Deuterated analogues
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- IMPERIAL COLLEGE INNVOATIONS LTD
- Filing Date
- 2026-01-30
- Publication Date
- 2026-08-06
Smart Images

Figure EP2026052529_06082026_PF_FP_ABST
Abstract
Description
[0001] DEUTERATED ANALOGUES
[0002] FIELD OF THE INVENTION
[0003] The present invention relates to deuterated analogues of TSPO binding member XBD173. In particular, the invention relates to deuterated compounds of Formula (I), pharmaceutical compositions comprising deuterated compounds of Formula (I) and their use in therapy.
[0004] BACKGROUND
[0005] The Translocator Protein (TSPO) is a conserved 18-kDa protein found in the outer mitochondrial membrane. TSPO is involved in multiple essential cellular processes, including cholesterol transport, steroidogenesis, mitochondrial function, apoptosis, and immune responses. Its expression is low in most healthy tissues but is significantly increased in a range of pathological conditions.
[0006] TSPO is expressed in microglia. TSPO expression is markedly increased in response to neuroinflammation. This increase of TSPO is known to play a role in a number of neurological disorders. In diseases such as Alzheimer's disease (AD), Parkinson's disease (PD), and multiple sclerosis (MS), elevated TSPO levels reflect microglial density and gliosis. As such, TSPO ligands have been explored for their neuroprotective effects (Barron, et al., 2013; Fairley, et al., 2021; Christensen, et al., 2018; Ma, et al., 2016; Pradhan, et al., 2023; Li, et al., 2016).
[0007] TSPO expression is upregulated in many cancers, including glioblastoma, breast, prostate, and colon cancers (Li, et al., 2016; Bhoola, et al., 2018). It is associated with tumour progression, invasion, and resistance to therapy. TSPO ligands have been investigated for their ability to induce apoptosis and inhibit tumour growth.
[0008] In psychiatric conditions such as depression, anxiety, and post-traumatic stress disorder (PTSD), TSPO is implicated in dysregulated neurosteroidogenesis. TSPO ligands, by enhancing neurosteroid production, are being investigated as potential treatments for these disorders (Rupprecht, et al., 2022).
[0009] Increased TSPO expression is also linked to cardiovascular diseases such as atherosclerosis, cardiac hypertrophy, pulmonary hypertension (PH) and pulmonary arterial hypertension (PAH), often reflecting mitochondrial dysfunction and oxidative stress. In metabolic disorders such as diabetes, TSPO plays a role in modulating mitochondrial health and inflammation (Baglini, et al., 2024; Morin, et al., 2016; Li, et al., 2022).
[0010] The present inventors have previously shown that targeting TSPO using XBD173 has therapeutic potential in the treatment of PH, particularly PAH (W02022 / 096901). In particular, thepresent have previously demonstrated that treatment of MCT rats with XBD173 (a binding member for TSPO) attenuates the PH phenotype without affecting systemic blood pressure, and that this can be achieved using doses of XBD173 comparable to the licensed dose for humans. In their earlier work, the inventors have shown that treatment with XBD173 reduces pulmonary arterial pressure (PAP) and pulmonary vascular remodelling. The inventors have also previously shown that XBD173 treatment reduces remodelling of the right ventricle (RV) and improves cardiac performance, and attenuates glucose uptake in both lung and RV. Further, the inventors have demonstrated that in vitro XBD173 treatment inhibits DMOG (a permeable prolyl-4-hydroxylase inhibitor which upregulates hypoxiainducible factor) induced endothelial apoptosis, and PDGF- and hypoxia-induced pulmonary smooth muscle cell proliferation.
[0011] XBD173 (Emapunil) is an orally bioavailable selective and high-affinity ligand for TSPO. It has been extensively studied for its anxiolytic, anti-inflammatory, and neuroprotective properties, without exhibiting sedative or dependence-inducing side effects commonly associated with traditional benzodiazepines.
[0012] To date, the metabolic pathways of XBD173 within humans are unknown, and there have been no successful attempts to improve the pharmacokinetics of XBD173 to facilitate its clinical use.
[0013] It is an object of the present invention to address one or more of the above challenges, and to provide modified forms of XBD173 with improved pharmacokinetic properties.
[0014] SUMMARY OF THE INVENTION
[0015] It is not possible to definitively identify modifications that could improve the pharmacokinetic properties of XBD173 merely from its structure alone. To-date, there are no reports in the art investigating the metabolic degradation of XBD173 in humans. The inventors have now carried out studies to investigate XBD173 degradation, and in doing so, they identified nine potential metabolites, the most abundant metabolite being (XBD173-C₇H₆, referred to herein as M2). Furthermore, the inventors have confirmed that the M2 metabolite is present in humans treated with XBD173, confirming that this is a relevant metabolic pathway in humans. Using this new information regarding the metabolism of XBD173 and the primary metabolite, M2, the inventors were able to design deuterated analogues of XBD173, and have demonstrated that these deuterated analogues exhibit decreased metabolic degradation and increased intact half-life in human microsomes, with particular deuteration patterns being particularly effective at reducing metabolic degradation. The inventors also provide evidence that the increased metabolic stability of deuterated analogues of XBD173 does not impact their activity on TSPO. Furthermore, the present inventors have shown that the increased metabolic stability of deuterated analogues of XBD173 observed in vitro is translated in vivo.Accordingly, the present invention provides a compound according to Formula (I)
[0016]
[0017] wherein:
[0018] R, R', R", R'" and R"" are independently selected from hydrogen and deuterium; Ra, Rband Rcare independently selected from hydrogen and deuterium; and at least one of R, R', R", R'", R"", Ra, Rband Rcis deuterium;
[0019] or a pharmaceutically acceptable salt thereof.
[0020] In compounds of the invention according to Formula (I), -CR"2- may be -CDH- and / or -CR'2-may be -CDH-. -CR"2- may be -CDH- and R' may be deuterium or -CR'2- may be -CDH- and R" may be deuterium in a compound of the invention. -CR"2- may be -CDH- in (R) configuration and / or -CR'2- may be -CDH- in (R) configuration in a compound of the invention. -CR"2- may be -CDH- in (S) configuration and / or -CR'2- may be -CDH- in (S) configuration in a compound of the invention. R may be deuterium in a compound of the invention.
[0021] In compounds of the invention according to Formula (I), R, R' or R" may be deuterium. R and R' may be deuterium in a compound of the invention. R, R' and R" may be deuterium in a compound of the invention. R'" may be deuterium in a compound of the invention. R, R', R" and R'" may be deuterium in a compound of the invention.
[0022] The compounds of the invention may be selected from the group comprising 3, 4, 6, 7, 10, 16, 26, 40, 48, 64, 72, 88, 96, 104, 144, 152, 200, 208 and 216, optionally the compound may be selected from compounds 10, 16, 26, 64, 72, 144 and 152.
[0023] The metabolic degradation of the compound of the invention may be reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, or at least about 45%, compared to a compound of Formula (I) wherein R, R', R", R'", R"", Ra, Rband Rcare hydrogens (XBD173). The metabolic degradation of the compound of the invention may be reduced by at least about 30% compared to acompound of Formula (I) wherein R, R', R", R'", R"", Ra, Rband Rcare hydrogens (XBD173). The metabolic degradation of the compound of the invention may be reduced by at least about 40%, optionally by at least about 45% compared to a compound of Formula (I) wherein R, R', R", R'", R"", Ra, Rband Rcare hydrogens (XBD173).
[0024] The invention further provides a pharmaceutical composition comprising a compound of the invention and at least one pharmaceutically acceptable carrier, optionally the composition may be a solid composition or a liquid composition.
[0025] The invention further provides a compound of the invention or a pharmaceutical composition of the invention for use in a method of treatment in a patient in need thereof.
[0026] The invention further provides a compound of the invention or a pharmaceutical composition of the invention for use in a method of treatment or prevention of endothelial cell dysfunction.
[0027] The condition to be treated may be selected from Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), pulmonary hypertension, heart failure, stress-related disorders such as panic disorders and anxiety, depression, age-related macular degeneration (AMD) or metabolic diseases such as diabetes type 1 and / or type 2. The condition to be treated may be Alzheimer's disease (AD). The condition to be treated may be pulmonary hypertension, preferably pulmonary arterial hypertension (PAH), optionally idiopathic pulmonary arterial hypertension (IPAH). The condition to be treated may be heart failure, optionally heart failure with preserved ejection fraction and associated pulmonary hypertension (PH-HFpEF). The patient may be a mammal, preferably wherein the patient may be a human. The patient may be a rapid-metaboliser. A therapeutically effective amount of the compound maybe from about 0.1 mg / kgto 20 mg / kg. The patient may be administered the compound or pharmaceutical composition at least once daily, preferably once or twice daily, more preferably once daily. The compound or composition may be for oral, buccal, nasal, rectal, transdermal, intravenous, intramuscular or ocular administration to the patient, preferably the compound or composition may be for oral administration to the patient.
[0028] The invention further provides a method of treatment comprising the step of administering a therapeutically effective amount of a compound of the invention, or a pharmaceutical composition of the invention to a subject in need thereof.
[0029] The invention further provides the use of a compound of the invention in the manufacture of a medicament.
[0030] The invention further provides a compound of the invention or XBD173 for use in the treatment of a disorder associated with a vascular component.
[0031] The invention further provides a pharmaceutical composition comprising a compound of the invention and / or XBD 173 for use in the treatment of a disorder associated with a vascular component.BRIEF DESCRIPTION OF THE DRAWINGS
[0032] Figure 1 - Markush formula of Formula (I)
[0033] Figure 2 - Schematic showing the different metabolites of XBD173
[0034] Figure 3 - Time course showing metabolic degradation of compounds of the invention during linear phase. This data was produced in the presence of human microsomes and compared to nondeuterated XBD173 and Verapamil. The results show that compound 6, 16 and 26 have increased metabolic stability in the presence of human microsomes compared to non-deuterated XBD173. Figure 4 - Effect of non-deuterated XBD173 on vasodilatation in Alzheimer's disease mouse model. Data produced using the APP(nlgf) mouse model showed improved recovery of vascular function for the group treated with non-deuterated XBD173 compared with the non-treated group.
[0035] Figure 5 - Effect of non-deuterated XBD173 on glucose tolerance in health human subjects. Treatment for 7 days with non-deuterated oral XBD173 showed evidence that XBD173 reduces the peak plasma glucose concentration following oral glucose administration (which occurs orally at t=0) and the area under the plasma glucose / time curve.
[0036] Figure 6 -Time course showing metabolic degradation of compound 16 of the invention during linear phase. This data was produced in the presence of mouse microsomes and compared to non-deuterated XBD173. The results show that compound 16 has increased metabolic stability in the presence of mouse microsomes compared to non-deuterated XBD173.
[0037] DETAILED DESCRIPTION
[0038] Definitions
[0039] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994), and Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) provide the skilled person with a general dictionary of many of the terms used in this disclosure. The meaning and scope of the terms should be clear; however, in the event of any latent ambiguity, definitions provided herein take precedent over any dictionary or extrinsic definition. It should be understood that this invention is not limited to the particular methodology, protocols, and reagents, etc., described herein and as such can vary.This disclosure is not limited by the exemplary methods and materials disclosed herein, and any methods and materials similar or equivalent to those described herein can be used in the practice or testing of embodiments of this disclosure. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.
[0040] The description of embodiments of the disclosure is not intended to be exhaustive or to limit the disclosure to the precise form disclosed. While specific embodiments of, and examples for, the disclosure are described herein for illustrative purposes, various equivalent modifications are possible within the scope of the disclosure, as those skilled in the relevant art will recognize. For example, while method steps or functions are presented in a given order, alternative embodiments may perform functions in a different order, or functions may be performed substantially concurrently. The teachings of the disclosure provided herein can be applied to other procedures or methods as appropriate. The various embodiments described herein can be combined to provide further embodiments. Aspects of the disclosure can be modified, if necessary, to employ the compositions, functions and concepts of the above references and application to provide yet further embodiments of the disclosure. Moreover, due to biological functional equivalency considerations, some changes can be made in protein structure without affecting the biological or chemical action in kind or amount. These and other changes can be made to the disclosure in light of the detailed description. All such modifications are intended to be included within the scope of the appended claims.
[0041] The headings provided herein are not limitations of the various aspects or embodiments of this disclosure.
[0042] As used herein, the term "capable of' when used with a verb, encompasses or means the action of the corresponding verb. For example, "capable of interacting" also means interacting, "capable of reducing" also means reduces, "capable of binding" also means binds and "capable of specifically targeting..." also means specifically targets.
[0043] Numeric ranges are inclusive of the numbers defining the range. Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limits of that range is also specifically disclosed. Each smaller range between any stated value or intervening value in a stated range and any other stated or intervening value in that stated range is encompassed within this disclosure. The upper and lower limits of these smaller ranges may independently be included or excluded in the range, and each range where either, neither or both limits are included in the smaller ranges is also encompassed within this disclosure, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either orboth of those included limits are also included in this disclosure. Concentrations, amounts, volumes, percentages and other numerical values may be presented herein in a range format.
[0044] As used herein, the articles "a" and "an" may refer to one or to more than one (e.g. to at least one) of the grammatical object of the article. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular. In this application, the use of "or" means "and / or" unless stated otherwise. Furthermore, the use of the term "including", as well as other forms, such as "includes" and "included", is not limiting.
[0045] " About" may generally mean an acceptable degree of error for the quantity measured given the nature or precision of the measurements. Exemplary degrees of error are within 20 percent (%), typically, within 10%, and more typically, within 5% of a given value or range of values. Preferably, the term "about" shall be understood herein as plus or minus (±) 5%, preferably ± 4%, ± 3%, ± 2%, ± 1%, ± 0.5%, ± 0.1%, of the numerical value of the number with which it is being used.
[0046] The term "consisting of" refers to compositions, methods, and respective components thereof as described herein, which are exclusive of any element not recited in that description of the invention.
[0047] As used herein the term "consisting essentially of" refers to those elements required for a given invention. The term permits the presence of elements that do not materially affect the basic and novel or functional characteristic(s) of that invention (i.e. inactive or non-immunogenic ingredients).
[0048] Embodiments described herein as "comprising" one or more features may also be considered as disclosure of the corresponding embodiments "consisting of" and / or "consisting essentially of" such features.
[0049] Amino acids are referred to herein using the name of the amino acid, the three-letter abbreviation or the single letter abbreviation.
[0050] As used herein, the terms "protein" and "polypeptide" are used interchangeably herein to designate a series of amino acid residues, connected to each other by peptide bonds between the alpha-amino and carboxyl groups of adjacent residues. The terms "protein", and "polypeptide" refer to a polymer of amino acids, including modified amino acids (e.g., phosphorylated, glycated, glycosylated, etc.) and amino acid analogues, regardless of its size or function. " Protein" and "polypeptide" are often used in reference to relatively large polypeptides, whereas the term "peptide" is often used in reference to small polypeptides, but usage of these terms in the art overlaps. The terms "protein" and "polypeptide" are used interchangeably herein when referring to a gene product and fragments thereof. Thus, exemplary polypeptides or proteins include gene products, naturally occurring proteins, homologs, orthologs, paralogs, fragments and other equivalents, variants, fragments, and analogues of the foregoing. The 3-letter code for amino acids as defined in conformity with the IUPACIUB Joint Commission on Biochemical Nomenclature (JCBN). It is also understood thata polypeptide may be coded for by more than one nucleotide sequence due to the degeneracy of the genetic code.
[0051] As used herein, the terms "polynucleotides", "nucleic acid" and "nucleic acid sequence" refers to any molecule, preferably a polymeric molecule, incorporating units of ribonucleic acid, deoxyribonucleic acid or an analogue thereof. The nucleic acid can be either single-stranded or doublestranded. A single-stranded nucleic acid can be one nucleic acid strand of a denatured doublestranded DNA Alternatively, it can be a single-stranded nucleic acid not derived from any doublestranded DNA. In one aspect, the nucleic acid can be DNA. In another aspect, the nucleic acid can be RNA Suitable nucleic acid molecules are DNA, including genomic DNA or cDNA. Other suitable nucleic acid molecules are RNA, including siRNA, shRNA, and antisense oligonucleotides.
[0052] An exemplary, but non-limiting amino acid sequence of human TSPO may comprise or consist of UniProt Accession No. P30536 (version 3 of the sequence, sequence for the entry last modified 30 November 2010, provided herein as SEQ ID NO: 1). The corresponding mRNA sequence is SEQ ID NO: 2.
[0053] The term "chemically feasible" means a bonding arrangement or a compound where the generally understood rules of organic structure are not violated; for example, a structure within a definition of a claim that would contain in certain situations a pentavalent carbon atom that would not exist in nature would be understood to not be within the claim. The structures disclosed herein, in all of their embodiments are intended to include only "chemically feasible" structures, and any recited structures that are not chemically feasible, for example in a structure shown with variable atoms or groups, are not intended to be disclosed herein and do not form part of the present invention.
[0054] An "analogue" of a chemical structure, as the term is used herein, refers to a chemical structure that preserves substantial similarity with the parent structure, although it may not be readily derived synthetically from the parent structure. A related chemical structure that is readily derived synthetically from a parent chemical structure is referred to as a "derivative."
[0055] When a substituent is specified to be an atom or atoms of specified identity, "or a bond", a configuration is referred to when the substituent is "a bond" that the groups that are immediately adjacent to the specified substituent are directly connected to each other in a chemically feasible bonding configuration.
[0056] All chiral, diastereomeric, racemic forms of a structure are intended, unless a particular stereochemistry or isomeric form is specifically indicated. Compounds used in the present invention can include enriched or resolved optical isomers at any or all asymmetric atoms as are apparent from the depictions, at any degree of enrichment. Both racemic and diastereomeric mixtures, as well as theindividual optical isomers can be isolated or synthesized so as to be substantially free of their enantiomeric or diastereomeric partners, and these are all within the scope of the invention.
[0057] As used herein, the terms "stable compound" and "stable structure" are meant to indicate a compound that is sufficiently robust to survive isolation to a useful degree of purity from a reaction mixture, and formulation into an efficacious therapeutic agent. Only stable compounds are contemplated herein.
[0058] Standard abbreviations for chemical groups such as are well known in the art are used; e.g., Me = methyl, Et = ethyl, i-Pr = isopropyl, Bu = butyl, t-Bu = tert-butyl, Ph = phenyl, Bn = benzyl, Ac = acetyl, Bz = benzoyl, and the like.
[0059] When a group is recited, wherein the group can be present in more than a single orientation within a structure resulting in more than single molecular structure, e.g., a carboxamide group C(=O)NR, it is understood that the group can be present in any possible orientation, e.g., X-C(=O)N(R)-Y or X-N(R)C(=O)-Y, unless the context clearly limits the orientation of the group within the molecular structure.
[0060] Hydrocarbyl groups are groups that consist only of carbon and hydrogen, though the groups may be substituted one or more times, as defined herein. Hydrocarbyl groups include straight chain and branched groups. Compounds of Formula (I) typically have hydrocarbyl groups with from 1 to 6 carbon atoms, particularly from 1 to 4 carbon atoms or from 1 to 3 carbon atoms. As used herein, the term "hydrocarbyl" encompasses aromatic and non-aromatic groups. Preferred hydrocarbyl groups include alkyl, alkenyl and alkynyl groups which are described further below.
[0061] Alkyl groups include straight chain and branched alkyl groups and cycloalkyl groups having from 1 to about 20 carbon atoms, and typically from 1 to 12 carbons, from 1 to 8 carbon atoms, from 1 to 6 carbon atoms. Examples of straight chain alkyl groups include those with from 1 to 8 carbon atoms such as methyl, ethyl, n-propyl, n-butyl, n-pentyl, n-hexyl, n-heptyl, and n-octyl groups. Examples of branched alkyl groups include, but are not limited to, isopropyl, iso-butyl, sec-butyl, t-butyl, neopentyl, isopentyl, and 2,2-dimethylpropyl groups. As used herein, the term "alkyl" encompasses n-alkyl, isoalkyl, and anteisoalkyl groups as well as other branched chain forms of alkyl. Representative substituted alkyl groups can be substituted one or more times, as defined herein.
[0062] Heterocyclyl groups / rings or the term "heterocyclyl" includes aromatic and non-aromatic ring compounds containing 3 or more ring members, of which, one or more is a heteroatom such as, but not limited to, N, 0, and S. Thus, a heterocyclyl can be a cycloheteroalkyl, or a heteroaryl, or if polycyclic, any combination thereof. Heterocyclyl groups may include 3 to about 20 ring members, whereas in compounds of Formula (I) heterocyclyl rings typically have 5 to 10 ring members. A heterocyclyl ring can be a 5-membered ring with one heteroatom, a 6-membered ring with twoheteroatoms, and so forth. The number of carbon atoms plus the number of heteroatoms sums up to equal the total number of ring atoms. A heterocyclyl ring can also include one or more double bonds. A heteroaryl ring is an embodiment of a heterocyclyl group. The phrase "heterocyclyl group" includes fused ring species including those comprising fused aromatic and non-aromatic groups. For example, a dioxolanyl ring and a benzdioxolanyl ring system (methylenedioxyphenyl ring system) are both heterocyclyl groups within the meaning herein. The phrase also includes polycyclic ring systems containing a heteroatom as described herein. Heterocyclyl groups can be unsubstituted or can be substituted as discussed above.
[0063] Heteroaryl groups are aromatic ring compounds containing 5 or more ring members, of which, one or more is a heteroatom such as, but not limited to, N, 0, and S; for instance, heteroaryl rings can have 5 to about 8-12 ring members. In compounds of Formula (I) heteroaryl rings typically have 5 to about 10 ring members. A heteroaryl group is a variety of a heterocyclyl group that possesses an aromatic electronic structure. Likewise a heteroaryl can be a 5-ring with one heteroatom, a 6-ring with two heteroatoms, and so forth. The number of carbon atoms plus the number of heteroatoms sums up to equal the total number of ring atoms. Heteroaryl groups include, but are not limited to, groups such as pyrrolyl, pyrazolyl, triazolyl, tetrazolyl, oxazolyl, isoxazolyl, thiazolyl, pyridinyl, pyrimidyl, thiophenyl, benzothiophenyl, benzofuranyl, indolyl, azaindolyl, indazolyl, benzimidazolyl, azabenzimidazolyl, benzoxazolyl, benzothiazolyl, benzothiadiazolyl, imidazopyridinyl, isoxazolopyridinyl, thianaphthalenyl, purinyl, xanthinyl, adeninyl, guaninyl, quinolinyl, isoquinolinyl, tetrahydroquinolinyl, quinoxalinyl, and quinazolinyl groups. Heteroaryl groups can be unsubstituted or can be substituted with groups as is discussed above. Representative substituted heteroaryl groups can be substituted one or more times with groups such as those listed above.
[0064] Halogen refers to fluorine, chlorine, bromine or iodine.
[0065] A "salt" as is well known in the art includes an organic compound such as a carboxylic acid, a sulfonic acid, or an amine, in ionic form, in combination with a counterion. For example, acids in their anionic form can form salts with cations such as metal cations, for example sodium, potassium, and the like; with ammonium salts such as NH4+ or the cations of various amines, including tetraalkyl ammonium salts such as tetramethylammonium, or other cations such as trimethylsulfonium, and the like. A "pharmaceutically acceptable" or "pharmacologically acceptable" salt is a salt formed from an ion that has been approved for human consumption and is generally non-toxic, such as a chloride salt or a sodium salt. A "zwitterion" is an internal salt such as can be formed in a molecule that has at least two ionisable groups, one forming an anion and the other a cation, which serve to balance each other. For example, amino acids such as glycine can exist in a zwitterionic form. A "zwitterion" is a salt within the meaning herein. The compounds of the present invention may take the form of salts. The term"salts" embraces addition salts of free acids or free bases which are compounds of the invention. Salts can be "pharmaceutically-acceptable salts. " The term "pharmaceutically-acceptable salt" refers to salts which possess toxicity profiles within a range that affords utility in pharmaceutical applications.
[0066] Pharmaceutically unacceptable salts may nonetheless possess properties such as high crystallinity, which have utility in the practice of the present invention, such as for example utility in process of synthesis, purification or formulation of compounds of the invention.
[0067] Suitable pharmaceutically-acceptable acid addition salts may be prepared from an inorganic acid or from an organic acid. Examples of inorganic acids include hydrochloric, hydrobromic, hydriodic, nitric, carbonic, sulfuric, and phosphoric acids. Appropriate organic acids may be selected from aliphatic, cycloaliphatic, aromatic, araliphatic, heterocyclic, carboxylic and sulfonic classes of organic acids, examples of which include formic, acetic, propionic, succinic, glycolic, gluconic, lactic, malic, tartaric, citric, ascorbic, glucuronic, maleic, fumaric, pyruvic, aspartic, glutamic, benzoic, anthranilic, 4-hydroxybenzoic, phenylacetic, mandelic, embonic (pamoic), methanesulfonic, ethanesulfonic, benzenesulfonic, pantothenic, trifluoromethanesulfonic, 2-hydroxyethanesulfonic, p-toluenesulfonic, sulfanilic, cyclohexylaminosulfonic, stearic, alginic, β-hydroxybutyric, salicylic, galactaric and galacturonic acid. Examples of pharmaceutically unacceptable acid addition salts include, for example, perchlorates and tetrafluoroborates.
[0068] Suitable pharmaceutically acceptable base addition salts of compounds of the invention include, for example, metallic salts including alkali metal, alkaline earth metal and transition metal salts such as, for example, calcium, magnesium, potassium, sodium and zinc salts. Pharmaceutically acceptable base addition salts also include organic salts made from basic amines such as, for example, N, N-dibenzylethylenediamine, chloroprocaine, choline, diethanolamine, ethylenediamine, meglumine (N-methylglucamine) and procaine. Examples of pharmaceutically unacceptable base addition salts include lithium salts and cyanate salts. Although pharmaceutically unacceptable salts are not generally useful as medicaments, such salts may be useful, for example as intermediates in the synthesis of Formula (I) compounds, for example in their purification by recrystallization. All of these salts may be prepared by conventional means from the corresponding compound according to Formula (I) by reacting, for example, the appropriate acid or base with the compound according to Formula (I). The term "pharmaceutically acceptable salts" refers to nontoxic inorganic or organic acid and / or base addition salts, see, for example, Lit et al., Salt Selection for Basic Drugs (1986), Int J. Pharm., 33, 201-217.
[0069] Since compounds of Formula (I) are bases, then they will readily form salts in which the amine group is present as an ammonium cation having an anionic counterion. Suitable anionic ions are described above.A "hydrate" is a compound that exists in a composition with water molecules. The composition can include water in stoichiometric quantities, such as a monohydrate or a dihydrate, or can include water in random amounts. As the term is used herein a "hydrate" refers to a solid form, i.e., a compound in water solution, while it may be hydrated, is not a hydrate as the term is used herein.
[0070] A "solvate" is a similar composition except that a solvent other that water replaces the water. For example, methanol or ethanol can form an "alcoholate", which can again be stoichiometric or non-stoichiometric. As the term is used herein a "solvate" refers to a solid form, i.e., a compound in solution in a solvent, while it may be solvated, is not a solvate as the term is used herein.
[0071] Deuterium is referred herein as D but may be referenced in the art as2H and is a stable isotope of hydrogen.
[0072] A "prodrug" as is well known in the art is a substance that can be administered to a patient where the substance is converted in vivo by the action of biochemicals within the patient's body, such as enzymes, to the active pharmaceutical ingredient. Examples of prodrugs include esters of carboxylic acid groups, which can be hydrolysed by endogenous esterases as are found in the bloodstream of humans and other mammals. Conventional procedures for the selection and preparation of suitable prodrug derivatives are described, for example, in " Design of Prodrugs", ed. H. Bundgaard, Elsevier, 1985.
[0073] In addition, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any individual member or subgroup of members of the Markush group. For example, if X is described as selected from the group consisting of bromine, chlorine, and iodine, claims for X being bromine and claims for X being bromine and chlorine are fully described. Moreover, where features or aspects of the invention are described in terms of Markush groups, those skilled in the art will recognize that the invention is also thereby described in terms of any combination of individual members or subgroups of members of Markush groups. Thus, for example, if X is described as selected from the group consisting of bromine, chlorine, and iodine, and Y is described as selected from the group consisting of methyl, ethyl, and propyl, claims for X being bromine and Y being methyl are fully described.
[0074] If a value of a variable that is necessarily an integer, e.g., the number of carbon atoms in an alkyl group or the number of substituents on a ring, is described as a range, e.g., 0-4, what is meant is that the value can be any integer between 0 and 4 inclusive, i.e., 0, 1, 2, 3, or 4.
[0075] In various embodiments, the compound or set of compounds, such as are used in the inventive methods, can be any one of any of the combinations and / or subcombinations of the above-listed embodiments.In various embodiments, a compound as shown in any of the Examples, or among the exemplary compounds, is provided.
[0076] Provisos may apply to any of the disclosed categories or embodiments wherein any one or more of the other above disclosed embodiments or species may be excluded from such categories or embodiments.
[0077] The terms "decrease", "reduced", "reduction", or "inhibit" are all used herein to mean a decrease by a statistically significant amount. The terms "reduce," "reduction" or "decrease" or "inhibit" typically means a decrease by at least 10% as compared to a reference level (e.g. the absence of a given treatment) and can include, for example, a decrease by at least about 10%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 98%, at least about 99%, or more. As used herein, "reduction" or "inhibition" encompasses a complete inhibition or reduction as compared to a reference level. " Complete inhibition" is a 100% inhibition (i.e. abrogation) as compared to a reference level. A decrease can be preferably down to a level accepted as within the range of normal for an individual without a given disorder.
[0078] The terms "increased", "increase", "enhance", or "activate" are all used herein to mean an increase by a statically significant amount. The terms "increased", "increase", "enhance", or "activate" can mean an increase of at least 10% as compared to a reference level, for example an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90% or up to and including a 100% increase or any increase between 10-100% as compared to a reference level, or at least about a 2-fold, or at least about a 3-fold, or at least about a 4-fold, or at least about a 5-fold or at least about a 10-fold increase, or any increase between 2-fold and 10-fold or greater as compared to a reference level. In the context of a marker or symptom, an "increase" is a statistically significant increase in such level.
[0079] References herein to the level of a particular molecule (e.g. TSPO, any of the deuterated XBD173 analogues described herein) encompass the actual amount of the molecule, such as the mass, molar amount, concentration or molarity of the molecule. Preferably in the context of the invention, references to the level of a particular molecule refer to the concentration of the molecule. References herein to the level of a particular cell encompass both the actual number of that cell type or a concentration thereof.
[0080] The level of a molecule may be determined in any appropriate physiological compartment. Preferred physiological compartments include bronchoalveolar lavage (BAL), plasma, cerebrospinalfluid (CSF), whole blood and / or serum. The level of a molecule may be determined from any appropriate sample from an individual, e.g. a BAL sample plasma sample, a CSF sample, a blood sample and / or a serum sample. Other non-limiting examples of samples which may be tested are tissue or fluid samples, such as urine and biopsy samples. Thus, by way of non-limiting example, the invention may reference the level (e.g. concentration) of a molecule (e.g. TSPO, any of the deuterated XBD173 analogues described herein) in the BAL and / or plasma of an individual. The level of a molecule pretreatment with a deuterated XBD173 analogue of the invention may be interchangeably referred to as the "baseline".
[0081] The level of a molecule (e.g. TSPO, any of the deuterated XBD173 analogues described herein) may be compared with any appropriate control. For example, a control may be obtained from a healthy individual. Alternatively, the control may be obtained from the same individual prior to treatment.
[0082] The level of a molecule (e.g. TSPO, any of the deuterated XBD173 analogues described herein) after treatment with an agent of the invention may be compared with the level of the molecule in the individual pre-treatment with the agent. Thus, the invention may be concerned with the relative level of the molecule (e.g. TSPO, any of the deuterated XBD173 analogues described herein) pre- and posttreatment. The level of a molecule pre-treatment (e.g. TSPO, any of the deuterated XBD173 analogues described herein) may be used to identify an individual as suitable for treatment according to the invention. Other parameters may also be used, either alone or in combination with the level of a molecule as described above, to identify an individual as suitable for treatment according to the invention. Suitable parameters to identify an individual as suitable for treatment according to the invention are known to the skilled person. For example, the presence and / or amount of a biomarker is used to identify an individual as suitable for treatment. The biomarker may, for example, be a circulating protein biomarker. Imaging biomarkers may also be used to identify an individual as suitable for treatment according to the invention. The imaging biomarkers may be identified, for example, through analysis of computerised tomography (CT) images.
[0083] The level of a molecule may be measured directly or indirectly, and may be determined using any appropriate technique. Suitable standard techniques are known in the art, for example Western blotting, enzyme-linked immunosorbent assays (ELISAs) and liquid chromatography coupled mass-spectrometry (LCMS). In particular, the standard technique used in this present application is UHPLC-TOF MS (ultrahigh pressure liquid chromatography coupled with time-of-flight mass spectrometry).
[0084] An individual can be one who has been previously diagnosed with or identified as suffering from or having a condition in need of treatment or one or more complications related to such a condition, and optionally, have already undergone treatment for a condition as defined herein or theone or more complications related to said condition. Alternatively, an individual can also be one who has not been previously diagnosed as having a condition as defined herein or one or more complications related to said condition. For example, an individual can be one who exhibits one or more risk factors for a condition, or one or more complications related to said condition or a subject who does not exhibit risk factors.
[0085] An "individual in need" of treatment for a particular condition can be an individual having that condition, diagnosed as having that condition, or at risk of developing that condition.
[0086] The terms "subject", "individual" and "patient" are used interchangeably herein to refer to a mammalian individual. An "individual" may be any mammal. Generally, the individual may be human; in other words, in one embodiment, the "individual" is a human. A "individual" may be an adult, juvenile or infant. An "individual" may be male or female.
[0087] The term "pharmaceutically acceptable" as used herein means approved by a regulatory agency of the Federal or a state government, or listed in the U. S. Pharmacopeia, European Pharmacopeia or other generally recognized pharmacopeia.
[0088] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that such publications constitute prior art to the claims appended hereto.
[0089] TSPO
[0090] Translocator protein (TSPO) is an 18kDa conserved mitochondrial outer membrane protein, formerly known as the peripheral benzodiazepine receptor (PBR). Non-limiting exemplary human TSPO amino acid and nucleic acid sequences are provided herein. TSPO is highly expressed in inflammatory and endothelial cells. TSPO is widely distributed in tissues such as lung, heart, kidney, blood, gonads and adipocytes and associated with a wide range of biological processes including cell proliferation, apoptosis, steroidogenesis, and immunomodulation.
[0091] XBD173
[0092] The term " XBD173" as used herein refers to N-Ethyl-7,8-dihydro-7-methyl-8-oxo-2-phenyl-N-(phenylmethyl)-9H-purine-9-acetamide, as well as derivatives or analogues thereof. Various synonyms of XBD173 are known to the skilled person, including Emapunil, AC-5216 and NVP-XBD173. XBD173 has been assigned Chemical Abstracts Service registry number (CAS No.) 226954-04-7.
[0093] XBD173 has the structure:XBD173
[0094]
[0095] XBD173 is a TSPO binding member that binds selectively to TSPO. There is some variation in the binding affinity for TSPO across human subjects. XBD173 was originally developed as part of a drug discovery program for various CNS disorders, but CNS trials using XBD173 were discontinued. Typically, the Kd value of XBD173 for human TSPO is in the range of from about 1 nM to about 50 nM, particularly from about 2 nM to about 35 nM. High affinity binders (human subjects who exhibit high-affinity binding of their TSPO to XBD173) have a mean Kd of about 2.5 nM. Low affinity binders (human subjects who exhibit low-affinity binding of their TSPO to XBD173) have a mean Kd of about 30 nM. Mixed affinity binders (human subjects who exhibit both high-and low-affinity binding sites on their TSPO for XBD173) have a mean Kd of about 11 nM. These values were first investigated in Owen et al. Synapse (2011) 65(3):257-259, which is herein incorporated by reference in its entirety.
[0096] XBD173 is a selective ligand (referred to interchangeably as a selective TSPO modulator) of TSPO. XBD173 activity may therefore be defined in terms of its effect on endothelial cell (EC) dysfunction, as described herein. Alternatively or in addition, XBD173 activity may be defined in terms of its effect on other cell types, such as adipocytes and neurons.
[0097] Deuterated analogues of XBD173
[0098] As described and exemplified herein, the present inventors are the first to have investigated the metabolism of XBD173, and have surprisingly identified M2 (see Figure 2) as a key metabolite. The inventors have further determined that metabolism of XBD173 to M2 occurs by an amide dealkylation reaction. Such amide dealkylation reactions are known to be potentially sensitive to deuteration. Therefore, based on their novel and surprising findings, the inventors have designed and produced deuterated analogues of XBD173, and have demonstrated that exemplary analogues of XBD173 have increased stability compared with XBD173. Furthermore, the present inventors have demonstrated that the increased metabolic stability of deuterated analogues of XBD173 observed in vitro is translated in vivo (e.g. see Example 9), indicating that the deuterated analogues of XBD173 of theinvention have the potential to provide this advantage when used therapeutically where nondeuterated XBD173 is indicated.
[0099] As used herein "deuterated analogues" refers to molecules sharing close structural similarity with their parent compound in which at least one hydrogen has been substituted with a deuterium. The deuterated analogues of XBD173 of the invention are therefore defined by Formula (I):
[0100]
[0101] wherein:
[0102] R, R', R", R'" and R"" are independently selected from hydrogen and deuterium; Ra, Rband Rcare independently selected from hydrogen and deuterium; and at least one of R, R', R", R'", R"", Ra, Rband Rcis deuterium;
[0103] or a pharmaceutically acceptable salt thereof.
[0104] For the avoidance of doubt, a compound of Formula (I) wherein R, R', R", R'", R"", Ra, Rb and Rcare hydrogens is non-deuterated XBD173. Unless expressly stated to the contrary, all references herein to XBD173 refer to non-deuterated XBD173.
[0105] The terms "deuterated analogue of XBD173", "deuterated XBD173 analogue", "deuterated analogue of Formula (I)" and "compound of Formula (I)" may be used interchangeably to refer to compounds of the invention.
[0106] The deuterated analogues of XBD173 of the invention may comprise any number of substitutions of hydrogen to deuterium. For example, the compound of deuterated analogues of XBD173 of the invention may only have a single deuterium substitution at R, R', R", R'", R"", Ra, Rb or Rcor a combination thereof. Byway of non-limiting example, CR3and / or CR'"3may each independently comprise three hydrogens (CH3), one deuterium substitution and two hydrogens (CDH2), two deuterium substitutions and one hydrogen (CD2H) or three deuterium substitutions (CD3). By way of a further non-limiting example, CR'2, CR"2and / or CR""2may each independently comprise two hydrogens (CH2), one deuterium substitution and one hydrogen (CDH), or two deuterium substitutions (CD2). Such combination of deuterium substitutions at R, R', R", R'", R"", Ra, Rb or Rcmay be coupledwith full deuterium substitution at any other of R, R', R", R'" or R"" or a combination thereof. The deuteration pattern of the deuterated analogues of XBD173 encompasses therefore all molecules having at least one deuterium substitution at R, R', R", R'", R"", Ra, Rb or Rc.
[0107] Exemplary deuterated analogues of XBD173 of the invention wherein CR'2, CR"2and / or CR""2comprise one deuterium substitution and one hydrogen (CDH) may comprise one, two or three stereocenters. Each stereocenter may independently have an absolute configuration " R" or " S". When compounds of the present invention contain one or more chiral centres, the compounds may exist in, and may be isolated as pure enantiomeric or diastereomeric forms or as racemic mixtures. The present invention therefore includes any possible enantiomers, diastereomers, racemates or mixtures thereof of the compounds of the invention. Thus, compounds of Formula (I) may be used in a racemic mixture, or as single enantiomers. Both racemic and diastereomeric mixtures, as well as the individual optical isomers can be isolated or synthesised so as to be substantially free of their enantiomeric or diastereomeric partners, and these are all within the scope of the invention. Preferably, for any of R, R', R", R'", R"", Ra, Rb and Rc, either all are all hydrogens or all are substituted with deuterium. By way of example:
[0108] CR3is preferably CH3or CD3;
[0109] CR'2is preferably CH2or CD2;
[0110] CR"2is preferably CH2or CD2;
[0111] CR'"3is preferably CH3or CD3; and / or
[0112] CR""2is preferably CH2or CD2.
[0113] In these preferred embodiments, the presence of hydrogens or deuterium substitutions may be determined independently for any of R, R', R", R'", R"", Ra, Rb and Rc. For example, see Table 1 below.
[0114] In compounds of Formula (I), Rais independently selected from hydrogen and deuterium. In compounds of Formula (I), Rb is independently selected from hydrogen and deuterium. In compounds of Formula (I), Rcis independently selected from hydrogen and deuterium. In compounds of Formula (I), R is independently selected from hydrogen or deuterium. Preferably R is deuterium. Particularly preferred both R and R' are deuterium, more preferably R, R' and R" are deuterium.
[0115] In compounds of Formula (I), R' is independently selected from hydrogen or deuterium. Preferably R' is deuterium. Particularly preferred both R and R' are deuterium, more preferably R, R' and R" are deuterium.
[0116] In compounds of Formula (I), R' is independently selected from hydrogen or deuterium. Preferably R' is deuterium. Particularly preferred both R' and R" are deuterium.In compounds of Formula (I), R' is independently selected from hydrogen or deuterium. Preferably CR'2is CDH, optionally in (S) or ( R) configuration. More preferably CR'2is CDH, optionally in (S) or (R) configuration and R" is deuterium, optionally R is deuterium.
[0117] In compounds of Formula (I), R" is independently selected from hydrogen or deuterium. Preferably R" is deuterium. Particularly preferred R, R' and R" are deuterium.
[0118] In compounds of Formula (I), R" is independently selected from hydrogen or deuterium. Preferably CR"2is CDH, optionally in (S) or (R) configuration. More preferably CR"2is CDH in (R) configuration. Particularly preferred CR"2is CDH in (R) configuration and R' is deuterium, optionally R is deuterium.
[0119] In compounds of Formula (I), R' and R" are independently selected from hydrogen or deuterium. Preferably CR'2and CR"2are CDH, optionally in (S) or (R) configuration. CR'2and CR"2may be both CDH in (R) configuration. CR'2and CR"2may be both CDH in (S) configuration. CR'2may be CDH in (R) configuration and CR"2may be CDH in (S) configuration. CR'2may be CDH in (S) configuration and CR"2may be CDH in (R) configuration. More preferably CR"2is CDH in (R) configuration and CR'2may be CDH, optionally in (S) or (R) configuration.
[0120] In compounds of Formula (I), R'" is independently selected from hydrogen or deuterium. Preferably R'" is deuterium. Particularly preferred R, R', R" and R'" are deuterium.
[0121] In compounds of Formula (I), R"" is independently selected from hydrogen or deuterium. R"" may be deuterium.
[0122] In compounds of Formula (I), each R is independently selected from hydrogen or deuterium, each R' is independently selected from hydrogen or deuterium, each R" is independently selected from hydrogen or deuterium, each R'" is independently selected from hydrogen or deuterium, each R"" is independently selected from hydrogen or deuterium, each Rais independently selected from hydrogen and deuterium, each Rb is independently selected from hydrogen and deuterium and each Rcis independently selected from hydrogen and deuterium. Optionally, in compounds of Formula (I), each R is independently selected from hydrogen or deuterium, each R' is independently selected from hydrogen or deuterium, each R" is independently selected from hydrogen or deuterium, each R'" is independently selected from hydrogen or deuterium and each R"" is independently selected from hydrogen or deuterium.
[0123] Specific examples of compounds according to the present invention are set out in Table 1 below.Table 1 - Examples of compounds of Formula (I) ( Ra, Rband Rc14 H H D H D are hydrogen, H means all positions are hydrogen and D means 15 H H H D D 16 D D D H H all positions are deuterium) 17 D D H D H Cpd# R R' R" R'" R"" 18 D D H H D XBD173 H H H H H 19 D H D D H 1 D H H H H 20 D H D H D 2 H D H H H 21 D H H D D 3 H H D H H 22 H D D D H 4 H H H D H 23 H D D H D 5 H H H H D 24 H D H D D 6 D D H H H 25 H H D D D 7 D H D H H 26 D D D D H 8 D H H D H 27 D D D H D 9 D H H H D 28 D D H D D 10 H D D H H 29 D H D D D 11 H D H D H 30 H D D D D 12 H D H H D
[0124]
[0125] 31 D D D D D
[0126]
[0127] 13 H H D D H
[0128] Further exemplary compounds wherein CR'2, CR"2and / or CR""2independently comprise one deuterium substitution and one hydrogen (CDH) may be defined as per Table 2 below.
[0129] Table 2 - Exemplary compounds comprising a 43 H H D(R) H D(S) stereocenter (Ra, Rband Rcare hydrogen, " D(R)" indicates one 44 H H D(R) D H 45 H H D(R) D D deuterium substitution and one hydrogen with absolute
[0130] 46 H H D(R) D D(R) configuration " R" and " D(S)" indicates one deuterium 47 H H D(R) D D(S) substitution and one hydrogen with absolute configuration " S", 48 H H D(S) H H 49 H H D(S) H D H means all positions are hydrogen and D means all positions
[0131] 50 H H D(S) H D(R) are deuterium) 51 H H D(S) H D(S) Cpd# R R1R" R" R"" 52 H H D(S) D H 32 H H H H D(R) 53 H H D(S) D D 33 H H H H D(S) 54 H H D(S) D D(R) 34 H H H D D(R) 55 H H D(S) D D(S) 35 H H H D D(S) 56 H D H H D(R) 36 H H D H D(R) 57 H D H H D(S) 37 H H D H D(S) 58 H D H D D(R) 38 H H D D D(R) 59 H D H D D(S) 39 H H D D D(S) 60 H D D H D(R) 40 H H D(R) H H 61 H D D H D(S) 41 H H D(R) H D 62 H D D D D(R)
[0132] 63 H D D D D(S)
[0133]
[0134] 42 H H D(R) H D(R)
[0135]
[0136] H D D(R) H H 108 H D(R) D(S) D H H D D(R) H D 109 H D(R) D(S) D D H D D(R) H D(R) 110 H D(R) D(S) D D(R) H D D(R) H D(S) 111 H D(R) D(S) D D(S) H D D(R) D H 112 D H H H D(R) H D D(R) D D 113 D H H H D(S) H D D(R) D D(R) 114 D H H D D(R) H D D(R) D D(S) 115 D H H D D(S) H D D(S) H H 116 D H D H D(R) H D D(S) H D 117 D H D H D(S) H D D(S) H D(R) 118 D H D D D(R) H D D(S) H D(S) 119 D H D D D(S) H D D(S) D H 120 D H D(R) H H H D D(S) D D 121 D H D(R) H D H D D(S) D D(R) 122 D H D(R) H D(R) H D D(S) D D(S) 123 D H D(R) H D(S) H D(R) H H H 124 D H D(R) D H H D(R) H H D 125 D H D(R) D D H D(R) H H D(R) 126 D H D(R) D D(R) H D(R) H H D(S) 127 D H D(R) D D(S) H D(R) H D H 128 D H D(S) H H H D(R) H D D 129 D H D(S) H D H D(R) H D D(R) 130 D H D(S) H D(R) H D(R) H D D(S) 131 D H D(S) H D(S) H D(R) D H H 132 D H D(S) D H H D(R) D H D 133 D H D(S) D D H D(R) D H D(R) 134 D H D(S) D D(R) H D(R) D H D(S) 135 D H D(S) D D(S) H D(R) D D H 136 D D H H D(R) H D(R) D D D 137 D D H H D(S) H D(R) D D D(R) 138 D D H D D(R) H D(R) D D D(S) 139 D D H D D(S) H D(R) D(R) H H 140 D D D H D(R) H D(R) D(R) H D 141 D D D H D(S) H D(R) D(R) H D(R) 142 D D D D D(R) H D(R) D(R) H D(S) 143 D D D D D(S) H D(R) D(R) D H 144 D D D(R) H H H D(R) D(R) D D 145 D D D(R) H D H D(R) D(R) D D(R) 146 D D D(R) H D(R) H D(R) D(R) D D(S) 147 D D D(R) H D(S) H D(R) D(S) H H 148 D D D(R) D H H D(R) D(S) H D 149 D D D(R) D D H D(R) D(S) H D(R) 150 D D D(R) D D(R)
[0137]
[0138] H D(R) D(S) H D(S)
[0139]
[0140] 151 D D D(R) D D(S)D D D(S) H H 196 H D(S) H D H D D D(S) H D 197 H D(S) H D D D D D(S) H D(R) 198 H D(S) H D D(R) D D D(S) H D(S) 199 H D(S) H D D(S) D D D(S) D H 200 H D(S) D H H D D D(S) D D 201 H D(S) D H D D D D(S) D D(R) 202 H D(S) D H D(R) D D D(S) D D(S) 203 H D(S) D H D(S) D D(R) H H H 204 H D(S) D D H D D(R) H H D 205 H D(S) D D D D D(R) H H D(R) 206 H D(S) D D D(R) D D(R) H H D(S) 207 H D(S) D D D(S) D D(R) H D H 208 H D(S) D(R) H H D D(R) H D D 209 H D(S) D(R) H D D D(R) H D D(R) 210 H D(S) D(R) H D(R) D D(R) H D D(S) 211 H D(S) D(R) H D(S) D D(R) D H H 212 H D(S) D(R) D H D D(R) D H D 213 H D(S) D(R) D D D D(R) D H D(R) 214 H D(S) D(R) D D(R) D D(R) D H D(S) 215 H D(S) D(R) D D(S) D D(R) D D H 216 H D(S) D(S) H H D D(R) D D D 217 H D(S) D(S) H D D D(R) D D D(R) 218 H D(S) D(S) H D(R) D D(R) D D D(S) 219 H D(S) D(S) H D(S) D D(R) D(R) H H 220 H D(S) D(S) D H D D(R) D(R) H D 221 H D(S) D(S) D D D D(R) D(R) H D(R) 222 H D(S) D(S) D D(R) D D(R) D(R) H D(S) 223 H D(S) D(S) D D(S) D D(R) D(R) D H 224 D D(S) H H H D D(R) D(R) D D 225 D D(S) H H D D D(R) D(R) D D(R) 226 D D(S) H H D(R) D D(R) D(R) D D(S) 227 D D(S) H H D(S) D D(R) D(S) H H 228 D D(S) H D H D D(R) D(S) H D 229 D D(S) H D D D D(R) D(S) H D(R) 230 D D(S) H D D(R) D D(R) D(S) H D(S) 231 D D(S) H D D(S) D D(R) D(S) D H 232 D D(S) D H H D D(R) D(S) D D 233 D D(S) D H D D D(R) D(S) D D(R) 234 D D(S) D H D(R) D D(R) D(S) D D(S) 235 D D(S) D H D(S) H D(S) H H H 236 D D(S) D D H H D(S) H H D 237 D D(S) D D D H D(S) H H D(R) 238 D D(S) D D D(R)
[0141]
[0142] H D(S) H H D(S)
[0143]
[0144] 239 D D(S) D D D(S)240 D D(S) D(R) H H 249 D D(S) D(S) H D 241 D D(S) D(R) H D 250 D D(S) D(S) H D(R) 242 D D(S) D(R) H D(R) 251 D D(S) D(S) H D(S) 243 D D(S) D(R) H D(S) 252 D D(S) D(S) D H 244 D D(S) D(R) D H 253 D D(S) D(S) D D 245 D D(S) D(R) D D 254 D D(S) D(S) D D(R) 246 D D(S) D(R) D D(R)
[0145]
[0146] 255 D D(S) D(S) D D(S) 247 D D(S) D(R) D D(S)
[0147]
[0148] 248 D D(S) D(S) H H
[0149] Substitution of hydrogen to deuterium at positions Ra, Rband / or Rcare exemplified in the compounds listed in Table 3 below.
[0150] Table 3 - Exemplary compounds comprising 281 H H H D D D H D substitutions at Ra, Rband / or Rc(H means all positions are 282 H H H D D D D H 283 H H H D D D D D hydrogen, D means all positions are deuterium).
[0151] 284 H H D H H H H D Cpd# R R R" R" R"" Ra Rb Rc 285 H H D H H H D H 256 H H H H H H H D 286 H H D H H H D D 257 H H H H H H D H 287 H H D H H D H H 258 H H H H H H D D 288 H H D H H D H D 259 H H H H H D H H 289 H H D H H D D H 260 H H H H H D H D 290 H H D H H D D D 261 H H H H H D D H 291 H H D H D H H D 262 H H H H H D D D 292 H H D H D H D H 263 H H H H D H H D 293 H H D H D H D D 264 H H H H D H D H 294 H H D H D D H H 265 H H H H D H D D 295 H H D H D D H D 266 H H H H D D H H 296 H H D H D D D H 267 H H H H D D H D 297 H H D H D D D D 268 H H H H D D D H 298 H H D D H H H D 269 H H H H D D D D 299 H H D D H H D H 270 H H H D H H H D 300 H H D D H H D D 271 H H H D H H D H 301 H H D D H D H H 272 H H H D H H D D 302 H H D D H D H D 273 H H H D H D H H 303 H H D D H D D H 274 H H H D H D H D 304 H H D D H D D D 275 H H H D H D D H 305 H H D D D H H D 276 H H H D H D D D 306 H H D D D H D H 277 H H H D D H H D 307 H H D D D H D D 278 H H H D D H D H 308 H H D D D D H H 279 H H H D D H D D 309 H H D D D D H D
[0152]
[0153] 280 H H H D D D H H
[0154]
[0155] 310 H H D D D D D HH H D D D D D D 355 H D D D H H D H H D H H H H H D 356 H D D D H H D D H D H H H H D H 357 H D D D H D H H H D H H H H D D 358 H D D D H D H D H D H H H D H H 359 H D D D H D D H H D H H H D H D 360 H D D D H D D D H D H H H D D H 361 H D D D D H H D H D H H H D D D 362 H D D D D H D H H D H H D H H D 363 H D D D D H D D H D H H D H D H 364 H D D D D D H H H D H H D H D D 365 H D D D D D H D H D H H D D H H 366 H D D D D D D H H D H H D D H D 367 H D D D D D D D H D H H D D D H 368 D H H H H H H D H D H H D D D D 369 D H H H H H D H H D H D H H H D 370 D H H H H H D D H D H D H H D H 371 D H H H H D H H H D H D H H D D 372 D H H H H D H D H D H D H D H H 373 D H H H H D D H H D H D H D H D 374 D H H H H D D D H D H D H D D H 375 D H H H D H H D H D H D H D D D 376 D H H H D H D H H D H D D H H D 377 D H H H D H D D H D H D D H D H 378 D H H H D D H H H D H D D H D D 379 D H H H D D H D H D H D D D H H 380 D H H H D D D H H D H D D D H D 381 D H H H D D D D H D H D D D D H 382 D H H D H H H D H D H D D D D D 383 D H H D H H D H H D D H H H H D 384 D H H D H H D D H D D H H H D H 385 D H H D H D H H H D D H H H D D 386 D H H D H D H D H D D H H D H H 387 D H H D H D D H H D D H H D H D 388 D H H D H D D D H D D H H D D H 389 D H H D D H H D H D D H H D D D 390 D H H D D H D H H D D H D H H D 391 D H H D D H D D H D D H D H D H 392 D H H D D D H H H D D H D H D D 393 D H H D D D H D H D D H D D H H 394 D H H D D D D H H D D H D D H D 395 D H H D D D D D H D D H D D D H 396 D H D H H H H D H D D H D D D D 397 D H D H H H D H
[0156]
[0157] H D D D H H H D
[0158]
[0159] 398 D H D H H H D DD H D H H D H H 441 D D H D H D H H D H D H H D H D 442 D D H D H D H D D H D H H D D H 443 D D H D H D D H D H D H H D D D 444 D D H D H D D D D H D H D H H D 445 D D H D D H H D D H D H D H D H 446 D D H D D H D H D H D H D H D D 447 D D H D D H D D D H D H D D H H 448 D D H D D D H H D H D H D D H D 449 D D H D D D H D D H D H D D D H 450 D D H D D D D H D H D H D D D D 451 D D H D D D D D D H D D H H H D 452 D D D H H H H D D H D D H H D H 453 D D D H H H D H D H D D H H D D 454 D D D H H H D D D H D D H D H H 455 D D D H H D H H D H D D H D H D 456 D D D H H D H D D H D D H D D H 457 D D D H H D D H D H D D H D D D 458 D D D H H D D D D H D D D H H D 459 D D D H D H H D D H D D D H D H 460 D D D H D H D H D H D D D H D D 461 D D D H D H D D D H D D D D H H 462 D D D H D D H H D H D D D D H D 463 D D D H D D H D D H D D D D D H 464 D D D H D D D H D H D D D D D D 465 D D D H D D D D D D H H H H H D 466 D D D D H H H D D D H H H H D H 467 D D D D H H D H D D H H H H D D 468 D D D D H H D D D D H H H D H H 469 D D D D H D H H D D H H H D H D 470 D D D D H D H D D D H H H D D H 471 D D D D H D D H D D H H H D D D 472 D D D D H D D D D D H H D H H D 473 D D D D D H H D D D H H D H D H 474 D D D D D H D H D D H H D H D D 475 D D D D D H D D D D H H D D H H 476 D D D D D D H H D D H H D D H D 477 D D D D D D H D D D H H D D D H 478 D D D D D D D H D D H H D D D D 479 D D D D D D D D
[0160]
[0161] D D H D H H H D D D H D H H D H
[0162]
[0163] D D H D H H D DIt will be appreciated that each of the compounds depicted in Table 1, Table 2, Table 3 or elsewhere in the present application may be used in the form of a pharmaceutically acceptable salt.
[0164] Compounds 6, 16 and 26 may be preferred. Compound 16 and 26 may be particularly preferred.
[0165] Compounds 3, 4, 6, 7, 10, 16, 26, 40, 48, 64, 72, 88, 96, 104, 144, 152, 200, 208 and 216 may be preferred. In particular, compounds 6, 10, 16, 26, 40, 48, 64, 72, 144 and 152 may be preferred. Compound 10, 16, 26, 64, 72, 144 and 152 may be particularly preferred.
[0166] The compounds per se of the invention may be provided in an isolated form. It will be appreciated that a compound in an isolated form is equivalent to a composition which consists substantially of the compound. For instance, an isolated compound of Formula (I) will contain less than 10% by weight, such as less than 7.5% by weight, less than 5% by weight, less than 2.5% by weight and less than 1% by weight of impurities, i.e. substances other than compounds of Formula (I).
[0167] The compounds of Formula (I) may have rotameric forms, or may not have rotational activity. Rotameric forms include slow rotating forms and fast rotating forms. In some preferred embodiments, fast rotating forms of the compounds of Formula (I) are preferred. For example,
[0168]
[0169] R2O
[0170] A compound of the Formula (I) or a salt thereof may exhibit the phenomenon of tautomerism whereby two chemical compounds that are capable of facile interconversion by exchanging a hydrogen atom between two atoms, to either of which it forms a covalent bond. Since the tautomeric compounds exist in mobile equilibrium with each other they may be regarded as different isomeric forms of the same compound. It is to be understood that the formulae drawings within this specification can represent only one of the possible tautomeric forms. However, it is also to be understood that the invention encompasses any tautomeric form, and is not to be limited merely to any one tautomeric form utilized within the formulae drawings. The formulae drawings within this specification can represent only one of the possible tautomeric forms and it is to be understood that the specification encompasses all possible tautomeric forms of the compounds drawn not just those forms which it has been convenient to show graphically herein. Thus, compounds of Formula (I) according to the invention encompass tautomers (including keto-enol and amide-imidic acid forms).Accordingly, a structure depicted herein as one tautomer is intended to also include the other tautomer.
[0171] Compounds may be used in the form of salts, hydrates and solvate forms, as defined in the Definitions section herein. It will be appreciated that salt forms of the compound may themselves be in the form of hydrates or solvate forms.
[0172] A deuterated analogue of XBD173 according to the invention may selectively bind and / or modulate TSPO (also referred to interchangeably herein as specifically binding and / or modulating TSPO). For such deuterated analogues of XBD173, selectivity may mean that the deuterated analogue of XBD173 binds selectively (also referred to interchangeably herein as specifically) with TSPO. By "binds selectively", it will be understood that said agent (particularly a deuterated XBD173 analogue of the invention) binds to TSPO, with no significant cross-reactivity to any other molecule. Crossreactivity may be assessed by any suitable method. By way of non-limiting example, cross-reactivity of a deuterated analogue of XBD173 with a molecule other than TSPO may be considered significant if the agent binds to the other molecule at least 5%, 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90% or 100% as strongly as it binds to TSPO. A deuterated analogue of XBD173 that binds selectively to TSPO may bind to another molecule at less than 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25% or 20% the strength that it binds to TSPO. Preferably, the deuterated analogue of XBD173 binds to the other molecule at less than 20%, less than 15%, less than 10% or less than 5%, less than 2% or less than 1% the strength that it binds to TSPO. By way of non-limiting example, a deuterated analogue of XBD173 of the invention may have no significant cross-reactivity with a phosphodiesterase (PDE), sodium channel and / or calcium channel.
[0173] Without being bound to theory, the substitution of any hydrogen to deuterium is not expected to significantly affect the binding affinity of the deuterated analogues of XBD173 to TSPO. Accordingly, the binding affinity of a deuterated analogue of XBD173 of the invention may be at least 70%, such as at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more of the binding affinity of XBD173 for TSPO.
[0174] A deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof, may exhibit an improved TSPO binding activity when compared to the binding affinity of XBD173 for TSPO.
[0175] A deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof, may bind to TSPO (particularly human TSPO) with a Kd in the range of from about 1 nM to about 50 nM, particularly from about 2 nM to about 35 nM. A deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof, may bind to TSPO in a high affinity binder (a human subjects who exhibits high-affinitybinding of their TSPO to XBD173) with a mean Kd of from about 2 nM to about 9 nM, particularly 2.5 nM. A deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof, may bind to a low affinity binder (a human subjects who exhibits low-affinity binding of theirTSPO to XBD173) with a mean Kd of from about 30 nM to about 50 nM, particularly about 30 nM. A deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof, may bind to a mixed affinity binder (a human subject who exhibits both high-and low-affinity binding sites on their TSPO for XBD173) with a mean Kd offrom about 10 nM toabout20 nM, particularly about 11 nM. The Kd of such deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof may be determined using any appropriate technique, which may be selected by one of ordinary skill in the art without undue burden. By way of non-limiting example, the Kd of such deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof may be determined using in vitro radioligand binding, such as described in Owen et al. Synapse (2011) 65(3):257-259.
[0176] Without being bound to theory, the substitution of any hydrogen to deuterium is not expected to significantly affect activity the of the deuterated analogues of XBD173. Accordingly, a deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof typically exhibits similar functional properties to XBD173. A deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof typically modulates TSPO in an equivalent manner to XBD173. A deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof, may exhibit at least 50%, such as at least 70%, at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or more (e.g. at least 60%, 70%, 80% or 90%) of the activity of XBD173, such as defined herein. A deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof, may exhibit improved activity when compared to XBD173. The activity of such deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof may be determined using any appropriate technique, which may be selected by one of ordinary skill in the art without undue burden. By way of non-limiting example, the activity of such deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof may be determined the method described in the examples herein (e.g. Example 10).
[0177] Accordingly, a deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof typically exhibits similar modulation (inhibition) of TSPO as non-deuterated XBD173. A deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof typically inhibits TSPO in an equivalent manner to non-deuterated XBD173. Typically, a deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof may have an IC50of between about 0.1 nM and about 15 nM. A deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof may have an IC50of between about 0.1 nM and about 10 nM, between about 0.1 nM and about 5 nM or between about0.1 nM and about 1 nM. Preferably, a deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof may have an IC50of between about 0.1 nM and about 5 nM. Non-deuterated XBD173, for reference, may exhibit an IC50of 0.23 nM in the assay described in Example 10. The IC50of such deuterated analogue of XBD173, or a pharmaceutically acceptable salt thereof may be determined using any appropriate technique, which may be selected by one of ordinary skill in the art without undue burden. By way of non-limiting example, IC50of deuterated analogues of XBD173, or a pharmaceutically acceptable salt thereof may be determined using the method described in Example 10.
[0178] Thus, and as exemplified herein, deuterated analogue of XBD173 according to the invention can exhibit both (i) improved stability compared with XBD173, which may be quantified by any appropriate parameter such as those described herein (e.g. half-life); and (ii) similar activity to XBD173, which may be quantified by any appropriate parameter such as those described herein (e.g. IC50).
[0179] As used herein "stability" relates to the amount of a compound that is retained over time. Stability may be interchangeably referred to as "metabolic stability". The counterpart is "metabolic degradation", which relates to the amount of the compound lost / degraded over time. By way of example, metabolic stability of 80% means that 80% of the starting amount of a compound is retained over a defined period of time (and hence 20% of the compound is lost). Metabolic degradation of 20% means that that 20% of the starting amount of a compound is lost over a defined period of time (and hence 80% of the compound is retained). The metabolic break down of a compound may be through known or unknown mechanisms in physiologically relevant conditions. Stability and metabolic degradation may be measured using known techniques in the art such as incubation with mammalian microsomes, preferably human microsomes, and quantifying the amount of intact compound of interest as a function of time. Such quantification may be done using known techniques such as described herein and preferably using LCMS. Stability and / or metabolic degradation of a deuterated analogue of XBD173 of the invention may be compared to a suitable control, such as XBD173. Exemplary assays for determining the stability of a compound of the invention are demonstrated in the examples herein, e.g. in Examples 1, 2, 7 and 8.
[0180] The deuterated analogues of XBD173 of the invention may have increased stability compared with (non-deuterated) XBD173. The stability of the deuterated analogues of XBD173 of the invention may be increased by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, or at least about 45%, compared to non-deuterated XBD173. Preferably, the stability of the deuterated analogues of XBD173 of the invention may be increased by at least about 30% compared to non-deuterated XBD173. More preferably, the stability of the deuterated analogues of XBD173 of the invention may be increased byat least about 35% compared to non-deuterated XBD173. Still more preferably, the stability of the deuterated analogues of XBD173 of the invention may be increased by at least about 40% compared to non-deuterated XBD173. Even more preferably, the stability of the deuterated analogues of XBD173 of the invention may be increased by at least about 45% compared to non-deuterated XBD173. Stability of the deuterated analogues of XBD173 of the invention and non-deuterated XBD173 may be measured using human microsomes, such as in a method as described in this application, particularly as exemplified herein (e.g. the microsome assay of Example 1).
[0181] The deuterated analogues of XBD173 of the invention may have a reduced metabolic degradation compared with non-deuterated XBD173. The metabolic degradation of the deuterated analogues of XBD173 of the invention may be reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, or at least about 45%, compared to non-deuterated XBD173. Preferably, the metabolic degradation of the deuterated analogues of XBD173 of the invention may be reduced by at least about 40% compared to non-deuterated XBD173. Even more preferably, the metabolic degradation of the deuterated analogues of XBD173 of the invention may be reduced by at least about 45% compared to non-deuterated XBD173. Metabolic degradation of the deuterated analogues of XBD173 of the invention and non-deuterated XBD173 may be measured using human microsomes, such as in a method as described in this application, particularly as exemplified herein (e.g. the microsome assay of Example 1).
[0182] The deuterated analogues of XBD173 of the invention may have an increased half-life (t½) compared with non-deuterated XBD173. The half-life of the deuterated analogues of XBD173 of the invention may be increased in vivo, particularly in humans. The half-life of the deuterated analogues of XBD173 of the invention, as measured using human microsomes in a method as described in this application, particularly as exemplified herein (e.g. the microsome assay of Example 1), may be increased by at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, or at least about 45%, compared to non-deuterated XBD173.
[0183] XBD173 (non-deuterated) has a half-life in human microsomes of about 2.92 mins, and an in vivo half-life in humans of approximately 4 hours (Rupprecht et al Science (2009) 24;325(5939):490-3). As exemplified herein, the deuterated analogues of XBD173 of the invention have a half-life in human microsomes of at least 2.96 min. Therefore, the deuterated analogues of XBD173 of the invention may have a half-life (t½) of at least 2.96 min, such as at least about 3.5 min, at least about 4 min, at least about 4.5 min, at least about 5 min, at least about 5.5 min, at least about 6 min, at leastabout 6.5 min or more, as measured using human microsomes in a method as described in this application, particularly as exemplified herein (e.g. the microsome assay of Example 1).
[0184] The predicted in vivo clearance based on the human microsome data is 2.94 mL / min / kg (XBD173) and for the deuterated compounds 3, 4, 6, 16 and 26 respectively 2.79 mL / min / kg (compound 3), 2.90 mL / min / kg (compound 4), 2.31 mL / min / kg (compound 6), 1.41 mL / min / kg (compound 16), and 1.46 mL / min / kg (compound 26). Furthermore, the predicted in vivo clearance based on the human microsome data for deuterated compounds 7, 10, 40, 48, 64, 72, 144 and 152 is calculated to be 2.41 mL / min / kg (compound 7), 1.83 mL / min / kg (compound 10), 2.65 mL / min / kg (compound 40), 2.27 mL / min / kg (compound 48), 2.00 mL / min / kg (compound 64), 2.19 mL / min / kg (compound 72), 1.86 mL / min / kg (compound 144) and 2.00 mL / min / kg (compound 152) respectively. Accordingly, deuterated analogues of XBD173 of the invention may have an in vivo clearance rate of between about 1.0 mL / min / kg to about 2.90 mL / min / kg, such as between about 1.0 mL / min / kg to about 2.80 mL / min / kg, between about 1.0 mL / min / kg to about 2.50 mL / min / kg, between about 1.0 mL / min / kg to about 2.40 mL / min / kg, between about 1.0 mL / min / kg to about 2.0 mL / min / kg, between about 1.0 mL / min / kg to about 1.75 mL / min / kg, between about 1.0 mL / min / kg to about 1.50 mL / min / kg, between about 1.2 mL / min / kg to about 2.80 mL / min / kg, between about 1.2 mL / min / kg to about 2.50 mL / min / kg, between about 1.2 mL / min / kg to about 2.40 mL / min / kg, between about 1.2 mL / min / kg to about 2.0 mL / min / kg, between about 1.2 mL / min / kg to about 1.75 mL / min / kg, or between about 1.2 mL / min / kg to about 1.50 mL / min / kg. The in vivo clearance of a compound may be calculated from data measured using human microsomes in a method as described in this application, particularly as exemplified herein (e.g. the microsome assay of Example 1).
[0185] Based on the in vivo half-life of XBD173 (about 4 hours), and the microsome half-life and clearance data exemplified herein, the in vivo half-life of deuterated compounds 3, 4, 6, 16 and 26 is calculated to be about 4.2 hours (compound 3), about 4 hours (compound 4), about 5.1 hours (compound 6), about 8.3 hours (compound 16) and about 8.0 hours (compound 26) respectively. Furthermore, the in vivo half-life of deuterated compounds 7, 10, 40, 48, 64, 72, 144 and 152 is calculated to be about 4.4 hours (compound 7), about 6.1 hours (compound 10), about 4.0 hours (compound 40), about 4.7 hours (compound 48), about 5.4 hours (compound 64), about 4.9 hours (compound 72), about 5.9 hours (compound 144) and about 5.5 hours (compound 152) respectively. Accordingly, the deuterated analogues of XBD173 of the invention may have an in vivo half-life (t½) of at least about 5 hours, at least about 5.5 hours, at least about 6 hours, at least 7 hours, such as at least 7.5 hours, at least 8 hours, at least 8.5 hours, at least 9 hours, at least 9.5 hours, at least 10 hours or more. The deuterated analogues of XBD173 of the invention may have an in vivo half-life (t½) of at least about 6 hours. The deuterated analogues of XBD173 of the invention may have an in vivo half-life (t½)of at least about 7 hours. The deuterated analogues of XBD173 of the invention may have an in vivo half-life (t½) of between about 5 hours to about 15 hours. The deuterated analogues of XBD173 of the invention may have an in vivo half-life (t½) of between about 6 hours to about 15 hours. The deuterated analogues of XBD173 of the invention may have an in vivo half-life (t½) of between about 7 hours to about 15 hours, such as between about 7 hours to about 12 hours, between about 7 hours to about 10 hours, or between about 8 hours to about 10 hours. The deuterated analogues of XBD173 of the invention may have an in vivo half-life (t½) of between about 7 hours to about 10 hours. The in vivo half-life of the deuterated analogues of XBD173 of the invention may be measured using protocols known in the art such as dosing the compounds in heathy male individuals, collecting blood samples at regular intervals and quantifying the amount of intact compound still present by an appropriate technique such as mass-spectrometry coupled with liquid chromatography.
[0186] In addition to deuterated analogues of XBD173 of the invention having a reduced metabolic degradation (e.g. half-life (t½) compared with non-deuterated XBD173, the deuterated analogues of XBD173 of the invention may also have a reduced CYP3A4-mediated metabolic degradation compared with non-deuterated XBD173. The CYP3A4-mediated metabolic degradation of the deuterated analogues of XBD173 of the invention may be reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, or at least about 45%, compared to non-deuterated XBD173. Preferably, the CYP3A4-mediated metabolic degradation of the deuterated analogues of XBD173 of the invention may be reduced by at least about 25% compared to non-deuterated XBD173. Even more preferably, the CYP3A4-mediated metabolic degradation of the deuterated analogues of XBD173 of the invention may be reduced by at least about 30% compared to non-deuterated XBD173. CYP3A4-mediated metabolic degradation of the deuterated analogues of XBD173 of the invention and non-deuterated XBD173 may be measured using human CYP3A4 isoform in a method as described in this application, particularly as exemplified herein (e.g. the assay of Example 11).
[0187] Drug Delivery Systems
[0188] A deuterated XBD173 analogue of the invention may be delivered by means of a drug delivery system. Drug delivery systems may be used to increase delivery of a deuterated XBD173 analogue of the invention; increase uptake of a deuterated XBD173 analogue of the invention by a target cell or tissue; and / or to increase the efficacy of a deuterated XBD173 analogue of the invention.
[0189] Any appropriate drug delivery system may be used to deliver a deuterated XBD173 analogue of the invention. Conventional drug delivery systems are known in the art. By way of non-limiting example, appropriate drug delivery systems include liposomes, immunoliposomes, nanoparticles andconjugates. Thus, it would be routine for one of skill in the art to select a suitable drug delivery system. Liposome drug delivery systems are referred to interchangeably herein as liposome-based drug delivery systems.
[0190] Pharmaceutical compositions
[0191] The "compound" and products described herein may be comprised in a "therapeutic / prophylactic composition", "formulation" or "medicament" of the invention. The terms "composition", "formulation", "medicament", "pharmaceutical composition" and "therapeutic / prophylactic composition" may be used interchangeably.
[0192] The deuterated XBD173 analogues of the invention can be combined or administered in addition to a pharmaceutically acceptable carrier, diluent and / or excipient. Alternatively or in addition the deuterated XBD173 analogues of the invention can further be combined with one or more of a salt, excipient, diluent, adjuvant, immunoregulatory agent and / or antimicrobial compound.
[0193] Compositions comprising a deuterated XBD173 analogue may further comprise one or more additional active ingredient or therapeutic. Said one or more additional active ingredient or therapeutic may be another deuterated XBD173 analogue of the invention, or may be a different active ingredient or therapeutic, such as an agent which relaxes vascular tone and / or an anti-inflammatory as described herein. The deuterated XBD173 analogues of the invention and the one or more additional active ingredient or therapeutic may be provided as a kit of parts.
[0194] The deuterated XBD173 analogue (compound of Formula (I)) may be in the form of a salt, particularly a pharmaceutically acceptable salt as described herein.
[0195] Administration of a compound, composition, drug delivery system, or therapeutic formulations, medicaments and prophylactic formulations thereof is generally by conventional routes e.g. intravenous, subcutaneous, intraperitoneal, or mucosal routes. The administration may be by parenteral injection, for example, a subcutaneous, intradermal or intramuscular injection. For example, compounds, drug delivery systems and compositions and formulations comprising compounds of the invention may be particularly suited to administration intravenously, intramuscularly, intradermally, or subcutaneously. Administration of compounds, drug delivery system and compositions / formulations of the invention may be particularly suited to administration by injection, such as intravenously, intramuscularly, intradermally, or subcutaneously, or by oral administration. A compound, drug delivery system and / or composition / formulation of the invention may be for oral, buccal, nasal, rectal, transdermal, intravenous, intramuscular or ocular administration, particularly oral administration.Compounds, compositions, drug delivery systems, therapeutic formulations, medicaments and prophylactic formulations of the invention may be prepared as injectables, either as liquid solutions or suspensions. Solid forms suitable for solution in, or suspension in, liquid prior to injection may alternatively be prepared. The preparation may also be emulsified.
[0196] The compounds of the invention may be mixed with excipients which are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol, or the like and combinations thereof.. In addition, if desired, the composition may contain minor amounts of auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and / or adjuvants which enhance the effectiveness of the vaccine.
[0197] Formulation of a deuterated XBD173 analogues of the invention may therefore be adapted using routine practice to suit the preferred route of administration.
[0198] Generally, the carrier is a pharmaceutically-acceptable carrier. Non-limiting examples of pharmaceutically acceptable carriers include water, saline, and phosphate-buffered saline. In some embodiments, however, where the composition comprises a compound of the invention, this may be in lyophilized form, in which case it may include a stabilizer, such as BSA. In some embodiments, it may be desirable to formulate the composition with a preservative, such as thiomersal or sodium azide, to facilitate long term storage.
[0199] Examples of additional adjuvants which may be effective include but are not limited to: complete Freunds adjuvant (CFA), Incomplete Freunds adjuvant (IFA), Saponin, a purified extract fraction of Saponin such as Qu II A, a derivative of Saponin such as QS-21, lipid particles based on Saponin such as ISCOM / ISCOMATRIX, E. coli heat labile toxin (LT) mutants such as LTK63 and / or LTK72, aluminium hydroxide, N-acetyl-muramyl-L-threonyl-D-isoglutamine (thr-MDP), N-acetyl-nor-muramyl-L-alanyl-D-isoglutamine (CGP 11637, referred to as nor-MDP), N-acetylmuramyl-L-alanyl-D-isoglutaminyl-L-alanine-2-(l'-2'-dipalmitoyl-sn-glycero-3-hydroxyphosphoryl oxy)-ethylamine (CGP 19835 A, referred to as MTP-PE), and RIBI, which contains three components extracted from bacteria, monophosphoryl lipid A, trehalose dimycolate and cell wall skeleton (MPL+TDM+CWS) in a 2 % squalene / Tween 80 emulsion, the MF59 formulation developed by Novartis, and the AS02, AS01, AS03 and AS04 adjuvant formulations developed by GSK Biologicals (Rixensart, Belgium).
[0200] Examples of buffering agents include, but are not limited to, sodium succinate (pH 6.5), and phosphate buffered saline (PBS; pH 6.5 and 7.5).
[0201] Additional formulations which are suitable for other modes of administration include suppositories, eye drops and, in some cases, oral formulations or formulations suitable for distribution as aerosols. For suppositories, traditional binders and carriers may include, for example, polyalkyleneglycols or triglycerides; such suppositories may be formed from mixtures containing the active ingredient in the range of 0.5% to 10%, preferably l%-2%.
[0202] Oral formulations include such normally employed excipients as, for example, pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, and the like. These compositions take the form of solutions, suspensions, tablets, pills, capsules, sustained release formulations or powders.
[0203] Endothelial Cell Dysfunction
[0204] Healthy endothelial cells (ECs) are displaying a number of behaviours, including vascular tubule formation, vascular repair and anticoagulant properties. EC dysfunction plays a major role in the development and progression of vascular pathologies. In particular, pulmonary endothelial cell (PEC) dysfunction plays a role in the development and progression of pulmonary hypertension (PH), particularly pulmonary arterial hypertension (PAH). The impact of PEC dysfunction on the development and progression of PH and particularly PAH are discussed extensively by the present inventors in W02022 / 096901, which is incorporated herein by reference in its entirety.
[0205] The terms EC dysfunction and PEC dysfunction are well-known in the art (see, for example Deanfield et al. Circulation 2007, 15( 10): 128501295; Humbert et al. European Respiratory Journal 2019, 53: 1801887; Ranchoux et al. Pulm. Circ. 2018, 8(l):2045893217752912; Lai et al. J Physiol 2019, 597:1143-1156; and Franssen et al. ACC Heart Fail 2016, 4:312-324; each of which is incorporated herein by reference in its entirety). Accordingly as defined herein, the term " EC dysfunction" (and " PEC dysfunction") typically encompasses any deviation from normal physiological EC (e.g. PEC) behaviours (also referred to interchangeably herein as phenotypes). EC dysfunction (e.g. " PEC dysfunction") may be defined as a deviation from normal physiological EC (e.g. PEC), and typically include one or more abnormal phenotype. Non-limiting examples of such phenotypes include (i) an increase in pro-inflammatory activation; (ii) an increase in EC (e.g. PEC) apoptosis; (iii) an increase in reactive oxygen species (ROS) production; (iv) alteration (particularly an increase in) in vascular tone, which is typically associated with altered production of various endothelial vasoactive mediators, including NO, prostacyclin, endothelin-1 (ET-1), serotonin, and thromboxane (particularly, reduced production of NO and prostacyclin, and increased production of ET-1, serotonin and thromboxane); (v) active metabolic changes; (vi) a reduction in anticoagulant properties (for example a reduction in anticoagulant properties may associated with a decrease in P-selectin and / or Von Willebrand Factor (VWF) levels and / or an increase in the level of thrombomodulin); (vii) a reduction in vascular tubule formation; (viii) a reduction in vascular repair; (ix) disordered endothelial cell proliferation along with concurrent neoangiogenesis, particularly endothelia damage with hypoxia-induced proliferation; (x) adecrease in mitochondrial membrane potential and / or (xi) increased expression of markers of endothelial to mesenchymal transition; or any combination of (i) to (xi). EC (e.g. PEC) phenotypes which deviate from normal physiological EC (e.g. PEC) phenotypes are referred to herein as phenotypes of EC dysfunction (e.g. PEC dysfunction), and are also interchangeably referred to as EC (e.g. PEC) dysfunctional phenotypes.
[0206] EC (e.g. PEC) dysfunction may comprise a deviation (i.e. an increase or decrease as appropriate) in any EC (e.g. PEC) phenotype, such as those described herein, of at least 5%, at least 10%, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or more. In the case of EC (e.g. PEC) dysfunction comprising a reducing in a EC (e.g. PEC) phenotype, this may include up to and including complete ablation of the phenotype. By way of nonlimiting example, EC (e.g. PEC) dysfunction may comprise a reduction in vascular tubule formation of at least 30%, at least 40%, at least 50% or more.
[0207] Standard techniques and assays for quantifying EC behaviours are known in the art and the selection of an appropriate assays would be routine for one of skill in the art. By way of non-limiting example, vascular tubule formation may be assays using a Matrigel tube formation assay, metabolic changes may be quantified using a glucose uptake assay, and / or EC proliferation may be quantified using a cell proliferation assay.
[0208] Where EC (e.g. PEC) dysfunction involves an increase in a particular EC (e.g. PEC) phenotype, a deuterated XBD173 analogue of the invention may reduce said phenotype (i.e. result in an absolute or relative reduction in said phenotype), or it may attenuate the increase in said phenotype (i.e. an individual may still exhibit an increase in the phenotype compared with said phenotype in a healthy control, but there is a reduction in the phenotype compared with the phenotype in said individual prior to treatment with the deuterated XBD173 analogue). Reduction or inhibition of said phenotype is preferred.
[0209] Where EC (e.g. PEC) dysfunction involves a decrease in a particular EC (e.g. PEC) phenotype, a deuterated XBD173 analogue of the invention may reduce said phenotype (i.e. result in an absolute or relative increase in said phenotype), or it may attenuate the decrease in said phenotype (i.e. an individual may still exhibit an decrease in the phenotype compared with said phenotype in a healthy control, but there is an increase in the phenotype compared with the phenotype in said individual prior to treatment with the deuterated XBD173 analogue). An increase of said phenotype is preferred.
[0210] By way of non-limiting example, a deuterated XBD173 analogue of the invention may (i) reduce or attenuate an increase in pro-inflammatory activation; (ii) reduce or attenuate an increase in endothelial cell (e.g. PEC) apoptosis; (iii) reduce or attenuate an increase in reactive oxygen species (ROS) production; (iv) reduce or attenuate an increase in vascular tone (e.g. by modulating theexpression of various endothelial vasoactive mediators, including NO, prostacyclin, endothelin-1 (ET-1), serotonin, and thromboxane); (v) reverse the active metabolic changes seen in endothelial cell (e.g. PEC) dysfunction (e.g. reverse the shift of mitochondrial glucose oxidation to cytoplasmic glycolysis, thus the increased cellular glucose uptake in the pulmonary vascular tissues; (vi) increase or attenuate a decrease in anticoagulant properties (for example, treatment may increase the level of P-selectin and / or Von Willebrand Factor (VWF), and / or may decrease the level of thrombomodulin, as described herein); (vii) increase or attenuate a decrease in vascular tubule formation; (viii) increase or attenuate a decrease in vascular repair; (ix) reduce or attenuate an increase in disordered endothelial cell proliferation and associated neoangiogenesis; (x) increase or attenuate a decrease in mitochondrial membrane potential; and / or (xi) reduce or attenuate an increase in expression of markers of endothelial to mesenchymal transition; or any combination of (i) to (xi).
[0211] A deuterated XBD173 analogue of the invention may inhibit (protect against) pro-inflammatory activation of ECs (e.g. PECs), or attenuate an increase in the pro-inflammatory activation of ECs (e.g. PECs). In other words, a TSPO modulating agent (e.g. a TSPO binding member) of the invention may inhibit ECs (e.g. PECs) from exhibiting a pro-inflammatory phenotype, such as the pro-inflammatory phenotypes as described herein. By way of non-limiting example, a deuterated XBD173 analogue of the invention may inhibit expression of pro-inflammatory markers by ECs (e.g. PECs), particularly E-selectin, ICAM1 and / or VCAM1 (or attenuate an increase in the expression of such markers). A deuterated XBD173 analogue of the invention may inhibit expression and / or release of inflammatory mediators, including certain cytokines and chemokines, including but not limited to IFN-gamma; IL1, 2, 6, 8, 10, 17, 18 or 21; IP10 (CXCL10); I-TAC (CXCL11); G-CSF; MCP-1; PAI1, TNF-alpha, RANTES, SDF-1 (CXCL12) (or attenuate an increase in the expression and / or release of such mediators). A deuterated XBD173 analogue of the invention may inhibit expression of inflammatory markers on the surface of ECs (e.g. PECs), particularly E-selectin and / or ICAM-1. A deuterated XBD173 analogue of the invention may inhibit (or attenuate an increase in) both expression of pro-inflammatory markers and expression and / or release of inflammatory mediators. Standard assays are known in the art for the detection and quantification of pro-inflammatory markers, with commercial products (e.g. Human Cytokine Antibody Array Panel A from R& D Systems) being readily available. A deuterated XBD173 analogue of the invention may independently decrease the level of any one or more inflammatory mediator, e.g. any cytokine, chemokine or cell surface marker as described herein, by at least 1.5-fold, at least 2-fold, at least 3-fold, at least 4-fold, at least 5-fold or more compared with a suitable control (e.g. a corresponding patient or sample not treated with said deuterated XBD173 analogue, or treated with non-deuterated XBD173). Alternatively or in addition, a deuterated XBD173 analogue of the invention may independently restore the level of any one or more inflammatory mediator, e.g. anycytokine, chemokine or cell surface marker as described herein, to within at least 5-fold, at least 4-fold, at least 3-fold, at least 2-fold, at least 1.5-fold, preferably to approximately baseline levels compared with a suitable control (e.g. a healthy control or individual not suffering from EC (e.g. PEC) dysfunction or an associated disease, such as PAH, as described herein).
[0212] A deuterated XBD173 analogue of the invention may reduce or attenuate an increase in ROS production by at least 1.5-fold, at least 2-fold, at least 3-fold or more compared with a suitable control (e.g. a corresponding patient or sample not treated with said TSPO modulating agent). A deuterated XBD173 analogue of the invention may independently restore the level of ROS production, to within at least 2-fold, at least 1.5-fold, preferably to approximately baseline levels compared with a suitable control (e.g. a healthy control or individual not suffering from EC (e.g. PEC) dysfunction or an associated disease, such as PAH, as described herein).
[0213] A deuterated XBD173 analogue of the invention may increase or attenuate a decrease in mitochondrial membrane potential by at least 50%, at least 70%, at least 80%, at least 90%, at least 100%, at least 110%, at least 120%, at least 150% or more compared with a suitable control (e.g. a corresponding patient or sample not treated with said TSPO modulating agent). A TSPO modulating agent of the invention may independently restore the mitochondrial membrane potential, to within at least 2-fold, at least 1.5-fold, preferably to approximately baseline levels compared with a suitable control (e.g. a healthy control or individual not suffering from EC (e.g. PEC) dysfunction or an associated disease, such as PAH, as described herein).
[0214] A deuterated XBD173 analogue of the invention typically does not have phosophodiesterase 1 (PDE) inhibitory activity, or does not inhibit EC (e.g. PEC) dysfunction by inhibition of PDE1. Thus, a deuterated XBD173 analogue of the invention typically has a distinct mechanism of action compared with a PDE1 inhibitor.
[0215] In contrast to conventional treatments for PAH, deuterated XBD173 analogues of the invention may not act to relax vascular tone and particularly may not act directly to relax vascular tone. Rather, deuterated XBD173 analogues of the invention act to treat the underlying EC (e.g. PEC) dysfunction, as described herein, such as by reducing or attenuating an increase in vascular tone.
[0216] The effect of a deuterated XBD173 analogue on a particular EC (e.g. PEC) phenotype may be compared with a suitable control, such as the same phenotype in the EC (e.g. PEC) from a healthy individual, or the phenotype in EC (e.g. PEC) from an individual (typically the same individual) with EC (e.g. PEC) dysfunction prior to treatment with the deuterated XBD173 analogue, or treated with nondeuterated XBD173. When the control is the same phenotype in an individual (typically the same individual) with EC (e.g. PEC) dysfunction prior to treatment with the deuterated XBD173 analogue,treatment with the deuterated XBD173 analogue of the invention results in divergence of the phenotype from the dysfunctional baseline.
[0217] When the control is the same phenotype in the EC (e.g. PEC) from a healthy individual, treatment with a deuterated XBD173 analogue of the invention results in a return of the phenotype towards the baseline of the healthy phenotype. In other words, the deuterated XBD173 analogues of the invention restore normal healthy EC (e.g. PEC) phenotypes. This restoration may be partial, such as at least a 10%, at least a 20%, at least a 30%, at least a 40%, at least a 50%, at least a 60%, at least a 70%, at least an 80%, at least a 85%, at least a 90%, at least a 95%, at least a 96%, at least a 97%, at least a 98%, at least a 99% or more restoration of a normal PEC phenotype, up to and including a complete restoration of the normal EC (e.g. PEC) phenotype, such as any normal EC (e.g. PEC) phenotype as described herein.
[0218] By way of non-limiting example, treatment with a deuterated XBD173 analogue may reduce (or attenuate an increase in) proliferation, particularly hypoxia-induced proliferation, of ECs (e.g. PECs). In particular, "treatment" may be defined as reducing the number of ECs (e.g. pulmonary PECs) by at least 20%, at least 25%, at least 30%, at least 40%, at least 50% or more. Preferably, there is a reduction in the number of ECs of at least 30%, more preferably at least 40%. By way of further non-limiting example, treatment may reduce (or attenuate an increase in) apoptosis of ECs (e.g. PECs). In particular, "treatment" may be defined as reducing the number of apoptotic ECs (e.g. PECs) by at least 20%, at least 25%, at least 30%, at least 40%, at least 50% or more. Preferably, there is a reduction in the number of apoptotic ECs (e.g. PECs) of at least 30%, more preferably at least 40%.
[0219] The increase or decrease in any phenotype, including those listed above is typically assessed or quantified relative to the same phenotype or parameter in the disease state (e.g. in the same individual prior to treatment or in an individual with the same disease who has not been treated according to the invention. Thus, an appropriate control for assessing the increase or decrease in any treatment may be obtained from the same individual prior to treatment, or from a different individual with (clinically relevant) endothelial cell (e.g. PEC) dysfunction, e.g. an individual with PH or PAH, but wherein the different individual has not been treated with a deuterated XBD173 analogue of the invention, as described herein.
[0220] The terms "inhibit EC (e.g. PEC) dysfunction", "inhibition of EC (e.g. PEC) dysfunction" and " EC (e.g. PEC) dysfunction inhibitor" as used herein relate to inhibition of one or more phenotype of EC (e.g. PEC) dysfunction, and can be used interchangeably with the terms "reduce EC (e.g. PEC) dysfunction" and "reduction of EC (e.g. PEC) dysfunction".
[0221] As deuterated XBD173 analogues of the invention can inhibit EC (e.g. PEC) dysfunction, they can be used therapeutically in the treatment and / or prevention of EC (e.g. PEC) dysfunction.Deuterated XBD173 analogues can also be used to treat and / or prevent diseases, disorders or conditions which are associated with EC (e.g. PEC) dysfunction, examples of which are described herein.
[0222] Therapeutic Indications
[0223] The deuterated XBD173 analogues, compositions and drug delivery systems as described herein are useful in the treatment of EC (e.g. PEC) dysfunction. EC (e.g. PEC) is described herein.
[0224] EC dysfunction plays a major role in the development and progression of vascular and related diseases and disorders. Without being bound by theory, EC (e.g. PEC) dysfunction typically involves pro-inflammatory activation of ECs (e.g. PEC). This typically results in the expression of pro-inflammatory markers and the release of pro-inflammatory mediators into the vasculature (as described herein). These pro-inflammatory markers include adhesion molecules such as E-selectin, ICAM1 and VCAM1. Surface expression of such markers and adhesion molecules, together with release of pro-inflammatory mediators drive inflammatory and immune cell recruitment and infiltration into the tissue (e.g. lung), which can drive pathological restructuring of the vasculature. This restructuring can affect ECs (e.g. PECs) as well as smooth muscle cells and fibroblasts within the vasculature, typically by stimulating proliferation of these cells. Thus, PEC dysfunction plays a major role in the development and progression of vascular pathology in pulmonary hypertension (PH), including pulmonary arterial hypertension (PAH) and other related diseases and disorders, as inflammation and excessive proliferation of these vascular cells leads to increased pulmonary vascular resistance and chronic elevation of pulmonary arterial pressure (PAP), which can ultimately result in hypertrophy of the right heart and eventually heart failure.
[0225] Although differing in aetiology and causative mechanisms, different types of PH and associated heart failures are all associated with PEC dysfunction. Due to this common mechanism, the deuterated XBD173 analogues, compositions and drug delivery systems of the invention are useful in treating any disease or disorder associated with EC (e.g. PEC) dysfunction, including PH and associated heart failures.
[0226] Accordingly, the present invention relates to the treatment and / or prevention of PH and / or heart failure. The invention particularly relates to the treatment and / or prevention of PAH (including idiopathic PAH (I PAH )) and / or heart failure with preserved ejection fraction and associated pulmonary hypertension (PH-HFpEF). Preferably the invention relates to the treatment of PAH and / or HFpEF using the deuterated XBD173 analogues, compositions and drug delivery systems of the invention.
[0227] In addition, ligands targeting TSPO have been shown to induce neurosteroid-mediated signaling, which can prevent the neurotoxic effect of β-amyloid peptide (Aβ). Other studies have demonstrated that TSPO ligands can have a neuroprotective and / or anti-inflammatory effect in theCNS. As such, the deuterated XBD173 analogues, compositions and drug delivery systems of the invention have clinical potential in the treatment of neurodegenerative diseases such as Alzheimer's Disease (AD) and cerebral Small Vessel Disease (cSVD). Accordingly, the present invention relates to the treatment and / or prevention of Alzheimer's Disease (AD) and / or cerebral Small Vessel Disease (cSVD) using the deuterated XBD173 analogues, compositions and drug delivery systems of the invention.
[0228] TSPO ligands have also been shown to increase signalling from delta subunit-containing GABAAneurones via neurosteroidogenesis, with therapeutic effects on depression and stress-related disorders such as anxiety observed in both animal models and humans. As such, the deuterated XBD173 analogues, compositions and drug delivery systems of the invention have clinical potential in the treatment of depression and stress-related disorders, such as anxiety. Accordingly, the present invention relates to the treatment and / or prevention of depression and / or stress-related disorders, such as anxiety) using the deuterated XBD173 analogues, compositions and drug delivery systems of the invention.
[0229] TSPO modulators have also been identified as glucose-lowering agents in hepatic gluconeogenesis models in larval zebrafish. As such, the deuterated XBD173 analogues, compositions and drug delivery systems of the invention have clinical potential in the treatment of diabetes (type 1 and / or type 2) and metabolic disorders. Accordingly, the present invention relates to the treatment and / or prevention of diabetes and / or metabolic disorders using the deuterated XBD173 analogues, compositions and drug delivery systems of the invention.
[0230] The deuterated XBD173 analogues, compositions and drug delivery systems as described herein are useful in the treatment of TSPO-mediated diseases or disorders. TSPO is known to play a role in a number of diseases and disorders, such as stress related diseases and diseases associated with EC (e.g. PEC) dysfunction, such as described herein. Therefore, it is within the routine practice of one of ordinary skill in the art to identify TSPO-mediated diseases or disorders for treatment according to the present invention.
[0231] XDB173 in the treatment of disorders associated with a vascular component
[0232] As discussed herein, the invention provides deuterated analogues of XBD173 for use in the treatment of disorders associated with EC dysfunction. The present inventors have previously demonstrated that XBD173 itself (i.e. non-deuterated XBD173) can be used to treat diseases associated with PEC dysfunction. As exemplified herein for the first time (see below) non-deuterated XBD173 has been shown to have a role in regulating Aβ through its effect on EC function. Thus, the present inventors have demonstrated that the effects of XBD173 extend beyond its effect on PECdysfunction, but can also have a role in decreasing EC dysfunction in other tissues and organs, such as the CNS. Therefore, the inventors provide evidence for the first time that non-deuterated XBD173 has therapeutic potential in the treatment and / or prevention of diseases and disorders with a vascular component (e.g. EC dysfunction) beyond diseases and disorders associated with PEC dysfunction.
[0233] As the deuterated analogues of XBD173 of the invention have been designed to have increased stability compared with XBD173, but with their functional properties unchanged, one of ordinary skill in the art would appreciate based on the evidence herein that deuterated analogues of XBD173, as well as non-deuterated XBD173 therapeutic potential in the treatment and / or prevention of diseases and disorders with a vascular component (e.g. EC dysfunction) beyond diseases and disorders associated with PEC dysfunction.
[0234] Accordingly, the present invention provides XBD173 (i.e. non-deuterated) and / or deuterated analogues of XBD173, as well as pharmaceutical compositions thereof, for use in the treatment of disorders associated with a vascular component (e.g. disorders associated with EC dysfunction). Non-deuterated XBD173 may be used in such treatments. Alternatively, deuterated analogues of XBD173 may be used in such treatments.
[0235] In particular, and as exemplified in the present application, the inventors have shown that XBD173 was able to restore vascular function in an APP(nlgf) mouse model. The present inventors are the first to establish the beneficial use of XBD173 in the treatment of Alzheimer's disease through restoration of vascular function. It has in fact been shown that there is an overlap between cerebrovascular disease and Alzheimer's disease suggesting potential synergistic effects of both pathologies. Without being bound by theory, the inventors hypothesise that this effect of XBD173 as demonstrated in the present application has the potential to be generalised to other conditions in with a vascular component (e.g. EC dysfunction).
[0236] The invention provides XBD173 and / or a deuterated analogue of XBD173, or pharmaceutical combination thereof for use in a method of treatment or prevention of Alzheimer's disease (AD) and cerebral Small Vessel Disease (cSVD) by increasing vascular function. Non-deuterated XBD173 may be used in such treatments. Alternatively, deuterated analogues of XBD173 may be used in such treatments.
[0237] The invention provides XBD173 and / or a deuterated analogue of XBD173, or pharmaceutical combination thereof for use in a method of treatment or prevention of Alzheimer's disease (AD) and cerebral Small Vessel Disease (cSVD) by decreasing EC dysfunction. Non-deuterated XBD173 may be used in such treatments. Alternatively, deuterated analogues of XBD173 may be used in such treatments.The invention provides XBD173 and / or a deuterated analogue of XBD173, or pharmaceutical combination thereof of the invention for use in a method of treatment and / or prevention of Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), metabolic diseases (e.g. type 1 and / or type 2 diabetes), stress-related disorders (e.g. panic disorders and / or anxiety), depression and / or age-related macular degeneration (AMD) by decreasing EC dysfunction. Non-deuterated XBD173 may be used in such treatments. Alternatively, deuterated analogues of XBD173 may be used in such treatments.
[0238] In other words, the invention therefore provides XBD173 and / or a deuterated analogue of XBD173, or pharmaceutical combination thereof of the invention for use in a method of treatment and / or prevention of Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), metabolic diseases (e.g. type 1 and / or type 2 diabetes), stress-related disorders (e.g. panic disorders and / or anxiety), depression and / or age-related macular degeneration (AMD) by increasing vascular function. Non-deuterated XBD173 may be used in such treatments. Alternatively, deuterated analogues of XBD173 may be used in such treatments.
[0239] The invention provides a method of treatment and / or prevention of Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), metabolic diseases (e.g. type 1 and / or type 2 diabetes), stress-related disorders (e.g. panic disorders and / or anxiety), depression and / or age-related macular degeneration (AMD) by administering a therapeutically effective amount of treating XBD173 and / or a deuterated analogue of XBD173, or pharmaceutical combination thereof, to patient in need thereof, wherein the XBD173, deuterated analogue, or pharmaceutical combination thereof decreases EC dysfunction. Non-deuterated XBD173 may be used in such methods. Alternatively, deuterated analogues of XBD173 may be used in such methods.
[0240] The invention provides a method of treatment and / or prevention of Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), metabolic diseases (e.g. type 1 and / or type 2 diabetes), stress-related disorders (e.g. panic disorders and / or anxiety), depression and / or age-related macular degeneration (AMD) by administering a therapeutically effective amount of treating XBD173 and / or a deuterated analogue of XBD173, or pharmaceutical combination thereof, to patient in need thereof, wherein the XBD173, deuterated analogue, or pharmaceutical combination thereof increases vascular function. Non-deuterated XBD173 may be used in such methods. Alternatively, deuterated analogues of XBD173 may be used in such methods.
[0241] The invention provides the use of XBD173 and / or a deuterated analogue of XBD173 for the manufacture of a medicament for the treatment and / or prevention of Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), metabolic diseases (e.g. type 1 and / or type 2 diabetes), stress-related disorders (e.g. panic disorders and / or anxiety), depression and / or age-related maculardegeneration (AMD), wherein the XBD173 or deuterated analogue thereof decreases EC dysfunction. Non-deuterated XBD173 may be used. Alternatively, deuterated analogues of XBD173 may be used.
[0242] The invention provides the use of XBD173 and / or a deuterated analogue of XBD173 for the manufacture of a medicament for the treatment and / or prevention of Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), metabolic diseases (e.g. type 1 and / or type 2 diabetes), stress-related disorders (e.g. panic disorders and / or anxiety), depression and / or age-related macular degeneration (AMD), wherein the XBD173 or deuterated analogue thereof increases vascular function. Non-deuterated XBD173 may be used. Alternatively, deuterated analogues of XBD173 may be used.
[0243] Whilst XBD173 has been hypothesised, and in some instances investigated for conditions such as stress-related disorders, the focus in such work has been in relation to the role of TSPO in steroidogenesis, and the effect that XBD173 may have on this function of TSPO. In contrast, as exemplified herein, XBD173 (and deuterated analogues thereof) have therapeutic potential in the treatment of such conditions by targeting the vasculature, as XBD173 can reduce EC dysfunction. Without being bound by theory, this is clinically of interest, as it may allow for different patient cohorts to be treated. By way of non-limiting example, according to the present invention, XBD173 (and deuterated analogues thereof) could potentially be used to specifically treat patients with Alzheimer's disease with a vascular component, whereas the conventional use of XBD173 acting on steroidogenesis may not define the same patient cohort. By way of further non-limiting example, according to the present invention, XBD173 (and deuterated analogues thereof) could potentially be used to specifically to treat patients earlier in disease progression than using conventional treatments.
[0244] XBD173, deuterated analogues of XBD173, and pharmaceutical compositions thereof of the invention may be of particular interest for the treatment of patients with a further vascular disorder in addition to the disease or disorder intended for treatment with XBD173, deuterated analogues of XBD173, and pharmaceutical compositions thereof as described herein. Without being bound by theory, it is believed that such subpopulations of patients would benefit from the activity of XBD173 and / or deuterated analogues thereof in decreasing EC dysfunction in treating this further disorder, in addition to the treatment of the disease or disorder for which the XBD173 and / or deuterated analogue was prescribed. This would decrease the risk of complications linked to co-morbidity factors such as hypertension and diabetes in the treatment of Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), pulmonary hypertension, heart failure, stress-related disorders, depression or age-related macular degeneration (AMD). By way of non-limiting example, XBD173, deuterated analogues of XBD173, and pharmaceutical compositions thereof may be of particular use in the treatment of Alzheimer's disease in a patient who also has hypertension, or is at risk of hypertension. The inventiontherefore provides XBD173, a deuterated analogue of XBD173 or pharmaceutical combination thereof of the invention for use in a method of treatment and / or prevention of Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), pulmonary hypertension, heart failure, stress-related disorders, depression or age-related macular degeneration (AMD) in patients suffering from a further vascular disorder, or at risk of a further vascular disorder.
[0245] Therapy
[0246] The invention provides deuterated XBD173 analogues and pharmaceutical compositions thereof of the invention for use in a method of treatment.
[0247] The invention deuterated XBD173 analogues and pharmaceutical compositions thereof for use in the treatment and / or prevention of endothelial cell (EC) dysfunction and associated diseases and disorders (as described herein).
[0248] The term "treat" or "treating" as used herein encompasses prophylactic treatment (e.g. to prevent onset of EC dysfunction or an associated disease or disorder) as well as corrective treatment (treatment of an individual already suffering from EC dysfunction or an associated disease or disorder). Preferably, the term "treat" or "treating" as used herein means corrective treatment. The term "treat" or "treating" encompasses treating both EC dysfunction, symptoms thereof and diseases / disorder associated therewith. In some embodiments the term "treat" or "treating" refers to a symptom of EC dysfunction.
[0249] A deuterated XBD173 analogue or pharmaceutical composition of the invention may be used in the treatment of an individual having EC dysfunction as described herein. An individual may be screened for EC dysfunction prior to treatment (e.g. using a bronchoalveolar (BAL) lavage sample or tissue biopsy), and may be selected for treatment based on the level of EC dysfunction (in other words based on the deviation of one or more EC phenotype from the normal value in a healthy individual, as described herein).
[0250] A "therapeutically effective amount" is any amount of a deuterated XBD173 analogue or pharmaceutical composition of the invention which, when administered alone or in combination to a patient for treating PEC dysfunction (or preventing further dysfunction) or a symptom thereof or a disease associated therewith is sufficient to provide such treatment of the EC dysfunction, or symptom thereof, or associated disease. A "prophylactically effective amount" is any amount of a deuterated XBD173 analogue or pharmaceutical composition of the invention that, when administered alone or in combination to an individual inhibits or delays the onset or reoccurrence of EC dysfunction, or a symptom thereof or disease associated therewith). The prophylactically effective amount may prevent the onset or reoccurrence of EC dysfunction entirely. " Inhibiting" the onset means either lesseningthe likelihood of EC dysfunction onset (or symptom thereof or disease associated therewith) or preventing the onset entirely.
[0251] Treating EC dysfunction according to the invention may allow diseases associated with EC dysfunction to be treated earlier in their progression than using conventional treatments, and this prevent or reduce phenotypes associated with EC dysfunction, or other symptoms and / or pathological changes associated with EC dysfunction or associated diseases. Thus, compared with conventional treatments for PH, treatment according to the invention may prevent or reducing such phenotypes or other symptoms and / or pathological changes.
[0252] For example, treating pulmonary EC (PEC) dysfunction may allow associated conditions such as pulmonary hypertension (PH), particularly pulmonary arterial hypertension (PAH) (e.g. idiopathic PAH (IPAH)) to be treated earlier in their progression than using conventional treatments, and this prevent or reduce phenotypes associated with PEC dysfunction, or other symptoms and / or pathological changes associated with PEC dysfunction or associated diseases, such as pulmonary vascular remodelling.
[0253] The terms "subject", "individual" and "patient" are used interchangeably herein to refer to a mammalian individual. Generally, the individual may be human; in other words, in one embodiment, the "individual" is a human. The individual may not have been previously diagnosed as having EC dysfunction (or symptom thereof or disease associated therewith). Alternatively, the individual may have been previously diagnosed as having EC dysfunction (or symptom thereof or disease associated therewith). The individual may also be one who exhibits disease risk factors, or one who is asymptomatic for EC dysfunction (or symptom thereof or disease associated therewith). The individual may also be one who is suffering from or is at risk of developing EC dysfunction (or symptom thereof or disease associated therewith).
[0254] Administration of a deuterated XBD173 analogue or pharmaceutical composition of the invention may be by any appropriate route. Non-limiting examples of conventional routes include inhalation; intraperitoneal, intravenous, intra-arterial, subcutaneous, and / or intramuscular injection; infusion; rectal, vaginal, topical and oral administration. The most appropriate administration route may be selected based on the deuterated XBD173 analogue or pharmaceutical composition of the invention used. Preferably the deuterated XBD173 analogue or pharmaceutical composition of the invention may be administered orally, or by inhalation, particularly oropharyngeal inhalation and / or nasal inhalation, or by intravenous or intra-arterial administration.
[0255] It will be appreciated by one of skill in the art that the appropriate dosage of a deuterated XBD173 analogue or pharmaceutical composition of the invention, can vary from individual to individual. Determining the optimal dosage will generally involve the balancing of the level oftherapeutic benefit against any risk or deleterious side effects. The selected dosage level will depend on a variety of factors including, the route of administration, the severity of the individual's / patient's disease, whether a patient is a rapid / poor metaboliser, contraindications, Rs6971 genotype, and the species, sex, age, weight, condition, general health, and prior medical history of the individual / patient. The dosage ranges for administration of a deuterated XBD173 analogue or pharmaceutical composition of the present invention are those which produce the desired therapeutic effect. Suitable doses can be readily determined using the judgement of the attending physician. Variations in these dosage levels can be adjusted using standard empirical routines for optimisation.
[0256] The dose of a deuterated XBD173 analogue, drug delivery system or pharmaceutical composition of the invention can be readily determined by one of skill in the art, and is any dose that produces the desired therapeutic effect. Typically, deuterated analogues of XBD173 may be administered at a dose of about 0.1 to 20 mg / kg. Preferably, the deuterated analogues of XBD173 of the invention are administered at a dose of about 0.1 to 10 mg / kg, even more preferably at dose of about 0.1 to 5 mg / kg, even more preferably at a dose of about 0.3 to 3 mg / kg. In particularly preferred embodiments, deuterated analogues of XBD173 may be administered at a dose of about 0.1 to 5 mg / kg or 0.3 to 3 mg / kg by oral administration. This particularly preferred dose may be administered daily (once a day) or twice daily (two times a day) and may be administered indefinitely. Most preferably this preferred dose is administered once daily.
[0257] The frequency of dosing selected may also be dependent on a range of factors. The skilled person will be able to select the most suitable dosing regimen appropriate for the individual. Typically, a deuterated XBD173 analogue, drug delivery system or pharmaceutical composition of the invention is administered between about once every three months to about four times per day. For example, a deuterated XBD173 analogue, drug delivery system or pharmaceutical composition of the invention may be administered once every three months, once per month, twice per month, once per week, twice per week, 3 times per week, 4 times per week, 5 times per week, 6 times per week, once a day, twice a day, 3 times per day, 4 times per day or more. Preferably, a deuterated XBD173 analogue, drug delivery system or pharmaceutical composition of the invention is administered about once per day or twice a day. More preferably, a deuterated XBD173 analogue, drug delivery system or pharmaceutical composition of the invention is administered about once per day. Treatment may be continued for at least one month, at least two months, at least four months, at least six months, at least one year, at least two years, at least five years, at least ten years or more, including indefinite treatment / treatment for the life of an individual.
[0258] A deuterated XBD173 analogue, drug delivery system or pharmaceutical composition of the invention may have a therapeutic benefit (e.g. a change in a phenotype as described herein, or someother measurable clinical parameter used clinically to quantify disease status and / or prognosis) herein within 4-52 weeks (preferably within 36 weeks, more preferably within 24 weeks, still more preferably within 12 weeks, yet more preferably within 8 weeks, even more preferably within 4 weeks) from baseline. Preferably, administration of a deuterated XBD173 analogue, drug delivery system or pharmaceutical composition of the invention may provide a therapeutic benefit within 36 weeks, more preferably within 24 weeks, still more preferably within 12 weeks, yet more preferably within 8 weeks, even more preferably within 4 weeks.
[0259] The therapeutic benefit may be sustained (e.g. maintained) subsequent to and / or during treatment for several weeks or months or years. A deuterated XBD173 analogue, drug delivery system or pharmaceutical composition of the invention may provide a sustained therapeutic benefit for at least 1, 2, 3, 4, 5, 10, 12, 16, 18, 20, 22, 24, 38, 32, 36, 40, 52, 78 or 104 weeks. For example, administration of a deuterated XBD173 analogue, drug delivery system or pharmaceutical composition of the invention may provide a sustained therapeutic benefit for at least 1 week, at least 2 weeks, at least 3 weeks, at least 4 weeks, at least 5 weeks, at least 10 weeks, at least 20 weeks, or at least 52 weeks.
[0260] A deuterated analogue of XBD173 of the invention may be used in combination with one or more additional active ingredient or therapeutic, such as an agent which relaxes vascular tone and / or an anti-inflammatory. By way of non-limiting example, deuterated analogue of XBD173 of the invention may be used in combination with PDE5 inhibitors, ERA, prostacyclin, sotatercept, ISMN, cilostazol and / or a NO stimulator, e.g. sildenafil, tadalafil, macetentan, epoprostinil, selexipag, riociguat.
[0261] The one or more additional active ingredient or therapeutic may be administered sequentially (before or after) the deuterated analogue of XBD173, drug delivery system or pharmaceutical composition of the invention. The one or more additional active ingredient or therapeutic may be administered simultaneously with the deuterated analogue of XBD173, drug delivery system or pharmaceutical composition of the invention.
[0262] The invention also provides a deuterated analogue of XBD173, drug delivery system or pharmaceutical composition thereof for use in a method of treatment or prevention of a disease or disorder in a patient in need thereof, more particularly in a disease or disorder associated with dysfunction of endothelial cells. The invention provides a deuterated analogue of XBD173 of the invention for use in a method of treatment or prevention of Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), metabolic diseases (e.g. type 1 and / or type 2 diabetes), pulmonary hypertension, heart failure, stress-related disorders (e.g. panic disorders and / or anxiety), depression or age-related macular degeneration (AMD).The invention provides a deuterated analogue of XBD173, drug delivery system or pharmaceutical composition thereof for use in a method of treatment or prevention of Alzheimer's disease (AD) and / or cerebral Small Vessel Disease (cSVD).
[0263] The invention provides a deuterated analogue of XBD173, drug delivery system or pharmaceutical composition thereof for use in a method of treatment or prevention of pulmonary hypertension. Preferably the invention provides a deuterated analogue of XBD173 for use in a method of treatment or prevention of pulmonary arterial hypertension (PAH), optionally idiopathic pulmonary arterial hypertension (IPAH).
[0264] The invention provides a deuterated analogue of XBD173, drug delivery system or pharmaceutical composition thereof for use in a method of treatment or prevention of heart failure. Optionally the invention provides a deuterated analogue of XBD173 for use in a method of treatment or prevention of heart failure with preserved ejection fraction and associated pulmonary hypertension (PH-HFpEF).
[0265] The invention provides a deuterated analogue of XBD173, drug delivery system or pharmaceutical composition thereof for use in a method of treatment or prevention of metabolic diseases, optionally type 1 and / or type 2 diabetes.
[0266] The invention provides a deuterated analogue of XBD173, drug delivery system or pharmaceutical composition thereof for use in a method of treatment or prevention of stress-related disorders, optionally panic disorders and / or anxiety.
[0267] The invention also provides a method of treatment comprising the step of administering a therapeutically effective amount of a deuterated analogue of XBD173, drug delivery system or pharmaceutical composition thereof to a patient in need thereof.
[0268] The invention also provides the use of a deuterated analogue of XBD173 as defined herein in the manufacture of a medicament.
[0269] Rapid-metabolisers
[0270] As used herein, "metabolise" relates to the chemical or enzymatic degradation of a drug product, for example XBD173 or deuterated analogues of XBD173. As used herein, "metabolite" relates to the resulting molecule from the chemical or enzymatic degradation of a drug product, for example XBD173 or deuterated analogues of XBD173. Such metabolite may or may not carry some drug activity or toxicity.
[0271] The present inventors have shown that XBD173 is metabolised in human liver microsomes to produce one major metabolite (M2, see Example 1 and Figure 2). The present inventors have also shown that the metabolic degradation of XBD173 to metabolite M2 is observed in healthy humansubjects (see Example 2). Without being bound by theory, the experimental results presented in the present application indicate that XBD173 is mainly metabolised in the liver. It is known that the level of activity and expression of metabolic liver enzymes varies between subjects and therefore some subjects will be able to metabolise XBD173 faster than others.
[0272] As used herein, a "poor metaboliser" relates to a subject that metabolises XBD173 slower than the average subject. For example, a poor metaboliser may metabolise XBD173 about at least 10%, about at least 20%, about at least 30%, about at least 40% or about at least 50% less than average subject.
[0273] As used herein, a "rapid metaboliser" relates to a subject that metabolises XBD173 faster than the average subject. For example, a rapid metaboliser may metabolise XBD173 about at least 10%, about at least 20%, about at least 30%, about at least 40% or about at least 50% more than average subject.
[0274] The present inventors have found that deuterated analogues of XBD173 of the invention are more stable (subject to less metabolic degradation) than non-deuterated XBD173. In particular, the Examples herein demonstrate that compounds 16 and 26 (see Table 1) are more stable and subject to less metabolic degradation. These deuterated XBD173 analogues of the invention, particularly those which are more metabolically stable are of particular interest to help sustain a larger dose of active molecule (deuterated analogues of XBD173 of the invention) in circulation in the patient for a longer time allowing for initially smaller doses or higher efficacy of the original dosage.
[0275] This is particularly relevant in the case of rapid metabolisers, as these specific subjects degrade the non-deuterated XDB173 faster than the average subject and therefore exhibit a smaller dose of XBD173 in the circulation for a shorter time. Therefore, more the deuterated analogues of XBD173 of the invention, by virtue of their improved metabolic stability have particular clinical potential in the treatment of rapid metabolisers, by allowing an effective amount of the deuterated analogue of XBD173 of the invention to remain in circulation for longer.
[0276] As described herein, XBD173 (non-deuterated) has a half-life in human microsomes of about 2.92 min, and an in vivo half-life in humans of between about 4 hours (Rupprecht et al Science (2009) 24;325(5939):490-3). As exemplified herein, the deuterated analogues of XBD173 of the invention have a half-life in human microsomes of at least 2.96 min. Therefore, the deuterated analogues of XBD173 of the invention may have a half-life (t½) of at least 2.96 min, such as at least about 3.5 min, at least about 4 min, at least about 4.5 min, at least about 5 min, at least about 5.5 min, at least about 6 min, at least about 6.5 min or more, as measured using human microsomes in a method as described in this application, particularly as exemplified herein (e.g. the microsome assay of Example 1).The predicted in vivo clearance based on the human microsome data is 2.94 mL / min / kg (XBD173) and for the deuterated compounds 3, 4, 6, 16 and 26 respectively 2.79 mL / min / kg (compound 3), 2.90 mL / min / kg (compound 4), 2.31 mL / min / kg (compound 6), 1.41 mL / min / kg (compound 16), and 1.46 mL / min / kg (compound 26). Accordingly, deuterated analogues of XBD173 of the invention may have an in vivo clearance rate of between about 1.0 mL / min / kg to about 2.90 mL / min / kg, such as between about 1.0 mL / min / kg to about 2.80 mL / min / kg, between about 1.0 mL / min / kg to about 2.50 mL / min / kg, between about 1.0 mL / min / kg to about 2.40 mL / min / kg, between about 1.0 mL / min / kg to about 2.0 mL / min / kg, between about 1.0 mL / min / kg to about 1.75 mL / min / kg, between about 1.0 mL / min / kg to about 1.50 mL / min / kg, between about 1.2 mL / min / kg to about 2.80 mL / min / kg, between about 1.2 mL / min / kg to about 2.50 mL / min / kg, between about 1.2 mL / min / kg to about 2.40 mL / min / kg, between about 1.2 mL / min / kg to about 2.0 mL / min / kg, between about 1.2 mL / min / kg to about 1.75 mL / min / kg, or between about 1.2 mL / min / kg to about 1.50 mL / min / kg.
[0277] Based on the in vivo half-life of XBD173 (about 4 hours), and the microsome half-life and clearance data exemplified herein, the in vivo half-life of deuterated compounds 3, 4, 6, 16 and 26 is calculated to be about 4.2 hours (compound 3), about 4 hours (compound 4), about 5.1 hours (compound 6), about 8.3 hours (compound 16) and about 8.0 hours (compound 26) respectively. Accordingly, he deuterated analogues of XBD173 of the invention may have an in vivo half-life (t½) of at least 7 hours, such as at least 7.5 hours, at least 8 hours, at least 8.5 hours, at least 9 hours, at least 9.5 hours, at least 10 hours or more. The deuterated analogues of XBD173 of the invention may have a half-life (t½) of between about 7 hours to about 15 hours, such as between about 7 hours to about 12 hours, between about 7 hours to about 10 hours, or between about 8 hours to about 10 hours. The deuterated analogues of XBD173 of the invention may have a half-life (t½) of between about 7 hours to about 10 hours. The in vivo half-life of the deuterated analogues of XBD173 of the invention may be measured using protocols known in the art such as dosing the compounds in heathy male individuals, collecting blood samples at regular intervals and quantifying the amount of intact compound still present by an appropriate technique such as mass-spectrometry coupled with liquid chromatography.
[0278] The level of metabolism of a patient pre-treatment (e.g. through particular genotype or phenotype associated with rapid-metabolisers or slow metabolisers) may be used to identify an individual as suitable for treatment according to the invention. Alternatively or in addition, biomarkers for rapid metabolism could be used to identify an individual as suitable for treatment according to the invention. Other parameters may also be used, either alone or in combination with the level of a metabolism of a patient as described above, to identify an individual as suitable for treatmentaccording to the invention. Suitable parameters to identify an individual as suitable for treatment according to the invention are known to the skilled person. For example, the presence and / or amount of a biomarker is used to identify an individual as suitable for treatment. The biomarker may, for example, be a circulating protein biomarker or a nucleic acid biomarker.
[0279] The invention therefore provides a method of treatment of a patient comprising the steps of (a) identifying the level of metabolism of the patient, optionally using one or more parameter described herein, (b) assessing if the patient is rapid or slow metaboliser, and (c) providing a therapeutically effective amount of a deuterated analogues of XBD173 of the invention. The therapeutically effective dose of said deuterated analogue of XBD173 may depend on the nature of the patient's metabolism. Thus, a patient identified as a fast metaboliser may be given a higher dose and / or a more frequent dose than a patient identified as a normal metaboliser or a slow metaboliser. A patient identified as a slow metaboliser may be given a lower dose and / or a less frequent dose than a patient identified as a normal metaboliser or a rapid metaboliser.
[0280] The invention also provides a method of identifying whether a patient is suitable for treatment according to the invention comprising: (a) identifying the level of metabolism of the patient, optionally using one or more parameter described herein, (b) determining whether the patient is rapid or slow metaboliser using the information obtained in step (a); and (c) identifying a patient as suitable for treatment according to the invention.
[0281] The invention also provides a method of selecting a therapeutically effective dose of a deuterated analogue of XBD173 of the invention, said method comprising: (a) identifying the level of metabolism of the patient, optionally using one or more parameter described herein, (b) assessing if the patient is rapid or slow metaboliser, and (c) selecting an appropriate dose of a deuterated analogue of XBD173 of the invention depending on whether the patient is identified as a slow, normal or rapid metaboliser.
[0282] SEQUENCE HOMOLOGY
[0283] Any of a variety of sequence alignment methods can be used to determine percent identity, including, without limitation, global methods, local methods and hybrid methods, such as, e.g., segment approach methods. Protocols to determine percent identity are routine procedures within the scope of one skilled in the art. Global methods align sequences from the beginning to the end of the molecule and determine the best alignment by adding up scores of individual residue pairs and by imposing gap penalties. Non-limiting methods include, e.g., CLUSTAL W, see, e.g., Julie D. Thompson et al., CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment Through Sequence Weighting, Position- Specific Gap Penalties and Weight Matrix Choice, 22(22) Nucleic AcidsResearch 4673-4680 (1994); and iterative refinement, see, e.g., Osamu Gotoh, Significant Improvement in Accuracy of Multiple Protein. Sequence Alignments by Iterative Refinement as Assessed by Reference to Structural Alignments, 264(4) J. Mol. Biol. 823-838 (1996). Local methods align sequences by identifying one or more conserved motifs shared by all of the input sequences. Non-limiting methods include, e.g., Match-box, see, e.g., Eric Depiereux and Ernest Feytmans, Match-Box: A Fundamentally New Algorithm for the Simultaneous Alignment of Several Protein Sequences, 8(5) CABIOS 501 -509 (1992); Gibbs sampling, see, e.g., C. E. Lawrence et al., Detecting Subtle Sequence Signals: A Gibbs Sampling Strategy for Multiple Alignment, 262(5131 ) Science 208-214 (1993); Align-M, see, e.g., Ivo Van Walle et al., Align-M - A New Algorithm for Multiple Alignment of Highly Divergent Sequences, 20(9) Bioinformatics: 1428-1435 (2004).
[0284] Thus, percent sequence identity is determined by conventional methods. See, for example, Altschul et al., Bull. Math. Bio. 48: 603-16, 1986 and Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-19, 1992. Briefly, two amino acid sequences are aligned to optimize the alignment scores using a gap opening penalty of 10, a gap extension penalty of 1, and the "blosum 62" scoring matrix of Henikoff and Henikoff (ibid.) as shown below (amino acids are indicated by the standard one-letter codes).
[0285] The "percent sequence identity" between two or more nucleic acid or amino acid sequences is a function of the number of identical positions shared by the sequences. Thus, % identity may be calculated as the number of identical nucleotides / amino acids divided by the total number of nucleotides / amino acids, multiplied by 100. Calculations of % sequence identity may also take into account the number of gaps, and the length of each gap that needs to be introduced to optimize alignment of two or more sequences. Sequence comparisons and the determination of percent identity between two or more sequences can be carried out using specific mathematical algorithms, such as BLAST, which will be familiar to a skilled person.
[0286] ALIGNMENT SCORES FOR DETERMINING SEQUENCE IDENTITY A R N D C Q E G H I L K M F P S T W Y V
[0287] A 4
[0288] R -l 5
[0289] N -2 0 6
[0290] D -2 -2 1 6
[0291] C 0 -3 -3 -3 9
[0292] Q-l 1 0 0 -3 5
[0293] E -1 0 0 2 -4 2 5G 0 -2 0 -1 -3 -2 -2 6
[0294] H -2 0 1 -1 -3 0 0 -2 8
[0295] I -1 -3 -3 -3 -1 -3 -3 -4 -3 4
[0296] L -1 -2 -3 -4 -1 -2 -3 -4 -3 2 4
[0297] K-l 2 0 -1 -3 1 1 -2 -1 -3 -2 5
[0298] M -1 -1 -2 -3 -1 0 -2 -3 -2 1 2 -1 5
[0299] F -2 -3 -3 -3 -2 -3 -3 -3 -1 0 0 -3 0 6
[0300] P -1 -2 -2 -1 -3 -1 -1 -2 -2 -3 -3 -1 -2 -4 7
[0301] S 1 -1 1 0 -1 0 0 0 -1 -2 -2 0 -1 -2 -1 4
[0302] T 0 -1 0 -1 -1 -1 -1 -2 -2 -1 -1 -1 -1 -2 -1 1 5
[0303] W -3 -3 -4 -4 -2 -2 -3 -2 -2 -3 -2 -3 -1 1 -4 -3 -2 11
[0304] Y -2 -2 -2 -3 -2 -1 -2 -3 2 -1 -1 -2 -1 3 -3 -2 -2 2 7
[0305] V 0 -3 -3 -3 -1 -2 -2 -3 -3 3 1 -2 1 -1 -2 -2 0 -3 -1 4
[0306] The percent identity is then calculated as:
[0307] Total number of identical matches
[0308] - - - X 100 [length of the longer sequence + number of gaps introduced in alignment]
[0309] Substantially homologous polypeptides are characterized as having one or more amino acid substitutions, deletions or additions. These changes are preferably of a minor nature, that is conservative amino acid substitutions (as described herein) and other substitutions that do not significantly affect the folding or activity of the polypeptide; small deletions, typically of one to about 30 amino acids; and small amino- or carboxyl-terminal extensions, such as an amino-terminal methionine residue, a small linker peptide of up to about 20-25 residues, or an affinity tag.
[0310] In addition to the 20 standard amino acids, non-standard amino acids (such as 4-hydroxyproline, 6-N-methyl lysine, 2-aminoisobutyric acid, isovaline and a -methyl serine) may be substituted for amino acid residues of the polypeptides of the present invention. A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, and unnatural amino acids may be substituted for polypeptide amino acid residues. The polypeptides of the present invention can also comprise non-naturally occurring amino acid residues.
[0311] Non-naturally occurring amino acids include, without limitation, trans-3-methylproline, 2,4-methano-proline, cis-4-hydroxyproline, trans-4-hydroxy-proline, N-methylglycine, allo-threonine, methyl-threonine, hydroxy-ethylcysteine, hydroxyethylhomo-cysteine, nitro-glutamine, homoglutamine, pipecolic acid, tert-leucine, norvaline, 2-azaphenylalanine, 3-azaphenyl-alanine, 4-azaphenyl-alanine, and 4-fluorophenylalanine. Several methods are known in the art for incorporatingnon-naturally occurring amino acid residues into proteins. For example, an in vitro system can be employed wherein nonsense mutations are suppressed using chemically aminoacylated suppressor tRNAs. Methods for synthesizing amino acids and aminoacylating tRNA are known in the art. Transcription and translation of plasmids containing nonsense mutations is carried out in a cell free system comprising an E. coli S30 extract and commercially available enzymes and other reagents. Proteins are purified by chromatography. See, for example, Robertson et al., J. Am. Chem. Soc.
[0312] 113:2722, 1991; Ellman et al., Methods Enzymol.202:301, 1991; Chung et al., Science 259:806-9, 1993; and Chung et al., Proc. Natl. Acad. Sci. USA 90:10145-9, 1993). In a second method, translation is carried out in Xenopus oocytes by microinjection of mutated mRNA and chemically aminoacylated suppressor tRNAs (Turcatti et al., J. Biol. Chem. 271:19991-8, 1996). Within a third method, E. coli cells are cultured in the absence of a natural amino acid that is to be replaced (e.g., phenylalanine) and in the presence of the desired non-naturally occurring amino acid(s) (e.g., 2-azaphenylalanine, 3-azaphenylalanine, 4-azaphenylalanine, or 4-fluorophenylalanine). The non-naturally occurring amino acid is incorporated into the polypeptide in place of its natural counterpart. See, Koide et al., Biochem.
[0313] 33:7470-6, 1994. Naturally occurring amino acid residues can be converted to non-naturally occurring species by in vitro chemical modification. Chemical modification can be combined with site-directed mutagenesis to further expand the range of substitutions (Wynn and Richards, Protein Sci. 2:395-403, 1993).
[0314] A limited number of non-conservative amino acids, amino acids that are not encoded by the genetic code, non-naturally occurring amino acids, and unnatural amino acids may be substituted for amino acid residues of polypeptides of the present invention.
[0315] Essential amino acids in the polypeptides of the present invention can be identified according to procedures known in the art, such as site-directed mutagenesis or alanine-scanning mutagenesis (Cunningham and Wells, Science 244: 1081-5, 1989). Sites of biological interaction can also be determined by physical analysis of structure, as determined by such techniques as nuclear magnetic resonance, crystallography, electron diffraction or photoaffinity labeling, in conjunction with mutation of putative contact site amino acids. See, for example, de Vos et al., Science 255:306-12, 1992; Smith et al., J. Mol. Biol. 224:899-904, 1992; Wlodaver et al., FEBS Lett. 309:59-64, 1992. The identities of essential amino acids can also be inferred from analysis of homologies with related components (e.g. the translocation or protease components) of the polypeptides of the present invention.
[0316] Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these authors disclose methods for simultaneously randomizing two or more positions in a polypeptide, selecting forfunctional polypeptide, and then sequencing the mutagenized polypeptides to determine the spectrum of allowable substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et aL, Biochem.30:10832-7, 1991; Ladner et al., U. S. Patent No.5,223,409; Huse, WIPO Publication WO 92 / 06204) and region-directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA 7:127, 1988).
[0317] Multiple amino acid substitutions can be made and tested using known methods of mutagenesis and screening, such as those disclosed by Reidhaar-Olson and Sauer (Science 241:53-7, 1988) or Bowie and Sauer (Proc. Natl. Acad. Sci. USA 86:2152-6, 1989). Briefly, these authors disclose methods for simultaneously randomizing two or more positions in a polypeptide, selecting for functional polypeptide, and then sequencing the mutagenized polypeptides to determine the spectrum of allowable substitutions at each position. Other methods that can be used include phage display (e.g., Lowman et aL, Biochem.30:10832-7, 1991; Ladner et al., U. S. Patent No.5,223,409; Huse, WIPO Publication WO 92 / 06204) and region-directed mutagenesis (Derbyshire et al., Gene 46:145, 1986; Ner et al., DNA 7:127, 1988).
[0318] INFORMATION
[0319] SEQ ID NO: 1 - Homo sapiens TSPO amino acid sequence
[0320] MAPPWVPAMG FTLAPSLGCF VGSRFVHGEG LRWYAGLQKP SWHPPHWVLG PVWGTLYSAM GYGSYLVWKE LGGFTEKAVV PLGLYTGQLA LNWAWPPIFF GARQMGWALV DLLLVSGAAA ATTVAWYQVS PLAARLLYPY LAWLAFTTTL NYCVWRDNHG WRGGRRLPE
[0321] SEQ ID NO: 2 - Homo sapiens TSPO mRNA sequence
[0322] aactcctgcc aggcagtgcc cttcccggag cgtgccctcg ccgctgagct cccctgaaca gcagctgcag cagccatggc cccgccctgg gtgcccgcca tgggcttcac gctggcgccc agcctggggt gcttcgtggg ctcccgcttt gtccacggcg agggtctccg ctggtacgcc ggcctgcaga agccctcgtg gcacccgccc cactgggtgc tgggccctgt ctggggcacg ctctactcag ccatggggta cggctcctac ctggtctgga aagagctggg aggcttcaca gagaaggctg tggttcccct gggcctctac actgggcagc tggccctgaa ctgggcatgg ccccccatct tctttggtgc ccgacaaatg ggctgggcct tggtggatct cctgctggtc agtggggcgg cggcagccac taccgtggcc tggtaccagg tgagcccgct ggccgcccgc ctgctctacc cctacctggc ctggctggcc ttcacgacca cactcaacta ctgcgtatgg cgggacaacc atggctggcg tgggggacgg cggctgccag agtgagtgcc cggcccaccagggactgcag ctgcaccagc aggtgccatc acgcttgtga tgtggtggcc gtcacgcttt catgaccact gggcctgcta gtctgtcagg gccttggccc aggggtcagc agagcttcag aggtggcccc acctgagccc ccacccggga gcagtgtcct gtgctttctg catgcttaga gcatgttctt ggaacatgga attttataag ctgaataaag tttttgactt ccttta
[0323] REFERENCES
[0324] 1. Barron, A. M., et al., Ligand for translocator protein reverses pathology in a mouse model of Alzheimer's disease. J Neurosci, 2013. 33(20): p. 8891-7.
[0325] 2. Fairley, L. H., et al., Neuroprotective effect of mitochondrial translocator protein ligand in a mouse model of tauopathy. J Neuroinflammation, 2021. 18(1): p. 76.
[0326] 3. Christensen, A. and C. J. Pike, TSPO ligand PK11195 improves Alzheimer-related outcomes in aged female 3xTg-AD mice. Neurosci Lett, 2018. 683: p. 7-12.
[0327] 4. Ma, L., et al., TSPO ligand PK11195 alleviates neuroinflammation and beta-amyloid generation induced by systemic LPS administration. Brain Res Bull, 2016. 121: p. 192-200.
[0328] 5. Pradhan et al, Chronic administration of XBD173 ameliorates cognitive deficits and neuropathology via 18 kDa translocator protein (TSPO) in a mouse model of Alzheimer's disease. Transl Psychiatry. 2023 Oct 27; 13( 1):332.
[0329] 6. Li F, Liu J, Liu N, Kuhn LA, Garavito RM, Ferguson-Miller S. Translocator Protein 18 kDa (TSPO): An Old Protein with New Functions? Biochemistry. 2016 May 24;55(20):2821-31.
[0330] 7. Bhoola NH, Mbita Z, Hull R, Dlamini Z. Translocator Protein (TSPO) as a Potential Biomarker in Human Cancers. Int J Mol Sci. 2018 Jul 25; 19(8):2176.
[0331] 8. Rupprecht R, Wetzel CH, Dorostkar M, Herms J, Albert NL, Schwarzbach J, Schumacher M, Neumann ID. Translocator protein ( 18kDa ) TSPO: a new diagnostic or therapeutic target for stress- related disorders? Mol Psychiatry. 2022 Ju l;27(7):2918-2926.
[0332] 9. Baglini E, Poggetti V, Cavallini C, Petroni D, Forini F, Nicolini G, Barresi E, Salerno S, Costa B, lozzo P, Neglia D, Menichetti L, Taliani S, Da Settimo F. Targeting the Translocator Protein (18 kDa) in Cardiac Diseases: State of the Art and Future Opportunities. J Med Chem. 2024 Jan 11;67(1): 17-37. 10. Morin D, Musman J, Pons S, Berdeaux A, Ghaleh B. Mitochondrial translocator protein (TSPO):
[0333] From physiology to cardioprotection. Biochem Pharmacol. 2016 Apr l;105:l-13.
[0334] 11. Li X, He Z, Shu X. Therapeutic potential of translocator protein ligands for age-related macular degeneration. Neural Regen Res. 2022 Apr;17(4):793-794.
[0335] 12. Owen DR, Phillips A, O'Connor D, Grey G, Aimola L, Nicholas R, Matthews PM. Human pharmacokinetics of XBD173 and etifoxine distinguish their potential for pharmacodynamic effects mediated by translocator protein. Br J Clin Pharmacol. 2022 Sep;88(9):4230-4236.13. Singleton, et al., DICTIONARY OF MICROBIOLOGY AND MOLECULAR BIOLOGY, 20 ED., John Wiley and Sons, New York (1994)
[0336] 14. Hale & Marham, THE HARPER COLLINS DICTIONARY OF BIOLOGY, Harper Perennial, NY (1991) 15. Lit et al., Salt Selection for Basic Drugs (1986), Int J. Pharm., 33, 201-217
[0337] 16. Rupprecht R, Rammes G, Eser D, Baghai TC, Schiile C, Nothdurfter C, Troxler T, Gentsch C, Kalkman HO, Chaperon F, Uzunov V, McAllister KH, Bertaina-Anglade V, La Rochelle CD, Tuerck D, Floesser A, Kiese B, Schumacher M, Landgraf R, Holsboer F, Kucher K. Translocator protein (18 kD) as target for anxiolytics without benzodiazepine-like side effects. Science. 2009 Jul 24;325(5939):490-3. doi: 10.1126 / science.1175055. PMID: 19541954.
[0338] EXAMPLES
[0339] The invention is now described with reference to the Examples below. These are not limiting on the scope of the invention, and a person skilled in the art would be appreciate that suitable equivalents could be used within the scope of the present invention. Thus, the Examples may be considered component parts of the invention, and the individual aspects described therein may be considered as disclosed independently, or in any combination.
[0340] Example 1 - Pharmacokinetic study of deuterated analogues of XBD173
[0341] From the structure of XBD173 alone, it is not possible to identify definitively the route of its metabolism in humans. Therefore, before stabilised XBD173 analogues can be designed and generated, it was first necessary for the inventors to understand how XBD173 is metabolised. As such, the inventors conducted an investigation to determine the metabolites of XBD173.
[0342] XBD173 was incubated with human liver microsomes for determination of metabolite profiles. Samples generated were analysed using accurate mass on a UHPLC-QToF system (Agilent 1290 UHPLC with Agilent 6550 QToF mass spectrometer - Column Aquity BEH C18, 1.7 pm, 50 mm x 2.1 mm at 50°C). Viability of incubations was demonstrated by incubation and analysis of positive control compounds.
[0343] XBD173 was incubated at 10 pM for 120 mins at 37°C in pooled male human liver microsomes, fortified with NADPH, with protein concentration of 1 mg / mL. Incubation of XBD173 in buffer served as control for any degradants formed by non-metabolic processes.
[0344] To demonstrate metabolic competency of the microsomes, verapamil was used as positive control. This was incubated at 1 pM, and samples taken at t = 0, 2, 5, 15, 30 and 60 min to allow intrinsic clearance to be determined.Reactions were terminated with acetonitrile containing internal standard (tolbutamide), and samples were stored at -80°C prior to analysis. Samples were thawed and mixed prior to LC-MS analysis.
[0345] Nine different metabolites were identified. These are shown listed in Table 4, with their structures shown in Figure 2.
[0346] Metabolite M2 was identified as the primary form of metabolite produced in this assay. Table 4: Identification of XBD173 from microsome experiments
[0347] Metabolite Biotransformation Nominal Microsomes: % area of parent mass
[0348] Ml XBD173-C7H6- 283 1.9
[0349] C2H4
[0350] M2 XBD173-C7H6311 18.6
[0351] M3 XBD173 -C3H6359 0.5
[0352] M4 XBD173 +0 417 0.0
[0353] M5 XBD173 +0 417 0.1
[0354] M6 XBD173-C7H6-CH2297 3.0
[0355] M7 XBD173 -C2H4373 1.5
[0356] M8 XBD173 +2O -2H 431 0.1
[0357] M9 XBD173 -CH2387 0.0
[0358] Parent XBD173 401 1.5
[0359]
[0360] Example 2 - Metabolic study of XBD173 in healthy male subjects
[0361] To confirm whether the results of Example 1 reflect the situation in vivo, it was necessary to determine whether M2 was also present in the plasma following administration of XBD173 to human patients.
[0362] Samples obtained from dosing XBD173 to healthy human subjects were reanalysed to investigate whether the metabolites observed in vitro in Example 1 were also formed in vivo.
[0363] Complete time courses from 5 subjects were analysed. To 50 pL aliquots of sample plasma was added 200 pL IS solution (500 ng / mL tolbutamide in acetonitrile). These samples were mixed (150 rpm, 15 minutes) and centrifuged (3000 rpm, 15 min). 50 pL of the resulting supernatant was added to 100 pL water, and samples were mixed (100 rpm, 15 min). Samples generated were analysed using accurate mass on a UHPLC-QToF system (Agilent 1290 UHPLC with Agilent 6550 QToF mass spectrometer - Column Aquity BEH Phenyl, 1.7 pm, 50 mm x 2.1 mm at 50°C).Chromatograms and mass spectra were inspected using Agilent Qualitative and Quantitative Analysis software to screen for a wide range of known biotransformations, plus other metabolites that might be expected to form based on the compound structure.
[0364] Peak areas for found metabolites were tabulated and AUC(0-3h), in MS response.hr units, was calculated for each metabolite in each subject.
[0365] These results demonstrated that M2 is present in the blood samples from these human male subjects, validating the results of Example 1.
[0366] Example 3a - Generation of deuterated XBD173 analogues
[0367] Having surprisingly demonstrated that XBD173 is metabolised to M2, the inventors determined that this metabolism occurs via amide N-dealkylation. Amide N-dealkylation is potentially sensitive to deuteration. Therefore, several deuterated analogues of XBD173 were designed and generated.
[0368] Deuterated analogues of XBD173 were synthesised using standard synthetic methods and readily available starting materials. The following chemical schemes summarise the synthesis strategy employed for exemplary deuterated analogues of XBD173. Each deuterated analogues was ultimately purified by reverse phase chromatography and analysed by MS and
[0369]
[0370] 1H NMR.
[0371] Intermediary A (INT A)
[0372] Intermediate A was used for the synthesis of all exemplified deuterated XBD173 analogues, and in particular compounds 16 and 26. The synthesis of INT A is summarised in Scheme 1 below.
[0373] Scheme 1
[0374] Glycine POCI3NEt390°C EtOH
[0375] 75°C
[0376]
[0377] Intermediary B (INT B)
[0378] Intermediate B was used for the synthesis of compounds 3, 4 and 6. INT B is obtained from INT A as summarised in Scheme 2 below.
[0379] Scheme 2BnNH2
[0380] BOP NEt31M NaOH
[0381] DMF EtOH
[0382] RT 80°C
[0383] DPPA NEt3
[0384] DMF
[0385] 100°C
[0386]
[0387] Compound 3
[0388] Compound 3 was synthesised following the method exemplified in Scheme 3 below. Once purified (34mg, purity >95%) it was characterised. [Cpd3+H] m / z= 404.2.1H NMR (400 MHz, Chloroform-d) δ 8.40 – 8.33 (m, 2H), 8.25 (d, J= 15.3 Hz, 1H), 7.51 – 7.36 (m, 6H), 7.27 (s, 2H), 4.88 (d, J= 25.0 Hz, 2H), 3.57 – 3.42 (m, 5H), 1.25 (dt, J= 82.3, 7.2 Hz, 3H).
[0389]
[0390] Compound 4
[0391] Compound 4 was synthesised following the method exemplified in Scheme 4 below. Once purified (24mg, purity >95%) it was characterised. [Cpd4+H] m / z= 405.3.1H NMR (400 MHz, Chloroform-d) δ 8.39 – 8.34 (m, 2H), 8.25 (d, J= 15.4 Hz, 1H), 7.50 – 7.35 (m, 6H), 7.27 (s, 2H), 4.88 (d, J= 25.6 Hz, 2H), 4.65 (d, J= 17.9 Hz, 2H), 3.51 – 3.42 (m, 2H), 1.25 (dt, J= 82.1, 7.1 Hz, 3H).
[0392] Scheme 4
[0393]
[0394] Compound 6
[0395] Compound 6 was synthesised following the method exemplified in Scheme 5 below. Once purified (33mg, purity >95%) it was characterised. [Cpd6+H] m / z= 407.2.1H NMR (400 MHz, Chloroform-d) δ 8.36 (dd, J= 7.4, 2.3 Hz, 2H), 8.25 (d, J= 15.4 Hz, 1H), 7.53 – 7.34 (m, 6H), 7.27 (d, J= 3.1 Hz, 2H), 4.88 (d, J= 23.8 Hz, 2H), 4.65 (d, J= 17.7 Hz, 2H), 3.51 (d, J= 13.1 Hz, 3H).
[0396] Scheme 5
[0397]
[0398] Compound 16
[0399] Compound 16 was synthesised following the method exemplified in Scheme 6 below. Once purified (24mg, purity >95%) it was characterised. [Cpd16+H] m / z= 409.4.1H NMR (400 MHz, Chloroform-d) δ 8.56 (d, J= 9.4 Hz, 1H), 8.37 – 8.29 (m, 2H), 7.56 – 7.38 (m, 5H), 7.24 (s, 3H), 4.95 (s, 1H), 4.85 (s, 1H), 3.45 (d, J= 7.7 Hz, 3H).
[0400] Scheme 6
[0401]
[0402] Compound 26
[0403] Compound 26 was synthesised following the method exemplified in Scheme 7 below. Once purified (24mg, purity >95%) it was characterised. [Cpd26+H] m / z= 412.4.1H NMR (400 MHz, Chloroform-d) δ 8.56 (d, J= 9.4 Hz, 1H), 8.38 – 8.29 (m, 2H), 7.57 – 7.37 (m, 6H), 7.24 (s, 2H), 4.95 (s, 1H), 4.85 (s, 1H).
[0404] Scheme 7
[0405]
[0406] Example 3b - Generation of deuterated XBD173 analogues
[0407] Deuterated analogues of XBD173 were synthesised using standard synthetic methods and readily available starting materials. The following chemical schemes summarise the synthesis strategy employed for exemplary deuterated analogues of XBD173. Each deuterated analogues was ultimately purified by reverse phase chromatography and analysed by MS andJH1H NMR.
[0408] Compound 10
[0409] Compound 10 was synthesised following the method exemplified in Scheme 8 below. Once purified (purity >95%) it was characterised. [Cpd10+H] m / z= 406.3.1H NMR (400 MHz, Chloroform-d) δ 8.56 (d, J= 9.4 Hz, 1H), 8.39 – 8.27 (m, 2H), 7.56 – 7.37 (m, 5H), 7.24 (d, J=2.4 Hz, 3H), 4.95 (s, 1H), 4.85 (s, 1H), 3.46 (s, 3H), 1.12 (d, J=93 Hz, 3H).
[0410] Scheme 8D D
[0411] 1M NaOH BOP, Et3N DMF EtOH RT, 1.5 h 80 °C, 1.5 h
[0412] DPPA NEt3DMF
[0413] 100 °C, 1.5 h
[0414]
[0415] Compound 7
[0416] Compound 7 was synthesised following the method exemplified in Scheme 9 below. Once purified (purity >95%) it was characterised. [Cpd7+H] m / z= 407.3.1H NMR (500 MHz, Chloroform-d) δ 8.56 (d, J= 11.6 Hz, 1H), 8.38 – 8.29 (m, 2H), 7.56 – 7.38 (m, 5H), 7.24 (d, J=3.4 Hz, 3H), 4.96 (s, 1H), 4.86 (s, 1H), 3.52-3.42 (m, 4H), 3.29 (s, 1H).
[0417] Scheme 9
[0418]
[0419] Compound 144
[0420] Compound 144 was synthesised following the method exemplified in Scheme 10 below. Once purified (purity >95%) it was characterised. [Cpd144+H] m / z= 408.5.1H NMR (400 MHz, Chloroform-d) δ 8.56 (d, J= 9.4 Hz, 1H), 8.39 – 8.28 (m, 2H), 7.56 – 7.45 (m, 4H), 7.45 – 7.38 (m, 1H), 7.24 (s, 3H), 4.90 (d, J=40.0 Hz, 2H), 4.64 (d, J=94.7 Hz, 1H), 3.45 (d, J=7.7 Hz, 3H).
[0421] Scheme 10
[0422]
[0423] Compound 152
[0424] Compound 152 was synthesised following the method exemplified in Scheme 11 below. Once purified (purity >95%) it was characterised. [Cpd152+H] m / z= 408.3.1H NMR (400 MHz, Chloroform-d) δ 8.56 (d, J= 9.4 Hz, 1H), 8.39 – 8.29 (m, 2H), 7.56 – 7.45 (m, 4H), 7.45 – 7.38 (m, 1H), 7.24 (s, 3H), 4.90 (d, J=40.1 Hz, 2H), 4.64 (d, J=94.8 Hz, 1H), 3.45 (d, J=7.6 Hz, 3H).
[0425] Scheme 11
[0426]
[0427] Compound 40
[0428] Compound 40 was synthesised following the method exemplified in Scheme 12 below. Once purified (31 mg, purity >95%) it was characterised. [Cpd40+H] m / z= 403.3.1H NMR (400 MHz, Chloroform-d) δ 8.57 (m, 1H), 8.42 – 8.24 (m, 2H), 7.60 – 7.35 (m, 5H), 7.29 – 7.19 (m, 3H), 4.96 (s, 2H), 4.52 (s, 1H), 3.51 (q, J= 7.0 Hz, 1H), 3.46 (s, 3H), 3.29 (m, 1H), 1.02 (t, J=7.0 Hz, 3H).
[0429] Scheme 12
[0430]
[0431] Compound 48
[0432] Compound 48 was synthesised following the method exemplified in Scheme 13 below. Once purified (23 mg, purity >95%) it was characterised. [Cpd48+H] m / z= 403.4.1H NMR (400 MHz, Chloroform-d) δ 8.40 – 8.33 (m, 2H), 8.28 (s, 1H), 7.53 – 7.26 (m, 8H), 4.92 (s, 2H), 4.63 (s, 1H), 3.53 (s, 3H), 3.49 – 3.40 (m, 2H), 1.35 (t, J=7.1 Hz, 2H).
[0433]
[0434] Compound 72
[0435] Compound 72 was synthesised following the method exemplified in Scheme 14 below. Once purified (60 mg, purity >95%) it was characterised. [Cpd72+H] m / z= 405.2.1H NMR (500 MHz, Chloroform-d) δ 8.57 (s, 1H), 8.36 – 8.31 (m, 2H), 7.54 – 7.39 (m, 6H), 7.25 – 7.22 (m, 2H), 4.96 (s, 2H), 4.52 (s, 1H), 3.46 (s, 3H), 1.23 (s, 3H).
[0436] Scheme 14
[0437]
[0438] Compound 64
[0439] Compound 64 was synthesised following the method exemplified in Scheme 15 below. Once purified (27 mg, purity >95%) it was characterised. [Cpd64+H] m / z= 405.3.1H NMR (400 MHz,Chloroform-d) δ 8.57 (m, 1H), 8.40 – 8.27 (m, 2H), 7.59 – 7.35 (m, 5H), 7.29 – 7.19 (m, 3H), 4.96 (s, 2H), 4.62 (s, 1H), 3.47 (s, 3H), 1.24 (s, 3H).
[0440] Scheme 15
[0441]
[0442] Example 4 - Determining the stability of deuterated XBD173 analogues
[0443] The deuterated analogues of XBD173 produced in Example 3 were then subjected to analysis using microsomes in a modified protocol as described in Example 1.
[0444] XBD173 analogues and XBD173 were incubated with human liver microsomes for determination of metabolic stability. Samples generated were analysed using accurate mass on a UHPLC-QToF system (Agilent 1290 UHPLC with Agilent 6550 QToF mass spectrometer - Column Aquity BEH C18, 1.7 pm, 50 mm x 2.1 mm at 50°C). Viability of incubations was demonstrated by incubation and analysis of positive control compounds.
[0445] XBD173 analogues and XBD173 were incubated at 1 pM for 120 mins at 37°C in pooled male human liver microsomes, fortified with NADPH, with protein concentration of 1 mg / mL. Incubation of XBD173 in buffer served as control for any degradants formed by non-metabolic processes. Reactions were terminated with acetonitrile containing internal standard (tolbutamide) at t=0 min, t=2 min, t=5 min, t=10 min, t=15 min and t=30 min. Samples were stored at -80°C prior to analysis.
[0446] To demonstrate metabolic competency of the microsomes, verapamil was used as positive control. This was incubated at 1 pM, and samples taken at t = 0, 2, 5, 15, 30 and 60 min to allow intrinsic clearance to be determined.
[0447] The results illustrated in Figure 3 show that compounds 6, 16 and 26 have increased metabolic stability (higher half-life) in the presence of human microsomes compared with non-deuterated XBD173. The results are summarised in Table 5 below, half-life values were adjusted to the control Verapamil experiment. The predicted clearance was calculated using a known prediction model in the art using liver blood flow of 21 mL / min / kg, liver weight of 25 g / kg, microsomal protein of 40 mg / kg of liver, fraction unbound value characteristic for XBD173 and microsomal intrinsic clearance calculated from the experiment of Example 4.
[0448] Table 5 - Metabolic degradation of compounds of the invention in human microsome assayMicrosome half-life Predicted clearance Compound
[0449] (min) (mL / min / kg)
[0450] Verapamil 6.62 NA
[0451] XBD173 2.92 2.94
[0452] Compound 3 3.10 2.79
[0453] Compound 4 2.96 2.90
[0454] Compound 6 3.84 2.31
[0455] Compound 16 6.60 1.41
[0456] Compound 26 6.33 1.46
[0457]
[0458] Example 5 - XBD173 can improve vascular function in a murine model of Alzheimer's disease A cohort study was conducted in AppNL-G-F mice, testing XBD173 3 mg / kg against vehicle. Cranial window implantation was conducted as in previous work (N. Doostdar et al., Multi-scale network imaging in a mouse model of amyloidosis. Cell Calcium 95, 102365 (2021)). Briefly, a craniotomy was made over the visual cortex and a glass cover slip implanted and held in place using dental cement. Animals were allowed to recover for two weeks ahead of imaging. Following recovery from surgery, animals were injected with a fluorescent dextran via the tail vein on the day of imaging and then underwent isoflurane anaesthesia to facilitate two photon imaging of cortical microvasculature in superficial layers of the visual cortex. Animals are longitudinally imaged in light and dark conditions under isoflurane for a maximum of one hour on four imaging sessions separated by one week, over which time XBD173 dosing is continuous. Vascular pulsation in during both resting state activity and in response to visual stimulation were measured. These results show that continuous XBD173 treatment rescues the reduced vascular pulsation (termed elasticity) seen in AppNL-G-F mice in response to visual stimulation back to control wild-type levels (Figure 4). These data suggest that XBD173 (and deuterated analogues with increased half-life but having the same functional properties) have therapeutic potential in the treatment of Alzheimer's disease.
[0459] Example 6 - XBD173 can improve glucose tolerance in health human subjects
[0460] Healthy volunteers were recruited and an oral glucose tolerance test (OGTT) was performed, which involved oral administration of 75 g glucose solution. A venous cannula was placed and blood was drawn before administration of this solution, and 30, 60, 90, 120, 150 and 180 mins afterwards. The samples were analysed for glucose concentration. The participants were then dosed orally with 90 mg XBD173 every day for 7 days. They returned on day 7 after their final dose, and the OGTT was repeated. The rise in glucose following oral administration of 75 g glucose solution on the initial visit(study visit 1) was compared to that on the visit that followed 7 days of XBD173 (study visit 2). The results show that XBD173 reduces the peak following glucose administration (which occurs orally at t=0) (Figure 5) and reduces the area under the plasma glucose / time curve. These results indicate that XBD173 (and deuterated analogues with increased half-life but having the same functional properties) have therapeutic potential in the treatment of diabetes (type 1 and / or type 2) and metabolic disorders.
[0461] Example 7 - Determining the stability of further deuterated XBD173 analogues
[0462] The deuterated analogues of XBD173 were subjected to analysis using microsomes in a modified protocol as described in Example 4.
[0463] XBD173 analogues and XBD173 were incubated with human liver microsomes for determination of metabolic stability. Samples generated were analysed using accurate mass on a UHPLC-QToF system (Agilent 1290 UHPLC with Agilent 6550 QToF mass spectrometer - Column Aquity BEH C18, 1.7 pm, 50 mm x 2.1 mm at 50°C). Viability of incubations was demonstrated by incubation and analysis of positive control compounds.
[0464] XBD173 analogues and XBD173 were incubated at 1 pM for 120 mins at 37°C in pooled male human liver microsomes, fortified with NADPH, with protein concentration of 1 mg / mL. Incubation of XBD173 in buffer served as control for any degradants formed by non-metabolic processes. Reactions were terminated with acetonitrile containing internal standard (tolbutamide) at t=0 min, t=2 min, t=4 min, t=8 min, t=15 min, t=30 min and t=60 min. Samples were stored at -80°C prior to analysis.
[0465] To demonstrate metabolic competency of the microsomes, verapamil was used as positive control. This was incubated at 1 pM, and samples taken at t = 0, 2, 4, 8, 15, 30 and 60 min to allow intrinsic clearance to be determined.
[0466] The results illustrated in Table 6 below show that compounds 16, 26, 152, 144 and 10 have increased metabolic stability (higher half-life) in the presence of human microsomes compared with non-deuterated XBD173. Interestingly it shows that compound 7 has the same metabolic stability as non-deuterated XBD173, indicating that the deuteration at CR'2position is important for increased metabolic stability. Looking at the difference in metabolic stability between compounds 144 and 152, it appears that mono-deuteration at the CR"2site in (R) configuration further enhances metabolic stability.
[0467] The predicted clearance was calculated using a known prediction model in the art using liver blood flow of 21 mL / min / kg, liver weight of 25 g / kg, microsomal protein of 40 mg / kg of liver, fraction unbound value characteristic for XBD173 and microsomal intrinsic clearance calculated from the experiment of Example 7.Table 6 - Metabolic degradation of compounds of the invention in human microsome assay Microsome half-life Predicted clearance
[0468] Compound
[0469] (min) (mL / min / kg)
[0470] Verapamil 6.56 NA
[0471] XBD173 3.29 2.63
[0472] Compound 72 4.08 2.19
[0473] Compound 64 4.50 2.00
[0474] Compound 40 3.28 2.65
[0475] Compound 48 3.92 2.27
[0476] Compound 16 5.29 1.73
[0477] Compound 26 5.42 1.69
[0478] Compound 152 4.52 2.00
[0479] Compound 144 4.88 1.86
[0480] Compound 7 3.66 2.41
[0481] Compound 10 4.98 1.83
[0482]
[0483] Example 8 - Determining the stability of compound 16 in mouse microsomes
[0484] Compound 16 was selected as an exemplary compound for further analysis. Compound 16 and XBD173 were prepared in PBS from an original DMSO solution so that the final incubation concentration was 1 pM. Buffer containing the compound was added followed by microsomes (0.5 mg / mL microsome protein concentration) and NADPH. The reaction was incubated at 37°C typically for up to 60 minutes. Acetonitrile with internal standard was added to stop the incubation at 0, 2, 5, 10, 30, 60 and 120 mins. The samples (n=3 for each compound) were centrifuged, and the supernatant was then analysed by UHPLC-TOF MS for parent compound.
[0485] To demonstrate metabolic competency of the microsomes, verapamil was used as positive control. This was incubated at 1 pM, and samples taken at 0, 2, 5, 10, 30, 60 and 120 mins to allow intrinsic clearance to be determined.
[0486] The results are shown in Figure 6 and Table 7 below and confirm that compound 16 has an increased metabolic stability (higher half-life) in the presence of mouse microsomes compared with non-deuterated XBD173. This shows that metabolic stability observed in human microsomes can be translated to metabolic stability observed in mouse microsomes and vice-versa for XBD173 and deuterated analogues.
[0487] Table 7 - Metabolic degradation of compound 16 of the invention in mouse microsome assayMicrosome half-life Intrinsic clearance Compound
[0488] (min) (pL / min / mg)
[0489] Verapamil 5.33 260
[0490] XBD173 2.44 568
[0491] Compound 16 3.54 392
[0492]
[0493] Example 9 - In-vivo pharmacokinetic study of compound 16 in C57 black mouse
[0494] To assess the translation of the increased metabolic stability conferred to the deuterated analogues of XBD173, compound 16 alongside non-deuterated XBD173 were investigated in male C57 black mouse (n=4for each compound per time point) at 2 mg / kg oral dose (formulated with Tragacanth gum + DMSO in chocolate spread). Samples of tail blood were collected at 0.5h, lh, 1.5h, 2h and 4h. Plasma was extracted, and protein content was precipitated with acetonitrile. The clear supernatant was then analysed by UHPLC – tandem mass spectrometry using electrospray ionisation, to assess the amount of intact compound still present in the rodent circulation. The results are presented below in Table 8.
[0495] Compound 16 exhibits a consistent increase in half-life compared with non-deuterated XBD173 as observed in vitro in mouse microsomes (Example 8) and in human microsomes (Example 7).
[0496] Table 8 - Metabolic degradation of compound 16 of the invention in mouse microsome assay Compound Half-life (h) Tmax(h)
[0497] XBD173 1.3 1.1
[0498] Compound 16 2.0 1.6
[0499]
[0500] Example 10 - Inhibition of TSPO with deuterated analogues of XBD173
[0501] Human Parietal Cortex tissue was added to ice-cold lysis buffer (50 mM Tris-HCI; 5 mM MgCI2; 5 mM EDTA; protease inhibitor cocktail) and homogenised. The homogenate was centrifuged at 100 x g for 2 minutes and the supernatant divided. The supernatants were centrifuged at 17,000 x g for 10 minutes at 4 °C to re-pellet the cell lysate. The pellet was resuspended in fresh wash buffer (50 mM Tris-HCI; 5 mM MgCI2; 5 mM EDTA) and centrifuged again at 17,000 x g for 10 minutes. The pellet was then resuspended in wash buffer containing 10% sucrose as a cryoprotectant, divided into aliquots (0.4 mL) and stored at -80 °C. A sample of the homogenate was analysed for protein content. On the day of the assay, the membrane preparation was thawed and the pellet resuspended in final assay buffer.Radioligands PK11195, [N-Methyl-3H] 71.7 Ci / mmol Non-Specific Compound PK11195
[0502] Compounds 7, 10, 16, 26, 40, 48, 72, 144, 152 and non-deuterated XBD173 were dissolved in DMSO (5 or 10 mM stocks). For compound screen competition assays, compounds were diluted in DMSO to 100 x final maximal assay concentration (10 nM).
[0503] Assay Incubation Buffer 50 mM Tris; 5 mM MgCI2; 0.1 mM EDTA (pH 7.4) Assay Wash Buffer 50 mM Tris; 5 mM MgCI2; 0.1 mM EDTA (pH 7.4) Competition binding assays were carried out in 96-well plates in a final volume of 250 pL per well. To each well was added 197.5 pL homogenates, 2.5 pL test or non-specific compound in DMSO (or DMSO alone) and 50 pL radioligand in buffer. The plate was incubated at 30 °C for 90 minutes with gentle agitation. The incubation was stopped by vacuum filtration onto presoaked (assay incubation buffer + 0.1% PEI) GF / C filters, followed by five washes with ice-cold wash buffer. Filters were then dried under a warm air stream, sealed in polyethylene, scintillation cocktail added, and the radioactivity measured.
[0504] In all assays, non-specific binding was subtracted from total binding to give specific binding. Data were fitted using the non-linear curve fitting. Bottom-of-curve was constrained to zero.
[0505] Table 9 - IC50data for deuterated analogues of XBD173 and XBD173 Compound IC50(nM)
[0506] Compound 16 4.06
[0507] Compound 26 0.80
[0508] Compound 144 1.30
[0509] Compound 152 1.33
[0510] Compound 7 1.71
[0511] Compound 10 0.60
[0512] Compound 72 0.44
[0513] Compound 48 0.81
[0514] Compound 40 0.54
[0515]
[0516] XBD173 0.23
[0517] Example 11 - Determining the CYP3A4-mediated metabolic stability of deuterated analogues of XBD173
[0518] Test compounds 7, 10, 16, 26, 40, 48, 72, 144, 152 and non-deuterated XBD173 were prepared in PBS to a final incubation concentration was 1 pM. Compounds were then added to the wells followed by CYP3A4 isoform (50 pmol / ml final concentration) and NADPH (2 mM final concentration). The reaction was incubated at 37°C typically for up to 60 minutes. Acetonitrile with internal standardwas added to stop the incubation in samples taken from the well at 0, 2, 5 and 10 min. The samples were centrifuged, and the supernatant was then analysed by UHPLC-TOF MS for parent compound. Half-life for each compound was then calculated. Compounds 10, 6, 72, 144 and 152 show a particular increase in CYP3A4-mediated metabolic stability compared to XBD173.
[0519] Table 10 - CYP3A4-mediated metabolic degradation of deuterated analogues of XBD173 Compound Half-life (min) Fold change compared to XBD173 XBD173 2.22 1.00
[0520] Compound 16 2.45 1.10
[0521] Compound 26 2.84 1.28
[0522] Compound 152 2.72 1.22
[0523] Compound 144 2.88 1.30
[0524] Compound 7 2.60 1.17
[0525] Compound 10 3.40 1.53
[0526] Compound 72 2.97 1.34
[0527] Compound 64 2.29 1.03
[0528] Compound 48 2.36 1.06
[0529]
[0530] Compound 40 2.13 0.96
Claims
CLAIMS1. A compound according to Formula (I)wherein:R, R', R", R'" and R"" are independently selected from hydrogen and deuterium; Ra, Rband Rcare independently selected from hydrogen and deuterium; and at least one of R, R', R", R'", R"", Ra, Rband Rcis deuterium;or a pharmaceutically acceptable salt thereof.
2. The compound according to claim 1, wherein -CR"2- is -CDH- and / or -CR'2- is -CDH-.
3. The compound according to claim 2, wherein:a. -CR"2- is -CDH- and R' is deuterium; orb. -CR'2- is -CDH- and R" is deuterium.
4. The compound according to any one of claims 1 to 3, wherein -CR"2- is -CDH- in (R) configuration and / or -CR'2- is -CDH- in (R) configuration.
5. The compound according to any one of claims 1 to 4, wherein -CR"2- is -CDH- in (S) configuration and / or -CR'2- is -CDH- in (S) configuration.
6. The compound according to any one of the preceding claims, wherein R is deuterium.
7. The compound according to claim 1, wherein R, R' or R" is deuterium.
8. The compound according to claim 7, wherein R and R' are deuterium.
9. The compound according to claim 7 or 8, wherein R, R' and R" are deuterium.
10. The compound according to any one of the preceding claims, wherein R'" is deuterium.
11. The compound according to any one of claims 1 and 7 to 10, wherein R, R', R" and R'" are deuterium.
12. The compound according to claim 1, wherein the compound is selected from the group comprising compounds 3, 4, 6, 7, 10, 16, 26, 40, 48, 64, 72, 88, 96, 104, 144, 152, 200, 208 and 216, optionally the compound is selected from compounds 10, 16, 26, 64, 72, 144 and 152.
13. The compound according to any one of the preceding claims, wherein the metabolic degradation of the compound is reduced by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, or at least about 45%, compared to a compound of Formula (I) wherein R, R', R", R'", R"", Ra, Rband Rcare hydrogens (XBD173).
14. The compound according to any one of claims 11 to 13, wherein the metabolic degradation of the compound is reduced by at least about 30% compared to a compound of Formula (I) wherein R, R', R", R'", R"", Ra, Rband Rcare hydrogens (XBD173).
15. The compound according to any one of claims 11 to 14, wherein the metabolic degradation of the compound is reduced by at least about 40%, optionally by at least about 45% compared to a compound of Formula (I) wherein R, R', R", R'", R"", Ra, Rband Rcare hydrogens (XBD173).
16. A pharmaceutical composition comprising a compound according to any one of the preceding claims and at least one pharmaceutically acceptable carrier, optionally the composition is a solid composition or a liquid composition.
17. A compound according to any one of claims 1 to 15, or a pharmaceutical composition according to claim 16 for use in a method of treatment in a patient in need thereof.
18. A compound according to any one of claims 1 to 15, or a pharmaceutical composition according to claim 16 for use in a method of treatment or prevention of endothelial cell dysfunction.
19. A compound or pharmaceutical composition for use according to claim 17 or 18, wherein the condition to be treated is selected from Alzheimer's disease (AD), cerebral Small Vessel Disease (cSVD), pulmonary hypertension, heart failure, stress-related disorders such as panic disorders and anxiety, depression, age-related macular degeneration (AMD) or metabolic diseases such as diabetes type 1 and / or type 2.
20. A compound or pharmaceutical composition for use according to any one of claims 17 to 19, wherein the condition to be treated is Alzheimer's disease (AD).
21. A compound or pharmaceutical composition for use according to any one of claims 17 to 19, wherein the condition to be treated is pulmonary hypertension, preferably pulmonary arterial hypertension (PAH), optionally idiopathic pulmonary arterial hypertension (IPAH).
22. A compound or pharmaceutical composition for use according to any one of claims 17 to 19, wherein the condition to be treated is heart failure, optionally heart failure with preserved ejection fraction and associated pulmonary hypertension (PH-HFpEF).
23. A compound or pharmaceutical composition for use according to any one of claims 17 to 22, wherein the patient is a mammal, preferably wherein the patient is a human.
24. A compound or pharmaceutical composition for use according to any one of claims 17 to 23, wherein the patient is a rapid-metaboliser.
25. A compound or pharmaceutical composition for use according to any one of claims 17 to 24, wherein a therapeutically effective amount of the compound is from about 0.1 mg / kg to 20 mg / kg.
26. A compound or pharmaceutical composition for use according to any one of claims 17 to 25, wherein the patient is administered the compound or pharmaceutical composition at least once daily, preferably once or twice daily, more preferably once daily.
27. A compound or pharmaceutical composition for use according to any one of claims 17 to 26, wherein the compound or composition is for oral, buccal, nasal, rectal, transdermal, intravenous, intramuscular or ocular administration to the patient, preferably the compound or composition is for oral administration to the patient.
28. A method of treatment comprising the step of administering a therapeutically effective amount of a compound according to any one of claims 1 to 15, or a pharmaceutical composition according to claim 10 to a subject in need thereof.
29. Use of a compound according to any one of claims 1 to 15 in the manufacture of a medicament.
30. A compound according to any of one claims 1 to 15 or XBD173 for use in the treatment of a disorder associated with a vascular component.
31. A pharmaceutical composition comprising a compound according to any one of claims 1 to 15 and / or XBD173 for use in the treatment of a disorder associated with a vascular component.