRelated, ELF1, AR, AR. In some embodiments, the synthetic promoter further includes restriction enzyme cleavage sites Mini, Avril and AvrII_mut. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4, FOSL1 (optionally in two copies), MAFK, MEF2A (optionally in 2 or 3 copies), SOXIO, ATF3, AHRHIF, PAX3, NRF1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 (optionally in two copies), ELF1, FOSL1 (optionally in two copies), MAFG, PEA3, MEF2A, NKX3A, CEBPE, ETV5CEBPD_01, and SOX9. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4, ELF1, FOSL1, AR, FOXP1, and ATF3 (optionally in 2 copies). In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, MAFK (optionally in two copies), TBX2Related, MAFG (optionally in two copies), FOXP1, IRF3, CEBPE, ETV5CEBPD_01, and NFATC1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3 (optionally in two copies), FOSL1, TBX2Related, MAFG (optionally in two copies), RORA2, and IRF3. In some embodiments, the synthetic promoter includes at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 different TREs. In some embodiments, the synthetic promoter includes at least two copies of one or more of the TREs. In some embodiments, at least one TRE is duplicated and is selected from the group consisting of a TRE recognized by AR, FOXP3, MAFG, and EFL1 four JUNBFRA. In some embodiments, the synthetic promoter comprises three copies of a TRE recognized by AR. In some embodiments, the number of unique TREs in the plurality is not more than any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, the synthetic promoter includes at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 10, or at most 20 TREs. In some embodiments, the at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 10, or at most 20 TREs are unique TREs. In some embodiments, the at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at 6MF-365941982Docket No.: 237752001140most 10, or at most 20 TREs are non-unique TREs. In some embodiments, the number of unique TREs in the plurality is at least any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, the plurality of TREs span a range of no more than 400 nucleotides. In some embodiments, the plurality of TREs span a range of no more than 300 nucleotides, optionally between 100-300 nucleotides. In some embodiments, the plurality of TREs span a range of between 275 nucleotides and 375 nucleotides. In some embodiments, the synthetic promoter includes no more than 500, 400, 350, or 300 nucleotides. In some embodiments, the TREs, if present, include a consensus sequence of SOX4 (FIG. 7A; SEQ ID NO: 1); FOXP3 (FIG. 7B; SEQ ID NO: 2); AR (FIG. 7C; SEQ ID NO: 3); SOX10 (FIG. 7D; SEQ ID NO: 4); ELF1 (FIG. 7E; SEQ ID NO: 5); TBX2Related (FIG. 7F; SEQ ID NO: 6); MAFK (FIG.7G; SEQ ID NO: 7); PEA3 (FIG. 7H; SEQ ID NO: 8); ATF3 (FIG. 71; SEQ ID NO: 7); FOXP1 (FIG. 7J; SEQ ID NO: 10); RORA2 (FIG. 7K; SEQ ID NO: 11); NKX3A (FIG. 7L; SEQ ID NO: 12); JUNBFRA2 (FIG. 7M; SEQ ID NO: 13); FOSL1 (FIG. 7N; SEQ ID NO: 14); IRF3 (FIG. 70; SEQ ID NO: 15); RARB (FIG. 7P; SEQ ID NO: 16); MAFG (FIG. 7Q; SEQ ID NO: 17); MEF2A (FIG. 7R; SEQ ID NO: 18); AHRHIF (FIG. 7S; SEQ ID NO: 17); CEBPE (FIG. 7T; SEQ ID NO: 20); ETV5CEBPD (FIG. 7U; SEQ ID NO: 21); PAX3 (FIG. 7V; SEQ ID NO: 22); NRF1 (FIG. 7W; SEQ ID NO: 23); SOX7 (FIG. 7X; SEQ ID NO: 24); NFATC1 (FIG. 7Y; SEQ ID NO: 25). In some embodiments, the TREs, if present, include a sequence selected from the group consisting of SEQ ID NO: 1 (SOX4), SEQ ID NO: 2 (FOXP3), SEQ ID NO: 3 (AR), SEQ ID NO: 4 (SOX 10), SEQ ID NO: 5 (ELF1), SEQ ID NO: 6 (TBX2Related), SEQ ID NO: 7 (MAFK), SEQ ID NO: 8 (PEA3), SEQ ID NO: 9 (ATF3), SEQ ID NO: 10 (FOXP1), SEQ ID NO: 11 (RORA2), SEQ ID NO: 12 (NKX3A), SEQ ID NO: 13 (JUNBFRA), SEQ ID NO: 14 (FOSL1), SEQ ID NO: 15 (IRF3), SEQ ID NO: 16 (RARB), SEQ ID NO: 17 (MAFG), SEQ ID NO: 18 (MEF2A), SEQ ID NO: 19 (AHRHIF), SEQ ID NO: 20 (CEBPE), SEQ ID NO: 21 (ETV5CEBPD_01), SEQ ID NO: 22 (PAX3), SEQ ID NO: 23 (NRF1), SEQ ID NO: 24 (SOX9), and SEQ ID NO: 25 (NFATC1). In some embodiments, the core promoter is selected from the group consisting of a core promoter of CTLA4, FOXP3, IL2RA, RGS1, and IL1R2, optionally wherein the CTLA4 core promoter is CTLA4mp(91) or CTLA4mp(l 18), the FOXP3 core promoter is FOXP3mp(82) or FOXP3mp(117), the IL2RA core promoter is IL2Ramp, the RGS1 core promoter is RGSlmp, and the IL1R2 promoter is ILlR2mp. In some embodiments, the core promoter is RGS1.7MF-365941982Docket No.: 237752001140

[0013] In some embodiments of any of the preceding aspects, the synthetic promoter preferentially promotes expression in Treg cells by a factor of at least two times, three times, five times, ten times, 20 times or 50 times compared with Teff cells. In some embodiments, the synthetic promoter is active in Treg cells and inactive in Teff cells. In some embodiments, the synthetic promoter includes at least 1 TRE in a forward orientation and at least 1 TRE in a reverse orientation. In some embodiments of any of the preceding aspects, the synthetic promoter has a Treg score and a Teff score, and the Treg score of the synthetic promoter is greater than the Teff score of the synthetic promoter.

[0014] In another aspect, provided herein is an expression construct, including the synthetic promoter of any one of the preceding aspects and embodiments, operably linked with a nucleotide sequence encoding a polypeptide. In some embodiments, the polypeptide includes a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker. In some embodiments, the polypeptide includes a chimeric antigen receptor, including, (i) a signal peptide, (ii) a target or antigen binding domain, (iii) a hinge region, (iv) a transmembrane domain, (v) a signal transduction domain, and (vi) a co- stimulatory domain. In some embodiments, the polypeptide includes a chimeric antigen receptor that targets: AFP (alphafetoprotein), avP6 or another integrin, BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (delta-like protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma-associated antigen), IGF1R (insulin-like growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL-13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A8MF-365941982Docket No.: 237752001140(leucine rich repeat containing 8 Family member A), Lewis Y, melanoma-associated antigen (MAGE)-Al, MAGE-A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma-associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes (e.g., HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1), NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME (preferentially expressed antigen of melanoma), progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen), PSMA (prostate specific membrane antigen), R0R1, ROR2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor- associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, or HPV. In some embodiments, the chimeric antigen receptor includes a signal transduction domain that is an intracellular IL-2 receptor beta domain. In some embodiments, the expression vector includes: (a) the expression construct; (b) an origin of replication; and, optionally, one or more of (c) a selection marker; (d) a polyadenylation signal; or (e) a transcription terminator. In some embodiments, the expression vector includes a viral vector, a plasmid, a bacterial artificial chromosome, a yeast artificial chromosome, a cosmid, a transposon, or a minicircle vector. In some embodiments, the expression vector includes a viral vector selected from the group consisting of lentivirus, adenovirus, AAV, retrovirus, and vesicular stomatitis virus. In some embodiments, the expression vector is encapsulated in a microvesicle, optionally wherein the microvesicle is a liposome.

[0015] In another aspect, provided herein is a cell transfected with the expression construct of any one of the preceding aspects and embodiments. In some embodiments, the cell is a Treg cell. In some embodiments, the cell displays the phenotype CD4+, CD25 high and CD 127 low. In some embodiments, the cell expresses a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker, under transcriptional control of the synthetic promoter.9MF-365941982Docket No.: 237752001140

[0016] In another aspect, provided herein is a method of engineering a T cell comprising transfecting the T cell with the expression vector of any one of the preceding aspects and embodiments.

[0017] In another aspect, provided herein is a pharmaceutical composition including the cell of any one of the preceding aspects and embodiments and a pharmaceutically acceptable carrier.

[0018] In another aspect, provided herein is a method for treating a Treg associated disorder including administering an effective amount of the composition of the preceding aspect. In some embodiments, the Treg associated disorder is selected from an autoimmune disease, an allergic condition, an inflammatory condition or a transplant rejection. In some embodiments, the autoimmune disease is selected from the group consisting of type I diabetes, rheumatoid arthritis, systemic lupus erythematosus, celiac disease, psoriasis, myasthenia gravis, scleroderma, Addison disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis, pernicious anemia, reactive arthritis, and Sjogren syndrome.

[0019] In another aspect, provided herein is a method of treating a pathological condition in a subject, comprising: (i) isolating T cells from a biological sample obtained from the subject; (ii) enriching the T cells for T regulatory cells (Treg); (iii) transfecting the enriched Treg cells with the expression vector of any one of the preceding aspects and embodiments; (iv) expanding the transfected Treg cells; and (v) administering the expanded Treg cells to the subject. In some embodiments, the Treg cells are not sorted by cell surface marker expression. In some embodiments, the administration is mucosal or parental. In some embodiments, the administration is parenteral and the parenteral administration is selected from subcutaneous, intravenous, intraarterial, intramuscular or intrasynovial. In some embodiments, the pathological condition is selected from the group consisting of an autoimmune disease, an allergic condition, an inflammatory condition, and a transplant rejection.

[0020] In another aspect, provided herein is a method of delivering a transgene to a subject, the method including administering to the subject the cell of any one of the preceding aspects and embodiments.

[0021] In another aspect, provided herein is a nucleic acid molecule including a plurality of transcription factor response elements (TREs) wherein the TREs are recognized by at least 10MF-365941982Docket No.: 2377520011404, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, wherein the TREs, when operably linked to a core promoter, preferentially upregulate transcription in Treg cells.

[0022] In another aspect, provided herein is a nucleic acid molecule including a plurality of transcription factor response elements (TREs), wherein each TRE in the plurality is recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG, wherein the TREs, when operably linked to a core promoter, preferentially upregulate transcription in Treg cells.BRIEF DESCRIPTION OF THE DRAWINGS

[0023] The accompanying drawings, which are incorporated herein and form a part of the specification, illustrate exemplary embodiments and, together with the description, further serve to enable a person skilled in the pertinent art to make and use these embodiments and others that will be apparent to those skilled in the art.

[0024] FIG. 1 is an exemplary schematic of the Treg specific synthetic promoters (TRSPs) of the present disclosure.

[0025] FIG. 2 shows the TRE assembly of three exemplary synthetic promoters: AELS2, AS4, and AS24.

[0026] FIGS. 3A-3B show expression in Treg and Teff cells of a CAR regulated by synthetic-promoters of this disclosure (AS4, AS24, AELS2) compared to expression regulated by CNS123p promoter. FIG. 3A depicts %CAR = % of cells in the population expressing the CAR. FIG. 3B depicts MFI = mean fluorescent intensity.

[0027] FIG. 4 shows a histogram of CAR expression using select synthetic promoters of the present disclosure in Treg and Teff cells on day 7, after the first stimulation by Dynabeads™ Human Treg Expander (ThermoFisher).

[0028] FIG. 5 shows a histogram of CAR expression using select synthetic promoters of the present disclosure in Treg and Teff cells on day 11, which is 2 days after the second stimulation by Dynabeads™ Human Treg Expander (ThermoFisher).11MF-365941982Docket No.: 237752001140

[0029] FIG. 6 shows a histogram of CAR expression using select synthetic promoters of the present disclosure in Treg and Teff cells on day 14.

[0030] FIGS. 7A-7Y show consensus sequences of various TREs: SOX4 (FIG. 7A; SEQ ID NO: 1); FOXP3 (FIG. 7B; SEQ ID NO: 2); AR (FIG. 7C; SEQ ID NO: 3); SOX10 (FIG.7D; SEQ ID NO: 4); ELF1 (FIG. 7E; SEQ ID NO: 5); TBX2Related (FIG. 7F; SEQ ID NO: 6); MAFK (FIG. 7G; SEQ ID NO: 7); PEA3 (FIG. 7H; SEQ ID NO: 8); ATF3 (FIG. 71; SEQ ID NO: 7); FOXP1 (FIG. 7J; SEQ ID NO: 10); RORA2 (FIG. 7K; SEQ ID NO: 11); NKX3A (FIG. 7L; SEQ ID NO: 12); JUNBFRA2 (FIG. 7M; SEQ ID NO: 13); FOSL1 (FIG. 7N; SEQ ID NO: 14); IRF3 (FIG. 70; SEQ ID NO: 15); RARB (FIG. 7P; SEQ ID NO: 16); MAFG (FIG. 7Q; SEQ ID NO: 17); MEF2A (FIG. 7R; SEQ ID NO: 18); AHRHIF (FIG. 7S; SEQ ID NO: 17); CEBPE (FIG. 7T; SEQ ID NO: 20); ETV5CEBPD (FIG. 7U;SEQ ID NO: 21); PAX3 (FIG. 7V; SEQ ID NO: 22); NRF1 (FIG. 7W; SEQ ID NO: 23); SOX7 (FIG. 7X; SEQ ID NO: 24); NFATC1 (FIG. 7Y; SEQ ID NO: 25). N= any nucleotide (A, T, C, G). R=purine (A, G). Y=pyrimidine (T or C). S=G or C. W=A or T. K=G or T. M=A orC. B=C, G, T. D=A, G, T. H=A, C, T. V=A, C, G.

[0031] FIG. 8 shows AELS2 (a first generation TRSP “TRSP1”) and MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev promoter) regulated gene expression in primary Tregs and Teffs. Zsgreen is in the bi-cistronic reporter lentiviral construct comprising Zsgreen and mCherry genes, and gated on mCherry+ cells. The CAR is in a single promoter lentiviral vector.

[0032] FIGS. 9A-9C depict expression of a CAR in Tregs mediated by TRSP1. FIG. 9A shows that TRSP1 enhances day 14 Treg product quality by expressing a CAR in Tregs, while minimizing expression in Teff cells and destabilized Treg cells. FIG. 9B shows an in vitro stress model used to compare the TRSP1 and MND promoters. This model consisted of mixed Tregs and Teffs, along with a high-tonic CAR for disrupting Treg stability. FIG. 9C shows CAR positive cells under the TRSP1 promoter have a better Treg phenotype defined by FOXP3 and Helios expression.

[0033] FIGS. 10A-10B depict stability of the Treg phenotype compared between TRSP-CAR Tregs and MND-CAR Tregs. FIG. 10A shows that TRSP-CAR Tregs maintained a more stable phenotype under inflammatory conditions compared to MND-CAR Tregs. The day 14 CAR-Treg product was stimulated through CAR or TCR and cultured in a supraphysiological cytokine condition containing IL2, IL6, ILip, and IL23. FIG. 10B shows 12MF-365941982Docket No.: 237752001140the phenotype of the CAR+ cells compared between TRSP and MND promoters 7 days post the second stimulation.

[0034] FIGS. 11A-11B show a CAR-mediated Treg suppression assay and cytokine profile. FIG. 11A depicts results of a CAR specific suppression assay. The proliferation of cultured Teffs in the presence of CAR-Tregs at different ratios is shown, measured by flowbased CFSE dilution. FIG. 11B depicts cytokines from the supernatant of the suppression assay measured by Luminex. (UT = Untransduced.)

[0035] FIGS. 12A-12E depict the function of a TRSP as a safety switch, restricting the survival signal from a tethered switch receptor (SR) to Tregs, but not Teffs. FIG. 12A depicts an IL-X / IL-2RP cytokine receptor diagram and downstream STAT5 signaling, where X is, for example, 2, 4, 7, 9, or 21; thus, the IL extracellular domain and transmembrane domain can be from any of IL-2, IL-4, IL-7, IL-9, and IL-21. FIG. 12B depicts the fold expansion of Teff cell products after day 14 in the absence of IL-2, with the exception of the control group.FIG. 12C depicts the fold expansion of Treg cell products after day 14 in the absence of IL-2, with the exception of the control group. FIG. 12D depicts enrichment of Tag-positive Tregs transduced with SR-Tag under MND or TRSP. FIG. 12E shows a workflow of promoter library screening using a bi-cistronic reporter construct to identify TRSPs.

[0036] FIG. 13 depicts the promoter activity of second generation TRSPs (“G2TRSP”). The second generation TRSPs demonstrated stronger promoter activity compared to the top candidate from the first generation TRSPs (“TRSP1”).

[0037] FIGS. 14A-14B depict constructs and a workflow for testing TRSP-IL2TRB expression. FIG. 14A depicts exemplary constructs for use in the present methods, with a TRSP or MND promoter, a cytokine receptor payload sequence (switch receptor “SR” (i.e., a cytokine receptor comprising an extracellular cytokine receptor domain, a transmembrane domain, and an intracellular IL-2 receptor beta chain domain, wherein the extracellular cytokine receptor domain binds to a cytokine other than IL-2); an IL-2 tethered receptor “IL2TRB” (i.e., a cytokine receptor comprising an IL-2 cytokine molecule tethered to the IL-2 receptor beta (IL-2RP) extracellular domain)), the P2A self-cleaving peptide, and an IL5Ra tag. FIG. 14B depicts a workflow for a sort-free platform for Treg cell expansion using CD25 enriched cells transduced with a TRSP linked to a cytokine receptor payload sequence.

[0038] FIG. 15 is a FACS plot showing a comparison of first and second generation TRSPs and expression levels of SR and IL5Ra tag markers. Second generation TRSPs (238,13MF-365941982Docket No.: 237752001140204, 285, 70, 276, 217, 183, 50, 233, 214) exhibited stronger expression of payload sequences (switch receptor “SR”) compared with a first generation TRSP (TRSP1) in the day 14 product.

[0039] FIG. 16 is a FACS plot showing a comparison of first and second generation TRSPs and expression levels of the FOXP3 and HELIOS markers. Cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214) (TRSP-SR payload) showed a stronger FOXP3 / HELIOS phenotype than cells transduced with the first generation TRSP (TRSP 1- SR) and cells transduced with MND-SR.

[0040] FIG. 17 is a graph quantifying the percentage of FOXP3 in IL5Ra tag-positive cells transduced with various constructs comprising the MND promoter as compared to the same transduced with second generation TRSPs (233, 70, 238, 285, 204, 217, 214, 183, 50, 276) and a first generation TRSP (TRSP1).

[0041] FIG. 18 is a FACS plot showing expression levels of CD4 and CD3 markers in cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214), a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-tag only + IL2), or untransduced cells with IL-2. The payload used in these experiments was IL2TRB. After gating for live cells, the day 14 products exhibited a mild degree of heterogeneity.

[0042] FIG. 19 is a FACS plot showing expression levels of CD4 and CD3 markers in cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214), a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-tag only + IL2), or untransduced cells with IL-2. The payload used in these experiments was IL2TRB. After gating for IL5Ra tag-positive cells, the day 14 products were mainly CD4+.

[0043] FIG. 20 is a FACS plot showing expression levels of IL-2 and IL5Ra tag markers in cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214), a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-tag only + IL2), or untransduced cells with IL-2. The payload used in these experiments was IL2TRB. The second generation TRSPs exhibited strong expression of the payload on day 14.

[0044] FIG. 21 is a graph showing high enrichment of IL5Ra tag-positive cells under IL-2-free culture conditions on days 7 and 14 after transduction with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214) as compared to a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-IL5Ra tag).14MF-365941982Docket No.: 237752001140

[0045] FIGS. 22A-22B depict a stronger FOXP3 / HELIOS phenotype in TRSP-IL2TRB transduced cells compared to MND and MSCV controls. FIG.22A is a FACS plot showing expression levels of HELIOS and FOXP3 markers in cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214), a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-tag only + IL2), or untransduced cells with IL-2. After gating for tag-positive cells, the day 14 products exhibited a strong FOXP3 / HELIOS phenotype for cells transduced with certain second generation TRSPs. FIG. 22B depicts the percentage of cells in the population expressing FOXP3 against mean fluorescent intensity.

[0046] FIGS. 23A-23C depict activation assay results of Tregs transduced with TRSP regulated HLA-A2CAR and stimulated by HLA-A2+PBMCs. FIG. 23A depicts a timeline of the activation assay and the TRSP regulated HLA-A2CAR construct used for transducing the Tregs. FIG. 23B depicts proliferation of Treg cells transduced with different TRSPs (TRSP1, TRSP4, TRSP5, TRSP6, TRSP10) after gating on Tag+CD3+CD4+. FIG. 23C depicts Tag+ expression in Treg cells transduced with different TRSPs (TRSP1, TRSP4, TRSP5, TRSP6, TRSP 10) after gating on CD3+CD4+.

[0047] FIGS. 24A-24B depict FOXP3 (FIG. 24A) and HELIOS (FIG. 24B) expression in Tag positive cells after 7 days of HLA-A2+PBMC stimulation and gating on Tag+CD3+CD4+.

[0048] FIG. 25 depicts differential CAR expression in Treg and Teff cells for AELS2 as compared to MND.

[0049] FIGS. 26A-26D show screening and expression analysis for second-generation TRSPs. Expression levels for second-generation (G2) TRSPs were compared against the first-generation (Gl) TRSP AELS2 (measuring % Zsgreen expression in FIG. 26A and mean fluorescent intensity Zsgreen in FIG. 26B). FIG. 26C depicts an exemplary schematic of Treg and Teff score comparisons to assess Treg specificity of candidate TRSPs. FIG. 26D depicts that all G2 promoters fell below the line of identity (as shown in FIG. 26C), indicating high Treg scores.

[0050] FIG. 27 depicts that G2 top promoters show high Treg specificity and high strength. The FACS plots show expression levels of Zsgreen and mCherry markers in cells transduced with the AELS2 first- generation promoter, an MSCV control, and the 2559, 2581, and 2633 second-generation TRSPs.15MF-365941982Docket No.: 237752001140

[0051] FIGS. 28A-28B depict that G2 promoters show high Treg specificity and range of strengths. FIG. 28A depicts MFI fold change in mCherry+ expression in Tregs for AELS2 compared to different second-generation TRSPs and an MSCV control. The left bars are for data collected on day 14; the right bars are for data collected on day 19. FIG. 28B depicts MFI fold change in mCherry+ expression in Teffs for AELS2 compared to different second-generation TRSPs and an MSCV control. The left bars are for data collected on day 14; the right bars are for data collected on day 19.

[0052] FIG. 29 depicts the top second-generation TRSP candidates ranked by Treg score, and the enrichment of four TREs (FOXP3, ELF1, TBX2Related, and AR). The top candidates are shorter in length than common promoters. The numbers shown in each row are the number of each TRE (labeled at the top) for each TRSP candidate (labeled on the left). The promoter lengths are shown on the right.DETAILED DESCRIPTION

[0053] The following description sets forth exemplary methods, parameters, and the like. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure but is instead provided as a description of exemplary embodiments.

[0054] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.Definitions

[0055] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to particular method steps, reagents, or conditions are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed.

[0056] As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is16MF-365941982Docket No.: 237752001140intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only,” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0057] Reference to “about” a value or parameter herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to “about” a value or parameter herein includes (and describes) aspects that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X”.

[0058] The term “and / or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0059] It is understood that aspects and embodiments of the present disclosure described herein include “comprising,” “consisting,” and “consisting essentially of’ aspects and embodiments.

[0060] As used herein, the terms “including,” “containing,” and “comprising” are used in their open, non-limiting sense.

[0061] As used herein, the term “polypeptide” refers to a molecule having a sequence of natural and / or unnatural amino acids connected through peptide bonds. The term “peptide” refers to a short polypeptide, typically no more than 30 amino acids long. The amino acid sequence of a polypeptide is referred to as its “primary structure.” The term “protein” refers to a polypeptide having a secondary, tertiary and / or quaternary structure, e.g., structures stabilized by hydrogen bonds, relationships between secondary structures and structures formed of more than one protein. Proteins can be further modified by other attached moieties such as carbohydrate (glycoproteins), lipids (lipoproteins) phosphate groups (phosphoproteins) and the like.

[0062] The term "vector" as used herein comprises any intermediary vehicle for a nucleic acid molecule which enables said nucleic acid molecule, for example, to be introduced into17MF-365941982Docket No.: 237752001140prokaryotic and / or eukaryotic cells and / or integrated into a genome, and include plasmids, phagemids, bacteriophages or viral vectors such as retroviral based vectors, lentiviral vectors, Adeno Associated viral vectors and the like. The term "plasmid" as used herein generally refers to a construct of extrachromosomal genetic material, usually a circular DNA duplex, which can replicate independently of chromosomal DNA.

[0063] “Transfection” refers to the introduction of new genetic material into a cell. It includes transformation (the direct uptake and incorporation of exogenous genetic material from its surroundings through the cell membrane), transduction (the introduction of foreign DNA by a bacteriophage virus into a host cell) and conjugation.

[0064] An “individual” or “subject” is a mammal. Mammals include, but are not limited to, primates (e.g., humans and non-human primates such as rhesus and cynomolgus monkeys), rabbits, and rodents (e.g., mice and rats). In some embodiments, the individual or subject is a human.

[0065] ‘Treatment” or “therapy” of a subject refers to any type of intervention or process performed on, or the administration of an active agent to, the subject with the objective of curing, reversing, alleviating, ameliorating, inhibiting, slowing down, or preventing the onset, progression, development, severity, or recurrence of a symptom, complication, condition, or biochemical indicia associated with a disease.

[0066] An “effective amount” or "therapeutically effective amount" of a drug or therapeutic agent is any amount of the drug that, when used alone or in combination with another therapeutic agent, protects a subject against the onset of a disease or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction. The ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.

[0067] As used herein, the term “pharmaceutical composition” refers to a composition comprising a pharmaceutical compound (e.g., a drug or a recombinant Treg cell as described herein) and a pharmaceutically acceptable carrier.18MF-365941982Docket No.: 237752001140

[0068] As used herein, the term “pharmaceutically acceptable” refers to a carrier that is compatible with the other ingredients of a pharmaceutical composition and can be safely administered to a subject.

[0069] As described herein, the term “tethered” includes fused, linked, connected, attached, etc. and can include any method known to one of skill in the art for fusing, linking, connecting, attaching, etc. For example, two polypeptide sequences can be “tethered” or otherwise fused, linked, connected, attached, etc. using a polypeptide or peptide linker. Two polypeptide sequences can be tethered, for example, directly or indirectly via a linker.

[0070] As described herein, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. Description of endpoints includes ranges between all endpoints disclosed. For example, description of 1, 2, or 3 includes the ranges 1-2, 2-3, and 1-3.

[0071] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.Treg Specific Promoters

[0072] Certain aspects of the present disclosure relate to Treg specific synthetic promoters (“TRSPs”). The Treg-specific synthetic promoters of the present disclosure comprise a TRE cassette comprising a plurality of TREs recognized by selected transcription factors. The TRE cassette is functionally coupled or operably linked to a core promoter.

[0073] A promoter is a transcription regulatory nucleotide sequence at least sufficient to promote the transcription of a nucleotide sequence in DNA to which it is operably linked into an RNA transcript.

[0074] A nucleotide sequence is operably linked to a promoter when the promoter functions in a cell to regulate transcription of the nucleotide sequence, e.g., as confirmed through transcriptional activity assays or other experimental methods. This includes promoting transcription of the nucleotide sequence through an interaction between a polymerase and a promoter.19MF-365941982Docket No.: 237752001140

[0075] As used herein, a first nucleotide sequence is “heterologous” to a second nucleotide sequence if the first nucleotide sequence is not coupled with the second nucleotide sequence in nature. By extension, a polypeptide is “heterologous” to a promoter if it is encoded by nucleotide sequence heterologous to the promoter. Such polypeptides also can be referred to as “transgenes.” The synthetic promoters of this disclosure are recombinant products in that they connect nucleotide sequences not normally connected in nature.

[0076] Promoters typically include the so-called “core” or “minimal” promoter, and an extended promoter region comprising other transcription regulatory elements that, together, determine the function of the promoter.

[0077] A transcript transcribed from a promoter typically includes sequences from the promoter downstream of the transcription start site, as well as downstream sequences that, in the case of mRNA, encode an amino acid sequence. Promoters are well-characterized due to their predictable location upstream of transcription start sites. Promoters include sequences that modulate the recognition, binding and transcription initiation activity of the RNA polymerase. These sequences can be cis acting or can be responsive to trans acting factors. Experimental methods for characterizing promoter activity include, for example, reporter assays, ChlP-Seq, and DNase footprinting.

[0078] Promoters, depending upon the nature of the regulation, can be constitutive or regulated. These include, for example, inducible promoters, which are activated by specific stimuli such as heat shock or hormones; tissue- specific promoters, which are active only in certain cell types; and synthetic promoters, that comprise engineered sequences. The activity of eukaryotic promoters can be influenced by epigenetic modifications, such as DNA methylation.Minimal / Core Promoter

[0079] The core promoter (also called “minimal promoter”) includes sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation. The core promoter includes the transcriptional start site, an RNA polymerase binding site, and other general transcription binding sites and is where the pre-initiation complex forms, and the general transcription machinery assembles. The pre-initiation complex is generally within 50 nucleotides (nt) of the transcription start site (TSS). In prokaryotic promoters, the core promoter also includes a sequence for a ribosome binding site, necessary for translation of an mRNA into a polypeptide, e.g., a Shine-Dalgamo sequence.20MF-365941982Docket No.: 237752001140

[0080] Eukaryotic promoters include core elements such as the TATA box, initiator (Inr) sequence, and downstream promoter elements (DPE), along with regulatory sequences for transcription factors, so-called “transcription regulatory elements” or “TREs.” Such elements include enhancers, silencers and insulators.

[0081] The core promoter of the synthetic promoters of this disclosure can be any core or minimal promoter that functions in a Treg cell. These include, without limitation, minimal promoters of CTLA4, Foxp3, IL2Ra, RGS1 and ILR2.

[0082] Exemplary minimal promoters include the following:Table 1: Minimal promoters.Extended Promoter / Transcription Regulatory Elements

[0083] The extended promoter region includes the so-called proximal promoter, which typically includes the region up to -250 nucleotides upstream of the transcription start site. It typically includes regulatory elements such as the CAAT box and GC box, which bind transcription factors to modulate transcription initiation. It has been found that many genes have transcription regulatory elements located further upstream. In particular, a fragment that includes most of the transcription regulatory elements of a gene can extend up to 70021MF-365941982Docket No.: 237752001140nucleotides or more up-stream of the transcription start site. In certain genes, transcription regulatory sequences have been found thousands of nucleotides upstream of the transcriptional start site.Transcription Regulatory Elements

[0084] Transcription regulatory elements (“TREs”) are short nucleotide sequences involved in the regulation of gene expression. These sequences can contribute to tissuespecific and / or cell-specific transcription by interacting with transcription factors (“TFs”) that are active in certain cell types. TREs can be referred to by the name of the transcription factor that recognizes them, as an abbreviation, i.e., reference to “FOXP3 TRE” can mean a TRE recognized by FOXP3.

[0085] Synthetic promoters of this disclosure comprise a plurality of TREs recognized by the transcription factors of Table 2, functionally coupled or operably linked to a core promoter, in particular, a core promoter operative in Treg cells. Functionally coupling a plurality of the TREs of Table 2 with a core promoter produces a synthetic promoter that preferentially regulates expression in Treg cells of a gene operably linked to the synthetic promoter, compared with other cells, in particular, Teff cells. Reference to a “TRE of Table 2” refers to a TRE recognized by a transcription factor of Table 2.Table 2: Transcription factors for TRE recognition.22MF-365941982Docket No.: 237752001140

[0086] TREs useful in the TRE cassettes of this disclosure can be any natural TRE recognized by the reference transcription factor. These can be determined from examination of the genome. TREs also can be derived from a consensus sequence. More specifically, sequences of TREs for a particular transcription factor across many genes are compared, and the frequency of nucleotides at particular positions is determined. Consensus sequences for various TREs are presented in FIGS. 7A-7Y. TREs also can comprise the exemplary nucleotide sequences presented in Table 3. A TRE sequence also can be expressed as its complement. For example, the FOXP3 TRE sequence, GTAAACA (SEQ ID NO: 2) is present as its complement the FOXP1 sequence TTGTTTACCATGCCTTACGATGGACAACAA (SEQ ID NO: 10) (complementary sequence in bold).

[0087] For example, the exemplary TRE nucleotide sequence recognized by FOXP3 is given in the Table 3 as GTAAACA (SEQ ID NO: 2). However, the FOXP3 consensus sequence is RTAAACA (SEQ ID NO: 33).

[0088] Accordingly, reference to a TRE in synthetic promoter of this disclosure can mean a TRE with a sequence selected from the group consisting of SEQ ID NO: 1 (SOX4), SEQ ID NO: 2 (FOXP3), SEQ ID NO: 3 (AR), SEQ ID NO: 4 (SOX10), SEQ ID NO: 5 (ELF1), SEQ ID NO: 6 (TBX2Related), SEQ ID NO: 7 (MAFK), SEQ ID NO: 8 (PEA3), SEQ ID NO: 9 (ATF3), SEQ ID NO: 10 (FOXP1), SEQ ID NO: 11 (RORA2), SEQ ID NO: 12 (NKX3A), SEQ ID NO: 13 (JUNBFRA), SEQ ID NO: 14 (FOSL1), SEQ ID NO: 15 (IRF3), SEQ ID NO: 16 (RARB), SEQ ID NO: 17 (MAFG), SEQ ID NO: 18 (MEF2A), SEQ ID NO: 19 (AHRHIF), SEQ ID NO: 20 (CEBPE), SEQ ID NO: 21 (ETV5CEBPD_01), SEQ ID NO: 22 (PAX3), SEQ ID NO: 23 (NRF1), SEQ ID NO: 24 (SOX9), and SEQ ID NO: 25 (NFATC1), as set forth in Table 3, a TRE with a consensus sequence taken from FIGS. 7A-7Y, or a TRE having a naturally occurring sequence for the identified transcription factor taken from the genome.Table 3: Exemplary TRE nucleotide sequences.23MF-365941982Docket No.: 237752001140Treg Specific Promoters

[0089] Treg specific promoters (TRSPs) of the present disclosure comprise a cassette comprising a plurality of TREs for transcription factors selected from Table 2 functionally coupled or operably linked to a core promoter. A TRE is “functionally coupled” or “operably linked” to a core promoter when the TRE modulates the transcriptional activity of that promoter, e.g., through mechanisms such as direct interaction with transcription factors, recruitment of coactivators or corepressors, chromatin remodeling, or DNA looping, enabling or repressing the assembly and activity of the transcriptional machinery at the promoter. The plurality of TREs may be functionally coupled or operably linked to any core promoter that functions in a Treg cell.

[0090] The synthetic promoters of this disclosure preferentially promote transcription in Treg cells. That is, transcription levels of transgenes, which may also be referred to as payload sequences, operably linked with these promoters is greater in Treg cells than in other 24MF-365941982Docket No.: 237752001140cell types, in particular, compared with Teff cells. In some embodiments, these promoters preferentially promote the production of mRNA transcripts in Treg cells by a factor of at least any of 2, 3, 5, 10, 20, 50 or 100 times greater as compared with transcriptional activity in any other cell type. For example, about twenty times as many Treg cells as Teff cells express transgenes under transcriptional control of a Treg-specific promoter of this disclosure.

[0091] The synthetic promoters of this disclosure may be active in Treg cells but inactive in Teff cells. The activity of a synthetic promoter in Treg cells or Teff cells may be determined, for example, by an assay that measures expression in relation to vector copy number. In some embodiments, the activity of a synthetic promoter in Treg cells or Teff cells may be determined by an assay which measures the expression of Zsgreen fluorescent reporter protein that is operably linked to the synthetic promoter. In this assay, the fluorescent reporter protein is introduced into the Treg cells or Teff cells as part of a bicistronic reporter construct that also contains a mCherry transduction marker. A score for promoter activity is calculated by multiplying the percentage of transduced cells that express the fluorescent reporter protein (% mCherry +Zsgreen+ cells) by the mean fluorescence intensity (MFI) fold change for the fluorescent reporter protein expression. MFI fold change is calculated by dividing the Zsgreen MFI in Zsgreen+mCherry+ cells by the Zsgreen MFI in mCherry+ cells of no promoter control. Such a score can be calculated under the same conditions in both Treg cells and Teff cells, providing a “Treg score” and a “Teff score”. In this context, a synthetic promoter is (a) “active” in a Treg cell if it has a “Treg score” of 200 or greater and (b) “inactive” in a Teff cell if it has a “Teff score” of 75 or less. In some embodiments, a synthetic promoter of the present disclosure has a Treg score that describes activity of the promoter in Treg cells and a Teff score that describes activity of the promoter in Teff cells. In some embodiments, the Treg score of the synthetic promoter is higher than the Teff score of the synthetic promoter. In some embodiments, the Treg score of the synthetic promoter is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold higher than the Teff score of the synthetic promoter. In some embodiments, the Treg score of the synthetic promoter is at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, or at least about 1000. In some embodiments, the Teff score of the synthetic promoter is no more than about 200, no more than about 175, no more than about 150, no more than about 125, no more than about 100, no more than about 75, no more than about 50, or no more than about 25.25MF-365941982Docket No.: 237752001140

[0092] The synthetic promoters of this disclosure can comprise at least any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 TREs from Table 2 (e.g., with sequences from Table 3). Typically, the synthetic promoters of this disclosure comprise between six and 12 unique promoters from Table 2.

[0093] Furthermore, TREs may be present in more than one copy in a synthetic promoter. In some embodiments, a synthetic promoter of this disclosure comprises one or more TREs recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOX10, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1, AHRIF, MEF2A, PAX3, NPF1, and SOX9, wherein one or more of the TREs is present in one copy, two copies, three copies, four copies, five copies, or six copies. Any number of TREs may be included in a synthetic promoter of this disclosure, provided that the synthetic promoter can be accommodated in the biological system being used. For instance, if a lentiviral vector is being used for delivering the transgene, then the number of TREs should be selected so that the length of the synthetic promoter is compatible with the vector. The maximum number of TREs in a synthetic promoter may be, for example, no more than 40 TREs, no more than 30 TREs, or no more than 20 TREs. Preferably, the total number of TREs in a synthetic promoter can be between 5 and 20 TREs. The total number of TREs in a synthetic promoter can also be, for example, between six and 15 TREs. The set of TREs may span a range of up to 400 nucleotides long, for example no more than 300 nucleotides. In some embodiments, the set of TREs spans a range of about 100 to 300 nucleotides. The set of TREs may also span a range of about 200 to 350 nucleotides. In some cases, the set of TREs are positioned no more than about 80 nucleotides upstream of the TATA box.

[0094] In some embodiments, the total length of the synthetic promoter (i.e. including the set of TREs and the core promoter) is no more than 500 nucleotides.

[0095] TREs can be in any orientation. In some embodiments, the synthetic promoters of this disclosure comprise at least 1 TRE in a forward orientation and at least 1 TRE in a reverse orientation. For example, the synthetic promoters of this disclosure may comprise at least any of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 TREs in a reverse orientation.

[0096] A TRE that is in the forward orientation is one that is in the same 5 ’-3’ orientation as the core promoter. A TRE that is in the reverse orientation is the reverse complement of a given TRE in the forward orientation, relative to the core promoter.26MF-365941982Docket No.: 237752001140

[0097] The TREs in a synthetic promoter of the present disclosure may be separated by a nucleotide spacer sequence. A nucleotide spacer sequence may be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, the spacer is 4 nucleotides in length. In some embodiments, the spacer is TCGA.

[0098] It has been found that certain TREs are more commonly found in synthetic promoters having Treg-cell specificity than others, and further, that certain combinations of TREs are more commonly found among such synthetic promoters. Table 4 provides exemplary synthetic promoters and TREs comprised within them. For example, as in Table 4, four TREs selected from TREs recognized by FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, or MAFG, are found in eight Treg-specific promoters of this disclosure.Table 4: Exemplary synthetic TRSPs and TREs.27MF-365941982Docket No.: 237752001140

[0099] Synthetic TRSPs of the present disclosure can be described as first generation TRSPs or second generation TRSPs. Selected synthetic promoters have the following sequences (the portion of the synthetic promoter containing the set of TREs is in bold, and the portion not in bold corresponds to the core promoter):Table 5: Sequences of selected synthetic TRSPs.28MF-365941982Docket No.: 237752001140

[0100] Selected second generation synthetic TRSPs are listed in Table 6 and further described below:Table 6: Second generation synthetic TRSPs.29MF-365941982Docket No.: 237752001140

[0101] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by PEA3. In some embodiments, the synthetic promoter comprises a TRE recognized by SOXIO. In some embodiments, the synthetic promoter comprises a TRE recognized by RORA2. In some embodiments, the synthetic promoter comprises a TRE recognized by IRF3. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP1. In some embodiments, the synthetic promoter comprises a TRE recognized by NKX3A. In some embodiments, the synthetic promoter comprises a TRE recognized by JUNBFRA. In some embodiments, the synthetic promoter comprises a TRE recognized by ATF3. In some embodiments, the synthetic promoter comprises a TRE recognized by RARB. In some embodiments, the synthetic promoter comprises a TRE30MF-365941982Docket No.: 237752001140recognized by CEBPE. In some embodiments, the synthetic promoter comprises a TRE recognized by ETV5CEBPD_01. In some embodiments, the synthetic promoter comprises a TRE recognized by NFATC1. In some embodiments, the synthetic promoter comprises a TRE recognized by AHRIF. In some embodiments, the synthetic promoter comprises a TRE recognized by MEF2A. In some embodiments, the synthetic promoter comprises a TRE recognized by PAX3. In some embodiments, the synthetic promoter comprises a TRE recognized by NPF1. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX9.

[0102] In a preferred embodiment, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by ELFE

[0103] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by SOX4. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by ELF1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by MAFG.

[0104] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by ELF1. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by MAFG.

[0105] In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1 and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1 and a TRE recognized by AR. In some embodiments,31MF-365941982Docket No.: 237752001140the synthetic promoter comprises a TRE recognized by ELF1 and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1 and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1 and a TRE recognized by MAFG.

[0106] In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1 and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1 and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1 and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1 and a TRE recognized by MAFG.

[0107] In some embodiments, the synthetic promoter comprises a TRE recognized by AR and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by AR and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by AR and a TRE recognized by MAFG.

[0108] In some embodiments, the synthetic promoter comprises a TRE recognized by MAFK and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by MAFK and a TRE recognized by MAFG.

[0109] In some embodiments, the synthetic promoter comprises a TRE recognized by TBX2Related and a TRE recognized by MAFG.

[0110] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by ELFE In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, and a TRE 32MF-365941982Docket No.: 237752001140recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0111] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by AR. In some 33MF-365941982Docket No.: 237752001140embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0112] In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.34MF-365941982Docket No.: 237752001140

[0113] In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0114] In some embodiments, the synthetic promoter comprises a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0115] In some embodiments, the synthetic promoter comprises a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0116] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE35MF-365941982Docket No.: 237752001140recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related.36MF-365941982Docket No.: 237752001140In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0117] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by AR.In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFK.In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE 37MF-365941982Docket No.: 237752001140recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFG.In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFK.In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE38MF-365941982Docket No.: 237752001140recognized by SOX4, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0118] In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related.In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0119] In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE39MF-365941982Docket No.: 237752001140recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0120] In some embodiments, the synthetic promoter comprises a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0121] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related.In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic40MF-365941982Docket No.: 237752001140promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related.In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a 41MF-365941982Docket No.: 237752001140TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related.In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0122] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In 42MF-365941982Docket No.: 237752001140some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0123] In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by 43MF-365941982Docket No.: 237752001140AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0124] In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0125] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE44MF-365941982Docket No.: 237752001140recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1,45MF-365941982Docket No.: 237752001140a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0126] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0127] In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0128] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0129] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.46MF-365941982Docket No.: 237752001140

[0130] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0131] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0132] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0133] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0134] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG.

[0135] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related.

[0136] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0137] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1 and a TRE recognized by SOX4. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF147MF-365941982Docket No.: 237752001140and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1 and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1 and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1 and a TRE recognized by MAFK.

[0138] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR (optionally 3 copies), a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related, a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2502 / G2RO183 in Table 6).

[0139] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR, a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4 (optionally 3 copies), a TRE recognized by ELF1 (optionally 5 copies), a TRE recognized by TBX2Related (optionally 3 copies), and a TRE recognized by MAFK see, e.g., synthetic TRSP 2507 / G2RO217 in Table 6).

[0140] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 3 copies), a TRE recognized by TBX2Related (optionally 3 copies), and a TRE recognized by MAFG (optionally 2 copies) (see, e.g., synthetic TRSP 2513 / G2RO250 in Table 6).

[0141] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3, a TRE recognized by AR (optionally 4 copies), a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related (optionally 3 copies), and a TRE recognized by MAFG (optionally 2 copies) (see, e.g., synthetic TRSP 2516 / G2RO257 in Table 6).

[0142] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3, a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1, a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 448MF-365941982Docket No.: 237752001140copies), a TRE recognized by TBX2Related, a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2520 / G2RO275 in Table 6).

[0143] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR, a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related, a TRE recognized by MAFK (optionally 2 copies), and a TRE recognized by MAFG (optionally 3 copies) see, e.g., synthetic TRSP 2521 / G2RO276 in Table 6).

[0144] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3, a TRE recognized by AR (optionally 4 copies), a TRE recognized by FOSL1, a TRE recognized by SOX4 (optionally 3 copies), a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related, a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2522 / G2RO279 in Table 6).

[0145] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4 (optionally 4 copies), a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related, a TRE recognized by MAFK (optionally 3 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2523 / G2RO281 in Table 6).

[0146] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR (optionally 3 copies), a TRE recognized by SOX4 (optionally 3 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related (optionally 2 copies), a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2524 / G2RO285 in Table 6).

[0147] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 4 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1, a TRE recognized by SOX4 (optionally 4 copies), a TRE recognized by ELF1 (optionally 3 copies), a TRE recognized by TBX2Related, and a TRE recognized by MAFK (see, e.g., synthetic TRSP 2554 / G2RO204 in Table 6).49MF-365941982Docket No.: 237752001140

[0148] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 6 copies), a TRE recognized by TBX2Related (optionally 3 copies), a TRE recognized by MAFK (optionally 2 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2559 / G2RO238 in Table 6).

[0149] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by SOX4 (optionally 3 copies), and a TRE recognized by ELF1 (optionally 3 copies) see, e.g., synthetic TRSP 2579 / G2RO077 in Table 6).

[0150] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR, a TRE recognized by FOSL1, a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related (optionally 3 copies), a TRE recognized by MAFK (optionally 2 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2581 / G2RO214 in Table 6).

[0151] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR, a TRE recognized by FOSL1, a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related (optionally 2 copies), a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2604 / G2100 in Table 6).

[0152] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 4 copies), a TRE recognized by AR (optionally 3 copies), a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by TBX2Related, a TRE recognized by MAFK (optionally 2 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2610 / G2RO34 in Table 6).

[0153] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR, a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by SOX4 (optionally 350MF-365941982Docket No.: 237752001140copies), a TRE recognized by ELF1 (optionally 3 copies), and a TRE recognized by MAFG (optionally 2 copies) (see, e.g., synthetic TRSP 2612 / G2RO53 in Table 6).

[0154] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4 (optionally 5 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related (optionally 2 copies), and a TRE recognized by MAFK (optionally 2 copies) see, e.g., synthetic TRSP 2613 / G2RO55 in Table 6).

[0155] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 5 copies), a TRE recognized by AR, a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4 (optionally 4 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related (optionally 2 copies), and a TRE recognized by MAFK (optionally 3 copies) (see, e.g., synthetic TRSP 2629 / G2RO184 in Table 6).

[0156] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 4 copies), a TRE recognized by AR (optionally 3 copies), a TRE recognized by FOSL1, a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 3 copies), a TRE recognized by TBX2Related (optionally 3 copies), and a TRE recognized by MAFK (see, e.g., synthetic TRSP 2633 / G2RO233 in Table 6).

[0157] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR, a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related (optionally 3 copies), a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2640 / G2RO263 in Table 6).

[0158] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR, a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by ELF1 (optionally 4 copies), a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2641 / G2RO265 in Table 6).

[0159] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR, a TRE51MF-365941982Docket No.: 237752001140recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related (optionally 2 copies), a TRE recognized by MAFK (optionally 3 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2642 / G2RO267 in Table 6).

[0160] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by SOX4 (optionally 3 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related, and a TRE recognized by MAFK (see, e.g., synthetic TRSP 2656 / G2RO27 in Table 6).

[0161] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1 (optionally 4 copies), a TRE recognized by TBX2Related (optionally 2 copies), a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2666 / G2RO50 in Table 6).

[0162] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related (optionally 2 copies), a TRE recognized by MAFK (optionally 2 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2667 / G2RO65 in Table 6).

[0163] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1, a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 6 copies), and a TRE recognized by TBX2Related (see, e.g., synthetic TRSP 2668 / G2RO70 in Table 6).Expression Constructs and Vectors Comprising Treg Specific Promoters

[0164] Certain aspects of the present disclosure relate to polynucleotide vectors. In some embodiments, a polynucleotide vector comprises a synthetic promoter of this disclosure operably linked to a transgene or payload sequence that encodes a polypeptide of interest.

[0165] Disclosed herein are nucleic acid molecules (polynucleotides) comprising a synthetic promoter of this disclosure operably linked to a nucleotide sequence that encodes a polypeptide of interest, such as a chimeric antigen receptor (CAR) (collectively, an52MF-365941982Docket No.: 237752001140“expression construct”). The nucleic acid can be in the form of DNA or in the form of RNA. DNA includes cDNA, genomic DNA, and synthetic DNA; and can be double-stranded or single-stranded, and if single stranded can be the coding strand or non-coding (anti-sense) strand. RNA includes mRNA, siRNA, sRNA, ssRNA and so on.

[0166] Polynucleotides can be isolated molecules, or can be included within a vector, such as a plasmid, a cosmid, an artificial chromosome or a virus. Such vectors can be used to transfect target cells, e.g., Treg cells. An expression vector can comprise an origin of replication, a selectable marker, a multiple cloning site, and elements for gene expression including a promoter with transcription regulatory elements, a ribosome binding site, a transgene, and a termination signal. Viral vectors can include a packaging signal, or an integration signal.

[0167] Expression constructs can be incorporated into vectors capable of transfecting cells. Such vectors include, without limitation, viral vectors, plasmids and microvesicles, e.g., liposomes. Exemplary viral vectors adenoviral vectors Ad, AAV, lentivirus, and vesicular stomatitis virus (VSV) and retroviruses. Lentiviruses are a genus of the Retro viridae family and include HIV, SIV, and FIV. Lentiviruses can deliver a large quantities of genetic material into the DNA of the host cell. They are able to infect non-dividing cells. Other vectors are described in more detail herein.Recombinant Treg CellsRegulatory T cells (Tregs)

[0168] Regulatory T (Treg) cells are involved in the maintenance of immunological self tolerance and in mitigating deleterious immune responses to both self and non-self (allo) antigens. Tregs comprise both natural and induced subtypes. Natural Tregs (nTregs) are cells which originate as a separate cell lineage during development. Peripheral or induced Tregs (iTregs) differentiate from conventional T cells. In some embodiments, CD4+ T cells that are not nTregs and not iTregs can be engineered into Tregs using the methods and compositions of the disclosure. In some embodiments, the CD4+ T cells are used to make Treg cells expressing transgenes using the methods and compositions of the disclosure.

[0169] Treg markers include high levels of CD25 (CD25+), low levels of CD 127 (CD1271o), or both high CD25 and low CD127. The levels of CD25 and CD127 are compared, for example to a CD4+ T cell that is not a Treg. In some embodiments, the Treg53MF-365941982Docket No.: 237752001140cell expressing the transgene has a high CD25, high CD4, and low CD127 phenotype. Treg cells are also characterized by high levels of FOXP3 and / or Helios expression (as opposed to “destabilized” Treg cells, which typically have much lower levels of FOXP3 and / or Helios expression). Teff cells may be distinguished from Treg cells by much lower levels of FOXP3 and / or Helios expression, lower levels of CD25 expression, and / or higher levels of CD127 expression.

[0170] Tregs include CD4+ T cells that characteristically express the high-affinity IL-2 receptor a-chain (CD25) and master transcription factor Forkhead box P-3 (Foxp3) which is essential for their suppressive phenotype and stability. As activated CD4+ T cells can upregulate CD25 expression, an additional defining feature of Tregs is the absence of IL-7 receptor a-chain (CD127). Their function includes dominant controllers of self-tolerance, tissue inflammation, long-term immune homeostasis, among others. Despite making up only 5%— 10% of the peripheral CD4+ T cell pool, Tregs exert powerful inhibitory effects on effector cells through a variety of mechanisms including cytokine secretion, metabolic disruption, inhibition of dendritic cells (DCs), and cytolysis. These mechanisms have been rigorously examined using animal models and shown to regulate autoimmune disease. For example, studies in patients with inflammatory bowel disease (IBD) have identified defects in the number and distribution of Tregs and their ability to traffic to the GI tract. Additionally, resistance to Treg-mediated suppression has been noted in lamina propria T effector cells (Teffs).

[0171] Tregs can be broadly divided into two groups, thymic Tregs (tTregs) or peripherally induced Tregs (pTregs), based on their developmental origin.

[0172] tTregs are generated in the thymus in the early neonatal period and migrate to peripheral organs thereafter where they maintain tolerance. Further, thymically derived CD4+CD25+ T cells possess the ability to suppress autoreactive T cells and eliminate autoimmunity; therefore, tTregs are important for maintenance of self-tolerance and prevention and / or control of autoimmune disease. pTregs are generated when naive CD4+CD25- T cells are converted into Foxp3-expressing CD4+CD25+ Tregs by T cell receptor (TCR) co-stimulation in the presence of transforming growth factor p (TGF-p, TGFbeta). pTreg conversion in gut- associated lymphoid tissues (GALTs) is enhanced when naive CD4+ T cells encounter an antigen in the presence of TGF-p, IL-2, and retinoic acid (RA). For example, pTregs are found in abundance in the intestinal lamina propria where54MF-365941982Docket No.: 237752001140interactions with environmental antigens can shape phenotypic differences and transcription factor expression. In patients with active IBD, the intestinal lamina propria Treg pool was significantly smaller than that of a positive control, namely patients with diverticulitis.Additionally, in these patients, the peripheral blood Treg pool was smaller as compared to inactive IBD or diverticulitis.

[0173] Tregs function as key mediators of peripheral tolerance through direct cellular contact and paracrine actions on tissues where they reside, for example, IL- 10- secreting Tregs can help control inflammatory responses and selective disruption of IL- 10 expression in these Tregs has been shown to cause autoimmune disease. This is one of many modalities that Tregs can employ to maintain immune homeostasis at the site of action. Others include inhibitory cytokine secretion, cytolysis of effector cells, metabolic disruption, neutralization of antigen presenting cells and promotion of tissue repair. The Treg cytokine repertoire includes the anti-inflammatory molecules IL-10, TGF-p, IL-35, PD-1, among others (as discussed herein). Tregs are capable of producing TGF-p, which profoundly suppresses the proliferation of effector T cells (Teffs). TGF-P and IL-35 can induce the generation of Tregs from naive CD4+ T cells. In certain embodiments, provided herein are cells that secrete one or more cytokines, preferably an anti-inflammatory cytokine, more preferably an immune checkpoint inhibitor, even more preferably IL-10, TGF-p, and / or PD-1. In preferred embodiments, the cell further comprises one or more transgenes, for example a CAR.

[0174] The development and function of Tregs is associated with IL-2. IL-2 and the transcription factor STAT5, downstream of IL-2 alpha receptor (IL-2R alpha, i.e., CD25), induce the expression of Foxp3 and differentiation of tTregs. STAT5 activation driven by IL-2 IL-2Ralpha (CD25) and subsequent signaling enhances the suppressor function of differentiated Tregs. Further, Tregs can sequester local IL-2 reducing the available cytokine concentration for actively dividing Teffs reducing their ability to survive and proliferate. In certain embodiments, provided herein are cells comprising CD25. In certain embodiments, the cell comprises one or more CD25 bound to IL-2. In preferred embodiments, the cell further comprises one or more transgenes, for example a CAR.

[0175] Tregs can also interfere with ATP metabolism to dampen proinflammatory responses. Tregs co-express the ectoenzymes CD39 and CD73 responsible for the degradation of ATP and generation of pericellular adenosine. Adenosine stimulates the A2A receptor on Teffs exerting potent inhibitory effects. Activation of the A2A receptor also55MF-365941982Docket No.: 237752001140inhibits IL-6 expression while enhancing the production of TGF-p. This promotes the development of adaptive induced Tregs and simultaneously inhibits proinflammatory Thl7 cell formation. In certain embodiments, provided herein are cells the co-express one or more immunosuppressive enzymes. In preferred embodiments, the cell secretes CD39 and / or CD73. In preferred embodiments, the cell further comprises one or more transgenes, for example a CAR.

[0176] The activation of T cells comprises TCR antigen / major histocompatibility complex engagement in the context of a secondary signal, namely T cell-derived CD28 binding the dendritic cell (DC) B7 ligands, CD80 and CD86. This process is negatively regulated through the production of cytotoxic T lymphocyte associated protein 4 (CTLA-4) which is constitutively expressed in Foxp3+ Tregs.

[0177] Tregs further can promote cell lysis of Teffs to suppress their activity. Granzyme-B expressing CD4+ Tregs can promote lysis of target cells in a perforin-dependent, but TCR-independent manner. Activated Tregs upregulate tumor necrosis factor-related apoptosis inducing ligand (TRAIL) which enhances CD4+ suppressive activity as well as cytotoxicity against T cells.

[0178] Tregs may further aid in tissue repair and maintenance distinct from their suppressive function.

[0179] Treg cells into which expression constructs of this disclosure have been incorporated can express these transgenes, e.g., CARs and be used in the methods described herein to treat Treg-associated dysfunctions. Genetic loci suitable for insertion of a CAR- or exogenous TCR-encoding sequence include but are not limited to safe harbor loci (e.g., the AAVS1 locus) TCR subunit loci (e.g., the TCRa constant (TRAC) locus, the TCRP constant 1 (TRBC1) locus, and the TCRP constant 2 (TRBC2) locus). It is understood that insertion in the TRAC locus reduces tonic CAR signaling and enhances T cell potency (see, Eyquem et al. (2017) NATURE, 543: 113). Furthermore, inactivation of the endogenous TRAC, TRBC1, or TRBC2 gene may reduce a graft-versus-host disease (GVHD) response, thereby allowing use of allogeneic T cells as starting materials for preparation of CAR T cells. Accordingly, in certain embodiments, an immune cell, e.g., a T cell, is engineered to have reduced expression of an endogenous TCR or TCR subunit, e.g., TRAC, TRBC1, and / or TRBC2. The cell may be engineered to have partially reduced or no expression of the endogenous TCR or TCR subunit. For example, in certain embodiments, the immune cell, e.g., a T cell, is engineered to 56MF-365941982Docket No.: 237752001140have less than 80% (e.g., less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, or less than 5%) of the expression of the endogenous TCR or TCR subunit relative to a corresponding unmodified or parental cell. In certain embodiments, the immune cell, e.g., a T cell, is engineered to have no detectable expression of the endogenous TCR or TCR subunit. Exemplary approaches to reduce expression of TCRs using CRISPR systems are described in U.S. Patent No. 9,181,527, Liu et al. (2017) CELL RES, 27: 154, Ren et al. (2017) CLIN CANCER RES, 23: 2255, Cooper et al. (2018) LEUKEMIA, 32: 1970, and Ren et al. (2017) ONCOTARGET, 8: 17002.Transgenes

[0180] Any suitable transgene can be expressed using the Treg specific promoters of this disclosure. This includes, for example a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, a selectable marker, or a combination thereof. In certain embodiments, the transgene comprises a Treg healing factor. The transgene can encode any suitable number of polypeptides, for example at least any of 1, 2, 3, 4, 5, 6, 7, 8, or 9 and / or not more than any of 20, 15, 10, 9, 8, 7, 6, 5, 4, 3, or 2 polypeptides.

[0181] Any suitable database can be used to derive a suitable transgene sequence, for example GenBank, PubMed, and / or KEGG GENES Database, and the like. A skilled artisan would understand how to identify and use such databases to identify and retrieve sequences of interest from the databases. Additionally or alternatively genes of interest can be identified using any suitable technique, such as sequencing a sample from a cell of interest or subject of interest. Suitable techniques include, but are not limited to, Sanger sequencing and high throughput sequencing.Chimeric antigen receptors

[0182] In certain embodiments, the transgene encodes a chimeric antigen receptor (CAR) or component thereof. In certain embodiments, the transgene encodes a T-cell receptor (TCR). The transgene (e.g. CAR or TCR) may target an antigen of interest e.g., a tumor antigen, an antigen of a pathogen, or a target in an inflammation site). The antigens may include, without limitation, AFP (alpha- fetoprotein), avP6 or another integrin, BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123,57MF-365941982Docket No.: 237752001140CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (deltalike protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma- associated antigen), IGF1R (insulinlike growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL- 13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A), Lewis Y, melanoma-associated antigen (MAGE)-Al, MAGE-A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma- associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes (e.g., HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1), NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME (preferentially expressed antigen of melanoma), progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen), PSMA (prostate specific membrane antigen), ROR1, ROR2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor-associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, HPV, and other pathogens.

[0183] Chimeric antigen receptors typically include the following domains: (1) an extracellular binding domain that binds a target antigen (“antigen binding domain”); (2) a hinge region (optional); (3) a transmembrane domain; and (4) an intracellular domain comprising one or more signal transduction domains.

[0184] The antigen binding domain can comprise any suitable binding domain, such as an antibody, an Fab (VLCL VHCH), an F(ab')2, an Fv (VLVH), an scFv (single chain Fv) (a58MF-365941982Docket No.: 237752001140polypeptide comprising a VL and VH joined by a spacer, e.g., a peptide spacer), an(scFv)2, an sc(Fv)2, a minibody (sc(Fv)2 fused to CH3 domain), a diabody (noncovalent dimer of heavy chain variable (VH) and light chain variable (VL) regions connected by a peptide spacer), a triabody (trivalent sc(Fv)? or tri-specific sc(Fv)s), an Fd (the portion of the heavy chain included in the Fab fragment), and a single domain antibody (sdAb) (a variable domain of either a heavy chain or a light chain).

[0185] In certain embodiments, the CAR comprises a first-generation CAR, a second-generation CAR, a third- generation CAR, and / or a fourth-generation CAR. First generation CARs typically comprise an antigen binding domain (e.g., in the form of an scFv), a transmembrane domain, and intracellular signaling domain (e.g., derived from CD3 .Second generation CARs typically further comprise an additional co- stimulatory domain (e.g., from (e.g., CD28, 4-1BB, or 0X40). Third generation CARs typically comprise multiple co- stimulatory domains. Fourth generation CARs are typically engineered for inducible gene expression.

[0186] The antigen binding domain can, for example, bind one or more targets on one or more target cells involved in autoimmune disease.

[0187] In certain embodiments, the CAR further comprises a spacer domain (hinge domain) which links an antigen binding domain to a transmembrane domain. In some embodiments, a spacer domain of appropriate length can improve mobility of an antigen binding domain to allow for optimal binding to a target antigen and improve flexibility. In certain embodiments, the spacer domain comprises at least a portion or segment of a hinge region of an IgGl, IgG2, IgG3, or IgG4. In some embodiments, a spacer domain can be derived from a CH2 region and / or CH3 region of an IgGl, IgG2, IgG3, or IgG4. In certain embodiments, the spacer domain comprises upper hinge amino acids found between the variable heavy chain and the core and the core hinge amino acids including a polyproline region. In certain embodiments, the spacer region comprises at least a portion of a hinge region of a human IgG4 hinge spacer. In some embodiments, the spacer region comprises a human IgG4 hinge-CH3 spacer.

[0188] In some embodiments, the CAR further comprises a transmembrane domain. A transmembrane domain can provide anchoring of a CAR in a cell membrane and further assist in translocation of a signal from an extracellular domain to an intracellular domain. In some embodiments, the transmembrane domain comprises a membrane-bound or59MF-365941982Docket No.: 237752001140transmembrane protein. In certain embodiments, the transmembrane domain comprises a transmembrane region of an alpha, beta, or zeta chain of a T-cell receptor, such as CD28, CD3, CD45, CD4, CD 8, CD9, CD 16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137 or CD154. In some embodiments, the transmembrane domain comprises a CD28 transmembrane domain (CD28tm).

[0189] In some embodiments, the intracellular signaling domain can include a signaling domain and a co- stimulatory domain.

[0190] In certain embodiments, the CAR further comprises an intracellular signaling domain linked to a transmembrane domain. In accordance with these embodiments, the intracellular signaling domain can activate a function of a cell when the antigen binding domain binds to a target antigen. In some embodiments, the intracellular signaling domain can activate a function of a cell expressing a CAR, such as a T cell expressing the CAR. In certain embodiments, the intracellular signaling domain comprises one or more intracellular signaling domains. In some embodiments, the intracellular signaling domain comprises a functional domain of a primary cytoplasmic signaling protein. In some embodiments, the intracellular signaling domain comprises a functional domain of a primary cytoplasmic signaling protein, and at least one functional domain of one or more secondary cytoplasmic signaling proteins. In certain embodiments, a primary cytoplasmic signaling protein that acts in a stimulatory manner can contain signaling motifs which are known as intracellular receptor tyrosine-based activation motifs (IT AMs). In accordance with these embodiments, examples of IT AMs containing primary cytoplasmic signaling domains for use herein include, but are not limited to, those derived from CD3zeta, FcR gamma, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, or CD66d. In some embodiments, the intracellular signaling domain and / or the co-stimulatory domain herein can include all or a biologically active fragment of CD27, CD28, 41BB, 0X40, CD30, CD40, ICOS, lymphocyte function- associated antigen- 1 (LFA-1), CD2, CD7, LIGHT, NKG2C, or B7H3, and / or a ligand that specifically binds with CD83. In some embodiments, the intracellular signaling domain herein can include all or a biologically relevant segment of the signaling domain of CD3-zeta or variant thereof and all or a portion of the signaling domain of 4- IBB or variant thereof.

[0191] In certain embodiments, the first cell further comprises a second CAR, or a polynucleotide coding for at least a portion thereof, that binds a second binding partner or60MF-365941982Docket No.: 237752001140portion thereof different from the first, such as a bicistronic CAR cell. The first cell can comprise any suitable number of additional CARs that bind to binding partners or portions thereof different from the others. In certain embodiments, the first cell comprises (CAR)x, or a polynucleotide coding for at least a portion thereof, wherein, for each integer, x, (CAR)x comprises a CAR that bind to binding partners or portions thereof different from the other CARs. In certain embodiments, the integer x is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, or 14 and / or not more than 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15, for example 1-15, preferably 1-10, more preferably 1-5, even more preferably 1-3. For example, for an integer of 3, the first cell comprises 3 CARs, each of which bind to binding partners or portions thereof different from the others.

[0192] The CAR can comprise any suitable affinity for a binding partner or portion thereof. In certain embodiments, the CAR binds to the binding partner or portion thereof with an affinity of at least 0.001, 0.005, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 5, 10, 50, 100, or 1,000 pM and / or no more than 0.005, 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 5, 10, 50, 100, 1,000, 10,000 pM, for example 0.001 to 10,000 pM, preferably 100-10,000 pM, more preferably 0.001 to 1 pM, even more preferably 1 to 100 pM. Not wishing to be bound by theory, the affinity of a CAR may be tailored for an intended application such that CAR leads to activation at the site of use more often than at an unintended site, for example too high of an affinity may allow for a CAR to be activated at a tissue expressing a low amount of the binding partner as well as at the site of use where a higher amount of the binding partner is present.Chemokine receptors

[0193] In certain embodiments, the transgene encodes a chemokine receptor, such as a cytokine receptor, for example CCR and / or a CXCR receptor. Any suitable chemokine receptor can be used, for example CXC chemokine receptor 1 (CXCR1), CXC chemokine receptor 2 (CXCR2), CXC chemokine receptor 3 (CXCR3), CXC chemokine receptor 4 (CXCR4), CXC chemokine receptor 5 (CXCR5), CXC chemokine receptor 6 (CXCR6), CC chemokine receptor 1 (CCR1), CC chemokine receptor 2 (CCR2), CC chemokine receptor 3 (CCR3), CC chemokine receptor 4 (CCR4), CC chemokine receptor 5 (CCR5), CC chemokine receptor 6 (CCR6), CC chemokine receptor 7 (CCR7), CC chemokine receptor 8 (CCR8), CC chemokine receptor 9 (CCR9), CC chemokine receptor 10 (CCR10), CC chemokine receptor 11 (CCR11), C chemokine receptor (XCR1), CX3C chemokine receptor61MF-365941982Docket No.: 237752001140(CX3CR1), or a combination thereof or biologically active fragment thereof. In preferred embodiments, the chemokine receptor comprises a receptor involved in an autoimmune disease.Cytokines and cytokine receptors

[0194] In certain embodiments, the transgene encodes a cytokine, for example IL- 10, TGF-beta, and / or PD-10. The cytokine can be any suitable cytokine as needed for the application, such as an immune checkpoint inhibitor, for example PDCD1 (PD-1), CTLA4, ADORA2A (A2AR), B7-H3, B7-H4, BTLA, KIR, LAG3, HAVCR2 (TIM3), TIGIT, VISTA, PTPN6 (SHP-1), and FAS. In certain embodiments, the transgene encodes one or more cytokine receptors, for example CD25. In certain embodiments, the transgene encodes both a cytokine and a cytokine receptor, for example IL-2 and CD25. In certain embodiments, the transgene encodes, IL-13, IL-22, AREG, and / or BDNF.Methods for producing cells comprising a synthetic promoter

[0195] Provided herein are methods for engineering a cell, e.g., a Treg cell, to comprise an expression construct comprising a synthetic promoter of this disclosure. In certain embodiments, the method comprises delivering a composition comprising one or more polynucleotides encoding an expression construct to the population of cells, for example Treg cells. In certain embodiments, the method further comprises integrating at least a portion of the one or more polynucleotides encoding an expression construct into a genome of a cell in the population of cells. In preferred embodiments, the cell comprises a Treg cell. In further embodiments, the method comprises expanding the cells.

[0196] Any suitable method can be used to deliver polynucleotides and / or proteins to a cell. Methods of introducing polynucleotides and / or proteins into a cell include physical, biological, and chemical methods. Physical methods for introducing polynucleotides and / or proteins into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, viral transduction, and the like.Polynucleotides and / or proteins can be introduced into target cells using commercially available methods which include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany), BTX ECM 830 (Harvard Instruments, Boston, MA, USA), Gene Pulser II (BioRad, Denver, CO, USA), Multiporator (Eppendorf, Hamburg, Germany), among others). Polynucleotides and / or proteins can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation,62MF-365941982Docket No.: 237752001140using peptide mediated transfection, or using biolistic particle delivery systems such as "gene guns" (Nishikawa (2001) HUM GENE THER).

[0197] Biological methods for introducing polynucleotides and / or proteins of interest into a host cell include the use of vectors. Viral vectors can be derived from retrovirus, lentivirus, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, and the like. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362.

[0198] Chemical means for introducing polynucleotides and / or proteins into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle).

[0199] Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine ("DMPC") can be obtained from Sigma (St. Louis, MO, USA); dicetyl phosphate ("DCP") can be obtained from K & K Laboratories (Plainview, NY USA); cholesterol ("Choi") can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol ("DMPG") and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL, USA). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20 °C. Chloroform can be as a solvent since it is more readily evaporated than methanol. "Liposome" is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh (1991) GLYCOBIOLOGY). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine-nucleic acid complexes.63MF-365941982Docket No.: 237752001140

[0200] Once delivered to the cell, any suitable method can be used for integrating at least a portion of the polynucleotide encoding the expression construct into the genome of the cell, such as viral and / or CRISPR / Cas-mediated.

[0201] The CRISPR / Cas system is a facile and efficient system for inducing targeted genetic alterations. Any suitable CRISPR / Cas protein can be used, such as a Class I or class II, for example cas9 and / or cpfl. Target recognition by the CRISPR / Cas protein includes a ‘seed’ sequence within the guide nucleic acid (gNA), e.g., gRNA, and a protospacer adjacent motif (PAM) sequence adjacent to the ‘seed’ sequence of the gRNA. The CRISPR / Cas system can thereby be engineered to cleave virtually any DNA sequence in cell lines (such as 293T cells), primary cells, and CAR T cells by redesigning the gRNA. The CRISPR / Cas system can simultaneously target multiple genomic loci by provided two or more gNAs, making this system uniquely suited for multiple gene editing / modification.

[0202] Using a CRISPR / Cas system to introduce at least a portion of a polynucleotide into a genome of a cell leverages the CRISPR / Cas endonuclease to introduce a strand break into the genome of the cell in which homology dependent repair pathways result in integration of the at least portion of the polynucleotide into a desired site. Typically, the polynucleotide will further comprises one or more homology arms at least partially complementary to regions upstream and / or downstream of the desired site.

[0203] In certain embodiments, the gNA comprises a sequence specific for a target site, wherein upon binding of the CRISPR / Cas system at least one strand break is generated at or near the target site. The sequence of the gNA sequence may be within any suitable loci of the gene. In one embodiment, the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides in length.

[0204] The guide nucleic acid sequence can comprise an RNA sequence, a DNA sequence, a combination thereof (a RNA-DNA combination sequence), or a sequence with synthetic nucleotides. The guide nucleic acid sequence can be a single molecule or a double molecule. In one embodiment, the guide nucleic acid sequence comprises a single guide RNA.

[0205] A polynucleotide can be provided to the cell in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (4th Edition, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory,64MF-365941982Docket No.: 237752001140New York, 2012), and other virological and molecular organisms. It is described in the academic manual. Viruses useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, Sindbis viruses, gammaretroviruses, and lend viruses, preferably lenti viruses. In general, suitable vectors contain an origin of replication that functions in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., Internal PCT application Nos. WO 2001 / 096584 and WO 2001 / 029058, and US Patent No. 6,326,193).

[0206] In certain embodiments, the one or more polynucleotides integrate into a genome of at least 40, 50, 60, 70, 80, 90, or 100% of the Treg cells in the population, thereby producing a second population of Treg cells comprising a CAR polypeptide

[0207] In certain embodiments, the cell to which the composition comprising the polynucleotide comprising the expression construct was delivered is expanded after delivery of the composition. In preferred embodiments, the cell is expanded in the presence of IL-2.

[0208] In certain embodiments, a population of Treg cells for delivery of one or more polynucleotides can be produced by a method comprising expanding the Treg cells in the presence of IL-2. In other embodiment, the method further comprises expanding a population of Treg cells, wherein the initial population of Treg cells are at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, 99.9, or 100% pure, in other words, at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, 99.9, or 100% of the cells in the population of cells are Treg cells. In certain embodiments, the cells are acquired from a biological sample. In certain embodiments, Treg cells are purified from the sample using cell sorting, for example fluorescent-automated cell sorting (FACS). In certain embodiments, the one or more cells are stained before purifying with one or more fluorescent indicators for Foxp3, CD25, CD127, and / or HELIOS.

[0209] In certain embodiments, the cell further comprises CD71, preferably on a surface of the cell.

[0210] In certain embodiments, the cell is autologous to a potential recipient of the cell. In certain embodiments, the cell demonstrates reduced immunogenicity when placed in an allogeneic host, preferably the cell is non-immunogenic when placed in an allogeneic host. Pharmaceutical Compositions

[0211] Also disclosed are pharmaceutical compositions comprising a recombinant cell comprising an expression construct encoding a transgene and / or expressing the transgene,65MF-365941982Docket No.: 237752001140and a pharmaceutically acceptable carrier, as well as methods of use in the treatment rheumatoid arthritis.

[0212] As used herein, the term “pharmaceutical composition” refers to a composition comprising a pharmaceutical compound (e.g., a drug or a recombinant Treg cell as described herein) and a pharmaceutically acceptable carrier.

[0213] Pharmaceutically acceptable carriers will generally be sterile, at least for human use. A pharmaceutical composition will generally comprise agents for buffering and preservation in storage, and can include buffers and carriers for appropriate delivery, depending on the route of administration. Examples of pharmaceutically acceptable carriers include, without limitation, normal (0.9%) saline, phosphate-buffered saline (PBS) Hank's balanced salt solution (HBSS) and multiple electrolyte solutions such as PlasmaLyte ATM (Baxter).

[0214] Pharmaceutical compositions can be formulated for any route of administration, including mucosal (e.g., nasal, sublingual, vaginal, buccal, or rectal), parenteral (e.g., subcutaneous, intravenous, intramuscular, or intraarterial injection, either bolus or infusion), oral, or transdermal.

[0215] Injectable (e.g., intravenous) compositions can comprise a solution of the composition suspended in an acceptable carrier, such as an aqueous carrier. Any of a variety of aqueous carriers can be used, e.g., water, buffered water, 0.4% saline, 0.9% isotonic saline, 0.3% glycine, 5% dextrose, and the like, and may include glycoproteins for enhanced stability, such as albumin, lipoprotein, globulin, etc. Often, normal buffered saline (135-150 mM NaCl) will be used. The compositions can contain pharmaceutically acceptable auxiliary substances to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents, e.g., sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc. In some embodiments, the composition can be formulated in a kit for intravenous administration.

[0216] Formulations suitable for parenteral administration, such as, for example, by intraarticular (in the joints), intravenous, intramuscular, intratumoral, intradermal, intraperitoneal, and subcutaneous routes, include aqueous and non-aqueous, isotonic sterile injection solutions, which can contain antioxidants, buffers, bacteriostats, and solutes that render the formulation isotonic with the blood of the intended recipient, and aqueous and 66MF-365941982Docket No.: 237752001140non-aqueous sterile suspensions that can include suspending agents, solubilizers, thickening agents, stabilizers, and preservatives. Injection solutions and suspensions can also be prepared from sterile powders, granules, and tablets. In the practice of the present invention, compositions can be administered, for example, by intravenous infusion, topically, intraperitoneally, intravesically, or intrathecally. The formulations of compositions can be presented in unit-dose or multi-dose sealed containers, such as ampoules and vials.

[0217] Cells can be cryopreserved. Cryopreservation can include formulating cells with a cryopreservation agent, such as DMSO. Commercially available media include, for example, CryoStor® and pZerve®, available from Millipore Sigma.

[0218] Compositions can be formulated as dosage forms for administration. The term “dosage form” refers to the particular format of the pharmaceutical, and depends on the route of administration. Examples of dosage forms include, but are not limited to: dispersions; suppositories; ointments; cataplasms (poultices); pastes; powders; dressings; creams; plasters; solutions; patches; aerosols (e.g., nasal sprays or inhalers); gels; liquid dosage forms suitable for oral or mucosal administration to a patient, including suspensions (e.g., aqueous or nonaqueous liquid suspensions, oil-in-water emulsions, or a water-in-oil liquid emulsions), solutions, and elixirs; liquid dosage forms suitable for parenteral administration to a patient; and sterile solids (e.g., crystalline or amorphous solids) that can be reconstituted to provide liquid dosage forms suitable for parenteral administration to a patient.

[0219] In certain embodiments, a pharmaceutical composition may contain nanoparticles, e.g., polymeric nanoparticles, liposomes, or micelles (Anselmo (2016) BIOENGTRANSL MED). In certain embodiment, the pharmaceutical composition comprises an inorganic nanoparticle. Exemplary inorganic nanoparticles include, e.g., magnetic nanoparticles (e.g., FesMnCE) or silica. The outer surface of the nanoparticle can be conjugated with a positively charged polymer (e.g., polyethylenimine, polylysine, polyserine) which allows for attachment (e.g., conjugation or entrapment) of payload. In certain embodiment, the pharmaceutical composition comprises an organic nanoparticle (e.g., entrapment of the payload inside the nanoparticle). Exemplary organic nanoparticles include, e.g., SNALP liposomes that contain cationic lipids together with neutral helper lipids which are coated with polyethylene glycol (PEG) and protamine and nucleic acid complex coated with lipid coating. In certain embodiment, the pharmaceutical composition comprises a liposome, for example, a liposome disclosed in International (PCT) Application Publication No. WO 2015 / 148863.67MF-365941982Docket No.: 237752001140

[0220] In certain embodiments, a pharmaceutical composition may contain a sustained-or controlled-delivery formulation. Techniques for formulating sustained- or controlled-delivery means, such as liposome carriers, bio-erodible microparticles or porous beads and depot injections, are also known to those skilled in the art. Sustained-release preparations may include, e.g., porous polymeric microparticles or semipermeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules. Sustained release matrices may include polyesters, hydrogels, polylactides, copolymers of L-glutamic acid and gamma ethyl-L-glutamate, poly (2-hydroxyethyl-inethacrylate), ethylene vinyl acetate, or poly-D(-)-3-hydroxybutyric acid. Sustained release compositions may also include liposomes that can be prepared by any of several methods known in the art.

[0221] The terms “dose” and “dosage” are used interchangeably herein. A dose refers to the amount of active ingredient given to an individual at each administration. The dose will vary depending on a number of factors, including frequency of administration; size and tolerance of the individual; severity of the condition; risk of side effects; the route of administration; and the imaging modality of the detectable label (if present). One of skill in the art will recognize that the dose can be modified depending on the above factors or based on therapeutic progress.

[0222] In certain embodiments, composition comprise a dose of at least 5xl04, IxlO5, 5xl05, IxlO6, 5xl06, IxlO7, 5xl07, IxlO8, 5xl08, IxlO9, or 2xl09and / or not more than IxlO5, 5xl05, IxlO6, 5xl06, IxlO7, 5xl07, IxlO8, 5xl08, IxlO9, 2xl09, or IxlO10cells, for example 5xl04to IxlO10cells.

[0223] The pharmaceutical preparation can be packaged or prepared in unit dosage form. In such form, the preparation is subdivided into unit doses containing appropriate quantities of the active component, e.g., according to the dose of the therapeutic agent or concentration of the composition. The unit dosage form can be a packaged preparation, the package containing discrete quantities of preparation. The composition can, if desired, also contain other compatible therapeutic agents.

[0224] An “effective amount” or "therapeutically effective amount" or "therapeutically effective dosage" of a drug or therapeutic agent is any amount of the drug that, when used alone or in combination with another therapeutic agent, protects a subject against the onset of a disease or promotes disease regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom- free periods, or a 68MF-365941982Docket No.: 237752001140prevention of impairment or disability due to the disease affliction. The ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.

[0225] ‘Treatment" or "therapy" of a subject refers to any type of intervention or process performed on, or the administration of an active agent to, the subject with the objective of curing, reversing, alleviating, ameliorating, inhibiting, slowing down, or preventing the onset, progression, development, severity, or recurrence of a symptom, complication, condition, or biochemical indicia associated with a disease.Methods of Treatment

[0226] Tregs maintain immune homeostasis and confer immune tolerance. The engineered Treg cells as disclosed herein may be autologous or allogeneic, can be used in cell-based therapy to treat patients in need of induction of immune tolerance or restoration of immune homeostasis, such as patients receiving organ transplantation or allogeneic cell therapy and patients with an autoimmune diseases. The present Treg cells will have enhanced immune-regulatory activities, including improved tissue specificity and / or increased immunosuppressive functions. The Tregs will actively control the proliferation and activation of Teffs locally and / or systemically through receptor-mediated cell-to-cell contact and secretion of immunosuppressive cytokines as disclosed herein. Further, since Treg cells can proliferate and self-renew, the cells as disclosed herein can achieve long-term tolerance when used as cell therapies to treat autoimmune disease.

[0227] Cells can be expanded ex vivo before administration to a subject.Autoimmune disease

[0228] Autoimmune disease is a condition arising from an abnormal immune response to a functioning body part, e.g., when a subject’s own immune system mistakenly attacks healthy cells. About 24 million (-7.5%) people in the United States alone are affected by an autoimmune disease. Both humans and non-human animals suffer from autoimmune diseases.

[0229] It is contemplated that the compositions and methods disclosed herein can be used to genetically engineer cells sourced from a healthy individual and / or a subject suffering from any autoimmune disease, and the resulting genetically engineered cells can be used to treat a 69MF-365941982Docket No.: 237752001140patient suffering from an autoimmune disease. In certain embodiments, one or more cells are isolated from a subject suffering from an autoimmune disease. In certain embodiments, the one or more cells are genetically engineered to comprise one or more transgenes.

[0230] The compositions and methods provided herein can be used to treat any autoimmune disease. Exemplary autoimmune diseases include but are not limited to Acquired aplastic anemia, Acquired hemophilia, Acromegaly, Acute disseminated encephalomyelitis, Acute hemorrhagic leukoencephalitis, Adult-onset Still's disease, Agammaglobulinemia, Alopecia areata, ANCA-associated vasculitis, Ankylosing spondylitis, Anti-GBM / anti-TBM disease, Anti-NMDA receptor encephalitis, Antiphospholipid syndrome, Arteriosclerosis, Asherson's syndrome, Atopic Dermatitis, Autoimmune Addison’s disease, Autoimmune autonomic ganglionopathy, Autoimmune dysautonomia, Autoimmune encephalitis, Autoimmune gastritis, Autoimmune gastrointestinal dysmotility, Autoimmune hemolytic anemia, Autoimmune hepatitis, Autoimmune hyperlipidemia, Autoimmune hypophysitis, Autoimmune inner ear disease, Autoimmune lymphoproliferative syndrome, Autoimmune myelofibrosis, Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune pancreatitis, Autoimmune poly endocrine syndrome type II, Autoimmune polyglandular syndromes, types I, II, & III, Autoimmune progesterone dermatitis, Autoimmune retinopathy, Autoimmune sudden sensorineural hearing loss, Autoimmune thrombocytopenia, Autoimmune thrombocytopenic purpura, Autoimmune thyroiditis, Balo disease, Behget’s disease, Berger's disease, Birdshot chorioretinopathy, Birdshot uveitis, Bullous pemphigoid, Castleman disease, Catastrophic antiphospholipid syndrome, Celiac disease, Chagas disease, Chronic fatigue syndrome, Chronic inflammatory demyelinating polyneuropathy, Chronic Lyme disease, Chronic lymphocytic thyroiditis, Chronic urticaria, Churg-Strauss syndrome / eosinophilic granulomatosis with polyangiitis, Cogan’s syndrome, Cold agglutinin disease, Complex regional pain syndrome, CREST syndrome, Crohn’s disease, Cronkhite-Canada syndrome, Cryptogenic organizing pneumonia, Dermatitis herpetiformis, Dermatomyositis, Devic's disease, Diabetes (type 1), Discoid lupus, Dressier’s syndrome, Eczema, Endometriosis, Eosinophilic esophagitis, Eosinophilic fasciitis, Erythema nodosum, Essential mixed cryoglobulinemia, Evans syndrome, Fibrosing alveolitis, Giant cell arteritis, Giant Cell Myocarditis, Glomerulonephritis, Goodpasture’s syndrome, Granulomatosis with polyangiitis, Graves disease, Guillain-Barre syndrome, Hashimoto’s thyroiditis, Hemifacial atrophy, Henoch-Schonlein purpura, Herpes gestationis, Hidradenitis suppurativa, Horton’s disease, Hurst’s disease, Hypogammaglobulinemia, Idiopathic pulmonary fibrosis, IgA 70MF-365941982Docket No.: 237752001140nephropathy, IgA vasculitis, IgG4-related sclerosing disease, Immune thrombocytopenia (ITP), Immune-mediated necrotizing myopathy, Inclusion body myositis, Interstitial cystitis, Juvenile dermatomyositis, Juvenile idiopathic arthritis, Juvenile myositis, Juvenile polymyositis, Kawasaki disease, Lambert-Eaton myasthenic syndrome, Leukocytoclastic vasculitis, Lichen planus, Lichen sclerosus, Ligneous conjunctivitis, Limited cutaneous systemic sclerosis, Linear IgA bullous dermatosis, Linear IgA disease, Lupus nephritis, Lyme disease, Lymphocytic colitis, Meniere’s disease, Mesenteric Panniculitis, Microscopic colitis, Microscopic polyangiitis, Mixed connective tissue disease, Mooren’s ulcer, Mucha-Habermann disease, Multifocal motor neuropathy, Multiple sclerosis, Myalgic encephalomyelitis, Myasthenia gravis, Narcolepsy, Neuromyelitis optica, Ocular cicatricial pemphigoid, Opsoclonus-myoclonus syndrome, Palindromic rheumatism, Palmoplantar Pustulosis, PANS / PANDAS, Paraneoplastic cerebellar degeneration, Paraneoplastic pemphigus, Paroxysmal nocturnal hemoglobinuria, Parry-Romberg syndrome, Pars planitis, Parsonage-Turner syndrome, Pemphigus foliaceus, Pemphigus gestationis, Pemphigus vulgaris, Peripheral uveitis, Pernicious anemia, POEMS syndrome, Polyarteritis nodosa, Polymyalgia rheumatica, Polymyositis, Post-treatment Lyme disease syndrome, Postmyocardial infarction, Postpericardiotomy syndrome, Postural orthostatic tachycardia syndrome, Primary biliary cholangitis, Primary biliary cirrhosis, Primary sclerosing cholangitis, Progressive facial hemiatrophy, Psoriasis, Psoriatic arthritis, Pulmonary fibrosis, idiopathic, Pure red cell aplasia, Pyoderma gangrenosum, Raynaud’s syndrome / phenomenon, Reactive arthritis, Reflex sympathetic dystrophy syndrome, Reiter’s syndrome, Relapsing polychondritis, Restless leg syndrome, Rheumatic fever, Rheumatoid arthritis, Sarcoidosis, Schmidt syndrome, Scleritis, Scleroderma, Sclerosing Mesenteritis, Serpiginous choroidopathy, Sjogren’s syndrome, Small fiber sensory neuropathy, Stiff person syndrome, Subacute bacterial endocarditis, Susac syndrome, Sydenham's chorea, Sympathetic ophthalmia, Systemic lupus erythematosus, Takayasu’s arteritis, Temporal arteritis, Testicular autoimmunity, Thyroid eye disease, Tolosa-Hunt syndrome, Transverse myelitis, Tubulointerstitial nephritis uveitis syndrome, Ulcerative colitis, Undifferentiated connective tissue disease, Uveitis, Vasculitis, VEXAS Syndrome, Vitiligo, Vogt-Koyanagi-Harada syndrome, Wegener’s granulomatosis, Willis-Ekbom disease.

[0231] Typically, treatment of autoimmune diseases depends on the type and severity of the condition. Standard treatment methods include: vitamin or hormone supplementation, blood transfusions if the disease is blood related, physical therapy if the disease impacts 71MF-365941982Docket No.: 237752001140bones, joints, or muscles, immunosuppressant drugs to reduce the immune response against the body's own tissues, such as non-steroidal anti-inflammatory drugs (NSAIDs), glucocorticoids, and disease-modifying anti-rheumatic drugs (DMARDs). Because immunosuppressants weaken the overall immune response, relief of symptoms must be balanced with preserving the patient's ability to combat infections, which could potentially be life-threatening. Additional options include monoclonal antibodies that can be used to block pro-inflammatory cytokines, antigen- specific immunotherapy which allows immune cells to specifically target the abnormal cells that cause autoimmune disease, co-stimulatory blockade that works to block the pathway that leads to the autoimmune response, and regulatory T cell therapy that utilizes this special type of T cell to suppress the autoimmune response.Therapeutic Methods

[0232] After transfection with the expression constructs comprising the synthetic promoters of the invention, the viability of transfected Treg cells may be increased relative to untransfected cells. Target cells can be “autologous” (i.e. patient derived) or allogenic (i.e., same cell type, bit from different subject). Optionally, allograft rejection, such as that associated with transplant rejection by including an MHC-specific chimeric antigen receptor in the CAR cassette. Noyan et al., 2017, Am. J. Transplantation 17: 917-930.

[0233] Exemplary methods for Treg therapy are provided by Romano et al., 2016, Transplant International 2017, 30:745-753. Treg cell population can be expanded ex vivo, by methods described by Xia et al., 2009, Transl. Res. 2009 153(2): 60-70 (E.g., amplification of FoxP3+, CD4+ and CD25+ cells). After expansion, Treg identity can be confirmed by detecting cell surface markers known to be associated with Treg, such as CD4+, CD25+ and CD1271ow. Non T-reg cells can identified and excluded by suitable cell surface marker detection, e.g., CD4+, CD25+ and CD127+.

[0234] Cells can be administered using infusion techniques commonly known in immunotherapy, (e.g. Rosenberg et al., New Eng. J. med. 319: 1676, 1988). Dosages and dosing regimens may be optimized by monitoring the patient for disease and side effect symptoms adjusting the treatment accordingly.

[0235] Alternatively, the transfected Treg cells may be administered by any convenient matter, including injection, transfusion, subcutaneously, intradermally, intratumorally, intranodally, interamedullary, intramuscularly, intravenously, intraarterially or intraperitoneally. In a particular embodiment, the administration method is intravenously.72MF-365941982Docket No.: 237752001140Kits

[0236] As used herein, the term “kit” refers to a collection of items intended for use together. The kit can optionally include a reference agent and / or instructions for use thereof. A kit can further include a shipping container adapted to hold a container, such as a vial, that contains a composition as disclosed herein. A kit can include a container that contains within it the collection of items.

[0237] Kits of this disclosure can comprise a pharmaceutical composition as described herein, contained in a container, such as a bag or bottle for intravenous administration. In certain embodiments, one or more of the elements of the system are provided in lyophilized form, and the kit further comprises a diluent. Elements may be provided individually or in combinations, and may be provided in any suitable container, such as a vial, a bottle, a tube, Also included in the kit can be a fluidic conduit, such as a plastic tube, with a drip chamber. The drip chamber can communicate through a fluidic conduit with an intravenous needle. The fluidic conduit also can comprise one or more Y-sites and a roller clamp.

[0238] Having generally described the compositions, methods, and processes of this disclosure, the same will be better understood by reference to certain specific examples, which are included herein to further illustrate the disclosure and are not intended to limit the scope of the invention as defined by the claims.EXEMPLARY EMBODIMENTS

[0239] Exemplary embodiments of the methods described herein include:1. A synthetic promoter that preferentially promotes transcription in Treg cells, comprising a plurality of transcription factor response elements (“TREs”) wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOX10, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, wherein the TREs are functionally coupled to a core promoter.2. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes a TRE recognized by FOXP3.73MF-365941982Docket No.: 2377520011403. The synthetic promoter of embodiment 1 or embodiment 2, wherein the plurality of TREs includes at least 1, at least 2, at least 3, or 4 TREs recognized by a transcription factor selected from FOXP3, SOX4, ELF1, and FOSL1.4. The synthetic promoter of embodiment 3, wherein the plurality of TREs further comprises 1, 2, 3 or 4 TREs recognized by a transcription factor selected from AR, MAFK, TBX2Related, and MAFG.5. The synthetic promoter of embodiment 1, wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, or 8 transcription factors selected from FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG.6. The synthetic promoter of embodiment 1, wherein:SOX4 is present only if FOXP3 and AR are also present;TBX2Related is absent only if JUNBFRA is present;NKX3A and ATF3 are each present only if the other is present; orCEB PE, ETV5CEBPD_01, NFATC1 are each present only if the others are present.7. The synthetic promoter of embodiment 1, comprising a TRE having a FOXP3 consensus sequence RTAAACA.8. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes a TRE recognized by FOXP3.9. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes TREs recognized by FOXP3, SOX4 and ELFE10. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes TREs recognized by FOXP3, SOX4 and FOSL1.11. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes TREs recognized by FOXP3, SOX4 and AR.12. The synthetic promoter of embodiment 1, wherein the plurality of TRE includes TREs recognized by FOXP3, SOX4 and MAFK.13. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes TREs recognized by FOXP3, SOX4 and TBX2Related.74MF-365941982Docket No.: 23775200114014. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes TREs recognized by OXP3, SOX4 and MAGF.15. The synthetic promoter of embodiment 1, wherein the plurality of TRE includes TREs recognized by FOXP3, SOX4, ELF1 (optionally in two copies), AR (optionally in two copies), JUNBFRA, ATF3, FOXP1, R0RA2 and NKX3A.16. The synthetic promoter of embodiment 15, comprising, in 5’-to-3’ order, the TREs recognized by SOX4, ELF1, ATF3, FOXP1, R0RA2, FOXP3, AR, NX3A, JUNBFRA2, AR, ELFE17. The synthetic promoter of embodiment 16, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mini and Avril.18. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes TREs recognized by FOXP3, SOX4, FOSL1, AR, MAFK, TBX2Related, MAFG, JUNBFRA, IRF3, RARB and PEA3 (optionally in 2 or 3 copies).19. The synthetic promoter of embodiment 18, comprising, in 5’-to-3’ order, the TREs recognized by FOSL1, SOX4, TBX2Related, JUNBFRA2, MAFK, IRF3, PEA3, PEA3, PEA3, IRF3, AR, RARB, FOXP3, MAFG.20. The synthetic promoter of embodiment 19, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mlul and Avril.21. The synthetic promoter of embodiment 1, wherein the plurality of TRE includes TREs recognized by FOXP3, SOX4, ELF1, AR (optionally in two or three copies), MAFK, TBX2Related, SOXIO, and PEA3.22. The synthetic promoter of embodiment 21, comprising, in 5’-to-3’ order, the TREs recognized by SOX4, SOXIO, AR, FOXP3, MAFK, PEA3, TBXRelated, ELF1, AR, AR. 23. The synthetic promoter of embodiment 22, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mlul, Avril and AvrII_mut.24. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes TREs recognized by FOXP3, SOX4, FOSL1 (optionally in two copies), MAFK, MEF2A (optionally in 2 or 3 copies), SOXIO, ATF3, AHRHIF, PAX3, NRF1.MF-365941982Docket No.: 23775200114025. The synthetic promoter of embodiment 1, wherein the plurality of TRE includes TREs recognized by FOXP3, SOX4 (optionally in two copies), ELF1, FOSL1 (optionally in two copies), MAFG, PEA3, MEF2A, NKX3A, CEBPE, ETV5CEBPD_01, and SOX9.26. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes TREs recognized by FOXP3, SOX4, ELF1, FOSL1, AR, FOXP1, and ATF3 (optionally in 2 copies).27. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes TREs recognized by FOXP3, ELF1, MAFK (optionally in two copies), TBX2Related, MAFG (optionally in two copies), FOXP1, IRF3, CEBPE, ETV5CEBPD_01, and NFATC1.28. The synthetic promoter of embodiment 1, wherein the plurality of TREs includes TREs recognized by FOXP3 (optionally in two copies), FOSL1, TBX2Related, MAFG (optionally in two copies), R0RA2, and IRF3.29. The synthetic promoter of any of embodiments 1-28, comprising at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 different TREs. 30. The synthetic promoter of embodiment 29, comprising at least two copies of one or more of the TREs.31. The synthetic promoter of embodiment 30, wherein at least one TRE is duplicated and is selected from a TRE recognized by AR, FOXP3, MAFG, EFL1 four JUNBFRA.32. The synthetic promoter of embodiment 31, wherein AR TRE is triplicated.33. The synthetic promoter of any of embodiments 1-32, wherein the number of unique TREs in the plurality is not more than any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.34. The synthetic promoter of any of embodiments 1-33, comprising at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 10, or at most 20 TREs.35. The synthetic promoter of any of embodiments 1-32, wherein the number of unique TREs in the plurality is at least any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.36. The synthetic promoter of any of embodiments 1-35, wherein the plurality of TREs is comprised in a nucleic acid segment of between 275 nucleotides and 375 nucleotides.37. The synthetic promoter of any of embodiments 1-35, comprising no more than any of 400, 350, or 300 nucleotides.76MF-365941982Docket No.: 23775200114038. The synthetic promoter of any of embodiments 1-37, wherein the TREs, if present, comprise a consensus sequence of SOX4 (FIG.7A; SEQ ID NO: 1); FOXP3 (FIG.7B; SEQ ID NO: 2); AR (FIG.7C; SEQ ID NO: 3); SOXIO (FIG.7D; SEQ ID NO: 4); ELF1 (FIG.7E; SEQ ID NO: 5); TBX2Related (FIG.7F; SEQ ID NO: 6); MAFK (FIG.7G; SEQ ID NO: 7); PEA3 (FIG.7H; SEQ ID NO: 8); ATF3 (FIG.71; SEQ ID NO: 7); FOXP1 (FIG.7J; SEQ ID NO: 10); RORA2 (FIG.7K; SEQ ID NO: 11); NKX3A (FIG.7L; SEQ ID NO: 12); JUNBFRA2 (FIG.7M; SEQ ID NO: 13); FOSL1 (FIG.7N; SEQ ID NO: 14); IRF3 (FIG. 70; SEQ ID NO: 15); RARB (FIG.7P; SEQ ID NO: 16); MAFG (FIG.7Q; SEQ ID NO: 17); MEF2A (FIG.7R; SEQ ID NO: 18); AHRHIF (FIG.7S; SEQ ID NO: 17); CEBPE (FIG. 7T; SEQ ID NO: 20); ETV5CEBPD (FIG.7U; SEQ ID NO: 21); PAX3 (FIG.7V; SEQ ID NO: 22); NRF1 (FIG.7W; SEQ ID NO: 23); SOX7 (FIG.7X; SEQ ID NO: 24); NFATC1 (FIG.7Y; SEQ ID NO: 25).39. The synthetic promoter of any of embodiments 38, wherein the TREs, if present, comprise a sequence selected from the group consisting of SEQ ID NO: 1 (SOX4), SEQ ID NO: 2 (FOXP3), SEQ ID NO: 3 (AR), SEQ ID NO: 4 (SOXIO), SEQ ID NO: 5 (ELF1), SEQ ID NO: 6 (TBX2Related), SEQ ID NO: 7 (MAFK), SEQ ID NO: 8 (PEA3), SEQ ID NO: 9 (ATF3), SEQ ID NO: 10 (FOXP1), SEQ ID NO: 11 (RORA2), SEQ ID NO: 12 (NKX3A), SEQ ID NO: 13 (JUNBFRA), SEQ ID NO: 14 (FOSL1), SEQ ID NO: 15 (IRF3), SEQ ID NO: 16 (RARB), SEQ ID NO: 17 (MAFG), SEQ ID NO: 18 (MEF2A), SEQ ID NO: 19 (AHRHIF), SEQ ID NO: 20 (CEBPE), SEQ ID NO: 21 (ETV5CEBPD_01), SEQ ID NO: 22 (PAX3), SEQ ID NO: 23 (NRF1), SEQ ID NO: 24 (SOX9), and SEQ ID NO: 25 (NFATC1).40. The synthetic promoter of any of embodiments 1-39, wherein the core promoter is selected from a core promoter of CTLA4 (e.g.,CTLA4mp(91), CTLA4mp(118), Foxp3 (e.g., Foxp3mp(82), Foxp3mp(117), IL2RA (e.g., IL2Ramp) RFS1 (e.g., RGSlmp), and IL1R2 (e.g., ILlR2mp).41. The synthetic promoter of any of embodiments 1-40, wherein the synthetic promoter preferentially promotes expression in Treg cells by a factor of at least two times, three times, five times, ten times, 20 times or 50 times compared with Teff cells.42. An expression construct, comprising:(a) the promoter of any of embodiments 1-41, operably linked with a nucleotide sequence encoding a polypeptide.77MF-365941982Docket No.: 23775200114043. The expression construct of embodiment 42, wherein the polypeptide comprises a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker.44. The expression construct of embodiment 42, wherein the polypeptide comprises a chimeric antigen receptor, comprising, e.g., (i) a signal peptide, (ii) a target or antigen binding domain, (iii) a hinge region, (iv) a transmembrane domain, (v) a signal transduction domain, and (vi) a co-stimulatory domain.45. The expression construct of embodiment 42, wherein the polypeptide comprises a chimeric antigen receptor that targets: AFP (alpha-fetoprotein), avP6 or another integrin, BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (delta-like protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma- associated antigen), IGF1R (insulinlike growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL- 13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A), Lewis Y, melanoma-associated antigen (MAGE)-Al, MAGE-A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma- associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes (e.g., HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1), NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME (preferentially expressed antigen of melanoma), progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem78MF-365941982Docket No.: 237752001140cell antigen), PSMA (prostate specific membrane antigen), R0R1, R0R2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor-associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, or HPV.46. The expression construct of embodiment 44, wherein the signal transduction domain is an intracellular IL-2 receptor beta domain.47. An expression vector, comprising:(a) an expression construct of any of embodiments 42-46;(b) an origin of replication; and, optionally, one or more of(c) a selection marker;(d) a polyadenylation signal; or(e) a transcription terminator.48. The expression vector of embodiment 47, comprising a viral vector, a plasmid, a bacterial artificial chromosome, a yeast artificial chromosome, a cosmid, a transposon and a minicircle vector.49. The expression vector of embodiment 47, comprising a viral vector selected from: lentivirus, adenovirus, AAV, retrovirus, and vesicular stomatitis virus.50. The expression vector of embodiment 47, encapsulated in a microvesicle, e.g., a liposome.51. A cell transfected with the expression construct of any of embodiments 42-46.52. The transfected cell of embodiment 51, wherein the cell comprises a Treg cell.53. The transfected cell of embodiment 52, which displays the phenotype CD4+, CD25 high and CD 127 low.54. The transfected cell of any of embodiments 51-53, which cell expresses a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker, under transcriptional control of the synthetic promoter.55. A method of engineering a T cell comprising transfecting the T cell with the expression vector of any of embodiments 47-50.79MF-365941982Docket No.: 23775200114056. A pharmaceutical composition comprising a transfected T-cell of any of embodiments 51-54 and a pharmaceutically acceptable carrier.57. A method for treating a Treg associated disorder comprising administering an effective amount of the composition of embodiment 56.58. The method of embodiment 57, wherein the Treg associated disorder is selected from an autoimmune disease, an allergic condition, an inflammatory condition or a transplant rejection.59. The method of embodiment 58, wherein the autoimmune disease is selected from type I diabetes, rheumatoid arthritis, systemic lupus erythematosus, celiac disease, psoriasis, myasthenia gravis, scleroderma, Addison disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis, pernicious anemia, reactive arthritis, and Sjogren syndrome.60. A method of treating a pathological condition in a subject, comprising:(i) isolating T cells from a biological sample obtained from subject;(ii) enriching the T cells for T regulatory cells (Treg);(iii) transfecting the enriched Treg cells with an expression vector of any of embodiments 47-50;(iv) expanding the transfected Treg cells; and(v) administering the expanded Treg cells to the patient.61. The method of embodiment 60, wherein the Treg cells are not sorted by cell surface marker expression.62. The method of embodiment 60, wherein the administration is mucosal or parental.63. The method of embodiment 62, wherein the administration is parenteral and the parenteral administration is selected from subcutaneous, intravenous, intraarterial, intramuscular or intrasynovial.64. The method of any of embodiment 60-63, wherein the pathological condition is selected from an autoimmune disease, an allergic condition, an inflammatory condition or a transplant rejection.65. A method of delivering a transgene to a subject, comprising administering to the subject a genetically modified Treg cell of any of embodiments 51-54.80MF-365941982Docket No.: 23775200114066. A nucleic acid molecule comprising a plurality of transcription factor response elements (“TREs”) wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, wherein the TREs, when functionally coupled to a core promoter, preferentially upregulates transcription in Treg cells.

[0240] Further exemplary embodiments of the methods described herein include:1. A synthetic promoter that preferentially promotes transcription in Treg cells, comprising a plurality of transcription factor response elements (TREs) wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, wherein the TREs are operably linked to a core promoter.2. A synthetic promoter that preferentially promotes transcription in Treg cells, comprising a plurality of transcription factor response elements (TREs) wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1, AHRIF, MEF2A, PAX3, NPF1, and SOX9, wherein the TREs are operably linked to a core promoter.3. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises a TRE recognized by FOXP3.4. The synthetic promoter of embodiment 3, wherein the plurality of TREs comprises a TRE recognized by FOXP3 and a TRE recognized by ELFE5. The synthetic promoter of embodiment 4, wherein the plurality of TREs further comprises at least one TRE recognized by a transcription factor selected from the group consisting of SOX4, AR, and TBX2Related.81MF-365941982Docket No.: 2377520011406. The synthetic promoter of embodiment 4 or 5, wherein the plurality of TREs further comprises at least one copy of at least one TRE recognized by a transcription factor selected from the group consisting of FOSL1, MAFK, and MAFG.7. The synthetic promoter of any one of embodiments 1-3, wherein the plurality of TREs comprises at least 1, at least 2, at least 3, or 4 TREs recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, and FOSL1.8. The synthetic promoter of embodiment 7, wherein the plurality of TREs further comprises 1, 2, 3 or 4 TREs recognized by a transcription factor selected from the group consisting of AR, MAFK, TBX2Related, and MAFG.9. The synthetic promoter of embodiment 1 or 2, wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, or 8 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG.10. A synthetic promoter that preferentially promotes transcription in Treg cells, comprising a plurality of transcription factor response elements (TREs), wherein each TRE in the plurality is recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG, wherein the TREs are operably linked to a core promoter.11. The synthetic promoter of embodiment 1 or 2, wherein:SOX4 is present only if FOXP3 and AR are also present;TBX2Related is absent only if JUNBFRA is present;NKX3A and ATF3 are each present only if the other is present; orCEB PE, ETV5CEBPD_01, NFATC1 are each present only if the others are present.12. The synthetic promoter of embodiment 1 or 2, comprising a TRE having a FOXP3 consensus sequence RTAAACA.13. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises a TRE recognized by FOXP3.14. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3 and ELFl.82MF-365941982Docket No.: 23775200114015. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1 and AR.16. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and TBX2Related.17. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and MAFK.18. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and FOSL1.19. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and MAFG.20. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, TBX2Related and AR.21. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally 4 copies), ELF1 (optionally 3 copies), TBX2Related (optionally 3 copies), AR (optionally 3 copies), SOX4, MAFK, and FOSL1.22. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally 3 copies), ELF1, TBX2Related (optionally 3 copies), AR, SOX4 (optionally 2 copies), MAFK (optionally 2 copies), FOSL1, and MAFG.23. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally 3 copies), ELF1 (optionally 6 copies), TBX2Related (optionally 3 copies), AR (optionally 2 copies), SOX4, MAFK (optionally 2 copies), and MAFG.24. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and ELFE25. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and FOSL1.26. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and AR.83MF-365941982Docket No.: 23775200114027. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and MAFK.28. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and TBX2Related.29. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and MAGF.30. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1 (optionally in two copies), AR (optionally in two copies), JUNBFRA, ATF3, FOXP1, RORA2 and NKX3A.31. The synthetic promoter of embodiment 30, comprising, in 5’-to-3’ order, the TREs recognized by SOX4, ELF1, ATF3, FOXP1, RORA2, FOXP3, AR, NX3A, JUNBFRA2, AR, ELFE32. The synthetic promoter of embodiment 31, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mini and Avril.33. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, FOSL1, AR, MAFK, TBX2Related, MAFG, JUNBFRA, IRF3, RARB and PEA3 (optionally in 2 or 3 copies).34. The synthetic promoter of embodiment 33, comprising, in 5’-to-3’ order, the TREs recognized by FOSL1, SOX4, TBX2Related, JUNBFRA2, MAFK, IRF3, PEA3, PEA3, IRF3, AR, RARB, FOXP3, MAFG.35. The synthetic promoter of embodiment 34, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mlul and Avril.36. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1, AR (optionally in two or three copies), MAFK, TBX2Related, SOXIO, and PEA3.37. The synthetic promoter of embodiment 36, comprising, in 5’-to-3’ order, the TREs recognized by SOX4, SOXIO, AR, FOXP3, MAFK, PEA3, TBXRelated, ELF1, AR, AR. 38. The synthetic promoter of embodiment 37, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mlul, Avril and AvrII_mut.84MF-365941982Docket No.: 23775200114039. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, FOSL1 (optionally in two copies), MAFK, MEF2A (optionally in 2 or 3 copies), SOXIO, ATF3, AHRHIF, PAX3, NRF1.40. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 (optionally in two copies), ELF1, FOSL1 (optionally in two copies), MAFG, PEA3, MEF2A, NKX3A, CEBPE, ETV5CEBPD_01, and SOX9.41. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1, FOSL1, AR, FOXP1, and ATF3 (optionally in 2 copies).42. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, MAFK (optionally in two copies), TBX2Related, MAFG (optionally in two copies), FOXP1, IRF3, CEBPE, ETV5CEBPD_01, and NFATC1.43. The synthetic promoter of embodiment 1 or 2, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally in two copies), FOSL1, TBX2Related, MAFG (optionally in two copies), RORA2, and IRF3.44. The synthetic promoter of any one of embodiments 1-43, comprising at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 different TREs.45. The synthetic promoter of embodiment 44, comprising at least two copies of one or more of the TREs.46. The synthetic promoter of embodiment 45, wherein at least one TRE is duplicated and is selected from the group consisting of a TRE recognized by AR, FOXP3, MAFG, and EFL1 four JUNBFRA.47. The synthetic promoter of embodiment 46, wherein the synthetic promoter comprises three copies of a TRE recognized by AR.48. The synthetic promoter of any one of embodiments 1-47, wherein the number of unique TREs in the plurality is not more than any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.85MF-365941982Docket No.: 23775200114049. The synthetic promoter of any one of embodiments 1-48, comprising at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 10, or at most 20 TREs. 50. The synthetic promoter of any one of embodiments 1-47, wherein the number of unique TREs in the plurality is at least any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.51. The synthetic promoter of any one of embodiments 1-50, wherein the plurality of TREs span a range of no more than 400 nucleotides.52. The synthetic promoter of any one of embodiments 1-51, wherein the plurality of TREs span a range of no more than 300 nucleotides, optionally between 100-300 nucleotides.53. The synthetic promoter of any one of embodiments 1-51, wherein the plurality of TREs span a range of between 275 nucleotides and 375 nucleotides.54. The synthetic promoter of any one of embodiments 1-51, comprising no more than 500, 400, 350, or 300 nucleotides.55. The synthetic promoter of any one of embodiments 1-54, wherein the TREs, if present, comprise a consensus sequence of SOX4 (FIG. 7A; SEQ ID NO: 1); FOXP3 (FIG.7B; SEQ ID NO: 2); AR (FIG. 7C; SEQ ID NO: 3); SOX10 (FIG. 7D; SEQ ID NO: 4); ELF1 (FIG. 7E; SEQ ID NO: 5); TBX2Related (FIG. 7F; SEQ ID NO: 6); MAFK (FIG. 7G; SEQ ID NO: 7); PEA3 (FIG. 7H; SEQ ID NO: 8); ATF3 (FIG. 71; SEQ ID NO: 7); FOXP1 (FIG. 7J; SEQ ID NO: 10); RORA2 (FIG. 7K; SEQ ID NO: 11); NKX3A (FIG. 7L; SEQ ID NO: 12); JUNBFRA2 (FIG. 7M; SEQ ID NO: 13); FOSL1 (FIG. 7N; SEQ ID NO: 14); IRF3 (FIG. 70; SEQ ID NO: 15); RARB (FIG. 7P; SEQ ID NO: 16); MAFG (FIG. 7Q; SEQ ID NO: 17); MEF2A (FIG. 7R; SEQ ID NO: 18); AHRHIF (FIG. 7S; SEQ ID NO: 17); CEBPE (FIG. 7T; SEQ ID NO: 20); ETV5CEBPD (FIG. 7U; SEQ ID NO: 21); PAX3 (FIG. 7V; SEQ ID NO: 22); NRF1 (FIG. 7W; SEQ ID NO: 23); SOX7 (FIG. 7X; SEQ ID NO: 24); NFATC1 (FIG. 7Y; SEQ ID NO: 25).56. The synthetic promoter of any one of embodiments 1-55, wherein the TREs, if present, comprise a sequence selected from the group consisting of SEQ ID NO: 1 (SOX4), SEQ ID NO: 2 (FOXP3), SEQ ID NO: 3 (AR), SEQ ID NO: 4 (SOX10), SEQ ID NO: 5 (ELF1), SEQ ID NO: 6 (TBX2Related), SEQ ID NO: 7 (MAFK), SEQ ID NO: 8 (PEA3), SEQ ID NO: 9 (ATF3), SEQ ID NO: 10 (FOXP1), SEQ ID NO: 11 (RORA2), SEQ ID NO: 12 (NKX3A), SEQ ID NO: 13 (JUNBFRA), SEQ ID NO: 14 (FOSL1), SEQ ID NO: 1586MF-365941982Docket No.: 237752001140(IRF3), SEQ ID NO: 16 (RARB), SEQ ID NO: 17 (MAFG), SEQ ID NO: 18 (MEF2A), SEQ ID NO: 19 (AHRHIF), SEQ ID NO: 20 (CEBPE), SEQ ID NO: 21 (ETV5CEBPD_01), SEQ ID NO: 22 (PAX3), SEQ ID NO: 23 (NRF1), SEQ ID NO: 24 (SOX9), and SEQ ID NO: 25 (NFATC1).57. The synthetic promoter of any one of embodiments 1-56, wherein the core promoter is selected from the group consisting of a core promoter of CTLA4, FOXP3, IL2RA, RGS1, and IL1R2, optionally wherein the CTLA4 core promoter is CTLA4mp(91) or CTLA4mp(118), the FOXP3 core promoter is FOXP3mp(82) or FOXP3mp(117), the IL2RA core promoter is IL2Ramp, the RGS1 core promoter is RGSlmp, and the IL1R2 promoter is ILlR2mp.58. The synthetic promoter of embodiment 57, wherein the core promoter is RGS1.59. The synthetic promoter of any one of embodiments 1-58, wherein the synthetic promoter preferentially promotes expression in Treg cells by a factor of at least two times, three times, five times, ten times, 20 times or 50 times compared with Teff cells.60. The synthetic promoter of any one of embodiments 1-58, wherein the synthetic promoter is active in Treg cells and inactive in Teff cells.61. The synthetic promoter of any one of embodiments 1-60, wherein the synthetic promoter comprises at least 1 TRE in a forward orientation and at least 1 TRE in a reverse orientation.62. An expression construct, comprising the synthetic promoter of any one of embodiments 1-61, operably linked with a nucleotide sequence encoding a polypeptide. 63. The expression construct of embodiment 62, wherein the polypeptide comprises a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker.64. The expression construct of embodiment 62, wherein the polypeptide comprises a chimeric antigen receptor, comprising, (i) a signal peptide, (ii) a target or antigen binding domain, (iii) a hinge region, (iv) a transmembrane domain, (v) a signal transduction domain, and (vi) a co-stimulatory domain.65. The expression construct of embodiment 62, wherein the polypeptide comprises a chimeric antigen receptor that targets: AFP (alpha-fetoprotein), avP6 or another integrin,87MF-365941982Docket No.: 237752001140BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (delta-like protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma- associated antigen), IGF1R (insulinlike growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL- 13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A), Lewis Y, melanoma-associated antigen (MAGE)-Al, MAGE-A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma- associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes (e.g., HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1), NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME (preferentially expressed antigen of melanoma), progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen), PSMA (prostate specific membrane antigen), ROR1, ROR2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor-associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, or HPV.66. The expression construct of embodiment 65, wherein the chimeric antigen receptor comprises a signal transduction domain that is an intracellular IL-2 receptor beta domain. 67. An expression vector, comprising:(a) the expression construct of any one of embodiments 62-66;88MF-365941982Docket No.: 237752001140(b) an origin of replication; and, optionally, one or more of(c) a selection marker;(d) a polyadenylation signal; or(e) a transcription terminator.68. The expression vector of embodiment 67, comprising a viral vector, a plasmid, a bacterial artificial chromosome, a yeast artificial chromosome, a cosmid, a transposon, or a minicircle vector.69. The expression vector of embodiment 67, comprising a viral vector selected from the group consisting of lentivirus, adenovirus, AAV, retrovirus, and vesicular stomatitis virus.70. The expression vector of embodiment 67, encapsulated in a microvesicle, optionally wherein the microvesicle is a liposome.71. A cell transfected with the expression construct of any one of embodiments 62-66.72. The transfected cell of embodiment 71, wherein the cell is a Treg cell.73. The transfected cell of embodiment 72, wherein the cell displays the phenotype CD4+, CD25 high and CD 127 low.74. The transfected cell of any one of embodiments 71-73, wherein the cell expresses a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker, under transcriptional control of the synthetic promoter.75. A method of engineering a T cell comprising transfecting the T cell with the expression vector of any one of embodiments 67-70.76. A pharmaceutical composition comprising the cell of any one of embodiments 71-74 and a pharmaceutically acceptable carrier.77. A method for treating a Treg associated disorder comprising administering an effective amount of the composition of embodiment 76.78. The method of embodiment 77, wherein the Treg associated disorder is selected from an autoimmune disease, an allergic condition, an inflammatory condition or a transplant rejection.89MF-365941982Docket No.: 23775200114079. The method of embodiment 78, wherein the autoimmune disease is selected from the group consisting of type I diabetes, rheumatoid arthritis, systemic lupus erythematosus, celiac disease, psoriasis, myasthenia gravis, scleroderma, Addison disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis, pernicious anemia, reactive arthritis, and Sjogren syndrome.80. A method of treating a pathological condition in a subject, comprising:(i) isolating T cells from a biological sample obtained from the subject;(ii) enriching the T cells for T regulatory cells (Treg);(iii) transfecting the enriched Treg cells with an expression vector of any one of embodiments 67-70;(iv) expanding the transfected Treg cells; and(v) administering the expanded Treg cells to the subject.81. The method of embodiment 80, wherein the Treg cells are not sorted by cell surface marker expression.82. The method of embodiment 80, wherein the administration is mucosal or parental. 83. The method of embodiment 82, wherein the administration is parenteral and the parenteral administration is selected from subcutaneous, intravenous, intraarterial, intramuscular or intrasynovial.84. The method of any one of embodiments 80-83, wherein the pathological condition is selected from the group consisting of an autoimmune disease, an allergic condition, an inflammatory condition, and a transplant rejection.85. A method of delivering a transgene to a subject, comprising administering to the subject the cell of any one of embodiments 71-74.86. A nucleic acid molecule comprising a plurality of transcription factor response elements (TREs) wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOX10, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, wherein the TREs, when operably linked to a core promoter, preferentially upregulate transcription in Treg cells.90MF-365941982Docket No.: 23775200114087. A nucleic acid molecule comprising a plurality of transcription factor response elements (TREs) wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1, AHRIF, MEF2A, PAX3, NPF1, and SOX9, wherein the TREs, when operably linked to a core promoter, preferentially upregulate transcription in Treg cells.88. A nucleic acid molecule comprising a plurality of transcription factor response elements (TREs), wherein each TRE in the plurality is recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG, wherein the TREs, when operably linked to a core promoter, preferentially upregulate transcription in Treg cells.89. The synthetic promoter of any one of embodiments 1-61, wherein the synthetic promoter has a Treg score and a Teff score, and the Treg score of the synthetic promoter is greater than the Teff score of the synthetic promoter.EXAMPLES

[0241] The present disclosure is described in further detail in the following examples which are not in any way intended to limit the scope of the disclosure as claimed. The attached figures are meant to be considered as integral parts of the specification and description of the disclosure. The following examples are offered to illustrate, but not to limit the claimed disclosure.Example 1 - Screening workflow for Treg specific synthetic promoters (TRSPs)

[0242] A series of promoters were designed and screened to identify Treg specific synthetic promoters (TRSPs) that promote selective expression in Treg and not Teff cells (FIG. 12E). The synthetic promoters comprise a plurality of transcription factor response elements (TREs) operably linked to a minimal / core promoter (FIG. 1). FIG. 2 provides examples of the TRSPs and indicates the forward or reverse orientation of each TRE.

[0243] For the TRSP screening workflow, a promoter plasmid library was created. Seven different minimal promoters were cloned into a lentiviral reporter construct. The construct contained a EFla promoter regulated mCherry reporter as a transduction marker and a Zsgreen fluorescent reporter under a minimal promoter. The enhancer libraries were91MF-365941982Docket No.: 237752001140restriction digested and cloned into either a plasmid mix of 7 minimal promoters or the plasmid with CTLA4 minimal promoter. These promoter plasmid libraries were further packaged into lend- virus for transduction in primary T cells. Nucleotide sequences of exemplary minimal promoters are set forth in FIGS.7A-7Y.

[0244] The promoter plasmid library was screened in T cells. Treg specific promoters described herein were transduced into Treg and Teff at a low multiplicity of infection to achieve no more than one copy per cell. mCherry+ Zsgreen+ or mCherry+ Zgreen- cells were sorted out by a Sony Cell Sorter at different time points through-out the in vitro culture.Table 7: Nucleotide sequences of Zsgreen, mCherry and EFl.

[0245] Selected promoter candidates were validated by flow cytometry in Treg and Teff through our standard Treg cell culture condition. A few of them showed relatively high expression in Treg cells and low in Teff cells.92MF-365941982Docket No.: 237752001140

[0246] Primary Treg and Teff cells were flow sorted from PBMC cells isolated from a leukopak gated on the CD4+CD8 CD25hlghCD27lowpopulation, seeded in OpTmizer media with 0.5% serum replacement and 300IU / ml IL2, and stimulated with TregExpander beads (ThermoFisher). Three days later, the cells were transduced with lentiviral vectors at MOI of 12 for Treg and MOI of 24 for Teff in the presence of LentiBOOST. Cells were split on day 5 and collected for flow analysis on day 7, 11, and 14.Example 2 - Results for first-generation TRSPs

[0247] FIGS. 3A-3B show CAR expression in Treg and Teff cells induced by the AS4, AS24, and AELS2 first-generation TRSPs (see Table 4, Table 5 for sequences) compared to the CNS123p promoter (FOXP3) as a control. CAR lentiviral constructs were used, containing different promoters (see x-axis of FIGS. 3A-3B) driving CAR expression.Primary human Tregs or Teffs were stimulated with beads for 3 days, transduced with the CAR lentiviral vector, and analyzed for CAR expression by flow cytometry. The AS4, AS24, and AELS2 TRSPs promoted CAR expression (as measured by percentage CAR expression in FIG. 3A and mean fluorescent intensity in FIG. 3B) in Tregs as compared to Teffs, similar to the results observed for the CNS123p promoter.

[0248] FIGS. 4-6 show CAR expression using the AS4 and AELS2 TRSPs (see Table 4, Table 5 for sequences) as compared to a control MND promoter and a control CNS123p (FOXP3) promoter, on day 7 (FIG. 4), day 11 (FIG. 5), and day 14 (FIG. 6) after stimulation by Dynabeads™ Human Treg Expander. The TRSPs promoted similar CAR expression as the CNS123p promoter.

[0249] FIG. 8 depicts additional results for a top first generation TRSP candidate, AELS2 (see Table 4, Table 5, “TRSP1”). AELS2 has a small footprint in a DNA construct due to small size and promoted Treg specific expression as shown in FIG. 8. As shown in FIGS. 3A-3B, AELS2 outperformed the CNS123p promoter (a semi-synthetic FOXP3 promoter). In this experiment, Zsgreen is in the bi-cistronic reporter lentiviral construct comprising Zsgreen and mCherry genes, and gated on mCherry+ cells. The CAR is in a single promoter lentiviral vector.

[0250] FIG. 9A depicts that for AELS2 (TRSP1), day 14 Treg product quality can be enhanced by expressing a CAR in Tregs, while minimizing expression in Teff cells and destabilized Treg cells. FIG. 9B shows an in vitro stress model used to compare the TRSP1 and MND promoters. This model consisted of mixed Tregs and Teffs, along with a high-tonic 93MF-365941982Docket No.: 237752001140CAR for disrupting Treg stability. FIG. 9C shows CAR positive cells under the TRSP1 promoter have a better Treg phenotype defined by FOXP3 and Helios expression.

[0251] HELIOS / FOXP3 expression was analyzed in cells transduced with TRSP-CAR and MND-CAR constructs after CD3 / CD28 or CAR stimulation (FIG. 10A). The day 14 CAR-Treg product was stimulated through CAR or TCR and cultured in a supraphysiological cytokine condition containing IL2, IL6, ILip, and IL23. Seven days after a second stimulation, cells were analyzed by flow cytometry after gating on CAR+ cells for expression of FOXP3 and HELIOS. A stronger HELIOS / FOXP3 phenotype was observed in the TRSP-CAR transduced cells as compared to the MND-CAR transduced cells, indicating that TRSP-CAR Tregs maintained a more stable phenotype under inflammatory conditions compared to MND-CAR Tregs. FIG. 10B shows a summary heatmap of Treg-associated marker expression compared between the CD3 / CD28 and CAR stimulation conditions, for TRSP-CAR Tregs as compared to MND-CAR Tregs. TRSP-CAR Tregs retained higher levels of Treg-associated marker expression compared to MND-CAR Tregs.

[0252] FIG. 11A depicts a CAR specific suppression assay measuring the proliferation of cultured Teffs in the presence of CAR-Tregs at different ratios (8:1, 4:1, 2:1, 1:1, 1:2, 1:4).FIG. 11B depicts the cytokines measured from the supernatant of the suppression assay as shown in FIG. 11A, for Treg AELS-CAR, Treg MND-CAR, Treg MND-Tag only, Teff MND-CAR, and Teff UT- only.

[0253] FIGS. 12A-12C depict an exemplary use of a TRSP as a safety switch that restricts the survival signal from a tethered switch receptor (SR) to Tregs, but not Teffs. FIG.12A depicts an exemplary schematic of a IL-X / IL-2RP cytokine receptor and downstream STAT5 signaling, where X is, for example, 2, 4, 7, 9, or 21; thus, the IL extracellular domain and transmembrane domain can be from any of IL-2, IL-4, IL-7, IL-9, and IL-21. FIG. 12B depicts the fold expansion of Teff cell products after day 14 in the absence of IL-2, with the exception of the control group. FIG. 12C depicts the fold expansion of Treg cell products after day 14 in the absence of IL-2, with the exception of the control group. FIG. 12D depicts enrichment of Tag-positive Tregs transduced with SR-Tag under MND or TRSP.Example 3 - Results for second-generation TRSPs

[0254] First and second generation Treg specific promoters (TRSPs) as described herein were introduced into Treg cells and assessed with respect to promoter activity and elicited phenotypes in the transfected Treg cells.94MF-365941982Docket No.: 237752001140

[0255] The first- generation TRSPs included 27 transcription factor response elements (TREs) that were examined with 8 different minimal promoters. 8 TREs were selected for further examination in a series of second-generation TRSPs: FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG. The 8 TREs in the second-generation TRSPs were tested with the RGS 1 minimal promoter.

[0256] FIG. 25 depicts differential CAR expression in Treg and Teff cells for AEES2 (the top candidate from the first generation TRSPs (“TRSP1”), as compared to MND, and shows that AEES2 promotes CAR expression in Tregs. FIG. 13 depicts the stronger promoter activity of certain second generation TRSPs compared to AEES2 / TRSP1 (see Table 6 for map of TRSP identifier labels). Second generation TRSPs were tested in dual reporter construct (TRSP, EFl ah, mCherry) transduced Tregs and Teffs, and showed increased promoter activity as compared to TRSP1 in Tregs, and increased promoter activity in Tregs as compared to Teffs (FIG. 13).

[0257] Constructs comprising a cytokine receptor payload sequence (switch receptor “SR” (i.e., a cytokine receptor comprising an extracellular cytokine receptor domain, a transmembrane domain, and an intracellular IL-2 receptor beta chain domain, wherein the extracellular cytokine receptor domain binds to a cytokine other than IL-2); an IL-2 tethered receptor “IL2TRB” (i.e., a cytokine receptor comprising an IL-2 cytokine molecule tethered to the IL-2 receptor beta (IL-2RP) extracellular domain)) and a TRSP or MND promoter (FIG. 14A) were used for transfection experiments. As shown in FIG. 14B, a sort-free platform for Treg cell expansion was developed using CD25 enriched cells transduced with a TRSP linked to a cytokine receptor payload sequence.

[0258] Cells transduced with the second generation TRSPs operably linked to an SR payload sequence (second generation TRSPs 238, 204, 285, 70, 276, 217, 183, 50, 233, 214) exhibited stronger expression of the payload compared to TRSP1 in the day 14 product (FIG.15), and an enhanced FOXP3 / HELIOS phenotype (FIG. 16, FIG. 17). Transduced cells exhibited a mild degree of heterogeneity on day 14 with respect to CD4 and CD3 markers (FIG. 18). After gating on IL5Ra tag-positive cells, the day 14 products were mainly CD4+ (FIG. 19).

[0259] FIG. 20 depicts expression levels of IL-2TRB and IL5Ra tag markers as identified by FACS in cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214), a first generation TRSP1 (AELS2), control promoters (MND,95MF-365941982Docket No.: 237752001140MSCV, MND-tag only + IL2), or untransduced cells with IL-2. The second generation TRSPs exhibited strong expression of the IL-2 payload on day 14. FIG. 21 depicts high enrichment of IL5Ra tag-positive cells under IL-2-free culture conditions on days 7 and 14 after transduction with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214) as compared to a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-IL5Ra tag).

[0260] FIGS. 22A-22B depict a stronger FOXP3 / HELIOS phenotype in TRSP-IL2TRB transduced cells compared to MND and MSCV controls. After gating for IL5Ra tag-positive cells, the day 14 products exhibited a strong FOXP3 / HELIOS phenotype for cells transduced with certain second generation TRSPs (FIGS. 22A-22B).

[0261] FIGS. 23A-23C depict activation assay results of Tregs transduced with TRSP regulated HLA-A2CAR and stimulated by HLA-A2+PBMCs. FIG. 23A depicts a timeline of the activation assay and the TRSP regulated HLA-A2CAR construct used for transducing the Tregs. FIG. 23B depicts proliferation of Treg cells transduced with different TRSPs (TRSP1, TRSP4, TRSP5, TRSP6, TRSP10) after gating on Tag+CD3+CD4+. FIG. 23C depicts Tag+ expression in Treg cells transduced with different TRSPs (TRSP1, TRSP4, TRSP5, TRSP6, TRSP 10) after gating on CD3+CD4+. FIGS. 24A-24B depict FOXP3 (FIG. 24A) and HELIOS (FIG. 24B) expression in Tag positive cells after 7 days of HLA-A2+PBMC stimulation and gating on Tag+CD3+CD4+.

[0262] FIGS. 26A-26D show screening and expression analysis for second-generation TRSPs. Expression levels for second-generation (G2) TRSPs were compared against the first-generation (Gl) TRSP AELS2 (measuring % Zsgreen expression in FIG. 26A and mean fluorescent intensity Zsgreen in FIG. 26B).

[0263] The Zsgreen fluorescent reporter protein was introduced into cells as part of a bicistronic reporter construct that also contains a mCherry transduction marker. A score for promoter activity was calculated by multiplying the percentage of transduced cells that express the fluorescent reporter protein (% mCherry +Zsgreen+ cells) by the mean fluorescence intensity (MFI) fold change for the fluorescent reporter protein expression.Score = % Zsgreen (in mCherry+) x Zsgreen MFI fold change)

[0264] MFI fold change is calculated by dividing the Zsgreen MFI in Zsgreen+mCherry+ cells by the Zsgreen MFI in mCherry+ cells of no promoter control.96MF-365941982Docket No.: 237752001140Zsgreen MFI fold chnage

[0265] Such a score can be calculated under the same conditions in both Treg cells and Teff cells, providing a “Treg score” and a “Teff score”.

[0266] FIG. 26C depicts an exemplary schematic of Treg and Teff score comparisons (calculated as shown above) to assess Treg specificity of candidate TRSPs. For example, a high Treg score and a low Teff score indicates a mostly Treg specific strong promoter; a low Treg score and a near-zero Teff score indicates a highly Treg specific but weak promoter.

[0267] All G2 promoters fell below the line of identity (as identified in FIG. 26C, between Treg score and Teff score) (FIG. 26D), indicating high Treg scores.

[0268] G2 top promoters also showed high Treg specificity and high strength (FIG. 27).The FACS plots show expression levels of Zsgreen and mCherry markers in cells transduced with the AELS2 first-generation promoter, an MSCV control, and the 2559, 2581, and 2633 second-generation TRSPs.

[0269] FIGS. 28A-28B depict that G2 promoters show high Treg specificity and range of strengths. FIG. 28A depicts MFI fold change in mCherry+ expression in Tregs for AELS2 compared to different second-generation TRSPs and an MSCV control. The left bars are for data collected on day 14; the right bars are for data collected on day 19. FIG. 28B depicts MFI fold change in mCherry+ expression in Teffs for AELS2 compared to different second-generation TRSPs and an MSCV control. The left bars are for data collected on day 14; the right bars are for data collected on day 19.

[0270] FIG. 29 depicts the top second-generation TRSP candidates ranked by Treg score, and the enrichment of four TREs (FOXP3, ELF1, TBX2Related, and AR). The top candidates are shorter in length than common promoters. The promoter lengths are shown on the right. As controls, the MSCV promoter is 412 base pairs in length and the MND promoter is 451 base pairs in length. The numbers shown in each row are the number of each TRE (labeled at the top) for each TRSP candidate (labeled on the left).

[0271] Overall, this data showed that the top second-generation TRSP candidates expressed proteins at even higher levels compared to the top first- generation TRSP candidate97MF-365941982Docket No.: 237752001140(AELS2). The second-generation candidates displayed a wide range of strength while maintaining Treg specificity.

[0272] As used herein, the following meanings apply unless otherwise specified. The words “can” and “may” are used in a permissive sense (i.e., meaning having the potential to), rather than the mandatory sense (i.e., meaning must). The words “include”, “including”, and “includes” and the like mean including, but not limited to. The singular forms “a,” “an,” and “the” include plural referents. Thus, for example, reference to “an element” includes a combination of two or more elements, notwithstanding use of other terms and phrases for one or more elements, such as “one or more.” The phrase “at least one” includes “one”, “one or more”, “one or a plurality”, and, therefore, contemplates the use of the term “a plurality”. The term “or” is, unless indicated otherwise, non-exclusive, i.e., encompassing both “and” and “or.” The term “any of’ between a modifier and a sequence means that the modifier modifies each member of the sequence. So, for example, the phrase “at least any of 1, 2 or 3” means “at least 1, at least 2, or at least 3”. The term “about” refers to a range that is 5% plus or minus from a stated numerical value within the context of the particular usage. The term "consisting essentially of" refers to the inclusion of recited elements and other elements that do not materially affect the basic and novel characteristics of a claimed combination.

[0273] It should be understood that the description and the drawings are not intended to limit the invention to the particular form disclosed, but to the contrary, the intention is to cover all modifications, equivalents, and alternatives falling within the spirit and scope of the present invention as defined by the appended claims. Further modifications and alternative embodiments of various aspects of the invention will be apparent to those skilled in the art in view of this description. Accordingly, this description and the drawings are to be construed as illustrative only and are for the purpose of teaching those skilled in the art the general manner of carrying out the invention. It is to be understood that the forms of the invention shown and described herein are to be taken as examples of embodiments. Elements and materials may be substituted for those illustrated and described herein, parts and processes may be reversed or omitted, and certain features of the invention may be utilized independently, all as would be apparent to one skilled in the art after having the benefit of this description of the invention. Changes may be made in the elements described herein without departing from the spirit and scope of the invention as described in the following claims.98MF-365941982

Claims

Docket No.: 237752001140CLAIMSWhat is claimed is:

1. A synthetic promoter that preferentially promotes transcription in Treg cells, comprising a plurality of transcription factor response elements (TREs) wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, wherein the TREs are operably linked to a core promoter.

2. The synthetic promoter of claim 1, wherein the plurality of TREs comprises a TRE recognized by FOXP3.

3. The synthetic promoter of claim 2, wherein the plurality of TREs comprises a TRE recognized by FOXP3 and a TRE recognized by ELF1.

4. The synthetic promoter of claim 3, wherein the plurality of TREs further comprises at least one TRE recognized by a transcription factor selected from the group consisting of SOX4, AR, and TBX2Related.

5. The synthetic promoter of claim 3 or 4, wherein the plurality of TREs further comprises at least one copy of at least one TRE recognized by a transcription factor selected from the group consisting of FOSL1, MAFK, and MAFG.

6. The synthetic promoter of claim 1 or 2, wherein the plurality of TREs comprises at least 1, at least 2, at least 3, or 4 TREs recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, and FOSL1.

7. The synthetic promoter of claim 6, wherein the plurality of TREs further comprises 1, 2, 3 or 4 TREs recognized by a transcription factor selected from the group consisting of AR, MAFK, TBX2Related, and MAFG.99MF-365941982Docket No.: 2377520011408. The synthetic promoter of claim 1, wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, or 8 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG.

9. A synthetic promoter that preferentially promotes transcription in Treg cells, comprising a plurality of transcription factor response elements (TREs), wherein each TRE in the plurality is recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG, wherein the TREs are operably linked to a core promoter.

10. The synthetic promoter of claim 1, wherein:SOX4 is present only if FOXP3 and AR are also present;TBX2Related is absent only if JUNBFRA is present;NKX3A and ATF3 are each present only if the other is present; orCEB PE, ETV5CEBPD_01, NFATC1 are each present only if the others are present.

11. The synthetic promoter of claim 1, comprising a TRE having a FOXP3 consensus sequence RTAAACA.

12. The synthetic promoter of claim 1, wherein the plurality of TREs comprises a TRE recognized by FOXP3.

13. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3 and ELFE14. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1 and AR.

15. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and TBX2Related.

16. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and MAFK.100MF-365941982Docket No.: 23775200114017. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and FOSL1.

18. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and MAFG.

19. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, TBX2Related and AR.

20. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally 4 copies), ELF1 (optionally 3 copies), TBX2Related (optionally 3 copies), AR (optionally 3 copies), SOX4, MAFK, and FOSL1.

21. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally 3 copies), ELF1, TBX2Related (optionally 3 copies), AR, SOX4 (optionally 2 copies), MAFK (optionally 2 copies), FOSL1, and MAFG.

22. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally 3 copies), ELF1 (optionally 6 copies), TBX2Related (optionally 3 copies), AR (optionally 2 copies), SOX4, MAFK (optionally 2 copies), and MAFG.

23. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and ELFE24. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and FOSL1.

25. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and AR.

26. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and MAFK.101MF-365941982Docket No.: 23775200114027. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and TBX2Related.

28. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and MAGF.

29. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1 (optionally in two copies), AR (optionally in two copies), JUNBFRA, ATF3, FOXP1, R0RA2 and NKX3A.

30. The synthetic promoter of claim 29, comprising, in 5’-to-3’ order, the TREs recognized by SOX4, ELF1, ATF3, FOXP1, RORA2, FOXP3, AR, NX3A, JUNBFRA2, AR, ELFE31. The synthetic promoter of claim 30, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mini and Avril.

32. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, FOSL1, AR, MAFK, TBX2Related, MAFG, JUNBFRA, IRF3, RARB and PEA3 (optionally in 2 or 3 copies).

33. The synthetic promoter of claim 32, comprising, in 5’-to-3’ order, the TREs recognized by FOSL1, SOX4, TBX2Related, JUNBFRA2, MAFK, IRF3, PEA3, PEA3, IRF3, AR, RARB, FOXP3, MAFG.

34. The synthetic promoter of claim 33, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mlul and Avril.

35. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1, AR (optionally in two or three copies), MAFK, TBX2Related, SOXIO, and PEA3.102MF-365941982Docket No.: 23775200114036. The synthetic promoter of claim 35, comprising, in 5’-to-3’ order, the TREs recognized by SOX4, SOXIO, AR, FOXP3, MAFK, PEA3, TBXRelated, EEF1, AR, AR.

37. The synthetic promoter of claim 36, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mini, Avril and AvrII_mut.

38. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, FOSL1 (optionally in two copies), MAFK, MEF2A (optionally in 2 or 3 copies), SOXIO, ATF3, AHRHIF, PAX3, NRF1.

39. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 (optionally in two copies), ELF1, FOSL1 (optionally in two copies), MAFG, PEA3, MEF2A, NKX3A, CEBPE, ETV5CEBPD_01, and SOX9.

40. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1, FOSL1, AR, FOXP1, and ATF3 (optionally in 2 copies).

41. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, MAFK (optionally in two copies), TBX2Related, MAFG (optionally in two copies), FOXP1, IRF3, CEBPE, ETV5CEBPD_01, and NFATC1.

42. The synthetic promoter of claim 1, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally in two copies), FOSL1, TBX2Related, MAFG (optionally in two copies), RORA2, and IRF3.

43. The synthetic promoter of any one of claims 1-42, comprising at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 different TREs.

44. The synthetic promoter of claim 43, comprising at least two copies of one or more of the TREs.103MF-365941982Docket No.: 23775200114045. The synthetic promoter of claim 44, wherein at least one TRE is duplicated and is selected from the group consisting of a TRE recognized by AR, FOXP3, MAFG, and EFL1 four JUNBFRA.

46. The synthetic promoter of claim 45, wherein the synthetic promoter comprises three copies of a TRE recognized by AR.

47. The synthetic promoter of any one of claims 1-46, wherein the number of unique TREs in the plurality is not more than any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

48. The synthetic promoter of any one of claims 1-47, comprising at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 10, or at most 20 TREs.

49. The synthetic promoter of any one of claims 1-46, wherein the number of unique TREs in the plurality is at least any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

50. The synthetic promoter of any one of claims 1-49, wherein the plurality of TREs span a range of no more than 400 nucleotides.

51. The synthetic promoter of any one of claims 1-50, wherein the plurality of TREs span a range of no more than 300 nucleotides, optionally between 100-300 nucleotides.

52. The synthetic promoter of any one of claims 1-50, wherein the plurality of TREs span a range of between 275 nucleotides and 375 nucleotides.

53. The synthetic promoter of any one of claims 1-50, comprising no more than 500, 400, 350, or 300 nucleotides.

54. The synthetic promoter of any one of claims 1-53, wherein the TREs, if present, comprise a consensus sequence of SOX4 (FIG. 7A; SEQ ID NO: 1); FOXP3 (FIG. 7B; SEQ ID NO: 2); AR (FIG. 7C; SEQ ID NO: 3); SOX10 (FIG. 7D; SEQ ID NO: 4); ELF1 (FIG.7E; SEQ ID NO: 5); TBX2Related (FIG. 7F; SEQ ID NO: 6); MAFK (FIG. 7G; SEQ ID 104MF-365941982Docket No.: 237752001140NO: 7); PEA3 (FIG.7H; SEQ ID NO: 8); ATF3 (FIG.71; SEQ ID NO: 7); FOXP1 (FIG.7J; SEQ ID NO: 10); RORA2 (FIG.7K; SEQ ID NO: 11); NKX3A (FIG.7L; SEQ ID NO: 12); JUNBFRA2 (FIG.7M; SEQ ID NO: 13); FOSL1 (FIG.7N; SEQ ID NO: 14); IRF3 (FIG. 70; SEQ ID NO: 15); RARB (FIG.7P; SEQ ID NO: 16); MAFG (FIG.7Q; SEQ ID NO: 17); MEF2A (FIG.7R; SEQ ID NO: 18); AHRHIF (FIG.7S; SEQ ID NO: 17); CEBPE (FIG. 7T; SEQ ID NO: 20); ETV5CEBPD (FIG.7U; SEQ ID NO: 21); PAX3 (FIG.7V; SEQ ID NO: 22); NRF1 (FIG.7W; SEQ ID NO: 23); SOX7 (FIG.7X; SEQ ID NO: 24); NFATC1 (FIG.7Y; SEQ ID NO: 25).

55. The synthetic promoter of any one of claims 1-54, wherein the TREs, if present, comprise a sequence selected from the group consisting of SEQ ID NO: 1 (SOX4), SEQ ID NO: 2 (FOXP3), SEQ ID NO: 3 (AR), SEQ ID NO: 4 (SOXIO), SEQ ID NO: 5 (ELF1), SEQ ID NO: 6 (TBX2Related), SEQ ID NO: 7 (MAFK), SEQ ID NO: 8 (PEA3), SEQ ID NO: 9 (ATF3), SEQ ID NO: 10 (FOXP1), SEQ ID NO: 11 (RORA2), SEQ ID NO: 12 (NKX3A), SEQ ID NO: 13 (JUNBFRA), SEQ ID NO: 14 (F0SL1), SEQ ID NO: 15 (IRF3), SEQ ID NO: 16 (RARB), SEQ ID NO: 17 (MAFG), SEQ ID NO: 18 (MEF2A), SEQ ID NO: 19 (AHRHIF), SEQ ID NO: 20 (CEBPE), SEQ ID NO: 21 (ETV5CEBPD_01), SEQ ID NO: 22 (PAX3), SEQ ID NO: 23 (NRF1), SEQ ID NO: 24 (SOX9), and SEQ ID NO: 25 (NFATC1).

56. The synthetic promoter of any one of claims 1-55, wherein the core promoter is selected from the group consisting of a core promoter of CTLA4, a core promoter of FOXP3, a core promoter of IL2RA, a core promoter of RGS1, a core promoter of IL1R2, CTLA4mp(91), CTLA4mp(118), FOXP3mp(82), FOXP3mp(117), IL2Ramp, RGSlmp, and ILlR2mpa.

57. The synthetic promoter of claim 56, wherein the core promoter is RGS1.

58. The synthetic promoter of any one of claims 1-57, wherein the synthetic promoter preferentially promotes expression in Treg cells by a factor of at least two times, three times, five times, ten times, 20 times or 50 times compared with Teff cells.

59. The synthetic promoter of any one of claims 1-57, wherein the synthetic promoter is active in Treg cells and inactive in Teff cells.105MF-365941982Docket No.: 23775200114060. The synthetic promoter of any one of claims 1-59, wherein the synthetic promoter comprises at least 1 TRE in a forward orientation and at least 1 TRE in a reverse orientation.

61. An expression construct, comprising the synthetic promoter of any one of claims 1-60, operably linked with a nucleotide sequence encoding a polypeptide.

62. The expression construct of claim 61, wherein the polypeptide comprises a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker.

63. The expression construct of claim 61, wherein the polypeptide comprises a chimeric antigen receptor, comprising, (i) a signal peptide, (ii) a target or antigen binding domain, (iii) a hinge region, (iv) a transmembrane domain, (v) a signal transduction domain, and (vi) a costimulatory domain.

64. The expression construct of claim 61, wherein the polypeptide comprises a chimeric antigen receptor that targets: AFP (alpha-fetoprotein), avP6 or another integrin, BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (deltalike protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma- associated antigen), IGF1R (insulinlike growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL- 13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A),106MF-365941982Docket No.: 237752001140Lewis Y, melanoma- associated antigen (MAGE)-Al, MAGE-A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma-associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes (e.g., HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1), NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME (preferentially expressed antigen of melanoma), progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen), PSMA (prostate specific membrane antigen), R0R1, ROR2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor-associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, or HPV.

65. The expression construct of claim 64, wherein the chimeric antigen receptor comprises a signal transduction domain that is an intracellular IL-2 receptor beta domain.

66. An expression vector, comprising:(a) the expression construct of any one of claims 61-65;(b) an origin of replication; and, optionally, one or more of(c) a selection marker;(d) a polyadenylation signal; or(e) a transcription terminator.

67. The expression vector of claim 66, comprising a viral vector, a plasmid, a bacterial artificial chromosome, a yeast artificial chromosome, a cosmid, a transposon, or a minicircle vector.

68. The expression vector of claim 66, comprising a viral vector selected from the group consisting of lentivirus, adenovirus, AAV, retrovirus, and vesicular stomatitis virus.

69. The expression vector of claim 66, encapsulated in a microvesicle, optionally wherein the microvesicle is a liposome.107MF-365941982Docket No.: 23775200114070. A cell transfected with the expression construct of any one of claims 61-65.

71. The transfected cell of claim 70, wherein the cell is a Treg cell.

72. The transfected cell of claim 71, wherein the cell displays the phenotype CD4+, CD25 high and CD 127 low.

73. The transfected cell of any one of claims 70-72, wherein the cell expresses a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker, under transcriptional control of the synthetic promoter.

74. A method of engineering a T cell comprising transfecting the T cell with the expression vector of any one of claims 66-69.

75. A pharmaceutical composition comprising the cell of any one of claims 70-73 and a pharmaceutically acceptable carrier.

76. A method for treating a Treg associated disorder comprising administering an effective amount of the composition of claim 75.

77. The method of claim 76, wherein the Treg associated disorder is selected from an autoimmune disease, an allergic condition, an inflammatory condition or a transplant rejection.

78. The method of claim 77, wherein the autoimmune disease is selected from the group consisting of type I diabetes, rheumatoid arthritis, systemic lupus erythematosus, celiac disease, psoriasis, myasthenia gravis, scleroderma, Addison disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis, pernicious anemia, reactive arthritis, and Sjogren syndrome.

79. A method of treating a pathological condition in a subject, comprising:(i) isolating T cells from a biological sample obtained from the subject;108MF-365941982Docket No.: 237752001140(ii) enriching the T cells for T regulatory cells (Treg);(iii) transfecting the enriched Treg cells with an expression vector of any one of claims 66-69;(iv) expanding the transfected Treg cells; and(v) administering the expanded Treg cells to the subject.

80. The method of claim 79, wherein the Treg cells are not sorted by cell surface marker expression.

81. The method of claim 79, wherein the administration is mucosal or parental.

82. The method of claim 81, wherein the administration is parenteral and the parenteral administration is selected from subcutaneous, intravenous, intraarterial, intramuscular or intrasynovial.

83. The method of any one of claims 79-82, wherein the pathological condition is selected from the group consisting of an autoimmune disease, an allergic condition, an inflammatory condition, and a transplant rejection.

84. A method of delivering a transgene to a subject, comprising administering to the subject the cell of any one of claims 70-73.

85. A nucleic acid molecule comprising a plurality of transcription factor response elements (TREs) wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, wherein the TREs, when operably linked to a core promoter, preferentially upregulate transcription in Treg cells.

86. A nucleic acid molecule comprising a plurality of transcription factor response elements (TREs), wherein each TRE in the plurality is recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK,109MF-365941982Docket No.: 237752001140TBX2Related, and MAFG, wherein the TREs, when operably linked to a core promoter, preferentially upregulate transcription in Treg cells.

87. The synthetic promoter of any one of claims 1-60, wherein the synthetic promoter has a Treg score and a Teff score, and the Treg score of the synthetic promoter is greater than the Teff score of the synthetic promoter.110MF-365941982

Images