Antibodies binding to HCV e2

Abstract

Disclosed is an antibody or antigen-binding fragment thereof, which binds to HCV E2, and therapeutic and diagnostic uses thereof.

Description

[0001] IMPROVED POLYPEPTIDE

[0002] Technical Field

[0003] The present invention relates to compositions derived from immunoglobulin 5 molecules specific for the hepatitis C virus (HCV). More particularly, the invention is related to recombinant human monoclonal antibodies which are capable of specifically binding with HCV E2 antigen, and to therapeutic and diagnostic uses thereof.

[0004] 0

[0005] Background

[0006] Hepatitis C virus (HCV) was discovered in 1989 and is a member of hepacivirus genus within the Flaviviridae family (Choo et al., 1989). It infects the human liver and is currently estimated to be carried by approx. 50 million people, down from 170 5 million before effective drugs became available. It is carried in the human population as a chronic infection most often without clear symptoms. If untreated, the chronic infection often results in serious liver disease including cirrhosis and hepatocellular cancer; 1 million deaths yearly are now estimated to be due to HCV infection. Taken together, despite the advent of effective cure (anti-viral drugs), HCV 0 remains a global health problem (WHO 2024).

[0007] Virus genome replication is error-prone, and this, combined with high virus turnover, generates extensive genetic variability, both within an infected individual, where the virus exists as a swarm of genetically related but distinct viruses called a 5 quasispecies (Weiner et al, 1991). The great diversity has also led to the development globally of very varied genetical groups, or genotypes. Thus, the virus can be grouped into eight major genotypes that differ by up to 30% at the nucleotide level (Bukh et al., 1993; Simmonds et al., 1993; Simmonds et al., 2005, Vo-Quang & Pawlotsky, 2024). Among the most variable parts of the virus are the 0 two envelope proteins, El and E2, where hypervariable parts have been identified.Current therapy, antiviral drugs inhibiting the virus protease, polymerase or helicase and given separately or in combination, are very effective with a curing rate of 93-96% after daily dosing for 12 weeks. Still, viral strains resistant to these effective drugs continues to be identified (WHO 2024).

[0008] Based on the success of robust diagnostics and curative drugs, WHO have announced that HCV should be eradicated by 2030. But even with effective drugs for the infected, new infections occur daily and are estimated to approx. 1,5 million newly infected per annum (WHO 2024). A possibility to offer protection for large parts of the uninfected population via a vaccine, is therefore thought to considerably improve the chances to eradicate the virus. Despite substantial efforts, no effective vaccine has yet been developed for human use (Page et al., NEJM2021; Bukh, Gastroenterology 2022).

[0009] Other protective approaches have therefore been discussed but present a considerable challenge due to the variability of the virus. Antibodies with a capcity to inhibit the infection - even of different strains and genotypes - have been discussed as a possible protective measure in lack of effective vaccines (Salas et al., 2022).

[0010] WO9740176A1 discloses the discovery of human monoclonal antibody molecules which exhibit immunological binding affinity for HCV E2 polypeptide antigen, and which are cross-reactive against different HCV strains and that exhibits immunological binding affinity for HCV E2 antigen. For example, an antibody denoted 1:7 was isolated and characterized.

[0011] While the antibody 1:7 benefits from good binding affinity for HCV E2 antigen and broad neutralizing reactivity to different HCV strains of different genotypes, there is still a need in the art to obtain improved binders, preferably against regions conserved among the different genotypes.Summary of the invention

[0012] It is an object of the present invention to provide antibodies or fragments thereof that reduce or at least partly overcome challenges in the prior art.

[0013] It is an object of the present invention to provide novel antibodies or fragments 5 thereof that exhibits immunological binding affinity for HCV E2 antigen.

[0014] Another object of the present disclosure is to provide such antibodies that can bind to the HCV E2 antigen of different genotypes ("subgroups") of HCV, conferring broad neutralization capacity, i.e. block the infectivity of the virus to different HCV genotypes.

[0015] 0 Yet another object of the present disclosure is to improve the antiviral effects of an antibody or an antigen-binding fragment thereof having binding affinity for a hepatitis C virus (HCV) E2 antigen.

[0016] Yet another object of the present disclosure is to provide an antibody or antigenbinding fragment thereof that is able to protect a human subject from chronic 5 infections of HCV despite having been submtted to conact with the virus. In this regard, the present disclosure propose that the mentioned anti-E2 antibody can be mutated in tis Fc-portion to allow altered pharmacokinetics by extending the halflife of the antibody molecule.

[0017] Another object of theh present disclosure is to reduce the infection of HCV in a 0 subject.

[0018] In additon, an object of the present disclosure is provide antibodies or fragments which may exhibits immunological binding to the HCV protein E2 on the outer surface of a HCV infected cell. Such binding may in turn allow cells of the body's defence system to phagocytize such infected cells, or destroy such cells the by 5 acivating the bodys' complement system.

[0019] One or more of these objects, and other objects that are apparent to the skilled person from reading the entire disclosure, are met by the various aspects disclosed. Thus, in a first aspect In an first aspect, there is provided an antibody or an antigen- 0 binding fragment thereof, having binding affinity for a hepatitis C virus (HCV) E2 antigen. The antibody of antigen-binding fragment thereof comprises an immunoglobulin heavy chain variable region (VH) and an immunoglobulin light chain variable region (VL). The VH and VL regions form a VH / VL pair comprising anantigen-binding surface, in which said antigen-binding surface comprises three complementarity-determining regions (CDRs) from said VH region and three CDRs from said VL region. In the VH and VL regions, respectively, the CDRs comprises or consist the following:

[0020] VL-CDR1: RAX1QX2X3X4X5X6X7LX8 (SEQ ID NO:1) wherein

[0021] Xi is selected from S and N;

[0022] X2 is selected from S and T;

[0023] X3 is selected from V, G and I;

[0024] X4 is selected from S, G, D, I and T;

[0025] X5 is selected from N and S;

[0026] Xe is selected from Y, N and D;

[0027] X7 is selected from S or is absent; and

[0028] Xs is selected from A and N;

[0029] VL-CDR2: X9X10SX11X12X13X14 (SEQ ID NO:2) wherein

[0030] X9 is selected from D, V and A;

[0031] X10 is selected from A and T;

[0032] Xu is selected from N, K, T and S;

[0033] X12 is selected from R, I and L;

[0034] X13 is selected from A and Q;

[0035] X14 is selected from A, T and S;

[0036] VL-CDR3: QQX15X16X17X18X19X20T (SEQ ID NO:3)

[0037] wherein

[0038] X15 is selected from R, Y, N and F;

[0039] Xie is selected from A, S, N, G and Y;

[0040] X17 is selected from K, D, N and T;

[0041] Xis is selected from W, R, G, S and T;

[0042] X19 is selected from S, P, I, N, T and V; and

[0043] X20 is selected from W, H or is absent;VH-CDR1: RYTIQ (SEQ ID NO:4)

[0044] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5).

[0045] In one embodiment, the antigen-binding surface is further comprising VH-CDR3, said VH-CDR3 comprises or consists of:

[0046] VH-CDR3: VVIPX21X22X23X24HX25X26GX27YFDY (SEQ ID NO:6) wherein

[0047] X21 is selected from N, K, R, A and T;

[0048] X22 is selected from S, T, A, E and Q;

[0049] X23 is selected from I and L;

[0050] X24 is selected from R, W and S;

[0051] X25 is selected from T and S;

[0052] X26 is selected from R, M and A; and

[0053] X27 is selected from F and Y.

[0054] In an effort to generate improved anti-HCV antibodies from clone 1:7, the present inventors have surprisingly found novel antibodies or fragment thereof as described below. The inventors show herein that these antibodies and fragments thereof may prove useful anti-HCV antibodies and / or in therapeutic treatment of HCV. The inventors demonstrate that these compounds benefit from high binding affinity and / or broad neutralization capacity.

[0055] In one embodiment, the antigen-binding surface is further comprising VH-CDR3, said VH-CDR3 comprises or consists of:

[0056] VH-CDR3: VVIPX21X22X23X24HX25X26GX27YFDY (SEQ ID NO:6) wherein

[0057] X21 is selected from N, K, R, and T;

[0058] X22 is selected from S, T, A, E and Q;

[0059] X23 is selected from I and L;X74is selected from R, W and S;

[0060] X25 is selected from T and S;

[0061] X26 is selected from R, M and A; and

[0062] X27 is selected from F and Y.

[0063] In one embodiment, the CDRs comprise the following:

[0064] VL-CDR1: RASQSVX4X5X6LA (SEQ ID NO:7) wherein

[0065] X4is selected from S, G and D;

[0066] Xs is selected from N and S; and

[0067] Xe is selected from Y and N;

[0068] VL-CDR2: DASX11RAX14 (SEQ ID NO:8) wherein

[0069] Xu is selected from N, K and T; and

[0070] Xi4is selected from A, T and S;

[0071] VL-CDR3: QQRXi6Xi7Xi8Xi9T (SEQ ID NO:9) wherein

[0072] Xie is selected from A, S and N;

[0073] X17 is selected from K, D, N and T;

[0074] Xis is selected from W and R; and

[0075] X19 is selected from S, P and N;

[0076] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0077] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5).

[0078] In one embodiment, the antigen-binding surface is further comprising VH-CDR3, said VH-CDR3 comprises or consists of:

[0079] VH-CDR3: VVIPX21X22IRHX25MGYYFDY (SEQ ID NO:10) whereinX23 is selected from N, R, A and K;

[0080] X24 is selected from A and E;

[0081] X27 is selected from T and S.

[0082] This is a preferred embodiment, and it is an antibody or antigen-binding fragment thereof according to this embodiment may benefit from superior neutralization capacity. This is illustrated in example 3, see for example table 16.

[0083] In one embodiment, the antigen-binding surface is further comprising VH-CDR3, said VH-CDR3 comprises or consists of:

[0084] VH-CDR3: VVIPX21X22IRHX27MGYYFDY (SEQID NQ:10) wherein

[0085] X23 is selected from N, R, and K;

[0086] X24 is selected from A and E;

[0087] X27 is selected from T and S.

[0088] In one embodiment, the VH-CDR3 comprises or consists of:

[0089] VH-CDR3: VVIPX1X2IRHTMGYYFDY (SEQ ID NO:123) wherein

[0090] Xi is selected from N, R, K and A; and

[0091] X2 is selected from A and R.

[0092] In one embodiment, the antigen-binding surface is further comprising VH-CDR3, said VH-CDR3 comprises or consists of a sequence selected from the group consisting of SEQ ID NO: 41-53 and 92. VH-CDR3 comprises or consists of a sequence, which sequence is one of SEQ ID NO: 41-53 or 92.

[0093] In one embodiment, VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0094] VL-CDR1: RASQSVSSYLA (SEQID NO:11)

[0095] VL-CDR2: DASKRAT (SEQID NO:21)

[0096] VL-CDR3: QQRSDRPT (SEQ ID NO:31).

[0097] In one embodiment, VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:VL-CDR1: RASQSVGSYLA (SEQ ID NO:12) VL-CDR2: DASNRAT (SEQ ID NO:22) VL-CDR3: QQRSNWIT (SEQ ID NO:32)

[0098] In one embodiment, VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0099] VL-CDR1: RASQSVGSYLA (SEQ ID NO:12) VL-CDR2: DASNRAT (SEQ ID NO:22) VL-CDR3: QQRSNWNT (SEQ ID NO:33).

[0100] In one embodiment, VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0101] VL-CDR1: RASQSVSSYLA (SEQ ID NO:11) VL-CDR2: DASNRAT (SEQ ID NO:22) VL-CDR3: QQRSDGTT (SEQ ID NO:34).

[0102] In one embodiment, VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0103] VL-CDR1: RASQSVSNYLA (SEQ ID NO:15) VL-CDR2: DASNRAA (SEQ ID NO:25) VL-CDR3: QQRAKWST (SEQ ID NO:35).

[0104] In one embodiment, VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0105] VL-CDR1: RASQSVDNYLA (SEQ ID NO:16) VL-CDR2: DASNRAS (SEQ ID NO:26) VL-CDR3: QQRNKWST (SEQ ID NO:36).

[0106] In one embodiment, VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0107] VL-CDR1: RASQSVSNNLA (SEQ ID NO:17) VL-CDR2: DASTRAA (SEQ ID NO:27) VL-CDR3: QQRNTWNT (SEQ ID NO:37).In one embodiment, VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0108] VL-CDR1: RASQSGISDLA (SEQ ID NO:18)

[0109] VL-CDR2: AASTLQS (SEQ ID NO:28)

[0110] VL-CDR3: QQFNTWVT (SEQ ID NO:38).

[0111] In one embodiment, VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0112] VL-CDR1: RASQSVSSNSLA (SEQ ID NO:19)

[0113] VL-CDR2: VTSSRAT (SEQ ID NO:29)

[0114] VL-CDR3: QQYGNSPWT (SEQ ID NO:39).

[0115] In one embodiment, VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0116] VL-CDR1: RANQTITNYLN (SEQ ID NQ:20)

[0117] VL-CDR2: AASSLQS (SEQ ID NQ:30)

[0118] VL-CDR3: QQNYNTPHT (SEQ ID NQ:40).

[0119] In one embodiment, the antibody or antigen-binding fragment thereof comprises a heavy chain variable domain and a light chain variable domain, and the light chain variable domain comprises an amino acid sequence selected from

[0120] i) the group consisting of SEQ ID NO:54-63; and

[0121] ii) an amino acid sequence having at least 80 % identity, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, identity to any one of SEQ ID NO:54-63, provided that

[0122] VL-CDR1 comprises an amino acid sequence selected from SEQ ID NO:11-20;

[0123] VL-CDR2 comprises an amino acid sequence selected from SEQ ID NO:21-30; and VL-CDR3 comprises an amino acid sequence selected from SEQ ID NO:31-40.In a related embodiment, the VL amino acid sequence in i) is selected from the group consisting of SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:59 and SEQ ID NQ:60.

[0124] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0125] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0126] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0127] VH-CDR3: VVIPNAIRHTMGYYFDY (SEQ ID NO:41).

[0128] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0129] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0130] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0131] VH-CDR3: VVIPNSIRHTRGFYFDY (SEQ ID NO:42).

[0132] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0133] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0134] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0135] VH-CDR3: VVIPNTLWHTMGYYFDY (SEQ ID NO:43).

[0136] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0137] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0138] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0139] VH-CDR3: VVIPKAISHTAGYYFDY (SEQ ID NO:44).In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0140] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0141] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0142] VH-CDR3: VVIPKEIRHTMGYYFDY (SEQ ID NO:45).

[0143] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0144] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0145] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0146] VH-CDR3: VVIPNEIRHTMGYYFDY (SEQ ID NO:46).

[0147] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0148] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0149] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0150] VH-CDR3: VVIPNQIRHTMGYYFDY (SEQ ID NO:47).

[0151] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0152] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0153] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0154] VH-CDR3: VVIPRTIRHTMGYYFDY (SEQ ID NO:48).

[0155] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0156] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0157] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)VH-CDR3: VVIPNAISHTMGYYFDY (SEQ ID NO:49).

[0158] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0159] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0160] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0161] VH-CDR3: VVIPNAIRHSMGYYFDY (SEQ ID NO:50).

[0162] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0163] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0164] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0165] VH-CDR3: VVIPRAIRHTMGYYFDY (SEQ ID NO:51).

[0166] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0167] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0168] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0169] VH-CDR3: VVIPKAIRHTMGYYFDY (SEQ ID NO:52).

[0170] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 of the antibody or antigenbinding fragment thereof comprises or consist of the following amino acid sequences:

[0171] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0172] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0173] VH-CDR3: VVIPTAIRHTMGYYFDY (SEQ ID NO:53).

[0174] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0175] VH-CDR1: RYTIQ (SEQ ID NO:4)VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0176] VH-CDR3: VVIPAAIRHTMGYYFDY (SEQ ID NO:92).

[0177] In one embodiment, VH-CDR1, VH-CDR2 and VH-CDR3 consist of the following amino acid sequences:

[0178] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0179] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5);

[0180] and VH-CDR3 is selected from the group consisting of:

[0181] VVIPNAIRHTMGYYFDY (SEQ ID NO:41), VVIPNEIRHTMGYYFDY (SEQ ID NO:46), VVIPNAIRHSMGYYFDY (SEQ ID NO:50), VVIPRAIRHTMGYYFDY (SEQ ID NO:51), VVIPKAIRHTMGYYFDY (SEQ ID NO:52), VVIPAAIRHTMGYYFDY (SEQ ID NO:92).

[0182] In one embodiment, VH-CDR3 is selected from the group consisting of:

[0183] VVIPNAIRHTMGYYFDY (SEQ ID NO:41), and VVIPAAIRHTMGYYFDY (SEQ ID NO:92).

[0184] In one embodiment, CDR sequences in an antigen-binding interface comprised in the antibody or antigen-binding fragment thereof of the disclosure are as defined using the Kabat convention, which is well known to a person of skill in the art of antibody technology (see e.g. Kabat (1991), Sequences of Proteins of Immunological Interest, 5th edition, NIH Publication no 91-3242 from the US Department of Health and Human Services).

[0185] In one embodiment, VH is selected from the group consisting of SEQ ID NO: 64-76, or wherein VH is selected from the group consisting of SEQ ID NO: 64, 69, 73, 74, and 75. In one embodiment, VH is selected from the group consisting of SEQ ID NO: 64-76 and 79, or wherein VH is selected from the group consisting of SEQ ID NO: 64, 69, 73, 74, 75 and 79.In one embodiment, VH is selected from the group consisting of

[0186] i) SEQ ID NO: 64, and

[0187] ii) an amino acid sequence having at least 80 %, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, identity to identity to SEQ ID NO:64, provided that VH-CDR1 is SEQ ID NO:4, VH-CDR2 is SEQ ID NO:5 and VH-CDR3 is selected from the group consisting of SEQ ID NO:41-52 and 92.

[0188] In one embodiment, VH is selected from the group consisting of

[0189] i) SEQ ID NO: 79, and

[0190] ii) an amino acid sequence having at least 80 %, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, identity to identity to SEQ ID NO:64, provided that VH-CDR1 is SEQ ID NO:4, VH-CDR2 is SEQ ID NO:5 and VH-CDR3 is selected from the group consisting of SEQ ID NO:41-52 and 92.

[0191] In one embodiment, the heavy chain variable domain is as defined in SEQ ID NO:76 and the light chain variable domain is as defined in any one of SEQ ID NO:54-63. In one embodiment, the heavy chain variable domain is as defined in any one of SEQ ID NO:64-76 and the light chain variable domain is as defined in any one of SEQ ID NO:54-63. In one embodiment, the heavy chain variable domain is as defined in any one of SEQ ID NO:64-76 and 79, and the light chain variable domain is as defined in any one of SEQ ID NO:54-63.

[0192] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0193] a) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and a light chain variable domain comprising SEQ ID NO:54;

[0194] b) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:55;c) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:56;

[0195] d) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:57;

[0196] e) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:58;

[0197] f) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:59;

[0198] g) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:60;

[0199] h) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:61;

[0200] i) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:62;

[0201] j) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:63.

[0202] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0203] a) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:54-63;

[0204] b) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:65 and a light chain variable domain comprising SEQ ID NO:54-63;c) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:66 and a light chain variable domain comprising SEQ ID NO:54-63;

[0205] d) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:67 and a light chain variable domain comprising SEQ ID NO:54-63;

[0206] e) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:68 and a light chain variable domain comprising SEQ ID NO:54-63;

[0207] f) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:59;

[0208] g) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:70 and a light chain variable domain comprising SEQ ID NO:54-63;

[0209] h) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:71 and a light chain variable domain comprising SEQ ID NO:54-63;

[0210] i) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:72 and a light chain variable domain comprising SEQ ID NO:54-63;

[0211] j) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:54-63;

[0212] k) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:54-63;

[0213] l) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:54-63;

[0214] m) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:76 and a light chain variable domain comprising SEQ ID NO:54-63; such as represented by the VH / VL combinations f), j), k) and / or I)n) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:79 and a light chain variable domain comprising SEQ ID NO:54-63; such as represented by the VH / VL combinations f), j), k) and / or I).

[0215] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0216] a) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:54;

[0217] b) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:55;

[0218] c) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:56;

[0219] d) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:57;

[0220] e) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:58;

[0221] f) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:59;

[0222] g) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:60;

[0223] h) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:61;

[0224] i) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:62;

[0225] j) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:63.

[0226] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0227] a) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:54;

[0228] b) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:55;c) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:56;

[0229] d) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:57;

[0230] e) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:58;

[0231] f) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:59;

[0232] g) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:60;

[0233] h) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:61;

[0234] i) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:62;

[0235] j) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:63.

[0236] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0237] a) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:54;

[0238] b) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:55;

[0239] c) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:56;

[0240] d) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:57;

[0241] e) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:58;

[0242] f) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:59;

[0243] g) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NQ:60;h) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:61;

[0244] i) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:62;

[0245] j) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:63.

[0246] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0247] a) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:54;

[0248] b) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:55;

[0249] c) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:56;

[0250] d) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:57;

[0251] e) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:58;

[0252] f) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:59;

[0253] g) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:60;

[0254] h) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:61;

[0255] i) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:62;

[0256] j) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:63.

[0257] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0258] a) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:54;b) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:55;

[0259] c) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:56;

[0260] d) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:57;

[0261] e) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:58;

[0262] f) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:59;

[0263] g) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:60;

[0264] h) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:61;

[0265] i) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:62;

[0266] j) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:63.

[0267] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0268] a) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:54;

[0269] c) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:56;

[0270] e) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:58;

[0271] f) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:59;

[0272] g) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:60.In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0273] a) a heavy chain variable domain comprising SEQ ID NO:79 and a light chain variable domain comprising SEQ ID NO:54;

[0274] c) a heavy chain variable domain comprising SEQ ID NO:79 and a light chain variable domain comprising SEQ ID NO:56;

[0275] e) a heavy chain variable domain comprising SEQ ID NO:79 and a light chain variable domain comprising SEQ ID NO:58;

[0276] f) a heavy chain variable domain comprising SEQ ID NO:79 and a light chain variable domain comprising SEQ ID NO:59;

[0277] g) a heavy chain variable domain comprising SEQ ID NO:79 and a light chain variable domain comprising SEQ ID NO:60.

[0278] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0279] a) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:54;

[0280] c) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:56;

[0281] e) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:58;

[0282] f) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:59;

[0283] g) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:60.

[0284] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0285] a) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:54;

[0286] c) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:56;e) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:58;

[0287] f) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:59;

[0288] g) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:60.

[0289] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0290] a) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:54;

[0291] c) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:56;

[0292] e) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:58;

[0293] f) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:59;

[0294] g) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:60.

[0295] In one embodiment, the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0296] a) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:54;

[0297] c) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:56;

[0298] e) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:58;

[0299] f) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:59;

[0300] g) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:60.In one embodiment, the heavy chain variable domain comprises or consists of SEQ ID NO: 64 and wherein said light chain variable domain comprises or consists of SEQ ID NO: 58. In one embodiment, the heavy chain variable domain is as defined in any one of SEQ ID NO:64, 69, 73, 74, 75 and 79; and said light chain variable domain is as defined in SEQ ID NO:58. In one embodiment, the heavy chain variable domain is as defined in SEQ ID NO:64 or 79. In one embodiment, the heavy chain variable domain consists of SEQ ID NO: 64. In one embodiment, the heavy chain variable domain consists of SEQ ID NO: 79.

[0301] As described above, the VH and VL sequences, when present in the antibody or antigen-binding fragment thereof, are, in certain embodiments, selected from any one of the listed sequences and sequences having at least 70%, such as at least 80%, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity thereto. In some embodiments, the VH and VL sequences, when present in the antibody or antigen-binding fragment thereof, are selected from any one of the listed sequences and sequences having at least 80%, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, such as 100% identity thereto. Non-limiting examples of such specific amino acid sequences are provided herein for the specific antibodies generated and characterized as described in Examples 1-3. It is contemplated that the specific sequence information provided for the generated antibodies enables the skilled person to define combinations and variations of these sequences within the scope of the invention, such as including the combinations and variations afforded by the variation in the general VH and VL sequences provided as SEQ ID NO:54-76. For embodiments wherein the variable domains of the antibodies or antigen-binding fragments are defined by a particular percentage sequence identity to a reference sequence, the VH and / or VL domains retain identical CDR sequences to those present in the reference sequence such that the variation is present only within the framework regions. In specific embodiments, the combinations of VH / VL are those present in the antibodies exemplified in Examples 1 and 3.In one particular embodiment of the antibody or antigen-binding fragment thereof of the disclosure, the antibody or antigen-binding fragment thereof further comprises a heavy chain constant (CH) region. In one embodiment, said CH region comprises or consists of an amino acid sequence represented by SEQ ID NO:121; and an amino acid sequence having at least 70%, such as at least 80%, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, identity to a sequence defined in SEQ ID NO:121. In a specific embodiment, the CH region consists of SEQ ID NO:121. In one particular embodiment of the antibody or antigenbinding fragment thereof of the disclosure, the antibody or antigen-binding fragment thereof further comprises a light chain constant (CL) region. In one embodiment, said CL region comprises or consists of an amino acid sequence represented by SEQ ID NO:122; and amino acid sequences having at least 70%, such as at least 80%, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, identity to SEQ ID NO:122. In a specific embodiment, the CL region consists of SEQ ID NO:122.

[0302] In one embodiment, the antibody of antigen-binding fragment thereof is selected from the group consisting of Fab fragments, single chain Fv fragments (scFv), IgG 1, IgG2, IgG3, and IgG4.

[0303] In one embodiment, the antibody of antigen-binding fragment thereof is a Fab fragment. In one embodiment, the antibody of antigen-binding fragment thereof is a single chain Fv fragment (scFv). In one embodiment, the antibody of antigen-binding fragment thereof is IgGl. In one embodiment, the antibody of antigen-binding fragment thereof is IgG2. In one embodiment, the antibody of antigen-binding fragment thereof is IgG3. In one embodiment, the antibody of antigen-binding fragment thereof is IgG4.

[0304] In one embodiment, the antibody or antigen-binding fragment thereof is of IgG subclass. In one embodiment, the IgG subclass is selected from the group consisting of IgG 1, IgG 2, IgG3, and IgG4. In one embodiment, the IgG subclass is selected from the group consisting of IgG1 and IgG4. In one embodiment, the IgG subclass is IgG 1.In one embodiment, the IgG subclass is IgG 2. In one embodiment, the IgG subclass is IgG 3. In one embodiment, the IgG subclass is IgG 4.

[0305] A skilled person appreciates that certain mutations in the Fc portion of the antibody or antigen-binding fragment thereof can alter the properties of the binding molecule. For example, it may be possible to prolong or to shorten the half-life in vivo, and / or it may be possible to reduce or prohibit the possibility of the antibody or antigen-binding fragment thereof to activate the complement system in vivo, or to bind to IgG receptors on cells, so called Fcγ-receptors (FcγR). The skilled person appreciates that similar such receptors have been ordered into three groups, FcγRI-, FcγRII- and FcγRIII receptors. These receptors allow interactions between antibodybound antigen and cells in the body, facilitating a plethora of actions against the antigen (be it virus, bacteria, infected or cancer-transformed cells etc) like phagocytosis (by FcγR on macrophages and monocytes) and activation of granulocytes to eliminate the virus of a cell infected with the virus (expressing viral proteins on its surface, to which antibodies against HCV-El or HCV-E2 may bind). In one embodiment, the IgG 1, IgG 2, or lgG4 has one or more mutations in the Fc-portion. Such mutation may be present for the purpose of changing the pharmacokinetics of the antibody, such as to prolong the half-life of the monoclonal antibody in the blood, or indeed in the whole body. The skilled person appreciates that mutations of amino acid residues on the Fc-portion of IgG molecule are known to interact with the FcR-n receptor, among the most used for this purpose are the group M252, S254 and T256 (EU-numbering, often described as the FcRn binding site 252-256), as well as the group 433-436 (EU-numbering) Several mutations have been shown to have this effect as appreciated by a skilled person, among some of the more used one are the three mentioned positions mutated to Tyrosine, Threonine and Glutamic acid: M252Y / S254T / T256E. Many other mutations have also been tried and indeed already used on existing drugs. The skilled person appreciates which mutations are suitable for this purpose. Additional successful examples are M428L / N434S, N343A / E380A, orT250R / M428L, or H433K / N434F / Y436H, respectively. Thus, in one embodiment the one or more mutations in the Fc-portion are one or more of T250, M252, 1253, S254 and T256, E380, M428, H433, N434, H435, Y436 (EU-numbering).In one embodiment the one or more mutations in the Fc-portion are M252Y / S254T / T256E. In one embodiment the one or more mutations in the Fc-portion are M428L / N434S, N343A / E380A. In one embodiment the one or more mutations in the Fc-portion are T250R / M428L. In one embodiment the one or more mutations in the Fc-portion are H433K / N434F / Y436H.

[0306] In one embodiment, the antibody or antigen-binding fragment thereof is monoclonal. In one embodiment, the antibody or antigen-binding fragment thereof is selected from the group consisting of human antibodies, humanized antibodies, antibodies that have been mutated to reduce the antigenicity thereof in humans and antigen-binding fragments thereof.

[0307] In one embodiment, the antibody or antigen-binding fragment thereof has a binding affinity for the HCV-E2 protein that corresponds to a IC50 value of no more than 90 nM, such as between 25 and 85 nM, such as between 30 and 40 nM. In some embodiments, the binding affinity is determined by competition ELISA.

[0308] In one embodiment, the antibody or antigen-binding fragment thereof exhibits cross-reactivity to E2 antigens from HCV genotypes 1, 2, 3, 4, 5 and 6. In one embodiment, the antibody or antigen-binding fragment thereof exhibits crossreactivity to E2 antigens from HCV genotypes 1, 2, 3, 4, and 5. In one embodiment, the antibody or antigen-binding fragment thereof exhibits cross-reactivity to E2 antigens from HCV genotypes 1, 2, 3, 4, and 6. In one embodiment, the antibody or antigen-binding fragment thereof exhibits cross-reactivity to E2 antigens from HCV genotypes 1, 2, 3, 5 and 6. In one embodiment, the antibody or antigen-binding fragment thereof exhibits cross-reactivity to E2 antigens from HCV genotypes 1, 2, 3, and 5. In one embodiment, the antibody or antigen-binding fragment thereof exhibits cross-reactivity to E2 antigens from HCV genotypes 1, 2, 3, and 6. In one embodiment, the antibody or antigen-binding fragment thereof exhibits crossreactivity to E2 antigens from HCV genotypes 1, 2, 3 and 4. In one embodiment, the antibody or antigen-binding fragment thereof exhibits cross-reactivity to E2 antigens from HCV genotypes 1, 2 and 3. In one embodiment, the antibody or antigen-binding fragment thereof exhibits cross-reactivity to E2 antigens from HCV genotypes la and2b. An antibody or antigen-binding fragment thereof which exhibits such crossreactivity may benefit from broad neutralizing reactivity to different HCV strains. Broadly reactive anti-E2 antibodies may be valuable for therapeutic applications, as apparent to a person of skill in the art. For example, such antibodies can tentatively be used for protection against infection if given prior to contact with HCV. In addition, HCV is known to quickly generate a family of slightly different HCV variants once in the infected subject, and thus broadly reactive antibodies therefore have an added value if they can mitigate the development of a broader infection (i.e., mitigate the development of an infection from a family of slightly different HCV variants).

[0309] Indeed, the skilled person is well aware of the existence of different HCV isolates and their origin. It is therefore of particular interest to assess if novel monoclonal antibodies can react with a broad collection of HCV viruses, both separate isolates as well as with viruses of different genotypes. To do this, several scientific groups have made considerable efforts to generate panels of different E1 / E2 variants, stemming from several hundreds of infected donors. In one embodiment, the antibody or antigen-binding fragment thereof is able to neutralize a HCV isolate selected from the group consisting of H77(belonging to genotype (gt) la), JFH-1 (gt2a), J6 (gt2a), U 1.20.3 (gtl), U 3A 13.6 (gt 3), U 4.1.1 (gt4), U2.4.1 (gt2), U3.2.1 (gt3), and U6 1.2 (gt6); or an isolate of a genotype represented by an isolate of said group; and / or an isolate of genotype 7 and 8.

[0310] In one embodiment, the isolate is H77. In one embodiment, the isolate is JFH-1 or a genotype represented by JFH-1. In one embodiment, the isolate is J6 or a genotype represented by J6. In one embodiment, the isolate is U 1.20.3 or a genotype represented by U 1.20.3. In one embodiment, the isolate is U 3A 13.6 or a genotype represented by U 3A 13.6. In one embodiment, the isolate is U 4.1.1 or a genotype represented by U 4.1.1. In one embodiment, the isolate is U2.4.1 or a genotype represented by U2.4.1. In one embodiment, the isolate is U3.2.1 or a genotype represented by U3.2.1. In one embodiment, the isolate is U6 1.2 or a genotype represented by U6 1.2. In one embodiment, the isolate is of genotype 7 and 8.Table 1. El / E2clones from the following isolates used in the present disclosure.

[0311] Full isolate name genotype accession No.

[0312] H77 la AF011751

[0313] JFH-1 2a AB047639

[0314] J6 2a JN578258

[0315] UKNP 1.20.3 1 KU285198.1

[0316] UKNP 3A 13.6 3 AY894683

[0317] UKNP 4.1.1 4 KU285220.1

[0318] UKNP 2.4.1 2 KU285213

[0319] UKNP 3.2.1 3 KU285218

[0320] UKNP 6.1.2 6 KU285228

[0321] The antibodies and / or antigen-binding fragments thereof of the present disclosure may be used in the prophylaxis and / or treatment as such, or in a form of a pharmaceutical composition. While it is possible for the active ingredient to be administered alone, it is also possible for it to be present in a pharmaceutical composition. Accordingly, in a second aspect there is provided a pharmaceutical composition, comprising an antibody or antigen-binding fragment thereof according to any embodiment of the first aspect and a pharmaceutically acceptable carrier or excipient.

[0322] Techniques for formulating antibodies for human therapeutic use are well known in the art and are reviewed, for example, in Wang et al. (2007), J Pharm Sci, 96:1-26, the contents of which are incorporated herein in their entirety.

[0323] Pharmaceutically acceptable excipients that may be used to formulate the compositions include, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, serum proteins, such as human serum albumin, buffer substances such as phosphates, glycine, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamine sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, zinc salts, colloidal silica, magnesium trisilicate, polyvinyl pyrrolidone, cellulose-based substances (for example sodium carboxymethylcellulose), polyethylene glycol, polyacrylates, waxes, polyethylenepolyoxypropylene block polymers, polyethylene glycol and wool fat.In certain embodiments, the pharmaceutical compositions are formulated for administration to a subject via any suitable route of administration including but not limited to intramuscular, intravenous, intradermal, intraperitoneal injection, subcutaneous, epidural, nasal, oral, rectal, topical, inhalational, buccal (e.g., sublingual) and transdermal administration. In preferred embodiments, the composition is formulated for intravenous or subcutaneous administration.

[0324] In one embodiment, the pharmaceutical composition further comprises an additional therapeutic agent. In one embodiment, the additional therapeutic agent is a direct acting anti-viral drug. In one embodiment, the direct acting anti-viral drug selected from the group consisting of Daklinza, Exviera, Harvoni, Olysio, Sovaldi and Viekirax. In one embodiment, the direct acting anti-viral drug is Daklinza. In one embodiment, the direct acting anti-viral drug is Exviera In one embodiment, the direct acting anti-viral drug is Harvoni. In one embodiment, the direct acting antiviral drug is Olysio. In one embodiment, the direct acting anti-viral drug is Sovaldi. In one embodiment, the direct acting anti-viral drug is Viekirax.

[0325] In a related aspect, there is provided a combination of an antibody or antigenbinding fragment thereof according to the first aspect and an additional therapeutic agent, for use in therapeutic or prophylactic treatment of an hepatitis C virus (HCV) infection. The skilled person appreciates which therapeutic agent are suitable for this purpose, as well as suitable dose and administration route to use for the therapeutic agents in the combination. In one embodiment the additional therapeutic agent is a direct acting anti-viral drug. In one embodiment the direct acting anti-viral drug selected from the group consisting of Daklatasvir; Dasabuvir; Ledipasvir and Sofosbuvir; Simeprevir; Sofosbuvir; Ombitasvir, Paritaprevir and Ritonavir; such as selected from the group consisting of Ledipasvir and Sofosbuvir; and Sofosbuvir.

[0326] The antibodies or antigen-binding fragments thereof according to the present disclosure may be useful as therapeutic and / or diagnostic agents. Hence, aspects are disclosed herein, which among others relate to the following aspects:As such, in an aspect of the disclosure, there is provided an antibody or antigenbinding fragment thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use as a medicament.

[0327] In yet another aspect of the disclosure, there is provided an antibody or antigenbinding fragment thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use as a diagnostic agent.

[0328] Also provided are methods of preventing, treating or diagnosing disease or assessing disease prognosis, wherein an antibody or antigen-binding fragment thereof as disclosed herein is administered to a subject, typically a human subject.

[0329] Also provided is the use of the disclosed antibodies or antigen-binding fragments thereof for the manufacture of compositions (such as medicaments) for use in the prevention, treatment, diagnosis and / or prognosis of HCV.

[0330] Also provided are methods of detecting or diagnosing a disease in a subject, wherein the methods comprise contacting a sample obtained from the subject with an antibody or antigen-binding fragment thereof as described herein. These methods are typically in vitro methods.

[0331] Thus, said antibody or antigen-binding fragment thereof, or pharmaceutical composition comprising it, is useful in the treatment, prevention and / or diagnosis of HCV.

[0332] In a third aspect, there is provided an antibody or antigen-binding fragment thereof according to the first aspect or a composition according to the second aspect for use in treatment. In other words, there is provided an antibody or antigen-binding fragment thereof according to the first aspect or a composition according to the second aspect for use as a medicament. The use in treatment may be use in therapeutic treatment.

[0333] The use in treatment may be use in prophylactic treatment. At present, no vaccine effective against HCV exist. This is one reason to why prophylactic treatment is envisioned to be of importance.

[0334] In a fourth aspect, there is provided an antibody or antigen-binding fragment thereof according to the first aspect or a composition according to the second aspect for use as a diagnostic agent,. In one embodiment, the antibody or antigen-binding fragment thereof or composition for use according to the second aspect, wherein said therapeutic treatment or prophylactic treatment is with respect to a HVC infection.

[0335] In a related aspect of the disclosure, there is provided an antibody or antigenbinding fragment thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, for use as a prognostic agent, e.g. in vivo.

[0336] In a fifth aspect, there is provided a method of therapeutic treatment of a mammal having an HCV infection, and / or a method of prophylactic treatment of a mammal susceptible to obtaining an HCV infection. The method comprises administering to said mammal a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to the first aspect or a composition according to the second aspect.

[0337] In one embodiment, the method further comprises a step of administrating an additional therapeutic agent. The additional therapeutic agent may be administrated simultaneously or concurrently.

[0338] In one embodiment, the additional therapeutic agent is a direct acting anti-viral drug. In one embodiment, the direct acting anti-viral drug is selected from the group consisting of Daklinza, Exviera, Harvoni, Olysio, Sovaldi and Viekirax. In one embodiment, the direct acting anti-viral drug is Daklinza. In one embodiment, the direct acting anti-viral drug is Exviera. In one embodiment, the direct acting anti-viral drug is Harvoni. In one embodiment, the direct acting anti-viral drug is Olysio. In one embodiment, the direct acting anti-viral drug is Sovaldi. In one embodiment, the direct acting anti-viral drug is Viekirax.

[0339] In a sixth aspect, there is provided a method of neutralizing a HCV isolate or a genotype selected from the group consisting of H77, JFH-1, J6, U 1.20.3, U 3A 13.6, U 4.1.1, U2.4.1, U3.2.1, and U6 1.2, or an isolate of a genotype represented by said group, and / or an isolate of genotype 7 and 8. The method comprises administrating a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to the first aspect, or a pharmaceutical composition according tothe second aspect, to a subject, such as a mammal. In one embodiment, the mammal is a human.

[0340] In a seventh aspect, related to the fifth aspect, there is provided a method of binding to the HCV E2 antigen. The method comprises administrating a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, to a subject, such as a mammal. In one embodiment, the mammal is a human. The antibody or antigen-binding fragment thereof may bind specifically and / or selectively to the HCV E2 antigen. As used herein, the term "bind selectively" refers to the preferential binding of the antibody or antigen-binding fragment thereof to the target HCV E2 antigen.

[0341] In an eighth aspect, there is provided a method of detecting a hepatitis C virus (HCV) E2 antigen in vitro. The method comprises a step of providing a sample suspected to contain said E2 antigen; a step of contacting said sample with an antibody or antigen-binding fragment thereof according to the first aspect, or a pharmaceutical composition according to the second aspect; and a step of detecting the binding of said protein to indicate the presence of said E2 antigen in the sample.

[0342] In one embodiment of said method of detecting hepatitis C virus (HCV, said sample is a biopsy and / or a body fluid, such as wherein said sample is a skin biopsy, cerebrospinal fluid, plasma, serum and / or saliva. In one embodiment, said sample is isolated from a human.

[0343] In one embodiment, said method of detecting hepatitis C virus (HCV is an immunoassay, such as an ELISA method and / or an immunohistochemistry method

[0344] In a ninth aspect, there is provided a method of determining the amount of a hepatitis C virus (HCV) present in a subject. The method comprises the steps of: a) contacting the subject, or a sample isolated from the subject, with an antibody or antigen-binding fragment thereof according to the first aspect, or a pharmaceutical composition according to the second aspect, and

[0345] b) obtaining a value corresponding to the amount of the antibody or antigenbinding fragment thereof or composition that has bound in said subject or to saidsample. In one embodiment, the method further comprises a step of comparing said value to a reference.

[0346] In one embodiment of said method of determining the amount of hepatitis C virus (HCV), said sample is a biopsy and / or a body fluid, such as wherein said sample is a skin biopsy, cerebrospinal fluid, plasma, serum and / or saliva. In one embodiment, said sample is isolated from a human. In one embodiment, said method of determining the amount of hepatitis C virus (HCV) is an immunoassay, such as an ELISA method and / or an immunohistochemistry method.

[0347] With regard to diagnostic or prognostic use of the disclosed antibody, or antigenbinding fragment thereof, in HCV, E2 antigen can be detected and measured in patients at risk of disease or showing signs of incipient disease. One such method is PET scan using a radio-labelled antibody of the disclosure. Another method for diagnosis and prognosis is biochemical analysis analyzing the levels of E2 in blood, plasma, CSF and other fluids, using such methods as ELISA, Mesoscale Discovery (MSD) or Simoa.

[0348] In a tenth aspect of the disclosure, there is provided a polynucleotide encoding an antibody or antigen-binding fragment thereof according to the first aspect of the disclosure.

[0349] In an eleventh aspect of the disclosure, there is provided a cloning vector comprising a polynucleotide as defined above.

[0350] In twelth aspect of the disclosure, there is provided an expression vector comprising a polynucleotide as defined above.

[0351] In thirtenth of the disclosure, there is provided a host cell comprising a cloning vector as defined above. In one embodiment, the host cell is selected from the group consisting of a B lymphocyte, a plasma cell, a muscle cell, and an endothelial cell. In one embodiment, the host cell is a B lymphocyte. In one embodiment, the host cell is a plasma cell. In one embodiment, the host cell is a muscle cell. In one embodiment, the host cell is an endothelial cell.

[0352] In fourteenth aspect of the disclosure, there is provided a host cell comprising an expression vector as defined above. In one embodiment, the host cell is selected from the group consisting of a B lymphocyte, a plasma cell, a muscle cell, and anendothelial cell. In one embodiment, the host cell is a B lymphocyte. In one embodiment, the host cell is a plasma cell. In one embodiment, the host cell is a muscle cell. In one embodiment, the host cell is an endothelial cell. In one embodiment, the host cell is a mammlian cells developed for protein production in vitro. The skilled person appreciates which cells are suitable for this purpose.

[0353] Examples of such suitable cells are CHO cells and HEK cells.

[0354] In fifteenth aspect of the disclosure, there is provided a method of producing an antibody or antigen-binding fragment thereof according to the first aspect of the disclosure, comprising

[0355] culturing a host cell comprising an expression vector as defined above under conditions permissive for the expression of said antibody or antigen-binding fragment thereof from said expression vector, and

[0356] isolating said antibody or antigen-binding fragment thereof.

[0357] In sixteenth aspect of the disclosure, there is provided a polynucleotide according to the tenth aspect, for use as a medicament.

[0358] In seventeenth aspect of the disclosure, there is provided a polynucleotide for use according to the sixteenth aspect, for use in treatment of an HCV infection.

[0359] In eighteenth aspect of the disclosure, there is provided a a method of in vivo producing an antibody or antigen-binding fragment thereof as defined the first aspect comprising

[0360] introducing one or more polynucleotide(s) according to the tenth aspect into a cell of a mammal, thereby enabling translating of said polynucleotide and enabling assembly into an antibody of fragment thereof and enabling secretion into the blood stream, optionally wherein said polynucleotide is mRNA, DNA or cDNA.

[0361] In nineteenth aspect of the disclosure, there is provided a method of treatment of an HCV infection in a mammal comprising in vivo producing an antibody or antigenbinding fragment thereof as defined in the first aspect by introducing one or more polynucleotide(s) according to the tenth aspect into a cell of a mammal, thereby enabling translating of said polynucleotide and enabling assembly into an antibodyof fragment thereof and enabling secretion into the blood stream. In one embodiment, the polynucleotide is mRNA, DNA or cDNA.

[0362] In a twentieth aspect of the disclosure, there is provided a method of in situ producing an antibody or antigen-binding fragment thereof as defined in the first aspect comprising

[0363] introducing one or more polynucleotide(s) according to the tenth aspect into a mammalian cell, and thereafter

[0364] introducing said mammalian cell into a mammal,

[0365] thereby enabling translating of said polynucleotide and enabling assembly into an antibody of fragment thereof and enabling secretion into the blood stream. In one embodiment, the polynucleotide is mRNA, DNA or cDNA.

[0366] In a twentyfirst aspect of the disclosure, there is provided a use of antibody or an antigen-binding fragment thereof according to the first aspect, or a composition according to the second aspect, for use in the manufacture of a medicament for prevention, treatment, diagnosis and / or prognosis of an HCV infection.

[0367] Definitions

[0368] As used herein, the terms "hepatitis C virus," or " HCV" describe the virus in a generic manner, and as such the terms are not limiting to any particular HCV viral sequence or isolate. In this regard, there are 8 distinct genotypes of HCV with more than 100 distinct subtypes which have been identified based on phylogenetic analyses (Houghton, M. (1996) " Hepatitis C Viruses," Fields Virology, 3d Edition, Fields et al. eds., Lippincott-Raven Publishers, Philadelphia PA.; Simmonds et al. 1993; Vo-Quang & Pawlotsky, 2024).

[0369] Further, comparison of genomic nucleotide sequences from different HCV isolates around the world establish that HCV is highly heterogenous, with a range of sequence diversity among isolates from humans all over the world. Thus, the terms "hepatitis C virus," and " HCV" as used herein will generically encompass all such isolates.The terms "an antigen derived from an El polypeptide," an " El polypeptide antigen" and "an HCV El antigen" are used interchangeably herein and encompass molecules from an HCV El region.

[0370] The term "polypeptide," as used herein, refers to a polymer of amino acids and does not refer to a specific length of the product; thus, peptides, oligopeptides, and proteins are included within the definition of polypeptide. This term also does not refer to or exclude post expression modifications of the polypeptide, for example, glycosylations, acetylations, phosphorylations and the like. El polypeptides antigens can be physically derived from the HCV El region or produced recombinantly or synthetically, based on the known sequence. The mature El region of HCV1 begins at approximately amino acid 192 of the polyprotein and continues to approximately amino acid 383.

[0371] A polypeptide or amino acid sequence "derived from" a designated HCV region refers to a polypeptide having an amino acid sequence identical to that of a polypeptide encoded in the sequence, or a portion thereof wherein the portion consists of at least 3-5 amino acids, preferably at least 4-7 amino acids, more preferably at least 8-10 amino acids, and even more preferably at least 11-15 amino acids, or which is immunologically identifiable with a polypeptide encoded in the sequence. This terminology also includes a polypeptide expressed from a designated HCV region.

[0372] The terms "an antigen derived from an E2 polypeptide, an " E2 polypeptide antigen" and "an HCV E2 antigen" are used interchangeably herein and encompass molecules from an HCV E2 region. Such molecules can be physically derived from the region or produced recombinantly or synthetically, based on the known sequence. The mature E2 region of HCV1 is believed to begin at approximately amino acid 384-385.

[0373] For purposes of the present invention, HCV El and E2 polypeptides are defined with respect to the amino acid number of the polyprotein encoded by the genome of HCV1, with the initiator methionine being designated position 1. However, it should be noted that an antigen from an " El polypeptide" or an " E2 polypeptide" is not limited to polypeptides having an exact HCVI sequence. Indeed, the HCV genome is in a state of constant flux and contains several variable domains which exhibit relatively high degrees of variability between isolates. It is readily apparent that theterms encompass antigens from El and E2 polypeptides from any of the various HCV isolates including isolates having any of the 8 genotypes of HCV described in Vo-Quang & Pawlotsky 2024. In this regard, the corresponding El or E2 regions in a heterologous HCV isolate can be readily determined by aligning sequences from the two isolates in a manner that brings the sequences into maximum alignment, as apparent to a person of skill in the art.

[0374] Additionally, the terms " El polypeptide antigen" and " E2 polypeptide antigen" encompass polypeptides which include modifications to the native sequence, such as internal deletions, additions and substitutions (generally conservative in nature). These modifications may be deliberate, as through site-directed mutagenesis, or may be accidental, such as through naturally occurring mutational events.

[0375] The term "antibody" encompasses monoclonal antibody preparations, as well as preparations including altered antibodies, F(ab')2 fragments, F(ab) molecules, Fv fragments, single domain antibodies, chimeric antibodies and functional fragments thereof which exhibit immunological binding properties of the parent antibody molecule.

[0376] As used herein, the term "monoclonal antibody" refers to an antibody composition having a homogeneous antibody population. The term is not limited by the manner in which it is made. The term encompasses whole immunoglobulin molecules, as well as Fab molecules, F(ab')2 fragments, Fv fragments, and other molecules that exhibit immunological binding properties of the parent monoclonal antibody molecule.

[0377] The term "recombinant monoclonal antibody" is defined herein as a monoclonal antibody that has been produced by expression of a recombinant polynucleotide. The term "antigen-binding site," or "binding portion" refers to the part of the immunoglobulin molecule that participates in antigen binding. The antigen binding site is formed by amino acid residues of the N-terminal variable (" V") regions of the heavy (" H") and light (" L") chains. Three highly divergent stretches within the V regions of the heavy and light chains, referred to as "hypervariable regions," are interposed between more conserved flanking stretches known as "framework regions," or " FRs". Thus the term " FR" refers to amino acid sequences which arenaturally found between, and adjacent to, hypervariable regions in immunoglobulins. In an antibody molecule, the three hypervariable regions of a light chain and the three hypervariable regions of a heavy chain are disposed relative to each other in three dimensional space to form an antigen-binding surface. The antigen-binding surface is complementary to the three-dimensional surface of a bound antigen, and the three hypervariable regions of each of the heavy and light chains are referred to as "complementarity-determining regions," or " CDRs."

[0378] As known to a person skilled in the art, an epitope (or "antigenic determinant") is a group of amino acids or other chemical groups exposed on the surface of a molecule, frequently a protein, here HCV E2, which can generate an antigenic response and bind antibody. An epitope is a localized region on the surface of an antigen that is recognized by the immune system, specifically by antibodies. An epitope for a given antibody may be determined by epitope mapping, as appreciated by a person of skill in the art. During epitope mapping, the shortest amino acid sequence region recognized by an antibody within the amino acid sequence of the target protein may be revealed. The recognized amino acid region may be part of linear epitope, which consists of consecutive amino acids of the target protein. The recognized amino acid region revealed by epitope mapping may be part of a conformational epitope, also known as a non-linear epitope or discontinuous epitope, which is composed of neighboring amino acid residues located on an antigenic protein surface structure. Epitopes are bound by their complementary paratopes on B-cell receptors and / or on antibodies.

[0379] Antibodies which "recognize" an epitope have an affinity for the recognized epitope. " Affinity", or "binding affinity" as also referred to herein, corresponds to the strength with which the antigen-binding site of an antibody (also known as paratope) binds an epitope of a protein. As used herein, the terms "binding to X", "specific binding to X", "selective binding to X" and "affinity for X", wherein X is a target (e.g. an antigen or an epitope, such as HCV E2 or an epitope of HCV E2 bound by the antibody or an antigen-binding fragment thereof as defined herein), refer to a property of a binding molecule, such as a property of an antibody or antigen-binding fragment thereof or of a bi- or multispecific construct incorporating such an antibody or antigen-binding fragment thereof, which may be tested for example byELISA, by surface plasmon resonance (SPR), by Kinetic Exclusion Assay (KinExA®) or by bio-layer interferometry (BLI). The skilled person is aware of these methods and others.

[0380] For example, binding affinity for antigen or epitope X may be tested in an experiment in which an antibody or antigen-binding fragment thereof to be tested is captured on ELISA plates coated with antigen X or an antigen exhibiting the epitope X, and a biotinylated detector antibody is added, followed by streptavidin-conjugated horse radish peroxidase (HRP). Alternatively, said detector antibody may be directly conjugated with HRP. Tetramethylbenzidine (TMB) substrate is added and the absorbance at 450 nm is measured using an ELISA multi-well plate reader. The skilled person may then interpret the results obtained by such experiments to establish at least a qualitative measure of the binding affinity of the antibody or antigen-binding fragment thereof for X. If a quantitative measure is desired, for example to determine the EC50 value (the half maximal effective concentration) for the interaction, ELISA may also be used. The response of the antibody or antigenbinding fragment thereof against a dilution series of X may be measured using ELISA as described above. The skilled person may then interpret the results obtained by such experiments and EC50 values may be calculated from the results, using for example GraphPad Prism v.9 and non-linear regression.

[0381] As used herein, the term " EC50" refers to the half maximal effective concentration of an antibody or antigen-binding fragment thereof which induces a response halfway between the baseline and maximum after a specified exposure time.

[0382] Additionally, inhibition ELISA may be used to obtain a quantitative measure of interaction by determination of the " IC50" (the half maximal inhibitory concentration). In an inhibition ELISA, the concentration of an antigen or epitope X in a fluid sample is measured by detecting interference in an expected signal output. In principle, a known antigen or epitope-bearing substance is used to coat a multiwell plate. In parallel, an antibody or antigen-binding fragment thereof with putative affinity for the antigen or epitope is added and incubated with a solution containing antigen at varied concentrations. Following standard blocking and washing steps, samples containing the mixture of said antibody or antigen-binding fragment thereof and the antigen or epitope are added to the well. Labeled detection antibody with affinity for the antigen- or epitope-binding antibody or antigen-binding fragment thereof is then applied for detection using relevant substrates (for example TMB). In principle, if there is a high concentration of antigen or epitope in the fluid sample, a significant reduction in signal output will be observed. In contrast, if there is very little antigen or epitope in the fluid sample, there will be very little reduction in the expected signal output. The skilled person appreciates that the signal output is also dependent on the affinity of the antibody or antigenbinding fragment thereof for said antigen or epitope.

[0383] As used herein, the term " IC50" refers to the concentration of an antibody or antigen-binding fragment thereof which induces a response halfway between the baseline and maximum inhibition after a specified exposure time. Herein, a lower IC50 value indicates that a lower concentration of antigen or epitope is required to interfere with the binding of the detection antibody to the known antigen or epitope coated on the plate, as compared to a higher IC50 value. Thus, a lower IC50 value typically corresponds to a higher affinity.

[0384] The binding affinity of an antibody or antigen-binding fragment thereof may also be tested by SPR. For example, said binding affinity may be tested in an experiment in which antigen or epitope X is immobilized on a sensor chip of the instrument, and the sample containing the antibody or antigen-binding fragment thereof to be tested is passed over the chip. Alternatively, the antibody or antigen-binding fragment thereof to be tested may be immobilized on a sensor chip of the instrument, and a sample containing X is passed over the chip. The skilled person may then interpret the results obtained by such experiments to establish at least a qualitative measure of the binding affinity of the moiety for X. If a quantitative measure is desired, for example to determine a KD value for the interaction, SPR may also be used. Binding values may for example be defined in a Biacore (Cytiva) or ProteOn XPR 36 (Bio-Rad) instrument. The antigen or epitope is suitably immobilized on a sensor chip of the instrument, and samples of the antibody or antigen-binding fragment thereof whose affinity is to be determined are prepared by serial dilution and injected. KD values may then be calculated from the results using for example the 1:1 Langmuir binding model of the Biacore Insight Evaluation Software 2.0 or other suitable software, typically provided by the instrument manufacturer.The binding affinity may also be measured by bio-layer interferometry (BLI), a label-free technology for measuring biomolecular interactions within the interactome. It is an optical analytical technique that analyzes the interference pattern of white light reflected from two surfaces: a layer of immobilized protein on the biosensor tip, and an internal reference layer. The binding between a ligand (antigen or epitope X) immobilized on the biosensor tip surface and an analyte (such as an antibody or antigen-binding fragment thereof with affinity for X) in solution produces an increase in optical thickness at the biosensor tip resulting in a wavelength shift, Δλ, which is a direct measure of the change in thickness of the biological layer.

[0385] Interactions are measured in real time, providing the ability to monitor binding specificity, rates of association and dissociation, or concentration, with precision and accuracy.

[0386] The skilled person is aware of the above mentioned and other methods for measuring the affinity of an antibody or antigen-binding fragment thereof for antigen or epitope X, either qualitatively or quantitatively or both.

[0387] As used herein, the term "antibody or antigen-binding fragment thereof" encompasses not only full-length or intact polyclonal or monoclonal antibodies, but also antigen-binding fragments thereof, such as Fab, Fab', F(ab')2, Fab3, Fv and variants thereof, fusion proteins comprising one or more antibody portions, humanized antibodies, chimeric antibodies, minibodies, diabodies, triabodies, tetrabodies, linear antibodies, single chain antibodies, multispecific antibodies (e.g. bispecific antibodies) and any other modified configuration of the immunoglobulin molecule that comprises an antigen recognition site of the required specificity, including glycosylation variants of antibodies, amino acid sequence variants of antibodies and covalently modified antibodies. This listing of variants of antibodies and antigen-binding fragments thereof is not to be seen as limiting, and the skilled person is aware of other suitable variants.

[0388] A full-length antibody comprises two heavy chains and two light chains. Each heavy chain contains a heavy chain variable region (VH) and first, second and third constant regions (CHI, CH2 and CH3). Each light chain contains a light chain variable region (VL) and a light chain constant region (CL). Depending on the amino acid sequence of the constant domain of its heavy chains, antibodies are assigned to different classes. There are six major classes of antibodies: IgA, IgD, IgE, IgG, IgM andIgY, and several of these may be further divided into subclasses, e.g., IgGl, lgG2, lgG3, lgG4, IgAl and lgA2. The term "full-length antibody" as used herein, refers to an antibody of any class, such as IgD, IgE, IgG, IgA, IgM or IgY (or any sub-class thereof). The subunit structures and three-dimensional configurations of different classes of antibodies are well known.

[0389] The designation of " VH / VL" as used in relation to a VH / VL pair does not limit the construct to any particular order of the VH and VL regions in the polypeptide chain, but is only used to convey that both the VH and VL regions are present, and that they are capable of pairwise association to form an Ig domain with an antigenbinding surface, as e.g. found in naturally occurring antibodies. As such, the term " VH / VL pair" encompasses, for example, constructs in which the VL and VH regions associate as part of a Fab fragment or full-length antibody, constructs in which the VL region precedes the VH region in a single chain Fv, constructs in which the VH region precedes the VL region in a single chain Fv, and constructs in which the VH and VL regions are non-covalently associated with each other. With respect to the antigen-binding surface of the VH / VL pair, it may suitably be composed of said three VL-CDRs and said three VH-CDRs as defined in any one of the embodiments discussed herein. Thus, said three VL-CDRs and said three VH-CDRs forming the antigen-binding surface of the VH / VL pair consist of the amino acid sequences as defined in any one of the embodiments discussed herein.

[0390] The term "antigen-binding fragment" refers to a portion or region of an antibody molecule, or a derivative thereof, that retains all or a significant part of the antigen binding of the corresponding full-length antibody. An antigen-binding fragment may comprise the heavy chain variable region (VH), the light chain variable region (VL), or both. Each of the VH and VL regions or domains typically contains three CDRs, i.e. CDR1, CDR2 and CDR3, denoted VH-CDR1, VH-CDR2 and VH-CDR3 for the CDRs from the VH domain and VL-CDR1, VL-CDR2 and VL-CDR3 for the CDRs from the VL domain. The three CDRs in VH or VL are flanked by framework regions (FR1, FR2, FR3 and FR4). As briefly listed above, examples of antigen-binding fragments include, but are not limited to: (1 ) a Fab fragment, which is a monovalent fragment having a VL-CL chain and a VH-CH1 chain; (2) a Fab' fragment, which is a Fab fragment with the heavy chain hinge region, (3) a F(ab')2 fragment, which is a dimer of Fab' fragments joined by the heavy chain hinge region, for example linked by a disulfide bridge atthe hinge region; (4) an Fc fragment; (5) an Fv fragment, which is the minimum antibody fragment having the VL and VH domains of a single arm of an antibody; (6) a single chain Fv (scFv) fragment, which is a single polypeptide chain in which the VH and VL domains of an scFv are linked by a peptide linker; (7) an (scFv)2, which comprises two VH domains and two VL domains, which are associated through the two VH domains via disulfide bridges and (8) a domain antibody, which may be an antibody single variable domain (VH or VL) polypeptide that specifically bind antigen. Antigen-binding fragments can be prepared via routine methods. For example, F(ab')2 fragments can be produced by pepsin digestion of a full-length antibody molecule, and Fab fragments can be generated by reducing the disulfide bridges of F(ab')2 fragments. Alternatively, portions can be prepared via recombinant technology by expressing the heavy and light chain portions in suitable host cells (e.g., E. coli, yeast, mammalian, plant or insect cells) and having them assembled to form the desired antigen-binding fragments either in vivo or in vitro. A single-chain antibody can be prepared via recombinant technology by linking a nucleotide sequence coding for a heavy chain variable region and a nucleotide sequence coding for a light chain variable region. For example, a flexible linker may be incorporated between the two variable regions.

[0391] Furthermore, the skilled person is aware of the meaning of the terms polyclonal antibodies and monoclonal antibodies. Polyclonal antibodies are normally generated by administering an antigen to an animal. Said antigen will evoke an immune response giving rise to polyclonal antibodies. Monoclonal antibodies are made by immunizing an animal, usually a mouse, with an antigen and the subsequent isolation of the spleen from said animal. Isolated spleen cells are immortalized by fusion with myeloma cells to give rise to hybridoma cells. Each hybridoma cell produces a unique monoclonal antibody.

[0392] The term "human antibody" as used herein, refers to antibodies having variable and constant regions corresponding to, or derived from, antibodies obtained from human subjects. The term "chimeric antibodies" as used herein, refers to recombinant or genetically engineered antibodies, such as for example antibodies with variable regions (VH and VL) of mouse origin and human constant region (Fc), to reduce the antibodies' immunogenicity. The term "humanized antibodies" refers to antibodies from non-human species whose protein sequences have beenmodified to increase their similarity to antibody variants produced naturally in humans, in order to reduce immunogenicity of the full antibody itself.

[0393] The terms " G8", " R2G8", "2G8" are used interchangibly and are all intended to refer to the G8 clone, in which clone the heavy chain variable domain consists of SEQ ID 5 NO: 64 and wherein said light chain variable domain consists of SEQ ID NO: 58.

[0394] The term " G8v2", " G8 version2" is intented to refer to the G8 clone with the mutation N104A.

[0395] Incorporation by reference

[0396] Various publications are cited in the present application, each of which is 0 incorporated by reference herein in its entirety.

[0397] Brief description of the drawings

[0398] Figure 1 shows results from binding analyses for the Ala-mutants in ELISA for HCV-E2 5 gt la (dark grey) and gt 2b (light grey).

[0399] Figures 2 and 3 shows In vitro HCVpp neutralization data for four clones isolated in Experiment 3, for different isolates and / or genotypes.

[0400] References

[0401] 0 Allander T, Drakenberg K, Beyene A, Rosa D, Abrignani S, Houghton M, Widell A, Grillner L, Persson MAA. Recombinant human monoclonal antibodies against different conformational epitopes of the E2 envelope glycoprotein of hepatitis C virus that inhibit its interaction with CD81. J Gen Virol 2000; 81: 2451-2459. PMID: 10993933.

[0402] 5

[0403] Bukh J, Purcell RH, Miller RH. Proc Natl Acad Sci USA 1994; 90: 8234-8238.

[0404] Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M.

[0405] Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis 0 genome. Science. 1989;244: 359-62. doi: 10.1126 / science.2523562. PMID: 2523562Damelang T, Brinkhaus M, van Osch TU, Schuurman J, Labrijn AF, Rispens T, Vidarsson G. Impact of structural modifications of IgG antibodies on effector functions. Front Immunol. 2024 Jan 8:14:1304365. PMID: 38259472. DOI:

[0406] 10.3389 / fimmu.2023.1304365

[0407] de la Fuente C, Catanese MT. Production and Purification of Cell Culture Hepatitis C Virus, pp105-120. In Mansun Law (ed.), Hepatitis C Virus Protocols, Methods in Molecular Biology, vol. 1911, Springer Science& Business Media, LLC, part of Springer Nature, 2019. doi.org / 10.1007 / 978-1-4939-8976-8_30.

[0408] Johansson DX, Voisset C, Tarr AW, Aung M, Ball JK, Dubuisson J, Persson MAA.

[0409] Human combinatorial libraries yield rare antibodies that broadly neutralize hepatitis C virus. Proc Natl Acad Sci USA 2007; 104:16269-16274. E-pub ahead of print Oct. 2, 2007.

[0410] Page K, Melia MT, Veenhuis RT, Winter M, Rousseau KE, Massaccesi G, Osburn WO, Forman M, Thomas E, Thornton K, Wagner K, Vassilev V, Lin L, Lum PJ, Giudice LC, Stein E, Asher A, Chang S, Gorman R, Ghany MG, Liang TJ, Wierzbicki MR, Scarselli E, Nicosia A, Folgori A, Capone S, Cox AL. Randomized Trial of a Vaccine Regimen to Prevent Chronic HCV Infection. N Engl J Med 2021; 384:541-549.

[0411] doi: 10.1056 / NEJMoa2023345. PMID: 33567193

[0412] Prentoe J, Bukh J. In Vitro Neutralization Assay Using Cultured Hepatitis C Virus, pp 433-39. In Mansun Law (ed.), Hepatitis C Virus Protocols, Methods in Molecular Biology, vol. 1911, Springer Science& Business Media, LLC, part of Springer Nature, 2019. doi.org / 10.1007 / 978-1-4939-8976-8_30.

[0413] Rath S, Stanley CM, and Steward MW. An inhibition enzyme immunoassay for estimating relative antibody affinity and affinity heterogeneity. Journal of Immunological Methods 1988; 106: 245-249Riva L. and Dubuisson, J. Similarities and Differences Between HCV Pseudoparticle (HCVpp) and Cell Culture HCV (HCVcc) in the Study of HCV. In: Mansun Law (ed.), Hepatitis C Virus Protocols, Methods in Molecular Biology, 2019, vol. 1911, https: / / doi.org / 10.1007 / 978-1-4939-8976-8_2.

[0414] Salas JH, Urbanowicz RA, Guest JD, Frumento N, Figueroa A, Clark KE, Keck Z, Cowton VM, Cole SJ, Patel AH, Fuerst TR, Drummer HE, Major M, Tarr AW, Ball JK, Law M, Pierce BG, Foung SKH, Bailey JR. An Antigenically Diverse, Representative Panel of Envelope Glycoproteins for Hepatitis C Virus Vaccine Development.

[0415] Gastroenterology. 2022 Feb;162(2):562-574. doi: 10.1053 / j.gastro.2021.10.005. Epub 2021 Oct 13. PMID: 34655573

[0416] Simmonds P, Holmes EC, Cha TA, Chan SW, McOmish F, Irvine B, Beall E, Yap PL, Kolberg J, Urdea MS. J Gen Virol 1993; 74: 2391-2399.6.

[0417] Tarr A, Owsianka A, Szwejk A, Ball JK, Patel A. 2007. Cloning, expression, and functional analysis of patient-derived hepatitis C virus glycoproteins. Methods Mol Biol 379:177-197. dx.doi.org / 10.1007 / 978-1-59745-393-6_13.

[0418] Urbanowicz RA, McClure CP, Brown RJ, Tsoleridis T, Persson MA, Krey T, Irving WL, Ball JK, Tarr AW. A Diverse Panel of Hepatitis C Virus Glycoproteins for Use in Vaccine Research Reveals Extremes of Monoclonal Antibody Neutralization Resistance. J Virol. 2016; 90:3288-3301. doi: 10.1128 / JVI.02700-15. PMID: 26699643.

[0419] Vo-Quang E, Pawlotsky J. M.. Unusual' HCV genotype subtypes: origin, distribution, sensitivity to direct-acting antiviral drugs and behaviour on antiviral treatment and retreatment Gut 2024;73:1570-1582. doi: 10.1136 / gutjnl-2024-332177

[0420] PMID: 38782565.Wang W, Singh S, Zeng D L, King K, Nema S. Antibody Structure, Instability, and Formulation. J Pharm Sci, 2007, 96:1-26.

[0421] Wasilewski L, Ray S, Bailey JR. Hepatitis C virus resistance to broadly neutralizing 5 antibodies measured using replication competent virus and pseudoparticles. J Gen Virol 2016; 97: 2883-2893.

[0422] Experiments

[0423] 0

[0424] Experiment 1

[0425] 1.1 The goal of the experiment

[0426] The goal of this experiment was to improve the antiviral effects of a human monoclonal antibody with broad neutralizing reactivity to different HCV strains 5 and / or genotypes by light chain shuffling. The antibody was antibody 1:7, disclosed in Allander et al., 2000. In the present disclosure, VL and VH of 1:7 according to Allander et al is represented by SEQ ID NO: 82 and 83.

[0427] 1.2 Material and methods

[0428] 0 1:7

[0429] The published antibody 1:7 was originally isolated from a gamma1 / kappa combinatorial Fab-library displayed on phage, according to Allander et al.

[0430] Briefly, the Fab library of Allander et al was generated from lymphocytes drawn from a male donor (donor A) infected with HCV of genotype 2b. The resulting antibodies 5 were isolated by panning the library against HCV-E2 antigen of genotype la, thus possibly resulting in antibodies with the potential to cross react with distinct HCV genotypes.1:7 VH with new light chain

[0431] In an effort to generate improved anti-HCV antibodies from clone 1:7, a new phage displayed Fab-library was generated. The new library contained the conserved 1:7 Fd heavy chain in all members of the library, while exchanging the 1:7 light chain kappa cDNA with the original kappa light chain library from donor A.

[0432] To do this, the pComb3H phagemid containing the 1:7 Fd-chain and 1:7 kappa light chain was propagated in E.coli XL-1 blue cells and isolated according to standard procedures (and as shown in Allander et al., 2000). Subsequently, it was cleaved with restriction enzymes EcoRI and Xhol (New England Biolabs) according to the manufacturer's recommendations. The resulting plasmid DNA was separated on an agarose gel. The 3.8 kB plasmid DNA and the 0,8 kB LC DNA were identified via EthBr and recovered from the gel using standard procedures (and as shown in Allander et al., 2000).

[0433] Similarly, the whole light chain library originally cloned from donor A was isolated by treating the original gamma1 / kappa library plasmid DNA from donor A with restriction endonucleases EcoRI and Xhol, and the cDNA coding for the light chain library similarly isolated (0,8kB fragment)..

[0434] Next, the digested 3.8 kB pCOMB3H phagemid DNA carrying heavy chain cDNA of clone 1:7, but lacking the 1:7 kappa light chain, was ligated with the library of kappa light chain cDNAs from the donor A (isolated as described above), in a ligating reaction according to standard procedures using T4 ligase (New England Biolabs).

[0435] The ligated phagemid was electroporated into XL-1 Blue cells, and the resulting transformed E.coli propagated overnight in LB with 50ug / ml ampicillin. The following day, the plasmids resulting from the ligated material were isolated from the bacteria using standard plasmid preparation reagents. In parallel, dilutions of the bacteria were spread on LB-agar plates with ampicillin, and plasmids from 10 random clones were analyzed by relevant restriction enzyme digestions (Sacl+Xbal and Xhol+Spel, respectively). All 10 clones were found to have been correctly formed.

[0436] A small portion (50u I) of the plasmid DNA prepared above comprising the new Fab library (heavy chain 1:7 and the Ilight chain library from donor A) was used totransform XL 1-Blue cells by electroporation, 3 ml of SOC medium was added, and the culture was shaken for 1 hr at 37°. It was then transferred to 10 ml of SB medium (super broth) containing ampicillin {20 pg / ml), and 1% glu-cose and shaken for 1 hr at 37°. One hundred milliliters of SB with ampicillin (50 pg / ml} and 1% glucose was then added and the culture was grown at 37° until reaching an optical density (OD) at 600 nm of 0.5-0.7. At this point, cells were pelleted and resuspended in SB containing ampicillin (50 pg / ml), 2 mM isopropyl-, B-o-thio-galacto-pyranoside (IPTG), and helper phage VCS-M 13 (2x10¹¹ pfu). Kanamycin was added after 2 hrs, and the cultures were subject to additional growth overnight at 30° C. The resulting phages were recovered by precipitation using PEG(poly-ethenyl-glycol)as has been described in numerous publications (also in Allander et al., 2000). The final phage preparation was titrated by growing phage infected E.coli on LB-agar with ampicillin. In the resulting new Fab-library, all the Fab-clones have the 1:7 heavy chain, but are paired with a large population of different light chains from the original Fab library.

[0437] Biopanning

[0438] Panning of the new library was performed in four rounds, each with decreasing concentration of the antigen Hepatitis C virus envelope glycoprotein E2 genotype la (HCV-E2 gt la).

[0439] 100 pl of the phage preparation (prepared as described above), representing the new Fab-library, was diluted in 400pl PBS, and then mixed with the antigen (HCV E2 protein of genotype la fused to a Strep-tag), in decreasing concentrations. The phage + antigen solution was set to mix in room temperature on a slow spinning wheel for one hour, and the antigen and specific antibodies displayed on phage, if any, pulled down using streptavidin coated magnetic beads. The tubes were placed in a magnetic rack, and washed with PBS with 0,01% Tween-20 (PBS-T below) twice. Finally, phage bound to the antigen were released into the medium by adding 500 pl PBS with Desthiobiotin. After 5 minutes at RT, the solution was pipetted off and used to infect E.coli, in order to propagate phage as described above (and in Allander et al., 2000). The solution used to infect E.coli represents the population of phage enriched for binding to the E2 antigen. After propagation and standard preparation of phage using PEG, the phage preparation was used for the nextpanning round using the same protocol described above. The concentrations of antigen in the respective panning rounds were 500nM in the first round, 50 nM in the second, 5 nM in the third, and finally 1 nM in the final, fourth round.

[0440] After completion of the bio-panning steps, F'+ E coli were infected with output phage and plated on Amp+ plates. Approximately 100 random colonies were picked and individually grown overnight in expression media. Fab containing supernatants were screened against both Fab content (Fd Elisa) and reactivity towards sE2-2b antigen. Positive E2-2b clones were sent for sequencing.

[0441] 10 clones representing novel antibodies, i.e. having mutated or clearly different light chains than clone 1:7, were selected based on distinct amino acid sequences, and improved E2 reactivity (in ELISA) in relation to Fab-content. The 10 clones were expressed as full length IgGl / kappa, and further tested in neutralization assays.

[0442] Standard ELISA for IgG concentration orsE2-2b reactivity

[0443] As appreciated by a person of skill in the art, sE2-2b is a recombinantly produced soluble HCV E2 genotype 2b, which lacks the membrane entering part present in the wt HCV E2 protein.

[0444] The produced IgG proteins were tested for binding to sE2, or for concentration by ELISA (as per standard procedure, all concentrations used based on BCA). The test was either:

[0445] 1. Coating the wells of a microtiter plate with anti-Fd antibody (detecting the Fd region of IgG, and then detecting bound antibodies with anti-Kappa-AP.

[0446] 2. Coating the wells of a microtiter plate with the antigen sE2-2b, and then detecting bound antibodies with anti-Kappa-AP.

[0447] For the first step, the anti-Fd antibody or antigen sE2-2b was incubated in the wells for 4 hrs in RT, thereafter washed three times with PBS-T, and samples to be tested were added to the wells, diluted in PBS-T at two to four different dilutions. After incubation at RT for at least 1-2 hrs and four washes with PBS-T and a final one with PBS, detection reagent was added (anti-Kappa-AP). The reaction was incubated for 1 hr at RT, washed x 3 with PBS-T, and once in PBS, and the substrate " KPL Blue Phos"added, that contains 5-bromo-4 chloro-3-indolyl phosphate (BCIP) that is converted by alkaline phosphatase through several intermediate steps, via an oxidation / reduction reaction with a tetrazolium compound that eventually is reduced to the corresponding formazan. Using proprietary reagents supplied by the company providing the KLP Blue Phos-kit, the formazan exists as a soluble blue chromophore with an absorbance maximum near 600 nm. Accordingly, optical density (OD) was measured at 595 nm for both assays after 15, 30 and 60 minutes.

[0448] Inhibition ELISA

[0449] The wells of microtiter plates were coated with sE2 protein of the gt2b and gt la variants. Antibodies were mixed with decreasing amounts of sE2 protein, and added to the wells. After incubation at RT for 2 h, the wells were washed and detection reagent, ALP-conjugated anti human IgG, was added. The reaction was set to incubate for 1 h, then the solution was discarded and the wells were washed x 3 in PBS-Tween, and a final was in PBS. Substrate " KPL Blue Phos" was added (as described above) and the reaction read at 595nm at various time points. The results are shown in table 3.

[0450] In vitro neutralization assays

[0451] The discovery of the hepatitis C virus (HCV) was published in 1989 (Cho et al., 1989). However, for several years there was no system to test for infectivity of the virus in vitro, and thus not possible to readily assess if antibodies could inhibit the infectivity of the virus, so called virus neutralization.

[0452] The first successful attempt was the pseudo-particle system (pp-system), where a capsid protein from a retrovirus is co-expressed in a mammalian cell line in combination with expression of the HCV El and E2 proteins in the same cell (and a reporter gene). The result is a particle formed by the capsid protein, covered with the El and E2 proteins on its surface (a pseudo particle). Upon infection into a cell, expression of the reporter gene allows detection and quantification of successful entry. The El and E2 proteins are very important for entry and infectivity if the virus, so with the pp-system neutralization by antibodies to El or E2 could be assessed.Still, a system based on proper HCV particles was sought for, and finally the cc-system was developed from a HCV virus derived from a patient with fulminant hepatitis, the JFH-1 isolate. It allowed exchange of the E1E2 genes by recombinant techniques, resulting in proper HCV particles with E1E2 proteins of the experimenter's choice on its surface. Thus, panels of HCV particles presenting E1E2 proteins of different genotypes, and indeed from different infected humans, have been established. A review about the pp- and cc-systems in found in Riva & Dubuisson, 2019.

[0453] In the present disclosure, the antibodies were tested in the pp-system, and some also assessed with the cc-system. For detailed descriptions on how the different patient derived clones of E1-E2 cDNA was generated and used in the pp- and cc-systems, please see Urbanowicz RA, et al, 2016. Of note, data has been published showing a strong positive correlation between neutralization data for the same E1E2 isolate tested in parallel in the pp- and cc-systems (Wasilewski et al., 2016).

[0454] Antibody 1:7 has previously been tested in the pp-system (Johansson et al., 2007).

[0455] The present monoclonal antibodies were produced as IgG proteins and tested for in vitro neutralization of HCV, with

[0456] / .) the pseudo-particle (pp-) assay, where a retrovirus carries the HCV El and E2 membrane proteins on its surface, and

[0457] ii.) using the cc-assay, where cell cultured HCV virus is recombinantly manipulated to carry the El and E2 from various HCV strains. For both the pp and the cc assays, E1 / E2 RNA from a published panel of patient derived clones were used (Urbanovicz et al, 2016), as well as standard laboratory strains (H77, JFH-1, and J6).

[0458] HCV Retroviral Pseudoparticle Neutralization Assay

[0459] HCVpp assays were produced as described in detail in Tarr et al., 2007. Plasmids encoding HCV envelope glycoproteins of gtl, 2 and 3 were used to create HCVpp displaying E1E2 of the major genotypes (as shown in Table 1). Pseudoparticles generated in the absence of the E1E2 plasmid were used as a negative control. Retrovirus core expression, for a subset of HCVpp production runs, was analyzed by Western blotting, and there were no discernible differences in expression levels.Supernatants containing the pseudotyped particles were harvested 48 h after transfection and filtered through 0.45-pm-pore membranes. The pseudoparticles were mixed with defined concentrations of mAbs, placed for 1 h at 37°C, and then incubated with 1.5x104Huh-7 cells seeded in 96-well plates. 72hrs post-infection the cells were lyzed with cell lysis buffer (Promega), and luciferase activity measured with a BMG Fluostar Optima. All assays were done in triplicate. The 50% inhibitory concentration (IC50) titer was calculated as the MAb concentration that caused a 50% reduction in relative light units (RLU) compared to the level in the virus control wells after subtraction of cell control RLU. All the data were fitted

[0460] using nonlinear regression plots with no constraint on the Hill slope (GraphPad Prs version 6.05).

[0461] Infectious HCV Neutralization tests (cc assay)

[0462] The plasmid pJFH-1, containing the full-length cDNA of JFH-1 isolate and kindly provided by T. Wakita (Tokyo, Japan) was used to generate HCVcc. Detailed protocols for growing HCV and perform the cc-assay has been published (de la Fuente & Catanese, 2019, and Prentoe & Bukh, 2019). Briefly, the pJFHl plasmid - as original JFH-1 virus or clones where E1 / E2 had been replaced with patient derived El / E2 genes - was linearized and used as a template for in vitro transcription with the MEGAscript kit from Ambion. The transcribed RNA was delivered to Huh-7 cells by electroporation, and viral stocks were obtained by harvesting cell culture supernatants at 3-4 days after transfection.

[0463] For the neutralization tests, HCVcc were incubated with antibodies at indiccated concentrations for 1 h at 37°C and then added to Huh-7 cells seeded the day before in 24-well plates, and incubated for 2 h at 37°C. The supernatants were then removed, and the infected cells were incubated at 37°C. At 48 h after infection, HCVcc infection level was determined by comparison to the number of cells infected in the absence of inhibitors, as determined by NS5A staining with MAb 9E10.

[0464] Percentage infection was determined by comparison to the number of cells infectedin the absence of inhibitors. Statistical significance was determined performing a one-way ANOVA with Bonferroni correction for multiple comparisons.

[0465] 1.3 Results

[0466] Novel antibody clones isolated from the light chain shuffled library

[0467] From the first screen of Fab-antibodies binding to the HCV E2 gtla protein, approximately 40 antibodies were sequenced, and 10 distinct clones further characterized. Their novel light chains either was of the same VkaPPa- germ line gene as 1:7, or belonged to three different Vkappa-germ line genes (Table 2). 10 new light chain sequences identified; 7 with the same V-gene LC, 3 with different V-gene germline from 1:7 LC.

[0468] Table 2. Sequences of ten novel anti-HCV E2 antibodies, all sharing the heavy chain from the 1:7 antibody combined with a novel light chain. The amount of amino acids that differs from 1:7 wt are indicated.

[0469] IgGl LC Top V-gene Top J- aa diff VL-CDR1 VL-CDR2 VL-CDR3 gene fr 1:7

[0470] 1:7 wt IGKV3-11*01 IGKJ4*01 - RASQSVNKYLA DASNRAT QQRSDWVT (SEQ ID NO:78) (SEQ ID NO:22) (SEQ ID NQ:80) IGKV3-11*01 IGKJ4*01 9 RASQSVSSYLA DASKRAT QQRSDRPT R2A6 (SEQ ID NO:11) (SEQ ID NO:21) (SEQ ID NO:31) IGKV3-11*01 IGKJ5*01 11 RASQSVGSYLA DASNRAT QQRSNWIT R2C7 (SEQ ID NO:12) (SEQ ID NO:22) (SEQ ID NO: 32 IGKV3-11*01 IGKJ2*01 8 RASQSVGSYLA DASNRAT QQRSNWNT R2C9 (SEQ ID NO:12) (SEQ ID NO:22) (SEQ ID NO:33) IGKV3-11*01 IGKJ4*01 6 RASQSVSSYLA DASNRAT QQRSDGTT R2F1 (SEQ ID NO:11) (SEQ ID NO:22) (SEQ ID NO:34) IGKV3-11*01 IGKJ2*02 10 RASQSVSNYLA DASNRAA QQRAKWST R2G8 (SEQ ID NO:15) (SEQ ID NO:25) (SEQ ID NO:35) IGKV3-11*01 IGKJ2*02 12 RASQSVDNYLA DASNRAS QQRNKWST R4B11 (SEQ ID NO:16) (SEQ ID NO:26) (SEQ ID NO:36) IGKV3-11*01 IGKJ2*01 17 RASQSVSNNLA DASTRAA QQRNTWNT R4C10 (SEQ ID NO:17) (SEQ ID NO:27) (SEQ ID NO:37) IGKV3-9*01 IGKJ5*01 31 RASQGISTDLA AASTLQS QQFNTWVT R3A11 (SEQ ID NO:18) (SEQ ID NO:28) (SEQ ID NO:38) IGKV3-20*01 IGKJ1*01 17 RASQSVSSNSLA VTSSRAT QQYGNSPWT R3E8 (SEQ ID NO:19) (SEQ ID NO:29) (SEQ ID NO:39) IGKV3-39*01 IGKJ2*01 39 RANQTITNYLN AASSLQS QQNYNTPHT

[0471]

[0472] R4G3 (SEQ ID NQ:20) (SEQ ID NQ:30) (SEQ ID NQ:40)Inhibition ELISA

[0473] Table 3. IC50 for E2(2b) from inhibition ELISA

[0474] LC variant pig / mL E2(2b) nM E2 Top 5

[0475] R2A6 2.51 38.73 *

[0476] R3A11 4.52 69.54

[0477] R4B11 2.10 32.31 *

[0478] R2C7 3.45 58.08

[0479] R2C9 1.95 30.00 *

[0480] R4C10 2.20 33.85 *

[0481] R2F1 5.56 85.54

[0482] R2G8 2.30 35.38 *

[0483]

[0484] 1:7 Sino 3.28 50.46

[0485] Top 5 with lowest IC50 values were sent to Nottingham for PP and CC neutralization tests. Eight new clones were ranked for affinity using an inhibition-ELISA. The five clones with highest affinity (*top 5 in table 3) were further analyzed for in vitro neutralization in the HCV pp and HCV cc system (J KB).In vitro neutralization assays

[0486] Table 4. IC50 values for the five new clones with apparent best affinity for the antigen. In vitro HCVpp neutralization data are presented in the two top sections (H-77.20 pp and J6 p.p.), and in vitro HCV cc neutralization data are stated in the lower two sections JFH-1 cc and J6 cc.

[0487] Clone 1:7 R2A6 R2C9 R2G8 R4B11 R4C10 H-77.20pp

[0488] IC40 0.87 11.07 0.38* 0.41* 0.58* 0.65*

[0489] R square 0.93 0.85 -0.37** 0.63 0.94 0.82

[0490] J6 p.p.

[0491] IC50 26.5 19.6* 7.40* 4.62* 11.2* 11.9*

[0492] R square 0.48** 0.59** 0.91 0.70 0.57** 0.66

[0493] JFH-lcc

[0494] IC50 3.73 4.29 4.47 3.05* 26.81 6.19

[0495] R square 0.86 0.84 0.29** 0.48 0.73 0.89

[0496] J6cc

[0497] IC50 12.1 6.16* 7.66* 3.07* 3.21* 11.7*

[0498] R square 0.79 0.78 0.001** 0.86 0.36 0.86

[0499] *) Improvement over 1:7

[0500] **)R square < 0.6

[0501] 1.4 Conclusions drawn from the experiment

[0502] • Ten new clones were identified and characterized. Seven of them had point mutations compared to 1:7, but shared the same V-kappa germline gene as the original 1:7 clone (IGKV3-ll*01), while three clones also had distinct V-kappa germ line genes (IGKV1-9*01, IGKV3-20*01, and IGKV1-39*01) (Table 2).

[0503] • Five clones were selected based on highest affinity and tested for virus neutralization in the HCV pp and HCV cc assays. All of the five clones showed improvement over 1:7 for at least one of the antigen isolates. Of these, clone 2G8 had the best improvement compared to the original 1:7 clone. In particular, clone 2G8 was able to neutralize the J6 virus (in pp and cc systems; the J6 isolate is considered more difficult to neutralize than H77, so the clear reduction in IC50 titre for antibody 2G8 was deemed quite promising (Table 4). Surprisingly, clone 2G8 didnot have the highest affinity of the new clones, but still the most improved neutralization titre. Thus, affinity alone cannot explain the improved neutralization capacity.

[0504] Experiment 2

[0505] 2.1 The goal of the experiment

[0506] To identify amino acid residues of critical importance for the binding of anti-HCV antibody HCV-1:7 (and antibody G8, sharing the same heavy chain) to its cognate antigen, the HCV envelope protein E2.

[0507] 2.2 Material and methods

[0508] Wildtype Heavy Chain CDR3 in lgGl:7 (identical heavy chain to G8) was mutated in 8 positions (bold font): V V I P N A I R H T M G Y Y F D Y (SEQ ID NO:41) Oligos with codon change to GCA (Alanine) for the 8 different amino acid residues to be changed were purchased from MWG Eurofins Genomics.

[0509] Table 5. Oligo nucleotides used as PCT primers to achieve the Ala-mutations.

[0510] Position to be Name of Neucleotide sequence

[0511] Mutated SEQ ID NO:81) primer

[0512] VVIP / VAIRHTMGYYFDY N to A fwd CTGTGCGAGAGTCGTAATACCAGCAGCAATCCGGCACACGATGG (SEQ ID NO:100)

[0513] VVIP / VAIRHTMGYYFDY N to A rev CCATCGTGTGCCGGATTGCTGCTGGTATTACGACTCTCGCACAG (SEQ ID NO:101)

[0514] VVIPNAIRHTMGYYFDY R to A fwd GCGAGAGTCGTAATACCAAATGCAATCGCACACACGATGGGATA TTACTTTGACTACTGG (SEQ ID NO:102) VVIPNAIRHTMGYYFDY R to A rev CCAGTAGTCAAAGTAATATCCCATCGTGTGTGCGATTGCATTTGG TATTACGACTCTCGC (SEQ ID NO:103) VVIPNAIRHTMGYYFDY H to A fwd GAGTCGTAATACCAAATGCAATCCGGGCAACGATGGGATATTACT TTGACTACTGG (SEQ ID NO:104) VVIPNAIRHTMGYYFDY H to A rev CCAGTAGTCAAAGTAATATCCCATCGTTGCCCGGATTGCATTTGG TATTACGACTC (SEQ ID NO:105) VVIPNAIRHTMGYYFDY T to A fwd CGTAATACCAAATGCAATCCGGCACGCAATGGGATATTACTTTGA CTACTGG (SEQ ID NO:106)

[0515]

[0516] VVIPNAIRHTMGYYFDY T to A rev CCAGTAGTCAAAGTAATATCCCATTGCGTGCCGGATTGCATTTGG TATTACG (SEQ ID NO:107)

[0517] VVIPNAIRHTMGYYFDY G to A fwd CCAAATGCAATCCGGCACACGATGGCATATTACTTTGACTACTGG GGCC (SEQ ID NO:108)

[0518] VVIPNAIRHTMGYYFDY G to A rev GGCCCCAGTAGTCAAAGTAATATGCCATCGTGTGCCGGATTGCAT TTGG (SEQ ID NO:109)

[0519] VVIPNAIRHTMGYYFDY Y1 to A GCAATCCGGCACACGATGGGAGCATACTTTGACTACTGGGGCCA fwd GG (SEQ ID NQ:110)

[0520] VVIPNAIRHTMGYYFDY Y1 to A rev CCTGGCCCCAGTAGTCAAAGTATGCTCCCATCGTGTGCCGGATTG C (SEQ ID NO:111)

[0521] VVIPNAIRHTMGYYFDY Y2 to A GCAATCCGGCACACGATGGGATATGCATTTGACTACTGGGGCCA fwd GGG (SEQ ID NO:112)

[0522] VVIPNAIRHTMGYYFDY Y2 to A rev CCCTGGCCCCAGTAGTCAAATGCATATCCCATCGTGTGCCGGATT GC (SEQ ID NO:113)

[0523] VVIPNAIRHTMGYYFDY F to A fwd GCAATCCGGCACACGATGGGATATTACGCAGACTACTGGGGCCA GGGAACC (SEQ ID NO:114)

[0524] VVIPNAIRHTMGYYFDY F to A rev GGTTCCCTGGCCCCAGTAGTCTGCGTAATATCCCATCGTGTGCCG

[0525]

[0526] GATTGC (SEQ ID NO:115)

[0527] Oligo primers were used in PCR reaction with the in-house vector pcIgG1+1:7 as template, i.e. the vector pcIgGl (accession MK988448.1) containing the cDNA for clone 1-7 VH and VL allowing expression of 1-7 as human IgGl).

[0528] PCR enzyme kit (Q5 High Fidelity) was purchased from New England Biolabs and used as per protocol. Two separate PCR reactions were set up, A and B. One with the mutated fwd oligo plus BGH rev and one with pcIgG1xholfwd plus the mutated rev oligo.

[0529] BGH rev: 5'- TAGAAGGCACAGTCGAGG -3' (SEQ ID NO:116)

[0530] pcIgG1xholfwd: 5' - CAGGTGCAACTGCTCGAGCAGTC - 3 (SEQ ID NO:117)

[0531] Each PCR product was gel purified using Qiagen Gel Extraction Kit. Product A was approx. 1100 bp and product B approx. 350 bp.

[0532] A second PCR reaction was set up using a mixture of PCR products A and B as template along with the primers pcigg1xholfwd and BGHrev, the PCR reaction following the same parameters as in PCR reaction 1. The app 1500bp product was cut with Xhol and Agel, gel purified and ligated into pcIgG1:7 cut with same Xhol and Age I.

[0533] Plasmids were ligated with New England Biolabs T4 Ligase kit (M0202) as per protocol. Ligation reactions were transformed into NEBlOb cells (New England Biolabs) and colonies were screened for mutations by sequencing. They were all found to be as designed.Plasmid preparations were prepared of G8 IgG with the respective mutations according to Table 5.

[0534] HEK293 cells were transfected with the respective plasmids coding for G8 IgG with the CDRH3 region mutated to alanine at single positions as detailed above. The cells were cultivated in 25 ml om media at 37 C, 5% Co2, for 48 hours and the supernatant harvested. The monoclonal IgG was isolated by affinity chromatography to a Protein G column and tested for binding to HCV-E2 gt la in ELISA (according to the procedure disclosed in Johansson et al, PNAS 2007).

[0535] 2.3 Results

[0536] Mutations in the CDR3-H region of antibody G8. Plasmids carrying the Ala-mutated CDRH-3 1:7 clones were sequences for the VH regions and determined to show the designed sequences (Table 6 lists VH-CDR3, and Sequences 79 and 85-91 shows the mutated VH sequence, based on VH of G8 (SEQ ID NO:64).

[0537] Table 6.

[0538] G8 CDRH3 VVIPNAIRHTMGYYFDY SEQ ID NO:41

[0539] G8 VH N104A CDRH3 VVIPAAIRHTMGYYFDY SEQ ID NO:92

[0540] G8 VH R107A CDRH3 VVIPNAIAHTMGYYFDY SEQ ID NO:93

[0541] G8 VH H108A CDRH3 VVIPNAIRATMGYYFDY SEQ ID NO:94

[0542] G8 VH T109A CDRH3 VVIPNAIRHAMGYYFDY SEQ ID NO:95

[0543] G8 VH G111A CDRH3 VVIPNAIRHTMAYYFDY SEQ ID NO:96

[0544] G8 VH Y112A CDRH3 VVIPNAIRHTMGAYFDY SEQ ID NO:97

[0545] G8 VH Y113A CDRH3 VVIPNAIRHTMGYAFDY SEQ ID NO:98

[0546] G8 VH F114A CDRH3 VVIPNAIRHTMGYYADY SEQ ID NO:99

[0547]

[0548] Effects on binding to the HCV E2 protein. Eight different plasmid constructs were generated that successfully could be used to express antibody G8. In each construct, one of the following CDR-H3 amino acid residues (in bold) had been changed into Alanine:

[0549] V V I P N A I R H T M G Y Y F D Y (G8, SEQ ID NO: 41).

[0550] The greatest reductions in binding to HCV-E2 proteins of the la and 2b genotype, respectively, were seen for the two antibody clones where H108 or G 111 in the CDR3-H region had been changed to an alanine residue (Figure 1). The mutants H104A and G111A did show the most reduced binding of the nine mutants.

[0551] Unexpectedly, the N104A mutation increased the binding of the G8 antibody to HCV- E2 protein of both genotype la and 2b.2.4 Conclusions drawn from the experiment

[0552] - The amino acid residues H108 or G 111 of the CDR3-H were critically important for clones 1:7 and G8 in binding to the HCV-E2 proteins (Figure 1).

[0553] - The region N104 to Y112 of the CDR3-H sequence of clone G8 was selected for further mutations for an attempt to make additional improvements, if any, to the antiviral effects of the G8 antibody (as described in Experiment 3 below).

[0554] - In addition, it was noted that the N104A mutation clearly improved the reactivity of G8 to its cognate antigen HCV E2 (Figure 1, the panel in upper left corner).

[0555] Experiment 3

[0556] 3.1 The goal of the experiment

[0557] To further improve the antiviral effect of antibody R2G8 (developed in Experiment 1, herein also denoted " G8") by isolating novel antibody clones with mutations in the CDR3 heavy chain region of R2G8. Amino acid residues positions identified in Experiment 2 as important for the antibody's binding to the HCV envelope protein E2 were selected for mutation. The experimental design in selecting antibodies with new CDRH-3 sequences aimed at isolating mutant antibodies of higher affinity than G8.

[0558] 3.2 Material and methods

[0559] Introduction of random mutations on certain amino acid positions in the CDR3-H region of clone G8

[0560] In Experiment 2, we observed that two amino acid residues, H108 and Gill in the CDR3-H region comprising NAIRHTMGY (SEQ ID NO: 77), were critical to allow binding between the antibody and the HCV-E2 proteins. Gill was kept intact, while other amino acid residues in the CDR3-H region were mutated in a random fashion using so called wobble oligos in PCR reactions. VH of monoclonal antibody R2G8 was used as template (SEQ ID NO: 64). The primers containing wobble oligos were ordered custom synthesized with random exchange of the first and / or the second nucleotide in selected, tri-nucleotides of the template sequence.Design of wobble oligos

[0561] In the CDR3-H region, the following highlighted section was selected for mutagenesis:

[0562] VVIPNAIRHTMGYYFDY (SEQID NO:41)

[0563] >pComb3H_l_7 (CDRH3) GTCGTAATACCAAATGCAATCCGGCACACGATGGGATATTACTTTGACTAC (SEQ ID NO:118) V_V_I_P_N_A_I_R_H_T_M_G_Y_Y_F_D_Y_ SEQ ID NO: 41

[0564] >1_7 CDRH3 including Apal cleavage site (underlined) GTGCGAGAGTCGTAATACCAAATGCAATCCGGCACACGATGGGATATTACTTTGACTACTGGG GCCAGGGAACCCTGGTCACCGTCTCCTCAGCCTCCACCAAGGGCCCATCGGT (SEQ ID NO:119)

[0565] Two different primers were designed (note! It is the reverse primers that was ordered):

[0566] • NNK_1-7CDRH3: where all grey highlighted codons are replaced with NNK at a low rate (so that 1-2 aa changes will occur / clone)

[0567] • HY_NNK_1-7CDRH3: where all grey highlighted codons except the red texted are replaced with NNK at a low rate (so that 1-2 aa changes will occur / clone)

[0568] In the following two sequences > NNK_1-7CDRH3 and > HY_NNK_1-7CDRH3, wobble bases were introduced as follows:

[0569] Positions shown as capital letters were not modified. All positions shown as small letters are wobble positions, were nucleotide variation was allowed. Underlined positions was varied as "n" below. Bold positions was varied as "n" below.

[0570] • N = 100% (non-modified base)

[0571] • n = 70% n, 10%+10%+10% of each other base

[0572] • n = 70% n, 15% C, 15% A

[0573] > NNK_1-7CDRH3 GTGCGAGAGTCGTAATACCAaatgcaatccggcacacgatgGGAtatTACTTTGACTACTGGGGCCA GGGAACCCTGGTCACCGTCTCCTCAGCCTCCACCAAGGGCCCATCGGT (rev.c.) SEQ ID NO:1195'- ACCGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGT CAAAGTAataTCCcatcgtgtgccggattgcattTGGTATTACGACTCTCGCAC-3' SEQ ID NO:120

[0574] > HY_NNK_1-7CDRH3 GTGCGAGAGTCGTAATACCAaatgcaatccggCACacgatgGGATATTACTTTGACTACTGGGGCC AGGGAACCCTGGTCACCGTCTCCTCAGCCTCCACCAAGGGCCCATCGGT (rev.c) SEQ ID NO:119

[0575] 5'- ACCGATGGGCCCTTGGTGGAGGCTGAGGAGACGGTGACCAGGGTTCCCTGGCCCCAGTAGT CAAAGTAATATCCcatcgtGTGccggattgcattTGGTATTACGACTCTCGCAC-3' SEQ ID NO:120 In addition, the following primers was used:

[0576] > PelSeq: ACCTATTGCCTACGGCAGCCG (SEQ ID NO:81)

[0577] In the PCR reactions with wobble oligos, the template used was pComb3H-l:7, and the primers were:

[0578] PelSeq + NNK_1-7CDRH3

[0579] PelSeq + HY_NNK_1-7CDRH3

[0580] PCR product was expected and confirmed to be 450bp (data not shown).

[0581] The products were cut with Xbal and Apal. The lower band of the cut PCR product (~450bp) was cut out from the gel. The DNA in the cut out band was purified from the gel using Qiagen gel purification kit. The vector was also cut with Xbal and Apal, and in addition digested with Ncol to reduce background.

[0582] Preparation of total library 2: Library ligation

[0583] The following components (prepared as mentioned just above) were ligated (molar ratio Vector / lnsert: 1 / 3):

[0584] 1. 0.48ug pComb3H-R2G8 + 0.15ug CDRH3_ALL

[0585] 2. 0.48ug pComb3H-R2G8 + 0.15ug CDRH3_HY

[0586] 3. 0.48ug pComb3H-R2G8 (background control)

[0587] - Total volume of 25ul (NEB T4 ligase). Incubation was performed at RT for 2h and thereafter heat inactivated at 65 degrees C for 15min, the dialyzed on floating membrane for 20min.5ul of the ligation product was mixed with 70 µl XL1blue E.coli bacteria which were transfected with the ligations by electroporation. Recorded time constants for the electroporations were between 4.36-4.40 ms.

[0588] - The bacteria were recovered in 2ml SOC and shaken at 37C for lh.

[0589] All the transfected bacteria were plated on four large amp-tet-glucose plates, that were incubated over night at 30C. These plates where thereafter used in preparation of the Phage stock of Library 2 described below Mats: korrekt?.

[0590] Phage stock of Library 2

[0591] A phage stock of Library 2 was prepared in the following way. The plates from the total library 2 were scraped into a total volume of 12ml resulting in OD₆₀₀=8-12. This was diluted to 50ml and OD₆₀₀ ≈ 0.1, and grown in in SB+amp+tet+glucose, incubated at 37 degrees C in shaker for 2h15min, the culture then reaching OD₆₀₀ ~0.6-0.8.

[0592] 1ml helper phage was added and the mixture incubates at 37 degrees C (no shaking) for 20min. Finally, the culture was incubated in a shaker for another 40min at 37 degrees C.

[0593] The cultures were spun down, supernatant poured and the bacteria pellet dissolved in 100 ml 2xYT+amp+kan+tet, and thereafter incubated at 30 degrees C, shaking ON. The cultures were spun down, and 25ml PEG / NaCI added to the supernatant. The supernatant was incubated on ice for 30min, and then centrifuged at 9000rpm for 20min. The supernatant was discarded and the bottles kept upside down to dry for 15min.

[0594] Phage was resuspended in 2.5ml 2%BSA PBS, and thereafter centrifuged and sterile filtered. The phages were thereafter diluted; 250 µl phages with 250 µl PBST.

[0595] Library 2: panning R1

[0596] Phage was prepared as described above. The page were incubated with 50nM biotinylated sE2-2b at RT for 2hrs, whereafter 15 µl Streptavidin MyOne T1 magnetic beads were added. Incubation for lh at RT followed.

[0597] The beads were washed in the tubes while the tubes were held in a magnetic rack. They were washed five times in PBST, and finally once in PBS. Change of tubes occurred after 1st and 4th wash. The phage bound were eluted in 150 µl Desthiobiotin PBS, by incubation for 40min at RT. The phage were thereafter infected in 1ml suspension with E. coli XL1 blue, and grown on four 4 ampicillin & tetracyclinecontaining media plates for titrating, and in order to prepare phage enriched in the panning - the latter to be used in the subsequent panning (panning 2).

[0598] Table 7. Titers library 2, round 1

[0599] Library Colonies Dilution Titer

[0600] HY 50nM sE2 5000 E4 5E7 ALL50nM sE2 5000 E4 5E7

[0601] HY background 37 E4 3.7E5

[0602]

[0603] ALL background 103 E4 1E6

[0604] Panning 2, 3 and 4

[0605] For panning No. 2, a new line of panning were introduced with lower concentration of sE2 protein, in the hope pf isolating antibodies with higher affinity. Thus, in panning 2, the following 6 separate pannings were included:

[0606] 1. 500ul " CDRH3_HY" 5nM sE2

[0607] 2. 500ul " CDRH3_HY" 0,5nM sE2

[0608] 3. 500ul " CDRH3_HY" (negative control)

[0609] 4. 500ul " CDRH3_ALL" 5nM sE2

[0610] 5. 500ul " CDRH3_ALL" 0,5nM sE2

[0611] 6. 500ul " CDRH3_ALL" (negative control)

[0612] Apart from the concentration of the antigen, the procedure was essentially the same for panning No.2 as in panning 1. Panning 3 and 4 had the same properties as panning 2, i.e. sE2 was used at 5nM and 0.5 nM in separate lines of panning. The VH domains obtained in 2 (500ul " CDRH3_HY" 0,5nM sE2) and 5 (500ul " CDRH3_ALL" 0,5nM sE2) were selected for further experiment.

[0613] Sequencing of three random clones from the ALL and the HY libraries, respectively Three clones each from the ALL and HY libraries were picked randomly and sequenced according to standard protocols. The data are presented in the results.

[0614] Production of the new clones as IgG

[0615] The VH domains containing the new CDRH3 were moved into a mammalian expression vector, pclgGlv2, according to standard protocol (digestion with endonucleases, gel purification, recovery of correct DNA from the gel, and then ligation of the intended vector + insert).First, the cDNA for the light chain of R2G8x (where a non-coding Xhol site had been deleted) was ligated into pclgGlv2, and in the next steps the respective VH cDNA of the new clones were ligated into the vector that had been digested by Xhol+ApaL A quality control was made on the clone "pclgGlv2 (R2G8x LC, clone3 HC)", which was confirmed to have the correct sequences.

[0616] 3.75ug of pclgGlv2 (R2G8x LC, clone3 HC) and the following pComb3H clones were digested with Apal+Xhol:

[0617] • R3H1

[0618] • R2G11

[0619] • R4H4

[0620] • R4E9

[0621] • R4E2

[0622] • R3F1

[0623] • R2G12

[0624] • R3F6

[0625] They were digested at 25 degrees C for 6h, and then 37 degrees C ON. The correct products were isolated by gel filtration according to standard protocol.

[0626] Ligation; The isolated products were thereafter ligated using Quickligase (NEB, standard protocol), heat shocked into NEBlObeta (NEB, standard protocol), and plated on amp-plates.

[0627] Cultures; Overnight mini cultures of the pcIgGl-variants were prepared. Glycerol stocks and miniprep was prepared and sequencing was performed.

[0628] Standard ELISA for IgG concentration orsE2-2b reactivity

[0629] The produced IgG proteins were tested for binding to sE2, or for concentration by ELISA (as per standard procedure, all concentrations used based on BCA), in the same way as described in Example 1. The test was either:

[0630] 1. Coating the wells of a microtiter plate with anti-Fd antibody (detecting the Fd region of IgG), and then detecting bound antibodies with anti-Kappa-AP.

[0631] 2. Coating the wells of a microtiter plate with the antigen sE2-2b, and then detecting bound antibodies with anti-Kappa-AP. For the first step, incubate for 4 hrs in RT, wash three times with PBS-T, and add detection reagent as above. Incubate for 1 hr at RT, wash x 3 with PBS-T, and once in PBS, and then add substrate. Read OD for both assays after 15, 30 and 60 minutes.In vitro neutralization assays

[0632] The HCV pp pseudo virus system was used to assess the neutralizations capacity of the different antibodies reactive to the HCV sE2 proteins. The assays were performed as described in Johansson et al. PNAS 2007. The same method as described in Experiment 1 was followed (and references there mentioned: Johansson et al. PNAS 2007, and Urbanovic et al, 2015), but with the clones obtained in the present experiment.

[0633] 3.3 Results

[0634] Titers for Library 2, pre and post pannings

[0635] Table 8. Titers, Prepanning

[0636] Library Colonies Dilution Titer pComb3H-R2G8 (CDRH3_HY) ~700 E4 7E6 pComb3H-R2G8 (CDRH3_ALL) ~700 E4 7E6 pComb3H-R2G8 (background, no 28 E4 2.8E5

[0637]

[0638] insert)

[0639] Table 9. Titers Library 2, round 1

[0640] Library Colonies Dilution Titer

[0641] HY 50nM sE2 5000 E4 5E7 ALL50nM sE2 5000 E4 5E7

[0642] HY background 37 E4 3.7E5

[0643]

[0644] ALL background 103 E4 1E6

[0645] Table 10. Titers Library 2, round 2

[0646] Library Colonies Dilution Titer

[0647] HY 5nM sE2 ~300 E4 3E6

[0648] HY 0.5nM sE2 15 E4 1.5E5

[0649] HY background 7 E4 0.7E5 ALL5nM sE2 345 E4 3.45E6 ALL0.5nM sE2 37 E4 3.7E5

[0650]

[0651] ALL background 31 E4 3.1E5Table 11. Titers Library 2, round 3

[0652] Library Colonies Dilution Titer

[0653] HY 5nM sE2 8 E7 8E7

[0654] HY 0.5nM sE2 20 E5 2E6

[0655] HY background (from the 0.5nM 3 E5 3E5 lib)

[0656] ALL5nM sE2 1 E7 1E7 ALL0.5nM sE2 24 E5 2.4E6 ALL background (from the 0.5nM 4 E5 4E5

[0657]

[0658] lib)

[0659] Table 12. Titers Library 2, round 4

[0660] Library Colonies Dilution Titer

[0661] HY 5nM sE2 280 E5 2.8E7

[0662] HY 0.5nM sE2 110 E4 1.1E6

[0663] HY background 22 E4 2.2E5 ALL5nM sE2 420 E5 4.2E7 ALL0.5nM sE2 202 E4 2.02E6

[0664]

[0665] ALL background 49 E4 4.9E5

[0666] Sequencing of three random clones

[0667] Random clones from libraries ALL and HY were sequenced, and it was confirmed that each clone contained 7 nucleotide mutations on average, resulting in 3.8 amino acid mutations per clone (data not shown).

[0668] Sequences of isolated new clones

[0669] SEQ ID NO: 77 shows the sequence of antibody 1:7 in this region of VH-CDR3. The positions 104-112 are according to the Kabat numbering scheme.

[0670] N A I R H T M G Y SEQ ID NO: 77 104 105 106 107 108 109 110 111 112

[0671] Table 13. Summary of the new clones selected after panning 1-4 with library 2. " ALL" library: all positions except G mutated; " HY" library: all positions except H, Y and G mutatedClone Sequence in mutated region

[0672] 1:7 / G8 NAIRHTMGY (SEQ ID NO 77)

[0673] R3B12_ALL5 A105S, M110R, Y112F

[0674] R3Hl_HY0.5 A105T, I106L, R107W

[0675] R2G11_HY5 N104K, R107S, M110A

[0676] R2A4_ALL0.5 N104K, A105E

[0677] R4H4_HY0.5 N104K, A105E

[0678] R2C5_ALL0.5 A105E

[0679] R4E9_HY5 A105E

[0680] R3G12_HY5 N104Y, A105E

[0681] R4H11_HY5 A105Q

[0682] R4Dl_ALL0.5 N104R, A105T

[0683] R4E2_HY0.5 R107S

[0684] R3Fl_HY0.5 T109S

[0685] R3El_HY0.5 T109S

[0686] R2G12_HY5 A105R

[0687] R3F6_HY0.5 A105K

[0688] R4C6_ALL0.5 A105K

[0689]

[0690] R4G2_HY0.5 A105

[0691] A few notes on the data on the new clones:

[0692] • The new sequences came from the following panning conditions:

[0693] ALL 5nM: 5.8% (1 / 17)

[0694] ALL 0.5nM: 23.5% (4 / 17)

[0695] HY 5nM: 29% (5 / 17)

[0696] HY 0.5nM: 41% (7 / 17)

[0697] •41% (7 / 17) have a positive amino acid substitution in pos 1 (N - R / K) [2 mut N- R, 1 mut N-> K]

[0698] • 29% (5 / 17) have a glutamic acid substitution in pos 2 (A - E)

[0699] • 12% (2 / 17) have a serine substitution in pos 4 (R - S)

[0700] • 12% (2 / 17) have a serine substitution in pos 6 (T - S)

[0701] • High mutations frequency for asparagine position 1 (53%, 9 / 17) and the alanine in position 2 (53%, 9 / 17).

[0702] • The isoleucine in Position 3 seems fairly conserved (only 1 / 17 mutated

[0703]

[0704] leucine) • The histidine in Position 4 seems conserved (5 / 5 of the " ALL")

[0705] • The tyrosine in position 9 seems fairly conserved (only 1 / 5 mutated

[0706]

[0707] fenylalanine)Expression levels and binding activity of the new clone variants

[0708] The expression levels and binding activity to HCV-E2 protein were all very similar to the original G8 clone, as measured in anti-Fd- ELISA and anti-E2 ELISA described in Exp. 1. Therefore, an inhibition ELISA (performed as described above in Experiment 1) was set up in order to distinguish between the new clones.

[0709] Table 14. IC50 values resulting from the inhibition assay.

[0710] Name 0.5 ug / ml IgG Ranking based on

[0711] [50% inhib ug / ml sE2] affinity

[0712] R2G8 2.55 3

[0713] R4E9 (-E - ) 2.9 6

[0714] R4E2 (— S- — ) 2.6 4- R4H4 (KE - ) 3.02 7

[0715] R2G12 (R - ) 2.4 1

[0716] R3F1 (- — S — ) 2.47 2

[0717] R3F6 (K - ) 2.47 2

[0718] R3H1 (-TLW- — ) - Not tested

[0719]

[0720] R2G11 (K-S-A-) 2.68 5

[0721] Neutralisation test

[0722] An ultimate in vitro test for anti-viral activity are the assays for blocking virus infectivity using the pseudo particle assay (p.p. assay) or the cell cultured hybrid virus assay (the c.c. assay) as described in Experiment 2, and detailed in Riva & Dubuisson 2019.

[0723] Our new clones were tested in the p.p. assay, both using often used laboratory strains of the virus, and envelope proteins derived from patient isolates of the virus (Urbanowicz et al., 2015). As can be seen in Table 15, clear improvements were observed for the new clones compared to the neutralization capacity of the original 1-7 antibody.Table 15. In vitro HCVpp neutralization data for four clones isolated in Experiment 3. The results are depicted in figures 2 and 3. Units in IC50 ug / ml antibody.

[0724] 1:7 R4E9 R2G12 R3F1 R3F6 H77.20 IC50 0.8581 0.4431 0.4183 0.6259 0.6907 R squared 0.965 0.9538 0.9321 0.9295 0.9221

[0725] J6 IC50 12.86 9.686 3.99 10.75 12.45 R squared 0.9529 0.9217 0.9299 0.8704 0.9452

[0726] UKNP2.4.1 IC50 >100 72.48 57.16 61.14 >100 R squared 0.75 0.8566 0.8019 0.9037 0.7696

[0727] UKNP 4.1.1 IC50 3.724 2.321 2.592 0.9188 2.702 R squared 0.9583 0.9265 0.9036 0.9188 2.702

[0728] UKNP1.20.3 IC50 17.21 62.9 17.84 35.18 41.47 R squared 0.8972 0.8998 0.8778 0.9142 0.9225

[0729] JFH-1 22.71 12.36 7.447 6.647 7.609 R squared 0.9556 0.874 0.9714 0.92 0.9036

[0730] UKNP 3.2.1 IC50 11.51 2.867 4.169 6.853 9.479 R squared 0.9354 0.946 0.968 0.9531 0.9589

[0731] UKNP 6.1.2 IC50 4.683 0.4951 0.4565 0.5241 0.4328 R squared 0.961 0.9523 0.9568 0.9557 0.9345

[0732] 3.4 Conclusions drawn from the experiment

[0733] - A collection of new clones binding to the HCV-E2 proteins were generated.

[0734] - Certain mutations were favored: the same amino acid sequence was preferred coded for by different nucleotide sequences, i. e preference for certain polypeptide sequences was observed.- Antibody affinity did not directly correlate with breadth of neutralization of different HCV isolates and / or genotypes. This is both intriguing and surprising and, as a skilled person could assume, but not be totally sure of, that the novel antibodies derived from the original clone 1-7 are all binding to the same epitope as 1-7. Given that the light chain has been replaced (in Experiment 1) novel mutations have appeared in the VH-CDR3 regions, it is possible that the binding may affect the same epitope, or very much overlapping with it, but that the new antibodies may sterically interact slightly differently than 1-7 with the HCV protein E2, and hence have different neutralization capacity not only due to minor affinity differences.

[0735] Regardless, the observations are clearly unexpected, This is illustrated below where the virus neutralization data for clones in Experiment 1 (new light chains paired with the 1-7 heavy chain, Table 16A) can be compared with the neutralization capacity of the clones resulting from Experiment 3, where the CDR3 region of clone G8 was mutated and novel clones thus generated (Table 16B).

[0736] Table 16 shows neutralization capacity; a comparison of the clones of experiment 1 and experiment 3.

[0737] Table 16A. Virus neutralization data using the pp system for clones in Experiment 1. Values presented as IC50.

[0738] Ab / lsolate H77 JFH- J6 Ul.20.3 U4.1.1 U3A13.6 No. of IC50 values < 1.7

[0739] 1

[0740] 1:7 1.3 15.4 14.3 22.9 3.9 22.1 (N / A)

[0741] G8V1* 0.15 7.1 6.0 3.7 1.5 9.2 6 / 6

[0742] R2A6 10.1 38.1 18.5 110 3.96 209 0 / 6

[0743] R2C9 0.86 19.5 7.84 7.94 4.64 28.8 2 / 6

[0744] R4B11 0.65 20.6 13.5 22.2 2.28 151 3 / 6

[0745]

[0746] R4C10 0.56 11.2 13.6 32.5 7.58 11.6 3 / 6

[0747] Table 16B. Virus neutralization data (using the pp system) for clones in Experiment 3. Values presented as IC50.

[0748] Ab / H77 JFH-1 J6 U U U 2.4.1 U 3.2.1 U 6.1.2 Affinty No. of Isolate 1.20.3 4.1.1 ranking IC50 values < 1.7 1:7 0.86 22.7 12.9 17.2 3.7 >100 11.5 4.7 n / a n / a R4E9 0.44 12.4 9.7 62.9 2.32 72.5 2.9 0.49 6 7 / 8 R2G12 0.42 7.45 3.99 17.8 2.59 57.2 4.17 0.46 1 7 / 8 R3F1 0.63 6.65 10.8 35.2 0.92 61.1 6.85 0.52 2 7 / 8

[0749]

[0750] R3F6 0.69 7.61 12.4 41.5 2.70 >100 9.48 0.44 2 6 / 8As can be seen in Table 16A, clone G8vl showed reduced, i.e. improved, IC50 values against all six isolates when compared to the IC50 values for the original clone 1:7. The other four new clones had more potent IC50 values for two, three or none of the six isolates used in assay.

[0751] Table 16B shows data for the antibodies generated in Experiment 3, i.e. further development of clone G8vl. The four new antibody clones tested here had improved neutralization capacity compared to clone 1:7 regardless of their affinity ranking.

[0752] Similarly, we found in Experiment 2 that a single mutation in the H-CDR3 region of clone G8vl, where mutant N104A showed improved affinitiy to HCV-E2 (Fig 1). To understand how this affected its neutralizstion potency, the mutant version, named G8v2, was assess for neutralization of HCV in the pp system. As can be seen in Table 17, improved neutralization potency compared to the "parental" clone 1:7 was also observed for clone G8v2.

[0753] Table 17. IC50 values for mAb 1:7, G8vl and G8v2. IC50 values are given as ug / ml of mAb resulting in 50% neutralization af HCV-E2-presenting pseudoparticles (pp- assay). _

[0754] Isolate G8vl G8v2 1:7

[0755] H77.20 0,5195 0,5387 1,719

[0756] U 1A20.8 7,701 5,146 29,22

[0757] U 1B5.23 0,4926 0,5489 2,664

[0758] U 2A1.2 2,897 2,378 7,504

[0759] U 2B1.1 4,179 5,374 14,54

[0760] U 3A1.28C 6,305 2,113 22,51

[0761] U 3A13.6 4,253 6,062 2,25

[0762] U 4.11.1 2,022 2,989 14,98

[0763] U 4.21.7 2,752 0,1216 1,698

[0764] U 5.14.4c 3,339 0,09818 2,955

[0765] U 5.17.7 0,5093 0,3079 0,5414

[0766] U 6.5.8 0,117 0,1511 0,5976

[0767]

[0768] U 6.5.340 0,1106 0,32 1,164Itemized list of embodiments

[0769] 1. An antibody having binding affinity for a hepatitis C virus (HCV) E2 antigen, comprising

[0770] 5 an immunoglobulin heavy chain variable region (VH) and an immunoglobulin light chain variable region (VL), said VH and VL regions forming a VH / VL pair comprising an antigen-binding surface,

[0771] in which said antigen-binding surface comprises three complementarity-determining regions (CDRs) from said VH region and three CDRs from said VL region, and in which said CDRs comprises or consist the following:

[0772] VL-CDR1: RAX1QX2X3X4X5X6X7LX8 (SEQ ID NO:1) wherein

[0773] Xi is selected from S and N;

[0774] 5 X2 is selected from S and T;

[0775] X3 is selected from V, G and I;

[0776] X4 is selected from S, G, D, I and T;

[0777] X5 is selected from N and S;

[0778] Xe is selected from Y, N and D;

[0779] 0 X7 is selected from S or is absent; and

[0780] Xs is selected from A and N;

[0781] VL-CDR2: X9X10SX11X12X13X14 (SEQ ID NO:2) wherein

[0782] X9 is selected from D, V and A;

[0783] X10 is selected from A and T;

[0784] Xu is selected from N, K, T and S;

[0785] X12 is selected from R, I and L;

[0786] X13 is selected from A and Q;

[0787] 0 X14 is selected from A, T and S;

[0788] VL-CDR3: QQX15X16X17X18X19X20T (SEQ ID NO:3)

[0789] whereinXis is selected from R, Y, N and F;

[0790] Xi6 is selected from A, S, N, G and Y;

[0791] X17 is selected from K, D, N and T;

[0792] Xis is selected from W, R, G, S and T;

[0793] X19 is selected from S, P, I, N, T and V; and

[0794] X20 is selected from W, H or is absent;

[0795] VH-CDR1: RYTIQ. (SEQ ID NO:4)

[0796] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0797] or an antigen-binding fragment thereof.

[0798] 2. An antibody or antigen-binding fragment thereof according to item 1, wherein said antigen-binding surface is further comprising VH-CDR3, said VH-CDR3 comprises or consists of:

[0799] VH-CDR3: VVIPX21X22X23X24HX25X26GX27YFDY (SEQ ID NO:6) wherein

[0800] X21 is selected from N, K, R, A and T;

[0801] X22 is selected from S, T, A, E and Q;

[0802] X23 is selected from I and L;

[0803] X24 is selected from R, W and S;

[0804] X25 is selected from T and S;

[0805] X26 is selected from R, M and A; and

[0806] X27 is selected from F and Y.

[0807] 3. An antibody or antigen-binding fragment thereof according to any previous item, in which said CDRs comprise the following

[0808] VL-CDR1: RASQSVX4X5X6LA (SEQ ID NO:7) wherein

[0809] X4 is selected from S, G and D;X5 is selected from N and S; and

[0810] Xe is selected from Y and N;

[0811] VL-CDR2: DASXnRAX (SEQ ID NO:8) wherein

[0812] Xu is selected from N, K and T; and

[0813] X14 is selected from A, T and S;

[0814] VL-CDR3: QQRXi6Xi7Xi8Xi9T (SEQ ID NO:9), wherein

[0815] Xie is selected from A, S and N;

[0816] X17 is selected from K, D, N and T;

[0817] Xis is selected from W and R; and

[0818] X19 is selected from S, P and N;

[0819] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0820] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5).

[0821] 4. An antibody or antigen-binding fragment thereof according to item 1 or 3, wherein said antigen-binding surface is further comprising VH-CDR3, said VH-CDR3 comprises or consists of:

[0822] VH-CDR3: VVIPX21X22IRHX25MGYYFDY (SEQ ID NO:10) wherein

[0823] X21 is selected from N, R, A and K;

[0824] X22 is selected from A and E;

[0825] X25 is selected from T and S.

[0826] 5. An antibody or antigen-binding fragment thereof according to item 1, wherein said VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0827] VL-CDR1: RASQSVSSYLA (SEQID NO:11)

[0828] VL-CDR2: DASKRAT (SEQ ID NO:21)VL-CDR3: QQRSDRPT (SEQ ID NO:31).

[0829] 6. An antibody or antigen-binding fragment thereof according to any one of item 1, 2 and 4, wherein said VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0830] VL-CDR1: RASQSVGSYLA (SEQ ID NO:12)

[0831] VL-CDR2: DASNRAT (SEQ ID NO:22)

[0832] VL-CDR3: QQRSNWIT (SEQ ID NO:32).

[0833] 7. An antibody or antigen-binding fragment thereof according to any one of item 1, 2 and 4, wherein said VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0834] VL-CDR1: RASQSVGSYLA (SEQ ID NO:12)

[0835] VL-CDR2: DASNRAT (SEQ ID NO:22)

[0836] VL-CDR3: QQRSNWNT (SEQ ID NO:33).

[0837] 8. An antibody or antigen-binding fragment thereof according to any one of item 1, 2 and 4, wherein said VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0838] VL-CDR1: RASQSVSSYLA (SEQ ID NO:11)

[0839] VL-CDR2: DASNRAT (SEQ ID NO:22)

[0840] VL-CDR3: QQRSDGTT (SEQ ID NO:34).

[0841] 9. An antibody or antigen-binding fragment thereof according to any one of item 1, 2 and 4, wherein said VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0842] VL-CDR1: RASQSVSNYLA (SEQ ID NO:15)

[0843] VL-CDR2: DASNRAA (SEQ ID NO:25)

[0844] VL-CDR3: QQRAKWST (SEQ ID NO:35).

[0845] 10. An antibody or antigen-binding fragment thereof according to any one of item 1, 2 and 4, wherein said VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:VL-CDR1: RASQSVDNYLA (SEQ ID NO:16)

[0846] VL-CDR2: DASNRAS (SEQ ID NO:26)

[0847] VL-CDR3: QQRNKWST (SEQ ID NO:36).

[0848] 11. An antibody or antigen-binding fragment thereof according to any one of item 1, 2 and 4, wherein said VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0849] VL-CDR1: RASQSVSNNLA (SEQ ID NO:17)

[0850] VL-CDR2: DASTRAA (SEQ ID NO:27)

[0851] VL-CDR3: QQRNTWNT (SEQ ID NO:37).

[0852] 12. An antibody or antigen-binding fragment thereof according to any one of item 1, 2 and 4, wherein said VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0853] VL-CDR1: RASQSGISDLA (SEQ ID NO:18)

[0854] VL-CDR2: AASTLQS (SEQ ID NO:28)

[0855] VL-CDR3: QQFNTWVT (SEQ ID NO:38).

[0856] 13. An antibody or antigen-binding fragment thereof according to any one of item 1, 2 and 4, wherein said VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0857] VL-CDR1: RASQSVSSNSLA (SEQ ID NO:19)

[0858] VL-CDR2: VTSSRAT (SEQ ID NO:29)

[0859] VL-CDR3: QQYGNSPWT (SEQ ID NO:39).

[0860] 14. An antibody or antigen-binding fragment thereof according to any one of item 1, 2 and 4, wherein said VL-CDR1, VL-CDR2 and VL-CDR3 comprises or consist of the following amino acid sequences:

[0861] VL-CDR1: RANQTITNYLN (SEQ ID NQ:20)

[0862] VL-CDR2: AASSLQS (SEQ ID NQ:30)

[0863] VL-CDR3: QQNYNTPHT (SEQ ID NQ:40).15. An antibody or antigen-binding fragment thereof according to any preceding item, which comprises a heavy chain variable domain and a light chain variable domain, wherein said light chain variable domain comprises an amino acid sequence selected from

[0864] i) the group consisting of SEQ ID NO:54-63; and

[0865] ii) an amino acid sequence having at least 80 % identity, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, identity to any one of SEQ ID NO:54-63, provided that

[0866] VL-CDR1 comprises an amino acid sequence selected from SEQ ID NO:11-20;

[0867] VL-CDR2 comprises an amino acid sequence selected from SEQ ID NO:21-30; and VL-CDR3 comprises an amino acid sequence selected from SEQ ID NO:31-40.

[0868] 16. An antibody or antigen-binding fragment thereof according to any preceding item, wherein the VL amino acid sequence in i) is selected from the group consisting of SEQ ID NO:54, SEQ ID NO:56, SEQ ID NO:58, SEQ ID NO:59 and SEQ ID NQ:60.

[0869] 17. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0870] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0871] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0872] VH-CDR3: VVIPNAIRHTMGYYFDY (SEQ ID NO:41).

[0873] 18. An antibody or antigen-binding fragment thereof according to any one of any one of item 1, 3 and 5-16 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0874] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0875] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0876] VH-CDR3: VVIPNSIRHTRGFYFDY (SEQ ID NO:42).19. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0877] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0878] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0879] VH-CDR3: VVIPNTLWHTMGYYFDY (SEQ ID NO:43).

[0880] 20. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0881] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0882] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0883] VH-CDR3: VVIPKAISHTAGYYFDY (SEQ ID NO:44).

[0884] 21. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0885] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0886] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0887] VH-CDR3: VVIPKEIRHTMGYYFDY (SEQ ID NO:45).

[0888] 22. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0889] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0890] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0891] VH-CDR3: VVIPNEIRHTMGYYFDY (SEQ ID NO:46).

[0892] 23. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0893] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0894] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)VH-CDR3: VVIPNQIRHTMGYYFDY (SEQ ID NO:47).

[0895] 24. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0896] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0897] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0898] VH-CDR3: VVIPRTIRHTMGYYFDY (SEQ ID NO:48).

[0899] 25. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0900] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0901] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0902] VH-CDR3: VVIPNAISHTMGYYFDY (SEQ ID NO:49).

[0903] 26. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0904] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0905] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0906] VH-CDR3: VVIPNAIRHSMGYYFDY (SEQ ID NQ:50).

[0907] 27. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0908] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0909] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0910] VH-CDR3: VVIPRAIRHTMGYYFDY (SEQ ID NO:51).

[0911] 28. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:VH-CDR1: RYTIQ (SEQ ID N0:4)

[0912] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID N0:5)

[0913] VH-CDR3: VVIPKAIRHTMGYYFDY (SEQ ID NO:52).

[0914] 29. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0915] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0916] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0917] VH-CDR3: VVIPTAIRHTMGYYFDY (SEQ ID NO:53).

[0918] 30. An antibody or antigen-binding fragment thereof according to any one of item 1, 3 and 5-16, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:

[0919] VH-CDR1: RYTIQ (SEQ ID NO:4)

[0920] VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)

[0921] VH-CDR3: VVIPAAIRHTMGYYFDY (SEQ ID NO:92).

[0922] 31. An antibody or antigen-binding fragment thereof according to any one of items 1-3 and 5-16, wherein VH is selected from the group consisting of SEQ ID NO: 64-76 and 79, or wherein VH is selected from the group consisting of SEQ ID NO: 64, 69, 73, 74, 75 and 79.

[0923] 32. An antibody or antigen-binding fragment thereof according to any one of items 1-3 and 5-16, wherein VH is selected from the group consisting of

[0924] i) SEQ ID NO: 64, and

[0925] ii) an amino acid sequence having at least 80 % identity, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, identity to SEQ ID NO:64, provided that VH-CDR1 is SEQ ID NO:4, VH-CDR2 is SEQ ID NO:5 and VH-CDR3 is selected from the group consisting of SEQ ID NO:41-52 and 92.33. An antibody or antigen-binding fragment thereof according to any one of items 1-2, wherein said heavy chain variable domain is as defined in any one of SEQ ID NO:64-76 and 79, and said light chain variable domain is as defined in any one of SEQ ID NO:54-63.

[0926] 34. An antibody or antigen-binding fragment thereof according to any one of items 1-2, wherein the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0927] a) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:54;

[0928] b) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:55;

[0929] c) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:56;

[0930] d) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:57;

[0931] e) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:58;

[0932] f) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:59;

[0933] g) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:60;

[0934] h) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:61;i) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:62;

[0935] j) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64-76 and 79, and a light chain variable domain comprising SEQ ID NO:63.

[0936] 35. An antibody or antigen-binding fragment thereof according to any one of items 1-2, wherein the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0937] a) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:54-63;

[0938] b) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:65 and a light chain variable domain comprising SEQ ID NO:54-63;

[0939] c) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:66 and a light chain variable domain comprising SEQ ID NO:54-63;

[0940] d) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:67 and a light chain variable domain comprising SEQ ID NO:54-63;

[0941] e) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:68 and a light chain variable domain comprising SEQ ID NO:54-63;

[0942] f) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:59;

[0943] g) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:70 and a light chain variable domain comprising SEQ ID NO:54-63;h) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:71 and a light chain variable domain comprising SEQ ID NO:54-63;

[0944] i) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:72 and a light chain variable domain comprising SEQ ID NO:54-63;

[0945] j) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:54-63;

[0946] k) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:54-63;

[0947] l) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:54-63;

[0948] m) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:76 and a light chain variable domain comprising SEQ ID NO:54-63; such as represented by the VH / VL combinations f), j), k) and / or I); n) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:79 and a light chain variable domain comprising SEQ ID NO:54-63; such as represented by the VH / VL combinations f), j), k) and / or I).

[0949] 36. An antibody or antigen-binding fragment thereof according to any one of items 1-2, wherein the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0950] a) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:54;

[0951] b) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:55;

[0952] c) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:56;

[0953] d) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:57;e) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:58;

[0954] f) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:59;

[0955] g) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:60;

[0956] h) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:61;

[0957] i) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:62;

[0958] j) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:63.

[0959] 37. An antibody or antigen-binding fragment thereof according to any one of items 1-2, wherein the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0960] a) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:54;

[0961] c) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:56;

[0962] e) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:58;

[0963] f) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:59;

[0964] g) a heavy chain variable domain comprising SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:60.

[0965] 38. An antibody or antigen-binding fragment thereof according to any one of items 1-2, wherein the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0966] a) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:54;c) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:56;

[0967] e) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:58;

[0968] f) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:59;

[0969] g) a heavy chain variable domain comprising SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:60.

[0970] 39. An antibody or antigen-binding fragment thereof according to any one of items 1-2, wherein the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0971] a) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:54;

[0972] c) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:56;

[0973] e) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:58;

[0974] f) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:59;

[0975] g) a heavy chain variable domain comprising SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:60.

[0976] 40. An antibody or antigen-binding fragment thereof according to any one of items 1-2, wherein the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0977] a) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:54;

[0978] c) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:56;

[0979] e) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:58;f) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:59;

[0980] g) a heavy chain variable domain comprising SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:60.

[0981] 41. An antibody or antigen-binding fragment thereof according to any one of items 1-2, wherein the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:

[0982] a) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:54;

[0983] c) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:56;

[0984] e) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:58;

[0985] f) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:59;

[0986] g) a heavy chain variable domain comprising SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:60.

[0987] 42. An antibody or antigen-binding fragment thereof according to any one of items any one of items 1-2, wherein said heavy chain variable domain comprises or consists of SEQ ID NO: 64 and wherein said light chain variable domain comprises or consists of SEQ ID NO: 58.

[0988] 43. An antibody or antigen-binding fragment thereof according to any preceding item, which is selected from the group consisting of Fab fragments, single chain Fv fragments (scFv), IgG 1, IgG 2, lgG3, and lgG4, such as selected from the group consisting of Fab fragments and IgGl.

[0989] 44. An antibody or antigen-binding fragment thereof according to any preceding item, which is of IgG subclass, such as selected from the group consisting of IgG 1, IgG 2, lgG3, and lgG4, such as wherein said IgG subclass is selected from the group consisting of IgGl and lgG4.45. An antibody or antigen-binding fragment thereof according to item 44, wherein said IgG 1, IgG 2, or lgG4 has one or more mutations in the Fc-portion, such as one or more of T250, M252, 1253, S254 and T256, E380, M428, H433, N434, H435, Y436 (EU-numbering).

[0990] 46. An antibody or antigen-binding fragment thereof according to any preceding item, which is monoclonal.

[0991] 47. An antibody or antigen-binding fragment thereof according to any preceding item, which has a binding affinity for the HCV-E2 protein that corresponds to a IC50 value of no more than 90 nM, such as between 25 and 85 nM, such as between 30 and 40 nM, optionally as determined by competition ELISA.

[0992] 48. An antibody or antigen-binding fragment thereof according to any preceding item, which exhibits cross-reactivity to E2 antigens from HCV genotypes 1, 2 and 3; and / or which exhibits cross-reactivity to E2 antigens from HCV genotypes 1, 2, 3 and 4; and / or which exhibits cross-reactivity to E2 antigens from HCV genotypes 1, 2, 3, and 6; and / or which exhibits cross-reactivity to E2 antigens from HCV genotypes la and 2b.

[0993] 49. An antibody or antigen-binding fragment thereof according to any preceding item, which is able to neutralize a HCV isolate selected from the group consisting of H77, JFH-1, J6, U 1.20.3, U 3A 13.6, U 4.1.1, U2.4.1, U3.2.1, and U61.2, or an isolate of a genotype represented by said group, and / or an isolate of genotype 7 and 8.

[0994] 50. Pharmaceutical composition, comprising an antibody or antigen-binding fragment thereof according to any preceding item and a pharmaceutically acceptable carrier or excipient.

[0995] 51. Pharmaceutical composition according to item 50, further comprising an additional therapeutic agent.52. Combination of an antibody or antigen-binding fragment thereof according to any one of items 1-49 and an additional therapeutic agent, for use in therapeutic treatment or prophylactic treatment of an hepatitis C virus (HCV) infection, such as wherein said additional therapeutic agent is a direct acting anti-viral drug, such as a direct acting anti-viral drug selected from the group consisting of Daklatasvir;

[0996] Dasabuvir; Ledipasvir and Sofosbuvir; Simeprevir; Sofosbuvir; Ombitasvir, Paritaprevir and Ritonavir; such as selected from the group consisting of Ledipasvir and Sofosbuvir; and Sofosbuvir.

[0997] 53. An antibody or antigen-binding fragment thereof according to any one of items 1-49 or a composition according to items 50-51 for use in treatment, such as for use in therapeutic treatment or for use in prophylactic treatment.

[0998] 54. An antibody or antigen-binding fragment thereof according to any one of items 1-49 or a composition according to items 50-51 for use in diagnosis in vivo or prognosis in vivo.

[0999] 55. An antibody or antigen-binding fragment thereof or composition for use according to any one of items 53-54, wherein said therapeutic treatment or prophylactic treatment is with respect to a hepatitis C virus (HCV) infection.

[1000] 56. A method of therapeutic treatment of a mammal having an hepatitis C virus (HCV) infection, said method comprising administering to said mammal a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to any one of items 1-49 or a composition according to items 50-51.

[1001] 57. The method according to item 56, further comprising a step of administrating an additional therapeutic agent.

[1002] 58. The method according to item 57, wherein said additional therapeutic agent is a direct acting anti-viral drug, such as a direct acting anti-viral drug selected from the group consisting of Daklatasvir; Dasabuvir; Ledipasvir and Sofosbuvir; Simeprevir;Sofosbuvir; Ombitasvir, Paritaprevir and Ritonavir; such as selected from the group consisting of Ledipasvir and Sofosbuvir; and Sofosbuvir.

[1003] 59. A method of neutralizing a HCV isolate or a genotype selected from the group consisting of H77, JFH-1, J6, U 1.20.3, U 3A 13.6, U 4.1.1, U2.4.1, U3.2.1, and U61.2, or an isolate of a genotype represented by said group, and / or an isolate of genotype 7 and 8; comprising:

[1004] administrating a therapeutically effective amount of an antibody or antigen-binding fragment thereof according to any one of items 1-49, or a pharmaceutical composition according to items 50-51 to a mammal.

[1005] 60. The method according to item 59, wherein said mammal is a human.

[1006] 61. A method of detecting a hepatitis C virus (HCV) E2 antigen in vitro, comprising providing a sample suspected to contain said E2 antigen, contacting said sample with an antibody or antigen-binding fragment thereof according to any one of items 1-49 or a composition according to items 50-51, and detecting the binding of said protein to indicate the presence of said E2 antigen in the sample.

[1007] 62. A method of determining the amount of a hepatitis C virus (HCV) E2 antigen present in a subject, comprising the steps of:

[1008] a) contacting the subject, or a sample isolated from the subject, with an antibody or antigen-binding fragment thereof according to any one of items 1-49 or a composition according to items 50-51, and

[1009] b) obtaining a value corresponding to the amount of the antibody or antigenbinding fragment thereof or composition that has bound in said subject or to said sample.

[1010] 63. Method according to item 62, further comprising a step of comparing said value to a reference.64. Use of an antibody or antigen-binding fragment thereof according to any one of items 1-49 or a composition according to items 50-51 for the manufacture of a medicament for use in the treatment of hepatitis C virus (HCV).

[1011] 65. One or more polynucleotide(s) encoding the antibody or antigen-binding fragment thereof as defined in any one of items 1-49.

[1012] 66. A cloning vector comprising a polynucleotide as defined in item 65.

[1013] 67. An expression vector comprising a polynucleotide as defined in item 65.

[1014] 68. A host cell comprising a cloning vector as defined in item 66.

[1015] 69. A host cell comprising an expression vector as defined in item 67.

[1016] 70. The host cell according to item 69, wherein said host cell is selected from the group consisting of a B lymphocyte, a plasma cell, a muscle cell, and an endothelial cell, such as plasma cell.

[1017] 71. A method of producing the antibody or antigen-binding fragment thereof as defined in any one of items 1-49 comprising

[1018] culturing a host cell as defined in item 69 under conditions permissive for the expression of said antibody or antigen-binding fragment thereof from said expression vector, and

[1019] isolating said antibody or antigen-binding fragment thereof.

[1020] 72. Polynucleotide according to item 65, for use as a medicament.

[1021] 73. Polynucleotide for use according to item 72, for use in treatment of an hepatitis C virus (HCV) infection.

[1022] 74. A method of in vivo producing an antibody or antigen-binding fragment thereof as defined in any one of items 1-49 comprisingintroducing one or more polynucleotide(s) according to item 65 into a cell of a mammal, thereby enabling translating of said polynucleotide and enabling assembly into an antibody of fragment thereof and enabling secretion into the blood stream, optionally wherein said polynucleotide is mRNA, DNA or cDNA.

[1023] 75. Method of treatment of an hepatitis C virus (HCV) infection in a mammal comprising in vivo producing an antibody or antigen-binding fragment thereof as defined in any one of items 1-49 by introducing one or more polynucleotide(s) according to item 65 into a cell of a mammal, thereby enabling translating of said polynucleotide and enabling assembly into an antibody of fragment thereof and enabling secretion into the blood stream, optionally wherein said polynucleotide is mRNA, DNA or cDNA.

[1024] 76. A method of in situ producing an antibody or antigen-binding fragment thereof as defined in any one of items 1-49 comprising

[1025] introducing one or more polynucleotide(s) according to item 65 into a mammalian cell, and thereafter

[1026] introducing said mammalian cell into a mammal,

[1027] thereby enabling translating of said polynucleotide and enabling assembly into an antibody of fragment thereof and enabling secretion into the blood stream, optionally wherein said polynucleotide is mRNA, DNA or cDNA.

Claims

1. Claims1. An antibody having binding affinity for a hepatitis C virus (HCV) E2 antigen, comprising5 an immunoglobulin heavy chain variable region (VH) and an immunoglobulin light chain variable region (VL), said VH and VL regions forming a VH / VL pair comprising an antigen-binding surface,in which said antigen-binding surface comprises three complementarity-determining regions (CDRs) from said VH region and three CDRs from said VL region, and in which said CDRs comprises or consist the following:VL-CDR1: RAX1QX2X3X4X5X6X7LX8 (SEQ ID NO:1) whereinXi is selected from S and N;5 X2 is selected from S and T;X3 is selected from V, G and I;X4 is selected from S, G, D, I and T;X5 is selected from N and S;Xe is selected from Y, N and D;0 X7 is selected from S or is absent; andXs is selected from A and N;VL-CDR2: X9X10SX11X12X13X14 (SEQ ID NO:2) whereinX9 is selected from D, V and A;X10 is selected from A and T;Xu is selected from N, K, T and S;X12 is selected from R, I and L;X13 is selected from A and Q;0 X14 is selected from A, T and S;VL-CDR3: QQX15X16X17X18X19X20T (SEQ ID NO:3)whereinXis is selected from R, Y, N and F;Xi6 is selected from A, S, N, G and Y;X17 is selected from K, D, N and T;Xis is selected from W, R, G, S and T;X19 is selected from S, P, I, N, T and V; andX20 is selected from W, H or is absent;VH-CDR1: RYTIQ. (SEQ ID NO:4)VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)or an antigen-binding fragment thereof.

2. An antibody or antigen-binding fragment thereof according to claim 1, wherein said antigen-binding surface is further comprising VH-CDR3, said VH-CDR3 comprises or consists of:VH-CDR3: VVIPX21X22X23X24HX25X26GX27YFDY (SEQ ID NO:6) whereinX21 is selected from N, K, R, A and T;X22 is selected from S, T, A, E and Q;X23 is selected from I and L;X24 is selected from R, W and S;X25 is selected from T and S;X26 is selected from R, M and A; andX27 is selected from F and Y.

3. An antibody or antigen-binding fragment thereof according to any previous claim, in which said CDRs comprise the followingVL-CDR1: RASQSVX4X5X6LA (SEQ ID NO:7) whereinX4 is selected from S, G and D;X5 is selected from N and S; andXe is selected from Y and N;VL-CDR2: DASXnRAX (SEQ ID NO:8) whereinXu is selected from N, K and T; andX14 is selected from A, T and S;VL-CDR3: QQRXi6Xi7Xi8Xi9T (SEQ ID NO:9), whereinXie is selected from A, S and N;X17 is selected from K, D, N and T;Xis is selected from W and R; andX19 is selected from S, P and N;VH-CDR1: RYTIQ (SEQ ID NO:4)VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5).

4. An antibody or antigen-binding fragment thereof according to claim 1 or 3, wherein said antigen-binding surface is further comprising VH-CDR3, said VH-CDR3 comprises or consists of:VH-CDR3: VVIPX21X22IRHX25MGYYFDY (SEQ ID NO:10) whereinX21 is selected from N, R, A and K;X22 is selected from A and E;X25 is selected from T and S.

5. An antibody or antigen-binding fragment thereof according to any preceding claim, which comprises a heavy chain variable domain and a light chain variable domain, wherein said light chain variable domain comprises an amino acid sequence selected fromi) the group consisting of SEQ ID NO:54-63; andii) an amino acid sequence having at least 80 % identity, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, identity to any one of SEQ ID NO:54-63, provided thatVL-CDR1 comprises an amino acid sequence selected from SEQ ID NO:11-20;VL-CDR2 comprises an amino acid sequence selected from SEQ ID NO:21-30; and VL-CDR3 comprises an amino acid sequence selected from SEQ ID NO:31-40.

6. An antibody or antigen-binding fragment thereof according to any one of the preceding claims, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:VH-CDR1: RYTIQ (SEQ ID NO:4)VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)VH-CDR3: VVIPNAIRHTMGYYFDY (SEQ ID NO:41); or wherein said VH-CDR1, VH-CDR2 and VH-CDR3 comprises or consist of the following amino acid sequences:VH-CDR1: RYTIQ (SEQ ID NO:4)VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5)VH-CDR3: VVIPAAIRHTMGYYFDY (SEQ ID NO:92).

7. An antibody or antigen-binding fragment thereof according to any one of claims 1-4, wherein said VH-CDR1, VH-CDR2 and VH-CDR3 consist of the following amino acid sequences:VH-CDR1: RYTIQ (SEQ ID NO:4)VH-CDR2: NIIPVYNTPNYAQKFQG (SEQ ID NO:5); wherein VH-CDR3 is selected from the group consisting of:VVIPNAIRHTMGYYFDY (SEQ ID NO:41), VVIPNEIRHTMGYYFDY (SEQ ID NO:46), VVIPNAIRHSMGYYFDY (SEQ ID NO:50), VVIPRAIRHTMGYYFDY (SEQ ID NO:51), VVIPKAIRHTMGYYFDY (SEQ ID NO:52), VVIPAAIRHTMGYYFDY (SEQ ID NO:92).

8. An antibody or antigen-binding fragment thereof according to claim 7, wherein VH-CDR3 is selected from the group consisting of:VVIPNAIRHTMGYYFDY (SEQ ID NO:41), VVIPAAIRHTMGYYFDY (SEQ ID NO:92).

9. An antibody or antigen-binding fragment thereof according to any one of the preceding claims, wherein VH is selected from the group consisting of SEQ ID NO: 64-76 and 79, or wherein VH is selected from the group consisting of SEQ ID NO: 64, 69, 73, 74, 75 and 79.

10. An antibody or antigen-binding fragment thereof according to any one of claims 1-6, wherein VH is selected from the group consisting ofi) SEQ ID NO: 64, andii) an amino acid sequence having at least 80 % identity, such as at least 90%, such as at least 92%, such as at least 94%, such as at least 95%, such as at least 96%, such as at least 97%, such as at least 98%, such as at least 99%, identity to SEQ ID NO:64, provided that VH-CDR1 is SEQ ID NO:4, VH-CDR2 is SEQ ID NO:5 and VH-CDR3 is selected from the group consisting of SEQ ID NO:41-52 and 92.

11. An antibody or antigen-binding fragment thereof according to any one of claims 1-2, wherein said heavy chain variable domain is as defined in any one of SEQ ID NO:64-76 and 79, and said light chain variable domain is as defined in any one of SEQ ID NO:54-63.

12. An antibody or antigen-binding fragment thereof according to any one of claims 1-2, wherein the heavy chain variable domain and the light chain variable domain are represented by the following VH / VL combinations:a) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:64 and a light chain variable domain comprising SEQ ID NO:54-63;b) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:65 and a light chain variable domain comprising SEQ ID NO:54-63;c) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:66 and a light chain variable domain comprising SEQ ID NO:54-63;d) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:67 and a light chain variable domain comprising SEQ ID NO:54-63;e) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:68 and a light chain variable domain comprising SEQ ID NO:54-63;f) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:69 and a light chain variable domain comprising SEQ ID NO:59;g) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:70 and a light chain variable domain comprising SEQ ID NO:54-63;h) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:71 and a light chain variable domain comprising SEQ ID NO:54-63;i) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:72 and a light chain variable domain comprising SEQ ID NO:54-63;j) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:73 and a light chain variable domain comprising SEQ ID NO:54-63;k) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:74 and a light chain variable domain comprising SEQ ID NO:54-63;l) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:75 and a light chain variable domain comprising SEQ ID NO:54-63;m) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:76 and a light chain variable domain comprising SEQ ID NO:54-63; such as represented by the VH / VL combinations f), j), k) and / or I); n) a heavy chain variable domain comprising an amino acid sequence selected from the group consisting of SEQ ID NO:79 and a light chain variable domain comprising SEQ ID NO:54-63; such as represented by the VH / VL combinations f), j), k) and / or I).

13. An antibody or antigen-binding fragment thereof according to any one of claims any one of claims 1-2, wherein said heavy chain variable domain comprises or consists of SEQ ID NO: 64 and wherein said light chain variable domain comprises or consists of SEQ ID NO: 58.

14. An antibody or antigen-binding fragment thereof according to any one of the preceding claims, wherein said heavy chain variable domain is as defined in any one of SEQ ID NO:64, 69, 73, 74, 75 and 79; and said light chain variable domain is as defined in SEQ ID NO:58.

15. An antibody or antigen-binding fragment thereof according to claim 14, wherein said heavy chain variable domain is as defined in SEQ ID NO:64 or 79.

16. An antibody or antigen-binding fragment thereof according to any one of claims 14-15, wherein said heavy chain variable domain consists of SEQ ID NO: 64.

17. An antibody or antigen-binding fragment thereof according to any one of claims 14-15, wherein said heavy chain variable domain consists of SEQ ID NO: 79.

18. An antibody or antigen-binding fragment thereof according to any preceding claim, which is of IgG subclass, such as selected from the group consisting of IgG 1, IgG 2, lgG3, and lgG4, such as wherein said IgG subclass is selected from the group consisting of IgGl and lgG4.

19. Pharmaceutical composition, comprising an antibody or antigen-binding fragment thereof according to any preceding claim and a pharmaceutically acceptable carrier or excipient.

20. An antibody or antigen-binding fragment thereof according to any one of claims 1-18 or a pharmaceutical composition according to claim 19 for use in treatment, such as for use in therapeutic treatment or for use in prophylactic treatment, optionally wherein said therapeutic treatment or prophylactic treatment is with respect to a HVC infection.

21. A method of detecting a hepatitis C virus (HCV) E2 antigen in vitro, comprising providing a sample suspected to contain said E2 antigen, contacting said sample with an antibody or antigen-binding fragment thereof according to any one of claims 1-18 or a pharmaceutical composition according to claim 19, and detecting the binding of said protein to indicate the presence of said E2 antigen in the sample.

Images