Inverted terminal repeat mutant library and methods of preparing and using the same

Abstract

Described herein is a library composed of a plurality of mutant adeno-associated virus (AAV) inverted terminal repeats (ITRs) and a method of using the same to generate, screen and identify mutant AAV ITRs that exhibit an altered transduction efficiency, vector production, and / or gene editing property, for example, an increase or decrease in gene editing frequency and / or an increase or decrease in gene editing fidelity.

Description

Attorney Docket No. 5470.973.WOINVERTED TERMINAL REPEAT MUTANT LIBRARY AND METHODS OF PREPARING AND USING THE SAMESTATEMENT OF PRIORITY

[0001] This application claims the benefit of U.S. Provisional Application Serial No.63 / 750,015, filed January 27, 2025, the entire contents of which are incorporated by reference herein.STATEMENT REGARDING ELECTRONIC FILING OF A SEQUENCE LISTING

[0002] A Sequence Listing in XML text format, entitled 5470-973-WO_ST26.xml, 77,816 bytes in size, generated on January 24, 2026, and filed herewith, is hereby incorporated by reference into the specification for its disclosures.FIELD OF INVENTION

[0003] The present invention relates to a library of mutant adeno-associated virus inverted terminal repeats and methods for using the same to generate mutants exhibiting altered gene editing properties.BACKGROUND

[0004] The wild-type viral genome of the canonical adeno-associated virus (AAV) serotype 2 is a ssDNA genome of ~4,700 nucleotides and contains multiple genes with overlapping reading frames. The ends of the genome are flanked by 145 nt inverted terminal repeat (ITR) sequences that are predicted to fold back on themselves to form hairpin structures. The Cap gene produces the capsid viral proteins 1, 2, and 3 and also contains the reading frame for assembly-activating protein (AAP), which helps in assembly of the capsid. The AAV2 Rep gene produces four proteins named for their approximate weights: Rep78, Rep68, Rep50, and Rep42. The small Reps, 50 and 42, can act as motor proteins to package nascent genomes into preformed capsids. The large Reps, 78 and 68, have endonuclease and ATP-dependent helicase functions that are necessary for genomic replication. These large Reps can initiate genome replication by binding to the Rep binding element (RBE) in the A region of the ITR. This initial binding helps to unwind the DNA strands and form a nicking stem that is cleaved by Rep at the dinucleotide TT terminal resolution site (trs). In addition, the large Rep proteins also make contact with the RBE’ region at the tip of the C-loop. The ITR plays a fundamental role in the life cycle of AAV by containing the replication of origin, packaging signals, and the ability toAttorney Docket No. 5470.973.WOconfer persistence to AAV genomes after infection. For AAV serotypes 1-4 and 6-7, the predicted structure of the ITR is alike but there are sequence differences throughout, notably in the number of GAGC repeats in the RBE, the TTT or TCT at the RBE’, the nucleotides in the hairpin loops, and the nucleotides in the D-region that do not participate in the formation of the nicking stem. Even with these differences, the AAV2 Reps are capable of replicating and cross-packaging genomes from serotypes 1, 3, 4, and 6 into numerous, non-AAV2 capsids.

[0005] AAV vectors are the leading platform for gene delivery for the treatment of a variety of human diseases. Recent advances in developing clinically desirable AAV capsids, optimizing genome designs and harnessing revolutionary biotechnologies have contributed substantially to the growth of the gene therapy field. Preclinical and clinical successes in AAV-mediated gene replacement, gene silencing and gene editing have helped AAV gain popularity as the ideal therapeutic vector, with AAV-based therapeutics gaining regulatory approval in Europe and the United States. Accordingly, needed in the art are improved AAV vectors that facilitate gene delivery or gene editing and are suitable for use in vivo.SUMMARY OF THE INVENTION

[0006] An adeno-associated virus (AAV) inverted terminal repeat (ITR) library is provided herein, wherein the library comprises a plurality of vectors, each of which comprises an AAV ITR nucleotide sequence of no more than 126 nucleotides in length, said AAV ITR nucleotide sequence comprising at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence relative to a starting AAV ITR nucleotide sequence.

[0007] In another aspect, a method of generating a mutant AAV ITR exhibiting an altered gene editing property is provided, which comprises the steps of (a) generating a library of mutant AAV ITR nucleotide sequences operably linked to a homologous recombination repair template for a defective marker gene, wherein each of the mutant AAV ITR nucleotide sequences is no more than 126 nucleotides in length and comprises at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence relative to a starting AAV ITR nucleotide sequence; (b) introducing the library of mutant AAV ITR nucleotide sequences into a host cell comprising the defective marker gene; and (c) selecting at least one mutant AAV ITR nucleotide sequence exhibiting altered homologous recombination repair of the defective marker gene compared to the starting AAV ITR nucleotide sequence, thereby generating a mutant AAV ITR exhibiting an altered gene editing property.

[0008] In another aspect, a method of screening for a mutant AAV ITR exhibiting at least one altered property is provided, which comprises the steps of (a) generating a library of mutantAttorney Docket No. 5470.973.WOAAV ITR nucleotide sequences, wherein each of the mutant AAV ITR nucleotide sequences is no more than 126 nucleotides in length and comprises at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence relative to a starting AAV ITR nucleotide sequence; (b) introducing the library of mutant AAV ITR nucleotide sequences into a host cell; and (c) selecting at least one mutant AAV ITR nucleotide sequence exhibiting an altered property compared to the starting AAV ITR nucleotide sequence, thereby screening for a mutant AAV ITR exhibiting at least one altered property.

[0009] These and other aspects of the present invention are set forth in more detail in the description of the invention below.BRIEF DESCRIPTION OF THE FIGURES

[0010] FIG. 1 shows an example validation of an assay for assessing gene editing. DSB, double-strand break.

[0011] FIG. 2 shows representative wells from an assay validation.

[0012] FIGS. 3A-3C provide schematics (FIGS.3A-3B) and data (FIG.3C) showing that double-strand breaks and inverted repeats on the repair molecule stimulate gene editing. FIG.3A, Schematic of all repair molecules used in experiments. All tested structures are distant from the homologous region of the repair molecule (neo Repair). FIG. 3B, The three repair molecules tested with their respective structures. FIG. 3C, Cell viability as a measure of gene editing frequency for each group of the plasmids tested. ** indicates a p-value <0.01 and *** indicates a p-value <0.001 using a student’s t-test. Bars are average ± SEM. All groups n=6.

[0013] FIGS. 4A-4B provide data showing that deletions of specific AAV ITR2 regions decreases gene editing frequency. FIG. 4A, Predicted secondary structures of various AAV ITR2 -based sequences using the mFOLD server. ITR2, wild-type AAV ITR2; ITR2 no BC, AAV ITR2 with a deletion of the B and C loops; ITR2 no RBE, AAV ITR2 with a deletion of the Rep Binding Element (RBE); ITR2 no D, AAV ITR2 with a deletion of the D region. FIG.4B, Cell viability as a measure of gene editing frequency for each ITR2 sequence, n.s. indicates no significance and *** indicates a p-value <0.001 using a student’s t-test. Bars are average ± SEM. All groups n=8 over two experiments. All groups were co-transfected with pScel.

[0014] FIG. 5 shows exemplary nucleic acid sequences in the AAV-based inverted repeat library with 106diversity. Shown are the nucleic acid sequences of the Hindlll site (SEQ ID NO:2), TRS (terminal resolution site) (SEQ ID NO:3), first Rep Binding Element (RBE) (SEQ ID NO:4), BsaBl site (SEQ ID NO:5), second RBE (SEQ ID NO:6), nicking stemAttorney Docket No. 5470.973.WO(SEQ ID NO:7), Kpnl site (SEQ ID NO:8), consensus sequence (SEQ ID NO:9), and 40 examples of the mutant ITR sequences in the library (SEQ ID NOs: 10-49).

[0015] FIG. 6 shows the segregation of single mutants.

[0016] FIG. 7 shows gene editing frequencies of 63 exemplary mutant ITRs relative to ITR2, as measured by a viability assay which correlates with editing frequency. Higher viability indicates high gene editing frequency. Representative low (E2, E8) and high (G12, H6) mutants are indicated. Bars are average ± SD. All groups n=4.

[0017] FIGS. 8A-8B show alignments of exemplary mutant ITR sequences (SEQ ID NOs:50-74) with consensus sequences (SEQ ID NOs:3-7, 77 and 78), wherein the mutant ITR sequences exhibit a decrease in gene editing frequency (FIG. 8A) or enhanced gene editing frequency as compared to the library parent (ITR284; SEQ ID NO:75) (FIG. 8B).

[0018] FIG. 9 shows folding of exemplary low and high ITRs as compared to the parent ITR.

[0019] FIG. 10 provides data showing that example ITR make less virus than the library parent (ITR284), which in turn makes less virus than ITR2. The different graphs represent separate virus preps on different days.

[0020] FIG. 11 shows that the exemplary H6 mutant ITR enhances gene editing frequency in the context of GFP. A second gene editing reporter cell line was generated by integrating a defective fluorescent reporter into HEK-293 cells. The H6 mutant ITR was then evaluated multiple times in this GFP context, which utilized CRISPR / Cas9 to induce a DSB at the chromosomal target site. Gene editing is reported as a fold-change from the wild-type ITR2. All statistical tests done in relation to the wild-type ITR2. * indicates a p-value <0.05, ** indicates a p-value <0.01, and *** indicates a p-value <0.001 using a student’s t-test. Bars are average ± SD. All groups n=4+.

[0021] FIG. 12 shows that the exemplary G12 mutant ITR displays similar gene editing frequency to the wild-type ITR2 in the context of GFP. The wild type ITR2 and G12 did not display significantly altered gene editing from each other, however ITR284 was significantly enhanced for gene editing over each of these sequences. * indicates a p-value <0.05 using a student’s t-test in relation to ITR284. Bars are average ± SD. All groups n=3.

[0022] FIGS. 13A-13B show directed evolution of ITR284 for enhanced production using a CMV-GFP reporter cassette to monitor sequential transduction. FIG. 13A) The ITR284-based library was evaluated for enhanced vector production as described herein. FIG. 13B) Following an initial triple transfection, successive cycling of cell lysate demonstrates selection of mutant(s) ITR enhanced for production noted by increased GFP+ cells.Attorney Docket No. 5470.973.WODETAILED DESCRIPTION

[0023] The present invention will now be described hereinafter with reference to the accompanying drawings and examples, in which embodiments of the invention are shown. This description is not intended to be a detailed catalog of all the different ways in which the invention may be implemented, or all the features that may be added to the instant invention. For example, features illustrated with respect to one embodiment may be incorporated into other embodiments, and features illustrated with respect to a particular embodiment may be deleted from that embodiment. Thus, the invention contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. In addition, numerous variations and additions to the various embodiments suggested herein will be apparent to those skilled in the art in light of the instant disclosure, which do not depart from the instant invention. Hence, the following descriptions are intended to illustrate some particular embodiments of the invention, and not to exhaustively specify all permutations, combinations and variations thereof.

[0024] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. The terminology used in the description of the invention herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention.

[0025] All publications, patent applications, patents and other references cited herein are incorporated by reference in their entireties for the teachings relevant to the sentence and / or paragraph in which the reference is presented.

[0026] Unless the context indicates otherwise, it is specifically intended that the various features of the invention described herein can be used in any combination. Moreover, the present invention also contemplates that in some embodiments of the invention, any feature or combination of features set forth herein can be excluded or omitted. To illustrate, if the specification states that a composition comprises components A, B and C, it is specifically intended that any of A, B or C, or a combination thereof, can be omitted and disclaimed singularly or in any combination.

[0027] Nucleotide sequences are presented herein by single strand only, in the 5' to 3' direction, from left to right, unless specifically indicated otherwise. Nucleotides and amino acids are represented herein in the manner recommended by the IUPAC-IUB Biochemical Nomenclature Commission, or (for amino acids) by either the one-letter code, or the three letterAttorney Docket No. 5470.973.WOcode, both in accordance with 37 C.F.R. §1.831 and established usage.

[0028] Except as otherwise indicated, standard methods known to those skilled in the art may be used for the construction of recombinant AAV (rAAV) constructs, packaging vectors expressing the AAV Rep and / or Cap sequences, and transiently and stably transfected packaging cells. Such techniques are known to those skilled in the art. See, e.g., Sambrook et al. Molecular Cloning: A Laboratory Manual 2ndEd. (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989); Ausubel et al. Current Protocols in Molecular Biology (Greene Publishing Associates, Inc. and Wiley-Interscience, New York, NY, 1987).Definitions

[0029] The following terms are used in the description herein and the appended claims.

[0030] As used in the description of the invention and the appended claims, the singular forms “a,” “an” and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise.

[0031] Also as used herein, “and / or” refers to and encompasses any and all possible combinations of one or more of the associated listed items, as well as the lack of combinations when interpreted in the alternative (“or”).

[0032] The term “about,” as used herein when referring to a measurable value such as an amount or concentration and the like, is meant to encompass variations of ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of the specified value as well as the specified value. For example, “about X” where X is the measurable value, is meant to include X as well as variations of ± 10%, ± 5%, ± 1%, ± 0.5%, or even ± 0.1% of X. A range provided herein for a measurable value may include any other range and / or individual value therein.

[0033] As used herein, phrases such as “between X and Y” and “between about X and Y” should be interpreted to include X and Y. As used herein, phrases such as “between about X and Y” mean “between about X and about Y” and phrases such as “from about X to Y” mean “from about X to about Y.”

[0034] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. For example, if the range 10 to 15 is disclosed, then 11, 12, 13, and 14 are also disclosed.

[0035] The term “comprise,” “comprises” and “comprising” as used herein, specify the presence of the stated features, integers, steps, operations, elements, and / or components, butAttorney Docket No. 5470.973.WOdo not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof.

[0036] As used herein, the transitional phrase “consisting essentially of’ means that the scope of a claim is to be interpreted to encompass the specified materials or steps recited in the claim and those that do not materially affect the basic and novel characteristic(s) of the claimed invention. Thus, the term “consisting essentially of’ when used in a claim of this invention is not intended to be interpreted to be equivalent to “comprising.”

[0037] As used herein, the terms “increase,” “increasing,” “enhance,” “enhancing,” “improve” and “improving” (and grammatical variations thereof) describe an elevation of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 100%, 150%, 200%, 300%, 400%, 500% or more such as compared to another measurable property or quantity (e.g., a control value).

[0038] As used herein, the terms “reduce,” “reduced,” “reducing,” “reduction,” “diminish,” and “decrease” (and grammatical variations thereof), describe, for example, a decrease of at least about 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 97%, 98%, 99%, or 100% such as compared to another measurable property or quantity (e.g., a control value). In some embodiments, the reduction can result in no or essentially no (i.e., an insignificant amount, e.g., less than about 10% or even 5%) detectable activity or amount.

[0039] A “vector” as used herein refers to a macromolecule or association of macromolecules that comprises or associates with a polynucleotide and which can be used to mediate delivery of the polynucleotide to a cell. Illustrative vectors include, for example, plasmids, viral vectors, liposomes, and other gene delivery vehicles.

[0040] “AAV” is an abbreviation for adeno-associated virus, and may be used to refer to the virus itself or derivatives thereof. The term covers all subtypes and both naturally occurring and recombinant forms, except where required otherwise. The abbreviation “rAAV” refers to recombinant adeno-associated virus, also referred to as a recombinant AAV vector (or “rAAV vector”). The term “AAV” includes AAV type 1 (AAV-1), AAV type 2 (AAV-2), AAV type 3 (AAV-3), AAV type 4 (AAV-4), AAV type 5 (AAV-5), AAV type 6 (AAV-6), AAV type 7 (AAV-7), AAV type 8 (AAV-8), avian AAV, bovine AAV, canine AAV, equine AAV, primate AAV, non-primate AAV, and ovine AAV. “Primate AAV” refers to AAV that infect primates, “non-primate AAV” refers to AAV that infect non-primate mammals, “bovine AAV” refers to AAV that infect bovine mammals, etc.Attorney Docket No. 5470.973.WO

[0041] An “rAAV vector” as used herein refers to an AAV vector comprising a polynucleotide sequence not of AAV origin (i.e., a polynucleotide heterologous to AAV), typically a sequence of interest for the genetic transformation of a cell. In general, the heterologous polynucleotide is flanked by at least one, and generally by two AAV inverted terminal repeat sequences (ITRs). The term “rAAV vector” encompasses both rAAV vector particles and rAAV vector plasmids.

[0042] An “AAV virus” or “AAV viral particle” or “rAAV vector particle” refers to a viral particle composed of at least one AAV capsid protein (typically by all of the capsid proteins of a wild-type AAV) and an encapsidated polynucleotide rAAV vector. If the particle comprises a heterologous polynucleotide (i.e., a polynucleotide other than a wild-type AAV genome such as a transgene to be delivered to a mammalian cell), it is typically referred to as an “rAAV vector particle” or simply an “rAAV vector”. Thus, production of rAAV particle necessarily includes production of rAAV vector, as such a vector is contained within an rAAV particle.

[0043] The term “terminal repeat” or “TR” includes any viral terminal repeat or synthetic sequence that forms a hairpin structure and functions as an inverted terminal repeat (ITR) (i.e., mediates the desired functions such as replication, virus packaging, integration and / or provirus rescue, and the like). The TR can be an AAV ITR or a non-AAV TR. For example, a non-AAV TR sequence such as those of other parvoviruses (e.g., canine parvovirus (CPV), mouse parvovirus (MVM), human parvovirus B-19) or the SV40 hairpin that serves as the origin of SV40 replication can be used as a TR, which can further be modified by truncation, substitution, deletion, insertion and / or addition. Further, the TR can be partially or completely synthetic, such as the “double-D sequence” as described in U.S. Patent No. 5,478,745.

[0044] An “AAV inverted terminal repeat” or “AAV ITR” may be from any AAV, including but not limited to serotypes 1, 2, 3a, 3b, 4, 5, 6, 7, 8, 9, 10, 11, or 13, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, or any other AAV now known or later discovered. As described herein, an AAV ITR may not have the native terminal repeat sequence (e.g., the native AAV ITR sequence is altered by insertion, deletion, truncation and / or missense mutations), as long as the terminal repeat mediates the desired functions, e.g., replication, virus packaging, persistence, and / or provirus rescue, and the like.

[0045] The terms “polynucleotide,” “nucleic acid,” “nucleic acid molecule,” and “oligonucleotide” are used interchangeably and refer to a polymeric form of nucleotides of any length, either deoxyribonucleotides or ribonucleotides or analogs thereof, or DNA-RNA hybrid sequences (including both naturally occurring and non-naturally occurring nucleotides). Polynucleotides can have any three-dimensional structure and may perform any function,Attorney Docket No. 5470.973.WOknown or unknown. The following are non-limiting examples of polynucleotides: a gene or gene fragment (for example, a probe, primer, EST or SAGE tag), exons, introns, messenger RNA (mRNA), transfer RNA, ribosomal RNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, genomic DNA, chimeras of RNA and DNA, isolated DNA of any sequence, isolated RNA of any sequence, synthetic DNA of any sequence (e.g., chemically synthesized), synthetic RNA of any sequence (e.g., chemically synthesized), nucleic acid probes and primers. A polynucleotide can comprise modified nucleotides, such as methylated nucleotides and nucleotide analogs or derivatives (e.g., inosine or phosphorothioate nucleotides). Such nucleotides can be used, for example, to prepare nucleic acid molecules that have altered base-pairing abilities or increased resistance to nucleases.

[0046] If present, modifications to the nucleotide structure can be imparted before or after assembly of the polynucleotide. The sequence of nucleotides can be interrupted by nonnucleotide components. A polynucleotide can be further modified after polymerization, such as by conjugation with a labeling component. The term also refers to both double- and singlestranded molecules.

[0047] As used herein, an “isolated” polynucleotide (e.g., an “isolated DNA” or an “isolated RNA”) means a polynucleotide separated or substantially free from at least some of the other components of the naturally occurring organism or virus, for example, the cell or viral structural components or other polypeptides or nucleic acids commonly found associated with the polynucleotide.

[0048] As used herein, the term “modified,” “mutated,” or “mutant” as applied to a polynucleotide or polypeptide sequence, refers to a sequence that differs from a wild-type or reference sequence due to one or more deletions, additions, substitutions, or any combination thereof.

[0049] The term “library" refers to a large collection or plurality of variant nucleic acid molecules, wherein the sequence of the members of the library differ from one another by at least one nucleotide, e.g., a nucleotide substitution, deletion or insertion.

[0050] As used herein, a “marker gene” refers to a gene used in a gene editing process to screen cells for successful gene editing.

[0051] A “defective marker gene” refers to a marker gene having at least one mutation therein that results in little or no detectable expression and / or activity of the marker gene or protein encoded thereby.

[0052] A “homologous recombination repair template for a defective marker gene” refers toAttorney Docket No. 5470.973.WOa wild-type or functional sequence of a marker gene that is homologous to a defective or mutant sequence of a marker gene and can serve as a template for repair of the defective or mutant sequence of the marker gene by homology-directed repair.

[0053] A “selection agent” refers to a compound that when contacted with a cell allows for the identification of a cell expressing a marker (selectable marker) gene, either positively or negatively. For example, a selection agent for an antibiotic resistance polynucleotide is the antibiotic to which the polynucleotide confers resistance. As a further non-limiting example, a selection agent for a metabolizing enzyme selectable marker is the compound that can only be metabolized and utilized by the cell that expresses the selectable marker.

[0054] The term "genome editing" or “gene editing” refers to a type of genetic engineering in which DNA is inserted, replaced, or removed from a target DNA, e.g., the genome of a cell, using one or more nucleases and / or nickases. The nucleases create specific double-strand breaks (DSBs) at desired locations in the genome, and harness the cell's endogenous mechanisms to repair the induced break by nonhomologous end joining (NHEJ). The nickases create specific single-strand breaks at desired locations in the genome. Any suitable nuclease can be introduced into a cell to induce genome editing of a target DNA sequence including, but not limited to, CRISPR-associated protein (Cas) nucleases, zinc finger nucleases (ZFNs), transcription activator-like effector nucleases (TALENs), meganucleases, other endo- or exonucleases, variants thereof, fragments thereof, and combinations thereof.

[0055] The term "homology-directed repair" or "HDR" refers to a mechanism in cells to accurately and precisely repair double-strand DNA breaks using a homologous template to guide repair. The most common form of HDR is homologous recombination (HR), a type of genetic recombination in which nucleotide sequences are exchanged between two similar or identical molecules of DNA.

[0056] As used herein, the term “operably linked” refers to the juxtaposition of two or more components (such as sequence elements), in which the components are arranged such that both components function normally and allow the possibility that at least one of the components can mediate a function that is exerted upon at least one of the other components.Mutant AAV ITR Library

[0057] The present invention provides an AAV ITR mutant DNA library. The library contains mutant ITR sequences that can be replicated and packaged as termini of ssDNA genomes in an AAV capsid. Coupled with selection and screening for discrete aspects of AAV vectorology (e.g., vector production, gene editing substrates, altered integration, ITR promoterAttorney Docket No. 5470.973.WOactivity, ITR enhancer function, high fidelity packaging, altered innate immune response), mutant ITRs can be isolated and used to enhance transduction efficiency, genome editing, and / or the overall safety of AAV gene therapy approaches.

[0058] Accordingly, in one aspect, an AAV ITR library is provided. The library may comprise a plurality of mutant AAV ITRs of no more than 126 nucleotides in length, wherein each of the mutant AAV ITRs comprises at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence as compared to starting or reference AAV ITR. In some embodiments, each of the plurality of mutant AAV ITRs has a unique nucleotide sequence, i.e., no two mutant AAV ITRs have the same sequence. In some embodiments, the library comprises a plurality of vectors, each of which comprises an AAV ITR of no more than 126 nucleotides in length, wherein the AAV ITR (i.e., mutant AAV ITR) comprises at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence of the wild-type AAV ITR. In some embodiments, the library comprises a plurality of vectors, each of which comprises an AAV ITR of no more than 126 nucleotides in length, wherein the AAV ITR (i.e., mutant AAV ITR) comprises at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence of a starting or reference AAV ITR (e.g., a mutant or variant of a wildtype AAV ITR). The AAV ITR may be from any AAV serotype such as any of the serotypes listed in Table 1. In some embodiments, an AAV ITR used in the compositions and methods described herein is from AAV2, i.e., AAV ITR2. In some embodiments, the AAV ITR used in the compositions and methods described herein is AAV ITR284.Table 1Attorney Docket No. 5470.973.WO

[0059] In some embodiments, the nucleotide sequence of the starting or reference AAV ITR comprises a double-D sequence as described in U.S. Patent No. 5,478,745.

[0060] In some embodiments, the nucleotide sequence of the starting or reference AAV ITR has the sequence:AGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCAGGC AAAGCCTGGATTTTTATCCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGG CCAACTCCATCACT (SEQ ID NO:1). In some embodiments, an AAV ITR library comprises a plurality of mutant AAV ITR sequences having at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence of the starting ITR sequence, e.g., SEQ ID NO:1. In some embodiments, an AAV ITR library comprises a plurality of mutant AAV ITR sequences having at least one nucleotide substitution, insertion, and / or deletion in theAttorney Docket No. 5470.973.WOnucleotide sequence of the starting ITR sequence, e.g., SEQ ID NO:1. In some embodiments, an AAV ITR library is composed of at least 104, 105, 106, 107, 108, 109, IO10, 1011, or 1012unique mutant AAV ITRs that include one or more nucleotide substitutions, additions, and / or deletions in the nucleotide sequence of the starting AAV ITR sequence, e.g., SEQ ID NO:1.In some embodiments, an AAV ITR library comprises a plurality of mutant AAV ITR sequences, wherein the mutant AAV ITR sequences of the AAV ITR library have at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence of the starting ITR sequence, e.g., SEQ ID NO:1 In some embodiments, an AAV ITR library comprises a plurality of mutant AAV ITR sequences, wherein the mutant AAV ITR sequences of the AAV ITR library have at least one nucleotide substitution, e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35,36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 or more nucleotide substitutions in the nucleotide sequence of the starting ITR sequence, e.g., SEQ ID NO:1. Nucleotide substitutions may include, but are not limited to, an A to C substitution, an A to G substitution, an A to T substitution, a C to A substitution, a C to G substitution, a C to T substitution, a G to A substitution, a G to C substitution, a G to T substitution, a T to A substitution, a T to C substitution, or a T to G substitution. Nucleotide substitutions may also include substitution of a natural nucleotide (i.e., A, C, T or G) with a modified nucleotide. In some embodiments, an AAV ITR library comprises a plurality of mutant AAV ITR sequences, wherein the mutant AAV ITR sequences of the AAV ITR library have at least one nucleotide insertion, e.g., 1, 2, or 3 nucleotide insertions in the nucleotide sequence of the starting ITR sequence, e.g., SEQ ID NO:1, such that the mutant AAV ITR sequences are no more than 126 nucleotides in length. In some embodiments, an AAV ITR library comprises a plurality of mutant AAV ITR sequences, wherein the mutant AAV ITR sequences of the AAV ITR library have at least one nucleotide deletion, e.g., e.g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleotide deletions in the nucleotide sequence of the starting ITR sequence, e.g., SEQ ID NO:1

[0061] In some embodiments, the mutant AAV ITR sequences of the AAV ITR library have at least one nucleotide substitution, insertion, and / or deletion in a conserved region of the starting AAV ITR sequence, e.g., at least one nucleotide substitution, insertion, and / or deletion in a terminal resolution site (TRS), Rep Binding Element (RBE), restriction enzyme recognition sequence (e.g., BsaBT) and / or nicking stem sequence. In some embodiments, the mutant AAV ITR sequences of the AAV ITR library have at least one nucleotide substitution, insertion, and / or deletion in a non-conserved region of the starting AAV ITR sequence, e.g., atAttorney Docket No. 5470.973.WOleast one nucleotide substitution, insertion, and / or deletion in a sequence: upstream of a TRS, between a TRS and RBE, between a RBE and a restriction enzyme recognition sequence, between a RBE and a nicking stem sequence, and / or downstream of a nicking stem sequence. In some embodiments, the mutant AAV ITR sequences of the AAV ITR library have at least one nucleotide substitution, insertion, and / or deletion in a conserved region and a nonconserved region of the starting AAV ITR sequence.

[0062] In some embodiments, the mutant AAV ITR sequences of the AAV ITR library have a nucleotide substitution, insertion, and / or deletion at any one or more of positions 1, 2, 3, 24, 25, 26, 27, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 74, 75, 76, 77, 78, 79, 80, 97, 98, 99, 100, 121, 122, and / or 123 of SEQ ID NO:1. In some embodiments, a mutant AAV ITR sequence comprises a nucleotide sequence that comprises from about 1 to about 40 nucleotide differences (e.g., from about 1 to about 5, from about 5 to about 10, from about 10 to about 20, from about 20 to about 30 nucleotide differences or from about 30 to about 40 nucleotide differences) from a nucleotide sequence of SEQ ID NO:1. In some embodiments, a mutant AAV ITR may have the nucleotide sequence:NNNGATGGAGTTGGCCACTCCCTNNNNGCGCGCTCGCTCGCTCNNNNNNNNNNN NNNNNNNNNGATTTTTATCNNNNNNNGAGCGAGCGAGCGCGCNNNNAGGGAGT GGCCAACTCCATCNNN (SEQ ID NO:76), where N may be present or absent and when present may be A, C, T or G. In some embodiments, a mutant AAV ITR of SEQ ID NO:76 may include at least one nucleotide insertion, e.g, 1, 2, or 3 nucleotide insertions, e.g, at any one of positions 1, 2, 3, 24, 25, 26, 27, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 74, 75, 76, 77, 78, 79, 80, 97, 98, 99, 100, 121, 122, and / or 123 of SEQ ID NO:76, such that the mutant AAV ITR sequence is no more than 126 nucleotides in length.

[0063] In some embodiments, the mutant AAV ITR sequences of the AAV ITR library may further include one or more mutations in the TRS (SEQ ID NO:3), first RBE (SEQ ID NO:4), Av / BI site (SEQ ID NO:5), second RBE (SEQ ID NO:6), and / or nicking stem (SEQ ID NO:7) of SEQ ID NO:1 In some embodiments, a mutation in one or more of the TRS, first RBE, Asr / BI site, second RBE, and / or nicking stem does not substantially impact replication, virus packaging, integration and / or provirus rescue function of the AAV ITR.

[0064] In some embodiments, a mutant AAV ITR sequence may have a nucleotide sequence of any one of SEQ ID NOs:10-74. In some embodiments, a mutant AAV ITR sequence may have a nucleotide sequence of any one of SEQ ID NOs:50-74. In some embodiments, a mutant AAV ITR sequence may have a nucleotide sequence of any one of SEQ ID NOs:50-72. In some embodiments, a mutant AAV ITR sequence may have aAttorney Docket No. 5470.973.WOnucleotide sequence of SEQ ID NO:50 or SEQ ID NO:51. In some embodiments, a mutant AAV ITR sequence may have a nucleotide sequence of SEQ ID NO:73 or SEQ ID NO:74.

[0065] AAV ITR mutants may be prepared by conventional mutagenesis approaches such as site-directed mutagenesis, saturating random mutagenesis, and / or by computationally predicted improvements in activity. AAV ITR mutants may be generated by recombinant methods or chemically synthesized, or a combination thereof.

[0066] In some embodiments, one or more of the mutant AAV ITR sequences are in a vector. The vector may be any suitable vector including, but not limited to, plasmids, phagemids, cosmids, viral vectors, and the like. In some embodiments, the vector is a plasmid. In some embodiments, the vector is suitable for use in transforming mammalian cells. In some embodiments, the vector is suitable for use in transforming bacterial cells. Examples of vectors for transforming cells include, but are not limited to, vectors such as the pUC series, pBR322, pET series, pGEX series, and ColEl series. In some embodiments, one or more of the mutant AAV ITR sequences are converted from a double-D sequence to a single-D sequence and then inserted into a vector.

[0067] In some embodiments, the vector is suitable for use in a screening assay, e.g., as described herein. When used in the context of a screening assay, the vector may further include a homologous recombination repair template for a defective marker gene. Introduction of a vector including a mutant AAV ITR sequence and a homologous recombination repair template for a defective marker gene into a cell that includes the defective marker gene allows for the defective marker gene to be repaired by homology-directed repair (HDR) so that the marker gene is no longer defective, i.e., the marker is expressed and active. The repaired marker gene, when expressed, is indicative of successful HDR and hence gene editing.

[0068] Marker genes typically confer a selectable or scorable phenotype on target host cells. Common selectable markers include antibiotic resistance, fluorescent markers, and biochemical markers and are well-known in the art. Several different antibiotic resistance genes have been used successfully for selection including, e.g., blasticidin-S deaminase for conferring resistance to blastocidin; bleomycin resistance gene for conferring resistance to bleomycin or phleomycin; aminoglycoside-3 ’-adenyltransferase gene for conferring resistance to spectinomycin or streptomycin; nourseothricin N-acetyl transferase gene for conferring resistance to nourseothricin; neomycin phosphotransferase II gene for conferring resistance to G418, neomycin or kanamycin; puromycin resistance gene for conferring resistance to puromycin; hygromycin phosphotransferase gene for conferring resistance to hygromycin; and many others. Fluorescent or chromogenic markers that have been used include, but are notAttorney Docket No. 5470.973.WOlimited to, luciferase, P-glucuronidase, P-galactosidase, green fluorescent protein (GFP), and yellow fluorescent protein (YFP).

[0069] Further provided herein are host cells, e.g., isolated host cells, comprising a mutant AAV ITR as described herein. A subject host cell is typically an isolated cell, e.g., a cell in in vitro culture. A subject host cell is useful for generating, screening and / or producing a mutant AAV ITR, e.g., in a vector comprising the mutant AAV ITR, as described herein. A host cell is useful for producing a rAAV virion comprising a mutant AAV ITR. Where a subject host cell is used to produce a rAAV virion, it is referred to as a “packaging cell.”

[0070] In some embodiments, in addition to a mutant AAV ITR as described herein, a host cell further includes nucleic acids that comprise a nucleotide sequence encoding one or more components of a gene editing system, and / or a polynucleotide heterologous to AAV (e.g., encoding a therapeutic protein or RNA).Selection of Mutant AAV ITRs

[0071] A method of screening for a mutant AAV ITR exhibiting at least one altered property is also provided. In some embodiments, a method of screening for a mutant AAV ITR exhibiting at least one altered property comprises the steps of (a) generating a library of mutant AAV ITR nucleotide sequences, wherein each of the mutant AAV ITR nucleotide sequences is no more than 126 nucleotides in length and comprise at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence relative to a starting AAV ITR nucleotide sequence; (b) introducing the library of mutant AAV ITR nucleotide sequences into a host cell; and (c) selecting at least one mutant AAV ITR nucleotide sequence exhibiting an altered property compared to the starting AAV ITR nucleotide sequence thereby screening for a mutant AAV ITR exhibiting at least one altered property. In some embodiments, a method of screening for a mutant AAV ITR exhibiting an altered vector production property is provided. In some embodiments, a mutant AAV ITR exhibits an increase or decrease in vector production. In some embodiments, a method of screening for a mutant AAV ITR exhibiting an altered transduction efficiency is provided. In some embodiments, a mutant AAV ITR exhibits an increase or decrease in transduction efficiency. In some embodiments, a method of screening for a mutant AAV ITR exhibiting an altered gene editing property is provided. In some embodiments, a mutant AAV ITR exhibits an increase or decrease in a gene editing property, e.g., an increase or decrease in gene editing frequency or an increase or decrease in gene editing fidelity.Attorney Docket No. 5470.973.WO

[0072] In some embodiments, a method of generating a mutant AAV ITR exhibiting an altered gene editing property is also provided, which comprises the steps of (a) generating a library of mutant AAV ITR nucleotide sequences operably linked to a homologous recombination repair template for a defective marker gene, wherein each of the mutant AAV ITR nucleotide sequences is no more than 126 nucleotides in length and comprises at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence relative to a starting AAV ITR nucleotide sequence; (b) introducing the library of mutant AAV ITR nucleotide sequences into a host cell comprising the defective marker gene; and (c) selecting at least one mutant AAV ITR exhibiting altered homologous recombination repair of the defective marker gene compared to the starting AAV ITR nucleotide sequence, thereby generating a mutant AAV ITR exhibiting an altered gene editing property. In some embodiments, the starting AAV ITR nucleotide sequence comprises SEQ ID NO:1. In some embodiments, the at least one nucleotide substitution, insertion, and / or deletion is located at position 1, 2, 3, 24, 25, 26, 27, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 74, 75, 76, 77, 78, 79, 80, 97, 98, 99, 100, 121, 122, and / or 123 of SEQ ID NO:1.In some embodiments, the library of mutant AAV ITR nucleotide sequences comprises at least 104unique mutant AAV ITRs, e.g., at least 104, 105, 106, 107, 108, 109, 1010, 1011, or 1012unique mutant AAV ITRs that include one or more nucleotide substitutions, additions, and / or deletions in the nucleotide sequence of the starting AAV ITR sequence, e.g., SEQ ID NO:1.

[0073] As described herein, a library of AAV ITR mutants may be generated by conventional mutagenesis approaches via recombinant and / or chemical synthetic methods. For selection in a host cell, a plurality of distinct mutant AAV ITR sequences may be inserted (e.g., cloned or ligated) into a vector along with a homologous recombination repair template for a defective marker gene operably linked thereto. A mutant AAV ITR, e.g., a vector comprising a mutant AAV ITR, is introduced stably or transiently into a host cell, using established techniques including, but not limited to, electroporation, calcium phosphate precipitation, liposome-mediated transfection, and the like. A transformed host cell is generated by introducing a mutant AAV ITR, e.g., a vector comprising a mutant AAV ITR, into any of a variety of cells, e.g., mammalian cells, including, e.g., murine cells, and primate cells (e.g., human cells). Suitable mammalian cells include, but are not limited to, primary cells and cell lines, where suitable cell lines include, but are not limited to, HEK293 cells, COS cells, HeLa cells, Vero cells, 3T3 mouse fibroblasts, C3H10T1 / 2 fibroblasts, CHO cells, and the like.

[0074] In some embodiments, the host cell comprises a defective marker gene (e.g., chromosomally or extrachromasomally), at least a portion of which is homologous to the repairAttorney Docket No. 5470.973.WOtemplate operably linked to the mutant AAV ITR sequences. In some embodiments, the portion of the defective marker gene that is homologous to the repair template includes an insertion, deletion, or substitution that confers the defective maker gene phenotype. Influence of the mutant AAV ITR on repair of the defective marker gene by HDR with the repair template (e.g., wild-type sequence) allows for the selection of at least one mutant AAV ITR exhibiting altered homologous recombination repair compared to a cell comprising a wild type AAV ITR under the same conditions.

[0075] In some embodiments, the marker gene encodes a protein that confers resistance to a selection agent. In some embodiments, the marker gene encodes a protein that confers resistance to an antibiotic. In accordance with this embodiment, repair of the defective marker gene renders the host cell resistant to a cognate antibiotic. By way of illustration, a host cell comprising a defective neomycin resistance gene is unable to grow on medium comprising neomycin, whereas repair of the defective neomycin resistance gene allows the host cell comprising the repaired neomycin resistance gene to grow in the presence of neomycin. Conventional cell viability assays such as an Alamar blue assay, MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) assay or CellTiter Gio® luminescent assay may be used to assess cell growth and viability in the presence of a selection agent.

[0076] In some embodiments, the marker gene encodes a fluorescent protein. In accordance with this embodiment, repair of the defective marker gene renders the host cell detectable by fluorescence. By way of illustration, a host cell comprising a defective GFP gene will not fluoresce upon exposure to an excitation wavelength around 488 nm, whereas repair of the defective GFP gene will result in fluorescent cells.

[0077] In some embodiments, an altered gene editing property may comprise an increase or decrease in gene editing frequency and / or an increase or decrease in gene editing fidelity. In some embodiments, a mutant AAV ITR sequence may exert at least about a 10%, at least about a 15%, at least about a 20%, at least about a 25%, at least about a 30%, at least about a 35%, at least about a 40%, at least about a 45%, at least about a 50%, at least about a 55%, at least about a 60%, at least about a 65%, at least about a 70%, at least about a 75%, at least about a 80%, at least about a 85%, at least about a 90%, at least about a 95% increase or decrease in gene editing frequency and / or gene editing fidelity. In some embodiments, a mutant AAV ITR sequence may exert at least about a 2-fold, at least about a 2.5-fold, at least about a 5-fold, at least about a 10-fold, at least about a 15-fold, at least about a 50-fold, at least about a 75-fold, or at least about 100-fold or more increase or decrease in gene editing frequency and / or gene editing fidelity.Attorney Docket No. 5470.973.WO

[0078] When referring to increasing or decreasing the frequency of gene editing it is meant that the frequency of inserting, deleting or modifying a targeted region of a gene is respectively increased or decreased. Increasing or decreasing the fidelity of gene editing refers to the precision or accuracy in which the gene editing event occurs, e.g., whether there are any detectable off-target mutations. In some embodiments, a mutant AAV ITR alters gene editing frequency. In some embodiments, a mutant AAV ITR increases gene editing fidelity. In some embodiments, a mutant AAV ITR increases both gene editing frequency and gene editing fidelity.

[0079] Mutant AAV ITRs, as described herein, are useful for the delivery of a polynucleotide of interest to cells in vitro, ex vivo, and in vivo in both AAV and non- AAV gene transfer contexts. In particular, virus vectors comprising one or more mutant AAV ITRs can be advantageously employed to deliver or transfer a polynucleotide to an animal, including mammalian, cell. Mutant AAV ITRs disclosed herein are useful for creating vectors that facilitate human gene editing applications. Mutant AAV ITRs may also be used for various non-therapeutic purposes, including but not limited to use in protocols to assess gene targeting, clearance, transcription, translation, etc., as would be apparent to one skilled in the art. The mutant AAV ITRs can also be used for the purpose of evaluating safety (spread, toxicity, immunogenicity, etc.). Such data, for example, are considered by the United States Food and Drug Administration as part of the regulatory approval process prior to evaluation of clinical efficacy.

[0080] Having described the present invention, the same will be explained in greater detail in the following examples, which are included herein for illustration purposes only, and which are not intended to be limiting to the invention.EXAMPLESExample 1: Gene Editing Assay Using Defective Neomycin Gene

[0081] To identify AAV ITRs of interest, a gene editing assay was developed. A reporter cell line from HEK293 cells was generated, which included a defective neomycin gene inserted in the chromosome. As shown in FIGS. 1-2, a break at the target site and the presence of a homologous recombination repair template leads to repair of the defective neomycin gene and thus gene editing, as evidenced by growth of separate colonies, which each arise from individual parent cells where the gene editing event has occurred. The only group that had colonies was the group that had a double-strand break (DSB) at the target site and the repair template supplied.Attorney Docket No. 5470.973.WO

[0082] The activity of ITRs in the gene editing assay was assessed. This analysis indicated that DSBs and inverted repeats on the repair molecule stimulate gene editing over a no structure control (FIGS. 3A-3C). To determine the impact of deletions of specific AAV ITR2 regions on gene editing frequency, a deletion panel was prepared (FIG. 4A). The AAV ITR2 deletion mutants were tested in the gene editing assay shown in FIGS. 3A-3C. The results of this analysis indicated that deletion of specific AAV ITR2 regions decreases gene editing frequency (FIG. 4B). In particular, the D region is implicated as being important for the enhancement of gene editing seen with the wild-type ITR2 sequence (Table 2).Table 2. Summary table of deletion panel and sequence characteristics.

[0083] To determine whether one or more nucleotide substitutions in the ITRs would alter gene editing, a library of ITR mutants was generated. The library of mutant ITRs included one or more nucleotide substitutions at positions 1-3, 24-27, 44-63, 74-80, 97-100 and / or 121-123 of a truncated AAV ITR2 (SEQ ID NO:1)(FIG. 5). The library of mutant ITR sequences was inserted into the plasmid used in the gene editing assay. The library of plasmids was transformed into bacteria, single colonies were isolated, minipreps of DNA were prepared and individual plasmid preparations were placed in a well of a 96-well plate (FIG. 6). The individual plasmids were tested in the gene editing assay shown in FIGS. 3A-3C, which correlates viability with editing frequency; higher viability indicates high gene editing frequency. Viability for each construct is presented relative to the wild-type ITR2. Results of this assay are presented in FIG. 7. Representative low (E2, E8) and high (G12, H6) mutants were chosen for further examination. Of the 63 mutants investigated, 43 displayed significantly lower cell viability or lower gene editing, 18 mutants displayed no significant difference in viability, and two exhibited enhanced viability and thus enhanced gene editing.

[0084] Mutant ITRs that had significantly altered gene editing frequency compared to the wild-type ITR2 were sequenced. Mutant IR sequences were grouped and aligned based on their effect on editing frequency. (FIGS. 8A-8B). All conserved regions are conserved and all mutated regions were randomly mutated as desired, though the mutant ITR2 with the highestAttorney Docket No. 5470.973.WOgene editing frequency (H6) had a single bp mutation in the nicking stem. Data from the rational panel implicates the nicking stem as being important for wild-type ITR2 enhancement of gene editing; thus, a mutation in this region that increases gene editing was of interest. Predicted secondary structure analysis of selected mutant ITRs was carried out (FIG. 9) using the DNA mFOLD server (Zuker (2003) Nucl. Acid Res. 3 l(13):3406-3415). Secondary structure analyses of the mutants are useful in relating the structure of the mutant ITR to the ability of the mutant to enhance / decrease gene editing.

[0085] The library described herein was synthesized to retain regions thought to be necessary for rAAV production intact, while randomly mutating the intervening sequences. Accordingly, it was determined whether the mutants had altered rAAV production. FIG. 10 shows that ITR mutants H6, G12, and E8 made less virus than the library parent (ITR284), which in turn makes less virus than ITR2.Example 2: Gene Editing Assay Using Defective GFP Gene

[0086] A second gene editing reporter cell line was generated by integrating a defective fluorescent reporter into HEK-293 cells. The H6 mutant ITR sequence was then evaluated multiple times in this GFP context, which utilized CRISPR / Cas9 to induce a DSB at the chromosomal target site. Gene editing is reported as a fold-change from the wild-type ITR2 (FIG. 11). Both the H6 mutant and ITR284 were enhanced for gene editing compared to the wild-type ITR2 for each attempt, though not always significant. The G12 mutant ITR sequence was also evaluated in the GFP context. The wild-type ITR2 and G12 mutant did not display significantly altered gene editing from each other, however ITR284 was significantly enhanced for gene editing over each of these sequences (FIG. 12).Example 3: Selection of ITR Mutants with Enhanced Production

[0087] The ITR284 based library described in Example 1 was evaluated for enhanced vector production using a GFP gene (FIG. 13A). Two days after the initial triple transfection for AAV vector production (ITR Library, pRepCap, pAd helper), cells were harvested, lysed by 3x freeze / thaw, and clarified by centrifugation. The crude lysate was then applied to HEK-293 cells previously transfected with pRepCap and pAd_helper (cycle 1; FIG. 13B). Vector genomes harboring ITR284-derived mutants that were competent for production, infection, uncoating, etc. were viable substrates for AAV production in the subsequent cycle. We have performed 4 rounds of cycling to select for ITR284 library-derived mutants enhanced in fitnessAttorney Docket No. 5470.973.WOfor all aspects of rAAV production. From crude lysate transduction, we observed increased GFP+ cells each cycle which directly correlates to increased vector production.

[0088] The foregoing is illustrative of the present invention, and is not to be construed as limiting thereof. The invention is defined by the following claims, with equivalents of the claims to be included therein.

Claims

Attorney Docket No. 5470.973.WOTHAT WHICH IS CLAIMED IS:

1. An adeno-associated virus (AAV) inverted terminal repeat (ITR) library comprising a plurality of vectors, each of which comprises an AAV ITR nucleotide sequence of no more than 126 nucleotides in length, said AAV ITR nucleotide sequence comprising at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence relative to a starting AAV ITR nucleotide sequence.

2. The AAV ITR library of claim 1, wherein the starting AAV ITR nucleotide sequence is a wild-type AAV ITR nucleotide sequence.

3. The AAV ITR library of claim 1, wherein the starting AAV ITR nucleotide sequence is a non-naturally occurring AAV ITR nucleotide sequence.

4. The AAV ITR library of claim 1, wherein the starting AAV ITR nucleotide sequence comprises SEQ ID NO:1.

5. The AAV ITR library of claim 4, wherein the at least one nucleotide substitution, insertion, and / or deletion is located at position 1, 2, 3, 24, 25, 26, 27, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 74, 75, 76, 77, 78, 79, 80, 97, 98, 99, 100, 121, 122, and / or 123 of SEQ ID NO:1.

6. The AAV ITR library of any preceding claim, wherein the AAV ITR library comprises at least 104unique mutant AAV ITR nucleotide sequences.

7. The AAV ITR library of any preceding claim, wherein each of the plurality of vectors further comprises a homologous recombination repair template for a defective marker gene.

8. A transformed cell comprising a vector of the plurality of vectors of the AAV ITR library of any preceding claim.

9. A method of generating a mutant AAV ITR exhibiting an altered gene editing property comprising:Attorney Docket No. 5470.973.WO(a) generating a library of mutant AAV ITR nucleotide sequences operably linked to a homologous recombination repair template for a defective marker gene, wherein each of the mutant AAV ITR nucleotide sequences is no more than 126 nucleotides in length and comprises at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence relative to a starting AAV ITR nucleotide sequence;(b) introducing the library of mutant AAV ITR nucleotide sequences into a host cell comprising the defective marker gene; and(c) selecting at least one mutant AAV ITR nucleotide sequence exhibiting altered homologous recombination repair of the defective marker gene compared to the starting AAV ITR nucleotide sequence thereby generating a mutant AAV ITR exhibiting an altered gene editing property.

10. The method of claim 9, wherein the starting AAV ITR nucleotide sequence comprises SEQ ID NO:1.

11. The method of claim 10, wherein the at least one nucleotide substitution, insertion, and / or deletion is located at position 1, 2, 3, 24, 25, 26, 27, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 74, 75, 76, 77, 78, 79, 80, 97, 98, 99, 100, 121, 122, and / or 123 of SEQ ID NO:1.

12. The method of any one of claims 9-11, wherein the library of mutant AAV ITR nucleotide sequences comprises at least 104unique mutant AAV ITRs.

13. The method of any one of claims 9-12, wherein the defective marker gene comprises a defective gene that confers resistance to a selection agent.

14. The method of claim 13, wherein the selection agent is neomycin and the defective marker gene is a defective neomycin resistance gene.

15. The method of any one of claims 9-12, wherein the defective marker gene comprises a defective fluorescent marker gene.

16. The method of claim 15, wherein the defective fluorescent marker gene is a defective green fluorescent protein gene.Attorney Docket No. 5470.973.WO17. The method of any one of claims 9-16, wherein the altered gene editing property comprises an increase or decrease in gene editing frequency and / or an increase or decrease in gene editing fidelity.

18. A method of screening for a mutant adeno-associated virus (AAV) inverted terminal repeat (ITR) exhibiting at least one altered property comprising:(a) generating a library of mutant AAV ITR nucleotide sequences, wherein each of the mutant AAV ITR nucleotide sequences is no more than 126 nucleotides in length and comprises at least one nucleotide substitution, insertion, and / or deletion in the nucleotide sequence relative to a starting AAV ITR nucleotide sequence;(b) introducing the library of mutant AAV ITR nucleotide sequences into a host cell; and (c) selecting at least one mutant AAV ITR nucleotide sequence exhibiting an altered property compared to the starting AAV ITR nucleotide sequence thereby screening for a mutant AAV ITR exhibiting at least one altered property.

19. The method of claim 18, wherein the starting AAV ITR nucleotide sequence comprises SEQ ID NO:1.

20. The method of claim 19, wherein the at least one nucleotide substitution, insertion, and / or deletion is located at position 1, 2, 3, 24, 25, 26, 27, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 74, 75, 76, 77, 78, 79, 80, 97, 98, 99, 100, 121, 122, and / or 123 of SEQ ID NO:1.

21. The method of any one of claims 18-20, wherein the library of mutant AAV ITR nucleotide sequences comprises at least 104unique mutant AAV ITRs.

22. The method of any one of claims 18-21, wherein the at least one altered property comprises an increase or decrease in gene editing frequency, an increase or decrease in gene editing fidelity, an increase or decrease in transduction efficiency, and / or an increase or decrease in vector production.

23. A mutant AAV ITR comprising a nucleotide sequence of any one of SEQ ID NOs: 10-74.Attorney Docket No. 5470.973.WO24. A mutant AAV ITR comprising a nucleotide sequence of any one of SEQ ID NOs: 10-74 that has been converted from a double-D sequence to a single-D sequence.

25. A vector comprising the mutant AAV ITR of claim 23 or 24.

Images