RNA interference therapy for bassoon (BSN)-mediated tauopathies and related neurodegenerative diseases
By employing RNAi molecules to target Bassoon (BSN) and inhibit tau seed interactions, the progression of tauopathies is mitigated, addressing the limitations of current therapeutics and improving synaptic function and cognitive outcomes in neurodegenerative disorders.
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- THE TRUSTEES OF INDIANA UNIV
- Filing Date
- 2026-01-24
- Publication Date
- 2026-07-30
AI Technical Summary
Current therapeutics for neurodegenerative disorders such as Alzheimer's disease and tauopathies primarily offer symptom management with limited slowing of cognitive decline, and there is a lack of understanding regarding the propagation and seeding mechanisms of tau protein, which contributes to pathological aggregation and neuronal dysfunction.
The use of double-stranded RNA interference (RNAi) molecules to downregulate Bassoon (BSN), a scaffolding protein involved in presynaptic active zones, to inhibit the interaction of tau seed interactors with intracellular tau proteins, thereby reducing tau pathology and associated neurodegeneration.
This approach effectively reduces tau spreading, improves synaptic integrity, rescues electrophysiological and behavioral impairments, and ameliorates brain atrophy, providing a potential therapeutic avenue for neurodegenerative diseases like Alzheimer's disease and chronic traumatic encephalopathy.
Smart Images

Figure US2026012460_30072026_PF_FP_ABST
Abstract
Description
RNA INTERFERENCE THERAPY FOR BASSOON ( BSN )-M EDIATED TAUOPATHIES AND RELATED NEURODEGENERATIVE DISEASESFIELD OF THE INVENTION
[0001] The present disclosure relates to therapeutics and methods that may be used, e.g., for the treatment of neurodegenerative disorders.BACKGROUND
[0002] Neurodegenerative disorders such as Alzheimer’s disease (AD) affect millions of people worldwide. Current understanding of the etiology and mechanisms underlying such disorders is limited, and extant therapeutics for such disorders offer patients only symptom management and limited slowing of cognitive decline. Tau protein and tau-protein modulation is a promising avenue for improved understanding and potential target for treatment and prevention of neurodegenerative disorders.
[0003] Pathological aggregation of tau and the preponderance of neurofibrillary tangles (NFT) and other tau inclusions are defining histopathological features of AD, Pick’s disease (PiD), progressive supranuclear palsy (PSP), and many neurodegenerative disorders collectively known as tauopathies. See Alonso et al., “Mechanism of tau-induced neurodegeneration in Alzheimer disease and related tauopathies,” (2008) Curr Alzheimer Res 5: pp. 375-84; Lee et al., “Neurodegenerative tauopathies, (2001) Annu Rev Neurosci 24: pp. 1121-59. A major focus of research has been understanding the propagation of pathological tau along neuronal networks in the brains of AD patients. The precise cellular mechanisms involved in tau propagation remain unclear, although reports have linked it to synaptic activity. See Pooler et al., “Physiological release of endogenous tau is stimulated by neuronal activity,” (2013) EMBO Rep 14: pp. 389-94; Yamada et al., “Neuronal activity regulates extracellular tau in vivo,” (2014) J Exp Med 211: pp. 387-93.
[0004] It has been recently shown that increases in neuronal activity stimulate the release of tau in vitro and enhance tau pathology in vivo. See Wu et al., “Neuronal activity enhances tau propagation and tau pathology in vivo,” (2016) Nat Neurosci 19: pp. 1085-92. Tau protein released due to neuronal activity could be impaired by blocking presynaptic vesicle release, suggesting that tau is released via presynaptic compartments. See Pooler et al. 2013. Furthermore, seed-competent tau is significantly enriched in AD patient synapses, suggesting that tau seeds propagate through the brain along synaptically connected neurons. See DeVos et al., “Synaptic Tau Seeding Precedes Tau Pathology in Human Alzheimer's Disease Brain,”Taft Ref. :IUIC-00190(2018) Front Neurosci 12: p. 267. Unfortunately, the nature of the tau species involved in tau spreading and the precise seeding mechanism and template remain unclear. Despite this uncertainty, some studies suggest that a rare species of soluble phosphorylated high molecular weight (HMW) tau is involved in trans-synaptic propagation. See Takeda et al., “Neuronal uptake and propagation of a rare phosphorylated high-molecular-weight tau derived from Alzheimer's disease brain,” (2015) Nat Commun 6: p. 8490; Tanaka et al., “Seeding Activity-Based Detection Uncovers the Different Release Mechanisms of Seed-Competent Tau Versus Inert Tau via Uysosomal Exocytosis,” (2019) Front Neurosci 13: p. 1258. Whether these HMW tau-containing particles are exclusively comprised of tau or contain other constituents, such as proteins or lipids for propagation, is unknown.
[0005] Numerous studies on the tau interactome have established that tau interacts directly with proteins and complexes involved in various biological functions in addition to those associated with microtubule stability. See Eftekharzadeh et al., “Tau Protein Disrupts Nucleocytoplasmic Transport in Alzheimer's Disease,” (2018) Neuron 99: pp. 925-40; Ittner et al., “Phosphorylated Tau interacts with c-Jun N-terminal kinase-interacting protein 1 (JIP1) in Alzheimer disease,” (2009) J Biol Chem 284: pp. 20909-16; Ittner et al., “Dendritic function of tau mediates amyloidbeta toxicity in Alzheimer's disease mouse models,” (2010) Cell 142: pp. 387-97; Mclnnes et al., “Synaptogyrin-3 Mediates Presynaptic Dysfunction Induced by Tau, (2018) Neuron 97: pp.823-35; Sohn et al., “Pathogenic Tau Impairs Axon Initial Segment Plasticity and Excitability Homeostasis,” (2019) Neuron 104: pp. 458-70; Vanderweyde et al., “Interaction of tau with the RNA-Binding Protein TIA1 Regulates tau Pathophysiology and Toxicity,” (2016) Cell Rep 15: pp. 1455-66; Morris et al., “The many faces of tau,” (2011) Neuron 70: pp. 410-26. Mass spectrometry studies have identified interactors of total tau in vivo in tauopathy mouse model. See Liu et al., “Co-immunoprecipitation with Tau Isoform-specific Antibodies Reveals Distinct Protein Interactions and Highlights a Putative Role for 2N Tau in Disease,” (2016) J Biol Chem 291: pp. 8173-88; Maziuk et al., “RNA binding proteins co-localize with small tau inclusions in tauopathy,” (2018) Acta Neuropathol Commun 6: p. 71; Choi et al., “Acetylation changes tau interactome to degrade tau in Alzheimer's disease animal and organoid models,” (2020) Aging Cell 19: el3081; Wang et al., “Tau interactome mapping based identification of Otubl as Tau deubiquitinase involved in accumulation of pathological Tau forms in vitro and in vivo,” (2017) Acta Neuropathol 133: pp. 731-49. Other studies have examined the interactome of total tau in SH-SY5Y neuroblastoma cells, a mixed population of neuroprogenitor-derived human ReN cells, and iPSC-derived neurons. See Gunawardana et al., “The Human Tau Interactome:Taft Ref. :IUIC-00190Binding to the Ribonucleoproteome, and Impaired Binding of the Proline-to-Leucine Mutant at Position 301 (P301L) to Chaperones and the Proteasome,” (2015) Mol Cell Proteomics 14: pp.3000-14; Wang et al., “Tan interactome analyses in CRISPR-Cas9 engineered neuronal cells reveal ATPase-dependent binding of wild-type but not P301L Tau to non-muscle myosins,” (2019) Sci Rep 9: p. 16238; Tracy et al., “Tau interactome maps synaptic and mitochondrial processes associated with neurodegeneration,” (2022) Cell 185: pp. 712-28. However, no studies have directly compared the interactomes of seeding-competent tau aggregates with those of monomeric tau or determined how tau-seed interactors affect the nature of this seed and, subsequently, tau propagation.
[0006] Downregulating BSN significantly reduced tau spreading and overall tau pathology, improved synaptic integrity, rescued electrophysiological and behavioral impairments, and ameliorated brain atrophy. BSN is a large scaffolding protein (419 kDa) of the presynaptic active zone involved in the regulation of neurotransmitter release at the synapse. See Annamneedi et al., 2018. Mice with constitutive ablation of the bassoon gene Bsn show no abnormalities in brain architecture but have impaired presynaptic functions. See Altrock et al., “Functional inactivation of a fraction of excitatory synapses in mice deficient for the active zone protein bassoon,” (2003) Neuron 37: pp. 787-800.
[0007] Interestingly, partial loss of Bsn (Bsn+ / ~) causes no abnormalities, suggesting that a -50% decrease in Bsn levels is well tolerated. Altrock et al., 2003. The recently developed BsnfloxP / floxPmouse model shows no neuronal differences from constitutive knockout allele by Cre-mediated recombination in the germ line and wild-type controls, suggesting that ablation of Bsn is not detrimental. BSN also regulates presynaptic ubiquitination, proteostasis, and autophagy. See Okerlund et al., 2017; Waites et al., 2013, Schattleing et al. 2019. Synaptic accumulation of tau oligomers in AD is associated with dysfunction of the ubiquitin-proteasome system, suggesting that these oligomers may be an important mediator of the proteotoxicity that disrupts synapses in AD. See Tai et al., “The synaptic accumulation of hyperphosphorylated tau oligomers in Alzheimer disease is associated with dysfunction of the ubiquitin-proteasome system,” (2012) Am J Pathol 181: pp. 1426-35.
[0008] BSN protein is also involved in regulating neurotransmitter release from glutamatergic synapses. See Altrock et al., 2003. The selective ablation of Bsn in excitatory neurons enhances learning performance in mice. See Anamneedi et al., 2018. These functions of BSN could affect tau pathology considering recent studies demonstrating that tau accumulation occurs predominantly in excitatory neurons and that tau induces excitotoxicity due to alterations inTaft Ref. :IUIC-00190glutamate neurotransmission. See Fu et al., “A tau homeostasis signature is linked with the cellular and regional vulnerability of excitatory neurons to tau pathology,” (2019) Nat Neurosci 22: pp. 47-56; Hunsberger et al., “”P30 IL tau expression affects glutamate release and clearance in the hippocampal trisynaptic pathway,” (2015) J Neurochem 132: pp. 169-82; Roberson et al., “Reducing endogenous tau ameliorates amyloid beta-induced deficits in an Alzheimer's disease mouse model,” (2007) Science 316: pp. 750-54; Timmer et al., “Cerebral level of vGlutl is increased and level of glycine is decreased in TgSwDI mice,” (2014) J Alzheimers Dis 39: pp.89-101.
[0009] The strongest evidence linking BSN with tau pathology was published in 2018, revealing four missense mutations in the Bsn gene (P3866A) and aggregation of 3 and 4 repeat tau in patients with a spatial distribution of tau pathology consistent with PSP. See Yabe et al., 2018. Another study revealed increased BSN expression in patients with MSA, a neurodegenerative disease characterized by the aggregation of alpha-synuclein and tau protein. See Hashida et al., 1998; Nagaishi et al., “Tau-positive glial cytoplasmic granules in multiple system atrophy,” (2011) Neuropathology 31: pp. 299-305.
[0010] Another study demonstrated the toxic accumulation of BSN protein in the neuronal somata of mice and patients with multiple sclerosis (MS). Notably, this study also demonstrated that the genetic ablation of Bsn protected mice from inflammation-induced neuroaxonal injury and enhanced neuronal survival. Overall, these studies suggest associations among BSN, neurodegenerative events, and tau pathology, and support the feasibility of BSN downregulation as atherapeutic avenue for neurodegenerative tauopathies. Shattling et al., 2019.
[0011] Pathological tau aggregation is a defining histopathological feature of AD and other neurodegenerative diseases collectively known as tauopathies. The propagation of pathological forms of tau in AD patient brains has been shown to follow neuronal networks.
[0012] Currently, therapeutics for tauopathies offer only symptom management and limited slowing of cognitive decline. There is a need to treat and / or prevent tauopathies including AD and chronic traumatic encephalopathy (CTE).SUMMARY
[0013] The present disclosure provides compounds, compositions, and methods for treatment, management, prevention, and mitigation of neurodegenerative disease(s) in a subject.
[0014] The current invention is directed in part to double stranded RNAi molecules and methods for reducing Bassoon (BSN) expression.Taft Ref. :IUIC-00190
[0015] Also described herein are methods of treating neurodegenerative tauopathies in a patient in need thereof comprising administration of an agent (e.g., a dsRNA) that reduces or inhibits the interaction of a tan seed interactor Bassoon (BSN), a scaffolding protein of the presynaptic active zone with intracellular tau proteins. For example, contemplated dsRNA molecules as described herein may reduce or inhibit the interaction of a tau seed interactor with intracellular tau proteins and leads to a reduction of neurodegeneration in a patient with a neurodegenerative tauopathies. For example, agents / molecules provided herein may reduce or inhibit the interaction of a tau seed interactor with intracellular tau proteins leading to a behavioral improvement in a patient with a neurodegenerative tauopathies.
[0016] The current invention also provides methods of treating, ameliorating and / or preventing neurodegenerative tauopathies in a patient in need thereof comprising administration of an agent that reduces or inhibits the interaction of a tau seed interactor with intracellular tau proteins.
[0017] In any of the embodiments described herein, the neurodegenerative tauopathies can be neurodegenerative diseases characterized by abnormal metabolism of misfolded tau proteins which in turn leads to intracellular accumulation and formation of neurofibrillary tangles (NFT). In any embodiment, the neurodegenerative tauopathies are selected from Alzheimer’s disease, progressive supranuclear palsy (PSP), frontotemporal lobar degeneration (FTLD-TAU), corticobasal degeneration, Pick’s disease (frontal temporal dementia), chronic traumatic encephalopathy (CTE), and primary age related tauopathy.
[0018] The current invention also provides methods of treating or preventing Alzheimer’s disease and / or chronic traumatic encephalopathy (CTE) in a patient in need thereof comprising administration of an dsRNA molecule as described herein that reduces that reduces the interaction of a tau seed interactor with intracellular tau proteins.
[0019] In any of the methods of the current invention, can further comprise the administration of one or more additional therapeutic agents.
[0020] In an aspect, the present disclosure provides double-stranded ribonucleic acid (dsRNA) molecule for inhibiting the expression of BSN in a cell, wherein said dsRNA comprises a sense strand and an antisense strand forming a duplex structure less than 30 nucleotides in length; each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to part of an mRNA encoding BSN to mediate RNA interference and wherein the sense strand comprises a sequence having at least 90% identity to a sequence selected the group consisting of the sequences provided in Table 1. In an embodiment, the sequence identityTaft Ref. :IUIC-00190is at least 95%. In an embodiment, the sequence identity is at least 99%. In an embodiment, the sequence identity may be 100%.
[0021] In another aspect, the present disclosure provides an RNAi molecule that binds to nucleic acid encoding BSN to reduce expression of Bassoon in a cell, the RNAi molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises 15 to 30 consecutive nucleotide bases of a sequence selected from the group consisting of SEQ ID NOs.: 12-203 and the antisense strand is 15 to 30 nucleotides in length.
[0022] In still another aspect, the present disclosure provides a double stranded RNA comprising 15-30 consecutive nucleotide bases of a) a sense strand of any one of SEQ ID Nos.: 12-203 and 15-30 consecutive nucleotide bases of b) an antisense strand of any one SEQ ID.: 204-395.
[0023] In a further aspect, the present disclosure provides a double stranded RNA comprising a) a sense strand of any one of SEQ ID No.: 12-203, 396-414, 442-633, or 826-844 and b) an antisense strand of any one SEQ ID No.: 204-395, 415-433, 634-825, or 845-863.
[0024] In any aspect the antisense strand and the sense strand may each be 19 to 25 nucleotides in length, or the antisense strand and the sense strand may each be 21 to 23 nucleotides in length. In any aspect, the RNAi molecule comprises a single stranded overhang of at least one of the termini, e.g., an overhang of 1, 2, or 3 nucleotides in length. In any aspect, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length, wherein the strands form a double stranded region of 21 consecutive base pairs having a 2 nucleotide long single strand overhang at the 3' end. In any aspect, the sense strand is 19 nucleotides in length and the antisense strand is 21 nucleotides in length, wherein the strands form a double stranded region of 19 consecutive base pairs having a 2 nucleotide long single strand overhang at the 3' end.
[0025] In any aspect, the sense and antisense sequences are on different or the same RNA strands. In any aspect, the molecule may be an shRNA. In any aspect, the molecule may be an siRNA.
[0026] In any aspect, at one or more positions on the sense strand or the antisense strand, one or more nucleobases is substituted for a modified nucleobase, and / or one or more phosphodiester backbone moieties is substituted for a modified backbone moiety.
[0027] In any aspect, the modified nucleobases are selected from any of: 2'-O-methoxy nucleobase, 2'-deoxy nucleobase, 2'-allyl nucleobase, 2'-fluoro nucleobase, 2'-lipid-conjugated nucleobase, and 5'-(E)-vinylphosphonate nucleobase. In embodiments, the modified backbone moiety comprises at least one phosphorothioate or methylphosphonate intemucleotide linkage.Taft Ref. :IUIC-00190In embodiments, the phosphorothioate or methylphosphonate intemucleotide linkage is at the 3'-terminus of one strand.
[0028] In any aspect, the antisense strand comprises one or both of the following characteristics:(i) 2, 3, 4, 5 or 62'-fhioro modifications; and (ii) 1, 2, 3, 4 or 5 phosphorothioate intemucleotide linkages, and optionally comprises at least one thermally destabilizing modification of the molecule within the first 9 nucleotide positions of the 5' region of the antisense strand or a precursor thereof; and said sense strand comprises one, two or three of the following characteristics: (i) a) one or more lipophilic moieties each conjugated to a nucleotide optionally through a linker ; (ii) 2, 3, 4, or 52'-fluoro modifications; and (iii) 1, 2, 3, 4 or 5 phosphorothioate intemucleotide linkages.
[0029] In any aspect, the sense strand may be conjugated to at least one ligand. In embodiments, the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker. In embodiments, the ligand is attached to the 3' end of the sense strand.
[0030] In any aspect, the molecule further comprises a phosphate or a phosphate mimic at the 5' end of the antisense strand. In embodiments, the phosphate mimic is a 5' vinyl phosphate.
[0031] In embodiments, the one or more lipophilic moieties are conjugated to one or more of positions 4-8 and 13-18 on the sense strand and positions 6-10 and 18 on the antisense strand, counting from the 5' end of each strand.
[0032] In embodiments, the 2'-lipid-conjugated nucleobase comprises a nucleobases having conjugated to the 2' position a lipid group comprising 4 to 40 carbon atoms, wherein the lipid group is substituted, unsubstituted, saturated, and / or unsaturated. In embodiments, the 2'-lipid-conjugated nucleobase comprises a nucleobase having conjugated to the 2' position a lipid group comprising 10 to 20 carbon atoms, wherein the lipid group is substituted, unsubstituted, saturated, and / or unsaturated. In embodiments, the 2'-lipid-conjugated nucleobase comprises a nucleobases having conjugated to the 2' position a lipid group comprising 12 to 18 carbon atoms, wherein the lipid group is substituted, unsubstituted, saturated, and / or unsaturated. In embodiments, the 2'-lipid-conjugated nucleobase comprises a nucleobases having conjugated to the 2' position a lipid group that is a saturated or unsaturated Ci6 hydrocarbon chain group.
[0033] In embodiments, the lipid moiety may be conjugated to the molecule via a chemical linker.
[0034] In any aspect, at least 25%, at least 50%, at least 75% or at least 90% of total nucleobases of the molecule may be modified nucleobases.Taft Ref. :IUIC-00190
[0035] In any aspect, the sense strand has 4 to 12 asymmetrical 2'-O-alkyl modifications, at least 4 of which occur at the 4 terminal nucleotides of the 3' end, and an antisense sequence having at least 4 asymmetrical phosphorothioate modifications.
[0036] In any aspect, the sense strand has 5 to 10 asymmetrical 2'-O-alkyl modifications, at least 4 of which occur at the 4 terminal nucleotides of the 3' end, and an antisense sequence having at least 5 asymmetrical phosphorothioate modifications.
[0037] In any aspect, the sense strand has 62'-O-alkyl modifications at the 6 terminal nucleotides of the 5' end. In embodiments, the 2'-O-alkyl modification is 2'-O-methyl.
[0038] In any aspect, at least four phosphodiester moieties of the sense strand are substituted with a phosphorothioate moiety, and wherein at least four phosphodiester moieties of the antisense strand are substituted with a phosphorothioate moiety.
[0039] In any aspect, of the molecule of the present disclosure, the sense strand consists of 21 nucleobases, the nucleobases of the sense strand modified according to the pattern: 5'-3' ; and the antisense strand consists of 23 nucleobases, the nucleobases of the antisense strand modified according to the pattern:
[0040] 5'- M*F*MMMFMFFMMMMFMFMMMMM*M*M -3' wherein, independently at each individual position on each strand, M = a 2'-O-methoxy nucleobase, and F = a 2'-fluoro nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0041] In any aspect, of the molecule of the present disclosure, the sense strand consists of 21 nucleobases, the nucleobases of the sense strand modified according to the pattern: 5'- M*M*MMM(Cie)FMFFFMMMMMMMM*M*M -3' ; and the antisense strand consists of 23 nucleobases, the nucleobases of the antisense strand modified according to the pattern: 5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3' wherein, independently at each individual position on each strand, M = a 2'-O-methoxy nucleobase, F = a 2'-fluoro nucleobase, (Ci6) = a 2'-C 16-conjugated nucleobase, and (VP) = a 5'-(E)-vinylphosphonate nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0042] In an aspect, the present disclosure provides a double stranded RNA therapeutic comprising a sense strand and an antisense strand, as shown in Table 2.
[0043] In an aspect, the present disclosure provides a double stranded RNA therapeutic comprising a sense strand and an antisense strand, as shown in Table 2a or Table 5a.Taft Ref. :IUIC-00190
[0044] In an aspect, the present disclosure provides a double stranded RNA therapeutic comprising a sense strand and an antisense strand, as shown in Table 3 or Table 5b.
[0045] In an aspect, the present disclosure provides a double stranded RNA therapeutic comprising a sense strand and an antisense strand, as shown in Table 4.
[0046] In an aspect, the present disclosure provides a cell comprising the molecule described herein.
[0047] In any embodiment of the molecule, upon contact with a cell, inhibits expression of BSN by at least 20%, at least 40%, or at least 60%.
[0048] In an aspect, the present disclosure provides a therapeutic for the treatment, control, and / or prevention of neurodegenerative disease in a subject in need thereof comprising an siRNA comprising a sense strand comprising 21 nucleobases and an antisense strand complementary to the sense strand, the antisense strand comprising 23 nucleobases, wherein the sense strand and antisense strand form a double-stranded region at least 21 consecutive nucleobase pairs in length, and having a single-stranded overhang at the 3' end of the antisense strand which is at least 2 nucleobases long; wherein the sense strand sequence spanning the double -stranded region of the siRNA comprises at least 21 consecutive bases of a sequence selected from the group consisting of SEQ ID NOs. 12-203 and 396-414; wherein at least one nucleobase is a non-natural nucleobase, wherein the non-natural nucleobase is selected from any of: a 2'-O-methoxy nucleobase, a 2'-fluoro nucleobase, a 2'-Ci2-i8-lipid-conjugated nucleobase, and a 5'-(E)-vinylphosphonate nucleobase; and wherein at least one phosphodiester moiety of the siRNA is substituted with a phosphorothioate moiety.
[0049] In another aspect, the present disclosure provides a pharmaceutical composition comprising a molecule of the present disclosure and a pharmaceutically acceptable excipient. In some embodiments, the pharmaceutically acceptable excipient is selected from the group consisting of adjuvant, pH buffer, antioxidant, preservative, salt, pH modulator, solvent, chelation agent, emulsifier, antimicrobial agent, or any combination thereof.
[0050] In some aspects, the present disclosure provides a method of treating, controlling, and / or preventing a tauopathy in a brain cell or nerve cell comprising administering to the cell an effective amount of the molecule or the composition described herein.
[0051] In another aspect, the present disclosure provides a method of treating, controlling, and / or preventing a tauopathy in a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of the molecule or the composition described herein.Taft Ref. :IUIC-00190
[0052] In still another aspect, the present disclosure provides a method of treating and / or ameliorating symptoms in a patient suffering from a neurodegenerative disease and in need of treatment, comprising administering to the patient a therapeutically effective among of an molecule described herein, wherein the neurodegenerative disease is selected from the group consisting of: Alzheimer’s Disease, Progressive Supranuclear Palsy, Chronic Traumatic Encephalopathy, Corticobasal Degeneration, FTD (e.g., frontotemporal dementia with parkinsonism), Pick's Disease, and Primary Age Related Tauopathy.
[0053] In a further aspect, the present disclosure provides a method of treating and / or ameliorating symptoms in a patient suffering from a disorder and in need of treatment, comprising administering to the patient a therapeutically effective of a molecule described herein, wherein the disorder is from the group consisting of: Agyrophyllic grain disease, Vacuolar tauopathy, Lytico-bodig disease, Ganglioglioma, Gangliocytoma, Mengioangiomatosis, Postencephalitic Parkinsonism, Traumatic Brain Injury, MAPT associated disease, Subacute Sclerosing Panencephalitis, Lead Encephalopathy, Tuberous Sclerosis, Pantothenate Kinase-associated Neurodegeneration, Lipofuscinosis or Parkinsonism associated with tau deposition.
[0054] In another aspect, the present disclosure provides use of the molecule described herein in the manufacture of a medicament for the treatment of a neurodegenerative disease.
[0055] In another aspect, the present disclosure provides a kit comprising: the molecule or composition described herein; a container; and instructions providing information on how to administer the composition and / or therapeutic to a subject in need thereof.
[0056] In a further aspect, the present disclosure provides a double -stranded RNA duplex capable of downregulating BSN mRNA concentration in a cell. In embodiments, a 20nM concentration dose of the double -stranded RNA duplex results in a cellular BSN mRNA concentration of 55% to 75% of baseline concentration. In embodiments, the duplex forms part of an siRNA or a shRNA, the duplex comprising a sense strand portion and an antisense strand portion.
[0057] In embodiments, the sense strand portion comprises a sequence having at least 90% identity to a sequence selected from SEQ ID Nos.: 12-203, 396-414, 442-633, or 826-844.In embodiments, the antisense strand portion comprises a sequence having at least 90% identity to a sequence selected from SEQ ID Nos.: 204-395, 415-433, 634-825, or 845-863.Taft Ref. :IUIC-00190
[0058] In embodiments, the sense strand portion comprises a sequence selected from SEQ ID Nos.: 12-203, and the antisense strand portion comprises a sequence selected from SEQ ID Nos.: 204-395, and wherein the sense strand portion is complementary to the antisense strand portion.
[0059] In embodiments, one or more nucleotides is a modified nucleotide.
[0060] In embodiments, the sense strand portion comprises a span of 21 consecutive modified nucleobases according to the pattern: 5'-3'
[0061] wherein, independently at each individual position on each strand, M = a 2'-O-methoxy nucleobase, and F = a 2'-fluoro nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0062] In embodiments, the antisense strand portion comprises 23 consecutive modified nucleobases according to the pattern: 5'- M*F*MMMFMFFMMMMFMFMMMMM*M*M -3'
[0063] wherein, independently at each individual position on each strand, M = a 2'-O-methoxy nucleobase, and F = a 2'-fluoro nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0064] In embodiments, the sense strand portion comprises a span of 21 consecutive modified nucleobases according to the pattern: 5'- M*M*MMM(Cis)FMFFFMMMMMMMM*M*M -3'
[0065] wherein, independently at each individual position on each strand, M = a 2'-0-methoxy nucleobase, F = a 2'-fluoro nucleobase, (Cis) = a 2'-Cis-conjugated nucleobase, and
[0066] (VP) = a 5'-(E)-vinylphosphonate nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0067] In embodiments, the antisense strand portion comprises a span of 23 consecutive modified nucleobases according to the pattern: 5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3', wherein, independently at each individual position on each strand, M = a 2'-O-methoxy nucleobase, F = a 2'-fluoro nucleobase, (Ci6) = a 2'-C 16-conjugated nucleobase, and (VP) = a 5'-(E)-vinylphosphonate nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0068] In embodiments, the duplex further comprises a hairpin loop linking the sense strand and antisense strand.Taft Ref. :IUIC-00190
[0069] In an aspect, the present disclosure provides a cell comprising the double-stranded RNA duplex described herein.
[0070] In another aspect, the present disclosure provides a therapeutic composition comprising the double-stranded RNA duplex described herein and a pharmaceutically acceptable excipient. In embodiments, the pharmaceutically acceptable excipient is selected from the group consisting of adjuvant, pH buffer, antioxidant, preservative, salt, pH modulator, solvent, chelation agent, emulsifier, antimicrobial agent, or any combination thereof.
[0071] In another aspect, the present disclosure provides an RNAi molecule for the inhibition of expression of human BSN, the molecule comprising a sense sequence comprising the sequence of SEQ ID No. 12 or 13, and an antisense sequence comprising the sequence of SEQ ID No. 204 or 205.
[0072] In embodiments, the RNAi molecule is an siRNA. In embodiments, the RNAi molecule is an shRNA.
[0073] In embodiments, the sense sequence comprises a span of 21 consecutive modified nucleobases according to the pattern: 5'-3' ; and wherein the antisense sequence comprises a span of 23 consecutive modified nucleobases according to the pattern: 5'- M*F*MMMFMFFMMMMFMFMMMMM*M*M -3' wherein, independently at each individual position on each sequence, M = a 2'-0-methoxy nucleobase, and F = a 2'-fluoro nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0074] In embodiments, the sense sequence comprises a span of 21 consecutive modified nucleobases according to the pattern: 5'- M*M*MMM(Cie)FMFFFMMMMMMMM*M*M -3'; and wherein the antisense sequence comprises a span of 23 consecutive modified nucleobases according to the pattern: 5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3' wherein, independently at each individual position on each sequence, M = a 2'-O-methoxy nucleobase, F = a 2'-fluoro nucleobase, (Cis) = a 2'-C is-conjugated nucleobase, and (VP) = a 5'-(E)-vinylphosphonate nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0075] In yet another aspect, the present disclosure provides an siRNA for inhibiting human BSN comprising a sense strand comprising the nucleotide sequence of SEQ ID No. 12 and an antisense strand comprising the nucleotide sequence of SEQ ID No. 204, the sense strand comprising aTaft Ref. :IUIC-00190span of 21 consecutive modified nucleobases according to the pattern: 5'- M*M*MMM(CIS)FMFFFMMMMMMMM*M*M -3'; and the antisense strand comprising a span of 23 consecutive modified nucleobases according to the pattern: 5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3' wherein, independently at each individual position on each sequence, M = a 2'-O-methoxy nucleobase, F = a 2'-fluoro nucleobase, (Cis) = a 2'-Cis-conjugated nucleobase, and (VP) = a 5'-(E)-vinylphosphonate nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0076] In another aspect, the present disclosure provides use of the molecule described herein in the manufacture of a medicament for the treatment of a neurodegenerative disease.
[0077] In another aspect, the present disclosure provides use of the therapeutic or the composition described herein in the manufacture of a medicament for the treatment of a neurodegenerative disease.
[0078] In an aspect, the present disclosure provides a kit comprising: the double-stranded RNA duplex described herein; a container; and instructions providing information on how to administer the RNA and / or therapeutic composition to a subject in need thereof.
[0079] These and other embodiments and features of the disclosure will become more apparent through reference to the following description, the accompanying figures, and the claims. Furthermore, it is to be understood that the features of the various embodiments described herein are not mutually exclusive and can exist in various combinations and permutations.BRIEF DESCRIPTION OF THE DRAWINGS
[0080] FIGs. 1A-1D are data tables depicting experimental setup and raw luminescence data derived from branched DNA analysis assays using QuantiGene™ Singleplex Assay Kit and recorded using a VICTOR Light 1420 Luminescence counter (PerkinElmer). FIG. 1A shows a set-up for a ten-point transfection protocol for transfecting interfering RNA into SH-SY5Y cells according to one experiment of the present disclosure. FIG. IB shows knockdown of human BSN (hsBSN, as used in the table, refers to Homo sapiens 557VRNA). FIG. 1C shows knockdown of human GAPDH as a positive-control comparator to knockdown of human BSN (hsGAPDH, as used in the table, refers to Homo sapiens glyceraldehyde 3 -phosphate dehydrogenase RNA). FIG. ID shows the relative knockdown of human BSN versus human GAPDH. As used in FIGs.1A-1D, Oligonucleotide A refers to a synthetic-construct oligonucleotide having a sense-strandTaft Ref. :IUIC-001905'->3' nucleotide sequence of agaacaucaggcagcaucgaa (SEQ ID No.: 12) and having an antisense-strand 5'->3' nucleotide sequence of uucgaugcugccugauguucugc (SEQ ID No.: 204).As used in FIGs. 1A-1D, Oligonucleotide B refers to a synthetic-construct oligonucleotide having a sense-strand 5'->3' nucleotide sequence of cugagagugcauacauggaca (SEQ ID No.: 13) and having an antisense-strand 5'->3' nucleotide sequence of uguccauguaugcacucucagca (SEQ ID No.: 205).
[0081] FIGs. 2A-2B are data tables depicting mean-variance-normalized relative knockdown of human BSN versus human GAPDH in SH-SY 5Y cells transfected with various doses of RNA duplex. As used in Fig,. 2A, Oligonucleotide A refers to a synthetic-construct oligonucleotide having a sense-strand 5'->3 ' nucleotide sequence of agaacaucaggcagcaucgaa (SEQ ID No.: 12) and having an antisense-strand 5'->3' nucleotide sequence of uucgaugcugccugauguucugc (SEQ ID No.: 204). As used in FIG. 2B, Oligonucleotide B refers to a synthetic-construct oligonucleotide having a sense-strand 5'->3' nucleotide sequence of cugagagugcauacauggaca (SEQ ID No.: 13) and having an antisense-strand 5'->3' nucleotide sequence of uguccauguaugcacucucagca (SEQ ID No.: 205).
[0082] FIG. 3 is a bar graph depicting the results of a dose response experiment showing relative knockdown of human BSN RNA in SH-SY 5Y cells transfected with various doses of RNA duplex. As used in Fig. 3, Oligonucleotide A refers to a synthetic-construct oligonucleotide having a sense-strand 5'->3 ' nucleotide sequence of agaacaucaggcagcaucgaa (SEQ ID No.: 12) and having an antisense-strand 5'->3 ' nucleotide sequence of uucgaugcugccugauguucugc (SEQ ID No.: 204), and Oligonucleotide B refers to a synthetic-construct oligonucleotide having a sense-strand 5'->3' nucleotide sequence of cugagagugcauacauggaca (SEQ ID No.: 13) and having an antisense-strand 5'->3' nucleotide sequence of uguccauguaugcacucucagca (SEQ ID No.: 205).
[0083] FIGs. 4A-4B are data tables depicting MV -normalized relative knockdown of GAPDH in SH-SY5Y cells transfected with various doses of RNA duplex. As used in Fig. 4A, Oligonucleotide A refers to a synthetic-construct oligonucleotide having a sense-strand 5'->3' nucleotide sequence of agaacaucaggcagcaucgaa (SEQ ID No.: 12) and having an antisensestrand 5'->3 ' nucleotide sequence of uucgaugcugccugauguucugc (SEQ ID No.: 204). As used in FIG. 4B, Oligonucleotide B refers to a synthetic-construct oligonucleotide having a sense-strand 5'->3' nucleotide sequence of cugagagugcauacauggaca (SEQ ID No.: 13) and having an antisense-strand 5'->3' nucleotide sequence of uguccauguaugcacucucagca (SEQ ID No.: 205).Taft Ref. :IUIC-00190
[0084] FIG. 5 is a bar graph depicting the results of a dose response experiment showing meanvariance-normalized knockdown of human GAPDH RNA in SH-SY5Y cells transfected with various doses of RNA duplex. As shown in Fig. 5, Oligonucleotide A refers to a syntheticconstruct oligonucleotide having a sense-strand 5 '->3' nucleotide sequence of agaacaucaggcagcaucgaa (SEQ ID No.: 12) and having an antisense-strand 5'->3' nucleotide sequence of uucgaugcugccugauguucugc (SEQ ID No.: 204), and Oligonucleotide B refers to a synthetic-construct oligonucleotide having a sense-strand 5'->3' nucleotide sequence of cugagagugcauacauggaca (SEQ ID No.: 13) and having an antisense-strand 5'->3' nucleotide sequence of uguccauguaugcacucucagca (SEQ ID No.: 205). Also shown are positive and negative control RNA oligos.
[0085] FIGs. 6A-6B are line graphs showing dose-dependent knockdown of human BSN mRNA by transfection of RNA duplex having the sequences of SEQ ID No.: 12 (sense) and SEQ ID No.: 204 (antisense) (FIG. 6A) and transfected with various doses of RNA duplex having the sequences of SEQ ID No.: 13 (sense) and SEQ ID No.: 205 (antisense) (FIG. 6B).
[0086] FIGs. 7A-7B are exemplary diagrams illustrating chemical modifications to nucleotides and phosphate backbone on an exemplary RNA duplex.
[0087] FIG. 7A shows an exemplary RNA duplex having a 2 Ibp sense strand of sequence of SEQ ID No.: 12 and 23bp antisense strand of sequence of SEQ ID No.: 204, the strands having methoxy-modified and fluoro-modified nucleobases and phosphorothioate-modified sugarphosphate backbone linkages at the shown locations along each strand.
[0088] FIG. 7B shows an exemplary RNA duplex having a 2 Ibp sense strand of sequence of SEQ ID No.: 13 and 23bp antisense strand of sequence of SEQ ID No.: 205, the strands having methoxy-modified, fluoro-modified, (E)-vinylphosphonate-modified, and Ci6-lipidated nucleobases and phosphorothioate-modified sugar-phosphate backbone linkages at the shown locations along each strand.
[0089] FIGs. 8A-8H are line graphs showing dose-dependent knockdown of human BSN mRNA by transfection of RNA duplex depicting mean-variance-normalized relative knockdown of human BSN fragments inserted into psiCHECK vectors and expressed in HEK293T and transfected with various doses of RNA duplex.
[0090] FIG. 8 A shows a line graph where Oligonucleotide (Table 5b, row 15) refers to a synthetic-construct oligonucleotide screened in cells transfected with psiCHECK.hBSN_3 having a sense-strand 5' -»3' nucleotide sequence of ucgacuaucaauaccccaauu (Table 5a, SEQ IDTaft Ref. :IUIC-00190No.: 408) and having an antisense-strand nucleotide sequence of aauugggguauugauagucgagu (Table 5a, SEQ ID No.: 427).
[0091] FIG. 8B is a line graph where Oligonucleotide (Table 5b, row 14) refers to a syntheticconstruct oligonucleotide screened in cells transfected with psiCHECK.hBSN_2 having a sensestrand 5'-»3' nucleotide sequence of aguucucuacacagacgccaa (Table 5a, SEQ ID No.: 63) and having an antisense-strand nucleotide sequence of uuggcgucuguguagagaacucu (Table 5a, SEQ ID No.: 255).
[0092] FIG. 8C is a line graph wherein Oligonucleotide (Table 5b, row 9) refers to a syntheticconstruct oligonucleotide screened in cells transfected with psiCHECK.hBSN_l having a sensestrand 5'-»3' nucleotide sequence of ccagugucacaacaaggucug (Table 5a, SEQ ID No.: 404) and having an antisense-strand nucleotide sequence of cagaccuuguugugacacugggu (Table 5a, SEQ ID No.: 423).
[0093] FIG. 8D is a line graph where Oligonucleotide (Table 5b, row 21) refers to a syntheticconstruct oligonucleotide screened in cells transfected with psiCHECK.hBSN_4 having a sensestrand 5'-*3' nucleotide sequence of cacagcuaccaugacuacgau (Table 5a, SEQ ID No.: 414) and having an antisense-strand nucleotide sequence of aucguagucaugguagcugugcc (Table 5a, SEQ ID No.: 433).
[0094] FIG. 8E is a line graph where Oligonucleotide (Table 5b, row 22) refers to a syntheticconstruct oligonucleotide screened in cells transfected with psiCHECK.hBSN_4 having a sensestrand 5'-*3' nucleotide sequence of cagcuaccaugacuacgauga (Table 5a, SEQ ID No.: 191) and having an antisense-strand nucleotide sequence of ucaucguagucaugguagcugug (Table 5a, SEQ ID No.: 383).
[0095] FIG. 8F is a line graph where Oligonucleotide (Table 5b, row 3) refers to a syntheticconstruct oligonucleotide screened in cells transfected with psiCHECK.hBSN_2 having a sensestrand 5'-*3' nucleotide sequence of aaugaagcaaaaugguggccc (Table 5a, SEQ ID No.: 398) and having an antisense-strand nucleotide sequence of gggccaccauuuugcuucauugg (Table 2b, SEQ ID No.: 417).
[0096] FIG. 8G is a line graph where Oligonucleotide (Table 5b, row 4) refers to a syntheticconstruct oligonucleotide screened in cells transfected with psiCHECK.hBSN_3 having a sensestrand 5'-*3' nucleotide sequence of aagagagauucucccucuacc (Table 5a, SEQ ID No.: 399) and having an antisense-strand nucleotide sequence of gguagagggagaaucucucuuug (Table 5a, SEQ ID No.: 418).Taft Ref. :IUIC-00190
[0097] FIG. 8H is a line graph where Oligonucleotide (Table 5a, row 6) refers to a syntheticconstruct oligonucleotide screened in cells transfected with psiCHECK.hBSN_4 having a sensestrand 5'-»3' nucleotide sequence of aagcgaggcccugccaggcac (Table 5b, SEQ ID No.: 401) and having an antisense-strand nucleotide sequence of gugccuggcagggccucgcuucu (Table 5b, SEQ ID No.: 420).
[0098] FIG. 9 is a bar graph showing that the modified BSN siRNA containing a C16 conjugation having a sense-strand 5'-»3' nucleotide sequence of uscsgac(C16-U)AfuCfAfAf uaccccaasusa and having an antisense-strand 5'-*3' nucleotide sequence of (vinu)sAfsuugGfgGfUfauugAfiiAfgucgasgsu effectively reduced BSN mRNA levels without the need for Lipofectamine in iPSC-derived neurons. A modified BSN siRNA carrying the same sequence without the C16 conjugation, having sense-strand 5'-*3' nucleotide sequence of asasgccaAfaGfAfCfcaugccgasasa and having an antisense-strand 5'->3' nucleotide sequence of usUfsucgGfcAfUfggucUfuUfggcuusgsg, only reduced BSN transcript in the presence of Lipofectamine. FGM represents the non-treated control group.
[0099] FIGs. 10A and 10 B are micrographs of bassoon protein expression after siRNA treatment and line graph of area quantification. Bassoon levels are reduced in iPSC-derived human neurons following siRNA knockdown. iPSC-derived human neurons (30 DIV) were treated for 72 hours with either a scrambled sequence , having a sense-strand 5'-»3' nucleotide sequence of ascsuca(C16-A)CfgUfAfCfauaucacasusa and having an antisense-strand 5'-»3' nucleotide sequence of (VP)sAfsuguGfaUfAfuguaCfgUfiigagusgsu, or siRNA targeting BSN, having a sense-strand 5'-»3' nucleotide sequence of uscsgac(C16-U)AfuCfAfAf uaccccaasusa and having an antisense-strand 5'->3' nucleotide sequence of (VP)sAfsuugGfgGfUfauugAfiiAfgucgasgsu.
[0100] FIG. 10A. representative immunofluorescence images showing dendrites stained for the pre-synaptic protein Synpatophysin and BSN. Scale Bar: 5pm.
[0101] FIG. 10B. Quantification of BSN-positive area (%) with total synaptophysin area. Statistical significance was determined using a tow-tailed t-test on 10-11 fields per condition (from 2 wells per conditions). Data are presented as mean ± SEM.
[0102] FIGs. 11A-11C are line graphs showing the modified BSN siRNA containing a C16 conjugation having a sense-strand 5'-»3' nucleotide sequence of uscsgac(C16-U)AfuCfAfAfTaft Ref. :IUIC-00190uaccccaasusa and having an antisense-strand 5'->3' nucleotide sequence of (VP)sAfsuugGfgGfUfauugAfuAfgucgasgsu effectively reduced BSN mRNA in vivo.
[0103] FIG. 11A. shows BSN mRNA levels were reduced in the cortex of C57B1 mice (7 weeks old) injected with BSN siRNA targeting exon 5, having a sense-strand 5'-»3' nucleotide sequence of uscsgac(C16-U)AfuCfAfAf uaccccaasusa and having an antisense-strand 5'-»3' nucleotide sequence of (VP)sAfsuugGfgGfUfauugAfuAfgucgasgsu, but not in those injected with BSN siRNA targeting exon 3, having a sense-strand 5'-»3' nucleotide sequence of asasgcc(C16-A)AfaGfAfCfcaugccgasasa and having an antisense-strand 5'-»3' nucleotide sequence of (VP)sUfsucgGfcAfUfggucUfuUfggcuusgsg. No decrease in BSN was observed in animals treated with a scrambled sequence siRNA, having a sense-strand 5'->3' nucleotide sequence of ascsuca(C16-A)CfgUfAfCfauaucacasusa and having an antisense-strand 5'-»3' nucleotide sequence of (VP)sAfsuguGfaUfAfuguaCfgUfugagusgsu.
[0104] FIG. 1 IB shows a similar decrease in BSN mRNA was observed in the hippocampus of mice treated with the modified BSN siRNA containing a C16 conjugation having a sense-strand 5'-»3' nucleotide sequence of uscsgac(C16-U)AfuCfAfAf uaccccaasusa and having an antisense-strand 5' -»3' nucleotide sequence of (vinu)sAfsuugGfgGfUfauugAfuAfgucgasgsu, but not with the BSN siRNA targeting exon 3, having a sense-strand 5'-»3' nucleotide sequence of asasgcc(C16-A)AfaGfAfCfcaugccgasasa and having an antisense-strand 5'-»3' nucleotide sequence of (VP)sUfsucgGfcAfUfggucUfuUfggcuusgsg.
[0105] FIG. 11C shows no significant changes in BSN mRNA levels were observed in the cerebellum across any of the groups.
[0106] FIGs. 12A-12C are line graphs showing Bulk RNA-seq analysis of brains from mice injected with the scrambled siRNA, having a sense-strand 5'-»3' nucleotide sequence of ascsuca(C16-A)CfgUfAfCfauaucacasusa and having an antisense-strand 5'-»3' nucleotide sequence of (VP)sAfsuguGfaUfAfuguaCfgUfugagusgsu or the BSN siRNA targeting exon 5, having a sense-strand 5'-»3' nucleotide sequence of uscsgac(C16-U)AfuCfAfAf uaccccaasusa and having an antisense-strand 5'->3' nucleotide sequence of (VP)sAfsuugGfgGfUfauugAfuAfgucgasgsu.
[0107] FIG. 12A is a t-SNE plot showing clear group separation between treatment conditions.
[0108] FIG. 12B is a volcano plot highlighting significant downregulation of BSN.Taft Ref. :IUIC-00190
[0109] FIG. 12C shows the quantification of BSN downregulation shown by raw counts, normalized abundance (counts), and log2-transformed abundance. All data were normalized prior to analysisDETAILED DESCRIPTION
[0110] The present disclosure provides in part agents or molecules such as dsRNAs and methods for using these dsRNAs to inhibit the expression of BSN protein in a cell or mammal, where the dsRNA specifically targets a BSN mRNA transcript. Additionally, the present disclosure encompasses compositions and methods for treating pathological conditions and diseases, such as a tauopathy, in a mammal, which arise due to the association of BSN protein with various forms of Tau protein. dsRNA facilitates the sequence-specific degradation of mRNA via a mechanism known as RNA interference (RNAi).[oni] The dsRNAs in the compositions described herein include an RNA strand (the antisense strand) that is less than 30 nucleotides in length, typically 19-24 nucleotides, and may modulate the BSN gene. For example, provided herein are dsRNAs enable targeted degradation of mRNAs from genes implicated in pathologies related to BSN expression in mammals.
[0112] For example, provided BSN dsRNAs can mediate RNAi that can, result in significant inhibition of BSN gene expression. Provided methods and compositions including dsRNAs contemplated herein may be beneficial for treating pathological processes treatable by downregulating BSN, such as Alzheimer’s disease, and other tauopathies such as chronic traumatic encephalopathy (CTE).
[0113] For example, contemplated herein is a dsRNA molecule for inhibiting the expression of BSN in a cell, wherein the dsRNA comprises a sense strand and an antisense strand form a duplex structure less than 30 nucleotides in length; each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to part of an mRNA encoding BSN to mediate RNA interference and wherein the sense strand comprises a sequence having at least 90%, at least 95% or at least 99% identity to a sequence selected the group consisting of SEQ ID NOs.: 12 - 395.
[0114] Disclosed herein are double-stranded ribonucleic acid (dsRNA) molecule for inhibiting the expression of BSN in a cell, wherein said dsRNA comprises a sense strand and an antisense strand form a duplex structure less than 30 nucleotides in length; each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to part of a BSN mRNA to mediate RNA interference and wherein the sense strand comprises a sequence having aTaft Ref. :IUIC-00190sequence selected the group consisting of SEQ ID NOs.: 12-203, or, e.g., an antisense sequence complementary to a sequence of Table 1, or a sense sequence and antisense sequence of Table 2, or a sense sequence and antisense sequence of Table 3.
[0115] Contemplated dsRNA provided herein may for example have an antisense strand comprising a region of complementarity less than 30 nucleotides in length, including, for example, 19-24 nucleotides, substantially complementary to at least part of an RNA transcript of a BSN gene.
[0116] In accordance with the present invention, the sense strand of a contemplated dsRNA may encompass 15, 16, 17, 18, 19, 20, 21, or a greater number of contiguous nucleotides corresponding to any of the sense strands described herein. Similarly, the antisense strand of a dsRNA may incorporate 15, 16, 17, 18, 19, 20, 21, or additional contiguous nucleotides matching any of the antisense strands detailed in this disclosure.
[0117] For example, provided herein is a double stranded RNA comprising a) a sense strand of any one of SEQ ID No.: 12-203, 396-414, 442-633, or 826-844 and b) an antisense strand of any one SEQ ID No.: 204-395, 415-433, 634-825, or 845-863. Contemplated antisense strand and the sense strand may be each, independently, from 19 to 25 nucleotides in length. The antisense strand and the sense strand may be, independently, 21 to 23 nucleotides in length.
[0118] DEFINITIONS
[0119] Various quantities, such as amounts, sizes, dimensions, proportions, and the like, are presented in a range format throughout this disclosure. It should be understood that the description of a quantity in range format is merely for convenience and brevity and should not be constmed as an inflexible limitation on the scope of any embodiment. Accordingly, the description of a range should be considered to have specifically disclosed all the possible subranges as well as all individual numerical values within that range unless the context clearly dictates otherwise. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed subranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual values within that range, for example, 1.1, 2, 2.3, 4.62, 5, and 5.9. This applies regardless of the breadth of the range. The upper and lower limits of these intervening ranges may independently be included in the smaller ranges, and are also encompassed within the disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or bothTaft Ref. :IUIC-00190of those included limits are also included in the disclosure, unless the context clearly dictates otherwise.
[0120] The terminology used herein is to describe particular embodiments only and is not intended to be limiting of any embodiment. As used herein, the singular forms “a,” “an”, and “the” are intended to include the plural forms as well, unless the context clearly indicates otherwise. It will be further understood that the terms “includes”, “comprises”, “including” and / or “comprising,” when used in this specification, specify the presence of stated features, integers, steps, operations, elements, and / or components, but do not preclude the presence or addition of one or more other features, integers, steps, operations, elements, components, and / or groups thereof. As used herein, the term “and / or” includes any and all combinations of one or more of the associated listed items. Additionally, it should be appreciated that items included in a list in the form of “at least one of A, B, and C” can mean (A); (B); (C); (A and B); (B and C); (A and C); or (A, B, and C). Similarly, items listed in the form of “at least one of A, B, or C” can mean (A); (B); (C); (A and B); (B and C); (A and C); or (A, B, and C).
[0121] Unless expressly stated or obvious from context, as used herein, the term “about” in reference to a number or range of numbers is understood to mean the stated number and numbers + / - 10% thereof, or 10% below the lower listed limit and 10% above the higher listed limit for the values listed for a range.
[0122] In any of the embodiments disclosed herein, the terms “treating” or “to treat” includes restraining, slowing, stopping, or reversing the progression or severity of an existing symptom or disorder.
[0123] In any of the embodiments disclosed herein, the term “patient” refers to a human.
[0124] The term “RNA interference” or “RNAi” refers to the silencing or decreasing of gene expression by siRNAs. It should be understood that the siRNAs may derive from processing of short-hairpin RNAs (shRNAs). It is the process of sequence-specific, post-transcriptional gene silencing in animals and plants, initiated by siRNA that is homologous in its duplex region to the sequence of the silenced gene. The gene may be endogenous or exogenous to the organism, present integrated into a chromosome or present in a transfection vector that is not integrated into the genome. The expression of the gene is either completely or partially inhibited. RNAi may also be considered to inhibit the function of a target RNA; the function of the target RNA may be complete or partial.
[0125] The term “siRNAs” refers to short interfering RNAs. In some embodiments, siRNAs comprise a duplex, or double-stranded region, of about 18-25 nucleotides long; often siRNAsTaft Ref. :IUIC-00190contain from about two to four impaired nucleotides at the 3' end of each strand. At least one strand of the duplex or double-stranded region of a siRNA is substantially homologous to or substantially complementary to a target RNA molecule. The strand complementary to a target RNA molecule is the “antisense strand;” the strand homologous to the target RNA molecule is the “sense strand,” and is also complementary to the siRNA antisense strand. siRNAs may also contain additional sequences; non-limiting examples of such sequences include linking sequences, or loops, as well as stem and other folded structures. siRNAs appear to function as key intermediaries in triggering RNA interference in invertebrates and in vertebrates, and in triggering sequence-specific RNA degradation during posttranscriptional gene silencing in plants.
[0126] In the context of this specification, the abbreviations "G," "C," "A," and "U" each represent a nucleotide that incorporates guanine, cytosine, adenine, and uracil as its base, respectively. The terms "T" and "dT" are utilized interchangeably within this document and refer to a deoxyribonucleotide where the nucleobase is thymine, such as deoxyribothymine. It should be noted, however, that the terms "ribonucleotide," "nucleotide," and "deoxyribonucleotide" may also encompass modified nucleotides or surrogate replacement moieties, as elaborated upon further in subsequent sections. Those skilled in the art will recognize that guanine, cytosine, adenine, and uracil can be substituted with alternative moieties, which do not significantly alter the base pairing characteristics of an oligonucleotide containing a nucleotide with such a replacement moiety. By way of illustration and not limitation, a nucleotide featuring inosine as its base can form base pairs with nucleotides containing adenine, cytosine, or uracil. Consequently, in the nucleotide sequences of the present invention, nucleotides containing uracil, guanine, or adenine may be substituted with a nucleotide that includes, for instance, inosine. Sequences that comprise such replacement moieties are considered within the scope of this invention.
[0127] As used herein, the term "bassoon" refers to, as context dictates, any or all of (1) a nuclear gene found in vertebrates that encodes bassoon presynaptic matrix protein; (2) mRNA transcripts of the gene; and (3) the protein. Unless context dictates otherwise, “BSN” (styled in italics) shall presumptively refer throughout the present disclosure to the bassoon gene and / or mRNA transcripts of the gene. The protein BSN is also known in the art as bassoon presynaptic cytomatrix protein, zinc finger protein 231 (ZNF231), and neuronal double zinc finger protein. The BSN gene in humans is located on the forward strand of Chromosome 3. The nucleotide sequences of known isoforms of human BSN mRNA transcript can be found at accessionTaft Ref. :IUIC-00190numbers NM_003458.4 (SEQ ID No.: 1), XM_047449152.1 (SEQ ID No.: 2), XM_054348283.1 (SEQ ID No.: 3), XM_047449149.1 (SEQ ID No.: 4), XM_047449150.1 (SEQ ID No.: 5), and XM_047449151.1 (SEQ ID No.: 6). Sequences for known isoforms of mouse Bsn mRNA transcripts can be found at XM_006511634.4 (SEQ ID No.: 7) and NM_007567.2 (SEQ ID No.: 8). A sequence of rhesus macaque BSN mRNA transcript can be found at XM_028843490.1 (SEQ ID No.: 9). Sequence isoforms of cynomolgus monkey BSN mRNA can be found at XM_045386264.1 (SEQ ID No.: 10) and XM_045386265.1 (SEQ ID No.: 11). Ensembl genome annotations for Bassoon may be found at accession numbers ENST00000296452.5 and ENST00000467456.1 (for Homo sapiens); ENSMUST00000035208.14, ENSMUST00000124763.2 (for mouse); ENSUT00000020394.4 (for rhesus macaque); and ENST00000004680.2 (for cynomolgus monkey).
[0128] Within the scope of this specification, the term “target sequence” is defined as a contiguous segment of the nucleotide sequence of an mRNA molecule that is produced during the transcription of a BSN gene. This definition encompasses mRNA resulting from RNA processing of a primary transcription product.
[0129] The phrase “strand comprising a sequence,” as employed herein, denotes an oligonucleotide composed of a series of nucleotides, which is defined by the sequence referred to, in accordance with standard nucleotide nomenclature.
[0130] Furthermore, unless specified otherwise, the term “complementary,” when applied to a first nucleotide sequence in relation to a second nucleotide sequence, describes the capacity of an oligonucleotide or polynucleotide containing the first nucleotide sequence to hybridize and form a duplex structure with an oligonucleotide or polynucleotide containing the second nucleotide sequence, under certain conditions, as will be appreciated by those skilled in the art. Such conditions might include, for example, stringent conditions such as 400 mM NaCl, 40 mM 1,4-piperazinediethanesulfonic acid (PIPES) pH 6.4, 1 mM ethylenediaminetetraacetic acid (EDTA), at 50°C or 70°C for 12-16 hours followed by washing. Other conditions might be physiologically relevant conditions encountered within an organism. A skilled practitioner will be able to determine the appropriate conditions fortesting the complementarity of two sequences, based on the intended application of the hybridized nucleotides.
[0131] This definition includes the base-pairing of the oligonucleotide or polynucleotide comprising the first nucleotide sequence with the oligonucleotide or polynucleotide comprising the second nucleotide sequence over their entire lengths. Such sequences may be referred to as “fully complementary” to each other in this document. However, a first sequence described asTaft Ref. :IUIC-00190“substantially complementary” to a second sequence within this document may be fully complementary or may form a limited number of mismatched base pairs upon hybridization, typically no more than 4, 3, or 2, while still retaining the ability to hybridize under relevant conditions. In cases where two oligonucleotides are designed to hybridize with one or more single-stranded overhangs, these overhangs should not be considered mismatches in determining complementarity. For instance, a dsRNA comprising one oligonucleotide of 21 nucleotides and another of 23 nucleotides, where the longer oligonucleotide includes a sequence of 21 nucleotides fully complementary to the shorter one, may still be considered “fully complementary” for the purposes discussed herein.
[0132] The term “complementary” may also encompass sequences formed entirely from or including non-Watson-Crick base pairs and / or base pairs formed from non-natural and modified nucleotides, provided they fulfill the criteria for hybridization capability. Examples of such non-Watson-Crick base pairs include, but are not limited to, G:U Wobble or Hoogsteen base pairing.
[0133] The terms “complementary,” “fully complementary,” and “substantially complementary” are applicable with respect to the base pairing between the sense strand and the antisense strand of a dsRNA, or between the antisense strand of a dsRNA and a target sequence, as will be evident from the context in which they are used.
[0134] A polynucleotide that is “substantially complementary to at least part of’ a messenger RNA (mRNA) is understood to be a polynucleotide that is substantially complementary to a contiguous segment of the mRNA of interest (e.g., an mRNA encoding BSN). This definition includes substantial complementarity to various segments of the mRNA, such as a 5' untranslated region (UTR), an open reading frame (ORF), or a 3' UTR. For instance, a polynucleotide is considered complementary to at least a part of a BSN mRNA if its sequence is substantially complementary to an uninterrupted portion of an mRNA that encodes BSN. In some embodiments, a provided molecule is or comprises a small interfering RNA (siRNA) against bassoon (BSN).
[0135] The term “double -stranded RNA” or “dsRNA,” as employed denotes a molecular complex of ribonucleic acid, characterized by a duplex structure that is composed of two antiparallel and substantially complementary nucleic acid strands, where “substantially complementary” is as previously defined. Predominantly, the nucleotides in each strand of the dsRNA are ribonucleotides. However, as elaborated in this disclosure, one or both strands of the dsRNA may also incorporate at least one non-ribonucleotide, such as a deoxyribonucleotide and / or a modified nucleotide. Additionally, the term “dsRNA” in this specification may embraceTaft Ref. :IUIC-00190chemical modifications to ribonucleotides, which could be substantial and involve multiple nucleotides, encompassing all types of modifications disclosed herein or known in the art. Any such modifications, when used in an siRNA-type molecule, are included within the definition of “dsRNA” for the purposes of this specification and the associated claims.
[0136] The duplex structure of dsRNA may be formed by different segments of a singular, larger RNA molecule, or it could comprise two distinct RNA molecules. In instances where the two strands are segments of one larger molecule, thus connected by an uninterrupted nucleotide chain between the 3 '-end of one strand and the 5 '-end of the other strand forming the duplex structure, such connecting RNA chain is termed a “hairpin loop.” Conversely, where the two strands are covalently connected by means other than an uninterrupted nucleotide chain between the respective 3'- and 5 '-ends forming the duplex structure, the connecting structure is designated as a “linker.” The RNA strands in the dsRNA may have identical or differing numbers of nucleotides. The maximum count of base pairs in the dsRNA corresponds to the number of nucleotides in its shortest strand, subtracting any overhangs present in the duplex. Moreover, a dsRNA may include one or more nucleotide overhangs. The term “siRNA” is also applicable to describe a dsRNA as outlined above.
[0137] The term “antisense strand” is used to identify the strand of a dsRNA which encompasses a region substantially complementary to a target sequence. The “region of complementarity,” as used herein, refers to the segment on the antisense strand substantially complementary to a sequence, such as a target sequence, as defined in this context. Where the region of complementarity is not fully complementary to the target sequence, any mismatches are most likely to occur in the terminal regions, typically within 6, 5, 4, 3, or 2 nucleotides of the 5' and / or 3' terminus.
[0138] The term “sense strand” refers to the strand of a dsRNA containing a region that is substantially complementary to a segment of the antisense strand.
[0139] The terms “sense strand” and “passenger strand” can be used interchangeably. Likewise, as appreciated by those skilled in the art, the terms “antisense strand” and “guide strand” can be used interchangeably.
[0140] The term “sense strand” may be abbreviated by “S.” Likewise, the term “antisense strand” may be abbreviated by “AS.”
[0141] Effective or therapeutic amounts of the compositions of this disclosure include any amount sufficient to inhibit (e.g., slow or stop) the progression of a neurodegenerative disorder.Taft Ref. :IUIC-00190In some embodiments, effective amounts of the compositions include any amount sufficient to inhibit (e.g., slow or stop) the deterioration of the muscular function of a patient.
[0142] siRNA Molecules
[0143] In a particular embodiment, the region of complementarity of a dsRNA is at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or more nucleotides in length. In this embodiment, the region of complementarity may include 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more contiguous nucleotides of SEQ ID Nos: 12-395. The region of complementarity may include 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or more contiguous nucleotides of any sequence of Table 1. In an embodiment, the dsRNA region of complementarity may be complementary to a sequence of 25 -consecutive nucleotides along the mRNA sequence of human BSN selected from Table 1. In an embodiment, the dsRNA region of complementarity may be complementary to a portion of a sequence of 25-consecutive nucleotides along the mRNA sequence of human BSN selected from Table 1. Furthermore, each strand of a dsRNA is 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, or more nucleotides in length. In this context, the dsRNA comprises a sense strand, or a fragment thereof being 19, 20, 21, 22 or 23 nucleotides long, selected from Table 1, and an antisense strand, or a fragment thereof being 19, 20, 21, 22 or 23 nucleotides.
[0144] In a specific embodiment of the invention, contemplated molecules e.g., dsRNA may include at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23 or more modified nucleotides.These modified nucleotides may encompass, for example, a 2'-O-akyl, e.g., 2'-O-methyl, modified nucleotide, a nucleotide with a 5'-phosphorothioate group. Furthermore, in another embodiment, the modified nucleotide may comprise a 2'-deoxy-2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, or a nucleotide containing a non-natural base.
[0145] In a specific embodiment, administration of a disclosed dsRNA to a cell results in approximately 25% to 95% or more inhibition of BSN mRNA expression as measured by a realtime polymerase chain reaction (PCR) assay. Furthermore, administration of a dsRNA to a cell can result in about 25% to 95% or more inhibition of BSN mRNA expression, as measured by either a real-time PCR assay or a branched DNA assay. In another embodiment, a dsRNA exhibits an ICso of less than 0.01 nM, 0.1 nM, 1 nM, 5 nM, 10 nM, 100 nM, or 1000 nM, and an EDso of about 0.1, 1.0, 10, 50, or 100 mg / kg. In any embodiment, administration of the dsRNA may reduce BSN mRNA levels in brain cells, may reduce BSN protein levels in brain cells, orTaft Ref. :IUIC-00190may reduce both BSN mRNA and BSN protein levels in brain cells. In any embodiment, administration of the dsRNA may reduce BSN mRNA serum levels, may reduce BSN protein serum levels, or may reduce both BSN mRNA and BSN protein serum levels.
[0146] Degree of inhibition of BSN may be expressed in terms of a reduction in a parameter that is functionally linked to BSN gene expression. For example, this could include a decrease in the amount of protein encoded by a BSN gene that is expressed in a cell, or a reduction in the number of cells displaying a specific phenotype. Silencing of a BSN gene may be determined in any cell expressing the target, whether this expression is natural or induced through genomic engineering, and can be measured using any appropriate assay.
[0147] Accordingly, certain aspects of the invention feature pharmaceutical compositions containing a BSN dsRNA and a pharmaceutically acceptable carrier. Methods of using these compositions to inhibit the expression of a BSN gene, and methods of using the pharmaceutical compositions to treat diseases caused by the expression of a BSN gene, are also encompassed in this invention.
[0148] “Introducing into a cell,” in relation to a dsRNA, is defined as facilitating the uptake or absorption of the dsRNA into the cell, as commonly understood by those skilled in the art. This absorption or uptake of dsRNA can occur via passive or active cellular processes, or through the use of transfection agents. The scope of this term extends beyond in vitro cellular applications; it also encompasses scenarios where a dsRNA is “introduced into a cell” that is part of a living organism. In such cases, introduction into the cell includes delivery to the organism. For instance, in vivo delivery of dsRNA might involve injection into a specific tissue site or systemic administration. In vitro methods of introducing dsRNA into a cell include techniques known in the art, such as electroporation and lipofection, among other approaches detailed herein or recognized in the field.
[0149] The terms “silence,” “inhibit the expression of,” “down-regulate the expression of,” “suppress the expression of,” and similar phrases, as they pertain to a BSN gene, are used herein to denote the at least partial suppression of the expression of a BSN gene. This is evidenced by a reduction in the amount of mRNA that can be isolated from a first cell or group of cells in which a BSN gene is transcribed, and which has been treated to inhibit the expression of the BSN gene, compared to a second cell or group of cells that is substantially identical to the first cell or group of cells but has not undergone such treatment (control cells).
[0150] As used herein, the term “nucleotide overhang” refers to at least one unpaired nucleotide that protrudes from the duplex structure of a double stranded RNA. For example, when a 3 '-endTaft Ref. :IUIC-00190of one strand of a dsRNA extends beyond the 5 '-end of the other strand, or vice versa, there is a nucleotide overhang. A dsRNA can comprise an overhang of at least one nucleotide; alternatively, the overhang can comprise at least two nucleotides, at least three nucleotides, at least four nucleotides, at least five nucleotides or more. A nucleotide overhang can comprise or consist of a nucleotide / nucleoside analog, including a deoxynucleotide / nucleoside. Hie overhang(s) can be on the sense strand, the antisense strand, or any combination thereof. Furthermore, the nucleotide(s) of an overhang can be present on the 5'-end, 3'-end, or both ends of either an antisense or sense strand of a dsRNA.
[0151] In one embodiment, the antisense strand of disclosed dsRNA has a 1—10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, overhang at the 3'-end or the 5'-end. In one embodiment, the sense strand of a dsRNA has a 1—10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, overhang at the 3 '-end or the 5 '-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
[0152] In certain embodiments, the antisense strand of disclosed dsRNA has a 1—10 nucleotide, e.g., 0-3, 1—3, 2-4, 2-5, 4-10, 5-10, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, overhang at the 3'-end or the 5'-end. In one embodiment, the sense strand of a dsRNA has a 1-10 nucleotide, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, overhang at the 3'-end or the 5'-end. In another embodiment, one or more of the nucleotides in the overhang is replaced with a nucleoside thiophosphate.
[0153] In certain embodiments, the antisense strand of a dsRNA has a 1-10 nucleotides, e.g., a 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 nucleotides, overhang at the 3'-end or the 5'-end. In certain embodiments, the overhang on the sense strand or the antisense strand, or both, can include extended lengths longer than 10 nucleotides, e.g., 1-30 nucleotides, 2-30 nucleotides, 10-30 nucleotides, 10-25 nucleotides, 10-20 nucleotides, or 10-15 nucleotides in length. In certain embodiments, an extended overhang is on the sense strand of the duplex. In certain embodiments, an extended overhang is present on the 3' end of the sense strand of the duplex, hi certain embodiments, an extended overhang is present on the 5' end of the sense strand of the duplex. In certain embodiments, an extended overhang is on the antisense strand of the duplex. In certain embodiments, an extended overhang is present on the 3' end of the antisense strand of the duplex, hi certain embodiments, an extended overhang is present on the 5' end of the antisense strand of the duplex. In certain embodiments, one or more of the nucleotides in the extended overhang is replaced with a nucleoside thiophosphate. In certain embodiments, theTaft Ref. :IUIC-00190overhang includes a self-complementary portion such that the overhang is capable of forming a hairpin structure that is stable under physiological conditions.
[0154] Provided herein are double-stranded ribonucleic acid (dsRNA) molecules or agents for inhibiting the expression of BSN in a cell, wherein said dsRNA comprises a sense strand and an antisense strand form a duplex structure less than 30 nucleotides in length; each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to part of an mRNA encoding BSN to mediate RNA interference and wherein the sense strand comprises a sequence having at least 90%, at least 95% or at least 99% identity to a sequence selected the group consisting of SEQ ID NO.: 12 - 395, or the sense and antisense sequences of Table 2.
[0155] Provided herein are double-stranded ribonucleic acid (dsRNA) molecules or agents for inhibiting the expression of BSN in a cell, wherein said dsRNA comprises a sense strand and an antisense strand form a duplex structure less than 30 nucleotides in length; each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to part of an mRNA encoding BSN to mediate RNA interference and wherein the sense strand comprises a sequence having at least 90%, at least 95% or at least 99% identity to a sequence selected the group consisting of SEQ ID NO.: 12 - 395, or SEQ ID NO.: 442-863 as provided in Table 2a and Table 5b.
[0156] The double stranded region of a disclosed molecule or agent may be 19-30 nucleotide pairs in length; 19-25 nucleotide pairs in length; 19-23 nucleotide pairs in length; 23-27 nucleotide pairs in length; or 21-23 nucleotide pairs in length. In one embodiment, each strand is independently no more than 30 nucleotides in length, or for example, the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length.
[0157] The region of complementarity may be at least 17 nucleotides in length; between 19 and 23 nucleotides in length; or 19 nucleotides in length. In one embodiment, at least one strand comprises a 3' overhang of at least 1 nucleotide. In another embodiment, at least one strand comprises a 3' overhang of at least 2 nucleotides.
[0158] Such disclosed dsRNA molecules may include one or more 2'-O-alkyl, e.g., 2'-O-methyl modified nucleotides. For example, a disclosed dsRNA agent or molecule may comprise at least one modified nucleotide. In one embodiment, substantially all of the nucleotides of the sense strand are modified nucleotides; substantially all of the nucleotides of the antisense strand are modified nucleotides; or substantially all of the nucleotides of the sense strand and substantially all of the nucleotides of the antisense strand are modified nucleotides.Taft Ref. :IUIC-00190
[0159] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 3 '-terminal deoxythimidine (dT) nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a locked nucleotide, an unlocked nucleotide, a conformationally restricted nucleotide, a constrained ethyl nucleotide, an abasic nucleotide, a 2'-amino-modified nucleotide, a 2'-O-allyl-modified nucleotide, 2'-C-alkyl-modified nucleotide, 2'-hydroxly-modified nucleotide, a 2'-methoxyethyl modified nucleotide, a 2'-O-alkyl-modified nucleotide, a morpholino nucleotide, a phosphoramidate, a non-natural base comprising nucleotide, a tetrahydropyran modified nucleotide, a 1,5-anhydrohexitol modified nucleotide, a cyclohexenyl modified nucleotide, a nucleotide comprising a phosphorothioate group, a nucleotide comprising a methylphosphonate group, a vinyl phosphonate nucleotide, a nucleotide comprising a 5'-phosphate, a nucleotide comprising a 5 '-phosphate mimic, a thermally destabilizing nucleotide, a glycol modified nucleotide (GNA), a nucleotide comprising a 2' phosphate, and a 2-O-(N-methylacetamide) modified nucleotide; and combinations thereof
[0160] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of locked nucleic acid (LNA), 1,5-anhydrohexitol nucleic acid (HNA), cyclohexenyl nucleic acid (CeNA), 2'-methoxyethyl, 2'-O-alkyl, 2'-O-allyl, 2'-C- allyl, 2'-fluoro, 2'-deoxy, 2’-hydroxyl, and glycol; and combinations thereof
[0161] In one embodiment, at least one of the modified nucleotides is selected from the group consisting of a deoxy-nucleotide, a 2'-O-methyl modified nucleotide, a 2'-fluoro modified nucleotide, a 2'-deoxy-modified nucleotide, a glycol modified nucleotide (GNA), e.g., Ggn, Cgn, Tgn / Ugn, or Agn, a nucleotide with a 2' phosphate, e.g., G2p, C2p, A2p or U2p, and a nucleotide comprising a phosphorothioate group, and combinations thereof.
[0162] In another embodiment, at least one of the modified nucleotides is a nucleotide with a thermally destabilizing nucleotide modification, for example, where the thermally destabilizing nucleotide modification is selected from the group consisting of an abasic modification; a mismatch with the opposing nucleotide in the duplex; a destabilizing sugar modification, a 2'-deoxy modification, an acyclic nucleotide, an unlocked nucleic acid (UNA), and a glycerol nucleic acid (GNA). In some embodiments one or more modified nucleotide comprises a short sequence of 3 '-terminal deoxythimidine nucleotides (dT).
[0163] In some embodiments, a contemplated dsRNA agent or molecule further comprises at least one phosphorothioate intemucleotide linkage. In some embodiments, the dsRNA agent comprises 6-8 phosphorothioate intemucleotide linkages. In one embodiment, theTaft Ref. :IUIC-00190phosphorothioate or methylphosphonate internucleotide linkage is at the 3 '-terminus of one strand. Optionally, the strand is the antisense strand. In another embodiment, the strand is the sense strand. In a related embodiment, the phosphorothioate or methylphosphonate intemucleotide linkage is at the 5'-terminus of one strand. Optionally, the strand is the antisense strand. In another embodiment, the strand is the sense strand. In another embodiment, the phosphorothioate or methylphosphonate intemucleotide linkage is at the both the 5'- and 3'- terminus of one strand. Optionally, the strand is the antisense strand. In another embodiment, the strand is the sense strand.
[0164] The dsRNA agent can comprise in some embodiments, a phosphorus-containing group at the 5'-end of the sense strand or antisense strand. The 5'-end phosphorus-containing group can be 5'-end phosphate (5'-P), 5'-end phosphorothioate (5'-PS), 5'-end phosphorodithioate (5'-PS2), 5'-end vinylphosphonate (5'- VP), or 5'-end methylphosphonate (MePhos).
[0165] The dsRNA agent can comprise a phosphorus-containing group at the 5'-end of the sense strand or antisense strand. The 5 '-end phosphorus-containing group can be 5 '-end phosphate (5'-P), 5'-end phosphorothioate (5'-PS), 5'-end phosphorodithioate (5'-PS2), 5'-end vinylphosphonate (5'- VP), 5 '-end methylphosphonate (MePhos).A contemplated dsRNA agent may also comprise a ligand, e.g., a ligand conjugated to the 3' end of the sense strand of the dsRNA agent, for example, a ligand such as one or more N- acetylgalactosamine (GalNAc) derivative, where for example, the one or more GalNAc derivatives are atached through a monovalent, bivalent, or trivalent branched linker. Other contemplated modifications may include a base pair at the 1 position of the 5 '-end of the antisense strand of the duplex that is anAU base pair.
[0166] In an aspect, the present disclosure provides modified RNA oligonucleotides in accordance with the sequences of Table 3 and 5b, infra, where, as shown in Table 3 and 5b, a = adenine, g = guanine, c = cytosine, u = uracil, Af = 2'-fluoro-adenine, Gf = 2'-fluoro-guanine, Cf = 2'-fluorocytocine, and Uf = 2'-fluoro-uracil. An “s” refers to a phosphorothioate moiety substituted for a phosphodiester at the indicated position between two adjacent nucleobases. The absence of an “s” at any location along the sequence means the sugar-backbone is an unmodified phosphodiester moiety. (It should be understood for purposes of the present disclosure that a uracil residue could, alternatively, be described using the symbol “t”, and a 2'-fluoro-uracil residue could be described using the symbol “Tf ’.) Also shown in Table 3 is the calculated molecular weight and measured mass for the aggregate weight of the sense sequence and antisense sequence in each row.Taft Ref. :IUIC-00190
[0167] One aspect of the invention provides a double-stranded RNA agent comprising: an antisense strand which is complementary to a target gene; a sense strand which is complementary to said antisense strand; and one or more lipophilic moieties conjugated to one or more internal positions on at least one strand, optionally via a linker or carrier.
[0168] The term “lipophile” or “lipophilic moiety” broadly refers to any compound or chemical moiety having an affinity for lipids. One way to characterize the lipophilicity of the lipophilic moiety' is by the octanol-water partition coefficient, logKow, where Kow is the ratio of a chemical’s concentration in the octanol -phase to its concentration in the aqueous phase of a two-phase system at equilibrium. The octanol-water partition coefficient is a laboratory-measured property of a substance. However, it may also be predicted by using coefficients attributed to the structural components of a chemical which are calculated using first-principle or empirical methods (see, e.g., Tetko et al., Prediction of w-Octanol / Water Partition Coefficients from PHYSPROP Database Using Artificial Neural Networks and E-State Indices, J. Chem. Inf. Comput. Sei. 41 :1407-21 (2001), which is incorporated herein by reference in its entirety). It provides a thermodynamic measure of the tendency of the substance to prefer a non-aqueous or oily milieu rather than water (i.e. its hydrophilic / lipophilic balance). In principle, a chemical substance is lipophilic in character when its logKow exceeds 0. Typically, the lipophilic moiety possesses a logKowexceeding 1, exceeding 1.5, exceeding 2, exceeding 3, exceeding 4, exceeding 5, or exceeding 10. For instance, the logKow of 6-amino hexanol, for instance, is predicted to be approximately 0.7. Using the same method, the logKow' of cholesteryl N-(hexan-6-ol) carbamate is predicted to be 10.7.
[0169] The lipophilicity of a molecule can change with respect to the functional group it carries. For instance, adding a hydroxyl group or amine group to the end of a lipophilic moiety can increase or decrease the partition coefficient (e.g., logKow7) value of the lipophilic moiety.
[0170] Alternatively, the hydrophobicity of the double-stranded RNA agent, conjugated to one or more lipophilic moieties, can be measured by its protein binding characteristics. For instance, the unbound fraction in the plasma protein binding assay of the double-stranded RNA agent can be determined to positively correlate to the relative hydrophobicity of the double-stranded RNA agent, which can positively correlate to the silencing activity of the double -stranded RNA agent.
[0171] In certain embodiments, the lipophilic moiety is an aliphatic, cyclic such as alicyclic, or polycyclic such as polyalicyclic compound, such as a steroid (e.g., sterol) or a linear or branched aliphatic hydrocarbon. The lipophilic moiety may generally comprise a hydrocarbon chain, which may be cyclic or acyclic. The hydrocarbon chain may comprise various substituents and / orTaft Ref. :IUIC-00190one or more heteroatoms, such as an oxygen or nitrogen atom. Such lipophilic aliphatic moieties include, without limitation, saturated or unsaturated C4--C30 hydrocarbon (e.g., Ce-Cis hydrocarbon), saturated or unsaturated fatty acids, waxes (e.g., monohydric alcohol esters of fatty acids and fatty diamides), terpenes (e.g., C10 terpenes, C15 sesquiterpenes, C20 diterpenes, C30 triterpenes, and C40 tetraterpenes), and other polyalicyclic hydrocarbons. For instance, the lipophilic moiety’ may contain a C4-C30 hydrocarbon chain (e.g., C4-C30 alkyl or alkenyl). In some embodiment the lipophilic moiety contains a saturated or unsaturated Ce-Cis hydrocarbon chain (e.g., a linear Cg -Cis alkyl or alkenyl). In one embodiment, the lipophilic moiety contains a saturated or unsaturated Ci6 hydrocarbon chain (e.g., a linear Cie alkyl or alkenyl).
[0172] The lipophilic moiety may be attached to the RNAi agent by any method known in the art, including via a functional grouping already present in the lipophilic moiety or introduced into the RNAi agent, such as a hydroxy group (e.g., — CO — CH2 — OH). The functional groups already present in the lipophilic moiety or introduced into the RNAi agent include, but are not limited to, hydroxyl, amine, carboxylic acid, sulfonate, phosphate, thiol, azide, and alkyne. Conjugation of the RNAi agent and the lipophilic moiety may occur, for example, through formation of an ether or a carboxylic or carbamoyl ester linkage between tire hydroxy and an alkyl group R — , an alkanoyl group RCO — or a substituted carbamoyl group RNHCO — . Tire alkyl group R may be cyclic (e.g., cyclohexyl) or acyclic (e.g., straight-chained or branched; and saturated or unsaturated). Alkyl group R may be a butyl, pentyl, hexyl, heptyl, octyl, nonyl, decyl, undecyl, dodecyl, tridecyl, tetradecyl, pentadecyl, hexadecyl, heptadecyl or octadecyl group, or the like.
[0173] In some embodiments, the lipophilic moiety is conjugated to the double-stranded RNA agent via a linker a linker containing an ether, thioether, urea, carbonate, amine, amide, maleimide-thioether, disulfide, phosphodiester, sulfonamide linkage, a product of a click reaction (e.g., a triazole from the azide-alkyne cycloaddition), or carbamate.
[0174] In another embodiment, the lipophilic moiety is a steroid, such as sterol. Steroids are polycyclic compounds containing a perhydro- 1,2-cyclopentanophenanthrene ring system. Steroids include, without limitation, bile acids (e.g., cholic acid, deoxycholic acid and dehydrocholic acid), cortisone, digoxigenin, testosterone, cholesterol, and cationic steroids, such as cortisone. A ‘"cholesterol derivative” refers to a compound derived from cholesterol, for example by substitution, addition or removal of substituents. In some embodiments, the lipophilic moiety is conjugated to the double-stranded RNA agent via a nucleobase, sugar moiety, or internucleosidic linkage.Taft Ref. :IUIC-00190
[0175] Conjugation to purine nucleobases or derivatives thereof can occur at any position including, endocyclic and exocyclic atoms. In some embodiments, the 2-, 6-, 7-, or 8-positions of a purine nucleobase are attached to a conjugate moiety. Conjugation to pyrimidine nucleobases or derivatives thereof can also occur at any position. In some embodiments, the 2-, 5-, and 6-positions of a pyrimidine nucleobase can be substituted with a conjugate moiety. When a lipophilic moiety is conjugated to a nucleobase, the preferred position is one that does not interfere with hybridization, i.e., does not interfere with the hydrogen bonding interactions needed for base pairing. In one embodiment, the lipophilic moieties may be conjugated to a nucleobase via a linker containing an alkyl, alkenyl or amide linkage.
[0176] Conjugation to sugar moieties of nucleosides can occur at any carbon atom. Exemplary’ carbon atoms of a sugar moiety that a lipophilic moiety can be attached to include the 2’, 3’, and 5’ carbon atoms. A lipophilic moiety can also be attached to the F position, such as in an abasic residue. In one embodiment, the lipophilic moieties may be conjugated to a sugar moiety, via a 2 -0 modification, with or without a linker. Intemucleosidic linkages can also bear lipophilic moieties. For phosphorus-containing linkages (e.g., phosphodiester, phosphorothioate, phosphorodithiotate, phosphoroamidate, and the like), the lipophilic moiety can be attached directly to the phosphorus atom or to an O, N, or S atom bound to the phosphorus atom. For amine- or amide-containing intemucleosidic linkages (e.g., PNA), the lipophilic moiety can be attached to the nitrogen atom of the amine or amide or to an adjacent carbon atom. There are numerous methods for preparing conjugates of oligonuclotides. Generally, an oligonucleotide is attached to a conjugate moiety by contacting a reactive group (e.g., OH, SH, amine, carboxyl, aldehyde, and the like) on the oligonucleotide with a reactive group on the conjugate moiety. In some embodiments, one reactive group is electrophilic and the other is nucleophilic. In one embodiment, a first (complementary') RNA strand and a second (sense) RNA strand can be synthesized separately, w herein one of the RNA strands comprises a pendant lipophilic moiety, and the first and second RNA strands can be mixed to form a dsRNA. The step of synthesizing the RNA strand preferably involves solid-phase synthesis, wherein individual nucleotides are joined end to end through the formation of intemucleotide 3 -5 phosphodiester bonds in consecutive synthesis cycles. In one embodiment, a lipophilic molecule having a phosphoramidite group is coupled to the 3 '-end or 5 -end of either the first (complementary) or second (sense) RNA strand in the last synthesis cycle. In the solid-phase synthesis of an RNA, the nucleotides are initially in the form of nucleoside phosphorami dites. In each synthesis cycle, a further nucleoside phosphoramidite is linked to the -OH group of the previously' incorporatedTaft Ref. :IUIC-00190nucleotide. If the lipophilic molecule has a phosphoramidite group, it can be coupled in a manner similar to a nucleoside phosphoramidite to the free OH end of the RNA synthesized previously in the solid-phase synthesis. The synthesis can take place in an automated and standardized manner using a conventional RNA synthesizer. Synthesis of the lipophilic molecule having the phosphoramidite group may include phosphitylation of a free hydroxyl to generate the phosphoramidite group.
[0177] For example, provided herein are siRNA (e.g. dsRNA) molecules as disclosed herein where wherein at least 25%, at least 50%, at least 75% or at least 90% of total nucleobases of the molecule are modified nucleobases, for example, where the sense strand has 4 to 12 asymmetrical 2’-O-alkyl modifications, at least 4 of which occur at the 4 terminal nucleotides of the 3' end, and an antisense sequence having at least 4 asymmetrical phosphorothioate modifications. In some embodiment, a contemplated sense strand has 62’-O-alkyl modifications at the 6 terminal nucleotides of the 5' end.
[0178] An exemplary dsRNA may have at least four phosphodiester moieties of the sense strand are substituted with a phosphorothioate moiety, and wherein at least four phosphodiester moieties of the antisense strand are substituted with a phosphorothioate moiety.
[0179] In an exemplary embodiment, the sense strand consists of 21 nucleobases, the nucleobases of the sense strand modified according to the pattern: 5' -M*M*MMMMFMFFFMMMMMMMM*M*M- 3' ; and the antisense strand consists of 23 nucleobases, the nucleobases of the antisense strand modified according to the pattern: 5'-M*F*MMMFMFFMMMMFMFMMMMM*M*M -3 'wherein, independently at each individual position on each strand, M = a 2'-O-methoxy nucleobase, and F = a 2'-fluoro nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0180] In another embodiment, a sense strand consists of 21 nucleobases, the nucleobases of the sense strand modified according to the pattern: 5'- M*M*MMM(C16)FMFFFMMMMMMMM*M*M -3' ; and the antisense strand consists of 23 nucleobases, the nucleobases of the antisense strand modified according to the pattern: 5'-(VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3' wherein, independently at each individual position on each strand, M = a 2'-O-methoxy nucleobase, F = a 2'-fluoro nucleobase, (Cie) = a 2'-Ci6-conjugated nucleobase, and (VP) = a 5'-(E)-vinylphosphonate nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.Taft Ref. :IUIC-00190
[0181] A contemplated RNAi agent disclosed herein may be a pharmaceutically acceptable salt thereof. “Pharmaceutically acceptable salts” of each of RN Ai agents herein include, but are not limited to, a sodium salt, a calcium salt, a lithium salt, a potassium salt, an ammonium salt, a magnesium salt, and mixtures thereof. One skilled in the art will appreciate that the RNAi agent, when provided as a polycationic salt having one cation per free acid group of the optionally modified phosophodiester backbone and / or any other acidic modifications (e.g., 5' -terminal phosphonate groups). For example, an oligonucleotide of “w” nucleotides in length contains n-1 optionally modified phosophodiesters, so that an oligonucleotide of 21 nt in length may be provided as a salt having up to 20 cations (e.g., 20 sodium cations). Similarly, RNAi agents having a sense strand of 21 nt in length and an antisense strand of 23 nt in length may be provided as a salt having up to 42 cations (e.g., 42 sodium cations). In the preceding example, where the RNAi agent also includes a 5 '-terminal phosphate or a 5 '-terminal vinylphosphonate group, the RNAi agent may be provided as a salt having up to 44 cations (e.g., 44 sodium cations).
[0182] Formulation / Excipients
[0183] A composition that includes an RNAi agent as disclosed herein can be delivered to a subject by a variety of routes. Exemplary routes include intravenous, topical, rectal, anal, vaginal, nasal, pulmonary, ocular. Suitable for administration. Such compositions typically include one or more species of RNA and a pharmaceutically acceptable carrier. As used herein the language “pharmaceutically acceptable carrier” is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration. The use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated. Supplementary active compounds can also be incorporated into the compositions.
[0184] The current invention provides pharmaceutical compositions comprising an agent that reduces the expression of BSN and therefore its interaction with intracellular tau proteins. The pharmaceutical compositions of the current invention can further comprise one or more pharmaceutically acceptable carriers, diluents or excipients. The pharmaceutical composition of the invention may include RNAi agent in an unbuffered solution, e.g., saline or water, or the pharmaceutical composition of the invention may include the RNAi agent is in a buffer solution,Taft Ref. :IUIC-00190e.g., a buffer solution comprising acetate, citrate, prolamine, carbonate, or phosphate or any combination thereof; or phosphate buffered saline (PBS).
[0185] Compositions for oral administration include powders or granules, suspensions or solutions in water, syrups, elixirs or non-aqueous media, tablets, capsules, lozenges, or troches. In the case of tablets, carriers that can be used include lactose, sodium citrate and salts of phosphoric acid. Various disintegrants such as starch, and lubricating agents such as magnesium stearate, sodium lauryl sulfate and talc, are commonly used in tablets. For oral administration in capsule form, useful diluents are lactose and high molecular weight polyethylene glycols. When aqueous suspensions are required for oral use, the nucleic acid compositions can be combined with emulsifying and suspending agents. If desired, certain sweetening and / or flavoring agents can be added.
[0186] Compositions for intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives.
[0187] Formulations for parenteral administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives. Intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir. For intravenous use, the total concentration of solutes may be controlled to render the preparation isotonic. In one embodiment, the RNAi agent is administered intrathecally. By intrathecal administration of the RNAi agent, the method may reduce the expression of a target gene in a brain or spine tissue, for instance, cortex, cerebellum, cervical spine, lumbar spine, and thoracic spine.
[0188] Contemplated formulations, in certain embodiments, comprise a disclosed siRNA formulated in formulation comprising LNPs (lipophilic nano particle), which may reduce BSN mRNA levels by about 25% to 95% or more relative to a control group.
[0189] Methods
[0190] Another aspect of the invention relates to a method of treating a subject having, or predisposed to develop, a central nervous system (CNS) disorder, comprising administering to the subject a therapeutically effective amount of the double-stranded RNAi agent as disclosed herein, thereby treating the subject. Exemplary CNS disorders that can be treated by the method of the invention include Alzheimer’s disease, amyotrophic lateral sclerosis (ALS), frontotemporal dementia, Huntington, Parkinson, spinocerebellar, prion, and lafora.
[0191] Also contemplated herein are methods of treating or ameliorating symptoms of, a patient suffering from Alzheimer’s disease, Progressive Supranuclear Palsy, Chronic TraumaticTaft Ref. :IUIC-00190Encephalopathy, Corticobasal Degeneration, FTD (e.g., frontotemporal dementia with parkinsonism), Pick’s Disease, and / or Primary Age Related Tauopathy. Further contemplated methods include treating and / or ameliorating symptoms in a patient suffering from a disorder and in need of treatment, comprising administering to the patient a therapeutically effective of disclosed molecule, i.e. a siRNA, wherein the disorder is from the group consisting of: Agyrophyllic grain disease, Vacuolar tauopathy, Lytico-bodig disease, Ganglioglioma, Gangliocytoma, Mengioangiomatosis, Postencephalitic Parkinsonism, Traumatic Brain Injury. MAPT associated disease, Subacute Sclerosing Panencephalitis, Lead Encephalopathy, Tuberous Sclerosis, Pantothenate Kinase-associated Neurodegeneration, Lipofuscinosis or Parkinsonism associated with tau deposition.
[0192] Contemplated herein are method of treating patient suffering from neurodegenerative tauopathies, e.g., neurodegenerative diseases characterized by abnormal metabolism of misfolded tau proteins which in turn leads to intracellular accumulation and formation of neurofibrillary tangles (NFT), comprising administering an effective amount of a disclosed agent. Such neurodegenerative tauopathies may are selected from Alzheimer’s disease, progressive supranuclear palsy (PSP), frontotemporal lobar degeneration (FTLD-TAU), corticobasal degeneration, Pick’s disease (frontal temporal dementia), chronic traumatic encephalopathy (CTE), and primary age related tauopathy.
[0193] The current invention also provides methods of treating or preventing Alzheimer’s disease in a patient in need thereof comprising administration of a disclosed agent that reduces that reduces the interaction of a tau seed interactor with intracellular tau proteins.
[0194] Also provided herein are kits comprising any of the RNAs of the invention or any of the pharmaceutical compositions of the invention, and optionally, instructions for use. In one embodiment, the invention provides a kit for performing a method of inhibiting expression of the BSN gene in a cell by contacting a cell with a double stranded RNAi agent of the invention in an amount effective to inhibit expression of the BSN in the cell. The kit comprises an RNAi agent and instructions for use and, optionally, means for administering the RNAi agent to a subject.
[0195] The present invention also provides vials comprising the RNAi agent of the invention or the pharmaceutical composition of the invention. The present invention further provides syringes comprising the RNAi agent of the invention or the pharmaceutical composition of the invention. The present invention further provides an RNA-induced silencing complex (RISC) comprisingTaft Ref. :IUIC-00190an antisense strand of any of the RNAi agents of the invention, and / or a cell (e.g. a mammalian cell) comprising a disclosed RNAi agent.
[0196] In some embodiments, the target sequences of the siRNA may be at any location along BSN mRNA. In some embodiments, the target sequences of the siRNA may be at locations along human BSN mRNA (accession number NM_003458.4, SEQ ID No. 1) described in Table 1.
[0197] Evaluation of siRNAs
[0198] One can evaluate an RNAi agent or molecule, e.g., a modified siRNA, for a selected property by exposing the agent or modified molecule and a control molecule to the appropriate conditions and evaluating for the presence of the selected property. For example, resistance to a degradant can be evaluated as follows: A modified siRNA (and a control molecule, usually with a scrambled sequence) can be exposed to degradative conditions, e.g., exposed to a milieu, which includes a degradative agent, e.g., a nuclease, may be used. Biological sample, e.g., one that is similar to a milieu, which might be encountered, in therapeutic use, e.g., blood or a cellular fraction, e.g., a cell -free homogenate or disrupted cells. The molecule and control could then be evaluated for resistance to degradation by any of a number of approaches. For example, the molecule and control could be labeled prior to exposure, with, e.g., a radioactive or enzymatic label, or a fluorescent label, such as Cy3 or Cy5. Control and modified RNA’s can be incubated with the degradative agent, and optionally a control, e.g., an inactivated, e.g., heat inactivated, degradative agent. A physical parameter, e.g., size, of the modified and control molecules are then determined , and can be determined by a physical method, e.g., by polyacrylamide gel electrophoresis or a sizing column, to assess whether the molecule has maintained its original length, or assessed functionally. Alternatively, Northern blot analysis can be used to assay the length of an unlabeled modified molecule.
[0199] A functional assay can also be used to evaluate an agent. A functional assay can be applied initially or after an earlier non-functional assay, (e.g., assay for resistance to degradation) to determine if the modification alters the ability of the molecule to silence gene expression. For example, a cell, e.g., a mammalian cell, such as a mouse or human cell, can be co-transfected with a plasmid expressing a fluorescent protein, e.g., GFP, and an RNAi agent homologous to the transcript encoding the fluorescent protein. For example, a modified dsRN A homologous to the GFP mRNA can be assayed for the ability to inhibit GFP expression by monitoring for a decrease in cell fluorescence, as compared to a control cell, in which the transfection did not include the dsRNA, e.g., controls with no agent added and / or controls with a non-modified RNATaft Ref. :IUIC-00190added. Efficacy of the agent on gene expression can be assessed by comparing cell fluorescence in the presence of the modified and unmodified dsRNA compounds.
[0200] In an alternative functional assay, a dsRNA compound homologous to an endogenous mouse gene, for example, a maternally expressed gene, such as c-mos, can be injected into an immature mouse oocyte to assess the ability of the agent to inhibit gene expression in vivo (see, e.g., WO 01 / 36646). A phenotype of the oocyte, e.g., the ability’ to maintain arrest in metaphase II, can be monitored as an indicator that the agent is inhibiting expression. For example, cleavage of c-mos mRNA by an RNAi agent would cause the oocyte to exit metaphase arrest and initiate parthenogenetic development. The effect of the modified agent on target RNA levels can be verified by Northern blot to assay for a decrease in the level of target mRNA, or by Western blot to assay for a decrease in the level of target protein, as compared to a negative control. Controls can include cells in which with no agent is added and / or cells in which a non-modified RNA is added.
[0201] Tire scope of the present disclosure may be further appreciated by reference to the following clauses:
[0202] Clause 1. A double-stranded ribonucleic acid (dsRNA) molecule for inhibiting the expression of BSN in a cell, wherein said dsRNA comprises a sense strand and an antisense strand forming a duplex structure less than 30 nucleotides in length; each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to part of an mRNA encoding BSN to mediate RNA interference and wherein the sense strand comprises a sequence having at least 90% identity to a sequence selected the group consisting of the sequences provided in Table 1.
[0203] Clause 2. The dsRNA molecule of clause 1, wherein the sequence identity is at least 95%.
[0204] Clause 3. The dsRNA molecule of clause 1, wherein the sequence identity is at least 99%.
[0205] Clause 4. An RNAi molecule that binds to nucleic acid encoding BSN to reduce expression of Bassoon in a cell, the RNAi molecule comprising a sense strand and an antisense strand, wherein the sense strand comprises 15 to 30 consecutive nucleotide bases of a sequence selected from the group consisting of SEQ ID NOs.: 12-203 and the antisense strand is 15 to 30 nucleotides in length.Taft Ref. :IUIC-00190
[0206] Clause 5. A double stranded RNAi molecule comprising 15-30 consecutive nucleotide bases of a) a sense strand of any one of SEQ ID Nos.: 12-203 and 15-30 consecutive nucleotide bases of b) an antisense strand of any one SEQ ID.: 204-395
[0207] Clause 6. A double stranded RNAi molecule comprising a) a sense strand of any one of SEQ ID Nos.: 12-203, and b) an antisense strand of any one SEQ ID Nos.: 204-395.
[0208] Clause 7. The molecule of any one of clauses 1-6, wherein the antisense strand and the sense strand are each 19 to 25 nucleotides in length, or the antisense strand and the sense strand are each 21 to 23 nucleotides in length.
[0209] Clause 8. The molecule of any one of clauses 1-6 wherein the RNAi molecule comprises a single stranded overhang of at least one of the termini, e.g., an overhang of 1, 2, or 3 nucleotides in length.
[0210] Clause 9. The molecule of any one of clauses 1-8, wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length, wherein the strands form a double stranded region of 21 consecutive base pairs having a 2 nucleotide long single strand overhang at the 3' end.
[0211] Clause 10. The molecule of any one of clauses 1-9, wherein the sense strand is 19 nucleotides in length and the antisense strand is 21 nucleotides in length, wherein the strands form a double stranded region of 19 consecutive base pairs having a 2 nucleotide long single strand overhang at the 3' end.
[0212] Clause 11. The molecule of any one of clauses 1-10, wherein the sense and antisense sequences are on different or the same RNA strands.
[0213] Clause 12. The molecule of any of clauses 1-11, wherein the molecule is an shRNA molecule.
[0214] Clause 13. The molecule of any of clauses 1-12, wherein the molecule is an siRNA molecule.
[0215] Clause 14. The molecule of any of clauses 1-13, wherein at one or more positions on the sense strand or the antisense strand, one or more nucleobases is substituted for a modified nucleobase, and / or one or more phosphodiester backbone moieties is substituted for a modified backbone moiety.
[0216] Clause 15. The molecule of clause 14, wherein the modified nucleobases are selected from any of: 2'-O-methoxy nucleobase, 2'-deoxy nucleobase, 2'-ally 1 nucleobase, 2'-fluoro nucleobase, 2'-lipid-conjugated nucleobase, and 5'-(E)-vinylphosphonate nucleobase.Taft Ref. :IUIC-00190
[0217] Clause 16. The molecule of clause 14 or 15, wherein the modified backbone moiety comprises at least one phosphorothioate or methylphosphonate intemucleotide linkage.
[0218] Clause 17. The molecule of clause 16, wherein the phosphorothioate or methylphosphonate intemucleotide linkage is at the 3'-terminus of one strand.
[0219] Clause 18. The molecule of any one of clauses 1-17, wherein said antisense strand comprises one or both of the following characteristics: (i) 2, 3, 4, 5 or 62'-fluoro modifications; and (ii) 1, 2, 3, 4 or 5 phosphorothioate intemucleotide linkages, and optionally comprises at least one thermally destabilizing modification of the molecule within the first 9 nucleotide positions of the 5' region of the antisense strand or a precursor thereof; and said sense strand comprises one, two or three of the following characteristics: (i) a) one or more lipophilic moieties each conjugated to a nucleotide optionally through a linker ; (ii) 2, 3, 4, or 52'-fluoro modifications; and (iii) 1, 2, 3, 4 or 5 phosphorothioate intemucleotide linkages.
[0220] Clause 19. The molecule of any one of clauses 1-18, wherein the sense strand is conjugated to at least one ligand.
[0221] Clause 20. The molecule of clause 19 wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
[0222] Clause 21. The molecule of clause 19 or 20, wherein the ligand is attached to the 3' end of the sense strand.
[0223] Clause 22. The molecule any one of clauses 1-21, wherein the molecule further comprises a phosphate or a phosphate mimic at the 5' end of the antisense strand.
[0224] Clause 23. The molecule of clause 22, wherein the phosphate mimic is a 5' vinyl phosphate.
[0225] Clause 24. The molecule of any one of clauses 18-23 wherein the one or more lipophilic moieties are conjugated to one or more of positions 4-8 and 13-18 on the sense strand and positions 6-10 and 18 on the antisense strand, counting from the 5' end of each strand.
[0226] Clause 25. The molecule of clause 24, wherein the 2'-lipid-conjugated nucleobase comprises a nucleobase having conjugated to the 2' position a lipid group comprising 4 to 40 carbon atoms, wherein the lipid group is substituted, unsubstituted, saturated, and / or unsaturated.
[0227] Clause 26. The molecule of clause 24 wherein the 2'-lipid-conjugated nucleobase comprises a nucleobase having conjugated to the 2' position a lipid group comprising 10 to 20Taft Ref. :IUIC-00190carbon atoms, wherein the lipid group is substituted, unsubstituted, saturated, and / or unsaturated.
[0228] Clause 27. The molecule of clause 24 wherein the 2'-lipid-conjugated nucleobase comprises a nucleobase having conjugated to the 2' position a lipid group comprising 12 to 18 carbon atoms, wherein the lipid group is substituted, unsubstituted, saturated, and / or unsaturated.
[0229] Clause 28. The molecule of clause 24 wherein the 2'-lipid-conjugated nucleobase comprises a nucleobase having conjugated to the 2' position a lipid group that is a saturated or unsaturated Ci6 hydrocarbon chain group.
[0230] Clause 29. The molecule of any one of clauses 18-29, wherein the lipid moiety is conjugated to the molecule via a chemical linker.
[0231] Clause 30. The molecule of any of clauses 1-29, wherein at least 25%, at least 50%, at least 75% or at least 90% of total nucleobases of the molecule are modified nucleobases.
[0232] Clause 31. The molecule of any one of clauses 1-30, wherein the sense strand has 4 to 12 asymmetrical 2'-O-alkyl modifications, at least 4 of which occur at the 4 terminal nucleotides of the 3' end, and an antisense sequence having at least 4 asymmetrical phosphorothioate modifications.
[0233] Clause 32. The molecule of any one of clauses 1-31, wherein the sense strand has 5 to 10 asymmetrical 2'-O-alkyl modifications, at least 4 of which occur at the 4 terminal nucleotides of the 3' end, and an antisense sequence having at least 5 asymmetrical phosphorothioate modifications.
[0234] Clause 33. The molecule of any one of clauses 1-32 wherein the sense strand has 62'- O-alkyl modifications at the 6 terminal nucleotides of the 5' end.
[0235] Clause 34. The molecule of any one of clauses 31-33, wherein the 2'-O-alkyl modification is 2'-O-methyl.
[0236] Clause 35. The molecule of any one of clauses 1-33, wherein at least four phosphodiester moieties of the sense strand are substituted with a phosphorothioate moiety, and wherein at least four phosphodiester moieties of the antisense strand are substituted with a phosphorothioate moiety.
[0237] Clause 36. The molecule of any of clauses 1-35, wherein:the sense strand consists of 21 nucleobases, the nucleobases of the sense strand modified according to the pattern:Taft Ref. :IUIC-00190the antisense strand consists of 23 nucleobases, the nucleobases of the antisense strand modified according to the pattern:wherein, independently at each individual position on each strand,M = a 2'-0-methoxy nucleobase, andF = a 2'-fluoro nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0238] Clause 37. The composition of any of clauses 1-35, wherein the sense strand consists of 21 nucleobases, the nucleobases of the sense strand modified according to the pattern: 5'- M*M*MMM(CI6)FMFFFMMMMMMMM*M*M -3' ; andthe antisense strand consists of 23 nucleobases, the nucleobases of the antisense strand modified according to the pattern:5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each strand,M = a 2'-O-methoxy nucleobase,F = a 2'-fluoro nucleobase,(Cis) = a 2'-Ci6-conjugated nucleobase, and(VP) = a 5'-(E)-vinylphosphonate nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0239] Clause 38. A double stranded RNA therapeutic comprising a sense strand and an antisense strand, as shown in Table 2.
[0240] Clause 39. A double stranded RNA therapeutic comprising a sense strand and an antisense strand, as shown in Table 3.
[0241] Clause 40. A double stranded RNA therapeutic comprising a sense strand and an antisense strand, as shown in Table 4
[0242] Clause 41. A cell comprising the molecule of any one of clauses 1-40.
[0243] Clause 42. The molecule of any one of clauses 1-39, wherein said molecule, upon contact with a cell, inhibits expression of BSN by at least 20%, at least 40%, or at least 60%.
[0244] Clause 43. A therapeutic for the treatment, control, and / or prevention of neurodegenerative disease in a subject in need thereof comprising an siRNA comprising a sense strand comprising 21 nucleobases and an antisense strand complementary to the senseTaft Ref. :IUIC-00190strand, the antisense strand comprising 23 nucleobases, wherein the sense strand and antisense strand form a double-stranded region at least 21 consecutive nucleobase pairs in length, and having a single-stranded overhang at the 3' end of the antisense strand which is at least 2 nucleobases long;wherein the sense strand sequence spanning the double-stranded region of the siRNA comprises at least 21 consecutive bases of a sequence selected from the group consisting of SEQ ID NOs. 12-203;wherein at least one nucleobase is a non-natural nucleobase,wherein the non-natural nucleobase is selected from any of: a 2'-O-methoxy nucleobase, a 2'-fluoro nucleobase, a 2'-Ci2-i8-lipid-conjugated nucleobase, and a 5'-(E)-vinylphosphonate nucleobase; andwherein at least one phosphodiester moiety of the siRNA is substituted with a phosphorothioate moiety.
[0245] Clause 44. A pharmaceutical composition comprising a molecule of any one of clauses 1-43 and a pharmaceutically acceptable excipient.
[0246] Clause 45. The composition of clause 44, wherein the pharmaceutically acceptable excipient is selected from the group consisting of adjuvant, pH buffer, antioxidant, preservative, salt, pH modulator, solvent, chelation agent, emulsifier, antimicrobial agent, or any combination thereof.
[0247] Clause 46. A method of treating, controlling, and / or preventing a tauopathy in a brain cell or nerve cell comprising administering to the cell an effective amount of the molecule or composition of any of clauses 1-45.
[0248] Clause 47. A method of treating, controlling, and / or preventing a tauopathy in a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of the molecule or composition of any one of clauses 1-45.
[0249] Clause 48. A method of treating and / or ameliorating symptoms in a patient suffering from a neurodegenerative disease and in need of treatment, comprising administering to the patient a therapeutically effective among of a molecule of clauses 1-45, wherein the neurodegenerative disease is selected from the group consisting of:Alzheimer’s Disease, Progressive Supranuclear Palsy, Chronic Traumatic Encephalopathy, Corticobasal Degeneration, FTD (e.g., frontotemporal dementia with parkinsonism), Pick's Disease, and Primary Age Related Tauopathy.Taft Ref. :IUIC-00190
[0250] Clause 49. A method of treating and / or ameliorating symptoms in a patient suffering from a disorder and in need of treatment, comprising administering to the patient a therapeutically effective of a molecule of clauses 1-45, wherein the disorder is from the group consisting of: Agyrophyllic grain disease, Vacuolar tauopathy, Lytico-bodig disease, Ganglioglioma, Gangliocytoma, Mengioangiomatosis, Postencephalitic Parkinsonism, Traumatic Brain Injury, MAPT associated disease, Subacute Sclerosing Panencephalitis, Lead Encephalopathy, Tuberous Sclerosis, Pantothenate Kinase-associated Neurodegeneration, Lipofuscinosis or Parkinsonism associated with tau deposition.
[0251] Clause 50. Use of the molecule of any of clauses 1-45 in the manufacture of a medicament for the treatment of a neurodegenerative disease.
[0252] Clause 51. A kit comprising:the molecule or composition of any of clauses 1-45;a container; andinstructions providing information on how to administer the composition and / or therapeutic to a subject in need thereof.
[0253] Clause 52. A double-stranded RNA duplex capable of downregulating BSN mRNA concentration in a cell.
[0254] Clause 53. The double-stranded RNA duplex of clause 1, wherein a 20nM concentration dose of the double-stranded RNA duplex results in a cellular BSN mRNA concentration of 55% to 75% of baseline concentration.
[0255] Clause 54. The double-stranded RNA duplex of clause 52 or clause 53, wherein the duplex forms part of an siRNA or a shRNA, the duplex comprising a sense strand portion and an antisense strand portion.
[0256] Clause 55. The double-stranded RNA duplex of clause 54, wherein the sense strand portion comprises a sequence having at least 90% identity to a sequence selected from SEQ ID Nos.: 12-203.
[0257] Clause 56. The double-stranded RNA duplex of clause 54, wherein the antisense strand portion comprises a sequence having at least 90% identity to a sequence selected from SEQ ID Nos.: 204-395.
[0258] Clause 57. The double-stranded RNA duplex of clause 54, wherein the sense strand portion comprises a sequence selected from SEQ ID Nos.: 12-203, and the antisense strand portion comprises a sequence selected from SEQ ID Nos.: 204-395, and wherein the sense strand portion is complementary to the antisense strand portion.Taft Ref. :IUIC-00190
[0259] Clause 58. The double-stranded RNA duplex of any of clauses 52-57, wherein one or more nucleotides is a modified nucleotide.
[0260] Clause 59. The double-stranded RNA duplex of any of clauses 52-58, wherein the sense strand portion comprises a span of 21 consecutive modified nucleobases according to the pattern:wherein, independently at each individual position on each strand,M = a 2'-O-methoxy nucleobase, andF = a 2'-fluoro nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0261] Clause 60. The double-stranded RNA duplex of any of clauses 52-59, wherein the antisense strand portion comprises 23 consecutive modified nucleobases according to the pattern: 5'- M*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each strand,M = a 2'-O-methoxy nucleobase, andF = a 2'-fluoro nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0262] Clause 61. The double-stranded RNA duplex of any of clauses 52-59, wherein the sense strand portion comprises a span of 21 consecutive modified nucleobases according to the pattern:5'- M*M*MMM(C16)FMFFFMMMMMMMM*M*M -3'wherein, independently at each individual position on each strand,M = a 2'-0-methoxy nucleobase,F = a 2'-fhioro nucleobase,(Cis) = a 2'-Ci6-conjugated nucleobase, and(VP) = a 5'-(E)-vinylphosphonate nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0263] Clause 62. The double-stranded RNA duplex of any of clauses 52-59, wherein the antisense strand portion comprises a span of 23 consecutive modified nucleobases according to the pattern:Taft Ref. :IUIC-001905'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each strand,M = a 2'-0-methoxy nucleobase,F = a 2'-fluoro nucleobase,(Cie) = a 2'-Ci6-conjugated nucleobase, and(VP) = a 5'-(E)-vinylphosphonate nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0264] Clause 63. The double-stranded RNA duplex of any of clauses 52-59, further comprising a hairpin loop linking the sense strand and antisense strand.
[0265] Clause 64. A cell comprising the double-stranded RNA duplex of any of clauses 52-63.
[0266] Clause 65. A therapeutic composition comprising the double-stranded RNA duplex of any of clauses 52-63, and a pharmaceutically acceptable excipient.
[0267] Clause 66. The composition of clause 65, wherein the pharmaceutically acceptable excipient is selected from the group consisting of adjuvant, pH buffer, antioxidant, preservative, salt, pH modulator, solvent, chelation agent, emulsifier, antimicrobial agent, or any combination thereof.
[0268] Clause 67. An RNAi molecule for the inhibition of expression of human BSN, the molecule comprising a sense sequence comprising the sequence of SEQ ID No. 12 or 13, and an antisense sequence comprising the sequence of SEQ ID No. 204 or 205.
[0269] Clause 68. The RNAi molecule of clause 67, wherein the RNAi molecule is an siRNA.
[0270] Clause 69. The RNAi molecule of clause 67, wherein the RNAi molecule is an shRNA.
[0271] Clause 70. The RNAi molecule of any of clauses 67-69, wherein the sense sequence comprises a span of 21 consecutive modified nucleobases according to the pattern:5'- M*M*MMMMFMFFFMMMMMMMM*M*M- 3' ; andwherein the antisense sequence comprises a span of 23 consecutive modified nucleobases according to the pattern:5'- M*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each sequence,M = a 2'-O-methoxy nucleobase, andTaft Ref. :IUIC-00190F = a 2'-fluoro nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0272] Clause 71. The RNAi molecule of any of clauses 67-69, wherein the sense sequence comprises a span of 21 consecutive modified nucleobases according to the pattern:5'- M*M*MMM(CI6)FMFFFMMMMMMMM*M*M -3'; andwherein the antisense sequence comprises a span of 23 consecutive modified nucleobases according to the pattern:5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each sequence,M = a 2'-0-methoxy nucleobase,F = a 2'-fluoro nucleobase,(Cis) = a 2'-Ci6-conjugated nucleobase, and(VP) = a 5'-(E)-vinylphosphonate nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0273] Clause 72. An siRNA for inhibiting human BSN comprising a sense strand comprising the nucleotide sequence of SEQ ID No. 12 and an antisense strand comprising the nucleotide sequence of SEQ ID No. 204, the sense strand comprising a span of 21 consecutive modified nucleobases according to the pattern:5'- M*M*MMM(Ci6)FMFFFMMMMMMMM*M*M -3'; andthe antisense strand comprising a span of 23 consecutive modified nucleobases according to the pattern:5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each sequence,M = a 2'-O-methoxy nucleobase,F = a 2'-fluoro nucleobase,(Cis) = a 2'-Ci6-conjugated nucleobase, and(VP) = a 5'-(E)-vinylphosphonate nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0274] Clause 73. Use of the molecule of any of clauses 1-42 in the manufacture of a medicament for the treatment of a neurodegenerative disease.TaftRef.:IUIC-00190
[0275] Clause 74. Use of the therapeutic of clause 43 or the composition of clause 44 in the manufacture of a medicament for the treatment of a neurodeg enerative disease.
[0276] Clause 75. A kit comprising:The double-stranded RNA duplex of any of clauses 52-63a container; andinstructions providing information on how to administer the RNA and / or therapeutic composition to a subject in need thereof.
[0277] Clause 76. A double-stranded ribonucleic acid ( dsRNA) molecule for inhibiting the expression of BSN in a cell, wherein said dsRNA comprises a sense strand and an antisense strand forming a duplex structure less than 30 nucleotides in length; each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to part of an mRNA encoding BSN to mediate RNA interference and wherein the sense strand comprises a sequence having at least 90% identity to a sequence selected from the group consisting of the sequences provided in Table 5a, Table 5b, or Table 6.
[0278] Clause 77. An RNAi molecule that binds to nucleic acid encoding BSN to reduce expression of Bassoon in a cell, the siRNA comprising a sense strand and an antisense strand, wherein the sense strand comprises 15 to 30 consecutive nucleotide bases of a sequence selected from the group consisting of SEQ ID NOs.: 396-433 and the antisense strand is 15 to 30 nucleotides in length.
[0279] Clause 78. A double stranded RNA comprising 15-30 consecutive nucleotide bases of a) a sense strand of any one of SEQ ID Nos.: 396-433 and 15-30 consecutive nucleotide bases of b) an antisense strand of any one SEQ ID.
[0280] Clause 79. A double stranded RNA comprising a) a sense strand of any one of SEQ ID No.: 396-414, and b) an antisense strand of any one SEQ ID No.: 415-433.
[0281] Clause 80. A therapeutic for the treatment, control, and / or prevention of neurodegenerative disease in a subject in need thereof comprising an siRNA comprising a sense strand comprising 21 nucleobases and an antisense strand complementary to the sense strand, the antisense strand comprising 23 nucleobases, wherein the sense strand and antisense strand form a double-stranded region at least 21 consecutive nucleobase pairs in length, and having a single-stranded overhang at the 3' end of the antisense strand which is at least 2 nucleobases long; wherein the sense strand sequence spanning the double-stranded region of the siRNA comprises at least 21 consecutive bases of a sequence selected from the group consisting of SEQ ID NOs. 396-414; wherein at least one nucleobase is a non-natural nucleobase, wherein the non-Taft Ref. :IUIC-00190natural nucleobase is selected from any of: a 2'-O-methoxy nucleobase, a 2'-fluoro nucleobase, a 2'-C12-lS-lipid-conjugated nucleobase, and a 5'-(E)-vinylphosphonate nucleobase; and wherein at least one phosphodiester moiety of the siRNA is substituted with a phosphorothioate moiety.
[0282] Clause 81. The double-stranded RNA duplex of clause 80, wherein the sense strand portion comprises a sequence having at least 90% identity to a sequence selected from SEQ ID Nos.: 396-414.
[0283] Clause 82. The double -stranded RNA duplex of clause 80, wherein the antisense strand portion comprises a sequence having at least 90% identity to a sequence selected from SEQ ID Nos.: 406-433.
[0284] Clause 83. The double-stranded RNA duplex of clause 80, wherein the sense strand portion comprises a sequence selected from SEQ ID Nos.: 396-414, and the antisense strand portion comprises a sequence selected from SEQ ID Nos.: 406-433, and wherein the sense strand portion is complementary to the antisense strand portion.
[0285] Clause 84. An RNAi molecule that binds to nucleic acid encoding BSN to reduce expression of Bassoon in a cell, the siRNA comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand each comprise 15 to 30 consecutive nucleotide bases of a sequence selected from the group consisting of SEQ ID Nos.: 442-863.
[0286] EXAMPLES
[0287] Tire invention now being generally described, it will be more readily understood by reference to the following examples which are included merely for purposes of illustration of certain aspects and embodiments of the present invention and are not intended to limit the invention.
[0288] The following examples are provided for the purpose of illustrating various embodiments of the invention and are not meant to limit the present disclosure in any fashion. The present examples, along with the methods described herein are presently representative of preferred embodiments, are provided only as examples, and are not intended as limitations on the scope of the invention. Changes therein and other uses which are encompassed within the spirit of the disclosure as defined by the scope of the claims will occur to those skilled in the art.
[0289] EXAMPLE 1
[0290] BioinformaticsTaft Ref. :IUIC-00190
[0291] Possible siRNAs were generated starting from the human BSN mRNA sequence (NM_003458.4) (SEQ ID No.: 1) and with further reference to human BSN mRNA isoforms XM_047449152.1 (SEQ ID No.: 2), XM_054348283.1 (SEQ ID No.: 3), XM_047449149.1 (SEQ ID No.: 4), XM_047449150.1 (SEQ ID No.: 5), and XM_047449151.1 (SEQ ID No.: 6). To obtain query coverage of related transcripts, an alignment was created by performing a BLASTn search with the human BSN transcript vs. BSN transcripts of human and non-human primates (NHPs) from National Center for Biotechnology Information (NCBI) RefSeq and Ensembl. To assess the potential off-target effects, predictions were made for off-target genes in humans, rhesus monkeys (reference sequence XM_028843490.1 (SEQ ID No.: 9)), cynomolgus monkeys (reference sequences XM_045386264.1 (SEQ ID No.: 10) and XM_045386265.1 (SEQ ID No.: 11)), and mice (reference sequences XM_006511634.4 (SEQ ID No.: 7) and NM_007567.2 (SEQ ID No.: 8). Each siRNA strand was assigned a specificity score, reflecting its anticipated target precision. The analysis was separately performed for the sense and antisense strand, using position 2-18 (5 '-3') for each strand as the input. Further, the siRNA strands underwent analysis to identify the presence of miRNA seed regions from human, rhesus monkey, dog, pig, mouse, rat, and rabbit. This analysis assigned specificity categories to each siRNAs, integrating the specificity score with miRNA seed region analysis. Cross-reactivity of siRNAs was evaluated by examining potential interactions with transcript variants and their reactivity across different species. The analysis was conducted for both 21mer siRNAs and their corresponding 19mer versions (nucleotides 2-20 of the 21mer), including variants for both lengths with a single nucleotide mismatch. Additionally, human SNPs were mapped to the siRNA target sites within the BSN transcript NM_003458.4 (SEQ ID No.: 1) to ensure compatibility and specificity. siRNA target sites were selected to avoid regions with common SNPs, specifically those with a Minor Allele Frequency (MAF) of 1% or higher. Cross-reactivity was evaluated, with 21mer siRNAs being assessed fortheir interaction with human BSN mRNA and 19mer siRNAs fortheir interaction with non-human primate (NHP) BSN. The miRNA seed regions were assessed to ensure that the antisense (AS) and sense (S) strands of the siRNAs did not have seed regions conserved in humans, mice, and rats, and were not present in more than four species. The frequency of off-target effects was controlled by limiting the human off-target matches to 20 or fewer, with a minimum of 2 mismatches allowed on the AS strand. Additionally, the base composition of the siRNAs was tailored to prevent stretches of more than four guanines (Gs) in a row, and to limit G stretches to no more than two Gs at the termini, thereby optimizing stability and efficacy (Assmann, N.; Fratte, J.; Mandal, S.; Seitz, F.; Blindzellner, L.; Deckert,Taft Ref. :IUIC-00190J.; Vomlocher, H.-P.; Hadwiger, P. RNA-seq-based Nucleic Acid Therapeutics lead optimization; Axolabs, 2023).
[0292] Following these parameters, 785 sequences are provided below, which are given at Table 1.>Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190
[0293] EXAMPLE 2
[0294] Synthesis
[0295] 192 sequences with 8 phosphorothioate (PS) linkages at the strand terminals, 2'-fluoro-modifications at sites 7, 9, 10 and 11 of the sense strand and at 2, 6, 8, 9, 14 and 16 of the antisense strand and 2'-O-methyl modification at the remaining sites were selected for synthesis by solid-phase synthesis, briefly as follows: the single strands (both sense and antisense) were synthesized according to the conventional solid-phase oligonucleotide synthesis technology using the standard phosphoramidite-based oligomerization chemistry whereby the oligonucleotides were assembled on solid support, employing a MerMade 96E synthesizer in a 96 well format.
[0296] The sequences were synthesized on controlled pore glass (CPG) frit based-solid support, available from Biocomma (#DS0500, porosity of 500 A, scale 500 nmol). Amidite solutions (50 mM) used were prepared from amidites commercially available from Merck (Hamburg, Germany). Ethyl thiotetrazole (ETT, 500 mM in acetonitrile, 99.8%, Biosolve #0022112402BS) was used as activator solution. Standard coupling times of 3 minutes were employed. In order to introduce phosphorothioate linkages, a 100 mM solution of 3-Amino-l,2,4-dithiazole-5-thione (or Xanthane hydride obtained from TCI Chemicals, Germany) dissolved in acetonitrile-pyridine (2:3 v / v) was employed as sulfurizing agent. The other ancillary reagents used were as follows: lodine-oxidizer (50 mM h (in PyridineTHO (9:1 v / v))), trichloracetic acid (TCA) (3% in dichloromethane (DCM)) for deblocking, Cap A (Acetic anhydride in tetrahydrofuran (THF) (9.1:90.9 v / v)) and CapB (THF, '-Mcthylimidazolc and Pyridine (8:1:1 v / v / v) as capping agents. Oligonucleotides were all synthesized with the removal of the final dimethoxytrityl (DMT) protecting group (“DMT-Off ’).
[0297] Cleavage De-Protection: AMA solution (aq. Methylamine (41%) and aq. NH3 (30%) (1:1 v / v)) was used for cleavage and deprotection. Crude preparations were purified by Anion Exchange Chromatography using a Dionex DNA-Pac 100 (9 * 250 mm)-column, followed byTaft Ref. :IUIC-00190product precipitation using ethanol, and finally re-dissolving the pellets in water. The sense and the antisense strands concentration were quantified by ultraviolet (UV) absorption at 260 nm.
[0298] During the annealing step, equivalent amounts of the sense and antisense strands were mixed in annealing buffer (40 mM NaFbPCh bO + NazHPCE buffer, pH 6.8, 200 mM NaCl) and were annealed by heating the duplex sample followed by subsequent cooling to ambient temperature. The resultant siRNA-duplexes were finally characterized by size-exclusion chromatography (SEC) towards fulfilment of siRNA duplex purity > 90% (as per integration of the UV signal of the analytical SEC trace). The annealed duplexes were thereafter used for following in vitro studies.
[0299] 192 modified oligonucleotides were synthesized. The nucleotide sequences for these 192 oligonucleotides are shown in Table 2 below. It should be understood that the sequences may be described using the symbol “t” to refer to the location of a uracil residue. For completeness of disclosure, Table 2a provides the same nucleotide sequences of Table 2 with the position of uracil on the RNA sequence referred to by the symbol “t”.> >Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190> >Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190Taft Ref. :IUIC-00190
[0300] The 192 oligonucleotides that were synthesized may be described even more specifically from Table 3, below, where, as shown in Table 3, a = adenine, g = guanine, c = cytosine, u = uracil, Af = 2'-fluoro-adenine, Gf = 2'-fluoro-guanine, Cf = 2'-fluorocytocine, and Uf = 2'-fluoro-uracil. An “s” refers to a phosphorothioate moiety substituted for a phosphodiester at the indicated position between two adjacent nucleobases. The absence of an “s” at any location along the sequence means the sugar-backbone is an unmodified phosphodiester moiety. It should be understood for purposes of the present disclosure that a uracil residue could, alternatively, be described using the symbol “t”, and a 2' -fluoro-uracil residue could be described using theTaft Ref. :IUIC-00190symbol “Tf”. Also shown in Table 3 is the calculated molecular weight and measured mass for the aggregate weight of the sense sequence and antisense sequence in each row.> >TaftRef.:IUIC-00190TaftRef.:IUIC-00190TaftRef.:IUIC-00190TaftRef.:IUIC-00190TaftRef.:IUIC-00190
[0301] Cell culture co-transfection
[0302] SH-SH5Y cells were purchased from American Type Culture Collection (ATCC) (CRL-2266) and passaged no more than 15 times before use. Cultures were grown at 37 °C, 5 % CO2, in Dulbecco’s modified eagle medium (DMEM) (Biochrom #F0435), 15% fetal calf serum (FCS), 1% L-Glu, 1% P / S. Cells were differentiated with 10 pM retinoic acid for 13 days on collagen coated dishes. Cells were subsequently dissociated and seeded at 30,000 cells per well on collagen coated 96 well plates. (Fig. 1A.) Cells were then transfected with .SA'-targcting siRNA or control siRNAs (20 nM) using Lipofectamine RNAiMax (0.25 pL per well) in Opti-MEM media. After 24 hours, cells were lysed to quantify BSN mRNA levels, or alternatively, cell viability was determined by the CellTiter-Glo® 2.0 assay (Promega), as described below.
[0303] bDNA assay
[0304] Cells were lysed and branched DNA (bDNA) analysis was performed to quantify mRNA levels ofhsBSN, hsGAPDH, and hsAHSAl, using the QuantiGene™ Singleplex Assay Kit (cat# QS0016). Cell lysis and mRNA level quantification were prepared according to manufacturer’s instructions. Negative and transfection efficiency controls were included on each plate. Negative control treatment of cells included mock treatment as well as transfection of cells with a siRNA targeting hsAHSAl, hsFVII and F-Luc. As a positive control, cells were transfected with an active siRNA targeting hsAHSAl. Luminescence was read on plate reader VICTOR Light 1420 Luminescence counter (PerkinElmer).(Figs. 1B-1D.)
[0305] Cytotoxicity
[0306] CellTiter-Glo® 2.0 Cell Viability Assay (Promega) was carried out following the manufacturer’s recommendations. Twenty-four hours after transfection, 100 pl of the CellTiter-Glo® substrate was added to lOOpl medium per well and incubated for 10 minutes at room temperature. Luminescence was read on the multimode reader Mithras2LB 943 (Berthold Technologies).
[0307] Statistics
[0308] Statistical analyses and graph designs were performed using Microsoft Excel. All data were generated in biological quadruplicates. Mock treated cells were used for normalization to 100% for BSN transcript and cellular viability, for bDNA and CellTiter-Glo® assays, respectively. BSN transcript levels from siRNA treated cells were standardized to GAPDH expression and presented as % relative remaining mRNA. Data are presented as mean ± S.E.M.Taft Ref. :IUIC-00190
[0309] EXAMPLE 3
[0310] Knockdown of BSN via RNAi
[0311] BSN may also be knocked down via administration of one or more siRNAs or shRNA such as disclosed herein, utilizing RNAi techniques known in the art.
[0312] Efficiency of siRNA against BSN on downregulating BSN levelsThe efficiency of several different siRNA described above, against BSN on downregulating BSN levels in SH5Y cells was investigated. It should be understood that each of the dsRNA molecules transfected into the SH5Y cells contained modified nucleobases and phosphate backbone, in accordance with the pattern: 5'- M*M*MMM(Ci6)FMFFFMMMMMMMM*M*M -3' ; and the antisense strand consists of 23 nucleobases, the nucleobases of the antisense strand modified according to the pattern:5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each strand,M = a 2'-O-methoxy nucleobase,F = a 2'-fluoro nucleobase,(Cis) = a 2'-Ci6-conjugated nucleobase, and(VP) = a 5'-(E)-vinylphosphonate nucleobase; and wherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
[0313] Transfected synthetic-construct oligonucleotides that had a measurable knockdown effect of BSN at 20 nM dose using the above-described assay are given below in Table 4.Taft Ref. :IUIC-00190
[0314] The control oligo in these experiments had a sense-strand 5'->3' sequence of csusgcguCfaUfCfCfuacagaccsusa (SEQ ID NO: 864) and an anti sense -strand 5'->3' sequence of usAfsgguCfuGfUfaggaUfgAfcgcagsgsu (SEQ ID NO: 865). Described more generally without modifications to the nucleobases and sugar-backbone, the control oligo in these experiments had a sense-strand 5'->3' sequence of cugcgucauccuacagaccua (SEQ ID No. 866) and an antisense-strand 5' ->3' sequence of uaggucuguaggaugacgcaggu (SEQ ID No. 867).
[0315] EXAMPLE 4
[0316] Dose response efficiency of siRNA against BSN on downregulating BSN levels
[0317] A dose response of efficiency of dsRNA comprising duplexes of SEQ ID NO.: 12 and SEQ ID NO.: 204, and SEQ ID NO.: 13 and SEQ ID NO.: 205 were performed. Figure 2A shows, in quadruplicate (rows A through D), a dose response for transfected modified syntheticconstruct oligos having a sense sequence of SEQ ID No.: 12 and an antisense sequence of SEQ ID No.: 204, with a hsFVII positive control. Figure 2B shows, in quadruplicate (rows A through D), a dose response for transfected modified synthetic-construct oligos having a sense sequence of SEQ ID No.: 13 and an antisense sequence of SEQ ID No.: 205, with a F-Luc positive control. Figure 3 is shows graphed relative knockdown of BSN mRNA, charting the data of Figures 2A-2B, shown with hsFVII, hsHSAl, and F-Luc controls.
[0318] Relative expression of human BSN mRNA following transfection with varying doses of synthetic-construct oligo having a sense sequence of SEQ ID No.: 12 and an antisense sequence of SEQ ID No.: 204 is shown at Figure 6A. Relative expression of human BSN mRNA following transfection with varying doses of synthetic-construct oligo having a sense sequence of SEQ ID No.: 13 and an antisense sequence of SEQ ID No.: 205 is shown at FIG. 6B.
[0319] EXAMPLE 5Taft Ref. :IUIC-00190
[0320] psiCheck vector generation.
[0321] Notl and AsiSI restriction sites were introduced to fragments of the Human Bassoon gene (NM_003458.4) by Taq-catalyzed PCR (Thermo Fisher Scientific, Table 5). PCR products were separated by gel electrophoresis, excised and purified using the QIAquick Gel Extraction Kit (Qiagen). PCR products were subcloned into TOPO TA vector (Thermo Fisher Scientific)) using a 5-minute ligation. 2 pL of the ligation reaction was incubated with 50 pL 5-alpha Competent E. coli (New England Biolabs) on ice for 30 minutes, heat shocked at 42 °C for 45 seconds and immediately incubated on ice for 2 minutes. Cells were incubated in a shaking incubator (200 RPM) in 200 pL SOC media for 1 hour at 37 °C and then plated on LB Agar containing 100 pg ampicillin, 20 mg / mL X-Gal, and 100 mM IPTG. Cultures were incubated overnight at 37 °C and white colonies were picked and grown in 5 mb LB media containing 100 pg / ml ampicillin overnight at 37 °C with shaking (200 RPM). Plasmid minipreps (Qiagen) were prepared and the resulting plasmids and the psi CHECK-2 plasmid (1 pg; Promega) were cut with Notl and AsiSI (1 U each in rCutSmart buffer; New England Biolabs) for Ih at 37 °C. Fragments were separated by gel electrophoresis, excised and purified using the QIAquick Gel Extraction Kit (Qiagen). Purified gel products were ligated (3:1 ratio of psiCHECK to Bassoon product) with the Quick Ligation™ Kit (New England Biolabs) for 5 minutes and 5 pL of the ligation reaction was used to transform 5-alpha Competent E. coli and isolate colonies as described above. Plasmids were sequenced to confirm insert. The primer sequences used for cloning and gene coverage of the psiCHECK constructs are shown in Table 5 below.> >
[0322] psiCheck transient transfection.
[0323] HEK293T cells (ATCC) were plated on 6 well culture plates (Coming) at a cell density of 500,000 cells per well in 2 mL media (DMEM containing 10% FBS and 10 mg / mL Penicillin-Streptomycin). Cells were transfected with 1 pg of plasmid and 3.75 pL Lipofectamine 3000 (Thermo Fisher Scientific). For complex formation, Lipofectamine and DNA were diluted in 125 pL Opti-MEM media (Thermo Fisher Scientific) separately and then combined and incubated at room temperature for 15 minutes prior to the addition to the cells. Transfected cells were incubated for 24 hours at 37 °C in a 5 % CO2 incubator.
[0324] psiCheck siRNA screening.
[0325] 23 oligonucleotides were synthesized. The nucleotide sequences for these 23 oligonucleotides are shown in Table 5a and the modified sequences used in cellular experiments are shown in Table 5b below. The 23 oligonucleotides that were synthesized may be described even more specifically from Table 5a below where a is adenine, g is guanine, c is cytosine, u is uracil, and where Af is 2'-fluoro-adenine, Gf is 2'-fluoro-guanine, Cf is 2'-fluorocytocine, and Uf is 2'-fluoro-uracil, each of which comprise a 2'-fhioro substituted ribose. An “s” indicates that the intemucleoside linkage at the specified position is a phosphorothioate linkage rather than a phosphodiester linkage. In the absence of an “s,” the linkage is phosphodiester. For avoidance of doubt, an “s” following a nucleotide denotes that the linkage between that nucleotide and the next 3' nucleotide is phosphorothioate. It should be understood for purposes of the present disclosure that a uracil residue could, alternatively, be described using the symbol "t", and a 2'-fluoro-uracil residue could be described using the symbol "Tf which comprises a 2'-fluoro substituted ribose. Also shown in Table 5b is the calculated molecular weight and measured mass of the sense sequence and antisense sequence in each row.> >Taft Ref. :IUIC-00190> >TaftRef.:IUIC-00190
[0326] psiCHECK Transfected HEK293T cells were split and replated at 30,000 cells per well into white 96 well plates (Falcon) containing siRNAs and 0.1 pL RNAiMAX (Thermo Fisher Scientific)) in Opti-MEM media. After 24 hours, Renilla and Firefly luciferase readings were taken using the Dual-Glo™ Luciferase Assay System (Promega) on an Agilent Biotek Synergy Neo2 Hybrid Multimode plate reader. Data was standardized by subtracting the Firelfly values from the Renilla values and normalizing to RNAiMAX treated sister cultures. Data was plotted using Graphpad Prism software (Version 10.6.1) and curves fitted by four parameter non-linear regression analysis to determine potencies (ICso) and % knockdown (Figs. 8A-8H). Transfected synthetic-construct oligonucleotides that had a measurable knockdown effect of BSN using the above-described assay are given below in Table 5c, where knockdown levels of BSN and potencies (ICso) of synthetic-construct oligonucleotides as determined using HEK293T cells transfected with psiCHECK vectors containing BSN fragments. Data was standardized to RNAiMAX treated controls. Potencies (ICso) were determined by non-linear curve fitting (Variable slope (four parameters)) and the difference between top and bottom best fit values indicates the range and level of knockdown level (Table 5c).Table 5c. IC50s and Maximum Knockdown of BSN RNA IC50duplex, by Sense Correspondinre|a[jve[0Max- psiCHECK referenceeg Antisense , , ... .Sequence ® control Min construct usedrfor to row ... Complement ,, . . . _ SEQ II) ,. . .... (M) (psiChec screening (Table number of . , Sequence SEQ , , , . . _ ', - No.In. psiCheck k Assay) 5, supra) Table 5a, ID No.Assaysupra.1 396 415 1.00E-07 13.13 psiCHECK.hBSN l 9 404 423 1.40E-08 37.09 psiCHECK.hBSN l 10 24 216 1.26E-08 20.33 psiCHECK.hBSN l 2 397 416 1.33E-07 27.02 psiCHECK.hBSN l 11 405 424 2.08E-03 ND psiCHECK.hBSN l 12 406 425 9.08E-08 9.91 psiCHECK.hBSN l 3 398 417 1.42E-10 29.01 psiCHECK.hBSN_2 13 407 426 6.76E-08 15.27 psiCHECK.hBSN_2 14 63 255 3.34E-10 40.94 psiCHECK.hBSN_2 15 408 427 2.58E-11 68.81 psiCHECK.hBSN_3 16 409 428 1.08E-07 37.87 psiCHECK.hBSN_3 4 399 418 2.00E-07 30.63 psiCHECK.hBSN_3 18 411 430 1.65E-09 8.71 psiCHECK.hBSN_4 19 412 431 1.04E-09 ND psiCHECK.hBSN_4 5 400 419 1.05E-08 9.77 psiCHECK.hBSN_4 20 413 432 2.66E-09 30.9 psiCHECK.hBSN_4 6 401 420 2.29E-07 27.48 psiCHECK.hBSN_4 21 414 433 4.58E-10 43.01 psiCHECK.hBSN_4Taft Ref. :IUIC-0019022 191 383 3.00E-09 33,82 psiCHECK,hBSN 4
[0327] EXAMPLE 6
[0328] siRNA transfection in hiPSC-derived neurons. An assessment of self-delivery of dsRNA comprising duplexes of EXAMPLE 6A and EXAMPLE 6D (Table 6) were performed.6 modified oligonucleotides were synthesized. The nucleotide sequences for these 6 oligonucleotides are shown in Table 6 below. The 6 oligonucleotides that were synthesized may be described even more specifically from Table 6 below, where a is adenine, g is guanine, c is cytosine, u is uracil, and where Af is 2'-fluoro-adenine, Gf is 2'-fluoro-guanine, Cf is 2'-fluorocytocine, and Uf is 2'-fluoro-uracil, each of which comprise a 2'-fhioro substituted ribose. An “s” indicates that the intemucleoside linkage at the specified position is a phosphorothioate linkage rather than a phosphodiester linkage. In the absence of an “s,” the linkage is phosphodiester. For avoidance of doubt, an “s” following a nucleotide denotes that the linkage between that nucleotide and the next 3' nucleotide is phosphorothioate. It should be understood for purposes of the present disclosure that a uracil residue could, alternatively, be described using the symbol "t", and a 2'-fluoro-uracil residue could be described using the symbol "Tf", which comprises a 2'-fluoro substituted ribose. A “Cl 6” denotes a nucleotide residue having a ribose substituted at the 2'-position with a hexadecan- l-ol moiety (e.g., a 2'-O-hexadecyl substituent). A “(VP)” indicates that the oligonucleotide comprises a 5'-(E)-vinylphosphonate terminal modification.
[0329] Human induced pluripotent stem cells (iPSCs) were maintained under feeder-free conditions in mTeSRl medium on Matrigel-coated plates. Neuronal differentiation was initiated using dual-SMAD inhibition as previously described (Maltby et al., AAGGG repeat expansions trigger RFC 1 -independent synaptic dysregulation in human CANVAS neurons. Sci Adv. 2024, 6;10(36):eadn2321). Neural progenitor cells (NPCs) were plated onto poly-L-omithine / laminin-coated surfaces and differentiated in neuronal maturation medium consisting of BrainPhys medium supplemented with SMI, N2, brain-derived neurotrophic factor (BDNF), glial cell line-derived neurotrophic factor (GDNF), dibutyryl cyclic AMP (dbcAMP), and L-ascorbic acid. Compound E (CAS Number 209986-17-4) was added after NPC plating to promote neuronal differentiation, laminin was supplemented weekly, and triiodothyronine (T3) was added upon neurite outgrowth. siRNA-mediated gene silencing was performed in mature iPSC-derived neurons at day 21 of differentiation. Neurons were transfected with BSN-targeting siRNAs using Lipofectamine™ RNAiMAX Transfection Reagent (Invitrogen)Taft Ref. :IUIC-00190according to the manufacturer’s instructions while maintained in neuronal differentiation medium. To minimize cytotoxicity, the medium was partially replaced 24 hours posttransfection. Neurons were harvested 72 hours after transfection for RNA isolation using the Cells-to-Ct kit (Thermo Fisher Scientific) or for immunofluorescence staining with antibodies against Bassoon (BSN) and synaptophysin. Transfection efficiency and gene knockdown were quantified by real-time quantitative PCR (RT-qPCR). FIG. 9 shows the modified BSN siRNA containing a C16 conjugation (EXAMPLE 6D) effectively reduced BSN mRNA levels without the need for Lipofectamine. EXAMPLE 6A, a modified BSN siRNA carrying the same sequence as EXAMPLE 6D without the C16 conjugation only reduced BSN transcript in the presence of Lipofectamine.
[0330] siRNA injections in vivo. Bilateral stereotaxic injections of dsRNA comprising duplexes of Molecular ID Nos.: EXAMPLE 6D, EXAMPLE 6B, and EXAMPLE 6F (Table 6) were performed as previously described (Lee-Gosselin et al., TREM2 -Deficient Microglia Attenuate Tau Spreading In Vivo. Cells. 2023, 10;12(12): 1597). Briefly, seven-week-old C56B1 female mice were anesthetized with isoflurane, and 40 pg of siRNA was bilaterally injected at the following stereotaxic coordinates relative to bregma: ±1.0 mm mediolateral, -0.5 mm anteroposterior, and -2.3 mm dorsoventral. Two weeks after injection, brain tissue was harvested for RNA isolation and subsequent analysis by RT-qPCR and RNA sequencing.
[0331] Fig. 10 shows Bassoon levels are reduced in iPSC-derived human neurons following siRNA knockdown. iPSC-derived human neurons (30 DIV) were treated for 72 hours with either scramble (EXAMPLE 6F) or siRNA targeting BSN (EXAMPLE 6D). Fig. 10A. representative immunofluorescence images showing dendrites stained for the pre-synaptic protein Synpatophysin and BSN. EXAMPLE 6D, but not EXAMPLE 6F significantly reduced BSN staining. Scale Bar: 5pm. Fig 10B. shows significant knockdown of BSN relative to total Synaptophysin area (%). Statistical significance was determined using a tow-tailed t-test on 10-11 fields per condition (from 2 wells per conditions). Data are presented as mean ± SEM.
[0332] Fig. 11 shows BSN mRNA levels were reduced in the cortex of C56B1 mice injected with BSN siRNA targeting exon 5 (EXAMPLE 6D), but not in those injected with BSN siRNA targeting exon 3 (EXAMPLE 6B). No decrease in BSN was observed in animals treated with scramble siRNA (EXAMPLE 6F). A similar decrease in BSN mRNA was observed in the hippocampus of mice treated with EXAMPLE 6D, but not with EXAMPLE 6B. No significant changes in BSN mRNA levels were observed in the cerebellum across any of the groups.Taft Ref. :IUIC-00190
[0333] Fig. 12 shows bulk RNA-seq analysis of mice injected with scramble siRNA (EXAMPLE 6F) or BSN targeting siRNA (EXAMPLE 6D). Fig. 12A. shows at-SNE plot showing clear group separation between treatment conditions. Fig. 12B. shows a volcano plot highlighting significant downregulation of BSN. Fig. 12C shows quantification of BSN downregulation shown by raw counts, normalized abundance (counts), and log2-transformed abundance. All data were normalized prior to analysis.
[0334] While embodiments of the present disclosure have been described herein, it is to be understood by those skilled in the art that such embodiments are provided by way of example only. Numerous variations, changes, and substitutions will now occur to those skilled in the art without departing from the invention. It should be understood that various alternatives to the embodiments of the invention described herein may be employed in practicing the invention. It is intended that the following claims define the scope of the invention and that methods and structures within the scope of these claims and their equivalents be covered thereby.INCORPORATION BY REFERENCE
[0335] All U.S. patents and published patent applications, foreign patents and published patent applications, and non-patent literature referenced in the present disclosure are expressly incorporated by reference herein in their entireties.
Claims
Taft Ref. :IUIC-00190CLAIMS1. A double-stranded ribonucleic acid (dsRNA) molecule for inhibiting the expression of BSN in a cell, wherein said dsRNA comprises a sense strand and an antisense strand forming a duplex structure less than 30 nucleotides in length; each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to part of an mRNA encoding BSN to mediate RNA interference and wherein the sense strand comprises a sequence having at least 90% identity to a sequence selected from the group consisting of the sequences provided in Table 1, Table 2, Table 2a or Table 3.
2. The dsRNA molecule of claim 1, wherein the sequence identity is at least 95%.
3. The dsRNA molecule of claim 1, wherein the sequence identity is at least 99%.
4. An RNAi molecule that binds to nucleic acid encoding BSN to reduce expression of Bassoon in a cell, the siRNA comprising a sense strand and an antisense strand, wherein the sense strand comprises 15 to 30 consecutive nucleotide bases of a sequence selected from the group consisting of SEQ ID NOs.: 12-203 and the antisense strand is 15 to 30 nucleotides in length.
5. A double stranded RNA comprising 15-30 consecutive nucleotide bases of a) a sense strand of any one of SEQ ID Nos.: 12-203 and 15-30 consecutive nucleotide bases of b) an antisense strand of any one SEQ ID.
6. A double stranded RNA comprising a) a sense strand of any one of SEQ ID No.: 12-203, and b) an antisense strand of any one SEQ ID No.: 204-395.
7. The molecule of any one of claims 1-6, wherein the antisense strand and the sense strand are each 19 to 25 nucleotides in length, or the antisense strand and the sense strand are each 21 to 23 nucleotides in length.
8. The molecule of any one of claims 1-6 wherein the RNAi molecule comprises a single stranded overhang of at least one of the termini, e.g., an overhang of 1, 2, or 3 nucleotides in length.Taft Ref. :IUIC-001909. The molecule of any one of claims 1-8, wherein the sense strand is 21 nucleotides in length and the antisense strand is 23 nucleotides in length, wherein the strands form a double stranded region of 21 consecutive base pairs having a 2 nucleotide long single strand overhang at the 3' end.
10. The molecule of any one of claims 1-9, wherein the sense strand is 19 nucleotides in length and the antisense strand is 21 nucleotides in length, wherein the strands form a double stranded region of 19 consecutive base pairs having a 2 nucleotide long single strand overhang at the 3' end.
11. The molecule of any one of claims 1-10, wherein the sense and antisense sequences are on different or the same RNA strands.
12. The molecule of any of claims 1-11, wherein the molecule is a shRNA.
13. The molecule of any of claims 1-12, wherein the molecule is siRNA.
14. The molecule of any of claims 1-13, wherein at one or more positions on the sense strand or the antisense strand, one or more nucleobases is substituted for a modified nucleobase, and / or one or more phosphodiester backbone moieties is substituted for a modified backbone moiety.
15. The molecule of claim 14, wherein the modified nucleobases are selected from any of: 2'-O-methoxy nucleobase, 2'-deoxy nucleobase, 2'-allyl nucleobase, 2'-fluoro nucleobase, 2'-lipid-conjugated nucleobase, and 5'-(E)-vinylphosphonate nucleobase.
16. The molecule of claim 14 or 15, wherein the modified backbone moiety comprises at least one phosphorothioate or methylphosphonate intemucleotide linkage.
17. The molecule of claim 16, wherein the phosphorothioate or methylphosphonate intemucleotide linkage is at the 3'-terminus of one strand. ‘-terminus of one strand.Taft Ref. :IUIC-0019018. The molecule of any one of claims 1-17, wherein said antisense strand comprises one or both of the following characteristics: (i) 2, 3, 4, 5 or 62'-fluoro modifications; and (ii) 1, 2, 3, 4 or 5 phosphorothioate intemucleotide linkages, and optionally comprises at least one thermally destabilizing modification of the molecule within the first 9 nucleotide positions of the 5' region of the antisense strand or a precursor thereof; and said sense strand comprises one, two or three of the following characteristics: (i) a) one or more lipophilic moieties each conjugated to a nucleotide optionally through a linker ; (ii) 2, 3, 4, or 52'-fluoro modifications; and (iii) 1, 2, 3, 4 or 5 phosphorothioate intemucleotide linkages.
19. The molecule of any one of claims 1-18, wherein the sense strand is conjugated to at least one ligand.
20. The molecule of claim 19 wherein the ligand is one or more GalNAc derivatives attached through a bivalent or trivalent branched linker.
21. The molecule of claim 19 or 20, wherein the ligand is attached to the 3' end of the sense strand.’ end of the sense strand.
22. The molecule any one of claims 1-21, wherein the molecule further comprises a phosphate or a phosphate mimic at the 5' end of the antisense strand.
23. The molecule of claim 22, wherein the phosphate mimic is a 5' vinyl phosphate.
24. The molecule of any one of claims 18-23 wherein the one or more lipophilic moieties are conjugated to one or more of positions 4-8 and 13-18 on the sense strand and positions 6-10 and 18 on the antisense strand, counting from the 5' end of each strand.
25. The molecule of claim 24, wherein the 2'-lipid-conjugated nucleobase comprises a nucleobases having conjugated to the 2' position a lipid group comprising 4 to 40 carbon atoms, wherein the lipid group is substituted, unsubstituted, saturated, and / or unsaturated.Taft Ref. :IUIC-0019026. The molecule of claim 24 wherein the 2'-lipid-conjugated nucleobase comprises a nucleobase having conjugated to the 2' position a lipid group comprising 10 to 20 carbon atoms, wherein the lipid group is substituted, unsubstituted, saturated, and / or unsaturated.
27. The molecule of claim 24 wherein the 2'-lipid-conjugated nucleobase comprises a nucleobases having conjugated to the 2' position a lipid group comprising 12 to 18 carbon atoms, wherein the lipid group is substituted, unsubstituted, saturated, and / or unsaturated.
28. The molecule of claim 24 wherein the 2'-lipid-conjugated nucleobase comprises a nucleobases having conjugated to the 2' position a lipid group that is a saturated or unsaturated Ci6 hydrocarbon chain group.
29. The molecule of any one of claims 18-29, wherein the lipid moiety is conjugated to the molecule via a chemical linker.
30. The molecule of any of claims 1-29, wherein at least 25%, at least 50%, at least 75% or at least 90% of total nucleobases of the molecule are modified nucleobases.
31. The molecule of any one of claims 1-30, wherein the sense strand has 4 to 12 asymmetrical 2'-O-alkyl modifications, at least 4 of which occur at the 4 terminal nucleotides of the 3' end, and an antisense sequence having at least 4 asymmetrical phosphorothioate modifications.
32. The molecule of any one of claims 1-31, wherein the sense strand has 5 to 10 asymmetrical 2'-O-alkyl modifications, at least 4 of which occur at the 4 terminal nucleotides of the 3' end, and an antisense sequence having at least 5 asymmetrical phosphorothioate modifications.
33. The molecule of any one of claims 1-32 wherein the sense strand has 62'-O-alkyl modifications at the 6 terminal nucleotides of the 5' end.
34. The molecule of any one of claims 31-33, wherein the 2'-O-alkyl modification is 2'-O-methyl.Taft Ref. :IUIC-0019035. The molecule of any one of claims 1-33, wherein at least four phosphodiester moieties of the sense strand are substituted with a phosphorothioate moiety, and wherein at least four phosphodiester moieties of the antisense strand are substituted with a phosphorothioate moiety.
36. The molecule of any of claims 1-35, wherein:the sense strand consists of 21 nucleobases, the nucleobases of the sense strand modified according to the pattern:the antisense strand consists of 23 nucleobases, the nucleobases of the antisense strand modified according to the pattern:5'- M*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each strand,M = a 2'-O-methoxy nucleobase, andF = a 2'-fluoro nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
37. The composition of any of claims 1-35, wherein:the sense strand consists of 21 nucleobases, the nucleobases of the sense strand modified according to the pattern:5'- M*M*MMM(Ci6)FMFFFMMMMMMMM*M*M -3' ; andthe antisense strand consists of 23 nucleobases, the nucleobases of the antisense strand modified according to the pattern:5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each strand,M = a 2'-O-methoxy nucleobase,F = a 2'-fhioro nucleobase,(Cis) = a 2'-Ci6-conjugated nucleobase, and(VP) = a 5'-(E)-vinylphosphonate nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.Taft Ref. :IUIC-0019038. A double stranded RNA therapeutic comprising a sense strand and an antisense strand each chosen from the sense and antisense strands shown in Table 2.
39. A double stranded RNA therapeutic comprising a sense strand and an antisense strand, each chosen from the sense and antisense strands shown in Table 3.
40. A double stranded RNA therapeutic comprising a sense strand and an antisense strand, as shown in Table 441. A cell comprising the molecule of any one of claims 1-40.
42. The molecule of any one of claims 1-39, wherein said molecule, upon contact with a cell, inhibits expression of BSN by at least 20%, at least 40%, or at least 60%.
43. A therapeutic for the treatment, control, and / or prevention of neurodegenerative disease in a subject in need thereof comprising an siRNA comprising a sense strand comprising 21 nucleobases and an antisense strand complementary to the sense strand, the antisense strand comprising 23 nucleobases, wherein the sense strand and antisense strand form a doublestranded region at least 21 consecutive nucleobase pairs in length, and having a single-stranded overhang at the 3' end of the antisense strand which is at least 2 nucleobases long;wherein the sense strand sequence spanning the double-stranded region of the siRNA comprises at least 21 consecutive bases of a sequence selected from the group consisting of SEQ ID NOs. 12-203;wherein at least one nucleobase is a non-natural nucleobase,wherein the non-natural nucleobase is selected from any of: a 2'-O-methoxy nucleobase, a 2'-fluoro nucleobase, a 2'-Ci2-i8-lipid-conjugated nucleobase, and a 5'-(E)-vinylphosphonate nucleobase; andwherein at least one phosphodiester moiety of the siRNA is substituted with a phosphorothioate moiety.
44. A pharmaceutical composition comprising a molecule of any one of claims 1-43 and a pharmaceutically acceptable excipient.Taft Ref. :IUIC-0019045. The composition of claim 44, wherein the pharmaceutically acceptable excipient is selected from the group consisting of adjuvant, pH buffer, antioxidant, preservative, salt, pH modulator, solvent, chelation agent, emulsifier, antimicrobial agent, or any combination thereof.
46. A method of treating, controlling, and / or preventing a tauopathy in a brain cell or nerve cell comprising administering to the cell an effective amount of the molecule or composition of any of claims 1-45.
47. A method of treating, controlling, and / or preventing a tauopathy in a patient in need thereof, the method comprising administering to the patient a therapeutically effective amount of the molecule or composition of any one of claims 1-45.
48. A method of treating and / or ameliorating symptoms in a patient suffering from a neurodegenerative disease and in need of treatment, comprising administering to the patient a therapeutically effective among of an molecule of claims 1-45, wherein the neurodegenerative disease is selected from the group consisting of:Alzheimer’s Disease, Progressive Supranuclear Palsy, Chronic Traumatic Encephalopathy, Corticobasal Degeneration, FTD (e.g., frontotemporal dementia with parkinsonism), Pick's Disease, and Primary Age Related Tauopathy.
49. A method of treating and / or ameliorating symptoms in a patient suffering from a disorder and in need of treatment, comprising administering to the patient a therapeutically effective of a molecule of claims 1-45, wherein the disorder is from the group consisting of:Agyrophyllic grain disease, Vacuolar tauopathy, Lytico-bodig disease, Ganglioglioma, Gangliocytoma, Mengioangiomatosis, Postencephalitic Parkinsonism, Traumatic Brain Injury, MAPT associated disease, Subacute Sclerosing Panencephalitis, Lead Encephalopathy, Tuberous Sclerosis, Pantothenate Kinase-associated Neurodegeneration, Lipofuscinosis or Parkinsonism associated with tau deposition.
50. Use of the molecule of any of claims 1-45 in the manufacture of a medicament for the treatment of a neurodegenerative disease.Taft Ref. :IUIC-0019051. A kit comprising:the molecule or composition of any of claims 1-45;a container; andinstructions providing information on how to administer the composition and / or therapeutic to a subject in need thereof.
52. A double-stranded RNA duplex capable of downregulating BSN mRNA concentration in a cell.
53. The double-stranded RNA duplex of claim 1, wherein a 20nM concentration dose of the double-stranded RNA duplex results in a cellular BSN mRNA concentration of 55% to 75% of baseline concentration.
54. The double-stranded RNA duplex of claim 52 or claim 53, wherein the duplex forms part of an siRNA or a shRNA, the duplex comprising a sense strand portion and an antisense strand portion.
55. The double-stranded RNA duplex of claim 54, wherein the sense strand portion comprises a sequence having at least 90% identity to a sequence selected from SEQ ID Nos.: 12-203.
56. The double-stranded RNA duplex of claim 54, wherein the antisense strand portion comprises a sequence having at least 90% identity to a sequence selected from SEQ ID Nos.: 204-395.
57. The double-stranded RNA duplex of claim 54, wherein the sense strand portion comprises a sequence selected from SEQ ID Nos.: 12-203, and the antisense strand portion comprises a sequence selected from SEQ ID Nos.: 204-395, and wherein the sense strand portion is complementary to the antisense strand portion.
58. The double-stranded RNA duplex of any of claims 52-57, wherein one or more nucleotides is a modified nucleotide.Taft Ref. :IUIC-0019059. The double-stranded RNA duplex of any of claims 52-58, wherein the sense strand portion comprises a span of 21 consecutive modified nucleobases according to the pattern:wherein, independently at each individual position on each strand,M = a 2'-0-methoxy nucleobase, andF = a 2'-fluoro nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
60. The double-stranded RNA duplex of any of claims 52-59, wherein the antisense strand portion comprises 23 consecutive modified nucleobases according to the pattern: 5'- M*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each strand,M = a 2'-O-methoxy nucleobase, andF = a 2'-fluoro nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
61. The double-stranded RNA duplex of any of claims 52-59, wherein the sense strand portion comprises a span of 21 consecutive modified nucleobases according to the pattern: 5'- M*M*MMM(C16)FMFFFMMMMMMMM*M*M -3'wherein, independently at each individual position on each strand,M = a 2'-0-methoxy nucleobase,F = a 2'-fluoro nucleobase,(Cie) = a 2'-Ci6-conjugated nucleobase, and(VP) = a 5'-(E)-vinylphosphonate nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
62. The double-stranded RNA duplex of any of claims 52-59, wherein the antisense strand portion comprises a span of 23 consecutive modified nucleobases according to the pattern: 5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each strand,Taft Ref. :IUIC-00190M = a 2'-O-methoxy nucleobase,F = a 2'-fluoro nucleobase,(Cie) = a 2'-Ci6-conjugated nucleobase, and(VP) = a 5'-(E)-vinylphosphonate nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
63. The double-stranded RNA duplex of any of claims 52-59, further comprising a hairpin loop linking the sense strand and antisense strand.
64. A cell comprising the double-stranded RNA duplex of any of claims 52-63.
65. A therapeutic composition comprising the double -stranded RNA duplex of any of claims 52-63, and a pharmaceutically acceptable excipient.
66. The composition of claim 65, wherein the pharmaceutically acceptable excipient is selected from the group consisting of adjuvant, pH buffer, antioxidant, preservative, salt, pH modulator, solvent, chelation agent, emulsifier, antimicrobial agent, or any combination thereof.
67. An RNAi molecule for the inhibition of expression of human BSN, the molecule comprising a sense sequence comprising the sequence of SEQ ID No. 12 or 13, and an antisense sequence comprising the sequence of SEQ ID No. 204 or 205.
68. The RNAi molecule of claim 67, wherein the RNAi molecule is an siRNA.
69. The RNAi molecule of claim 67, wherein the RNAi molecule is an shRNA.
70. The RNAi molecule of any of claims 67-69, wherein the sense sequence comprises a span of 21 consecutive modified nucleobases according to the pattern:5'- M*M*MMMMFMFFFMMMMMMMM*M*M- 3' ; andwherein the antisense sequence comprises a span of 23 consecutive modified nucleobases according to the pattern:Taft Ref. :IUIC-001905'- M*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each sequence,M = a 2'-0-methoxy nucleobase, andF = a 2'-fluoro nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
71. The RNAi molecule of any of claims 67-69, wherein the sense sequence comprises a span of 21 consecutive modified nucleobases according to the pattern:5'- M*M*MMM(CI6)FMFFFMMMMMMMM*M*M -3'; andwherein the antisense sequence comprises a span of 23 consecutive modified nucleobases according to the pattern:5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each sequence,M = a 2'-0-methoxy nucleobase,F = a 2'-fluoro nucleobase,(Cis) = a 2'-Ci6-conjugated nucleobase, and(VP) = a 5'-(E)-vinylphosphonate nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
72. An siRNA for inhibiting human BSN comprising a sense strand comprising the nucleotide sequence of SEQ ID No. 12 and an antisense strand comprising the nucleotide sequence of SEQ ID No. 204, the sense strand comprising a span of 21 consecutive modified nucleobases according to the pattern:5'- M*M*MMM(Ci6)FMFFFMMMMMMMM*M*M -3'; andthe antisense strand comprising a span of 23 consecutive modified nucleobases according to the pattern:5'- (VP)*F*MMMFMFFMMMMFMFMMMMM*M*M -3'wherein, independently at each individual position on each sequence,M = a 2'-0-methoxy nucleobase,F = a 2'-fluoro nucleobase,(Cis) = a 2'-Ci6-conjugated nucleobase, andTaft Ref. :IUIC-00190(VP) = a 5'-(E)-vinylphosphonate nucleobase; andwherein the * symbol represents a phosphodiester moiety linking two adjacent nucleobases at the indicated positions along the strand that is substituted with a phosphorothioate moiety.
73. Use of the molecule of any of claims 1-42 in the manufacture of a medicament for the treatment of a neurodegenerative disease.
74. Use of the therapeutic of claim 43 or the composition of claim 44 in the manufacture of a medicament for the treatment of a neurodegenerative disease.
75. A kit comprising :The double-stranded RNA duplex of any of claims 52-63a container; andinstructions providing information on how to administer the RNA and / or therapeutic composition to a subject in need thereof.
76. A synthetic RNA molecule having at least 99% sequence identity to a sequence selected from SEQ ID NO: 442 to 863.
77. A double-stranded ribonucleic acid ( dsRNA) molecule for inhibiting the expression of BSN in a cell, wherein said dsRNA comprises a sense strand and an antisense strand forming a duplex structure less than 30 nucleotides in length; each strand having 14 to 40 nucleotides, wherein the antisense strand has sufficient complementarity to part of an mRNA encoding BSN to mediate RNA interference and wherein the sense strand comprises a sequence having at least 90% identity to a sequence selected from the group consisting of the sequences provided in Table 5a, Table 5b, or Table 6.
78. An RNAi molecule that binds to nucleic acid encoding BSN to reduce expression of Bassoon in a cell, the siRNA comprising a sense strand and an antisense strand, wherein the sense strand comprises 15 to 30 consecutive nucleotide bases of a sequence selected from the group consisting of SEQ ID Nos.: 396-433 and the antisense strand is 15 to 30 nucleotides in length.Taft Ref. :IUIC-0019079. A double stranded RNA comprising 15-30 consecutive nucleotide bases of a) a sense strand of any one of SEQ ID Nos.: 396-433 and 15-30 consecutive nucleotide bases of b) an antisense strand of any one SEQ ID.
80. A double stranded RNA comprising a) a sense strand of any one of SEQ ID No.: 396-414, and b) an antisense strand of any one SEQ ID No.: 415-433.
81. A therapeutic for the treatment, control, and / or prevention of neurodegenerative disease in a subject in need thereof comprising an siRNA comprising a sense strand comprising 21 nucleobases and an antisense strand complementary to the sense strand, the antisense strand comprising 23 nucleobases, wherein the sense strand and antisense strand form a doublestranded region at least 21 consecutive nucleobase pairs in length, and having a single-stranded overhang at the 3' end of the antisense strand which is at least 2 nucleobases long; wherein the sense strand sequence spanning the double-stranded region of the siRNA comprises at least 21 consecutive bases of a sequence selected from the group consisting of SEQ ID NOs. 396-414; wherein at least one nucleobase is a non-natural nucleobase, wherein the non-natural nucleobase is selected from any of: a 2'-O-methoxy nucleobase, a 2'-fluoro nucleobase, a 2'-C12-lS-lipid-conjugated nucleobase, and a 5'-(E)-vinylphosphonate nucleobase; and wherein at least one phosphodiester moiety of the siRNA is substituted with a phosphorothioate moiety.
82. The double-stranded RNA duplex of claim 81, wherein the sense strand portion comprises a sequence having at least 90% identity to a sequence selected from SEQ ID Nos.: 396-414.
83. The double-stranded RNA duplex of claim 81, wherein the antisense strand portion comprises a sequence having at least 90% identity to a sequence selected from SEQ ID Nos.: 406-433.
84. The double-stranded RNA duplex of claim 81, wherein the sense strand portion comprises a sequence selected from SEQ ID Nos.: 396-414, and the antisense strand portion comprises a sequence selected from SEQ ID Nos.: 406-433, and wherein the sense strand portion is complementary to the antisense strand portion.Taft Ref. :IUIC-0019085. An RNAi molecule that binds to nucleic acid encoding BSN to reduce expression of Bassoon in a cell, the siRNA comprising a sense strand and an antisense strand, wherein the sense strand and the antisense strand each comprise 15 to 30 consecutive nucleotide bases of a sequence selected from the group consisting of SEQ ID Nos.: 442-863.
86. A double stranded RNA comprising a) a sense strand of any one of SEQ ID No.: 12-203, 396-414, 442-633, or 826-844 and b) an antisense strand of any one SEQ ID No.: 204-395, 415-433, 634-825, or 845-863.