Synthetic TREG specific promoters for TREG cell expansion

Abstract

The present disclosure relates to methods of manufacturing Treg cells, expanding Treg cells, and selectively enriching Treg cells. The methods of the present disclosure use synthetic Treg specific promoters that promote transcription in Treg cells and that comprise a plurality of transcription regulatory elements recognized by selected transcription factors.

Description

Docket No.: 237752002540SYNTHETIC TREG SPECIFIC PROMOTERS FOR TREG CELL EXPANSION CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority to and benefit of U.S. Provisional Application No.63 / 749,446, filed January 24, 2025, U.S. Provisional Application No. 63 / 803,526, filed May 9, 2025, and U.S. Provisional Application No. 63 / 888,987, filed September 26, 2025, the contents of each of which are incorporated herein by reference in their entireties.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The content of the electronic sequence listing (237752002540SeqList.xml; Size: 58,001 bytes; and Date of Creation: January 20, 2026) is herein incorporated by reference in its entirety.TECHNICAL FIELD

[0003] The present disclosure relates to methods of manufacturing Treg cells, expanding Treg cells, and selectively enriching Treg cells. The methods of the present disclosure use synthetic Treg specific promoters that promote transcription in Treg cells and that comprise a plurality of transcription regulatory elements recognized by selected transcription factors.BACKGROUND

[0004] The immune system plays a critical role in maintaining organismal homeostasis, poised between the elimination of foreign antigens and the self-tolerance of autoantigens. In particular, hyperactive immune dysregulation can lead to various autoimmune disorders (e.g., irritable bowel syndrome, systemic lupus erythematosus, alopecia areata, multiple sclerosis), which is often the result of overactive effector T lymphocytes or underactive regulatory T lymphocytes (i.e., Tregs). Current therapies for autoimmune diseases involve the administration of steroids, which can cause serious side-effects in patients and often offer little relief.

[0005] Regulatory T cells are a key player in the maintenance of organismal homeostasis to prevent the destruction of otherwise healthy tissues. Tregs are a unique subset of T cells that inhibit the cytotoxic or pro-inflammatory activity of effector CD4+ or effector CD8+ T cells. Tregs differentiate from the parent T lymphocyte lineage upon the upregulation of key Treg genes, in particular CD25 and FOXP3 (see, e.g., Chen, ML et al. (2005), Proc Natl Acad Sci USA 102(2):419-424; and Liu, VC et al. (2007), J Immunol 178(5):2883-2892, hereby incorporated by reference in their entirety). Upon T cell receptor (TCR) activation,1MF-365934147Docket No.: 237752002540these Tregs are responsible for directly suppressing effector T cell activity via cytokine production, e.g., TGF-P and IL-10 (see, e.g., Chen, J et al. (2019), Trends Mol Med 25(11): 1010-1023, hereby incorporated by reference in its entirety), and the engagement of immune checkpoint receptors, e.g., TIGIT- or CTLA-4-engagement (see, e.g., Knochelmann, HM et al. (2018), Cell Mol Immunol', 15(5):458-469, hereby incorporated by reference in its entirety). While effector T cells are able to produce the cytokine IL-2 upon TCR activation to support their own expansion, Treg cells are dependent upon exogenous IL-2 to promote Treg survival and maintenance, as Tregs are unable to produce their own IL-2. This biological mechanism ensures that Tregs are maintained in tissue niches that are enriched with active effector T cells, thus creating a cellular negative feedback mechanism whereby the increased IL-2 production by the target effector T cell promotes the expansion of the Tregs that then act to inhibit effector T cell activity and thus downstream inhibit their own expansion and survival (see, e.g., Shevyrev, D & Tereshchenko, V (2020), Front Immunol; 10:3100, 1-13). Targeting of the IL-2 receptor signaling pathway in Tregs is one area of interest in the effort to promote Treg cell maintenance and proliferation in order to develop therapies for immune-related disorders.

[0006] Numerous trials have shown the promise of Treg therapy as an alternative to immunosuppressive therapy. However, the development of Treg therapy is more challenging than conventional T cell therapy due to the limited Treg cell number in the blood, the stringency on cell purity, and the potential instability of Treg cells under certain circumstances. Expression of an antigen specific chimeric antigen receptor (“CAR”) or T cell receptor (“TCR”) on a few effector T-cells (Teff cells) contaminated in purified Treg cells at the beginning of cell production can cause detrimental effects in autoimmune disease treatment. More contamination of Teff cells in a Treg product can lead to a low-quality or even a forfeit product. Moreover, Treg cells may destabilize and convert into Teff like cells in an inflammatory microenvironment. When this occurs, the CAR / TCR modified Treg cells will attack the antigen positive tissue and release inflammatory cytokines, which could worsen an existing autoimmune condition.

[0007] FOXP3 is a gold standard biomarker for Treg cells. FOXP3 gene regulatory sequences extend across several thousand base pairs in the genome. Recently, endogenous regulatory elements from the promoter of this gene were rearranged and cloned into a lentiviral vector to control FOXP3 expression in a preclinical research for immune dysregulation, polyendocrinopathy, enteropathy, X-linked (IPEX). Masiuk et al., 2019, Cell2MF-365934147Docket No.: 237752002540Stem Cell 24: 309-317. However, while this suggests that synthetic promoters offer promise for rescue of Treg deficiency, the non-trivial expression in Teff means that their application for CAR-T gene therapy in Treg cells remains an unmet need.BRIEF SUMMARY

[0008] The present disclosure relates to methods of manufacturing, expanding, and selectively enriching Treg cells using synthetic promoters that selectively promote transcription in Treg cells.

[0009] In one aspect, provided herein is a method of manufacturing Treg cells, the method including: (a) isolating T cells from a biological sample; and (b) transfecting the cells with a polynucleotide vector including a synthetic promoter operably linked to a payload sequence, wherein: (i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and includes a plurality of transcription factor response elements (TREs) that are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOX10, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, and that are operably linked to a core promoter; and (ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability.

[0010] In another aspect, provided herein is a method of manufacturing Treg cells, the method including: (a) isolating T cells from a biological sample; and (b) transfecting the cells with a polynucleotide vector including a synthetic promoter operably linked to a payload sequence, wherein: (i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and includes a plurality of transcription factor response elements (TREs), wherein each TRE in the plurality is recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG, and wherein the plurality of TREs are operably linked to a core promoter; and (ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability.

[0011] In some embodiments of any of the preceding aspects, the method further includes enriching the T cells for Treg cells prior to transfecting the cells. In some embodiments, the3MF-365934147Docket No.: 237752002540method further includes expanding the Treg cells. In some embodiments, the Treg cell expansion is performed in the absence of exogenous IL-2.

[0012] In another aspect, provided herein is a method of selectively enriching Treg cells in a population of T cells, the population including Treg cells and Teff cells, the method including: (a) transfecting the cells with a polynucleotide vector including a synthetic promoter operably linked to a payload sequence, wherein: (i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and includes a plurality of transcription factor response elements (TREs) that are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, and that are operably linked to a core promoter; and (ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability; and (b) culturing the cells.

[0013] In one aspect, provided herein is a method of selectively enriching Treg cells in a population of T cells, the population including Treg cells and Teff cells, the method including: (a) transfecting the cells with a polynucleotide vector including a synthetic promoter operably linked to a payload sequence, wherein: (i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and includes a plurality of transcription factor response elements (TREs), wherein each TRE in the plurality is recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG, and wherein the plurality of TREs are operably linked to a core promoter; and (ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability; and (b) culturing the cells.

[0014] In some embodiments of any of the preceding aspects, step (b) is performed in the absence of exogenous IL-2. In some embodiments, the cells are not sorted by cell surface marker expression. In some embodiments, the transfected Treg cells proliferate at an increased rate compared to Treg cells lacking the polynucleotide vector or cells other than Treg cells transfected with the polynucleotide vector. In some embodiments, the rate of proliferation is increased by about two-fold, about three-fold, about four-fold, or about fivefold. In some embodiments, the method includes a reduced risk of Teff cell contamination as 4MF-365934147Docket No.: 237752002540compared to a method performed without the polynucleotide vector. In some embodiments, the Treg cells maintain expression of least one Treg marker selected from the group consisting of CD4+, CD25+, and CD 127 lo. In some embodiments, the method further includes using anti-CD3 / CD28 coated beads, wherein the anti-CD3 / CD28 coated beads activate the Treg cells. In some embodiments, the synthetic promoter promotes transcription of the payload sequence in Treg cells by a factor of at least two times, three times, five times, ten times, 20 times or 50 times more as compared to transcription of the payload sequence in Teff cells.

[0015] In some embodiments of any of the preceding aspects, the polypeptide encoded by the payload sequence increases IL-2 availability, IL-2 secretion, IL-2 signaling, and / or IL-2 expression. In some embodiments, the polypeptide encoded by the payload sequence reduces pro-inflammatory cytokine availability. In some embodiments, the polypeptide encoded by the payload sequence increases TGF-P availability.

[0016] In some embodiments of any of the preceding aspects, the polypeptide encoded by the payload sequence includes an IL-2 cytokine. In some embodiments, the IL-2 cytokine includes one or more amino acid substitutions that alters affinity for one or more receptors, as compared to an IL-2 cytokine lacking the one or more amino acid substitutions.

[0017] In some embodiments of any of the preceding aspects, the polypeptide encoded by the payload sequence includes a chimeric antigen receptor (CAR) including: an antigenbinding domain, a first linker, an antibody-inducible domain, a transmembrane domain, and an intracellular signaling domain, wherein the antibody-inducible domain is a polypeptide of from about 60 to about 360 amino acids in length. In some embodiments, the method further includes providing an antibody to the cells, wherein the antibody binds to the antibodyinducible domain. In some embodiments, a T cell in which the CAR is expressed is activatable upon binding of the antibody to the antibody-inducible domain. In some embodiments, the method further includes providing to the cells IL-2. In some embodiments, the antibody-inducible domain includes a domain selected from the group consisting of a vascular endothelial growth factor receptor 2 (VEGFR2) domain, a human epidermal growth factor receptor 2 (HER2) domain, a platelet-derived growth factor receptor- alpha (PDGFRa) domain, an interleukin-4 receptor-alpha (IL-4Ra) domain, a CD4 domain, and a CD2 domain. In some embodiments, the antibody-inducible domain includes a VEGFR2 domain, wherein the VEGFR2 domain is bindable by an anti-VEGFR2 antibody or VEGFR2-binding fragment thereof selected from the group consisting of ramucirumab and alacizumab, and 5MF-365934147Docket No.: 237752002540optionally wherein the VEGFR2 domain is bindable by ramucirumab. In some embodiments, the antibody-inducible domain includes a HER2 domain, wherein the HER2 domain is bindable by an anti-HER2 antibody or HER2-binding fragment thereof selected from the group consisting of trastuzumab, margetuximab, pertuzumab, and timigutuzumab, and optionally wherein the HER2 domain is bindable by trastuzumab. In some embodiments, the antibody-inducible domain includes a PDGFRa domain, wherein the PDGFRa domain is bindable by an anti-PDGFRa antibody or PDGFRa-binding fragment thereof selected from the group consisting of olaratumab and tovetumab. In some embodiments, the antibodyinducible domain includes an IL-4Ra domain, and wherein the IL-4Ra domain is bindable by an anti-IL-4Ra antibody or IL-4Ra-binding fragment thereof selected from the group consisting of dupilumab and pascolizumab. In some embodiments, the antibody-inducible domain includes a CD4 domain, and wherein the CD4 domain is bindable by an anti-CD4 antibody or CD4-binding fragment thereof selected from the group consisting of cedelizumab, clenoliximab, ibalizumab, keliximab, priliximab, tregalizumab, zanolimumab, and semzuvolimab. In some embodiments, the antibody-inducible domain includes a CD2 domain, and wherein the CD2 domain is bindable by an anti-CD2 antibody or CD2-binding fragment thereof, wherein the anti-CD2-antibody is siplizumab.

[0018] In some embodiments of any of the preceding aspects, the polypeptide encoded by the payload sequence includes a cytokine receptor including: an extracellular cytokine receptor domain, a transmembrane domain, and an intracellular IL-2 receptor beta chain domain, wherein the extracellular cytokine receptor domain binds to a cytokine other than IL-2. In some embodiments, the cytokine other than IL-2 that binds to the extracellular cytokine receptor domain activates intracellular IL-2 signaling in a T cell expressing the cytokine receptor. In some embodiments, the method further includes providing to the cells the cytokine other than IL-2 that binds to the extracellular cytokine receptor domain. In some embodiments, the method further includes culturing the cells in a composition including the cytokine other than IL-2. In some embodiments, the extracellular cytokine receptor domain is not tethered to the cytokine. In some embodiments, the extracellular cytokine receptor domain is tethered to the cytokine, optionally wherein the extracellular cytokine receptor domain is selected from the group consisting of an IL-4 extracellular domain, an IL-7 extracellular domain, an IL-9 extracellular domain, and an IL-21 extracellular domain. In some embodiments, the transmembrane domain is a transmembrane domain of an IL-9 receptor, an IL-2 receptor, an IL-4 receptor, an IL-7 receptor, or an IL-21 receptor. In some6MF-365934147Docket No.: 237752002540embodiments, the transmembrane domain and the extracellular cytokine receptor domain are from the same cytokine receptor.

[0019] In some embodiments of any of the preceding aspects, the polypeptide encoded by the payload sequence includes a cytokine receptor including: an IL-2 cytokine; an IL-2 receptor beta extracellular domain; a transmembrane domain; and an IL-2 receptor beta intracellular domain; wherein the IL-2 receptor beta extracellular domain is tethered to the IL-2 cytokine by a polypeptide linker. In some embodiments, a T cell expressing the cytokine receptor engages in IL-2 signaling in the absence of exogenous IL-2. In some embodiments, the cytokine receptor forms a protein complex with IL-2Ry. In some embodiments, the IL-2 cytokine includes at least one amino acid substitution that reduces affinity for IL-2Ra and / or IL-2Ry. In some embodiments, the cytokine receptor does not activate IL-2 signaling on a cell that does not express the cytokine receptor. In some embodiments, the cytokine receptor does not activate signaling of an IL-2 receptor including a different amino acid sequence.

[0020] In some embodiments of any of the preceding aspects, the polypeptide encoded by the payload sequence includes an inducible receptor that activates intracellular IL-2 signaling upon binding of a small molecule. In some embodiments, the small molecule is rapamycin. In some embodiments, the polypeptide encoded by the payload sequence includes a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker. In some embodiments, the polypeptide includes a chimeric antigen receptor with a target selected from the group consisting of AFP (alpha-fetoprotein), avP6 or another integrin, BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (delta-like protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular7MF-365934147Docket No.: 237752002540weight-melanoma-associated antigen), IGF1R (insulin-like growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL-13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A), Lewis Y, melanoma-associated antigen (MAGE)-Al, MAGE-A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma-associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes, optionally HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1, NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME, optionally expressed antigen of melanoma, progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen), PSMA (prostate specific membrane antigen), R0R1, R0R2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor-associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, or HPV.

[0021] In some embodiments of any of the preceding aspects, the plurality of TREs includes a TRE recognized by FOXP3. In some embodiments, the plurality of TREs includes a TRE recognized by FOXP3 and a TRE recognized by ELFL In some embodiments, the plurality of TREs further includes at least one TRE recognized by a transcription factor selected from the group consisting of SOX4, AR, and TBX2Related. In some embodiments, the plurality of TREs further includes at least one copy of at least one TRE recognized by a transcription factor selected from the group consisting of FOSL1, MAFK, and MAFG. In some embodiments, the plurality of TREs includes at least 1, at least 2, at least 3, or 4 TREs recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, and FOSLL In some embodiments, the plurality of TREs includes 1, 2, 3 or 4 TREs recognized by a transcription factor selected from the group consisting of AR, MAFK, TBX2Related, and MAFG. In some embodiments, the TREs are recognized by at least 4, at least 5, at least 6, at least 7, or 8 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG. In some embodiments, SOX4 is present only if FOXP3 and AR are also present; TBX2Related is absent only if JUNBFRA is present; NKX3A and ATF3 are each present only if the other is present; or CEB PE, ETV5CEBPD_01, NFATC1 are each present only if the others are8MF-365934147Docket No.: 237752002540present. In some embodiments, the synthetic promoter includes a TRE having a FOXP3 consensus sequence RTAAACA. In some embodiments, the plurality of TREs includes a TRE recognized by FOXP3. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3 and ELFE In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1 and AR. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, and TBX2Related. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, and MAFK. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, and FOSL1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, and MAFG. In some embodiments, the plurality of TREs includes des TREs recognized by FOXP3, ELF1, TBX2Related and AR. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, TBX2Related, AR, SOX4, MAFK and FOSL1. In some embodiments, the plurality of TREs includes 4 copies of TREs recognized by FOXP3. In some embodiments, the plurality of TREs includes 3 copies of TREs recognized by ELF1. In some embodiments, the plurality of TREs includes 3 copies of TREs recognized by TBX2Related. In some embodiments, the plurality of TREs includes 3 copies of AR. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3 (optionally 3 copies), ELF1, TBX2Related (optionally 3 copies), AR, SOX4 (optionally 2 copies), MAFK (optionally 2 copies), FOSL1, and MAFG. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3 (optionally 3 copies), ELF1 (optionally 6 copies), TBX2Related (optionally 3 copies), AR (optionally 2 copies), SOX4, MAFK (optionally 2 copies), and MAFG. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and ELF1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and FOSL1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and AR. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and MAFK. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and TBX2Related. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 and MAGF. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4, ELF1 (optionally in two copies), AR (optionally in two copies), JUNBFRA, ATF3, FOXP1, R0RA2 and NKX3A. In some embodiments, the synthetic promoter includes, in 5'-to-3' order, the TREs recognized by SOX4, ELF1, ATF3, FOXP1, R0RA2, FOXP3, AR, NX3A, JUNBFRA2, AR, ELF1. In some embodiments, the synthetic promoter further includes restriction enzyme cleavage sites Mlul and Avril. In some embodiments, the9MF-365934147Docket No.: 237752002540plurality of TREs includes TREs recognized by FOXP3, SOX4, FOSL1, AR, MAFK, TBX2Related, MAFG, JUNBFRA, IRF3, RARB and PEA3 (optionally in 2 or 3 copies). In some embodiments, the synthetic promoter includes, in 5'-to-3' order, the TREs recognized by FOSL1, SOX4, TBX2Related, JUNBFRA2, MAFK, IRF3, PEA3, PEA3, IRF3, AR, RARB, FOXP3, MAFG. In some embodiments, the synthetic promoter further includes restriction enzyme cleavage sites Mlul and Avril. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4, ELF1, AR (optionally in two or three copies), MAFK, TBX2Related, SOXIO, and PEA3. In some embodiments, the synthetic promoter includes, in 5'-to-3' order, the TREs recognized by SOX4, SOXIO, AR, FOXP3, MAFK, PEA3, TBXRelated, ELF1, AR, AR. In some embodiments, the synthetic promoter further includes restriction enzyme cleavage sites Mlul, Avril and AvrII_mut. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4, FOSL1 (optionally in two copies), MAFK, MEF2A (optionally in 2 or 3 copies), SOXIO, ATF3, AHRHIF, PAX3, NRF1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4 (optionally in two copies), ELF1, FOSL1 (optionally in two copies), MAFG, PEA3, MEF2A, NKX3A, CEBPE, ETV5CEBPD_01, and SOX9. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, SOX4, ELF1, FOSL1, AR, FOXP1, and ATF3 (optionally in 2 copies). In some embodiments, the plurality of TREs includes TREs recognized by FOXP3, ELF1, MAFK (optionally in two copies), TBX2Related, MAFG (optionally in two copies), FOXP1, IRF3, CEBPE, ETV5CEBPD_01, and NFATC1. In some embodiments, the plurality of TREs includes TREs recognized by FOXP3 (optionally in two copies), FOSL1, TBX2Related, MAFG (optionally in two copies), RORA2, and IRF3. In some embodiments, the synthetic promoter includes at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 different TREs. In some embodiments, the synthetic promoter includes at least two copies of one or more of the TREs. In some embodiments, at least one TRE is duplicated and is selected from the group consisting of a TRE recognized by AR, FOXP3, MAFG, and EFL1 four JUNBFRA. In some embodiments, the synthetic promoter comprises three copies of a TRE recognized by AR. In some embodiments, the number of unique TREs in the plurality is not more than any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, the synthetic promoter includes at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 10, or at most 20 TREs. In some embodiments, the at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at 10MF-365934147Docket No.: 237752002540most 16, at most 17, at most 18, at most 10, or at most 20 TREs are unique TREs. In some embodiments, the at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 10, or at most 20 TREs are non-unique TREs. In some embodiments, the number of unique TREs in the plurality is at least any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20. In some embodiments, the plurality of TREs span a range of no more than 400 nucleotides. In some embodiments, the plurality of TREs span a range of no more than 300 nucleotides, optionally between 100-300 nucleotides. In some embodiments, the plurality of TREs span a range of between 275 nucleotides and 375 nucleotides. In some embodiments, the synthetic promoter includes no more than any of 500, 400, 350, or 300 nucleotides. In some embodiments, the TREs, if present, include a consensus sequence of SOX4 (FIG. 7A; SEQ ID NO: 1); FOXP3 (FIG. 7B; SEQ ID NO: 2); AR (FIG. 7C; SEQ ID NO: 3); SOX10 (FIG.7D; SEQ ID NO: 4); ELF1 (FIG. 7E; SEQ ID NO: 5); TBX2Related (FIG. 7F; SEQ ID NO: 6); MAFK (FIG. 7G; SEQ ID NO: 7); PEA3 (FIG. 7H; SEQ ID NO: 8); ATF3 (FIG. 71; SEQ ID NO: 7); FOXP1 (FIG. 7J; SEQ ID NO: 10); RORA2 (FIG. 7K; SEQ ID NO: 11); NKX3A (FIG. 7L; SEQ ID NO: 12); JUNBFRA2 (FIG. 7M; SEQ ID NO: 13); FOSL1 (FIG. 7N; SEQ ID NO: 14); IRF3 (FIG. 70; SEQ ID NO: 15); RARB (FIG. 7P; SEQ ID NO: 16); MAFG (FIG. 7Q; SEQ ID NO: 17); MEF2A (FIG. 7R; SEQ ID NO: 18); AHRHIF (FIG. 7S; SEQ ID NO: 17); CEBPE (FIG. 7T; SEQ ID NO: 20); ETV5CEBPD (FIG. 7U;SEQ ID NO: 21); PAX3 (FIG. 7V; SEQ ID NO: 22); NRF1 (FIG. 7W; SEQ ID NO: 23); SOX7 (FIG. 7X; SEQ ID NO: 24); NFATC1 (FIG. 7Y; SEQ ID NO: 25). In some embodiments, the TREs, if present, include a sequence selected from the group consisting of SEQ ID NO: 1 (SOX4), SEQ ID NO: 2 (FOXP3), SEQ ID NO: 3 (AR), SEQ ID NO: 4 (SOX10), SEQ ID NO: 5 (ELF1), SEQ ID NO: 6 (TBX2Related), SEQ ID NO: 7 (MAFK), SEQ ID NO: 8 (PEA3), SEQ ID NO: 9 (ATF3), SEQ ID NO: 10 (FOXP1), SEQ ID NO: 11 (RORA2), SEQ ID NO: 12 (NKX3A), SEQ ID NO: 13 (JUNBFRA), SEQ ID NO: 14 (FOSL1), SEQ ID NO: 15 (IRF3), SEQ ID NO: 16 (RARB), SEQ ID NO: 17 (MAFG), SEQ ID NO: 18 (MEF2A), SEQ ID NO: 19 (AHRHIF), SEQ ID NO: 20 (CEBPE), SEQ ID NO: 21 (ETV5CEBPD_01), SEQ ID NO: 22 (PAX3), SEQ ID NO: 23 (NRF1), SEQ ID NO: 24 (SOX9), and SEQ ID NO: 25 (NFATC1). In some embodiments, the core promoter is selected from the group consisting of a core promoter of CTLA4, FOXP3, IL2RA, RGS1, and IL1R2, optionally wherein the CTLA4 core promoter is CTLA4mp(91) or CTLA4mp(118), the FOXP3 core promoter is FOXP3mp(82) or FOXP3mp(117), the IL2RA core promoter is IL2Ramp, the RGS1 core promoter is RGSlmp, and the IL1R2 promoter is 11MF-365934147Docket No.: 237752002540ILlR2mp. In some embodiments, the core promoter is RGS1. In some embodiments, the synthetic promoter is active in Treg cells and inactive in Teff cells. In some embodiments, the synthetic promoter includes at least 1 TRE in a forward orientation and at least 1 TRE in a reverse orientation. In some embodiments of any of the preceding aspects, the synthetic promoter has a Treg score and a Teff score, and the Treg score of the synthetic promoter is greater than the Teff score of the synthetic promoter.BRIEF DESCRIPTION OF THE DRAWINGS

[0022] The accompanying drawings, which are incorporated herein and form a part of the specification, illustrate exemplary embodiments and, together with the description, further serve to enable a person skilled in the pertinent art to make and use these embodiments and others that will be apparent to those skilled in the art.

[0023] FIG. 1 is an exemplary schematic of the synthetic Treg specific promoters (TRSPs) of the present disclosure.

[0024] FIG. 2 shows the TRE assembly of three exemplary synthetic promoters: AELS2, AS4, and AS24.

[0025] FIGS. 3A-3B show expression in Treg and Teff cells of a CAR regulated by synthetic promoters of this disclosure (AS4, AS24, AELS2) compared to expression regulated by CNS123p promoter. FIG. 3A depicts %CAR = % of cells in the population expressing the CAR. FIG. 3B depicts MFI = mean fluorescent intensity.

[0026] FIG. 4 shows a histogram of CAR expression using select synthetic promoters of the present disclosure in Treg and Teff cells on day 7, after the first stimulation by Dynabeads™ Human Treg Expander (ThermoFisher).

[0027] FIG. 5 shows a histogram of CAR expression using select synthetic promoters of the present disclosure in Treg and Teff cells on day 11, which is 2 days after the second stimulation by Dynabeads™ Human Treg Expander (ThermoFisher).

[0028] FIG. 6 shows a histogram of CAR expression using select synthetic promoters of the present disclosure in Treg and Teff cells on day 14.

[0029] FIGS. 7A-7Y show consensus sequences of various TREs: SOX4 (FIG. 7A; SEQ ID NO: 1); FOXP3 (FIG. 7B; SEQ ID NO: 2); AR (FIG. 7C; SEQ ID NO: 3); SOX10 (FIG.7D; SEQ ID NO: 4); ELF1 (FIG. 7E; SEQ ID NO: 5); TBX2Related (FIG. 7F; SEQ ID NO: 6); MAFK (FIG. 7G; SEQ ID NO: 7); PEA3 (FIG. 7H; SEQ ID NO: 8); ATF3 (FIG. 71;12MF-365934147Docket No.: 237752002540SEQ ID NO: 7); FOXP1 (FIG. 7J; SEQ ID NO: 10); RORA2 (FIG. 7K; SEQ ID NO: 11); NKX3A (FIG. 7L; SEQ ID NO: 12); JUNBFRA2 (FIG. 7M; SEQ ID NO: 13); FOSL1 (FIG. 7N; SEQ ID NO: 14); IRF3 (FIG. 70; SEQ ID NO: 15); RARB (FIG. 7P; SEQ ID NO: 16); MAFG (FIG. 7Q; SEQ ID NO: 17); MEF2A (FIG. 7R; SEQ ID NO: 18); AHRHIF (FIG. 7S; SEQ ID NO: 17); CEBPE (FIG. 7T; SEQ ID NO: 20); ETV5CEBPD (FIG. 7U;SEQ ID NO: 21); PAX3 (FIG. 7V; SEQ ID NO: 22); NRF1 (FIG. 7W; SEQ ID NO: 23); SOX7 (FIG. 7X; SEQ ID NO: 24); NFATC1 (FIG. 7Y; SEQ ID NO: 25). N= any nucleotide (A, T, C, G). R=purine (A, G). Y=pyrimidine (T or C). S=G or C. W=A or T. K=G or T. M=A or C. B=C, G, T. D=A, G, T. H=A, C, T. V=A, C, G.

[0030] FIG. 8 shows AELS2 (a first generation TRSP “TRSP1”) and MND (myeloproliferative sarcoma virus enhancer, negative control region deleted, dl587rev promoter) regulated gene expression in primary Tregs and Teffs. Zsgreen is in the bi-cistronic reporter lentiviral construct comprising Zsgreen and mCherry genes, and gated on mCherry+ cells. The CAR is in a single promoter lentiviral vector.

[0031] FIGS. 9A-9C depict expression of a CAR in Tregs mediated by TRSP1. FIG. 9A shows that TRSP1 enhances day 14 Treg product quality by expressing a CAR in Tregs, while minimizing expression in Teff cells and destabilized Treg cells. FIG. 9B shows an in vitro stress model used to compare the TRSP1 and MND promoters. This model consisted of mixed Tregs and Teffs, along with a high-tonic CAR for disrupting Treg stability. FIG. 9C shows CAR positive cells under the TRSP1 promoter have a better Treg phenotype defined by FOXP3 and Helios expression.

[0032] FIGS. 10A-10B depict stability of the Treg phenotype compared between TRSP-CAR Tregs and MND-CAR Tregs. FIG. 10A shows that TRSP-CAR Tregs maintained a more stable phenotype under inflammatory conditions compared to MND-CAR Tregs. The day 14 CAR-Treg product was stimulated through CAR or TCR and cultured in a supraphysiological cytokine condition containing IL2, IL6, ILip, and IL23. FIG. 10B shows the phenotype of the CAR+ cells compared between TRSP and MND promoters 7 days post the second stimulation.

[0033] FIGS. 11A-11B show a CAR-mediated Treg suppression assay and cytokine profile. FIG. 11A depicts results of a CAR specific suppression assay. The proliferation of cultured Teffs in the presence of CAR-Tregs at different ratios is shown, measured by flow-13MF-365934147Docket No.: 237752002540based CFSE dilution. FIG. 11B depicts cytokines from the supernatant of the suppression assay measured by Luminex. (UT = Untransduced.)

[0034] FIGS. 12A-12D depict the function of a TRSP as a safety switch, restricting the survival signal from a tethered switch receptor (SR) to Tregs, but not Teffs. FIG. 12A depicts an IL-X / IL-2RP cytokine receptor diagram and downstream STAT5 signaling, where X is, for example, 2, 4, 7, 9, or 21; thus, the IL extracellular domain and transmembrane domain can be from any of IL-2, IL-4, IL-7, IL-9, and IL-21. FIG. 12B depicts the fold expansion of Teff cell products after day 14 in the absence of IL-2, with the exception of the control group.FIG. 12C depicts the fold expansion of Treg cell products after day 14 in the absence of IL-2, with the exception of the control group. FIG. 12D depicts enrichment of Tag-positive Tregs transduced with SR-Tag under MND or TRSP.

[0035] FIG. 13 depicts the promoter activity of second generation TRSPs (“G2TRSP”). The second generation TRSPs demonstrated stronger promoter activity compared to the top candidate from the first generation TRSPs (“TRSP1”).

[0036] FIGS. 14A-14B depict constructs and a workflow for testing TRSP-IL2TRB expression. FIG. 14A depicts exemplary constructs for use in the present methods, with a TRSP or MND promoter, a cytokine receptor payload sequence (switch receptor “SR” (i.e., a cytokine receptor comprising an extracellular cytokine receptor domain, a transmembrane domain, and an intracellular IL-2 receptor beta chain domain, wherein the extracellular cytokine receptor domain binds to a cytokine other than IL-2); an IL-2 tethered receptor “IL2TRB” (i.e., a cytokine receptor comprising an IL-2 cytokine molecule tethered to the IL-2 receptor beta (IL-2RP) extracellular domain)), the P2A self-cleaving peptide, and an IL5Ra tag. FIG. 14B depicts a workflow for a sort-free platform for Treg cell expansion using CD25 enriched cells transduced with a TRSP linked to a cytokine receptor payload sequence.

[0037] FIG. 15 is a FACS plot showing a comparison of first and second generation TRSPs and expression levels of SR and IL5Ra tag markers. Second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214) exhibited stronger expression of payload sequences (switch receptor “SR”) compared with a first generation TRSP (TRSP1) in the day 14 product.

[0038] FIG. 16 is a FACS plot showing a comparison of first and second generation TRSPs and expression levels of the FOXP3 and HELIOS markers. Cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214) (TRSP-SR14MF-365934147Docket No.: 237752002540payload) showed a stronger FOXP3 / HELIOS phenotype than cells transduced with the first generation TRSP (TRSP1-SR) and cells transduced with MND-SR.

[0039] FIG. 17 is a graph quantifying the percentage of FOXP3 in IL5Ra tag-positive cells transduced with various constructs comprising the MND promoter as compared to the same transduced with second generation TRSPs (233, 70, 238, 285, 204, 217, 214, 183, 50, 276) and a first generation TRSP (TRSP1).

[0040] FIG. 18 is a FACS plot showing expression levels of CD4 and CD3 markers in cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214), a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-tag only + IL2), or untransduced cells with IL-2. The payload used in these experiments was IL2TRB. After gating for live cells, the day 14 products exhibited a mild degree of heterogeneity.

[0041] FIG. 19 is a FACS plot showing expression levels of CD4 and CD3 markers in cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214), a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-tag only + IL2), or untransduced cells with IL-2. The payload used in these experiments was IL2TRB. After gating for IL5Ra tag-positive cells, the day 14 products were mainly CD4+.

[0042] FIG. 20 is a FACS plot showing expression levels of IL-2 and IL5Ra tag markers in cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214), a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-tag only + IL2), or untransduced cells with IL-2. The payload used in these experiments was IL2TRB. The second generation TRSPs exhibited strong expression of the payload on day 14.

[0043] FIG. 21 is a graph showing high enrichment of IL5Ra tag-positive cells under IL-2-free culture conditions on days 7 and 14 after transduction with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214) as compared to a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-IL5Ra tag).

[0044] FIGS. 22A-22B depict a stronger FOXP3 / HELIOS phenotype in TRSP-IL2TRB transduced cells compared to MND and MSCV controls. FIG. 22A is a FACS plot showing expression levels of HELIOS and FOXP3 markers in cells transduced with second generation TRSPs (238, 204, 285, 70, 276, 217, 183, 50, 233, 214), a first generation TRSP1 (AELS2), control promoters (MND, MSCV, MND-tag only + IL2), or untransduced cells with IL-2. After gating for tag-positive cells, the day 14 products exhibited a strong FOXP3 / HELIOS15MF-365934147Docket No.: 237752002540phenotype for cells transduced with certain second generation TRSPs. FIG. 22B depicts the percentage of cells in the population expressing FOXP3 against mean fluorescent intensity.

[0045] FIGS. 23A-23C depict activation assay results of Tregs transduced with TRSP regulated HLA-A2CAR and stimulated by HLA-A2+PBMCs. FIG. 23A depicts a timeline of the activation assay and the TRSP regulated HLA-A2CAR construct used for transducing the Tregs. FIG. 23B depicts proliferation of Treg cells transduced with different TRSPs (TRSP1, TRSP4, TRSP5, TRSP6, TRSP10) after gating on Tag+CD3+CD4+. FIG. 23C depicts Tag+ expression in Treg cells transduced with different TRSPs (TRSP1, TRSP4, TRSP5, TRSP6, TRSP 10) after gating on CD3+CD4+.

[0046] FIGS. 24A-24B depict FOXP3 (FIG. 24A) and HELIOS (FIG. 24B) expression in Tag positive cells after 7 days of HLA-A2+PBMC stimulation and gating on Tag+CD3+CD4+.

[0047] FIGS. 25A-25C depict that MND-IL2TRB variants support Teff cell expansion in the absence of IL2, and that AELS2-IL2TRB variants do not. FIG. 25A depicts Teff cell expansion after day 14 following transduction with different promoter- IL2TRB variant constructs. FIG. 25B depicts Treg cell expansion after day 14 following transduction with different promoter- IL2TRB variant constructs. FIG. 25C depicts the fold expansion ratio for Teff cells to Treg cells for MND and AELS2 promoter- IL2TRB variant constructs. Results are shown for three different donors in three independent experiments.

[0048] FIG. 26 depicts differential CAR expression in Treg and Teff cells for AELS2 as compared to MND.

[0049] FIGS. 27A-27D show screening and expression analysis for second-generation TRSPs. Expression levels for second-generation (G2) TRSPs were compared against the first-generation (Gl) TRSP AELS2 (measuring % Zsgreen expression in FIG. 27A and mean fluorescent intensity Zsgreen in FIG. 27B). FIG. 27C depicts an exemplary schematic of Treg and Teff score comparisons to assess Treg specificity of candidate TRSPs. FIG. 27D depicts that all G2 promoters fell below the line of identity (as shown in FIG. 27C), indicating high Treg scores.

[0050] FIG. 28 depicts that G2 top promoters show high Treg specificity and high strength. The FACS plots show expression levels of Zsgreen and mCherry markers in cells transduced with the AELS2 first- generation promoter, an MSCV control, and the 2559, 2581, and 2633 second-generation TRSPs.16MF-365934147Docket No.: 237752002540

[0051] FIGS. 29A-29B depict that G2 promoters show high Treg specificity and range of strengths. FIG. 29A depicts MFI fold change in mCherry+ expression in Tregs for AELS2 compared to different second-generation TRSPs and an MSCV control. The left bars are for data collected on day 14; the right bars are for data collected on day 19. FIG. 29B depicts MFI fold change in mCherry+ expression in Teffs for AELS2 compared to different second-generation TRSPs and an MSCV control. The left bars are for data collected on day 14; the right bars are for data collected on day 19.

[0052] FIG. 30 depicts the top second-generation TRSP candidates ranked by Treg score, and the enrichment of four TREs (FOXP3, ELF1, TBX2Related, and AR). The top candidates are shorter in length than common promoters. The numbers shown in each row are the number of each TRE (labeled at the top) for each TRSP candidate (labeled on the left). The promoter lengths are shown on the right.DETAILED DESCRIPTION

[0053] The following description sets forth exemplary methods, parameters, and the like. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure but is instead provided as a description of exemplary embodiments.

[0054] Successful adoptive cell therapy requires a robust expansion and persistence of administered cells. Provided herein are methods of manufacturing and expanding Treg cells in which Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability may be enhanced by the introduction of synthetic Treg specific promoters (TRSPs) into Treg cells. The Treg specific promoters of the present disclosure may be used to selectively promote transcription of certain payload sequences in Treg cells compared to non-Treg cells. Treg cells comprising the synthetic promoters and payload sequences of the present disclosure may be used as a cell therapy to treat, for example, autoimmune disorders. The methods described herein may be used to manufacture, selectively enrich, and / or expand Treg cells. The present methods may reduce the complexity of typical Treg manufacturing by eliminating the need to purify Treg cells, reducing the risk of contamination with Teff cells, and / or reducing the need for exogenous IL-2 cytokine supplementation in culture.

[0055] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described.17MF-365934147Docket No.: 237752002540Definitions

[0056] It is appreciated that certain features of the disclosure, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the disclosure, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments pertaining to particular method steps, reagents, or conditions are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed.

[0057] As used herein and in the appended claims, the singular forms “a,” “an,” and “the” include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only,” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

[0058] Reference to “about” a value or parameter herein refers to the usual error range for the respective value readily known to the skilled person in this technical field. Reference to “about” a value or parameter herein includes (and describes) aspects that are directed to that value or parameter per se. For example, description referring to “about X” includes description of “X”.

[0059] The term “and / or” where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term “and / or” as used in a phrase such as “A and / or B” herein is intended to include “A and B,” “A or B,” “A” (alone), and “B” (alone). Likewise, the term “and / or” as used in a phrase such as “A, B, and / or C” is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0060] It is understood that aspects and embodiments of the present disclosure described herein include “comprising,” “consisting,” and “consisting essentially of’ aspects and embodiments.

[0061] As used herein, the terms “including,” “containing,” and “comprising” are used in their open, non-limiting sense.18MF-365934147Docket No.: 237752002540

[0062] As used herein, the term “polypeptide” refers to a molecule having a sequence of natural and / or unnatural amino acids connected through peptide bonds. The term “peptide” refers to a short polypeptide, typically no more than 30 amino acids long. The amino acid sequence of a polypeptide is referred to as its “primary structure.” The term “protein” refers to a polypeptide having a secondary, tertiary and / or quaternary structure, e.g., structures stabilized by hydrogen bonds, relationships between secondary structures and structures formed of more than one protein. Proteins can be further modified by other attached moieties such as carbohydrate (glycoproteins), lipids (lipoproteins) phosphate groups (phosphoproteins) and the like.

[0063] The term "vector" as used herein comprises any intermediary vehicle for a nucleic acid molecule which enables said nucleic acid molecule, for example, to be introduced into prokaryotic and / or eukaryotic cells and / or integrated into a genome, and include plasmids, phagemids, bacteriophages or viral vectors such as retroviral based vectors, lentiviral vectors, Adeno Associated viral vectors and the like. The term "plasmid" as used herein generally refers to a construct of extrachromosomal genetic material, usually a circular DNA duplex, which can replicate independently of chromosomal DNA.

[0064] “Transfection” refers to the introduction of new genetic material into a cell. It includes transformation (the direct uptake and incorporation of exogenous genetic material from its surroundings through the cell membrane), transduction (the introduction of foreign DNA by a bacteriophage virus into a host cell) and conjugation.

[0065] An “individual” or “subject” is a mammal. Mammals include, but are not limited to, primates (e.g., humans and non-human primates such as rhesus and cynomolgus monkeys), rabbits, and rodents (e.g., mice and rats). In some embodiments, the individual or subject is a human.

[0066] “Treatment” or “therapy” of a subject refers to any type of intervention or process performed on, or the administration of an active agent to, the subject with the objective of curing, reversing, alleviating, ameliorating, inhibiting, slowing down, or preventing the onset, progression, development, severity, or recurrence of a symptom, complication, condition, or biochemical indicia associated with a disease.

[0067] An “effective amount” or "therapeutically effective amount" of a drug or therapeutic agent is any amount of the drug that, when used alone or in combination with another therapeutic agent, protects a subject against the onset of a disease or promotes disease19MF-365934147Docket No.: 237752002540regression evidenced by a decrease in severity of disease symptoms, an increase in frequency and duration of disease symptom-free periods, or a prevention of impairment or disability due to the disease affliction. The ability of a therapeutic agent to promote disease regression can be evaluated using a variety of methods known to the skilled practitioner, such as in human subjects during clinical trials, in animal model systems predictive of efficacy in humans, or by assaying the activity of the agent in in vitro assays.

[0068] As used herein, the term “pharmaceutical composition” refers to a composition comprising a pharmaceutical compound (e.g., a drug or a recombinant Treg cell as described herein) and a pharmaceutically acceptable carrier.

[0069] As used herein, the term “pharmaceutically acceptable” refers to a carrier that is compatible with the other ingredients of a pharmaceutical composition and can be safely administered to a subject.

[0070] As described herein, the term “tethered” includes fused, linked, connected, attached, etc. and can include any method known to one of skill in the art for fusing, linking, connecting, attaching, etc. For example, two polypeptide sequences can be “tethered” or otherwise fused, linked, connected, attached, etc. using a polypeptide or peptide linker. Two polypeptide sequences can be tethered, for example, directly or indirectly via a linker.

[0071] As described herein, any concentration range, percentage range, ratio range, or integer range is to be understood to include the value of any integer within the recited range and, when appropriate, fractions thereof (such as one tenth and one hundredth of an integer), unless otherwise indicated. Description of endpoints includes ranges between all endpoints disclosed. For example, description of 1, 2, or 3 includes the ranges 1-2, 2-3, and 1-3.

[0072] All publications, patents, and patent applications mentioned in this specification are herein incorporated by reference to the same extent as if each individual publication, patent, or patent application was specifically and individually indicated to be incorporated by reference.Methods of Manufacturing, Expanding, and Selectively Enriching Treg Cells

[0073] In some aspects, the methods provided herein allow for more efficient manufacturing of Treg cells for use in cell therapy. The Treg specific promoters provided herein allow for selective expression of a payload in Treg cells, such that when a Treg specific promoter drives expression of a payload that enhances proliferation, expansion, persistence, maintenance, survival and / or viability of Treg cells, expression of the payload 20MF-365934147Docket No.: 237752002540can be used to selectively enrich Treg cells in a mixed population of cells. Advantageously, the selective enrichment of Treg cells by expression of the payload under control of the Treg specific promoter may reduce the need for additional selection and / or sorting of cells to enrich Tregs during manufacturing of a Treg cell therapy product.

[0074] Certain aspects of the present disclosure relate to methods of manufacturing Treg cells. In some embodiments, the method of manufacturing Treg cells comprises a first step of isolating the cells. In some embodiments, the cells are acquired from a biological sample. In some embodiments, the cells are isolated from peripheral blood mononuclear (PBMC) cells. In some embodiments, Treg cells are isolated from PBMCs using density gradient centrifugation. In some embodiments, the method of manufacturing Treg cells does not comprise a step of enriching for Treg cells, e.g., by FACS. In some embodiments, the method of manufacturing Treg cells comprises a step of enriching for Treg cells by positive selection, e.g., magnetic beads. In some embodiments, the Treg cells are enriched by positive selection for CD25+. In some embodiments, the Treg cells are enriched by positive selection for CD4+CD25+CD1271O cells. In some embodiments, the enrichment occurs by cell sorting, for example, fluorescent-automated cell sorting (FACS). In certain embodiments, the one or more cells are stained before purifying with one or more fluorescent indicators for CD25, CD127, and / or CD4. In some embodiments, the method of manufacturing Treg cells does not comprise a step of sorting for Treg cells, e.g., by FACS, but comprises positive selection of cells for CD25. In some embodiments, the enriched cells are stimulated by anti-CD3 antibody and / or anti-CD28 antibody on day 0 after positive selection. In some embodiments, the enriched cells are re-stimulated by anti-CD3 antibody and / or anti-CD28 antibody on day 9 of culture after positive selection. In some embodiments, anti-CD3 / anti-CD28 coated beads are used for enriched cell activation in the methods described herein. In some embodiments, Tregs selectively expand in culture.

[0075] In some embodiments, the method of manufacturing Treg cells comprises transfecting the cells with a polynucleotide vector comprising a synthetic promoter operably linked to a payload sequence. In some embodiments, as described above, the cells that are transfected are not previously sorted, enriched, or purified. In some embodiments, as described above, the cells that are transfected are not previously sorted by FACS. Thus, in some embodiments, the transfected cells comprise a population of cells including Treg and other cells, for example Teffector cells. In some embodiments, as described above, the cells that are transfected are first enriched for at least one Treg marker, for example, CD25+. Any21MF-365934147Docket No.: 237752002540suitable method can be used to deliver such a polynucleotide vector into a cell. In some embodiments, the transfection occurs by use of a viral vector, electroporation, heat shock, bacteriophage, sonication, or calcium phosphate. Methods of introducing polynucleotides into a cell include physical, biological, and chemical methods. Physical methods for introducing polynucleotides and / or proteins into a host cell include calcium phosphate precipitation, lipofection, particle bombardment, microinjection, electroporation, viral transduction, and the like. Polynucleotides can be introduced into target cells using commercially available methods which include electroporation (Amaxa Nucleofector-II (Amaxa Biosystems, Cologne, Germany), BTX ECM 830 (Harvard Instruments, Boston, MA, USA), Gene Pulser II (BioRad, Denver, CO, USA), Multiporator (Eppendorf, Hamburg, Germany), among others). Polynucleotides can also be introduced into cells using cationic liposome mediated transfection using lipofection, using polymer encapsulation, using peptide mediated transfection, or using biolistic particle delivery systems such as "gene guns" (Nishikawa (2001) HUM GENE THER). Biological methods for introducing polynucleotides of interest into a host cell include the use of vectors. Viral vectors can be derived from retrovirus, lentivirus, poxviruses, herpes simplex virus I, adenoviruses, and adeno-associated viruses, and the like. See, for example, U.S. Patent Nos. 5,350,674 and 5,585,362. Chemical means for introducing polynucleotides into a host cell include colloidal dispersion systems, such as macromolecule complexes, nanocapsules, microspheres, beads, and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, and liposomes. An exemplary colloidal system for use as a delivery vehicle in vitro and in vivo is a liposome (e.g., an artificial membrane vesicle). Lipids suitable for use can be obtained from commercial sources. For example, dimyristyl phosphatidylcholine ("DMPC") can be obtained from Sigma (St. Louis, MO, USA); dicetyl phosphate ("DCP") can be obtained from K & K Laboratories (Plainview, NY USA); cholesterol ("Choi") can be obtained from Calbiochem-Behring; dimyristyl phosphatidylglycerol ("DMPG") and other lipids may be obtained from Avanti Polar Lipids, Inc. (Birmingham, AL, USA). Stock solutions of lipids in chloroform or chloroform / methanol can be stored at about -20 °C. Chloroform can be as a solvent since it is more readily evaporated than methanol. "Liposome" is a generic term encompassing a variety of single and multilamellar lipid vehicles formed by the generation of enclosed lipid bilayers or aggregates. Liposomes can be characterized as having vesicular structures with a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo 22MF-365934147Docket No.: 237752002540self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh (1991) GLYCOBIOLOGY). However, compositions that have different structures in solution than the normal vesicular structure are also encompassed. For example, the lipids may assume a micellar structure or merely exist as nonuniform aggregates of lipid molecules. Also contemplated are lipofectamine-nucleic acid complexes. In some embodiments, once delivered to the cell, the polynucleotide vector or at least a portion of the polynucleotide vector is integrated into the genome of the cell. Any suitable method can be used for achieving this integration, such as viral and / or CRISPR / Cas-mediated integration. The CRISPR / Cas system is a facile and efficient system for inducing targeted genetic alterations. Any suitable CRISPR / Cas protein can be used, such as a Class I or class II, for example Cas9 and / or Cpfl. Target recognition by the CRISPR / Cas protein includes a ‘seed’ sequence within the guide nucleic acid (gNA), e.g., gRNA, and a protospacer adjacent motif (PAM) sequence adjacent to the ‘seed’ sequence of the gRNA. The CRISPR / Cas system can thereby be engineered to cleave virtually any DNA sequence in cell lines (such as 293T cells), primary cells, and CAR T cells by redesigning the gRNA. The CRISPR / Cas system can simultaneously target multiple genomic loci by provided two or more gNAs, making this system uniquely suited for multiple gene editing / modification. Using a CRISPR / Cas system to introduce at least a portion of a polynucleotide into a genome of a cell leverages the CRISPR / Cas endonuclease to introduce a strand break into the genome of the cell in which homology dependent repair pathways result in integration of the at least portion of the polynucleotide into a desired site. Typically, the polynucleotide will further comprise one or more homology arms at least partially complementary to regions upstream and / or downstream of the desired site. In certain embodiments, the gNA comprises a sequence specific for a target site, wherein upon binding of the CRISPR / Cas system at least one strand break is generated at or near the target site. The sequence of the gNA sequence may be within any suitable loci of the gene. In one embodiment, the guide nucleic acid sequence is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40 or more nucleotides in length. The guide nucleic acid sequence can comprise an RNA sequence, a DNA sequence, a combination thereof (a RNA-DNA combination sequence), or a sequence with synthetic nucleotides. The guide nucleic acid sequence can be a single molecule or a double molecule. In one embodiment, the guide nucleic acid sequence comprises a single guide RNA.23MF-365934147Docket No.: 237752002540

[0076] A polynucleotide comprising a synthetic promoter operably linked to a payload sequence can be provided to a Treg cell in the present methods in the form of a viral vector. Viral vector technology is well known in the art and is described, for example, in Sambrook et al. (4th Edition, Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 2012), and other virological and molecular organisms. Viruses useful as vectors include, but are not limited to, retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, Sindbis viruses, gammaretroviruses, and lentiviruses, preferably lentiviruses. In general, suitable vectors contain an origin of replication that functions in at least one organism, a promoter sequence, convenient restriction endonuclease sites, and one or more selectable markers (e.g., Internal PCT application Nos. WO 2001 / 096584 and WO 2001 / 029058, and US Patent No. 6,326,193).

[0077] In some embodiments, the Treg cell transfected with the polynucleotide vector is expanded after transfection. In some embodiments, the cell is expanded in the presence of IL-2. In some embodiments, the cell is expanded in the absence of exogenous IL-2. In some embodiments, the method steps performed prior to transfection of the cells with the polynucleotide vector are performed in the presence of IL-2, and the method steps performed after transfection of the cells with the polynucleotide vector are performed in the absence of IL-2. In some embodiments, whether IL-2 is added before and / or after transfection of the cells depends on the payload sequence. For example, in some embodiments, cells are transfected with a polynucleotide vector comprising a payload sequence that encodes a receptor that engages in IL-2 independent signaling and IL-2 is not added to the culture after transfection of the cells. In some embodiments, cells are transfected with a polynucleotide vector comprising a payload sequence that encodes a cytokine receptor comprising an extracellular cytokine receptor domain, a transmembrane domain, and an intracellular IL-2 receptor beta chain domain, wherein the extracellular cytokine receptor domain binds to a cytokine other than IL-2, and the cytokine other than IL-2 (e.g., IL-9, IL-4) that bind to the extracellular cytokine receptor domain is added to the culture. In some embodiments, cells are transfected with a polynucleotide vector comprising a payload sequence that encodes a chimeric antigen receptor that renders the cell activatable upon binding of an antibody to an antibody-inducible domain in the chimeric antigen receptor, and both the antibody and IL-2 are added to the culture after transfection of the cells. In some embodiments, the expansion comprises using anti-CD3 / CD28 coated beads. In some embodiments, the expansion does not comprise using anti-CD3 / CD28 coated beads.24MF-365934147Docket No.: 237752002540

[0078] Certain aspects of the present disclosure relate to methods of selectively enriching Treg cells. Treg cells may be enriched from a population of T cells. In some embodiments, the population may comprise both Treg cells and Teff cells. In some embodiments, the method of selectively enriching Treg cells comprises transfecting the cells with a polynucleotide vector comprising a synthetic promoter operably linked to a payload sequence, as described above. In some embodiments, the selective enriching of Treg cells is performed without sorting by cell surface marker expression.

[0079] In some embodiments of any of the preceding aspects, the method produces a population of cells wherein Treg cells comprise at least 70, 75, 80, 85, 90, 91, 92, 93, 94, or 95% of cells in the population. In some embodiments of any of the preceding aspects, expanding the Treg cells produces a population of Treg cells that is at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, 99.9, or 100% pure, in other words, at least 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 99.5, 99.9, or 100% of the cells in the population of cells are Treg cells.

[0080] In some embodiments of any of the preceding aspects, the method allows the transfected Treg cell to proliferate without exogenous IL-2. In some embodiments, the relative amount of Treg cells in a composition comprising a population of transfected Treg cells increases over time. In some embodiments, the population of transfected Treg cells cultured without IL-2 contains a similar number of viable cells compared to a composition comprising a population of the same Treg cells not transfected and cultured with IL-2. In some embodiments, the transfected Treg cells maintain expression of at least one Treg marker after transfection, for example, at least 14 days after transfection. In some embodiments, the at least one Treg marker is selected from the group consisting of FOXP3, HELIOS, CD4+, CD25+, and CD 1271o. In some embodiments, at least 70%, at least 75%, at least 80%, at least 85%, or at least 90% of the population of transfected Treg cells maintains expression of the at least one Treg marker after transfection, for example, at least 14 days after transfection.

[0081] In some embodiments of any of the preceding aspects, after transfection of the Treg cells, the Treg cells may be cultured and one or more growth factor cytokines that promote proliferation of Tregs may be added to the culture. The cytokines may be human or non-human cytokines. Exemplary growth factor cytokines that may be used to promote Treg proliferation include IL-4, IL-7, IL-9, IL-21, or the like. In some embodiments, the cytokines are added to the media for approximately 15-60 minutes. In some embodiments, the cytokines are added to the media for approximately 40 minutes. In some embodiments,25MF-365934147Docket No.: 237752002540cytokines are added to the cell culture approximately every 12 to 60, such as about 24 to about 48 hours. In some embodiments, the cytokines are added to the media for the duration of the culture. In some embodiments, the cells are treated with cytokines wherein the cells are cultured at a cell density of approximately 0.25-1 million cells / mL. In some embodiments, the concentration of cytokines during cytokine treatment is approximately 0.15-300 ng / mL. In some embodiments, the Treg cells are cultured in a culture medium comprising a cytokine other than IL-2. In some embodiments, the Treg cells are cultured in a culture medium comprising IL-2. In some embodiments, the concentration of IL-2 during cytokine treatment is approximately 100-300 lU / mL. In some embodiments, the concentration of IL-2 during cytokine treatment is 100-300 lU / mL. In some embodiments, cells are cultured for a sufficient time to induce proliferation or differentiation. The cells are maintained in culture generally for about 3 days to about 5 days, about 4 to about 10 days, about 5 to about 20 days, about 10 to about 23 days, about 15 to about 30 days, or about 23 to about 30 days. It will be appreciated that the cells may be maintained for an appropriate amount of time required to achieve a desired result, i.e., a desired cellular composition or level of proliferation. For example, to generate a cellular composition comprising primarily Tregs, cells may be maintained in culture for about 30 days.

[0082] In some embodiments, the method further comprises detecting one or more Treg markers provided herein. In some embodiments, the method further comprises detecting IL-2 signaling. In some embodiments, the method further comprises detecting phosphorylated STAT-5.Treg Specific Promoters

[0083] Certain aspects of the present disclosure relate to Treg specific synthetic promoters (“TRSPs”). The Treg-specific promoters of the present disclosure comprise a TRE cassette comprising a plurality of TREs recognized by selected transcription factors. The TRE cassette is operably linked to a core promoter.

[0084] A promoter is a transcription regulatory nucleotide sequence at least sufficient to promote the transcription of a nucleotide sequence in DNA to which it is operably linked into an RNA transcript. A nucleotide sequence is operably linked to a promoter when the promoter functions in a cell to regulate transcription of the nucleotide sequence, e.g., as confirmed through transcriptional activity assays or other experimental methods. This26MF-365934147Docket No.: 237752002540includes promoting transcription of the nucleotide sequence through an interaction between a polymerase and a promoter.

[0085] As used herein, a first nucleotide sequence is “heterologous” to a second nucleotide sequence if the first nucleotide sequence is not coupled with the second nucleotide sequence in nature. By extension, a polypeptide is “heterologous” to a promoter if it is encoded by nucleotide sequence heterologous to the promoter. The synthetic promoters of this disclosure are recombinant products in that they connect nucleotide sequences not normally connected in nature.

[0086] Promoters typically include the so-called “core” or “minimal” promoter, and an extended promoter region comprising other transcription regulatory elements that, together, determine the function of the promoter.

[0087] A transcript transcribed from a promoter typically includes sequences from the promoter downstream of the transcription start site, as well as downstream sequences that, in the case of mRNA, encode an amino acid sequence. Promoters are well-characterized due to their predictable location upstream of transcription start sites. Promoters include sequences that modulate the recognition, binding and transcription initiation activity of the RNA polymerase. These sequences can be cis acting or can be responsive to trans acting factors. Experimental methods for characterizing promoter activity include, for example, reporter assays, ChlP-Seq, and DNase footprinting.

[0088] Promoters, depending upon the nature of the regulation, can be constitutive or regulated. These include, for example, inducible promoters, which are activated by specific stimuli such as heat shock or hormones; tissue- specific promoters, which are active only in certain cell types; and synthetic promoters, that comprise engineered sequences. The activity of eukaryotic promoters can be influenced by epigenetic modifications, such as DNA methylation.Minimal / Core Promoter

[0089] The core promoter (also called “minimal promoter”) includes sequences that are sufficient for RNA polymerase recognition, binding and transcription initiation The core promoter includes the transcriptional start site, an RNA polymerase binding site, and other general transcription binding sites and is where the pre-initiation complex forms, and the general transcription machinery assembles. The pre-initiation complex is generally within 50 nucleotides (nt) of the transcription start site (TSS). Eukaryotic promoters include core 27MF-365934147Docket No.: 237752002540elements such as the TATA box, initiator (Inr) sequence, and downstream promoter elements (DPE), along with regulatory sequences for transcription factors, so-called “transcription regulatory elements” or “TREs.” Such elements include enhancers, silencers and insulators.

[0090] The core promoter of the synthetic promoters of the present disclosure can be any core or minimal promoter that functions in a Treg cell. These include, without limitation, minimal promoters of CTLA4, Foxp3, IL2Ra, RGS1 and ILR2.

[0091] Exemplary minimal promoters include the following:Table 1: Minimal promoters.Extended Promoter / Transcription Regulatory Elements

[0092] The extended promoter region includes the so-called proximal promoter, which typically includes the region up to -250 nucleotides upstream of the transcription start site. It typically includes regulatory elements such as the CAAT box and GC box, which bind transcription factors to modulate transcription initiation. It has been found that many genes have transcription regulatory elements located further upstream. In particular, a fragment that includes most of the transcription regulatory elements of a gene can extend up to 700 nucleotides or more up-stream of the transcription start site. In certain genes, transcription regulatory sequences have been found thousands of nucleotides upstream of the transcriptional start site.28MF-365934147Docket No.: 237752002540

[0093] Transcription regulatory elements (“TREs”) are short nucleotide sequences involved in the regulation of gene expression. These sequences can contribute to tissuespecific and / or cell-specific transcription by interacting with transcription factors (“TFs”) that are active in certain cell types. TREs can be referred to by the name of the transcription factor that recognizes them as an abbreviation, i.e., reference to “FOXP3 TRE” can mean a TRE recognized by FOXP3.

[0094] Synthetic promoters of this disclosure comprise a plurality of TREs recognized by the transcription factors of Table 2, operably linked to a core promoter, in particular, a core promoter operative in Treg cells. Functionally coupling a plurality of the TREs of Table 2 with a core promoter produces a synthetic promoter that preferentially regulates expression in Treg cells of a gene operably linked to the synthetic promoter, compared with other cells, in particular, Teff cells. Reference to a “TRE of Table 2” refers to a TRE recognized by a transcription factor of Table 2.Table 2: Transcription factors for TRE recognition.

[0095] TREs useful in the TRE cassettes of this disclosure can be any natural TRE recognized by the reference transcription factor. These can be determined from examination of the genome. TREs also can be derived from a consensus sequence. More specifically,29MF-365934147Docket No.: 237752002540sequences of TREs for a particular transcription factor across many genes are compared, and the frequency of nucleotides at particular positions is determined. Consensus sequences for various TREs are presented in FIGS. 7A-7Y. TREs also can comprise the exemplary nucleotide sequences presented in Table 3. A TRE sequence also can be expressed as its complement. For example, the FOXP3 TRE sequence, GTAAACA (SEQ ID NO: 2) is present as its complement the FOXP1 sequence TTGTTTACCATGCCTTACGATGGACAACAA (SEQ ID NO: 10) (complementary sequence in bold).

[0096] For example, the exemplary TRE nucleotide sequence recognized by FOXP3 is given in the Table 3 as GTAAACA (SEQ ID NO: 2). However, the FOXP3 consensus sequence is RTAAACA (SEQ ID NO: 33).

[0097] Accordingly, reference to a TRE in synthetic promoter of this disclosure can mean a TRE with a sequence selected from the group consisting of SEQ ID NO: 1 (SOX4), SEQ ID NO: 2 (FOXP3), SEQ ID NO: 3 (AR), SEQ ID NO: 4 (SOX10), SEQ ID NO: 5 (ELF1), SEQ ID NO: 6 (TBX2Related), SEQ ID NO: 7 (MAFK), SEQ ID NO: 8 (PEA3), SEQ ID NO: 9 (ATF3), SEQ ID NO: 10 (FOXP1), SEQ ID NO: 11 (RORA2), SEQ ID NO: 12 (NKX3A), SEQ ID NO: 13 (JUNBFRA), SEQ ID NO: 14 (FOSL1), SEQ ID NO: 15 (IRF3), SEQ ID NO: 16 (RARB), SEQ ID NO: 17 (MAFG), SEQ ID NO: 18 (MEF2A), SEQ ID NO: 19 (AHRHIF), SEQ ID NO: 20 (CEBPE), SEQ ID NO: 21 (ETV5CEBPD_01), SEQ ID NO: 22 (PAX3), SEQ ID NO: 23 (NRF1), SEQ ID NO: 24 (SOX9), and SEQ ID NO: 25 (NFATC1), as set forth in Table 3, a TRE with a consensus sequence taken from FIGS. 7A-7Y, or a TRE having a naturally occurring sequence for the identified transcription factor taken from the genome.Table 3: Exemplary TRE nucleotide sequences.30MF-365934147Docket No.: 237752002540Treg Specific Promoters

[0098] Treg specific promoters (TRSPs) of the present disclosure comprise a cassette comprising a plurality of TREs for transcription factors selected from Table 2 operably linked to a core promoter. A TRE is operably linked to a core promoter when the TRE modulates the transcriptional activity of that promoter, e.g., through mechanisms such as direct interaction with transcription factors, recruitment of coactivators or corepressors, chromatin remodeling, or DNA looping, enabling or repressing the assembly and activity of the transcriptional machinery at the promoter. The plurality of TREs may be operably linked to any core promoter that functions in a Treg cell.

[0099] The synthetic promoters of this disclosure preferentially promote transcription in Treg cells. That is, transcription levels of sequences, which may herein be referred to as payload sequences, that are operably linked with these promoters is greater in Treg cells than in other cell types, in particular, compared with Teff cells. In some embodiments, these promoters preferentially promote the production of mRNA transcripts in Treg cells by a factor of at least any of 2, 3, 5, 10, 20, 50 or 100 times greater as compared with transcriptional activity in any other cell type. For example, about twenty times as many Treg cells as Teff cells express payload sequences under transcriptional control of a Treg specific promoter of this disclosure.

[0100] The synthetic promoters of this disclosure may be active in Treg cells but inactive in Teff cells. The activity of a synthetic promoter in Treg cells or Teff cells may be determined, for example, by an assay that measures expression in relation to vector copy number. In some embodiments, the activity of a synthetic promoter in Treg cells or Teff cells may be determined by an assay which measures the expression of Zsgreen fluorescent reporter protein that is operably linked to the synthetic promoter. In this assay, the fluorescent reporter protein is introduced into the Treg cells or Teff cells as part of a bicistronic reporter 31MF-365934147Docket No.: 237752002540construct that also contains a mCherry transduction marker. A score for promoter activity is calculated by multiplying the percentage of transduced cells that express the fluorescent reporter protein (% mCherry +Zsgreen+ cells) by the mean fluorescence intensity (MFI) fold change for the fluorescent reporter protein expression. MFI fold change is calculated by dividing the Zsgreen MFI in Zsgreen+mCherry+ cells by the Zsgreen MFI in mCherry+ cells of no promoter control. Such a score can be calculated under the same conditions in both Treg cells and Teff cells, providing a “Treg score” and a “Teff score”. In this context, a synthetic promoter is (a) “active” in a Treg cell if it has a “Treg score” of 200 or greater and (b) “inactive” in a Teff cell if it has a “Teff score” of 75 or less.

[0101] In some embodiments, a synthetic promoter of the present disclosure has a Treg score that describes activity of the promoter in Treg cells and a Teff score that describes activity of the promoter in Teff cells. In some embodiments, the Treg score of the synthetic promoter is higher than the Teff score of the synthetic promoter. In some embodiments, the Treg score of the synthetic promoter is at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, or at least 10-fold higher than the Teff score of the synthetic promoter. In some embodiments, the Treg score of the synthetic promoter is at least about 200, at least about 300, at least about 400, at least about 500, at least about 600, at least about 700, at least about 800, at least about 900, or at least about 1000. In some embodiments, the Teff score of the synthetic promoter is no more than about 200, no more than about 175, no more than about 150, no more than about 125, no more than about 100, no more than about 75, no more than about 50, or no more than about 25.

[0102] The synthetic promoters of this disclosure can comprise at least any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or 21 TREs from Table 2 (e.g., with sequences from Table 3). Typically, the synthetic promoters of this disclosure comprise between six and 12 unique promoters from Table 2.

[0103] Furthermore, TREs may be present in more than one copy in a synthetic promoter. In some embodiments, a synthetic promoter of this disclosure comprises one or more TREs recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOX10, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1, AHRIF, MEF2A, PAX3, NPF1, and SOX9, wherein one or more of the TREs is present in one copy, two copies, three copies, four copies, five copies, or six copies. Any number of TREs may be 32MF-365934147Docket No.: 237752002540included in a synthetic promoter of this disclosure, provided that the synthetic promoter can be accommodated in the biological system being used. For instance, if a lentiviral vector is being used for delivering the transgene, then the number of TREs should be selected so that the length of the synthetic promoter is compatible with the vector. The maximum number of TREs in a synthetic promoter may be, for example, no more than 40 TREs, no more than 30 TREs, or no more than 20 TREs. Preferably, the total number of TREs in a synthetic promoter can be between 5 and 20 TREs. The total number of TREs in a synthetic promoter can also be, for example, between six and 15 TREs. The set of TREs may span a range of up to 400 nucleotides long, for example no more than 300 nucleotides. In some embodiments, the set of TREs spans a range of about 100 to 300 nucleotides. The set of TREs may also span a range of about 200 to 350 nucleotides. In some cases, the set of TREs are positioned no more than about 80 nucleotides upstream of the TATA box.

[0104] In some embodiments, the total length of the synthetic promoter (i.e. including the set of TREs and the core promoter) is no more than 500 nucleotides.

[0105] TREs can be in any orientation. In some embodiments, the synthetic promoters of this disclosure comprise at least 1 TRE in a forward orientation and at least 1 TRE in a reverse orientation. For example, the synthetic promoters of this disclosure may comprise at least any of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 TREs in a reverse orientation.

[0106] A TRE that is in the forward orientation is one that is in the same 5 ’-3’ orientation as the core promoter. A TRE that is in the reverse orientation is the reverse complement of a given TRE in the forward orientation, relative to the core promoter.

[0107] The TREs in a synthetic promoter of the present disclosure may be separated by a nucleotide spacer sequence. A nucleotide spacer sequence may be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides in length. In some embodiments, the spacer is 4 nucleotides in length. In some embodiments, the spacer is TCGA.

[0108] It has been found that certain TREs are more commonly found in synthetic promoters having Treg-cell specificity than others, and further, that certain combinations of TREs are more commonly found among such synthetic promoters. Table 4 provides exemplary synthetic promoters and TREs comprised within them. For example, as in Table 4, four TREs selected from TREs recognized by FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, or MAFG, are found in eight Treg specific promoters of this disclosure.Table 4: Exemplary synthetic TRSPs and TREs.33MF-365934147Docket No.: 237752002540

[0109] Synthetic TRSPs of the present disclosure can be described as first generation TRSPs or second generation TRSPs. Selected synthetic promoters have the following sequences (the portion of the synthetic promoter containing the set of TREs is in bold, and the portion not in bold corresponds to the core promoter):Table 5: Sequences of selected synthetic TRSPs.34MF-365934147Docket No.: 23775200254035MF-365934147Docket No.: 237752002540

[0110] Selected second generation synthetic TRSPs are listed in Table 6 and further described below:Table 6: Second generation synthetic TRSPs.

[0111] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3. In some embodiments, the synthetic promoter comprises a TRE recognized by ELFE In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE36MF-365934147Docket No.: 237752002540recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by PEA3. In some embodiments, the synthetic promoter comprises a TRE recognized by SOXIO. In some embodiments, the synthetic promoter comprises a TRE recognized by RORA2. In some embodiments, the synthetic promoter comprises a TRE recognized by IRF3. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP1. In some embodiments, the synthetic promoter comprises a TRE recognized by NKX3A. In some embodiments, the synthetic promoter comprises a TRE recognized by JUNBFRA. In some embodiments, the synthetic promoter comprises a TRE recognized by ATF3. In some embodiments, the synthetic promoter comprises a TRE recognized by RARB. In some embodiments, the synthetic promoter comprises a TRE recognized by CEBPE. In some embodiments, the synthetic promoter comprises a TRE recognized by ETV5CEBPD_01. In some embodiments, the synthetic promoter comprises a TRE recognized by NFATC1. In some embodiments, the synthetic promoter comprises a TRE recognized by AHRIF. In some embodiments, the synthetic promoter comprises a TRE recognized by MEF2A. In some embodiments, the synthetic promoter comprises a TRE recognized by PAX3. In some embodiments, the synthetic promoter comprises a TRE recognized by NPF1. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX9.

[0112] In a preferred embodiment, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by ELFE

[0113] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by SOX4. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by ELF1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3 and a TRE recognized by MAFG.

[0114] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by ELF1. In some embodiments, the synthetic promoter 37MF-365934147Docket No.: 237752002540comprises a TRE recognized by SOX4 and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4 and a TRE recognized by MAFG.

[0115] In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1 and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1 and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1 and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1 and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1 and a TRE recognized by MAFG.

[0116] In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1 and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1 and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1 and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1 and a TRE recognized by MAFG.

[0117] In some embodiments, the synthetic promoter comprises a TRE recognized by AR and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by AR and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by AR and a TRE recognized by MAFG.

[0118] In some embodiments, the synthetic promoter comprises a TRE recognized by MAFK and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by MAFK and a TRE recognized by MAFG.

[0119] In some embodiments, the synthetic promoter comprises a TRE recognized by TBX2Related and a TRE recognized by MAFG.

[0120] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by ELFE In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4,38MF-365934147Docket No.: 237752002540and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.39MF-365934147Docket No.: 237752002540

[0121] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0122] In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE40MF-365934147Docket No.: 237752002540recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0123] In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0124] In some embodiments, the synthetic promoter comprises a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0125] In some embodiments, the synthetic promoter comprises a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0126] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by41MF-365934147Docket No.: 237752002540AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In 42MF-365934147Docket No.: 237752002540some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.43MF-365934147Docket No.: 237752002540

[0127] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by AR.In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFK.In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFG.In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFK.In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE 44MF-365934147Docket No.: 237752002540recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0128] In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related.In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0129] In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by45MF-365934147Docket No.: 237752002540F0SL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0130] In some embodiments, the synthetic promoter comprises a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0131] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by TBX2Related.In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by TBX2Related, and a46MF-365934147Docket No.: 237752002540TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related.47MF-365934147Docket No.: 237752002540In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related.In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0132] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the48MF-365934147Docket No.: 237752002540synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0133] In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK,49MF-365934147Docket No.: 237752002540and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0134] In some embodiments, the synthetic promoter comprises a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0135] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFK. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some50MF-365934147Docket No.: 237752002540embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1,51MF-365934147Docket No.: 237752002540a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0136] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG. In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0137] In some embodiments, the synthetic promoter comprises a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0138] In some embodiments, the synthetic promoter comprises a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0139] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.52MF-365934147Docket No.: 237752002540

[0140] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0141] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0142] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0143] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0144] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by MAFG.

[0145] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, and a TRE recognized by TBX2Related.

[0146] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by FOSL1, a TRE recognized by AR, a TRE recognized by MAFK, a TRE recognized by TBX2Related, and a TRE recognized by MAFG.

[0147] In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1 and a TRE recognized by SOX4. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1 and a TRE recognized by AR. In some embodiments, the synthetic promoter comprises a 53MF-365934147Docket No.: 237752002540TRE recognized by FOXP3, a TRE recognized by ELF1 and a TRE recognized by TBX2Related. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1 and a TRE recognized by FOSL1. In some embodiments, the synthetic promoter comprises a TRE recognized by FOXP3, a TRE recognized by ELF1 and a TRE recognized by MAFK.

[0148] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR (optionally 3 copies), a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related, a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2502 / G2RO183 in Table 6).

[0149] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR, a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4 (optionally 3 copies), a TRE recognized by ELF1 (optionally 5 copies), a TRE recognized by TBX2Related (optionally 3 copies), and a TRE recognized by MAFK see, e.g., synthetic TRSP 2507 / G2RO217 in Table 6).

[0150] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 3 copies), a TRE recognized by TBX2Related (optionally 3 copies), and a TRE recognized by MAFG (optionally 2 copies) (see, e.g., synthetic TRSP 2513 / G2RO250 in Table 6).

[0151] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3, a TRE recognized by AR (optionally 4 copies), a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related (optionally 3 copies), and a TRE recognized by MAFG (optionally 2 copies) (see, e.g., synthetic TRSP 2516 / G2RO257 in Table 6).

[0152] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3, a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1, a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 454MF-365934147Docket No.: 237752002540copies), a TRE recognized by TBX2Related, a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2520 / G2RO275 in Table 6).

[0153] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR, a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related, a TRE recognized by MAFK (optionally 2 copies), and a TRE recognized by MAFG (optionally 3 copies) see, e.g., synthetic TRSP 2521 / G2RO276 in Table 6).

[0154] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3, a TRE recognized by AR (optionally 4 copies), a TRE recognized by FOSL1, a TRE recognized by SOX4 (optionally 3 copies), a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related, a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2522 / G2RO279 in Table 6).

[0155] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4 (optionally 4 copies), a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related, a TRE recognized by MAFK (optionally 3 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2523 / G2RO281 in Table 6).

[0156] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR (optionally 3 copies), a TRE recognized by SOX4 (optionally 3 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related (optionally 2 copies), a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2524 / G2RO285 in Table 6).

[0157] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 4 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1, a TRE recognized by SOX4 (optionally 4 copies), a TRE recognized by ELF1 (optionally 3 copies), a TRE recognized by TBX2Related, and a TRE recognized by MAFK (see, e.g., synthetic TRSP 2554 / G2RO204 in Table 6).

[0158] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR (optionally 255MF-365934147Docket No.: 237752002540copies), a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 6 copies), a TRE recognized by TBX2Related (optionally 3 copies), a TRE recognized by MAFK (optionally 2 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2559 / G2RO238 in Table 6).

[0159] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by SOX4 (optionally 3 copies), and a TRE recognized by ELF1 (optionally 3 copies) see, e.g., synthetic TRSP 2579 / G2RO077 in Table 6).

[0160] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR, a TRE recognized by FOSL1, a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related (optionally 3 copies), a TRE recognized by MAFK (optionally 2 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2581 / G2RO214 in Table 6).

[0161] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR, a TRE recognized by FOSL1, a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related (optionally 2 copies), a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2604 / G2100 in Table 6).

[0162] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 4 copies), a TRE recognized by AR (optionally 3 copies), a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by SOX4, a TRE recognized by ELF1, a TRE recognized by TBX2Related, a TRE recognized by MAFK (optionally 2 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2610 / G2RO34 in Table 6).

[0163] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR, a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by SOX4 (optionally 3 copies), a TRE recognized by ELF1 (optionally 3 copies), and a TRE recognized by MAFG (optionally 2 copies) (see, e.g., synthetic TRSP 2612 / G2RO53 in Table 6).56MF-365934147Docket No.: 237752002540

[0164] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4 (optionally 5 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related (optionally 2 copies), and a TRE recognized by MAFK (optionally 2 copies) (see, e.g., synthetic TRSP 2613 / G2RO55 in Table 6).

[0165] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 5 copies), a TRE recognized by AR, a TRE recognized by FOSL1 (optionally 3 copies), a TRE recognized by SOX4 (optionally 4 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related (optionally 2 copies), and a TRE recognized by MAFK (optionally 3 copies) see, e.g., synthetic TRSP 2629 / G2RO184 in Table 6).

[0166] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 4 copies), a TRE recognized by AR (optionally 3 copies), a TRE recognized by FOSL1, a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 3 copies), a TRE recognized by TBX2Related (optionally 3 copies), and a TRE recognized by MAFK (see, e.g., synthetic TRSP 2633 / G2RO233 in Table 6).

[0167] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 3 copies), a TRE recognized by AR, a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related (optionally 3 copies), a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2640 / G2RO263 in Table 6).

[0168] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR, a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by ELF1 (optionally 4 copies), a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2641 / G2RO265 in Table 6).

[0169] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR, a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related (optionally 2 copies), a TRE recognized by MAFK57MF-365934147Docket No.: 237752002540(optionally 3 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2642 / G2RO267 in Table 6).

[0170] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by SOX4 (optionally 3 copies), a TRE recognized by ELF1, a TRE recognized by TBX2Related, and a TRE recognized by MAFK (see, e.g., synthetic TRSP 2656 / G2RO27 in Table 6).

[0171] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3, a TRE recognized by AR, a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1 (optionally 4 copies), a TRE recognized by TBX2Related (optionally 2 copies), a TRE recognized by MAFK, and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2666 / G2RO50 in Table 6).

[0172] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by FOSL1 (optionally 2 copies), a TRE recognized by SOX4 (optionally 2 copies), a TRE recognized by ELF1 (optionally 2 copies), a TRE recognized by TBX2Related (optionally 2 copies), a TRE recognized by MAFK (optionally 2 copies), and a TRE recognized by MAFG (see, e.g., synthetic TRSP 2667 / G2RO65 in Table 6).

[0173] In some embodiments, a synthetic promoter of the present disclosure comprises a TRE recognized by FOXP3 (optionally 2 copies), a TRE recognized by AR (optionally 2 copies), a TRE recognized by FOSL1, a TRE recognized by SOX4, a TRE recognized by ELF1 (optionally 6 copies), and a TRE recognized by TBX2Related (see, e.g., synthetic TRSP 2668 / G2RO70 in Table 6).Payload Sequences

[0174] Certain aspects of the present disclosure relate to payload sequences. Payload sequences of the present disclosure can encode polypeptides that are associated with one or more of Treg cell proliferation, expansion, persistence, maintenance, survival, and / or viability.

[0175] A payload sequence of the present disclosure may be operably linked to a Treg specific synthetic promoter as described above. Any suitable payload sequence can be expressed using the Treg specific promoters of this disclosure. This includes, for example, a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine58MF-365934147Docket No.: 237752002540receptor, a transcription factor, a reporter protein, a selectable marker, or a combination thereof. In some embodiments, the Treg specific synthetic promoter promotes transcription of the payload sequence in Treg cells by a factor of at least two times, three times, five times, ten times, 20 times or 50 times more as compared to transcription of the payload sequence in Teff cells.

[0176] Any suitable database can be used to derive a suitable payload sequence, for example GenBank, PubMed, and / or KEGG GENES Database, and the like. A skilled artisan would understand how to identify and use such databases to identify and retrieve sequences of interest from the databases. Additional or alternative genes of interest can be identified using any suitable technique, such as sequencing a sample from a cell of interest or subject of interest. Suitable techniques include, but are not limited to, Sanger sequencing and high throughput sequencing.

[0177] A payload sequence as described herein may be prepared and transfected into a cell, e.g., a Treg cell, by any expression method known in the art. For example, the payload sequence may can be synthesized, cloned into a suitable vector such that it is operably linked to a synthetic Treg specific promoter, then transfected into a suitable cell. A transfected cell can be recovered and cultured. In some embodiments, one or more than one payload sequence may be cloned into a suitable vector and operably linked to a synthetic Treg specific promoter of the present disclosure.

[0178] In some embodiments, the payload sequence encodes a polypeptide that increases one or more of IL-2 availability, IL-2 secretion, IL-2 signaling, and IL-2 expression. In some embodiments, the payload sequence encodes a polypeptide that reduces pro -inflammatory cytokine availability and thereby supports Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability. In some embodiments, the payload sequence encodes a polypeptide that increases TGF-P availability. In some embodiments, the payload sequence encodes a polypeptide that comprises an inducible receptor that activates intracellular IL-2 signaling upon binding of a small molecule, e.g., rapamycin. In some embodiments, the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability in an IL-2 dependent manner.

[0179] In some embodiments, the payload sequence encodes a cytokine, for example, IL-10, TGF-beta, and / or PD-10. The cytokine can be any suitable cytokine as needed for the application, such as an immune checkpoint inhibitor, for example PDCD1 (PD-1), CTLA4,59MF-365934147Docket No.: 237752002540AD0RA2A (A2AR), B7-H3, B7-H4, BTLA, KIR, LAG3, HAVCR2 (TIM3), TIGIT, VISTA, PTPN6 (SHP-1), and FAS. In certain embodiments, the payload sequence encodes one or more cytokine receptors, for example CD25. In certain embodiments, the payload sequence encodes both a cytokine and a cytokine receptor, for example IL-2 and CD25. In certain embodiments, the payload sequence encodes IL- 13, IL-22, AREG, and / or BDNF.

[0180] In some embodiments, the payload sequence encodes an IL-2 cytokine. In some embodiments, the IL-2 cytokine is a wild-type IL-2 molecule. In some embodiments, the IL-2 cytokine comprises one or more amino acid substitutions that alters affinity for one or more receptors, as compared to an IL-2 cytokine lacking the one or more amino acid substitutions.Chimeric Antigen Receptors

[0181] In some embodiments, the payload sequence encodes a polypeptide comprising a chimeric antigen receptor (CAR). Chimeric antigen receptors or CARs are engineered molecules comprising an optional signal peptide, a target antigen-binding domain, an optional hinge region, a transmembrane domain, an intracellular signaling domain and an optional co- stimulatory domain. CARs are based on the structure of T cell receptors, which are expressed on T cells, and are involved in cell-mediated immune responses. The “targetbinding domain” is also referred to herein as an “antigen-binding domain” or “antigenrecognition domain”, and as such the term “target” encompasses an “antigen.”

[0182] In some embodiments, the payload sequence encodes a polypeptide comprising a chimeric antigen receptor (CAR) comprising an extracellular accessory domain through which T cells expressing the CAR can be activated in an antigen-dependent fashion.Specifically, the extracellular accessory domain is an antibody-inducible domain by which T cells expressing the CARs can be activated upon binding of an antibody to the antibodyinducible domain, not just through the CAR via antigen binding to an antigen-binding domain or through the TCR via cross-linking of CD3 and CD28. A CAR of the present disclosure can comprise an antigen-binding domain, a first linker, an antibody-inducible domain, a transmembrane domain, and an intracellular signaling domain, wherein the antibodyinducible domain is a polypeptide of from about 60 to about 360 amino acids in length. Such a CAR is described further in International Patent Application Publication WO2025 / 184397. WO2025 / 184397 is specifically incorporated herein by reference in its entirety. In some embodiments, the linker comprises a “first linker” located between the antigen-binding domain and the antibody-inducible domain. In some embodiments, the linker further60MF-365934147Docket No.: 237752002540comprises a “second linker” located between the antibody-inducible domain and the transmembrane domain.

[0183] A signal peptide that may be present at the N-terminus of a nascent CAR of the present disclosure during expression in a cell can be a signal peptide of any human Type I transmembrane protein or any other signal peptide suitable for translocating the nascent CAR to the surface of a human cell. In some embodiments, the signal peptide is derived from a protein of the human immunoglobulin superfamily. In some embodiments, the signal peptide is derived from a CD4, CD8, CD19, CD28, TCR or immunoglobulin chain.

[0184] The antigen-binding domain (ABD) of the CARs of the present disclosure can possess any desired specificity and can be in any suitable polypeptide form for binding the target antigen and transmitting a signal through the transmembrane domain to the intracellular domain of the CAR. In some embodiments, the antigen-binding domain (ABD) is a single chain antibody (scFV). In some embodiments, such as when the ABD is a scFV, the antigen-binding domain comprises a heavy chain variable region (VH) and a light chain variable region (VL) of an antibody, wherein the heavy chain variable region comprises complementarity region (CDR)-Hl, CDR-H2, and CDR-H3 and the light chain variable region comprises CDR-L1, CDR-L2, and CDR-L3 of an antibody whose sequence is deposited in Version 13.1 (August 2023) of The ABCD (Antibodies Chemically Defined) database hosted by Expasy and operated by the Swiss Institute of Bioinformatics (see, Lima et al., Nucleic Acids Research, 48:D2610264, 2020). In some embodiments, the CDRs are as defined using Kabat nomenclature, which can easily be determined for a given sequence using online tools such as the abYsis annotate tool. In some embodiments, the antigenbinding domain comprises a light chain variable region and a heavy chain variable region of an antibody disclosed in Version 13.1 (August 2023) of The ABCD, which includes 24,485 sequence antibodies directed against 4,171 different target antigens.

[0185] In some embodiments, the antigen comprises citrullinated vimentin (CV). In exemplary embodiments, the antigen-binding domain is a CV-binding domain that comprises a heavy chain variable region (VH) comprising heavy chain CDRs and a light chain variable region (VL) comprising light chain CDRs as described in WO2025 / 184397. In some embodiments, the antigen comprises CD19 (also known as B-lymphocyte surface antigen B4). In some embodiments, the antigen-binding domain is a CD19-binding domain that comprises a light chain variable region (VL) comprising light chain CDRs and a heavy chain variable region (VH) comprising heavy chain CDRs as described in WO2025 / 184397. In 61MF-365934147Docket No.: 237752002540some embodiments, the antigen comprises B-cell maturation antigen (BCMA, (also known as tumor necrosis factor receptors superfamily member 17 or TNFRSF17). In exemplary embodiments, the antigen-binding domain is a BCMA-binding domain that comprises a light chain variable region (VL) comprising light chain CDRs and a heavy chain variable region (VH) comprising heavy chain CDRs as described in WO2025 / 184397.

[0186] The antigen-binding domains of the CARs of the present disclosure comprising a VH and a VL region, preferably are separated by a polypeptide linker. In some embodiments, the antigen-binding domain is arranged as VH-linker-VL. In other embodiments, the antigenbinding domain is arranged as VL-linker-VH. In some embodiments, the polypeptide linker is from about 4 to about 24 amino acids in length. In exemplary embodiments, the linker is a glycine linker. In other exemplary embodiments, the linker is a Whitlow linker. In further exemplary embodiments, the linker is a ABpur linker.

[0187] In exemplary embodiments, the antigen-binding domain (ABD) is a CV-binding domain. In other exemplary embodiments, the ABD is a CD19-binding domain. In further exemplary embodiments, the ABD is an BCMA-binding domain.

[0188] The antigen-binding domain and the antibody-inducible domain of the CARs of the present disclosure are separated by linker (1stlinker). The antibody-inducible domain and the transmembrane domain of the CARs of the present disclosure may also be separated by a linker (2ndlinker).

[0189] The linker may be a “flexible polypeptide linker” of from 4 to 24 amino acids in length. In some embodiments, the flexible polypeptide linker comprises [XaXbXcXdXeXfXg]n, wherein Xa, Xb, Xc, and Xd, are independently selected from G and S, Xe, Xf, and Xg are independently selected from G, S, and absent, and n is 1, 2 or 3. That is, the flexible polypeptide linker is rich in glycine and serine residues and is at least 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 amino acids in length and at most 24, 23, 22, 21, 20, 19, 18, 17, 16, 15, 14, 13, 12, 11, 10, 9, or 8 amino acids in length.

[0190] The linker may be a “hinge region” of from about 10 to about 20, 3040 or 50 amino acids in length. In some embodiments, the hinge region is a CD8a hinge region, a CD28 hinge region or an IgG4 hinge region. In some embodiments, the hinge region is an IgG4 hinge region.

[0191] In some embodiments, the 1stlinker is a flexible polypeptide linker. In exemplary embodiments, the 1stlinker is a flexible polypeptide linker and the 2ndlinker is a flexible 62MF-365934147Docket No.: 237752002540polypeptide linker, an IgG4 hinge region, or absent. In some embodiments, the 1stlinker is an IgG4 hinge region. In exemplary embodiments, the 1stlinker is an IgG4 hinge region, and the 2ndlinker is an IgG4 hinge region, a flexible polypeptide linker, or absent.

[0192] In some embodiments, the hinge region is a CD8a hinge region. In some embodiments, the hinge region is a CD28 hinge region. In some embodiments, the hinge region is an IgG4 hinge region. The antibody-inducible domain (AID) of the CARs of the present disclosure is a polypeptide of from about 60 to about 360 amino acids in length that is bindable by an antibody (e.g., comprises the epitope for the antibody). The AID is located between the antigen-binding domain and the transmembrane domain. In some embodiments, the AID is flanked by a 1stlinker or a hinge domain at its N-terminus. In some embodiments, the AID is flanked by a 2ndlinker or a hinge at its C-terminus. In some preferred embodiments, the AID comprises a fragment of an extracellular region of a human cell surface protein, with the proviso that it does not comprise a fragment of a B-cell or T-cell antigen receptor. Specifically, the AID is at least 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, 160, 170, 180, 190, or 200 amino acids in length and at most 360, 350, 340, 330, 320, 310, 300, 290, 280, 270, 260, 250, or 240 amino acids in length.

[0193] The AID of the CARs of the present disclosure is capable of transmitting a signal through the transmembrane domain to the intracellular domain of the CAR when the AID is bound by an antibody (e.g. a monoclonal antibody). In this way, the AID provides an alternative to the ABD for CAR-specific activation of a T-cell in which the CAR is expressed. In some embodiments, the antibody is a monoclonal antibody. In some embodiments, the monoclonal antibody is an IgG antibody. In some embodiments, the IgG antibody is an IgGl antibody. In some preferred embodiments, the monoclonal antibody is a human antibody or a humanized antibody. In other embodiments, the monoclonal antibody is a rodent antibody, such as a mouse monoclonal antibody or a rat monoclonal antibody. In some embodiments, the monoclonal antibody is a human / rodent chimeric antibody.

[0194] In some embodiments, the antibody-inducible domain comprises a member of the group consisting of a vascular endothelial growth factor receptor 2 (VEGFR2) domain, a human epidermal growth factor receptor 2 (HER2) domain, a platelet-derived growth factor receptor-alpha (PDGFRa) domain, an interleukin-4 receptor- alpha (IL-4Ra) domain, a CD4 domain, and a CD2 domain. In exemplary embodiments, the antibody-inducible domain comprises a fragment of a human protein selected from the group consisting of domain 3 of vascular endothelial growth factor receptor 2 (VEGFR2-D3), domain 4 of human epidermal 63MF-365934147Docket No.: 237752002540growth factor receptor 2 (HER2-D4), domains 3-5 of platelet-derived growth factor receptoralpha (PDGFRa-D3-D5), domains 1-2, domain 1 or domain 2 of interleukin-4 receptor- alpha (IL-4Ra-Dl-D2, IL-4Ra-Dl, or IL-4Ra-D2), domains 1-2, domain 1 or domain 2 of CD4 (CD4-D1-2, CD4-D1, or CD4-D2), and domains 1-2, domain 1 or domain 2 of CD2 (CD2-D1-D2, CD2-D1, or CD2-D2).

[0195] In some embodiments, the AID comprises a human VEGFR2 domain. In some embodiments, the VEGFR2 domain is bindable by an anti-VEGFR2 antibody or VEGFR2-binding fragment. In some embodiments, the anti-VEGFR2 antibody is ramucirumab. In some embodiments, the anti-VEGFR2 antibody is alacizumab.

[0196] In some embodiments, the AID comprises a human HER2 domain. In some embodiments, the HER2 domain is bindable by an anti-HER2 antibody or HER2-binding fragment thereof. In some embodiments, the anti-HER antibody is selected from the group consisting of trastuzumab, margetuximab, pertuzumab, and timigutuzumab. In some embodiments, the anti-HER2 antibody is trastuzumab.

[0197] In some embodiments, the AID comprises a human PDGFRa domain. In some embodiments, the PDGFRa domain is bindable by an anti-PDGFRa antibody or PDGFRa-binding fragment thereof. In some embodiments the anti-PDGFRa antibody is selected from the group consisting of olaratumab and tovetumab.

[0198] In some embodiments, the AID comprises a human IE-4Ra domain. In some embodiments, the IE-4Ra domain is bindable by an anti-IE-4Ra antibody or IE-4Ra-binding fragment thereof. In some embodiments, the IE-4Ra antibody is dupilumab. In some embodiments, the IE-4Ra antibody is pascolizumab.

[0199] In some embodiments, the AID comprises a human CD4 domain. In some embodiments, the CD4 domain is bindable by an anti-CD4 antibody or CD4-binding fragment. In some embodiments, anti-CD4 antibody is selected from the group consisting of cedelizumab, clenoliximab, ibalizumab, keliximab, priliximab, tregalizumab, zanolimumab, and semzuvolimab.

[0200] In some embodiments, the AID comprises a human CD2 domain. In some embodiments, the CD2 domain is bindable by an anti-CD2 antibody or CD2-binding fragment thereof or a lymphocyte function-associated antigen-IgG fusion protein selected from the group consisting of siplizumab.64MF-365934147Docket No.: 237752002540

[0201] The antibody-inducible domain (and optionally a 2ndlinker or hinge) of the CARs of the present disclosure is separated from the intracellular signaling domain by a transmembrane domain of from about 20 to about 30 amino acids in length.

[0202] In some embodiments, the transmembrane domain is a CD8a transmembrane domain. In some embodiments, the transmembrane domain is a CD28 transmembrane domain. In exemplary embodiments, the CD28 transmembrane domain is a wild type CD28 transmembrane domain.

[0203] In some embodiments, the transmembrane domain is a modified CD28 transmembrane domain. In exemplary embodiments, the amino acid sequence of the modified CD28 transmembrane domain comprises an insertion, substitution, and / or deletion relative to a wildtype CD28 transmembrane domain sequence. In some embodiments, the amino acid sequence of the CD28 transmembrane domain comprises at least one substitution selected from the group consisting of: C165L, Y166L, S167L, T171L.

[0204] The intracellular signaling domain of the CARs of the present disclosure may comprise a CD3zeta signal transduction domain. In some embodiments, the intracellular signaling domain further comprises a co-stimulatory domain. In some embodiments, the costimulatory domain can be derived from, for example, CD28, 4- IBB, CD2, CD27, CD30, 0X40, CD40, PD-1, PD-L1, PD-L2, ICOS, LFA-1, CD7, LIGHT, NKG2C, B7-H3, CD83L, B7-1 (CD80), B7-2 (CD86), B7-H3, B7-H4 and others. In some embodiments, the CARs of the present disclosure comprise two or more co-stimulatory signaling domains (e.g., CD28 and 4- IBB). In some embodiments, the co-stimulatory domain is a CD28 co-stimulatory domain. In some embodiments, the co-stimulatory domain is a 4- IBB co-stimulatory domain. In some embodiments, the intracellular signaling domain comprises a CD28 co-stimulatory domain and a CD3(^ signal transduction domain. In some embodiments, the intracellular signaling domain comprises a 4- IBB co-stimulatory domain and a CD3(^ signal transduction domain.

[0205] In some embodiments, the payload sequence encodes a polypeptide that comprises a CAR or TCR that targets an antigen of interest (e.g., a tumor antigen, an antigen of a pathogen, or a target in an inflammation site). The antigens may include, without limitation, AFP (alpha-fetoprotein), avP6 or another integrin, BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56,65MF-365934147Docket No.: 237752002540CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (delta-like protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma-associated antigen), IGF1R (insulin-like growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL-13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A), Lewis Y, melanoma-associated antigen (MAGE)-Al, MAGE-A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma-associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes (e.g., HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1), NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME (preferentially expressed antigen of melanoma), progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen), PSMA (prostate specific membrane antigen), ROR1, ROR2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor- associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, HPV, and other pathogens. In some embodiments, the payload sequence encodes a polypeptide that comprises a CAR or TCR that targets an antigen of interest, and further encodes one or more additional polypeptides comprising one or more of (i) a chimeric antigen receptor (CAR) comprising an extracellular accessory domain through which T cells expressing the CAR can be activated in an antigen-dependent fashion, (ii) a cytokine receptor that can be used for expanding Treg cells and that is able to transduce intracellular IL-2 signaling in the absence of exogenous IL-2, and (iii) a cytokine receptor that can be used for expanding Treg cells and comprises an IL-2 cytokine molecule tethered to the IL-2 receptor beta (IL-2RP) extracellular domain.66MF-365934147Docket No.: 237752002540Chemokine Receptors

[0206] In certain embodiments, the payload sequence encodes a polypeptide comprising a chemokine receptor, such as a cytokine receptor, for example CCR and / or a CXCR receptor. Any suitable chemokine receptor can be used, for example CXC chemokine receptor 1 (CXCR1), CXC chemokine receptor 2 (CXCR2), CXC chemokine receptor 3 (CXCR3), CXC chemokine receptor 4 (CXCR4), CXC chemokine receptor 5 (CXCR5), CXC chemokine receptor 6 (CXCR6), CC chemokine receptor 1 (CCR1), CC chemokine receptor 2 (CCR2), CC chemokine receptor 3 (CCR3), CC chemokine receptor 4 (CCR4), CC chemokine receptor 5 (CCR5), CC chemokine receptor 6 (CCR6), CC chemokine receptor 7 (CCR7), CC chemokine receptor 8 (CCR8), CC chemokine receptor 9 (CCR9), CC chemokine receptor 10 (CCR 10), CC chemokine receptor 11 (CCR 11), C chemokine receptor (XCR1), CX3C chemokine receptor (CX3CR1), or a combination thereof or biologically active fragment thereof. In some embodiments, the chemokine receptor comprises a receptor involved in an autoimmune disease.Cytokine Receptors for IL-2 Signaling in the Absence of Exogenous IL-2

[0207] In some embodiments, the payload sequence encodes a polypeptide comprising a cytokine receptor that can be used for expanding Treg cells and that is able to transduce intracellular IL-2 signaling in the absence of exogenous IL-2. In some embodiments, the cytokine receptor is an engineered molecule comprising an extracellular cytokine-binding domain (ED; also called an “extracellular cytokine receptor domain”), a transmembrane domain (TD), and an intracellular cytokine signaling domain (ID; also called an “intracellular domain”). In some embodiments, the ED binds to a cytokine other than IL-2. In some embodiments, the ID comprises the ID of the Interleukin-2 Receptor beta (IL-2RP) chain of the IL-2R. In some embodiments, the cytokine receptor that is able to transduce intracellular IL-2 signaling in the absence of exogenous IL-2 and that binds to a cytokine other than IL-2 may be referred to as a switch receptor, e.g., in Example 2.

[0208] Canonical IL-2 signaling causes STAT5 phosphorylation, thereby activating STAT5 nuclear translocation and initiation of target gene transcription. In some cells, e.g., T cells, including Treg cells, IL-2 signaling is required for cell survival and cell proliferation. Therefore, cytokine receptors comprising an IL-2RP intracellular domain that bind to a cytokine other than IL-2 are able to activate cell survival and proliferation in the absence of67MF-365934147Docket No.: 237752002540IL-2 via binding to another cytokine. That is, a cytokine receptor of the present disclosure may be able to activate IL-2RP signaling using a cytokine other than IL-2.

[0209] In some embodiments, the cytokine receptor is tethered to its cognate cytokine, which is therefore able to be activated in the absence of any exogenous cytokine. In some embodiments, the ED is selected from the group consisting of an IL-4 extracellular domain, an IL-7 extracellular domain, an IL-9 extracellular domain, and an IL-21 extracellular domain. In some embodiments, the cytokine receptor is not tethered to a cytokine. In some embodiments, the TD is from the same cytokine receptor as the ED. In some embodiments, the TD is from a different cytokine receptor than the ED. In some embodiments, the TD is a transmembrane domain of an IL-9 receptor, an IL-2 receptor, an IL-4 receptor, an IL-7 receptor, or an IL-21 receptor.

[0210] In some embodiments, the cytokine receptor is described with respect to the extracellular domain and intracellular domain. Thus, for example, an “IL-4Ra / IL-2RP” receptor comprises an IL-4 receptor extracellular domain linked to an IL-2RP intracellular domain. Exemplary embodiments of such cytokine receptors include untethered IL-4Ra / IL-2Rp, IL-7Ra / IL-2Rp, IL-9Ra / IL-2Rp, and IL-21Ra / IL-2Rp cytokine receptors, which each turns on intracellular IL-2 signaling (e.g., when transduced into a Treg) upon receptor binding to the respective cognate ligand (i.e., IL-4, IL-7, IL-9, or IL-21, respectively); and cytokine-tethered IL-4Ra / IL-2Rp, IL-7Ra / IL-2Rp, IL-9Ra / IL-2Rp, and IL-21Ra / IL-2Rp cytokine receptors, wherein intracellular IL-2 signaling is constitutively activated, which are described further in International Patent Application Publication WO2024 / 015734. WO2024 / 015734 is specifically incorporated herein by reference in its entirety. In some embodiments, the cytokine receptor comprises an IL-2 intracellular domain that is activated upon cytokine binding.

[0211] In some embodiments, the cytokine receptor is effective at maintaining Treg persistence. A Treg cell expressing a cytokine receptor payload according to the methods described herein may be capable of engaging in IL-2 signaling in the absence of IL-2, and may be able to maintain a Treg phenotype and / or have increased persistence compared to Treg cells that secrete IL-2.

[0212] In some embodiments, a Treg cell expressing a cytokine receptor payload according to the methods described herein can survive and proliferate in the absence of IL-2. In some embodiments, at least about 60% (such as at least about any of 60%, 65%, 70%,68MF-365934147Docket No.: 23775200254015%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of cells transfected with a polynucleotide vector comprising the cytokine receptor payload remain viable in the absence of IL-2.

[0213] In some embodiments, the Tregs expressing the cytokine receptor payload can survive and proliferate in vitro in the absence of IL-2 in a suitable medium that can maintain Tregs. In some embodiments, at least about 60% (such as at least about any of 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of the Tregs expressing the cytokine receptor payload remain viable in vitro about 2 days to about 30 days, such as about 10 to about 30 days, about 20 to about 30 days, or about 23 to about 30 days after transfection with the polynucleotide vector. In some embodiments, at least about 60%-99% of Tregs remain viable in vitro about 7 to about 20 days after transfection with the polynucleotide vector. In some embodiments, at least about 60-90% of Tregs remain viable in vitro about 7 to about 20 days after transfection with the polynucleotide vector.

[0214] In some embodiments, at least about 60-80% of the Tregs transduced with the cytokine receptor remain viable in vitro about 7 to about 20 days after transduction. In some embodiments, at least about 60%-99% of the Tregs transduced with the cytokine receptor remain viable in vitro about 7 days after transduction. In some embodiments, at least about 60-90% of the Tregs transduced with the cytokine receptor remain viable in vitro about 7 after days after transduction. In some embodiments, at least about 60-80% of the Tregs transduced with the cytokine receptor remain viable in vitro about 7 days after transduction. In some embodiments, at least about 60%-99% of the Tregs transduced with the cytokine receptor remain viable in vitro about 12 days after transduction. In some embodiments, at least about 60-90% of the Tregs transduced with the cytokine receptor remain viable in vitro about 12 after days after transduction. In some embodiments, at least about 60-80% of the Tregs transduced with the cytokine receptor remain viable in vitro about 12 days after transduction. In some embodiments, at least about 60%-99% of the Tregs transduced with the cytokine receptor remain viable in vitro about 14 days after transduction. In some embodiments, at least about 60-90% of the Tregs transduced with the cytokine receptor remain viable in vitro about 14 after days after transduction. In some embodiments, at least about 60-80% of the Tregs transduced with the cytokine receptor remain viable in vitro about 14 days after transduction. In some embodiments, the viability of Tregs transduced with the cytokine receptor is increased compared to Treg cells that are not transduced with the69MF-365934147Docket No.: 237752002540cytokine receptor. In some embodiments, the viability of Tregs transduced with the cytokine receptor is increased compared to Treg cells that are not transduced with the cytokine receptor when cultured without the cognate receptor cytokine. In some embodiments, the viability of Tregs is increased at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 3.2-fold, at least about 4-fold, at least about 10-fold, about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 45-fold, at least about 50-fold, or more compared to untransduced T cells.

[0215] In some embodiments, the Tregs expressing the cytokine receptor can survive and proliferate in vivo in the absence of IL-2. In some embodiments, at least about 60% (such as at least about any of 60%, 65%, 70%, 75%, 80%, 81%, 82%, 83%, 84%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%) of the Tregs transduced with the cytokine receptor can persist in vivo for at least about 3 days or longer. In some embodiments, at least about 60%-99% of the Tregs transduced with the cytokine receptor can persist in vivo for at least about 3 days or longer. In some embodiments, at least about 60-90% of the Tregs transduced with the cytokine receptor can persist in vivo for at least about 3 days or longer. In some embodiments, at least about 60-80% of the Tregs transduced with the cytokine receptor can persist in vivo for at least about 3 days or longer.

[0216] In some embodiments, the cells transduced with the cytokine receptor have increased or sustained proliferation post-transduction and in vivo. In some embodiments, the cells transduced with the cytokine receptor have more cells in an expanded in vitro culture compared to the number of cells before transduction. In some embodiments, the cells are T cells. In some embodiments, the cells are Treg cells.

[0217] In some embodiments, the Tregs transduced with the cytokine receptor have increased or sustained proliferation post-transduction. In some embodiments, the Tregs transduced with the cytokine receptor have more cells after expansion compared to the number of cells before transduction. In some embodiments, Tregs transduced with the cytokine receptor have a higher rate of proliferation compared to untransduced Treg cells. In some embodiments, the number of cells post-transduction is increased at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, at least about 75-fold, or more compared to untransduced cells. In some embodiments, the cells are cultured post-transduction in the presence of cytokine. In some embodiments, the cells are cultured post-transduction without cytokine.70MF-365934147Docket No.: 237752002540

[0218] In some embodiments, cell viability, transduction of intracellular signaling, activation of intracellular signaling, or the ability to proliferate is increased upon cell transduction with the cytokine receptor.

[0219] In some embodiments, cell viability, transduction of intracellular signaling, activation of intracellular signaling, or the ability to proliferate is increased upon cell transduction with the cytokine receptor. In some embodiments, the cytokine receptor expressed in cells transduces intracellular IL-2 signaling within the cells. In some embodiments, the cytokine receptor activates intracellular IL-2 signaling in cells. In some embodiments, the cytokine receptor promotes intracellular IL-2 signaling in cells. In some embodiments, the cytokine receptor increases intracellular IL-2 signaling in cells compared to cells without the cytokine receptor. In some embodiments, the intracellular domain of the cytokine receptors provided herein comprise an active IL-2RP intracellular domain. In some embodiments, the cytokine receptors comprise an active IL-2RP intracellular domain. In some embodiments, the intracellular domain of the cytokine receptors provided herein are able to engage in downstream signal transduction. In some embodiments, the cytokine receptor comprises an IL-2RP intracellular domain which phosphorylates STAT5 through its activation of the JAK1 kinase upon cytokine receptor activation. In some embodiments, the IL-2RP intracellular domain phosphorylates STAT5 through its activation of the JAK1 kinase upon cytokine receptor activation. In some embodiments, the cytokine receptor phosphorylates She upon cytokine receptor activation, thereby activating the downstream PI3K-AKT pathway. In some embodiments, the cytokine receptor phosphorylates She upon cytokine receptor activation, thereby activating the downstream Ras / MAPK pathway. In some embodiments, the cytokine receptor comprises IL-4Ra / IL-2Rp, IL-7Ra / IL-2Rp, IL-9Ra / IL-2Rp, or IL-21Ra / IL-2Rp extracellular / intracellular receptor domains. In some embodiments, the cells are T cells. In some embodiments, the cells are Treg cells.

[0220] In some embodiments, the cytokine receptor phosphorylates STAT5 through its activation of the JAK1 kinase upon cytokine receptor activation. In some embodiments, the cytokine receptor phosphorylates She upon cytokine receptor activation, thereby activating the downstream PI3K-AKT pathway. In some embodiments, the cytokine receptor phosphorylates She upon cytokine receptor activation, thereby activating the downstream Ras / MAPK pathway. In some embodiments, the cytokine receptor comprises IL-4Ra / IL-2Rp extracellular / intracellular receptor domains. In some embodiments, the cytokine receptor is IL-4Ra / IL-2Rp.71MF-365934147Docket No.: 237752002540

[0221] In some embodiments, the cytokine receptor has a capability to stimulate STAT5 phosphorylation in cells (e.g., Tregs). STAT5 signaling can be measured, for example, by phosphorylation of STAT5 using any suitable method known in the art. For example, STAT5 phosphorylation can be measured using antibodies specific for the phosphorylated version of these molecules in combination with flow cytometry analysis as described herein.

[0222] IL-2 is a class I cytokine. Class I cytokine receptors generally have large extracellular domains (EDs) that include multiple all- Ig-like domains and Fn3 domains (see, e.g., Metcalfe, RD et al. (2020), Front Immunol; 11:1424). These domains possess a [3-sandwich structure with two anti-parallel P sheets. Two Fn3 domains form the cytokine binding homology region at the domain juncture. Class I cytokine receptor EDs contain a conserved WSXWS (Trp-Ser-X-Trp-Ser, where X is any amino acid) motif that may act to stabilize the receptor, undergo conformational change upon cytokine binding, and can be extensively glycosylated. Class I cytokine receptor chains, including IL-2RP, IL-4Ra, IL-7Ra, IL-9Ra, and IL-21Ra are most often found in heterodimers or hetero trimers. For example, IL-2RP can be found in a heterodimer with IL-2Rycor in a heterotrimer with IL-2Ra and IL-2Ryc, wherein the IL-2 binding affinity for IL-2RP alone is Kd ~ 100 nm, in heterodimeric form Kd ~ 1 nM, and in heterotrimeric form Kd ~ 10 pM (see, e.g., Wang, X et al. (2009), Annu Rev Immunol; 27:29-60, hereby incorporated by reference in its entirety). Reconstitution studies have identified the cognate cytokine binding affinities for IL-4Ra, IL-7Ra, IL-9Ra, and IL-21Ra are the following: Kd ~ 266 pM, Kd ~ 250 pM, Kd ~ 100 pM (see, e.g., Lin, JX & Leonard, WJ (2018), Cold Spring Harb Perspect Biol; 10(9):a028449, hereby incorporated by reference in its entirety), and Kd ~ 70 pM (see, e.g., Kang, L et al. (2010), J Biol Chem; 285(16): 12223- 12231, hereby incorporated by reference in its entirety), respectively. These binding affinities can become higher-affinity upon each cytokine receptor complexing with ycchains. The EDs of IL-4Ra, IL-7Ra, IL-9Ra, and IL-21Ra are 232 residues, 239 residues, 270 residues, and 232 residues, respectively, in length. IL-2, IL-4, IL-7, IL-9, and IL-21 signaling pathways each have their own distinct impact on T cell biology: T cell survival and proliferation; T helper 2 (TH2) differentiation from naive T cells and antiinflammatory actions via suppression of T helper 1 (THI) and induced differentiation of Tregs; survival of naive and memory T cells; enhancement of Treg suppressive activity and differentiation of TH17 cells; and promotion of CD8+ T cell clonal expansion and cytolytic activity, respectively.72MF-365934147Docket No.: 237752002540

[0223] In some embodiments, the cytokine receptor is able to signal in the absence of exogenous IL-2. In some embodiments, the cytokine receptor comprises an interleukin ED, a TD, and an ID. Thus, in some embodiments, there is provided a cytokine receptor comprising: (I) the ED of IL-4Ra, IL-7Ra, IL-9Ra, or IL-21Ra; (II) the TD of IL-2RP, IL-4Ra, IL-7Ra, IL-9Ra, or IL-21Ra; (III) the ID of IL-2RP; and (IV) optionally, a cognate cytokine tethered by a polypeptide linker to the ED of the cytokine receptor. In some embodiments, the ED is from the same cytokine receptor as the TD (e.g., an ED from IL-4Ra and a TD from IL-4Ra). In some embodiments, the ED is from a different cytokine receptor from the TD.

[0224] In some embodiments, a Treg cell comprises more than one payload sequence. In some embodiments, the more than one payload sequences can encode (i) a polypeptide comprising a cytokine receptor that can be used for expanding Treg cells and that is able to transduce intracellular IL-2 signaling in the absence of exogenous IL-2, and (ii) a polypeptide comprising a chimeric antigen receptor (CAR) comprising an extracellular accessory domain through which T cells expressing the CAR can be activated in an antigen-dependent fashion as described above. In some embodiments, a Treg cell of the present disclosure comprises a cytokine receptor that can be used for expanding Treg cells and that is able to transduce intracellular IL-2 signaling in the absence of exogenous IL-2 and a chimeric antigen receptor (CAR) comprising an extracellular accessory domain through which T cells expressing the CAR can be activated in an antigen-dependent fashion as described above.Cytokine Receptors Comprising a Tethered IL-2 Molecule

[0225] In some embodiments, the payload sequence encodes a polypeptide comprising a cytokine receptor that can be used for expanding Treg cells and comprises an IL-2 cytokine molecule tethered to the IL-2 receptor beta (IL-2RP) extracellular domain. In some embodiments, the cytokine receptor promotes IL-2 signaling in Tregs in the absence of exogenous IL-2.

[0226] In particular, the cytokine receptor is an engineered molecule comprising an IL-2 cytokine, an IL-2 receptor beta extracellular domain, a transmembrane domain, and an IL-2 receptor beta intracellular domain, wherein the IL-2 receptor beta extracellular domain is tethered to the IL-2 cytokine by a polypeptide linker. The cytokine receptor can comprise a IL-2RP polypeptide tethered to IL-2 at the N-terminus of the IL-2RP extracellular domain. In73MF-365934147Docket No.: 237752002540some embodiments, the tethered IL-2 molecule is mutated to reduce or abolish IL-2 cytokine binding to IL-2Ra and / or IL-2Ry chains.

[0227] In some embodiments, the cytokine receptors do not comprise a TCR activation domain or a costimulatory domain (e.g., a CD3 or a CD28 activation or costimulatory domain, such as a CD28 signaling domain). In some embodiments, the IL-2 cytokine is a naturally occurring IL-2 cytokine and / or a naturally occurring IL-2 receptor polypeptide, e.g., a naturally occurring IL-2Rp. In some embodiments, the cytokine receptor comprises a naturally occurring IL-2 cytokine but does not comprise a CD28 signaling domain (e.g., a CD28 activation domain or costimulatory domain). In some embodiments, the IL-2 cytokine comprises one or more amino acid substitutions. In some embodiments, the IL-2 cytokine comprises at least one or more amino acid substitution at positions selected from amino acid positions 18, 22, 126, 38, 43, 61, 29, 15, 16, 19, 20, 22, 23, and 81. In some embodiments, the IL-2 cytokine comprises one or more of the following substitutions L18R, Q22E, Q126H. In some embodiments, the IL-2 cytokine comprises one or more of the following substitutions R38D, K43E, and E61R. In some embodiments, the IL-2 cytokine comprises one or more of the substitutions selected from the group consisting of E15S, H16Q, L19V, D20L, M23Q, and R81D. In some embodiments, the IL-2 cytokine comprises one or more of the substitutions selected from the group consisting of E15S, H16Q, L19V, D20L, Q22K, and M23A. In some embodiments, the IL-2 cytokine comprises L18R, Q22E, and Q126H; and / or R38D, K43E, and E61R; and / or E15S, H16Q, L19V, D20L, M23Q, and R81D; and / or E15S, H16Q, L19V, D20L, Q22K, and M23A. In some embodiments, the IL-2 cytokine comprises L18R, Q22E, Q126H, R38D, K43E, and E61R. In some embodiments, the IL-2 cytokine comprises L18R, Q22E, Q126H, R38D, K43E, E61R, E15S, H16Q, L19V, D20L, M23Q, and R81D. In some embodiments, the IL-2 cytokine comprises L18R, Q22E, Q126H, R38D, K43E, E61R, E15S, H16Q, L19V, D20L, Q22K, and M23A. In some embodiments, the IL-2 cytokine comprises one or more amino acid substitutions selected from the group consisting of F42A, F42K, R38D, R38A, E61R, R38D and E61R, K35D, K43E, K43D, E15S, H16Q, L19V, D20L, Q22K, M23Q, M23A, and R81D. In some embodiments, the IL-2 receptor comprises an IL-2 cytokine comprising one or more of the amino acid substitutions selected from the group consisting of L18R, Q22E, Q126K, Q126H, Q126M, and Q126R. In some embodiments the IL-2 cytokine comprises the amino acid substitutions L18R, Q22E, and Q126K. In some embodiments the IL-2 cytokine comprises the amino acid substitutions L18R, Q22E, and Q126M. In some embodiments the IL-2 cytokine comprises the amino acid74MF-365934147Docket No.: 237752002540substitutions L18R, Q22E, and Q126R, which are described further in International Patent Application Publication WO2024 / 044716. WO2024 / 044716 is specifically incorporated herein by reference in its entirety.

[0228] In some embodiments, the IL-2 cytokine is tethered to the IL-2 receptor extracellular domain, e.g., the IL-2RP extracellular domain, by a polypeptide linker. In some embodiments, the polypeptide linker comprises glycines and serines.

[0229] Cytokine receptors described herein are derived from Interleukin-2 cytokine receptors, e.g., the IL-2RP, wherein the IL-2 tethered receptor is the Interleukin-2 Receptor beta (IL-2RP, or IL-2RB) chain of the IL-2R complex or a derivative thereof (e.g., an IL-2RP polypeptide comprising at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 amino acid variations such as substitutions, deletions, or additions compared to a naturally occurring IL-2RP polypeptide sequence). In some instances, amino acid variations may be introduced in the IL-2RP intracellular domain, for example to optimize, enhance, promote, increase, etc. intracellular IL-2 signaling, such as STAT5 phosphorylation. In other instances, amino acid variations may be introduced in the IL-2RP extracellular domain, for example to alter binding affinity to an IL-2 cytokine, for example to reduce binding to a naturally occurring IL-2 cytokine and simultaneously increase binding to a non-naturally occurring IL-2 cytokine, such as any non-naturally occurring (e.g., “mutant” or “mutated”) IL-2 cytokine described herein. In some instances, amino acid variations may be introduced in both the IL-2RP intracellular domain and the IL-2RP extracellular domain. Canonical IL-2 signaling causes STAT5 phosphorylation, thereby activating STAT5 nuclear translocation and initiation of target gene transcription. In some cells, e.g., T cells, including Treg cells, IL-2 signaling is required for cell survival and cell proliferation. Therefore, cytokine receptors comprising an IL-2RP polypeptide that is tethered to an IL-2 cytokine are able to activate cell survival and proliferation in the absence of exogenous IL-2 via preferentially binding to the tethered IL-2 cytokine.

[0230] In some embodiments, IL-2 tethered cytokine receptors described herein are described with respect to the tethered IL-2 cytokine. Thus, for example, an “WT IL-2-tethered” receptor comprises a wild-type IL-2 molecule linked to the IL-2RP polypeptide. In some embodiments, the cytokine receptor comprises an IL-2 cytokine with one or more amino acid substitutions that results in reduced or no binding affinity for the IL-2Ra (alternatively “IL-2RA”) polypeptide chain with minimal or no disruption of binding to the IL-2RP polypeptide chain, for example, reduced binding affinity for IL-2Ra to less than at 75MF-365934147Docket No.: 237752002540least about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1% or less than WT IL-2 binding affinity for IL-2Ra. In some embodiments, the IL-2 cytokine comprises at least one amino acid substitution that reduces affinity for IL-2Ra by at least about any of 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold- 40-fold, 45-fold, 50-fold, or more compared to WT IL-2 binding affinity for IL-2Ra. In some embodiments, the cytokine receptor comprises an IL-2 cytokine with one or more amino acid substitutions that results in reduced or no binding affinity for the IL-2Ry polypeptide chain with minimal or no disruption of binding to the IL-2RP polypeptide chain, for example, reduced binding affinity for IL-2Ry to less than at least about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1% or less than WT IL-2 binding affinity for IL-2Ry. In some embodiments, the IL-2 cytokine comprises at least one amino acid substitution that reduces affinity for IL-2Ry by at least about any of 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold- 40-fold, 45-fold, 50-fold, or more compared to WT IL-2 binding affinity for IL-2Ry. In some embodiments, the cytokine receptor comprises an IL-2 cytokine with one or more amino acid substitutions that displays reduced or no binding affinity for either or both of the IL-2Ra and / or IL-2Ry polypeptide chains with minimal or no disruption of binding to the IL-2RP polypeptide chain, for example, reduced binding affinity for IL-2Ra to less than at least about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1% or less than WT IL-2 binding affinity for IL-2Ra and / or reduced binding affinity for IL-2Ry to less than at least about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1% or less than WT IL-2 binding affinity for IL-2Ry. In some embodiments, the IL-2 cytokine comprises at least one amino acid substitution that reduces affinity for IL-2Ra by at least about any of 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold- 40-fold, 45-fold, 50-fold, or more and / or that reduces affinity for IL-2Ry by at least about any of 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold,76MF-365934147Docket No.: 2377520025403-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold- 40-fold, 45-fold, 50-fold, or more compared to WT IL-2 binding affinity for IL-2Ra and / or IL-2Ry.

[0231] In some embodiments, the cytokine receptor comprises an IL-2 cytokine with one or more amino acid substitutions that results in reduced or no binding affinity for the naturally occurring IL-2RP, but with enhanced binding affinity for a non-naturally occurring IL-2Rp. Thus, in some embodiments, the cytokine receptor comprises both an IL-2 cytokine with one or more amino acid substitutions and an IL-2RP polypeptide with one or more amino acid substitutions. For example, in some embodiments, the IL-2 cytokine comprises one or more amino acid substitutions at position(s) 15, 16, 19, 20, 22, 23, and 81, and the IL-2RP polypeptide comprises one or both amino acid substitutions at position(s) 133 and / or 134. See, e.g., Zhang et al., Sci Transl Med 13, eabg6986 (2021); and Sockolosky et al., Science 359, 1037-1042 (2018), hereby both incorporated by reference in their entirety.Human IL-2 can be mutated at positions i. E15S, H16Q, L19V, D20L, M23Q, and R81D, or ii. E15S, H16Q, L19V, D20L, Q22K, and M23A, and binds to human IL-2RP comprising mutations H133D and Y134F. In some embodiments, the IL-2 cytokine comprises at least one amino acid substitution that reduces affinity for naturally occurring IL-2RP to less than at least about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1% or less than WT IL-2 binding affinity for naturally occurring IL-2Rp. In some embodiments, the IL-2 cytokine comprises at least one amino acid substitution that reduces affinity for naturally occurring IL-2RP by at least about any of 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold, 9-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold- 40-fold, 45-fold, 50-fold, or more compared to WT IL-2 binding affinity for naturally occurring IL-2Rp. In some embodiments, the IL-2RP comprises at least one amino acid substitution that reduces affinity for naturally occurring IL-2 cytokine to less than at least about 50%, about 45%, about 40%, about 35%, about 30%, about 25%, about 20%, about 15%, about 10%, about 9%, about 8%, about 7%, about 6%, about 5%, about 4%, about 3%, about 2%, about 1% or less than WT IL-2RP binding affinity for naturally occurring IL-2 cytokine. In some embodiments, the IL-2RP comprises at least one amino acid substitution that reduces affinity for naturally occurring IL-2 cytokine by at least about any of 1.5-fold, 1.6-fold, 1.7-fold, 1.8-fold, 1.9-fold, 2-fold, 2.5-fold, 3-fold, 3.5-fold, 4-fold, 4.5-fold, 5-fold, 6-fold, 7-fold, 8-fold,77MF-365934147Docket No.: 2377520025409-fold, 10-fold, 15-fold, 20-fold, 25-fold, 30-fold, 35-fold- 40-fold, 45-fold, 50-fold, or more compared to WT IL-2RP binding affinity for naturally occurring IL-2 cytokine.

[0232] In some embodiments, the cytokine receptors are more effective for maintaining Treg cell persistence. In some embodiments, the cytokine receptor allows the transduced Treg cell to proliferate without exogenous IL-2. In some embodiments, the cytokine receptor increases the relative amount of Treg cells in a composition comprising a population of Treg cells transduced with the cytokine receptor over time.

[0233] In some embodiments, the cytokine receptors are more effective for maintaining Treg persistence compared to other strategies for producing exogenous IL-2 independent Tregs, such as, for example, Tregs that secrete IL-2 or Tregs comprising membrane-bound IL-2 tethered tag proteins. In some embodiments, cells transduced with the cytokine receptors provided herein are able to maintain a Treg phenotype and / or have increased persistence compared to Treg cells that secrete IL-2 or compared to Tregs comprising membrane-bound IL-2 tethered tag proteins.

[0234] In some embodiments, the cytokine receptors provided herein have significant advantages including, but not limited to: (1) expression in regulatory T cells (Tregs); (2) increasing Treg survival and proliferation in the absence of IL-2; (3) increased IL-2 receptor signaling via STAT5 phosphorylation; (4) ability to suppress effector T cells in the absence of IL-2 to about or approximately the same degree as wild-type Tregs grown in the presence of IL-2; (5) supports Treg expansion and survival for at least about 14 days, and / or at least about 23 days without exogenous IL-2; and (6) supports Treg identity for at least about 14 days, and / or at least about 23 days without exogenous IL-2.

[0235] In some embodiments, a Treg cell comprises more than one payload sequence. In some embodiments, the more than one payload sequences can encode (i) a polypeptide comprising a cytokine receptor that can be used for expanding Treg cells and comprises an IL-2 cytokine molecule tethered to the IL-2 receptor beta (IL-2RP) extracellular domain as described herein, and (ii) a polypeptide comprising a chimeric antigen receptor (CAR) comprising an extracellular accessory domain through which T cells expressing the CAR can be activated in an antigen-dependent fashion as described above. In some embodiments, a Treg cell of the present disclosure comprises a cytokine receptor that can be used for expanding Treg cells and comprises an IL-2 cytokine molecule tethered to the IL-2 receptor beta (IL-2RP) extracellular domain as described herein and a chimeric antigen receptor78MF-365934147Docket No.: 237752002540(CAR) comprising an extracellular accessory domain through which T cells expressing the CAR can be activated in an antigen-dependent fashion as described above.Vectors

[0236] Certain aspects of the present disclosure relate to polynucleotide vectors. In some embodiments, a polynucleotide vector comprises a synthetic promoter of this disclosure operably linked to a payload sequence that encodes a polypeptide of interest.

[0237] Polynucleotides can be isolated molecules, or can be included within a vector, such as a plasmid, a cosmid, an artificial chromosome or a virus. Such vectors can be used to transfect target cells, e.g., Treg cells. A vector can comprise an origin of replication, a selectable marker, a multiple cloning site, and elements for gene expression including a promoter with transcription regulatory elements, e.g., a synthetic TRSP as described herein, a ribosome binding site, a payload sequence as described herein, and a termination signal. Viral vectors can include a packaging signal, or an integration signal.

[0238] Expression constructs can be incorporated into vectors capable of transfecting cells. Such vectors include, without limitation, viral vectors, plasmids and micro vesicles, e.g., liposomes. Exemplary viral vectors adenoviral vectors Ad, AAV, lentivirus, and vesicular stomatitis virus (VSV) and retroviruses. Lend viruses are a genus of the Retro viridae family and include HIV, SIV, and FIV. Lentiviruses can deliver a large quantities of genetic material into the DNA of the host cell. They are able to infect non-dividing cells.

[0239] As used herein, the term “recombinant” or “non-natural” refers to an organism, microorganism, cell, nucleic acid molecule, or vector that includes at least one genetic alteration or has been modified by introduction of an exogenous nucleic acid molecule, wherein such alterations or modifications are introduced by genetic engineering. Genetic alterations include, for example, modifications introducing expressible nucleic acid molecules encoding proteins, fusion proteins, enzymes, other nucleic acid molecule additions, deletions, substitutions, or other functional disruption of a cell's genetic material. Additional modifications include, for example, non-coding regulatory regions in which the modifications alter expression of a gene or operon. In some embodiments, a cell, such as a regulatory T cell (Treg), obtained from a subject may be converted into a non-natural or recombinant regulatory T cell (Treg) (e.g., a non-natural or recombinant Treg) by introducing a nucleic acid that encodes a payload sequence as described herein and whereby the cell expresses a79MF-365934147Docket No.: 237752002540polypeptide encoded by the payload sequence that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability.

[0240] A vector that encodes a core virus is referred to herein as a “viral vector.” There are a large number of available viral vectors suitable for use with the compositions of the instant disclosure, including those identified for human gene therapy applications (see Pfeifer and Verma, Ann. Rev. Genomics Hum. Genet. 2:177, 2001). Suitable viral vectors include vectors based on RNA viruses, such as retrovirus-derived vectors, e.g., Maloney murine leukemia virus (MLV)-derived vectors, and include more complex retrovirus-derived vectors, e.g., lentivirus-derived vectors. HIV-l-derived vectors belong to this category. Other examples include lentivirus vectors derived from HIV-2, FIV, equine infectious anemia virus, SIV, and Maedi-Visna virus (ovine lentivirus). Methods of using retroviral and lentiviral viral vectors and packaging cells for transducing mammalian host Tregs with viral particles containing, e.g., chimeric antigen receptor payloads are known in the art and have been previously described, for example, in U.S. Pat. No. 8,119,772; Walchli et al., pLoS One 6:327930, 2011; Zhao et al., J. Immunol. 174:4415, 2005; Engels et al., Hum. Gene Ther. 14:1155, 2003; Frecha et al., Mol. Ther. 18:1748, 2010; and Verhoeyen et al., Methods Mol. Biol. 506:97, 2009. Retroviral and lentiviral vector constructs and expression systems are also commercially available.

[0241] In some embodiments, a viral vector is used to introduce a non-endogenous nucleic acid sequence encoding a payload sequence. A viral vector may be a retroviral vector or a lentiviral vector. A viral vector may also include nucleic acid sequences encoding a marker for transduction. Transduction markers for viral vectors are known in the art and include selection markers, which may confer drug resistance, or detectable markers, such as fluorescent markers or cell surface proteins that can be detected by methods such as flow cytometry. In particular embodiments, a viral vector further comprises a gene marker for transduction comprising green fluorescent protein, an extracellular domain of human CD2, or a truncated human EGFR (huEGFRt; see Wang et al., Blood 118:1255, 2011). When a viral vector genome comprises a plurality of nucleic acid sequences to be expressed in a host cell (e.g., T cell such as Treg) as separate transcripts, the viral vector may also comprise additional sequences between the two (or more) transcripts allowing bicistronic or multicistronic expression. Examples of such sequences used in viral vectors include internal ribosome entry sites (IRES), furin cleavage sites, viral 2A peptide, or any combination thereof.80MF-365934147Docket No.: 237752002540

[0242] Other vectors also can be used for polynucleotide delivery including DNA viral vectors, including, for example adenovirus-based vectors and adeno-associated virus (AAV)-based vectors; vectors derived from herpes simplex viruses (HSVs), including amplicon vectors, replication-defective HSV and attenuated HSV (Krisky et al., Gene Ther. 5: 1517, 1998).

[0243] Other vectors recently developed for gene therapy uses can also be used with the compositions and methods of this disclosure. Such vectors include those derived from baculoviruses and a-viruses. (Jolly, D J. 1999. Emerging Viral Vectors, pp 209-40 in Friedmann T. ed. The Development of Human Gene Therapy. New York: Cold Spring Harbor Lab), or plasmid vectors (such as sleeping beauty or other transposon vectors).

[0244] In certain embodiments, hematopoietic progenitor cells or embryonic stem cells are modified to comprise a non-endogenous nucleic acid molecule of this disclosure.Hematopoietic progenitor cells may comprise induced pluripotent stem cells, which may be derived or originate from fetal liver tissue, bone marrow, cord blood, or peripheral blood. The hematopoietic progenitor cells may be from human, mouse, rat, or other mammals.

[0245] In certain embodiments, the host cell transfected to express a synthetic TRSP and a payload sequence of this disclosure is a functional Treg.

[0246] In some embodiments, the host cell (e.g., Treg cell) contains the vector described above. The vector can be introduced to the cell using any suitable methods known in the art, including, but not limited to, DEAE-dextran mediated delivery, calcium phosphate precipitate method, cationic lipids mediated delivery, liposome mediated transfection, electroporation, microprojectile bombardment, receptor-mediated gene delivery, delivery mediated by polylysine, histone, chitosan, and peptides. Standard methods for transduction of cells for expression of a vector of interest are well known in the art.

[0247] In some embodiments, the present application provides methods of culturing the isolated host cell containing the vector under conditions that allow expression of the isolated nucleic acids inserted in the vectors. Suitable conditions for expression of polynucleotides may include, without limitation, suitable medium, suitable density of host cells in the culture medium, presence of necessary nutrients, presence of supplemental factors, suitable temperatures and humidity, and absence of microorganism contaminants. A person with ordinary skill in the art can select the suitable conditions as appropriate for the purpose of the expression.81MF-365934147Docket No.: 237752002540Regulatory T cells (Tregs)

[0248] Regulatory T (Treg) cells are involved in the maintenance of immunological self tolerance and in mitigating deleterious immune responses to both self and non-self (allo) antigens. Tregs comprise both natural and induced subtypes. Natural Tregs (nTregs) are cells which originate as a separate cell lineage during development. Peripheral or induced Tregs (iTregs) differentiate from conventional T cells. In some embodiments, CD4+ T cells that are not nTregs and not iTregs can be engineered into Tregs using the methods and compositions of the disclosure. In some embodiments, the CD4+ T cells are used to make Treg cells expressing payload sequences using the methods and compositions of the disclosure.

[0249] Treg markers include high levels of CD25 (CD25+), low levels of CD 127 (CD1271o), or both high CD25 and low CD127. The levels of CD25 and CD127 are compared, for example to a CD4+ T cell that is not a Treg. In some embodiments, the Treg cell expressing the payload sequence has a high CD25, high CD4, and low CD127 phenotype. Treg cells are also characterized by high levels of FOXP3 and / or Helios expression (as opposed to “destabilized” Treg cells, which typically have much lower levels of FOXP3 and / or Helios expression). Teff cells may be distinguished from Treg cells by much lower levels of FOXP3 and / or Helios expression, lower levels of CD25 expression, and / or higher levels of CD 127 expression.

[0250] Tregs include CD4+ T cells that characteristically express the high-affinity IL-2 receptor a-chain (CD25) and master transcription factor Forkhead box P-3 (Foxp3) which is essential for their suppressive phenotype and stability. As activated CD4+ T cells can upregulate CD25 expression, an additional defining feature of Tregs is the absence of IL-7 receptor a-chain (CD127). Their function includes dominant controllers of self-tolerance, tissue inflammation, long-term immune homeostasis, among others. Despite making up only 5%— 10% of the peripheral CD4+ T cell pool, Tregs exert powerful inhibitory effects on effector cells through a variety of mechanisms including cytokine secretion, metabolic disruption, inhibition of dendritic cells (DCs), and cytolysis. These mechanisms have been rigorously examined using animal models and shown to regulate autoimmune disease. For example, studies in patients with inflammatory bowel disease (IBD) have identified defects in the number and distribution of Tregs and their ability to traffic to the GI tract. Additionally, resistance to Treg-mediated suppression has been noted in lamina propria T effector cells (Teffs).82MF-365934147Docket No.: 237752002540

[0251] Tregs can be broadly divided into two groups, thymic Tregs (tTregs) or peripherally induced Tregs (pTregs), based on their developmental origin.

[0252] tTregs are generated in the thymus in the early neonatal period and migrate to peripheral organs thereafter where they maintain tolerance. Further, thymically derived CD4+CD25+ T cells possess the ability to suppress autoreactive T cells and eliminate autoimmunity; therefore, tTregs are important for maintenance of self-tolerance and prevention and / or control of autoimmune disease. pTregs are generated when naive CD4+CD25- T cells are converted into Foxp3-expressing CD4+CD25+ Tregs by T cell receptor (TCR) co-stimulation in the presence of transforming growth factor p (TGF-p, TGFbeta). pTreg conversion in gut- associated lymphoid tissues (GALTs) is enhanced when naive CD4+ T cells encounter an antigen in the presence of TGF-p, IL-2, and retinoic acid (RA). For example, pTregs are found in abundance in the intestinal lamina propria where interactions with environmental antigens can shape phenotypic differences and transcription factor expression. In patients with active IBD, the intestinal lamina propria Treg pool was significantly smaller than that of a positive control, namely patients with diverticulitis.Additionally, in these patients, the peripheral blood Treg pool was smaller as compared to inactive IBD or diverticulitis.

[0253] Tregs function as key mediators of peripheral tolerance through direct cellular contact and paracrine actions on tissues where they reside, for example, IL- 10- secreting Tregs can help control inflammatory responses and selective disruption of IL- 10 expression in these Tregs has been shown to cause autoimmune disease. This is one of many modalities that Tregs can employ to maintain immune homeostasis at the site of action. Others include inhibitory cytokine secretion, cytolysis of effector cells, metabolic disruption, neutralization of antigen presenting cells and promotion of tissue repair. The Treg cytokine repertoire includes the anti-inflammatory molecules IL-10, TGF-p, IL-35, PD-1, among others (as discussed herein). Tregs are capable of producing TGF-p, which profoundly suppresses the proliferation of effector T cells (Teffs). TGF-P and IL-35 can induce the generation of Tregs from naive CD4+ T cells. In some embodiments, provided herein are cells that secrete one or more cytokines, preferably an anti-inflammatory cytokine, more preferably an immune checkpoint inhibitor, even more preferably IL-10, TGF-p, and / or PD-1. In some embodiments, the cell further comprises one or more payload sequences, for example a CAR or a cytokine receptor as described herein.83MF-365934147Docket No.: 237752002540

[0254] The development and function of Tregs is associated with IL-2. IL-2 and the transcription factor STAT5, downstream of IL-2 alpha receptor (IL-2R alpha, i.e., CD25), induce the expression of Foxp3 and differentiation of tTregs. STAT5 activation driven by IL-2 IL-2Ralpha (CD25) and subsequent signaling enhances the suppressor function of differentiated Tregs. Further, Tregs can sequester local IL-2 reducing the available cytokine concentration for actively dividing Teffs reducing their ability to survive and proliferate. In certain embodiments, provided herein are cells comprising CD25. In some embodiments, the cell comprises one or more CD25 bound to IL-2. In some embodiments, the cell further comprises one or more payload sequences, for example a CAR.

[0255] Tregs can also interfere with ATP metabolism to dampen proinflammatory responses. Tregs co-express the ectoenzymes CD39 and CD73 responsible for the degradation of ATP and generation of pericellular adenosine. Adenosine stimulates the A2A receptor on Teffs exerting potent inhibitory effects. Activation of the A2A receptor also inhibits IL-6 expression while enhancing the production of TGF-p. This promotes the development of adaptive induced Tregs and simultaneously inhibits proinflammatory Thl7 cell formation. In some embodiments, provided herein are cells the co-express one or more immunosuppressive enzymes. In some embodiments, the cell secretes CD39 and / or CD73.

[0256] The activation of T cells comprises TCR antigen / major histocompatibility complex engagement in the context of a secondary signal, namely T cell-derived CD28 binding the dendritic cell (DC) B7 ligands, CD80 and CD86. This process is negatively regulated through the production of cytotoxic T lymphocyte associated protein 4 (CTLA-4) which is constitutively expressed in Foxp3+ Tregs.

[0257] Tregs further can promote cell lysis of Teffs to suppress their activity. Granzyme-B expressing CD4+ Tregs can promote lysis of target cells in a perforin-dependent, but TCR-independent manner. Activated Tregs upregulate tumor necrosis factor-related apoptosis inducing ligand (TRAIL) which enhances CD4+ suppressive activity as well as cytotoxicity against T cells.

[0258] Tregs may further aid in tissue repair and maintenance distinct from their suppressive function.

[0259] Treg cells into which expression constructs of this disclosure have been incorporated can express these payload sequences, e.g., CARs and be used in the methods described herein to treat Treg-associated dysfunctions. Genetic loci suitable for insertion of a84MF-365934147Docket No.: 237752002540CAR- or exogenous TCR-encoding sequence include but are not limited to safe harbor loci (e.g., the AAVS1 locus) TCR subunit loci (e.g., the TCRa constant (TRAC) locus, the TCRP constant 1 (TRBC1) locus, and the TCRP constant 2 (TRBC2) locus). It is understood that insertion in the TRAC locus reduces tonic CAR signaling and enhances T cell potency (see, Eyquem et al. (2017) NATURE, 543: 113). Furthermore, inactivation of the endogenous TRAC, TRBC1, or TRBC2 gene may reduce a graft- versus-host disease (GVHD) response, thereby allowing use of allogeneic T cells as starting materials for preparation of CAR T cells. Accordingly, in certain embodiments, an immune cell, e.g., a T cell, is engineered to have reduced expression of an endogenous TCR or TCR subunit, e.g., TRAC, TRBC1, and / or TRBC2. The cell may be engineered to have partially reduced or no expression of the endogenous TCR or TCR subunit. For example, in certain embodiments, the immune cell, e.g., a T cell, is engineered to have less than 80% (e.g., less than 70%, less than 60%, less than 50%, less than 40%, less than 30%, less than 20%, less than 10%, or less than 5%) of the expression of the endogenous TCR or TCR subunit relative to a corresponding unmodified or parental cell. In certain embodiments, the immune cell, e.g., a T cell, is engineered to have no detectable expression of the endogenous TCR or TCR subunit. Exemplary approaches to reduce expression of TCRs using CRISPR systems are described in U.S. Patent No.9,181,527, Liu et al. (2017) CELL RES, 27: 154, Ren et al. (2017) CLIN CANCER RES, 23: 2255, Cooper et al. (2018) LEUKEMIA, 32: 1970, and Ren et al. (2017) ONCOTARGET, 8:17002.

[0260] In some embodiments, the cell expresses one or more proteins associated with a Treg phenotype. In some embodiments, the cell expresses FOXP3. FOXP3 plays a crucial role in development and function of Treg cells (see Yagi et al. 2004, Int Immunol. 16(11): 1643-56; Sadlon et al. 2018, Clin Transl Immunology 7(2):el011). FOXP3 is initially expressed during the expansion of T cells for a first time but is followed by the loss of FOXP3 expression after polyclonal stimulation. This is in contrast to Tregs, where FOXP3 expression rises and is maintained over time. Expression levels of FOXP3 may be assessed by conventional methods such as Western blotting, flow cytometry, or ELISA. Expression levels may also be assessed by analyzing mRNA using techniques such as RT-qPCR. In some embodiments, expression of FOXP3 increases compared to untransduced cells. In some embodiments, expression of FOXP3 is increased compared to cells without the synthetic TRSPs and payload sequences described herein.85MF-365934147Docket No.: 237752002540

[0261] In some embodiments, FOXP3 expression increases at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, or more compared to untransduced cells or non-Treg cells comprising the synthetic TRSPs and payload sequences described herein. In some embodiments, FOXP3 expression increases at least about 1.1-fold, at least about 1.5-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, or more compared to cells that have not been transduced or non-Treg cells that have been transduced. In some embodiments, the expression of FOXP3 is increased in transduced Tregs compared to untransduced cells cultured without one or more cytokines or transduced non-Tregs. In some embodiments, the expression of FOXP3 is increased in the transduced Tregs compared to untransduced cells cultured with a cytokine that is not IL-2 or transduced non-Tregs. In some embodiments, FOXP3 expression is maintained at approximately the same level as the day of highest FOXP3 expression following transduction.

[0262] In some embodiments, the Treg cell is CD4 positive (CD4+). In some embodiments, the cell is CD4+ / CD25+. In some embodiments, the cell is CD4+ / CD127 low (z.e., CD4+ / CD1271o). In some embodiments, the cell is CD4+ / CD25+ / CD127 low (z.e., CD4+ / CD25+ / CD 12710).

[0263] Tregs can be characterized by expression of CD25+. In some embodiments, the cell is Treg cell is CD25+. In some embodiments, the cell is CD4+ / CD25+. In some embodiments, the cell is CD25+ / CD127 low (z.e., CD25+ / CD1271o). In some embodiments, the cell is CD4+ / CD25+ / CD127 low (z.e., CD4+ / CD25+ / CD1271o).

[0264] In some embodiments, the cell expresses a low level of CD127 (CD1271o). In some embodiments, the cell is CD4+ / CD127 low (z.e., CD4+ / CD1271o). In some embodiments, the cell is CD25+ / CD127 low (z.e., CD25+ / CD1271o). In some embodiments, the cell is CD4+ / CD25+ / CD127 low (z.e., CD4+ / CD25+ / CD1271o). In some embodiments, cells transduced with the recombinant cytokine receptors provided herein maintain CD 127 low (CD1271o) status upon transduction.

[0265] HELIOS is a transcription factor that is expressed in Tregs. In some embodiments, the Treg cells of the present disclosure express HELIOS. In some embodiments, the expression of HELIOS is increased compared to conventional T cells. In some embodiments, the expression of HELIOS is detectable compared to conventional T cells. Expression levels of HELIOS may be assessed by conventional methods such as Western blotting, flow cytometry, or ELISA. Expression levels may also be assessed by analyzing mRNA using86MF-365934147Docket No.: 237752002540techniques such as RT-qPCR. In some embodiments, HELIOS expression increases at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold, at least 6-fold, at least 7-fold, at least 8-fold, at least 9-fold, at least 10-fold, at least 20-fold, or more compared to conventional T cells. In some embodiments, the expression of HELIOS is increased in the transduced Tregs compared to untransduced cells cultured without cytokine or transduced non-Tregs. In some embodiments, transduced Tregs maintain HELIOS expression following transduction.

[0266] Methods of measuring markers used to characterize Treg cells will be readily apparent to the person of ordinary skill in the art. For example, Tregs or populations of T cells comprising Tregs can be cultured using the methods described herein. Following culturing, Tregs can be collected and stained using antibodies against Treg markers such as FOXP3 (e.g., labeled by PE), CD25 (e.g., labeled by APC), and CD 127 (e.g., labeled by BV421) and expression analyzed using fluorescence activated flow cytometry (FACS) or fluorescence microscopy. Gene expression may be measured by methods such as RT-qPCR.Pharmaceutical Compositions and Kits

[0267] Also provided herein are pharmaceutical compositions comprising a Treg cell comprising a synthetic TSRP and a payload sequence, and a pharmaceutically acceptable carrier.

[0268] Pharmaceutically acceptable carriers will generally be sterile, at least for human use. A pharmaceutical composition will generally comprise agents for buffering and preservation in storage, and can include buffers and carriers for appropriate delivery, depending on the route of administration. Examples of pharmaceutically acceptable carriers include, without limitation, normal (0.9%) saline, phosphate-buffered saline (PBS), Hank's balanced salt solution (HBSS) and multiple electrolyte solutions such as PlasmaLyte ATM (Baxter).

[0269] Injectable (e.g., intravenous) compositions can comprise a solution of the composition suspended in an acceptable carrier, such as an aqueous carrier. Any of a variety of aqueous carriers can be used, e.g., water, buffered water, 0.4% saline, 0.9% isotonic saline, 0.3% glycine, 5% dextrose, and the like, and may include glycoproteins for enhanced stability, such as albumin, lipoprotein, globulin, etc. Often, normal buffered saline (135-150 mM NaCl) will be used. The compositions can contain pharmaceutically acceptable auxiliary substances to approximate physiological conditions, such as pH adjusting and buffering agents, tonicity adjusting agents, wetting agents, e.g., sodium acetate, sodium lactate, sodium87MF-365934147Docket No.: 237752002540chloride, potassium chloride, calcium chloride, sorbitan monolaurate, triethanolamine oleate, etc. In some embodiments, the composition can be formulated in a kit for intravenous administration.

[0270] Cells can be cryopreserved. Cryopreservation can include formulating cells with a cryopreservation agent, such as DMSO. Commercially available media include, for example, CryoStor® and pZerve®, available from Millipore Sigma.

[0271] Compositions can be formulated as forms for administration, i.e., in a particular format for the pharmaceutical, and depends on the route of administration. Examples of such forms include, but are not limited to: dispersions; suppositories; ointments; cataplasms (poultices); pastes; powders; dressings; creams; plasters; solutions; patches; aerosols (e.g., nasal sprays or inhalers); gels; liquid dosage forms suitable for oral or mucosal administration to a patient, including suspensions (e.g., aqueous or non-aqueous liquid suspensions, oil-in-water emulsions, or a water-in-oil liquid emulsions), solutions, and elixirs; liquid dosage forms suitable for parenteral administration to a patient; and sterile solids (e.g., crystalline or amorphous solids) that can be reconstituted to provide liquid dosage forms suitable for parenteral administration to a patient.

[0272] In certain embodiments, a pharmaceutical composition may contain a sustained-or controlled-delivery formulation. Techniques for formulating sustained- or controlled-delivery means, such as liposome carriers, bio-erodible microparticles or porous beads and depot injections, are also known to those skilled in the art. Sustained-release preparations may include, e.g., porous polymeric microparticles or semipermeable polymer matrices in the form of shaped articles, e.g., films, or microcapsules. Sustained release matrices may include polyesters, hydrogels, polylactides, copolymers of L-glutamic acid and gamma ethyl-L-glutamate, poly (2-hydroxyethyl-inethacrylate), ethylene vinyl acetate, or poly-D(-)-3-hydroxybutyric acid. Sustained release compositions may also include liposomes that can be prepared by any of several methods known in the art.

[0273] The pharmaceutical compositions to be used for in vivo administration are generally formulated as sterile, substantially isotonic, and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.Sterility is readily accomplished by filtration through sterile filtration membranes, for example the filtration of any liquid solutions as described herein used for reconstituting, storing, etc. the Treg cells or pharmaceutical composition described herein. In some88MF-365934147Docket No.: 237752002540embodiments, the composition is free of pathogens. For injection, the pharmaceutical composition can be in the form of liquid solutions, for example in physiologically compatible buffers such as Hank's solution or Ringer's solution.

[0274] In some embodiments, the pharmaceutical composition is suitable for administration to a human. In some embodiments, the pharmaceutical composition is suitable for administration to a rodent (e.g., mice, rats) or non-human primates (e.g., Cynomolgus monkey). In some embodiments, the pharmaceutical composition is cryopreserved.

[0275] The present application also provides kits comprising compositions (such as pharmaceutical compositions) described herein and may further comprise instruction(s) on methods of using the composition, such as uses described herein. The kits described herein may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for performing any methods described herein.Methods of Treatment

[0276] Certain aspects of the present disclosure relate to methods of treating an immune-related disorder. The methods of the present disclosure can comprise administering an engineered Treg cell comprising a synthetic Treg specific promoter operably linked to a payload sequence as described herein. A method of treating an immune-related disorder in a subject as described herein can comprise isolating (a) isolating T cells from a biological sample obtained from subject; (b) enriching the T cells for T regulatory (Treg) cells; (c) transfecting the enriched Treg cells with the vector of any of the preceding embodiments; (d) expanding the transfected Treg cells; and (e) administering the expanded Treg cells to the subject.

[0277] Tregs maintain immune homeostasis and confer immune tolerance. The engineered Treg cells as disclosed herein may be autologous or allogeneic, can be used in cell-based therapy to treat patients in need of induction of immune tolerance or restoration of immune homeostasis, such as patients receiving organ transplantation or allogeneic cell therapy and patients with an autoimmune diseases. The present Treg cells will have enhanced immune-regulatory activities, including improved tissue specificity and / or increased immunosuppressive functions. The Tregs will actively control the proliferation and activation of Teffs locally and / or systemically through receptor-mediated cell-to-cell contact and secretion of immunosuppressive cytokines as disclosed herein. Further, since Treg cells can89MF-365934147Docket No.: 237752002540proliferate and self-renew, the cells as disclosed herein can achieve long-term tolerance when used as cell therapies to treat autoimmune disease.

[0278] Cells can be expanded ex vivo before administration to a subject.

[0279] Immune conditions, diseases, disorders and reactions or responses to be treated according to the methods and compositions of the present disclosure means a disease in which the immune system contributes to pathogenesis or can be part of the treatment. These reactions include, but are not limited to, cancers, inflammation, autoimmune conditions, disorders or diseases and persistent and progressive immune reactions to infectious non-selfantigens from bacterial, viral (e.g., HCV), fungal, or parasitic organisms which invade and persist within mammals and humans. Such conditions and disorders include allergies and / or asthma. The allergies and asthma may be due to sensitization with foreign or non-selfantigens as pollen, animal dander and food proteins. The source of the provoking foreign antigen can be plant, fungal, mold, or other environmental contaminants.

[0280] Autoimmune disease is a condition arising from an abnormal immune response to a functioning body part, e.g., when a subject’s own immune system mistakenly attacks healthy cells. About 24 million (-7.5%) people in the United States alone are affected by an autoimmune disease. Both humans and non-human animals suffer from autoimmune diseases.

[0281] It is contemplated that the compositions and methods disclosed herein can be used to genetically engineer cells sourced from a healthy individual and / or a subject suffering from any autoimmune disease, and the resulting genetically engineered cells can be used to treat a patient suffering from an autoimmune disease. In certain embodiments, one or more cells are isolated from a subject suffering from an autoimmune disease. In certain embodiments, the one or more cells are genetically engineered to comprise one or more payload sequences.

[0282] The compositions and methods provided herein can be used to treat any autoimmune disease. Exemplary autoimmune diseases include but are not limited to Acquired aplastic anemia, Acquired hemophilia, Acromegaly, Acute disseminated encephalomyelitis, Acute hemorrhagic leukoencephalitis, Adult-onset Still's disease, Agammaglobulinemia, Alopecia areata, ANCA-associated vasculitis, Ankylosing spondylitis, Anti-GBM / anti-TBM disease, Anti-NMDA receptor encephalitis, Antiphospholipid syndrome, Arteriosclerosis, Asherson's syndrome, Atopic Dermatitis, Autoimmune Addison’s disease, Autoimmune autonomic ganglionopathy, Autoimmune dysautonomia, Autoimmune encephalitis, Autoimmune gastritis, Autoimmune gastrointestinal dysmotility, Autoimmune hemolytic90MF-365934147Docket No.: 237752002540anemia, Autoimmune hepatitis, Autoimmune hyperlipidemia, Autoimmune hypophysitis, Autoimmune inner ear disease, Autoimmune lymphoproliferative syndrome, Autoimmune myelofibrosis, Autoimmune myocarditis, Autoimmune oophoritis, Autoimmune pancreatitis, Autoimmune poly endocrine syndrome type II, Autoimmune polyglandular syndromes, types I, II, & III, Autoimmune progesterone dermatitis, Autoimmune retinopathy, Autoimmune sudden sensorineural hearing loss, Autoimmune thrombocytopenia, Autoimmune thrombocytopenic purpura, Autoimmune thyroiditis, Balo disease, Behget’s disease, Berger's disease, Birdshot chorioretinopathy, Birdshot uveitis, Bullous pemphigoid, Castleman disease, Catastrophic antiphospholipid syndrome, Celiac disease, Chagas disease, Chronic fatigue syndrome, Chronic inflammatory demyelinating polyneuropathy, Chronic Lyme disease, Chronic lymphocytic thyroiditis, Chronic urticaria, Churg-Strauss syndrome / eosinophilic granulomatosis with polyangiitis, Cogan’s syndrome, Cold agglutinin disease, Complex regional pain syndrome, CREST syndrome, Crohn’s disease, Cronkhite-Canada syndrome, Cryptogenic organizing pneumonia, Dermatitis herpetiformis, Dermatomyositis, Devic's disease, Diabetes (type 1), Discoid lupus, Dressier’s syndrome, Eczema, Endometriosis, Eosinophilic esophagitis, Eosinophilic fasciitis, Erythema nodosum, Essential mixed cryoglobulinemia, Evans syndrome, Fibrosing alveolitis, Giant cell arteritis, Giant Cell Myocarditis, Glomerulonephritis, Goodpasture’s syndrome, Granulomatosis with polyangiitis, Graves disease, Guillain-Barre syndrome, Hashimoto’s thyroiditis, Hemifacial atrophy, Henoch-Schonlein purpura, Herpes gestationis, Hidradenitis suppurativa, Horton’s disease, Hurst’s disease, Hypogammaglobulinemia, Idiopathic pulmonary fibrosis, IgA nephropathy, IgA vasculitis, IgG4-related sclerosing disease, Immune thrombocytopenia (ITP), Immune-mediated necrotizing myopathy, Inclusion body myositis, Interstitial cystitis, Juvenile dermatomyositis, Juvenile idiopathic arthritis, Juvenile myositis, Juvenile polymyositis, Kawasaki disease, Lambert-Eaton myasthenic syndrome, Leukocytoclastic vasculitis, Lichen planus, Lichen sclerosus, Ligneous conjunctivitis, Limited cutaneous systemic sclerosis, Linear IgA bullous dermatosis, Linear IgA disease, Lupus nephritis, Lyme disease, Lymphocytic colitis, Meniere’s disease, Mesenteric Panniculitis, Microscopic colitis, Microscopic polyangiitis, Mixed connective tissue disease, Mooren’s ulcer, Mucha-Habermann disease, Multifocal motor neuropathy, Multiple sclerosis, Myalgic encephalomyelitis, Myasthenia gravis, Narcolepsy, Neuromyelitis optica, Ocular cicatricial pemphigoid, Opsoclonus-myoclonus syndrome, Palindromic rheumatism, Palmoplantar Pustulosis, PANS / PANDAS, Paraneoplastic cerebellar degeneration, Paraneoplastic pemphigus, Paroxysmal nocturnal hemoglobinuria, Parry-Romberg syndrome, Pars planitis,91MF-365934147Docket No.: 237752002540Parsonage-Turner syndrome, Pemphigus foliaceus, Pemphigus gestationis, Pemphigus vulgaris, Peripheral uveitis, Pernicious anemia, POEMS syndrome, Polyarteritis nodosa, Polymyalgia rheumatica, Polymyositis, Post-treatment Lyme disease syndrome, Postmyocardial infarction, Postpericardiotomy syndrome, Postural orthostatic tachycardia syndrome, Primary biliary cholangitis, Primary biliary cirrhosis, Primary sclerosing cholangitis, Progressive facial hemiatrophy, Psoriasis, Psoriatic arthritis, Pulmonary fibrosis, idiopathic, Pure red cell aplasia, Pyoderma gangrenosum, Raynaud’s syndrome / phenomenon, Reactive arthritis, Reflex sympathetic dystrophy syndrome, Reiter’s syndrome, Relapsing polychondritis, Restless leg syndrome, Rheumatic fever, Rheumatoid arthritis, Sarcoidosis, Schmidt syndrome, Scleritis, Scleroderma, Sclerosing Mesenteritis, Serpiginous choroidopathy, Sjogren’s syndrome, Small fiber sensory neuropathy, Stiff person syndrome, Subacute bacterial endocarditis, Susac syndrome, Sydenham's chorea, Sympathetic ophthalmia, Systemic lupus erythematosus, Takayasu’s arteritis, Temporal arteritis, Testicular autoimmunity, Thyroid eye disease, Tolosa-Hunt syndrome, Transverse myelitis, Tubulointerstitial nephritis uveitis syndrome, Ulcerative colitis, Undifferentiated connective tissue disease, Uveitis, Vasculitis, VEXAS Syndrome, Vitiligo, Vogt-Koyanagi-Harada syndrome, Wegener’s granulomatosis, Willis-Ekbom disease.

[0283] Typically, treatment of autoimmune diseases depends on the type and severity of the condition. Standard treatment methods include: vitamin or hormone supplementation, blood transfusions if the disease is blood related, physical therapy if the disease impacts bones, joints, or muscles, immunosuppressant drugs to reduce the immune response against the body's own tissues, such as non-steroidal anti-inflammatory drugs (NSAIDs), glucocorticoids, and disease-modifying anti-rheumatic drugs (DMARDs). Because immunosuppressants weaken the overall immune response, relief of symptoms must be balanced with preserving the patient's ability to combat infections, which could potentially be life-threatening. Additional options include monoclonal antibodies that can be used to block pro-inflammatory cytokines, antigen- specific immunotherapy which allows immune cells to specifically target the abnormal cells that cause autoimmune disease, co-stimulatory blockade that works to block the pathway that leads to the autoimmune response, and regulatory T cell therapy that utilizes this special type of T cell to suppress the autoimmune response.

[0284] After transfection with the synthetic promoters and payload sequences of the present disclosure, the viability of transfected Treg cells may be increased relative to untransfected cells. Target cells can be “autologous” (i.e. patient derived) or allogenic (i.e.,92MF-365934147Docket No.: 237752002540same cell type, bit from different subject). Optionally, allograft rejection, such as that associated with transplant rejection by including an MHC-specific chimeric antigen receptor in the CAR cassette. Noyan et al., 2017, Am. J. Transplantation 17: 917-930.

[0285] Exemplary methods for Treg therapy are provided by Romano et al., 2016, Transplant International 2017, 30:745-753. Treg cell population can be expanded ex vivo, by methods described by Xia et al., 2009, Transl. Res. 2009 153(2): 60-70 (E.g., amplification of FoxP3+, CD4+ and CD25+ cells). After expansion, Treg identity can be confirmed by detecting cell surface markers known to be associated with Treg, such as CD4+, CD25+ and CD1271ow. Non T-reg cells can identified and excluded by suitable cell surface marker detection, e.g., CD4+, CD25+ and CD127+.

[0286] Cells can be administered using infusion techniques commonly known in immunotherapy, (e.g. Rosenberg et al., New Eng. J. med. 319: 1676, 1988).

[0287] Alternatively, the transfected Treg cells may be administered by any convenient matter, including injection, transfusion, subcutaneously, intradermally, intratumorally, intranodally, interamedullary, intramuscularly, intravenously, intraarterially or intraperitoneally. In a particular embodiment, the administration method is intravenously.

[0288] Having generally described the compositions, methods, and processes of this disclosure, the same will be better understood by reference to certain specific examples, which are included herein to further illustrate the disclosure and are not intended to limit the scope of the invention as defined by the claims.EXEMPLARY EMBODIMENTS

[0289] Exemplary embodiments of the methods described herein include:1. A method of manufacturing Treg cells, the method comprising:(a) isolating T cells from a biological sample; and(b) transfecting the cells with a polynucleotide vector comprising a synthetic promoter operably linked to a payload sequence, wherein:(i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and comprises a plurality of transcription factor response elements (TREs) that are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOX10, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE,93MF-365934147Docket No.: 237752002540ETV5CEBPD_01, NFATC1 and AHRIF, and that are operably linked to a core promoter; and(ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability.2. The method of embodiment 1, further comprising enriching the T cells for Treg cells prior to transfecting the cells.3. The method of embodiment 1 or 2, further comprising expanding the Treg cells.4. The method of embodiment 3, wherein the Treg cell expansion is performed in the absence of exogenous IL-2.5. A method of selectively enriching Treg cells in a population of T cells, the population comprising Treg cells and Teff cells, the method comprising:(a) transfecting the cells with a polynucleotide vector comprising a synthetic promoter operably linked to a payload sequence, wherein:(i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and comprises a plurality of transcription factor response elements (TREs) that are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, and that are operably linked to a core promoter; and(ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability; and (b) culturing the cells.6. The method of embodiment 5, wherein step (b) is performed in the absence of exogenous IL-2.7. The method of any one of embodiments 1-6, wherein the cells are not sorted by cell surface marker expression.94MF-365934147Docket No.: 2377520025408. The method of any one of embodiments 1-7, wherein the transfected Treg cells proliferate at an increased rate compared to Treg cells lacking the polynucleotide vector or cells other than Treg cells transfected with the polynucleotide vector.9. The method of embodiment 8, wherein the rate of proliferation is increased by about two-fold, about three-fold, about four-fold, or about five-fold.10. The method of any one of embodiments 1-9, wherein the method comprises a reduced risk of Teff cell contamination as compared to a method performed without the polynucleotide vector.11. The method of any one of embodiments 1-10, wherein the Treg cells maintain expression of least one Treg marker selected from the group consisting of CD4+, CD25+, and CD 127 lo.12. The method of any one of embodiments 1-11, further comprising using anti-CD3 / CD28 coated beads, wherein the anti-CD3 / CD28 coated beads activate the Treg cells.13. The method of any one of embodiments 1-12, wherein the synthetic promoter promotes transcription of the payload sequence in Treg cells by a factor of at least two times, three times, five times, ten times, 20 times or 50 times more as compared to transcription of the payload sequence in Teff cells.14. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence increases IL-2 availability, IL-2 secretion, IL-2 signaling, and / or IL-2 expression.15. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence reduces pro-inflammatory cytokine availability.16. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence increases TGF-P availability.95MF-365934147Docket No.: 23775200254017. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises an IL-2 cytokine.18. The method of embodiment 17, wherein the IL-2 cytokine comprises one or more amino acid substitutions that alters affinity for one or more receptors, as compared to an IL-2 cytokine lacking the one or more amino acid substitutions.19. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises a chimeric antigen receptor (CAR) comprising:an antigen-binding domain,a first linker,an antibody-inducible domain,a transmembrane domain, andan intracellular signaling domain,wherein the antibody-inducible domain is a polypeptide of from about 60 to about 360 amino acids in length.20. The method of embodiment 19, further comprising providing an antibody to the cells, wherein the antibody binds to the antibody-inducible domain.21. The method of embodiment 20, wherein a T cell in which the CAR is expressed is activatable upon binding of the antibody to the antibody-inducible domain.22. The method of any one of embodiments 19-21, further comprising providing to the cells IL-2.23. The method of any one of embodiments 20-22, wherein the antibody-inducible domain comprises a domain selected from the group consisting of a vascular endothelial growth factor receptor 2 (VEGFR2) domain, a human epidermal growth factor receptor 2 (HER2) domain, a platelet-derived growth factor receptor- alpha (PDGFRa) domain, an interleukin-4 receptor- alpha (IL-4Ra) domain, a CD4 domain, and a CD2 domain.24. The method of embodiment 23, wherein the antibody-inducible domain comprises a VEGFR2 domain, wherein the VEGFR2 domain is bindable by an anti-VEGFR2 antibody or 96MF-365934147Docket No.: 237752002540VEGFR2-binding fragment thereof selected from the group consisting of ramucirumab and alacizumab, and optionally wherein the VEGFR2 domain is bindable by ramucirumab.25. The method of embodiment 23, wherein the antibody-inducible domain comprises a HER2 domain, wherein the HER2 domain is bindable by an anti-HER2 antibody or HER2-binding fragment thereof selected from the group consisting of trastuzumab, margetuximab, pertuzumab, and timigutuzumab, and optionally wherein the HER2 domain is bindable by trastuzumab.26. The method of embodiment 23, wherein the antibody-inducible domain comprises a PDGFRa domain, wherein the PDGFRa domain is bindable by an anti-PDGFRa antibody or PDGFRa-binding fragment thereof selected from the group consisting of olaratumab and tovetumab.27. The method of embodiment 23, wherein the antibody-inducible domain comprises an IL-4Ra domain, and wherein the IL-4Ra domain is bindable by an anti-IL-4Ra antibody or IL-4Ra-binding fragment thereof selected from the group consisting of dupilumab and pascolizumab.28. The method of embodiment 23, wherein the antibody-inducible domain comprises a CD4 domain, and wherein the CD4 domain is bindable by an anti-CD4 antibody or CD4-binding fragment thereof selected from the group consisting of cedelizumab, clenoliximab, ibalizumab, keliximab, priliximab, tregalizumab, zanolimumab, and semzuvolimab.29. The method of embodiment 23, wherein the antibody-inducible domain comprises a CD2 domain, and wherein the CD2 domain is bindable by an anti-CD2 antibody or CD2-binding fragment thereof, wherein the anti-CD2-antibody is siplizumab.30. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises a cytokine receptor comprising:an extracellular cytokine receptor domain, a transmembrane domain, and an intracellular IL-2 receptor beta chain domain, wherein the extracellular cytokine receptor domain binds to a cytokine other than IL-2.97MF-365934147Docket No.: 23775200254031. The method of embodiment 30, wherein the cytokine other than IL-2 that binds to the extracellular cytokine receptor domain activates intracellular IL-2 signaling in a T cell expressing the cytokine receptor.32. The method of embodiment 30 or 31, further comprising providing to the cells the cytokine other than IL-2 that binds to the extracellular cytokine receptor domain.33. The method of any one of embodiments 30-32, further comprising culturing the cells in a composition comprising the cytokine other than IL-2.34. The method of any one of embodiments 30-33, wherein the extracellular cytokine receptor domain is not tethered to the cytokine.35. The method of embodiment 30 or 31, wherein the extracellular cytokine receptor domain is tethered to the cytokine, optionally wherein the extracellular cytokine receptor domain is selected from the group consisting of an IL-4 extracellular domain, an IL-7 extracellular domain, an IL-9 extracellular domain, and an IL-21 extracellular domain.36. The method of any one of embodiments 30-35, wherein the transmembrane domain is a transmembrane domain of an IL-9 receptor, an IL-2 receptor, an IL-4 receptor, an IL-7 receptor, or an IL-21 receptor.37. The method of any one of embodiments 30-36, wherein the transmembrane domain and the extracellular cytokine receptor domain are from the same cytokine receptor.38. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises a cytokine receptor comprising:an IL- 2 cytokine;an IL-2 receptor beta extracellular domain;a transmembrane domain; andan IL-2 receptor beta intracellular domain;wherein the IL-2 receptor beta extracellular domain is tethered to the IL-2 cytokine by a polypeptide linker.98MF-365934147Docket No.: 23775200254039. The method of embodiment 38, wherein a T cell expressing the cytokine receptor engages in IL-2 signaling in the absence of exogenous IL-2.40. The method of embodiment 38 or 39, wherein the cytokine receptor forms a protein complex with IL-2Ry.41. The method of any one of embodiments 38-40, wherein the IL-2 cytokine comprises at least one amino acid substitution that reduces affinity for IL-2Ra and / or IL-2Ry.42. The method of any one of embodiments 38-41, wherein the cytokine receptor does not activate IL-2 signaling on a cell that does not express the cytokine receptor.43. The method of any one of embodiments 38-41, wherein the cytokine receptor does not activate signaling of an IL-2 receptor comprising a different amino acid sequence.44. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises an inducible receptor that activates intracellular IL-2 signaling upon binding of a small molecule.45. The method of embodiment 44, wherein the small molecule is rapamycin.46. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker.47. The method of embodiment 46, wherein the polypeptide comprises a chimeric antigen receptor with a target selected from the group consisting of AFP (alpha-fetoprotein), avP6 or another integrin, BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (delta-like protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial99MF-365934147Docket No.: 237752002540glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HEA-A1 (human leukocyte antigen Al), HEA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma-associated antigen), IGF1R (insulin-like growth factor 1 receptor), Ig kappa, Ig lambda, IE-22Ra (IE-22 receptor alpha), IL-13Ra2 (IL-13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A), Lewis Y, melanoma- associated antigen (MAGE)-Al, MAGE- A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma-associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes, optionally HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1, NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME, optionally expressed antigen of melanoma, progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen), PSMA (prostate specific membrane antigen), ROR1, ROR2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor-associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, or HPV.48. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises a TRE recognized by FOXP3.49. The method of any one of embodiments 1-48, wherein the plurality of TREs comprises at least 1, at least 2, at least 3, or 4 TREs recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, and FOSL1.50. The method of embodiment 49, wherein the plurality of TREs comprises 1, 2, 3 or 4 TREs recognized by a transcription factor selected from the group consisting of AR, MAFK, TBX2Related, and MAFG.100MF-365934147Docket No.: 23775200254051. The method of any one of embodiments 1-47, wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, or 8 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG.52. The method of any one of embodiments 1-47, wherein:SOX4 is present only if FOXP3 and AR are also present;TBX2Related is absent only if JUNBFRA is present;NKX3A and ATF3 are each present only if the other is present; orCEB PE, ETV5CEBPD_01, NFATC1 are each present only if the others are present.53. The method of any one of embodiments 1-47, wherein the synthetic promoter comprises a TRE having a FOXP3 consensus sequence RTAAACA.54. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises a TRE recognized by FOXP3.55. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and ELFE56. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and FOSL1.57. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and AR.58. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and MAFK.59. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and TBX2Related.60. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and MAGF.101MF-365934147Docket No.: 23775200254061. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1 (optionally in two copies), AR (optionally in two copies), JUNBFRA, ATF3, FOXP1, R0RA2 and NKX3A.62. The method of any one of embodiments 1-47, wherein the synthetic promoter comprises, in 5’-to-3’ order, the TREs recognized by SOX4, ELF1, ATF3, FOXP1, R0RA2, FOXP3, AR, NX3A, JUNBFRA2, AR, ELFE63. The method of embodiment 62, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mini and Avril.64. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, FOSL1, AR, MAFK, TBX2Related, MAFG, JUNBFRA, IRF3, RARB and PEA3 (optionally in 2 or 3 copies).65. The method of embodiment 64, wherein the synthetic promoter comprises, in 5’-to-3’ order, the TREs recognized by FOSL1, SOX4, TBX2Related, JUNBFRA2, MAFK, IRF3, PEA3, PEA3, PEA3, IRF3, AR, RARB, FOXP3, MAFG.66. The method of embodiment 65, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mlul and Avril.67. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1, AR (optionally in two or three copies), MAFK, TBX2Related, SOXIO, and PEA3.68. The method of embodiment 67, wherein the synthetic promoter comprises, in 5’-to-3’ order, the TREs recognized by SOX4, SOXIO, AR, FOXP3, MAFK, PEA3, TBXRelated, ELF1, AR, AR.69. The method of embodiment 68, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mlul, Avril and AvrII_mut.102MF-365934147Docket No.: 23775200254070. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, FOSL1 (optionally in two copies), MAFK, MEF2A (optionally in 2 or 3 copies), SOXIO, ATF3, AHRHIF, PAX3, NRF1.71. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 (optionally in two copies), ELF1, FOSL1 (optionally in two copies), MAFG, PEA3, MEF2A, NKX3A, CEBPE, ETV5CEBPD_01, and SOX9.72. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1, FOSL1, AR, FOXP1, and ATF3 (optionally in 2 copies).73. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, MAFK (optionally in two copies), TBX2Related, MAFG (optionally in two copies), FOXP1, IRF3, CEBPE, ETV5CEBPD_01, and NFATC1.74. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally in two copies), FOSL1, TBX2Related, MAFG (optionally in two copies), RORA2, and IRF3.75. The method of any one of embodiments 1-74, wherein the synthetic promoter comprises at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 different TREs.76. The method of embodiment 75, wherein the synthetic promoter comprises at least two copies of one or more of the TREs.77. The method of embodiment 76, wherein at least one TRE is duplicated and is selected from the group consisting of a TRE recognized by AR, FOXP3, MAFG, and EFL1 four JUNBFRA.78. The method of embodiment 77, wherein AR TRE is triplicated.103MF-365934147Docket No.: 23775200254079. The method of any one of embodiments 1-78, wherein the number of unique TREs in the plurality is not more than any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.80. The method of any one of embodiments 1-79, wherein the synthetic promoter comprises at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 10, or at most 20 TREs.81. The method of any one of embodiments 1-78, wherein the number of unique TREs in the plurality is at least any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.82. The method of any one of embodiments 1-81, wherein the plurality of TREs is comprised in a nucleic acid segment of between 275 nucleotides and 375 nucleotides.83. The method of any one of embodiments 1-81, wherein the synthetic promoter comprises no more than any of 400, 350, or 300 nucleotides.84. The method of any one of embodiments 1-83, wherein the TREs, if present, comprise a consensus sequence of SOX4 (FIG. 7A; SEQ ID NO: 1); FOXP3 (FIG. 7B; SEQ ID NO: 2); AR (FIG. 7C; SEQ ID NO: 3); SOX10 (FIG. 7D; SEQ ID NO: 4); ELF1 (FIG. 7E; SEQ ID NO: 5); TBX2Related (FIG. 7F; SEQ ID NO: 6); MAFK (FIG. 7G; SEQ ID NO: 7); PEA3 (FIG. 7H; SEQ ID NO: 8); ATF3 (FIG. 71; SEQ ID NO: 7); FOXP1 (FIG. 7J; SEQ ID NO: 10); RORA2 (FIG. 7K; SEQ ID NO: 11); NKX3A (FIG. 7L; SEQ ID NO: 12); JUNBFRA2 (FIG. 7M; SEQ ID NO: 13); FOSL1 (FIG. 7N; SEQ ID NO: 14); IRF3 (FIG.70; SEQ ID NO: 15); RARB (FIG. 7P; SEQ ID NO: 16); MAFG (FIG. 7Q; SEQ ID NO: 17); MEF2A (FIG. 7R; SEQ ID NO: 18); AHRHIF (FIG. 7S; SEQ ID NO: 17); CEBPE (FIG. 7T; SEQ ID NO: 20); ETV5CEBPD (FIG. 7U; SEQ ID NO: 21); PAX3 (FIG. 7V; SEQ ID NO: 22); NRF1 (FIG. 7W; SEQ ID NO: 23); SOX7 (FIG. 7X; SEQ ID NO: 24); NFATC1 (FIG. 7Y; SEQ ID NO: 25).85. The method of any one of embodiments 1-84, wherein the TREs, if present, comprise a sequence selected from the group consisting of SEQ ID NO: 1 (SOX4), SEQ ID NO: 2 (FOXP3), SEQ ID NO: 3 (AR), SEQ ID NO: 4 (SOX10), SEQ ID NO: 5 (ELF1), SEQ ID NO: 6 (TBX2Related), SEQ ID NO: 7 (MAFK), SEQ ID NO: 8 (PEA3), SEQ ID NO: 9104MF-365934147Docket No.: 237752002540(ATF3), SEQ ID NO: 10 (FOXP1), SEQ ID NO: 11 (RORA2), SEQ ID NO: 12 (NKX3A), SEQ ID NO: 13 (JUNBFRA), SEQ ID NO: 14 (FOSL1), SEQ ID NO: 15 (IRF3), SEQ ID NO: 16 (RARB), SEQ ID NO: 17 (MAFG), SEQ ID NO: 18 (MEF2A), SEQ ID NO: 19 (AHRHIF), SEQ ID NO: 20 (CEBPE), SEQ ID NO: 21 (ETV5CEBPD_01), SEQ ID NO: 22 (PAX3), SEQ ID NO: 23 (NRF1), SEQ ID NO: 24 (SOX9), and SEQ ID NO: 25 (NFATC1).86. The method of any one of embodiments 1-85, wherein the core promoter is selected from the group consisting of a core promoter of CTLA4, FOXP3, IL2RA, RGS1, and IL1R2, optionally wherein the CTLA4 core promoter is CTLA4mp(91) or CTLA4mp(l 18), the FOXP3 core promoter is FOXP3mp(82) or FOXP3mp(l 17), the IL2RA core promoter is IL2Ramp, the RGS1 core promoter is RGSlmp, and the IL1R2 promoter is ILlR2mp.87. A polynucleotide comprising a synthetic promoter operably linked to a payload sequence, wherein:(a) the synthetic promoter promotes transcription of the payload sequence in Treg cells and comprises a plurality of transcription factor response elements (TREs) that are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, and that are operably linked to a core promoter; and(b) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability.88. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises a TRE recognized by FOXP3.89. The polynucleotide of embodiment 87 or 88, wherein the plurality of TREs comprises at least 1, at least 2, at least 3, or 4 TREs recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, and FOSL1.90. The polynucleotide of embodiment 89, wherein the plurality of TREs comprises 1, 2, 3 or 4 TREs recognized by a transcription factor selected from the group consisting of AR, MAFK, TBX2Related, and MAFG.105MF-365934147Docket No.: 23775200254091. The polynucleotide of embodiment 87, wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, or 8 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG.92. The polynucleotide of embodiment 87, wherein:SOX4 is present only if FOXP3 and AR are also present;TBX2Related is absent only if JUNBFRA is present;NKX3A and ATF3 are each present only if the other is present; orCEB PE, ETV5CEBPD_01, NFATC1 are each present only if the others are present.93. The polynucleotide of embodiment 87, wherein the synthetic promoter comprises a TRE having a FOXP3 consensus sequence RTAAACA.94. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises a TRE recognized by FOXP3.95. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and ELFE96. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and FOSL1.97. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and AR.98. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and MAFK.99. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and TBX2Related.100. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and MAGF.106MF-365934147Docket No.: 237752002540101. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1 (optionally in two copies), AR (optionally in two copies), JUNBFRA, ATF3, FOXP1, RORA2 and NKX3A.102. The polynucleotide of embodiment 101, wherein the synthetic promoter comprises, in 5’-to-3’ order, the TREs recognized by SOX4, ELF1, ATF3, FOXP1, RORA2, FOXP3, AR, NX3A, JUNBFRA2, AR, ELFE103. The polynucleotide of embodiment 102, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mini and Avril.104. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, FOSL1, AR, MAFK, TBX2Related, MAFG, JUNBFRA, IRF3, RARB and PEA3 (optionally in 2 or 3 copies).105. The polynucleotide of embodiment 104, wherein the synthetic promoter comprises, in 5’-to-3’ order, the TREs recognized by FOSL1, SOX4, TBX2Related, JUNBFRA2, MAFK, IRF3, PEA3, PEA3, PEA3, IRF3, AR, RARB, FOXP3, MAFG.106. The polynucleotide of embodiment 105, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mlul and Avril.107. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1, AR (optionally in two or three copies), MAFK, TBX2Related, SOX10, and PEA3.108. The polynucleotide of embodiment 107, wherein the synthetic promoter comprises, in 5’-to-3’ order, the TREs recognized by SOX4, SOX10, AR, FOXP3, MAFK, PEA3, TBXRelated, ELF1, AR, AR.109. The polynucleotide of embodiment 108, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mlul, Avril and AvrII_mut.107MF-365934147Docket No.: 237752002540110. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, FOSL1 (optionally in two copies), MAFK, MEF2A (optionally in 2 or 3 copies), SOXIO, ATF3, AHRHIF, PAX3, NRF1.111. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 (optionally in two copies), ELF1, FOSL1 (optionally in two copies), MAFG, PEA3, MEF2A, NKX3A, CEBPE, ETV5CEBPD_01, and SOX9.112. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1, FOSL1, AR, FOXP1, and ATF3 (optionally in 2 copies).113. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, MAFK (optionally in two copies), TBX2Related, MAFG (optionally in two copies), FOXP1, IRF3, CEBPE, ETV5CEBPD_01, and NFATC1.114. The polynucleotide of embodiment 87, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally in two copies), FOSL1, TBX2Related, MAFG (optionally in two copies), RORA2, and IRF3.115. The polynucleotide of any one of embodiments 87-114, wherein the synthetic promoter comprises at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 different TREs.116. The polynucleotide of embodiment 115, wherein the synthetic promoter comprises at least two copies of one or more of the TREs.117. The polynucleotide of embodiment 116, wherein at least one TRE is duplicated and is selected from the group consisting of a TRE recognized by AR, FOXP3, MAFG, and EFL1 four JUNBFRA.118. The polynucleotide of embodiment 117, wherein AR TRE is triplicated.108MF-365934147Docket No.: 237752002540119. The polynucleotide of any one of embodiments 87-118, wherein the number of unique TREs in the plurality is not more than any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.120. The polynucleotide of any one of embodiments 87-119, wherein the synthetic promoter comprises at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 10, or at most 20 TREs.121. The polynucleotide of any one of embodiments 87-118, wherein the number of unique TREs in the plurality is at least any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.122. The polynucleotide of any one of embodiments 87-121, wherein the plurality of TREs is comprised in a nucleic acid segment of between 275 nucleotides and 375 nucleotides.123. The polynucleotide of any one of embodiments 87-121, wherein the synthetic promoter comprises no more than any of 400, 350, or 300 nucleotides.124. The polynucleotide of any one of embodiments 87-123, wherein the TREs, if present, comprise a consensus sequence of SOX4 (FIG. 7A; SEQ ID NO: 1); FOXP3 (FIG. 7B; SEQ ID NO: 2); AR (FIG. 7C; SEQ ID NO: 3); SOX10 (FIG. 7D; SEQ ID NO: 4); ELF1 (FIG.7E; SEQ ID NO: 5); TBX2Related (FIG. 7F; SEQ ID NO: 6); MAFK (FIG.7G; SEQ ID NO: 7); PEA3 (FIG. 7H; SEQ ID NO: 8); ATF3 (FIG. 71; SEQ ID NO: 7); FOXP1 (FIG.7J; SEQ ID NO: 10); RORA2 (FIG. 7K; SEQ ID NO: 11); NKX3A (FIG. 7L; SEQ ID NO: 12); JUNBFRA2 (FIG. 7M; SEQ ID NO: 13); FOSL1 (FIG. 7N; SEQ ID NO: 14); IRF3 (FIG. 70; SEQ ID NO: 15); RARB (FIG. 7P; SEQ ID NO: 16); MAFG (FIG. 7Q; SEQ ID NO: 17); MEF2A (FIG. 7R; SEQ ID NO: 18); AHRHIF (FIG. 7S; SEQ ID NO: 17); CEBPE (FIG. 7T; SEQ ID NO: 20); ETV5CEBPD (FIG. 7U; SEQ ID NO: 21); PAX3 (FIG. 7V; SEQ ID NO: 22); NRF1 (FIG. 7W; SEQ ID NO: 23); SOX7 (FIG. 7X; SEQ ID NO: 24); NFATC1 (FIG. 7Y; SEQ ID NO: 25).125. The polynucleotide of any one of embodiments 87-124, wherein the TREs, if present, comprise a sequence selected from the group consisting of SEQ ID NO: 1 (SOX4), SEQ ID NO: 2 (FOXP3), SEQ ID NO: 3 (AR), SEQ ID NO: 4 (SOX10), SEQ ID NO: 5 (ELF1), SEQ ID NO: 6 (TBX2Related), SEQ ID NO: 7 (MAFK), SEQ ID NO: 8 (PEA3), SEQ ID NO: 9109MF-365934147Docket No.: 237752002540(ATF3), SEQ ID NO: 10 (FOXP1), SEQ ID NO: 11 (RORA2), SEQ ID NO: 12 (NKX3A), SEQ ID NO: 13 (JUNBFRA), SEQ ID NO: 14 (FOSL1), SEQ ID NO: 15 (IRF3), SEQ ID NO: 16 (RARB), SEQ ID NO: 17 (MAFG), SEQ ID NO: 18 (MEF2A), SEQ ID NO: 19 (AHRHIF), SEQ ID NO: 20 (CEBPE), SEQ ID NO: 21 (ETV5CEBPD_01), SEQ ID NO: 22 (PAX3), SEQ ID NO: 23 (NRF1), SEQ ID NO: 24 (SOX9), and SEQ ID NO: 25 (NFATC1).126. The polynucleotide of any one of embodiments 87-125, wherein the core promoter is selected from the group consisting of a core promoter of CTLA4, FOXP3, IL2RA, RGS1, and IL1R2, optionally wherein the CTLA4 core promoter is CTLA4mp(91) or CTLA4mp(118), the FOXP3 core promoter is FOXP3mp(82) or FOXP3mp(117), the IL2RA core promoter is IL2Ramp, the RGS1 core promoter is RGSlmp, and the IL1R2 promoter is ILlR2mp.127. The polynucleotide of any one of embodiments 87-126, wherein the synthetic promoter promotes transcription of the payload sequence in Treg cells by a factor of at least two times, three times, five times, ten times, 20 times or 50 times more as compared to transcription of the payload sequence in Teff cells.128. The polynucleotide of any one of embodiments 87-127, wherein the polypeptide encoded by the payload sequence increases IL-2 availability.129. The polynucleotide of embodiment 128, wherein the polypeptide increases IL-2 secretion and / or expression.130. The polynucleotide of embodiment 128 or 129, wherein the polypeptide increases IL-2 signaling.131. The polynucleotide of any one of embodiments 87-127, wherein the polypeptide encoded by the payload sequence reduces pro-inflammatory cytokine availability.132. The polynucleotide of any one of embodiments 87-127, wherein the polypeptide encoded by the payload sequence increases TGF-P availability.110MF-365934147Docket No.: 237752002540133. The polynucleotide of any one of embodiments 87-127, wherein the polypeptide comprises an IL-2 cytokine.134. The polynucleotide of embodiment 133, wherein the IL-2 cytokine comprises one or more amino acid substitutions that alters affinity for one or more receptors, as compared to an IL-2 cytokine lacking the one or more amino acid substitutions.135. The polynucleotide of any one of embodiments 87-127, wherein the polypeptide encoded by the payload sequence comprises a chimeric antigen receptor (CAR) comprising:an antigen-binding domain,a first linker,an antibody-inducible domain,a transmembrane domain, andan intracellular signaling domain,wherein the antibody-inducible domain is a polypeptide of from about 60 to about 360 amino acids in length.136. The polynucleotide of embodiment 135, wherein the antibody-inducible domain comprises a domain selected from the group consisting of a vascular endothelial growth factor receptor 2 (VEGFR2) domain, a human epidermal growth factor receptor 2 (HER2) domain, a platelet-derived growth factor receptor- alpha (PDGFRa) domain, an interleukin-4 receptor- alpha (IL-4Ra) domain, a CD4 domain, and a CD2 domain.137. The polynucleotide of embodiment 136, wherein the antibody-inducible domain comprises a VEGFR2 domain, wherein the VEGFR2 domain is bindable by an anti-VEGFR2 antibody or VEGFR2-binding fragment thereof selected from the group consisting of ramucirumab and alacizumab, and optionally wherein the VEGFR2 domain is bindable by ramucirumab.138. The polynucleotide of embodiment 136, wherein the antibody-inducible domain comprises a HER2 domain, wherein the HER2 domain is bindable by an anti-HER2 antibody or HER2-binding fragment thereof selected from the group consisting of trastuzumab, margetuximab, pertuzumab, and timigutuzumab, and optionally wherein the HER2 domain is bindable by trastuzumab.111MF-365934147Docket No.: 237752002540139. The polynucleotide of embodiment 136, wherein the antibody-inducible domain comprises a PDGFRa domain, wherein the PDGFRa domain is bindable by an anti-PDGFRa antibody or PDGFRa-binding fragment thereof selected from the group consisting of olaratumab and tovetumab.140. The polynucleotide of embodiment 136, wherein the antibody-inducible domain comprises an IL-4Ra domain, and wherein the IL-4Ra domain is bindable by an anti-IL-4Ra antibody or IL-4Ra-binding fragment thereof selected from the group consisting of dupilumab and pascolizumab.141. The polynucleotide of embodiment 136, wherein the antibody-inducible domain comprises a CD4 domain, and wherein the CD4 domain is bindable by an anti-CD4 antibody or CD4-binding fragment thereof selected from the group consisting of cedelizumab, clenoliximab, ibalizumab, keliximab, priliximab, tregalizumab, zanolimumab, and semzuvolimab.142. The polynucleotide of embodiment 136, wherein the antibody-inducible domain comprises a CD2 domain, and wherein the CD2 domain is bindable by an anti-CD2 antibody or CD2-binding fragment thereof, wherein the anti-CD2-antibody is siplizumab.143. The polynucleotide of any one of embodiments 136-142, wherein a T cell in which the CAR is expressed is activatable upon binding of an antibody or fragment thereof to the antibody-inducible domain.144. The polynucleotide of any one of embodiments 87-127, wherein the polypeptide encoded by the payload sequence comprises a cytokine receptor comprising:an extracellular cytokine receptor domain, a transmembrane domain, and an intracellular IL-2 receptor beta chain domain, wherein the extracellular cytokine receptor domain binds to a cytokine other than IL-2.145. The polynucleotide of embodiment 144, wherein the extracellular cytokine receptor domain is tethered to the cytokine, optionally wherein the extracellular cytokine receptor domain is selected from the group consisting of an IL-4 extracellular domain, an IL-7 extracellular domain, an IL-9 extracellular domain, and an IL-21 extracellular domain.112MF-365934147Docket No.: 237752002540146. The polynucleotide of embodiment 144, wherein the extracellular cytokine receptor domain is not tethered to the cytokine.147. The polynucleotide of any one of embodiments 144-146, wherein the cytokine receptor engages in IL-2 signaling in the absence of IL-2.148. The polynucleotide of any one of embodiments 144-147, wherein the transmembrane domain is a transmembrane domain of an IL-9 receptor, an IL-2 receptor, an IL-4 receptor, an IL-7 receptor, or an IL-21 receptor.149. The polynucleotide of any one of embodiments 144-148, wherein the transmembrane domain and the extracellular cytokine receptor domain are from the same cytokine receptor.150. The polynucleotide of any one of embodiments 87-127, wherein the polypeptide encoded by the payload sequence comprises a cytokine receptor comprising:an IL- 2 cytokine;an IL-2 receptor beta extracellular domain;a transmembrane domain; andan IL-2 receptor beta intracellular domain;wherein the IL-2 receptor beta extracellular domain is tethered to the IL-2 cytokine by a polypeptide linker.151. The polynucleotide of embodiment 150, wherein the cytokine receptor forms a protein complex with IL-2Ry.152. The polynucleotide of embodiment 150 or 151, wherein a T cell expressing the cytokine receptor engages in IL-2 signaling in the absence of exogenous IL-2.153. The polynucleotide of any one of embodiments 150-152, wherein the IL-2 cytokine comprises at least one amino acid substitution that reduces affinity for IL-2Ra and / or IL-2Ry.154. The polynucleotide of any one of embodiments 150-153, wherein the cytokine receptor does not activate IL-2 signaling on a cell that does not express the cytokine receptor.113MF-365934147Docket No.: 237752002540155. The polynucleotide of any one of embodiments 150-154, wherein the cytokine receptor does not activate signaling of an IL-2 receptor comprising a different amino acid sequence.156. The polynucleotide of any one of embodiments 87-127, wherein the polypeptide encoded by the payload sequence comprises an inducible receptor that activates intracellular IL-2 signaling upon binding of a small molecule.157. The polynucleotide of embodiment 156, wherein the small molecule is rapamycin.158. The polynucleotide of any one of embodiments 87-127, wherein the polypeptide encoded by the payload sequence comprises a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker.159. The polynucleotide of embodiment 158, wherein the polypeptide comprises a chimeric antigen receptor with a target selected from the group consisting of AFP (alphafetoprotein), avP6 or another integrin, BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (delta-like protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma-associated antigen), IGF1R (insulin-like growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL-13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A), Lewis Y, melanoma-associated antigen 114MF-365934147Docket No.: 237752002540(MAGE)-Al, MAGE-A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma-associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes, optionally HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1, NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME, optionally expressed antigen of melanoma, progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen), PSMA (prostate specific membrane antigen), R0R1, R0R2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor-associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, or HPV.160. A vector comprising the polynucleotide of any one of embodiments 87-159.161. The vector of embodiment 160, wherein the vector is selected from the group consisting of a viral vector, a plasmid, a bacterial artificial chromosome, a yeast artificial chromosome, a cosmid, a transposon and a minicircle vector.162. The vector of embodiment 161, wherein the vector is a viral vector selected from the group consisting of lentivirus, adenovirus, AAV, retrovirus, and vesicular stomatitis virus.163. A cell comprising the polynucleotide of any one of embodiments 87-159 or the vector of any one of embodiments 160-162.164. The cell of embodiment 163, wherein the cell is a Treg cell.165. The cell of embodiment 163 or 164, which displays the phenotype CD4+, CD25 high and CD 127 low.166. A method of engineering a Treg cell comprising transfecting the Treg cell with the vector of any one of embodiments 160-162.115MF-365934147Docket No.: 237752002540167. A pharmaceutical composition comprising the cell of any one of embodiments 163-166 and a pharmaceutically acceptable carrier.168. A method of treating an immune-related disorder comprising administering an effective amount of the composition of embodiment 167.169. The method of embodiment 168, wherein the immune-related disorder is selected from the group consisting of an autoimmune disease, an allergic condition, an inflammatory condition, and a transplant rejection.170. The method of embodiment 169, wherein the autoimmune disease is selected from the group consisting of type I diabetes, rheumatoid arthritis, systemic lupus erythematosus, celiac disease, psoriasis, myasthenia gravis, scleroderma, Addison disease, dermatomyositis, Graves disease, Hashimoto thyroiditis, inflammatory bowel disease, multiple sclerosis, pernicious anemia, reactive arthritis, and Sjogren syndrome.171. A method of treating an immune-related disorder in a subject, comprising:(a) isolating T cells from a biological sample obtained from subject;(b) enriching the T cells for T regulatory (Treg) cells;(c) transfecting the enriched Treg cells with the vector of any one of embodiments 160-162;(d) expanding the transfected Treg cells; and(e) administering the expanded Treg cells to the subject.172. A composition enriched for Treg cells produced by the method of any one of embodiments 1-86.173. The composition of embodiment 172, wherein Treg cells comprise at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% of the cells in the composition.174. A method of manufacturing Treg cells, the method comprising:(a) isolating T cells from a biological sample; and(b) transfecting the cells with the vector of any one of embodiments 160-162.116MF-365934147Docket No.: 237752002540175. The method of embodiment 174, further comprising enriching the T cells for Treg cells prior to transfecting the cells.176. The method of embodiment 174 or 175, further comprising expanding the T cells.177. The method of embodiment 176, wherein the Treg cell expansion is performed in the absence of exogenous IL-2.178. A method of selectively enriching Treg cells in a population of T cells, the population comprising Treg cells and Teff cells, the method comprising:(a) transfecting the cells with the vector of any one of embodiments 160-162; and (b) culturing the cells.179. The method of embodiment 178, wherein step (b) is performed in the absence of exogenous IL-2.180. The method of any one of embodiments 174-179, wherein the cells are not sorted by cell surface marker expression.181. The method of any one of embodiments 174-180, wherein the transfected Treg cells proliferate at an increased rate compared to Treg cells lacking the vector of any one of embodiments 160-162.182. The method of embodiment 181, wherein the rate of proliferation is increased by about two-fold, about three-fold, about four-fold, or about five-fold.183. The method of any one of embodiments 174-182, wherein the method comprises a reduced risk of Teff cell contamination as compared to a method performed without the vector of any one of embodiments 160-162.184. The method of any one of embodiments 174-182, wherein the Treg cells maintain expression of least one Treg marker selected from the group consisting of CD4+, CD25+, and CD 127 lo.117MF-365934147Docket No.: 237752002540

[0290] Further exemplary embodiments of the methods described herein include:1. A method of manufacturing Treg cells, the method comprising:(a) isolating T cells from a biological sample; and(b) transfecting the cells with a polynucleotide vector comprising a synthetic promoter operably linked to a payload sequence, wherein:(i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and comprises a plurality of transcription factor response elements (TREs) that are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, and that are operably linked to a core promoter; and(ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability.2. The method of embodiment 1, further comprising enriching the T cells for Treg cells prior to transfecting the cells.3. The method of embodiment 1 or 2, further comprising expanding the Treg cells.4. The method of embodiment 3, wherein the Treg cell expansion is performed in the absence of exogenous IE-2.5. A method of selectively enriching Treg cells in a population of T cells, the population comprising Treg cells and Teff cells, the method comprising:(a) transfecting the cells with a polynucleotide vector comprising a synthetic promoter operably linked to a payload sequence, wherein:(i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and comprises a plurality of transcription factor response elements (TREs) that are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, EEF1, FOSL1, AR, MAFK, TBX2Related, MAFG,118MF-365934147Docket No.: 237752002540PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, and that are operably linked to a core promoter; and(ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability; and (b) culturing the cells.6. The method of embodiment 5, wherein step (b) is performed in the absence of exogenous IL-2.7. The method of any one of embodiments 1-6, wherein the cells are not sorted by cell surface marker expression.8. The method of any one of embodiments 1-7, wherein the transfected Treg cells proliferate at an increased rate compared to Treg cells lacking the polynucleotide vector or cells other than Treg cells transfected with the polynucleotide vector.9. The method of embodiment 8, wherein the rate of proliferation is increased by about two-fold, about three-fold, about four-fold, or about five-fold.10. The method of any one of embodiments 1-9, wherein the method comprises a reduced risk of Teff cell contamination as compared to a method performed without the polynucleotide vector.11. The method of any one of embodiments 1-10, wherein the Treg cells maintain expression of least one Treg marker selected from the group consisting of CD4+, CD25+, and CD 127 lo.12. The method of any one of embodiments 1-11, further comprising using anti-CD3 / CD28 coated beads, wherein the anti-CD3 / CD28 coated beads activate the Treg cells.13. The method of any one of embodiments 1-12, wherein the synthetic promoter promotes transcription of the payload sequence in Treg cells by a factor of at least two times,119MF-365934147Docket No.: 237752002540three times, five times, ten times, 20 times or 50 times more as compared to transcription of the payload sequence in Teff cells.14. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence increases IL-2 availability, IL-2 secretion, IL-2 signaling, and / or IL-2 expression.15. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence reduces pro-inflammatory cytokine availability.16. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence increases TGF-P availability.17. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises an IL-2 cytokine.18. The method of embodiment 17, wherein the IL-2 cytokine comprises one or more amino acid substitutions that alters affinity for one or more receptors, as compared to an IL-2 cytokine lacking the one or more amino acid substitutions.19. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises a chimeric antigen receptor (CAR) comprising:an antigen-binding domain,a first linker,an antibody-inducible domain,a transmembrane domain, andan intracellular signaling domain,wherein the antibody-inducible domain is a polypeptide of from about 60 to about 360 amino acids in length.20. The method of embodiment 19, further comprising providing an antibody to the cells, wherein the antibody binds to the antibody-inducible domain.120MF-365934147Docket No.: 23775200254021. The method of embodiment 20, wherein a T cell in which the CAR is expressed is activatable upon binding of the antibody to the antibody-inducible domain.22. The method of any one of embodiments 19-21, further comprising providing to the cells IL-2.23. The method of any one of embodiments 20-22, wherein the antibody-inducible domain comprises a domain selected from the group consisting of a vascular endothelial growth factor receptor 2 (VEGFR2) domain, a human epidermal growth factor receptor 2 (HER2) domain, a platelet-derived growth factor receptor- alpha (PDGFRa) domain, an interleukin-4 receptor- alpha (IL-4Ra) domain, a CD4 domain, and a CD2 domain.24. The method of embodiment 23, wherein the antibody-inducible domain comprises a VEGFR2 domain, wherein the VEGFR2 domain is bindable by an anti-VEGFR2 antibody or VEGFR2-binding fragment thereof selected from the group consisting of ramucirumab and alacizumab, and optionally wherein the VEGFR2 domain is bindable by ramucirumab.25. The method of embodiment 23, wherein the antibody-inducible domain comprises a HER2 domain, wherein the HER2 domain is bindable by an anti-HER2 antibody or HER2-binding fragment thereof selected from the group consisting of trastuzumab, margetuximab, pertuzumab, and timigutuzumab, and optionally wherein the HER2 domain is bindable by trastuzumab.26. The method of embodiment 23, wherein the antibody-inducible domain comprises a PDGFRa domain, wherein the PDGFRa domain is bindable by an anti-PDGFRa antibody or PDGFRa-binding fragment thereof selected from the group consisting of olaratumab and tovetumab.27. The method of embodiment 23, wherein the antibody-inducible domain comprises an IL-4Ra domain, and wherein the IL-4Ra domain is bindable by an anti-IL-4Ra antibody or IL-4Ra-binding fragment thereof selected from the group consisting of dupilumab and pascolizumab.121MF-365934147Docket No.: 23775200254028. The method of embodiment 23, wherein the antibody-inducible domain comprises a CD4 domain, and wherein the CD4 domain is bindable by an anti-CD4 antibody or CD4-binding fragment thereof selected from the group consisting of cedelizumab, clenoliximab, ibalizumab, keliximab, priliximab, tregalizumab, zanolimumab, and semzuvolimab.29. The method of embodiment 23, wherein the antibody-inducible domain comprises a CD2 domain, and wherein the CD2 domain is bindable by an anti-CD2 antibody or CD2-binding fragment thereof, wherein the anti-CD2-antibody is siplizumab.30. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises a cytokine receptor comprising:an extracellular cytokine receptor domain, a transmembrane domain, and an intracellular IL-2 receptor beta chain domain, wherein the extracellular cytokine receptor domain binds to a cytokine other than IL-2.31. The method of embodiment 30, wherein the cytokine other than IL-2 that binds to the extracellular cytokine receptor domain activates intracellular IL-2 signaling in a T cell expressing the cytokine receptor.32. The method of embodiment 30 or 31, further comprising providing to the cells the cytokine other than IL-2 that binds to the extracellular cytokine receptor domain.33. The method of any one of embodiments 30-32, further comprising culturing the cells in a composition comprising the cytokine other than IL-2.34. The method of any one of embodiments 30-33, wherein the extracellular cytokine receptor domain is not tethered to the cytokine.35. The method of embodiment 30 or 31, wherein the extracellular cytokine receptor domain is tethered to the cytokine, optionally wherein the extracellular cytokine receptor domain is selected from the group consisting of an IL-4 extracellular domain, an IL-7 extracellular domain, an IL-9 extracellular domain, and an IL-21 extracellular domain.122MF-365934147Docket No.: 23775200254036. The method of any one of embodiments 30-35, wherein the transmembrane domain is a transmembrane domain of an IL-9 receptor, an IL-2 receptor, an IL-4 receptor, an IL-7 receptor, or an IL-21 receptor.37. The method of any one of embodiments 30-36, wherein the transmembrane domain and the extracellular cytokine receptor domain are from the same cytokine receptor.38. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises a cytokine receptor comprising:an IL- 2 cytokine;an IL-2 receptor beta extracellular domain;a transmembrane domain; andan IL-2 receptor beta intracellular domain;wherein the IL-2 receptor beta extracellular domain is tethered to the IL-2 cytokine by a polypeptide linker.39. The method of embodiment 38, wherein a T cell expressing the cytokine receptor engages in IL-2 signaling in the absence of exogenous IL-2.40. The method of embodiment 38 or 39, wherein the cytokine receptor forms a protein complex with IL-2Ry.41. The method of any one of embodiments 38-40, wherein the IL-2 cytokine comprises at least one amino acid substitution that reduces affinity for IL-2Ra and / or IL-2Ry.42. The method of any one of embodiments 38-41, wherein the cytokine receptor does not activate IL-2 signaling on a cell that does not express the cytokine receptor.43. The method of any one of embodiments 38-41, wherein the cytokine receptor does not activate signaling of an IL-2 receptor comprising a different amino acid sequence.44. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises an inducible receptor that activates intracellular IL-2 signaling upon binding of a small molecule.123MF-365934147Docket No.: 23775200254045. The method of embodiment 44, wherein the small molecule is rapamycin.46. The method of any one of embodiments 1-13, wherein the polypeptide encoded by the payload sequence comprises a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker.47. The method of embodiment 46, wherein the polypeptide comprises a chimeric antigen receptor with a target selected from the group consisting of AFP (alpha-fetoprotein), avP6 or another integrin, BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (delta-like protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma-associated antigen), IGF1R (insulin-like growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL-13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A), Lewis Y, melanoma- associated antigen (MAGE)-Al, MAGE- A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma-associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes, optionally HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1, NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME, optionally expressed antigen of melanoma, progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen), PSMA (prostate specific 124MF-365934147Docket No.: 237752002540membrane antigen), R0R1, ROR2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor-associated glycoprotein 72), TPBG (trophoblast glycoprotein), Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, or HPV.48. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises a TRE recognized by FOXP3.49. The method of embodiment 48, wherein the plurality of TREs comprises a TRE recognized by FOXP3 and a TRE recognized by ELF1.50. The method of embodiment 49, wherein the plurality of TREs further comprises at least one TRE recognized by a transcription factor selected from the group consisting of SOX4, AR, and TBX2Related.51. The method of embodiment 49 or 50, wherein the plurality of TREs further comprises at least one copy of at least one TRE recognized by a transcription factor selected from the group consisting of FOSL1, MAFK, and MAFG.52. The method of any one of embodiments 1-47, wherein the plurality of TREs comprises at least 1, at least 2, at least 3, or 4 TREs recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, and FOSL1.53. The method of embodiment 52, wherein the plurality of TREs comprises 1, 2, 3 or 4 TREs recognized by a transcription factor selected from the group consisting of AR, MAFK, TBX2Related, and MAFG.54. The method of any one of embodiments 1-47, wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, or 8 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG.55. The method of any one of embodiments 1-47, wherein:SOX4 is present only if FOXP3 and AR are also present;125MF-365934147Docket No.: 237752002540TBX2Related is absent only if JUNBFRA is present;NKX3A and ATF3 are each present only if the other is present; orCEB PE, ETV5CEBPD_01, NFATC1 are each present only if the others are present.56. The method of any one of embodiments 1-47, wherein the synthetic promoter comprises a TRE having a FOXP3 con...

Claims

Docket No.: 237752002540CLAIMSWhat is claimed is:

1. A method of manufacturing Treg cells, the method comprising:(a) isolating T cells from a biological sample; and(b) transfecting the cells with a polynucleotide vector comprising a synthetic promoter operably linked to a payload sequence, wherein:(i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and comprises a plurality of transcription factor response elements (TREs) that are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, RORA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, and that are operably linked to a core promoter; and(ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability.

2. The method of claim 1, further comprising enriching the T cells for Treg cells prior to transfecting the cells.

3. The method of claim 1 or 2, further comprising expanding the Treg cells.

4. The method of claim 3, wherein the Treg cell expansion is performed in the absence of exogenous IL-2.

5. A method of selectively enriching Treg cells in a population of T cells, the population comprising Treg cells and Teff cells, the method comprising:(a) transfecting the cells with a polynucleotide vector comprising a synthetic promoter operably linked to a payload sequence, wherein:(i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and comprises a plurality of transcription factor response elements (TREs) that are recognized by at least 4, at least 5, at least 6, at least 7, at least 8, or at least 9, at least 10, at least 11 or at least 12 transcription factors selected from the group 141MF-365934147Docket No.: 237752002540consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, MAFG, PEA3, SOXIO, R0RA2, IRF3, FOXP1, NKX3A, JUNBFRA, ATF3, RARB, CEBPE, ETV5CEBPD_01, NFATC1 and AHRIF, and that are operably linked to a core promoter; and(ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability; and (b) culturing the cells.

6. The method of claim 5, wherein step (b) is performed in the absence of exogenous IL-2.

7. The method of any one of claims 1-6, wherein the cells are not sorted by cell surface marker expression.

8. The method of any one of claims 1-7, wherein the transfected Treg cells proliferate at an increased rate compared to Treg cells lacking the polynucleotide vector or cells other than Treg cells transfected with the polynucleotide vector.

9. The method of claim 8, wherein the rate of proliferation is increased by about twofold, about three-fold, about four-fold, or about five-fold.

10. The method of any one of claims 1-9, wherein the method comprises a reduced risk of Teff cell contamination as compared to a method performed without the polynucleotide vector.

11. The method of any one of claims 1-10, wherein the Treg cells maintain expression of least one Treg marker selected from the group consisting of CD4+, CD25+, and CD 127 lo.

12. The method of any one of claims 1-11, further comprising using anti-CD3 / CD28 coated beads, wherein the anti-CD3 / CD28 coated beads activate the Treg cells.

13. The method of any one of claims 1-12, wherein the synthetic promoter promotes transcription of the payload sequence in Treg cells by a factor of at least two times, three142MF-365934147Docket No.: 237752002540times, five times, ten times, 20 times or 50 times more as compared to transcription of the payload sequence in Teff cells.

14. The method of any one of claims 1-13, wherein the polypeptide encoded by the payload sequence increases IL-2 availability, IL-2 secretion, IL-2 signaling, and / or IL-2 expression.

15. The method of any one of claims 1-13, wherein the polypeptide encoded by the payload sequence reduces pro-inflammatory cytokine availability.

16. The method of any one of claims 1-13, wherein the polypeptide encoded by the payload sequence increases TGF-P availability.

17. The method of any one of claims 1-13, wherein the polypeptide encoded by the payload sequence comprises an IL-2 cytokine.

18. The method of claim 17, wherein the IL-2 cytokine comprises one or more amino acid substitutions that alters affinity for one or more receptors, as compared to an IL-2 cytokine lacking the one or more amino acid substitutions.

19. The method of any one of claims 1-13, wherein the polypeptide encoded by the payload sequence comprises a chimeric antigen receptor (CAR) comprising:an antigen-binding domain,a first linker,an antibody-inducible domain,a transmembrane domain, andan intracellular signaling domain,wherein the antibody-inducible domain is a polypeptide of from about 60 to about 360 amino acids in length.

20. The method of claim 19, further comprising providing an antibody to the cells, wherein the antibody binds to the antibody-inducible domain.143MF-365934147Docket No.: 23775200254021. The method of claim 20, wherein a T cell in which the CAR is expressed is activatable upon binding of the antibody to the antibody-inducible domain.

22. The method of any one of claims 19-21, further comprising providing to the cells IL-2.

23. The method of any one of claims 20-22, wherein the antibody-inducible domain comprises a domain selected from the group consisting of a vascular endothelial growth factor receptor 2 (VEGFR2) domain, a human epidermal growth factor receptor 2 (HER2) domain, a platelet-derived growth factor receptor- alpha (PDGFRa) domain, an interleukin-4 receptor- alpha (IL-4Ra) domain, a CD4 domain, and a CD2 domain.

24. The method of claim 23, wherein the antibody-inducible domain comprises a VEGFR2 domain, wherein the VEGFR2 domain is bindable by an anti-VEGFR2 antibody or VEGFR2-binding fragment thereof selected from the group consisting of ramucirumab and alacizumab, and optionally wherein the VEGFR2 domain is bindable by ramucirumab.

25. The method of claim 23, wherein the antibody-inducible domain comprises a HER2 domain, wherein the HER2 domain is bindable by an anti-HER2 antibody or HER2-binding fragment thereof selected from the group consisting of trastuzumab, margetuximab, pertuzumab, and timigutuzumab, and optionally wherein the HER2 domain is bindable by trastuzumab.

26. The method of claim 23, wherein the antibody-inducible domain comprises a PDGFRa domain, wherein the PDGFRa domain is bindable by an anti-PDGFRa antibody or PDGFRa-binding fragment thereof selected from the group consisting of olaratumab and tovetumab.

27. The method of claim 23, wherein the antibody-inducible domain comprises an IE-4Ra domain, and wherein the IE-4Ra domain is bindable by an anti-IE-4Ra antibody or IE-4Ra-binding fragment thereof selected from the group consisting of dupilumab and pascolizumab.

28. The method of claim 23, wherein the antibody-inducible domain comprises a CD4 domain, and wherein the CD4 domain is bindable by an anti-CD4 antibody or CD4-binding 144MF-365934147Docket No.: 237752002540fragment thereof selected from the group consisting of cedelizumab, clenoliximab, ibalizumab, keliximab, priliximab, tregalizumab, zanolimumab, and semzuvolimab.

29. The method of claim 23, wherein the antibody-inducible domain comprises a CD2 domain, and wherein the CD2 domain is bindable by an anti-CD2 antibody or CD2-binding fragment thereof, wherein the anti-CD2-antibody is siplizumab.

30. The method of any one of claims 1-13, wherein the polypeptide encoded by the payload sequence comprises a cytokine receptor comprising:an extracellular cytokine receptor domain, a transmembrane domain, and an intracellular IL-2 receptor beta chain domain, wherein the extracellular cytokine receptor domain binds to a cytokine other than IL-2.

31. The method of claim 30, wherein the cytokine other than IL-2 that binds to the extracellular cytokine receptor domain activates intracellular IL-2 signaling in a T cell expressing the cytokine receptor.

32. The method of claim 30 or 31, further comprising providing to the cells the cytokine other than IL-2 that binds to the extracellular cytokine receptor domain.

33. The method of any one of claims 30-32, further comprising culturing the cells in a composition comprising the cytokine other than IL-2.

34. The method of any one of claims 30-33, wherein the extracellular cytokine receptor domain is not tethered to the cytokine.

35. The method of claim 30 or 31, wherein the extracellular cytokine receptor domain is tethered to the cytokine, optionally wherein the extracellular cytokine receptor domain is selected from the group consisting of an IL-4 extracellular domain, an IL-7 extracellular domain, an IL-9 extracellular domain, and an IL-21 extracellular domain.

36. The method of any one of claims 30-35, wherein the transmembrane domain is a transmembrane domain of an IL-9 receptor, an IL-2 receptor, an IL-4 receptor, an IL-7 receptor, or an IL-21 receptor.145MF-365934147Docket No.: 23775200254037. The method of any one of claims 30-36, wherein the transmembrane domain and the extracellular cytokine receptor domain are from the same cytokine receptor.

38. The method of any one of claims 1-13, wherein the polypeptide encoded by the payload sequence comprises a cytokine receptor comprising:an IL- 2 cytokine;an IL-2 receptor beta extracellular domain;a transmembrane domain; andan IL-2 receptor beta intracellular domain;wherein the IL-2 receptor beta extracellular domain is tethered to the IL-2 cytokine by a polypeptide linker.

39. The method of claim 38, wherein a T cell expressing the cytokine receptor engages in IL-2 signaling in the absence of exogenous IL-2.

40. The method of claim 38 or 39, wherein the cytokine receptor forms a protein complex with IL-2Ry.

41. The method of any one of claims 38-40, wherein the IL-2 cytokine comprises at least one amino acid substitution that reduces affinity for IL-2Ra and / or IL-2Ry.

42. The method of any one of claims 38-41, wherein the cytokine receptor does not activate IL-2 signaling on a cell that does not express the cytokine receptor.

43. The method of any one of claims 38-41, wherein the cytokine receptor does not activate signaling of an IL-2 receptor comprising a different amino acid sequence.

44. The method of any one of claims 1-13, wherein the polypeptide encoded by the payload sequence comprises an inducible receptor that activates intracellular IL-2 signaling upon binding of a small molecule.

45. The method of claim 44, wherein the small molecule is rapamycin.

46. The method of any one of claims 1-13, wherein the polypeptide encoded by the 146MF-365934147Docket No.: 237752002540payload sequence comprises a chimeric antigen receptor, a chemokine receptor, a cytokine, an interleukin, a cytokine receptor, a transcription factor, a reporter protein, or a selectable marker.

47. The method of claim 46, wherein the polypeptide comprises a chimeric antigen receptor with a target selected from the group consisting of AFP (alpha-fetoprotein), avP6 or another integrin, BCMA, B7-H3, B7-H6, CA9 (carbonic anhydrase 9), CCL-1 (C-C motif chemokine ligand 1), CD5, CD19, CD20, CD21, CD22, CD23, CD24, CD30, CD33, CD38, CD40, CD44, CD44v6, CD44v7 / 8, CD45, CD47, CD56, CD66e, CD70, CD74, CD79a, CD79b, CD98, CD123, CD138, CD171, CD352, CEA (carcinoembryonic antigen), Claudin, c-MET, DLL3 (delta-like protein 3), DLL4, ENPP3 (ectonucleotide pyrophosphatase / phosphodiesterase family member 3), EpCAM, EPG-2 (epithelial glycoprotein 2), EPG-40, ephrinB2, EPHa2 (ephrine receptor A2), ERBB dimers, estrogen receptor, ETBR (endothelin B receptor), FAP-a (fibroblast activation protein a), fetal AchR (fetal acetylcholine receptor), FBP (a folate binding protein), FCRL5, FR-a (folate receptor alpha), GCC (guanyl cyclase C), GD2, GD3, GPC2 (glypican-2), GPC3, gplOO (glycoprotein 100), GPNMB (glycoprotein NMB), GPRC5D (G Protein Coupled Receptor 5D), HER2, HER3, HER4, hepatitis B surface antigen, HLA-A1 (human leukocyte antigen Al), HLA-A2 (human leukocyte antigen A2), HMW-MAA (human high molecular weight-melanoma-associated antigen), IGF1R (insulin-like growth factor 1 receptor), Ig kappa, Ig lambda, IL-22Ra (IL-22 receptor alpha), IL-13Ra2 (IL-13 receptor alpha 2), KDR (kinase insert domain receptor), LI cell adhesion molecule (LI -CAM), Liv-1, LRRC8A (leucine rich repeat containing 8 Family member A), Lewis Y, melanoma- associated antigen (MAGE)-Al, MAGE- A3, MAGE-A6, MART-1 (melan A), murine cytomegalovirus (MCMV), MCSP (melanoma-associated chondroitin sulfate proteoglycan), mesothelin, mucin 1 (MUC1), MUC16, MHC / peptide complexes, optionally HLA-A complexed with peptides derived from AFP, KRAS, NY-ESO, MAGE-A, and WT1, NCAM (neural cell adhesion molecule), Nectin-4, NKG2D (natural killer group 2 member D) ligands, NY-ESO, oncofetal antigen, PD-1, PD-L1, PRAME, optionally expressed antigen of melanoma, progesterone receptor, PSA (prostate specific antigen), PSCA (prostate stem cell antigen), PSMA (prostate specific membrane antigen), ROR1, ROR2, SIRPa (signal-regulatory protein alpha), SLIT, SLITRK6 (NTRK-like protein 6), STEAP1 (six transmembrane epithelial antigen of the prostate 1), survivin, TAG72 (tumor-associated glycoprotein 72), TPBG (trophoblast glycoprotein),147MF-365934147Docket No.: 237752002540Trop-2, VEGFR1 (vascular endothelial growth factor receptor 1), VEGFR2, and antigens from HIV, HBV, HCV, or HPV.

48. The method of any one of claims 1-47, wherein the plurality of TREs comprises a TRE recognized by FOXP3.

49. The method of claim 48, wherein the plurality of TREs comprises a TRE recognized by FOXP3 and a TRE recognized by ELFE50. The method of claim 49, wherein the plurality of TREs further comprises at least one TRE recognized by a transcription factor selected from the group consisting of SOX4, AR, and TBX2Related.

51. The method of claim 49 or 50, wherein the plurality of TREs further comprises at least one copy of at least one TRE recognized by a transcription factor selected from the group consisting of FOSL1, MAFK, and MAFG.

52. The method of any one of claims 1-47, wherein the plurality of TREs comprises at least 1, at least 2, at least 3, or 4 TREs recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, and FOSL1.

53. The method of claim 52, wherein the plurality of TREs comprises 1, 2, 3 or 4 TREs recognized by a transcription factor selected from the group consisting of AR, MAFK, TBX2Related, and MAFG.

54. The method of any one of claims 1-47, wherein the TREs are recognized by at least 4, at least 5, at least 6, at least 7, or 8 transcription factors selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG.

55. The method of any one of claims 1-47, wherein:SOX4 is present only if FOXP3 and AR are also present;TBX2Related is absent only if JUNBFRA is present;NKX3A and ATF3 are each present only if the other is present; orCEB PE, ETV5CEBPD_01, NFATC1 are each present only if the others are present.148MF-365934147Docket No.: 23775200254056. The method of any one of claims 1-47, wherein the synthetic promoter comprises a TRE having a FOXP3 consensus sequence RTAAACA.

57. The method of any one of claims 1-47, wherein the plurality of TREs comprises a TRE recognized by FOXP3.

58. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3 and ELFE59. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1 and AR.

60. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and TBX2Related.

61. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and MAFK.

62. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and FOSL1.

63. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, and MAFG.

64. The method of any one of claims 1-47, wherein the plurality of TREs comprises des TREs recognized by FOXP3, ELF1, TBX2Related and AR.

65. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, TBX2Related, AR, SOX4, MAFK and FOSL1.

66. The method of claim 65, wherein the plurality of TREs comprises 4 copies of TREs recognized by FOXP3.149MF-365934147Docket No.: 23775200254067. The method of claim 65 or 66, wherein the plurality of TREs comprises 3 copies of TREs recognized by ELFE68. The method of any one of claims 65-67, wherein the plurality of TREs comprises 3 copies of TREs recognized by TBX2Related.

69. The method of any one of claims 65-68, wherein the plurality of TREs comprises 3 copies of AR.

70. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally 3 copies), ELF1, TBX2Related (optionally 3 copies), AR, SOX4 (optionally 2 copies), MAFK (optionally 2 copies), FOSL1, and MAFG.

71. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally 3 copies), ELF1 (optionally 6 copies), TBX2Related (optionally 3 copies), AR (optionally 2 copies), SOX4, MAFK (optionally 2 copies), and MAFG.

72. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and ELF1.

73. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and FOSL1.

74. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and AR.

75. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and MAFK.

76. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and TBX2Related.150MF-365934147Docket No.: 23775200254077. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 and MAGF.

78. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1 (optionally in two copies), AR (optionally in two copies), JUNBFRA, ATF3, FOXP1, R0RA2 and NKX3A.

79. The method of any one of claims 78, wherein the synthetic promoter comprises, in 5’-to-3’ order, the TREs recognized by SOX4, ELF1, ATF3, FOXP1, R0RA2, FOXP3, AR, NX3A, JUNBFRA2, AR, ELFE80. The method of claim 79, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mini and Avril.

81. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, FOSL1, AR, MAFK, TBX2Related, MAFG, JUNBFRA, IRF3, RARB and PEA3 (optionally in 2 or 3 copies).

82. The method of claim 81, wherein the synthetic promoter comprises, in 5’-to-3’ order, the TREs recognized by FOSL1, SOX4, TBX2Related, JUNBFRA2, MAFK, IRF3, PEA3, PEA3, IRF3, AR, RARB, FOXP3, MAFG.

83. The method of claim 82, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mlul and Avril.

84. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1, AR (optionally in two or three copies), MAFK, TBX2Related, SOXIO, and PEA3.

85. The method of claim 84, wherein the synthetic promoter comprises, in 5’-to-3’ order, the TREs recognized by SOX4, SOXIO, AR, FOXP3, MAFK, PEA3, TBXRelated, ELF1, AR, AR.151MF-365934147Docket No.: 23775200254086. The method of claim 85, wherein the synthetic promoter further comprises restriction enzyme cleavage sites Mini, Avril and AvrII_mut.

87. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, FOSL1 (optionally in two copies), MAFK, MEF2A (optionally in 2 or 3 copies), SOXIO, ATF3, AHRHIF, PAX3, NRF1.

88. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4 (optionally in two copies), ELF1, FOSL1 (optionally in two copies), MAFG, PEA3, MEF2A, NKX3A, CEBPE, ETV5CEBPD_01, and SOX9.

89. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, SOX4, ELF1, FOSL1, AR, FOXP1, and ATF3 (optionally in 2 copies).

90. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3, ELF1, MAFK (optionally in two copies), TBX2Related, MAFG (optionally in two copies), FOXP1, IRF3, CEBPE, ETV5CEBPD_01, and NFATC1.

91. The method of any one of claims 1-47, wherein the plurality of TREs comprises TREs recognized by FOXP3 (optionally in two copies), FOSL1, TBX2Related, MAFG (optionally in two copies), RORA2, and IRF3.

92. The method of any one of claims 1-91, wherein the synthetic promoter comprises at least 4, at least 5, least 6, at least 7, at least 8, at least 9, at least 10, at least 11, or at least 12 different TREs.

93. The method of claim 92, wherein the synthetic promoter comprises at least two copies of one or more of the TREs.

94. The method of claim 93, wherein at least one TRE is duplicated and is selected from the group consisting of a TRE recognized by AR, FOXP3, MAFG, and EFL1 four JUNBFRA.152MF-365934147Docket No.: 23775200254095. The method of claim 94, wherein the synthetic promoter comprises three copies of a TRE recognized by AR.

96. The method of any one of claims 1-95, wherein the number of unique TREs in the plurality is not more than any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

97. The method of any one of claims 1-96, wherein the synthetic promoter comprises at most 4, at most 5, most 6, at most 7, at most 8, at most 9, at most 10, at most 11, at most 12, at most 13, at most 14, at most 15, at most 16, at most 17, at most 18, at most 10, or at most 20 TREs.

98. The method of any one of claims 1-95, wherein the number of unique TREs in the plurality is at least any of 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20.

99. The method of any one of claims 1-98, wherein the plurality of TREs span a range of no more than 400 nucleotides.

100. The method of any one of claims 1-99, wherein the plurality of TREs span a range of no more than 300 nucleotides, optionally between 100-300 nucleotides.

101. The method of any one of claims 1-99, wherein the plurality of TREs span a range of between 275 nucleotides and 375 nucleotides.

102. The method of any one of claims 1-98, wherein the synthetic promoter comprises no more than any of 500, 400, 350, or 300 nucleotides.

103. The method of any one of claims 1-102, wherein the TREs, if present, comprise a consensus sequence of SOX4 (FIG. 7A; SEQ ID NO: 1); FOXP3 (FIG. 7B; SEQ ID NO: 2); AR (FIG. 7C; SEQ ID NO: 3); SOX10 (FIG. 7D; SEQ ID NO: 4); ELF1 (FIG. 7E; SEQ ID NO: 5); TBX2Related (FIG. 7F; SEQ ID NO: 6); MAFK (FIG. 7G; SEQ ID NO: 7); PEA3 (FIG. 7H; SEQ ID NO: 8); ATF3 (FIG. 71; SEQ ID NO: 7); FOXP1 (FIG. 7J; SEQ ID NO: 10); RORA2 (FIG. 7K; SEQ ID NO: 11); NKX3A (FIG. 7L; SEQ ID NO: 12); JUNBFRA2 (FIG. 7M; SEQ ID NO: 13); FOSL1 (FIG. 7N; SEQ ID NO: 14); IRF3 (FIG. 70; SEQ ID NO: 15); RARB (FIG. 7P; SEQ ID NO: 16); MAFG (FIG. 7Q; SEQ ID NO: 17); MEF2A 153MF-365934147Docket No.: 237752002540(FIG. 7R; SEQ ID NO: 18); AHRHIF (FIG. 7S; SEQ ID NO: 17); CEBPE (FIG. 7T; SEQ ID NO: 20); ETV5CEBPD (FIG. 7U; SEQ ID NO: 21); PAX3 (FIG. 7V; SEQ ID NO: 22); NRF1 (FIG. 7W; SEQ ID NO: 23); SOX7 (FIG. 7X; SEQ ID NO: 24); NFATC1 (FIG. 7Y;SEQ ID NO: 25).

104. The method of any one of claims 1-103, wherein the TREs, if present, comprise a sequence selected from the group consisting of SEQ ID NO: 1 (SOX4), SEQ ID NO: 2 (FOXP3), SEQ ID NO: 3 (AR), SEQ ID NO: 4 (SOXIO), SEQ ID NO: 5 (ELF1), SEQ ID NO: 6 (TBX2Related), SEQ ID NO: 7 (MAFK), SEQ ID NO: 8 (PEA3), SEQ ID NO: 9 (ATF3), SEQ ID NO: 10 (FOXP1), SEQ ID NO: 11 (RORA2), SEQ ID NO: 12 (NKX3A), SEQ ID NO: 13 (JUNBFRA), SEQ ID NO: 14 (FOSL1), SEQ ID NO: 15 (IRF3), SEQ ID NO: 16 (RARB), SEQ ID NO: 17 (MAFG), SEQ ID NO: 18 (MEF2A), SEQ ID NO: 19 (AHRHIF), SEQ ID NO: 20 (CEBPE), SEQ ID NO: 21 (ETV5CEBPD_01), SEQ ID NO: 22 (PAX3), SEQ ID NO: 23 (NRF1), SEQ ID NO: 24 (SOX9), and SEQ ID NO: 25 (NFATC1).

105. The method of any one of claims 1-104, wherein the core promoter is selected from the group consisting of a core promoter of CTLA4, a core promoter of FOXP3, a core promoter of IL2RA, a core promoter of RGS1, a core promoter of IL1R2, CTLA4mp(91), CTLA4mp(118), FOXP3mp(82), FOXP3mp(117), IL2Ramp, RGSlmp, and ILlR2mp.

106. The method of claim 105, wherein the core promoter is RGS1.

107. The method of any one of claims 1-106, wherein the synthetic promoter is active in Treg cells and inactive in Teff cells.

108. The method of any one of claims 1-107, wherein the synthetic promoter comprises at least 1 TRE in a forward orientation and at least 1 TRE in a reverse orientation.

109. A method of manufacturing Treg cells, the method comprising:(a) isolating T cells from a biological sample; and(b) transfecting the cells with a polynucleotide vector comprising a synthetic promoter operably linked to a payload sequence, wherein:(i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and comprises a plurality of transcription factor response elements (TREs),154MF-365934147Docket No.: 237752002540wherein each TRE in the plurality is recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG, and wherein the plurality of TREs are operably linked to a core promoter; and(ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability.

110. A method of selectively enriching Treg cells in a population of T cells, the population comprising Treg cells and Teff cells, the method comprising:(a) transfecting the cells with a polynucleotide vector comprising a synthetic promoter operably linked to a payload sequence, wherein:(i) the synthetic promoter promotes transcription of the payload sequence in Treg cells and comprises a plurality of transcription factor response elements (TREs), wherein each TRE in the plurality is recognized by a transcription factor selected from the group consisting of FOXP3, SOX4, ELF1, FOSL1, AR, MAFK, TBX2Related, and MAFG, and wherein the plurality of TREs are operably linked to a core promoter; and(ii) the payload sequence encodes a polypeptide that promotes Treg cell proliferation, expansion, persistence, maintenance, survival and / or viability; and (b) culturing the cells.

111. The method of any one of claims 1-108, wherein the synthetic promoter has a Treg score and a Teff score, and the Treg score of the synthetic promoter is greater than the Teff score of the synthetic promoter.155MF-365934147

Images