Use of angiotensin-(1-9) for treating glucose intolerance, insulin resistance,type 2 diabetes and diabetic cardiomyopathy

Abstract

The present invention relates to the use of angiotensin-(1-9) to prepare pharmaceutical compositions and methods for treating metabolic diseases such as glucose intolerance, insulin resistance, type 2 diabetes and diabetic cardiomyopathy. These therapies and methods reverse diabetic cardiomyopathy, improve glucose homeostasis, and increase insulin sensitivity in obesity, glucose intolerance, and type 2 diabetes.

Description

USE OF ANGIOTENSIN-(1-9) FOR TREATING GLUCOSE INTOLERANCE, INSULIN RESISTANCE,TYPE 2 DIABETES AND DIABETIC CARDIOMYOPATHY

[0001] The present invention is in the field of the renin-angiotensin system, in particular, the angiotensin-(1-9) peptide. The present invention provides angiotensin-(1-9) pharmaceutical compositions and methods to use the same for the treatment of glucose intolerance, insulin resistance, type 2 diabetes diabetic cardiomyopathy.

[0002] Angiotensins are peptides derived from angiotensinogen. Angiotensin-(1-9) has the following sequence Asp-Arg-Val-Tyr-Ile-His-Pro-Phe-His (SEQ ID 01).

[0003] Angiotensin-(1-9) (SEQ ID 01) is biosynthesized by the hydrolysis of the terminal amino acid leucine of angiotensin I by the analogous angiotensin-converting enzyme (ACE2) (Donoghue et al., J Mol Cell Cardiol. 35: 1043-53, 2003). Subsequently, angiotensin-(1-9) is degraded by the angiotensin converting enzyme (ACE1) to angiotensin-(1-7). Angiotensin-(1-9) has opposite actions to that of angiotensin II (Ocaranza et al, Nat Rev Cardiol. 17: 116-129, 2020).

[0004] Angiotensin-(1-9) decreases blood pressure and reduces cardiovascular damage in three experimental hypertensive models: angiotensin II infusion model with minipumps, Goldblatt 2K-1C model, and DOCA salt model. Chronic administration of angiotensin-(1-9) to hypertensive rats reduced systolic blood pressure and improved cardiac and endothelial function as well as cardiovascular remodeling and oxidative stress (Ocaranza et al., J Hypertens. 32: 771-83, 2014). Angiotensin-(1-9) also attenuates fibrosis in spontaneously hypertensive rats (Flores-Munoz et al., J Physiol. 589: 939-51, 2011). The administration of angiotensin-(1-9) by using mini osmotic pumps to infarcted rats by ligation of the left coronary artery prevented cardiac hypertrophy, evaluated by the decrease in the following markers: ANF (atrial natriuretic factor) mRNA levels, β-MHC (beta myosin heavy chain) protein levels and cardiomyocyte size (area and perimeter) (Ocaranza et al., J Hypertens. 28: 1054-64, 2010). This action is mediated by controlling the mitochondrial dynamics via miR-129-3p / PKIA pathway (Sotomayor-Flores et al., Cell Death Differ. 27: 2586-2604, 2020).In vitrostudies showed that angiotensin-(1-9) prevents the cardiac hypertrophic phenotype induced by different stimuli, such as the treatment with norepinephrine (NE), angiotensin II, and insulin-like growth factor 1 (IGF-1). In these studies, the effects of angiotensin-(1-9) were mediated by its union to the angiotensin type II receptor (AT2R) (Flores-Munoz et al., J Physiol. 589: 939-51, 2011; Ocaranza et al., J Hypertens. 28: 1054-64, 2010). Angiotensin-(1-9) also prevents vascular remodelling by decreasing vascular smooth muscle cell dedifferentiation through a FoxO1-dependent mechanism (Norambuena-Soto et al., Biochem Pharmacol. 180: 114190, 2020). Other studies indicate that angiotensin-(1-9) favors bradykinin binding to its B2 receptor probably due to conformational changes in the ACE-B2 receptor complex (Erdos et al., J Mol Cell Cardiol. 34: 1569-76, 2002). Part of the protective effects of angiotensin-(1-9) is due to the reduction of cardiovascular and renal inflammation (Gonzalez et al., Biochem Pharmacol. 156: 357-370, 2018).

[0005] We have previously filed two patent applications: CL2008003736 and CL2010000950. The patent application CL2008003736 corresponds to a pharmaceutical composition comprising an effective amount of angiotensin-(1-9) and at least one pharmaceutically acceptable carrier, excipient, stabilizer, diluent, and / or adjuvant. Furthermore, said invention describes the use of angiotensin-(1-9) pharmaceutical compositions useful for preventing, reversing, inhibiting, and / or reducing cardiovascular, pulmonary, cerebral, or renal remodeling. In addition, the application CL2008003736 also comprises a method to prevent, reverse, inhibit, and / or decrease cardiovascular, pulmonary, cerebral, or renal remodeling that consists in the elevation of angiotensin-(1-9) concentration in the blood and / or tissues by means of a pharmaceutical composition containing a vector that expresses ACE2, an enzyme responsible for the endogenous production of angiotensin-(1-9). These vectors correspond to adenoviruses, retroviruses, lentiviruses, or adeno-associated viruses that contain the ACE2 gene. The application CL2008003736 discloses the administration of angiotensin-(1-9) by oral, injectable, and continuous infusion using pumps. That patent application further provides a method to increase angiotensin-(1-9) levels in the body by treatment of patients with angiotensin-I converting enzyme inhibitors, with angiotensin II receptor antagonists (ARA II), with Rho kinase inhibitors, with L calcium channel blockers and / or with diuretics. Patent application CL2010000950 describes the use of angiotensin-(1-9) to control blood pressure and / or vasculature dilation and further discloses medical use of such peptide comprising by the administration of angiotensin-(1-9) for the treatment of hypertension, and as an agent to induce vasodilation.

[0006] Up to now, only two studies associate angiotensin-(1-9) with diabetes. In one of these studies, streptozotocin-induced type 1 diabetes, angiotensin-(1-9) decreased cardiac levels of angiotensin II, which was linked to reduced heart hypertrophy and fibrosis (Zheng et al. Biochem Pharmacol. 95: 38-45, 2015). The other study showed less angiotensin-(1-9) generation in the hearts of type 1 diabetic rats than healthy rats (Mahmood et al. Peptides. 23: 1171-1175, 2002). However, the relationship between angiotensin-(1-9), obesity, insulin sensitivity, glucose intolerance, and diabetic cardiomyopathy has not yet been described.

[0007] Several drugs are described to treat glucose intolerance, insulin resistance, and diabetes. Biguanides, like Metformin, are a cornerstone of type 2 diabetes treatment. Metformin reduces hepatic glucose output and enhances insulin sensitivity in hepatic and peripheral tissues. It does not directly stimulate insulin secretion but increases insulin action and insulin-mediated glucose utilization in peripheral tissues. Metformin also has an antilipolytic effect that lowers serum free fatty acid concentrations, reducing substrate availability for gluconeogenesis. Sulfonylureas, including glipizide, gliclazide, and glimepiride, stimulate insulin release from the insulin-secreting ß-cells located in the pancreas. They increase the responsiveness of β-cells to both glucose and non-glucose secretagogues, resulting in more insulin being released at all blood glucose concentrations. Meglitinides, such as repaglinide and nateglinide, are short-acting glucose-lowering drugs. They stimulate the release of insulin from the pancreatic beta cells through a different binding site on the “sulfonylurea receptor”. They are designed to achieve more physiologic insulin release and less risk for hypoglycemia. Thiazolidinediones, including rosiglitazone and pioglitazone, improve glycemia by reducing insulin resistance and preserving pancreatic beta-cell function. They act mainly by improving peripheral uptake and utilization of glucose in muscle and fat, thereby decreasing liver glucose production. These drugs activate one or more peroxisome proliferator-activated receptors (PPARs), which regulate gene expression in response to ligand binding (Lorenzati et al. Pharmaceuticals (Basel) 3:3005–3020, 2010). Recently, incretin mimetics (GLP-1 receptor agonists and DPP-4 inhibitors), amylin analogues, and sodium glucose co-transporter 2 antagonists / inhibitors have also been described (Radhi et al. Biomed Pharmacother 131:110718, 2020). All these drugs have different effects on obesity and adipose tissue content. For instance, sulfonylureas have been associated with weight gain, unless the diabetic diet and exercise program are followed. On the other hand, thiazolidinediones, due to their insulin-sensitizing effect, may positively impact adipose tissue, reducing inflammation and promoting lipid storage. On the other hand, these drugs have different effects on diabetic cardiomyopathy. Moreover, there are several negative opinions about the effectiveness of intensive glycemic control in the primary prevention of diabetic cardiomyopathy. In a meta-analysis in which intensive glycemic control was compared with conventional glycemic control, it was shown that intensive therapy did not reduce the risk of hospitalization due to heart failure. A meta-analysis of 13 studies in 34,533 diabetic patients showed that intensive glucose-lowering treatment did not reduce cardiovascular events, but instead increased the risk of developing heart failure by 47% (Nakamura et al. Int J Mol Sci. 23:3587, 2022). Particularly, Pioglitazone, a thiazolidinedione, increases the risk of developing heart failure and is not used in patients with heart failure. However, pioglitazone does not reduce cardiac function. DPP-4 inhibitors do not improve left ventricular diastolic function in patients with diabetes, and GLP-1 receptor agonists had little or no effect on hospitalizations for heart failure. However, metformin is thought to be safe in patients with diabetic cardiomyopathy, compared with insulin and sulfonylureas. In the EMPA-REG OUTCOME trial, empagliflozin, an SGLT2 inhibitor, suppressed heart failure hospitalization and heart failure death in patients with type 2 diabetes with a history of cardiovascular disease. However, the effects of SGLT2 on diabetic cardiomyopathy, a pathological condition that is different than heart failure, has not been described (Nakamura et al. Int J Mol Sci. 23:3587, 2022).

[0008] The present invention provides pharmaceutical compositions and methods utilizing angiotensin-(1-9) for the treatment of metabolic diseases, including glucose intolerance, insulin resistance, type 2 diabetes, and diabetic cardiomyopathy. These compositions and methods are effective in improving insulin sensitivity, reducing insulinemia and Homeostasis Model Assessment (HOMA) levels, and preventing insulin receptor desensitization in target tissues, such as the heart and skeletal muscle. Additionally, the invention addresses complications associated with diabetic cardiomyopathy by improving cardiac insulin sensitivity and reducing pathological conditions such as cardiac fibrosis, hypertrophy, and impairments in contractile function.

[0009] . Establishment of the HFD-fed mice model.(A) Body weight during 8 weeks of HFD or chow diet feeding. (B) Glucose levels were measured during the oral glucose tolerance test after 8 weeks of HFD or chow diet feeding. (C) Representative western blots after insulin pulse from heart tissue. (D) Quantification of C. (E) Experimental scheme of treatment and measurements. The data shown are individual values with means ± SEM. Two-way ANOVA was conducted, followed by Tukey’s multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different when compared to chow diet group.

[0010] . Angiotensin-(1-9) improves heart function in the diabetic cardiomyopathy HFD-induced mice model.(A) Representative echocardiography images are shown. (B) Cardiac function was measured by Ejection Fraction and Fractional Shortening. (C) Echocardiographic changes in HFD-fed mice treated with angiotensin-(1-9). Measurements for various parameters are labeled. LV mass cor: Left ventricle mass corrected; S: systole; D: diastole; LVID: Left ventricle internal diameter at end-systole or diastole; LVESV: Left ventricle at end-systole volume; LVEDV: Left ventricle at end-diastole volume; LVAWs: Left ventricle anterior wall thickness at systole; LVAWd: Left ventricle anterior wall thickness at diastole; LVPWs: Left ventricle posterior wall thickness at systole; LVPWd: Left ventricle posterior wall thickness at diastole. The data shown are individual values with means ± SEM. Two-way ANOVA was conducted, followed by Tukey’s multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different when compared to different groups.

[0011] . Angiotensin-(1-9) improves reverts cardiac remodeling in the diabetic cardiomyopathy HFD-induced mice model.(A) Representative images of WGA and Masson’s staining. (B) Quantification of cardiomyocyte cross-sectional area from WGA staining and fibrotic area from Masson’s staining. (C) Relative mRNA levels of pathological remodeling markers. The data shown are individual values with means ± SEM. Two-way ANOVA was conducted, followed by Tukey’s multiple comparison test. ***p<0.001, ****p<0.0001 significantly different when compared to different groups.

[0012] . Angiotensin-(1-9) reduces plasma insulin and reverts glucose intolerance in HFD-fed mice.(A) Body weight during 14 weeks of diet and treatment. (B) Glucose levels during oral Glucose tolerance test after 3 weeks of angiotensin-(1-9) treatment at a dose of 1200 ng / min / kg. (C) Area under the curve registered in (B) for each condition. (D) Glucose level after fasting for 6 h. (E) Plasma insulin level after fasting for 6 h. (F) Calculated HOMA-IR. The data shown are individual values with means ± SEM. Two-way ANOVA was conducted, followed by Tukey’s multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different when compared to different groups.

[0013] . Angiotensin-(1-9) does not change glucose tolerance in HFD-fed mice at a dose of 600 ng / min / kg.(A) Glucose levels were measured during oral glucose tolerance test after 3 weeks of Angiotensin-(1-9) treatment at a dose of 600ng / min / kg. (B) Area under the curve (AUC) registered in A for each condition. (C) Glucose level after fasting for 6 hours. The data shown are individual values with means ± SEM. Two-way ANOVA was conducted, followed by Tukey’s multiple comparison test. *p<0.05 and **p<0.01 were significantly different when compared to the chow diet group.

[0014] . Angiotensin-(1-9) improves insulin sensitivity in a tissue-dependent manner.Representative western blots of (A) Heart, (C) Liver, (E) eWAT (epididymal white adipose tissue), and (G) Skeletal muscle after insulin pulse. (B), (D), (F), and (H), Quantification of A, C, E, and G, respectively. The data shown are individual values with means ± SEM. Two-way ANOVA was conducted, followed by Tukey’s multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different when compared to different groups.

[0015] . Angiotensin-(1-9) prevents cardiomyocyte insulin desensitization.(A) Representative western blots of NRVM treated with a time course of angiotensin-(1-9) (100 µM). (B) Quantification of A. (C) Representative western blots of NRVM treated with insulin and angiotensin-(1-9) (100 µM) for 10 min. (D) Quantification of C. (E) Representative western blots of NRVM treated with HG+Palm (high glucose and palmitate) and angiotensin-(1-9) (100 µM) for 24 h. (F) Quantification of E. The data shown are individual values with means ± SEM. One-way and two-way ANOVA were conducted, followed by Tukey’s multiple comparison test. *p<0.05, **p<0.01, ***p<0.001, ****p<0.0001 significantly different when compared to chow diet group.Detailed Description of the Invention

[0016] In the present invention, we describe the use of angiotensin-(1-9) to prepare pharmaceutical compositions that are useful for the treatment of metabolic diseases. The metabolic diseases comprise glucose intolerance, insulin resistance, type 2 diabetes, and diabetic cardiomyopathy. These pharmaceutical compositions reverse diabetic cardiomyopathy, improve glucose homeostasis, and increase insulin sensitivity in obesity and type 2 diabetes. These pharmaceutical compositions also prevent insulin receptor desensitization. Therefore, the pharmaceutical compositions containing angiotensin-(1-9) can also be used to prevent the development of glucose intolerance, insulin resistance, type 2 diabetes, and diabetic cardiomyopathy.

[0017] The pharmaceutical compositions of the present invention comprise an effective amount of angiotensin-(1-9) and at least one pharmaceutically acceptable carrier, excipient, stabilizer, diluent, and / or adjuvant.

[0018] The peptides of the present invention can be prepared by conventional methods to synthesize peptides; more specifically, using the processes described in Schroder and Lubke, The Peptides, vol. 1, published by Academic Press, New York (1966), or Izumiya et al., Synthesis of Peptides, published by Maruzen Publishing Co., Ltd., (1975), which are incorporated herein by reference. For example, an azide process, an acid chloride process, an acid anhydride process, a mixed anhydride process, a DCC process, an active ester process (for example: p-nitrophenyl ester, N-hydroxysuccinimide or cyanomethyl ester), a carbodiimidazole process, an oxidative-reducing process or a DCC / additive process can be used. The above syntheses can be carried out in a solid phase and in a liquid phase.

[0019] The peptides of the present invention are prepared in a suitable manner according to the above-described processes, such as are typically employed in the synthesis of peptides, generally by a step-by-step process comprising condensing an amino acid to the terminal amino acid, one by one in sequence, or by coupling peptide fragments to the terminal amino acid (amino acids side groups that are not used in the coupling reaction should be protected to avoid coupling in the wrong location).

[0020] In case a solid phase synthesis is adopted, the C-terminal amino acid is attached to an insoluble support through its carboxyl group. The insoluble carrier is not particularly limited as long as it has a binding capacity to a reactive carboxyl group. Examples of such insoluble carriers include halomethyl resins, such as chloromethyl resin or bromomethyl resin; hydroxymethyl resins, phenol resins, tert-alkyloxycarbonylhydrazide resins and the like.

[0021] An amino acid protected by an amino group is linked in sequence through the condensation of its activated carboxyl group and the reactive amino group of the previously formed peptide or chain, to be synthesized step by step. After synthesizing the entire sequence, the peptide is separated from the insoluble carrier to produce the peptide. This solid phase approach is generally described by Merrifield et al. (J Am Chem Soc. 85: 2149-2156, 1963), which is incorporated herein by reference.

[0022] The peptide can be cleaved, and the protecting groups can be removed by stirring the insoluble support or resin in anhydrous liquid HF at about 0°C for about 20 to 90 minutes, preferably 60 minutes, or bubbling HBr continuously through 1 mg / 10 mL of suspension of the resin in TFA for 30 to 60 minutes at about room temperature, depending on the protective groups selected. Other methods of deprotection can also be used.

[0023] In the above process, it is preferred that the amino acids histidine, tyrosine, glutamic acid, lysine, serine, and aspartic acid are protected in the respective functional groups of the side chain. These functional groups in the side chain are protected by ordinary protective groups that are separated after completing the reaction. The functional groups that intervene in the reaction are generally activated.

[0024] This invention's peptides form salts with various inorganic or organic bases. Non-toxic, pharmaceutically acceptable salts are preferred, although other salts are also useful for isolating or purifying the product. Such pharmaceutically acceptable salts include metal salts, such as potassium, sodium, or lithium; alkaline earth metal salts, such as magnesium or calcium; and salts derived from amino acids, such as lysine or arginine. The salts are obtained by reacting the acid form of the peptide with an equivalent of the base that supplies the desired ion in a medium in which the salt precipitates or in an aqueous medium and then lyophilized.

[0025] Similarly, the peptides form salts with various inorganic and organic acids. Again, non-toxic, pharmaceutically acceptable salts are preferred, although other salts are also useful for isolating or purifying the product. Said pharmaceutically acceptable salts include those formed with sulfuric acid, hydrochloric acid, methanesulfonic acid, maleic acid, and the like. The salts are obtained by reacting the product with an equivalent amount of the acid in a medium in which the salt precipitates.

[0026] Pharmaceutical compositions containing the angiotensin-(1-9), according to the present invention, can be solid or liquid, including tablets, pills, powder, wafers, dragees, capsules, coated formulations, sustained release formulations, erodible formulations, implanted devices or components derived from said apparatuses, microsphere formulations, solutions, suspensions, elixirs, aerosols and the like, containing at least one excipient, carrier, diluent, stabilizer and / or pharmaceutically acceptable adjuvant. As used herein, pharmaceutically acceptable excipients, carriers, diluents, stabilizers, and / or adjuvants for the preparation of pharmaceutical compositions or medicaments of the invention are very well known in the state of the art. They can be solid, liquid, or mixtures of both. As used herein, the term “liquid carriers” refers to diluents and / or excipients, including water, saline, dextrose solution, and glycol solution, especially when the parenteral and / or injection route is used as the route of administration. As used herein, the term “carrier and / or diluent” can also be an oil, such as example, those derived from petroleum, oils of animal and / or vegetable origin, or synthetic oils. Examples of preferred oils in the invention include peanut oil, soybean oil, mineral oil, sesame oil, corn oil, and marigold oil, among others. As used herein, the term “excipients” refers to starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dehydrated skim milk, glycerol, propylene glycol, water, ethanol, among others. Other transporters, diluents, stabilizers, excipients, and / or adjuvants, which are not named here, are obvious to experts in the state of the art.

[0027] The pharmaceutical compositions may be in the form of a sterile injectable preparation, such as a sterile injectable aqueous or oleaginous suspension. This suspension can be formulated according to the known art using suitable dispersing, wetting, or suspending agents. The sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic and parenterally-acceptable diluent or solvent, for example, as a solution in 1,3-butanediol. Among the acceptable vehicles and solvents that may be employed are water, Ringer's solution, and isotonic sodium chloride solution. In addition, sterile fixed oils are conventionally employed as a solvent or suspending medium. For this purpose, any insipid, fixed oil may be employed, including mono or synthetic diglycerides. In addition, fatty acids such as oleic acid are used in the preparation of injectables.

[0028] The pharmaceutical compositions containing angiotensin-(1-9) can also be administered as suppositories for rectal administration of the drug. These compositions can be prepared by mixing the medicament with a suitable non-irritating excipient that is solid at normal temperatures but liquid at the rectal temperature and, therefore, will melt in the rectum to release the medicament. Such materials are cocoa butter and polyethylene glycols.

[0029] The pharmaceutical composition or medicament of the present invention may be subject to conventional pharmaceutical processes, such as sterilization. It may contain other conventional pharmaceutical additives such as preservatives, stabilizers, emulsifying agents, wetting agents, salts for adjusting osmotic pressure, buffers or buffers. To regulate the pH, among others. Transporters, stabilizers, diluents, excipients, and / or adjuvants and their formulations can be found in Martin, "Remington's Pharmaceutical Sciences" 15 Ed.; Mack Publishing Co., Easton (1975), see, for example, pages 1405-1412 and 1461-1487.

[0030] Pharmaceutical compositions containing angiotensin-(1-9) generally contain an effective amount of the active compound together with a suitable amount of one or more carriers, stabilizers, diluents, excipients, and / or adjuvants in such a manner as to make it possible to prepare the dose and form suitable for the proper administration of angiotensin-(1-9) to the patient. In the practice of the methods of treatment of the invention, the particular dosage of a pharmaceutical composition or medicament to be administered to the subject will depend on many variables, including the state of the disease, the severity of the disease, the administration scheme, the age, the physical characteristics of the subject, etc. Appropriate doses can be established using clinical approaches as understood by those in the field. The term “effective amount” refers to the dose and the period of time necessary to achieve the necessary therapeutic result, that is, to improve glucose homeostasis or increase insulin sensitivity. The effective amount may depend on many factors, such as the state of advance of the disease, age, sex, weight of the individual, the presence of other diseases, of the intake of other medications simultaneously, of race, among other things.

[0031] By the means of the present invention, chemically synthesized angiotensin-(1-9) is used.

[0032] In one embodiment, the present invention provides for the treatment of diabetic cardiomyopathy by simultaneously improving cardiac insulin sensitivity and enhancing cardiac function, such as the ejection fraction and fractional shortening. Additional embodiments address the reduction of pathological cardiac conditions, including cardiac fibrosis and hypertrophy, as part of the treatment of diabetic cardiomyopathy.

[0033] Diabetic cardiomyopathy is a clinical condition of ventricular dysfunction that develops in patients with type 2 diabetes. Through oxidative stress, chronic low-grade inflammation, and insulin resistance, type 2 diabetes triggers structural and functional alterations of the heart independent of hypertension or ischemic heart disease (Kenny & E.D. Abel. Circ Res. 124: 121-141, 2019).

[0034] Moreover, diabetic cardiomyopathy is a distinct form of heart disease that occurs in the context of diabetes, independent of other cardiovascular risk factors such as hypertension or coronary artery disease. Several markers can be used to assess the presence and severity of diabetic cardiomyopathy, including ejection fraction, fractional shortening, cardiac fibrosis, and cardiac hypertrophy. Ejection fraction (EF) is the percentage of blood pumped out of the ventricles with each heartbeat. It is commonly measured using echocardiography or cardiac magnetic resonance imaging (MRI). A reduced EF indicates systolic dysfunction, which is a hallmark of advanced diabetic cardiomyopathy. Diabetic patients often show a progressive decline in EF due to myocardial damage and impaired contractility. Fractional shortening (FS) measures the percentage change in the diameter of the left ventricle between diastole and systole. It is calculated as Fractional Shortening (%) = ((LVEDD - LVESD) / LVEDD) x 100, where LVEDD is left ventricular end-diastolic diameter, and LVESD is left ventricular end-systolic diameter. Reduced FS indicates impaired contractile function of the heart, similar to EF. It is a sensitive marker for detecting early systolic dysfunction in diabetic cardiomyopathy. Cardiac fibrosis is the excessive accumulation of extracellular matrix proteins in the myocardium, leading to stiffening and scarring of the heart tissue. Cardiac fibrosis can be assessed through histological analysis of heart tissue (e.g., Masson's trichrome staining), imaging techniques (e.g., cardiac MRI with late gadolinium enhancement), or biochemical markers (e.g., serum levels of collagen or tissue levels of collagen, connective tissue growth factor (CTGF), transforming growth factor β (TGF-β), α-smooth muscle actin (α-SMA) proteins and mRNAs, among others). Fibrosis is a key pathological feature of diabetic cardiomyopathy. It contributes to diastolic dysfunction, reduced compliance, and, eventually, systolic dysfunction. The extent of fibrosis correlates with the severity of myocardial impairment and heart failure risk. Cardiac hypertrophy is the enlargement of the heart muscle, particularly the left ventricle, due to increased workload or pathological stimuli. Cardiac hypertrophy can be measured using echocardiography (e.g., increased left ventricular mass index), MRI, histological analysis, or molecular markers. Some of the molecular markers used to evaluate cardiac and / or cardiomyocyte hypertrophy are protein and / or mRNA levels of atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), β-myosin heavy chain (β-MHC), α-skeletal actin (α-SKA), GATA4, calcineurin, regulator of calcineurin (Rcan), among others. In diabetes, cardiac hypertrophy often occurs as a compensatory mechanism in response to increased hemodynamic load and metabolic stress. It initially helps maintain cardiac output but eventually leads to maladaptive remodeling, diastolic dysfunction, and heart failure.

[0035] In another embodiment, the present invention discloses the use of angiotensin-(1-9) to prepare pharmaceutical compositions useful to treat glucose intolerance, insulin resistance, and type 2 diabetes. In particular embodiments, the treatment of glucose intolerance or insulin resistance involves the improvement of insulin sensitivity, which may be associated with a decrease in insulinemia or a reduction in the Homeostasis Model Assessment (HOMA) index.

[0036] Obesity, glucose intolerance, insulin resistance, type 2 diabetes, and diabetic cardiomyopathy are interrelated conditions that often coexist and influence each other, forming a complex web of metabolic and cardiovascular complications. Obesity is a condition characterized by excessive body fat accumulation that presents health risks caused by an imbalance between calorie intake and expenditure, influenced by genetic, environmental, and lifestyle factors. Obesity is a major risk factor for the development of glucose intolerance, insulin resistance, and type 2 diabetes.

[0037] Glucose intolerance refers to a state where the body has difficulty managing blood glucose levels. It encompasses conditions like impaired fasting glucose (IFG) and impaired glucose tolerance (IGT). IFG refers to elevated blood glucose levels after an overnight fast, but not high enough to be classified as diabetes. IFG is diagnosed if FPG is between 100-125 mg / dL. IGT refers to elevated blood glucose levels after a two-hour oral glucose tolerance test (OGTT), but not high enough to be classified as diabetes. IGT is diagnosed if the two-hour glucose level is between 140-199 mg / dL two hours after consuming a 75 g glucose drink. The primary cause of glucose intolerance is insulin receptor desensitization. It occurs when the body's cells become less responsive to insulin.

[0038] Insulin resistance is a condition in which the body's cells become less responsive to the hormone insulin, which regulates blood sugar levels. Insulin resistance is due to insulin receptor desensitization. Insulin receptor desensitization determination involves assessing the functionality of the insulin receptor and the downstream signaling pathways it activates. In insulin resistance, the phosphorylation of IRS proteins can be impaired. This can be due to increased serine phosphorylation instead of tyrosine phosphorylation, which negatively regulates IRS function. IRS serine phosphorylation disrupts insulin-dependent Akt activation. Akt activation can be measured by detecting threonine 308 (T308) and serine 473 (S473). Disruption in the PI3K-AKT signaling pathway impairs the translocation of glucose transporter 4 (GLUT4) to the cell membrane, reducing glucose uptake by cells. In vivo, IR can be determined by the hyperinsulinemic-euglycemic clamp (HEC). HEC is considered the gold standard for measuring insulin sensitivity. It involves infusing insulin at a constant rate to raise plasma insulin levels while simultaneously infusing glucose to maintain euglycemia (normal blood glucose levels). The oral glucose tolerance test (OGTT) involves ingesting a glucose-rich (75 g) drink, and blood glucose and insulin levels are measured at multiple time points over a few hours. Higher-than-normal blood glucose levels and a delayed or exaggerated insulin response indicate insulin resistance and / or insulin receptor desensitization. The fasting insulin and glucose levels are measured in blood samples taken after an overnight fast to measure fasting insulin and glucose levels. These values are used to calculate the Homeostatic Model Assessment of Insulin Resistance (HOMA-IR) by using the formula: HOMA-IR = Fasting Insulin (μU / mL) × Fasting Glucose (mg / dL) / 405. Higher HOMA-IR values indicate greater insulin resistance. In vitro, insulin resistance and / or insulin receptor desensitization are determined by Western blotting for insulin signaling proteins. The procedure involves the treatment of cells or tissues with insulin, and protein extracts are analyzed by Western blotting to assess the phosphorylation status of key insulin signaling proteins, such as the insulin receptor (IR), insulin receptor substrate (IRS), Akt, and glycogen synthase kinase-3β (GSK-3β). The reduced phosphorylation of these proteins in response to insulin indicates impaired insulin signaling.

[0039] Type 2 diabetes is a chronic condition characterized by insulin resistance and impaired insulin secretion, leading to elevated blood glucose levels. Type 2 diabetes is diagnosed if FPG is 126 mg / dL or higher. Type 2 diabetes is also diagnosed if the two-hour glucose level is 200 mg / dL or higher. During the progression from glucose intolerance to type 2 diabetes, initially, the body compensates for insulin resistance by producing more insulin. Over time, pancreatic beta cells cannot maintain increased insulin production, leading to glucose intolerance. However, continued stress on beta cells results in their dysfunction and eventual failure, causing a transition from glucose intolerance to type 2 diabetes. As beta-cell function declines, blood glucose levels rise consistently, leading to the onset of type 2 diabetes.

[0040] desensitization, with lower Akt phosphorylation and decreased levels of GLUT4 in the plasma membrane in response to acute insulin exposure (Cook et al. Eur Heart J. 31: 100-111, 2010). In humans, the classical renin-angiotensin system is hyperactive in postprandial hyperglycemia and type 2 diabetes, generating elevated angiotensin II levels, which over-activates the angiotensin II type 1 receptor (AT1R), increasing the generation of reactive oxygen species and activating serine kinase proteins such as S6K, a key protein in the insulin desensitization (Xu et al. Intern Med. 52: 855-861, 2013).

[0041] AT2R was described as an angiotensin II receptor that mediates the opposite effects of AT1R (Kaschina et al. Pharmacol Res. 125: 39-47, 2017). Activation of this receptor by the non-peptide agonist C21 increases insulin sensitivity in healthy mice (Quiroga et al. Physiol Rep. 6: e13824, 2018), as well as in diabetic mice (db / db), specifically in the liver (Dominici et al. Br J Pharmacol. 177: 4766-4781, 2020). AT2R blockade does not modify basal glucose or insulin levels but decreases insulin sensitivity in the liver and adipose tissue (Munoz et al. Peptides. 88: 37-45, 2017). Although it was described that the effects of angiotensin-(1-9) were mediated by the activation of angiotensin type II receptor (AT2R) (Flores-Munoz et al., J Physiol. 589: 939-51, 2011; Ocaranza et al., J Hypertens. 28: 1054-64, 2010), some of the physiological effects of angiotensin-(1-9) were also independent of AT2R (Gonzalez et al. Biochem Pharmacol. 156: 357-370, 2018). Moreover, it has been shown that in obese and diabetic Zucker rats, treatment with AT2R agonists C21 and NP-6A4 does not affect glucose homeostasis (Castoldi et al. Acta Diabetol. 56: 97-104, 2019; Gavini et al. Front Pharmacol. 12: 693167, 2021; Castoldi et al. Am J Physiol Renal Physiol. 307: F1123-1131, 2014). On the other hand, treatment with C21 in healthy, diabetic KK-Ay and db / db mice improves glucose intolerance mice (Quiroga et al. Physiol Rep. 6: e13824, 2018; Dominici et al. Br J Pharmacol. 177: 4766-4781, 2020; Ohshima. PLoS One. 7: e48387, 2012).

[0042] Other embodiments of the present invention focus on the improvement of insulin sensitivity in specific tissues, such as the heart or skeletal muscle, thereby addressing tissue-specific metabolic dysregulation.

[0043] The medicament or pharmaceutical composition of the present invention containing an effective amount of angiotensin-(1-9), can be dispensed by all known routes of administration of medicaments described. Said medicament or pharmaceutical composition can be administered by injectable and / or parenteral route (for example, and without the intention of excluding any other route, intravenous, intraarterial, intramuscular, intraperitoneal, intradermal, subcutaneous, and by direct injection to various organs, including heart, lung, kidney, and brain), by inhalation, by the use of continuous release pharmaceutical compositions, by the use of continuous release pumps, by suppositories, and orally. Said administration can be of a single dose, multiple dose or continuous administration. In one embodiment, the pharmaceutical composition is administered systemically or locally to the subject.

[0044] In some embodiments, the present invention describes the use of angiotensin-(1-9) to prepare medicaments and / or pharmaceutical compositions for treating glucose intolerance, insulin resistance, type 2 diabetes, and diabetic cardiomyopathy in a subject, wherein said subject is a mammal selected from human, horse, dog and cat.

[0045] Rats and mice are used as examples of mammals to which the method of treatment can be applied and to test the use of angiotensin-(1-9) in the form of a medicament and / or pharmaceutical composition. Animal models, including small mammals such as rat and mice, to study type 2 diabetes and diabetic cardiomyopathy, are very well accepted in the state of the art (Everette et al., Hypertension 23: 587-93, 1994; lndolfi et al., Circulation, 92: 1230-5, 1995).

[0046] The high-fat diet (HFD) mouse model is a powerful tool in biomedical research for studying the complex relationships among obesity, glucose intolerance, insulin resistance, type 2 diabetes, and diabetic cardiomyopathy. It provides a controlled environment to dissect the mechanisms underlying these conditions, evaluate potential treatments, and identify biomarkers for disease progression and intervention efficacy.

[0047] The HFD mouse model is useful to understand how excessive dietary fat leads to weight gain and adiposity, simulating human obesity. By inducing insulin resistance and hyperglycemia, this model helps study the progression from obesity to type 2 diabetes, including the molecular and cellular mechanisms involved (Heydemann. J Diabetes Res.2016: 2902351, 2016). The model also aids in understanding how metabolic disturbances from obesity and diabetes contribute to cardiac dysfunction, structural changes, and, ultimately, diabetic cardiomyopathy. The HFD mouse model is widely used to test the efficacy and safety of potential therapeutic agents aimed at treating obesity, insulin resistance, type 2 diabetes, and diabetic cardiomyopathy (Heydemann. J Diabetes Res.2016: 2902351, 2016). Although there are differences between mice and humans, the HFD mouse model provides valuable insights that can be translated into clinical research and potential human treatments. Moreover, although the use of angiotensin-(1-9) and / or pharmaceutical compositions containing it and thereof are exemplified in rats and mice, it is understood that the present invention extends to any mammal, for example, and without limitation to humans, mouse, rabbits, primates, dogs, cats, pets in general, farm animals, etc. The use of the rat and mouse models also does not exclude its use in humans that require such treatment.

[0048] A method for treating these metabolic diseases is also disclosed, comprising administering to a subject a therapeutically effective amount of a pharmaceutically acceptable composition containing angiotensin-(1-9). In specific embodiments, this method improves insulin sensitivity, decreases insulinemia and HOMA levels, and prevents insulin receptor desensitization. Additional embodiments involve the simultaneous treatment of diabetic cardiomyopathy and the improvement of heart function, including the reduction of cardiac fibrosis and hypertrophy.

[0049] The following examples are illustrative of the present invention but should not be construed as limitations thereof.Examples

[0050] EXAMPLE 1. Angiotensin-(1-9) reverts heart dysfunction and remodeling in a diabetic cardiomyopathy HFD-induced mice model.

[0051] Wild-type C57BL / 6N male mice were purchased from Charles River Laboratories at 8 weeks old. All mouse procedures were conducted following protocols approved by the Institutional Animal Care and Use Committee (IACUC) of the Beckman Research Institute of the City of Hope. All mice were maintained in a 12:12 hour light: dark cycle in temperature-controlled rooms with free access to water and food. After 1 week of acclimation, OGTT, blood sample collection, and echocardiography performed. Then, they were randomly separated into two groups: mice fed with chow or a high-fat diet (Research Diets, catalog #D12492 60 kcal% fat). After 8 weeks on HFD, we performed the Alzet osmotic minipump implantation to treat mice with a controlled Ang-(1-9) concentration. Briefly, mice were anesthetized with isoflurane. The fur was removed, and a subcutaneous pocket was created to implant the minipump in the back of the mice. Then, the wound was closed using skin closure clips. Animals were observed during recovery from anesthesia and returned to the animal facility for housing. The control group was conducted using the same procedure with a saline treatment. Three weeks later, we performed the OGTT, blood sample collection, and echocardiography again. To assess plasma glucose and insulin for the OGTT, the mice were fasted for 5 hours, and blood samples were drawn from the tail. Plasma glucose was measured by the Contour next EZ glucometer (Ascencia Diabetes Care) using the Contour next blood glucose test strips (Ascencia Diabetes Care). Plasma insulin was measured by the Ultra-sensitive mouse Insulin ELISA kit (Crystal Chem, catalog #90080) following manufacturer instructions. To perform the OGTT, the mice were weighed before, and after fasting for 5 hours during the light phase, and blood samples were drawn from the tail vein before and 15, 30, 60, and 120 minutes after an intragastric load with 2.5 g / kg glucose in PBS. One week later, the mice were fasted overnight, and 5 min before sacrifice, we injected 2 UI / Kg of insulin i.p. to assess the insulin signaling pathway. A description of the HFD fed mice model was depicted in. After feeding with HFD diet, the animals increased weight (Figure 1A), developed glucose intolerance at 8 weeks (Figure 1B), and insulin receptor desensitization (Figure 1C-D).

[0052] All animals gained weight 3 weeks after starting the high-fat diet (HFD), and they met the glucose intolerance parameters at week 8. In addition, the model was confirmed by evaluating insulin signaling in the heart by measuring phosphorylated Akt at the serine 473 and threonine 308 sites, both sites reflecting the activation of the protein. After an insulin pulse, mice fed with HFD showed lower Akt phosphorylation, suggesting a reduced insulin pathway activation. Upon confirmation of the pathological model at 8 weeks of HFD, mini-osmotic pumps with saline or angiotensin-(1-9) were implanted to treat the mice for 4 weeks in total. At the end of the treatment, glucose homeostasis via OGTT and cardiac function were assessed. Cardiac function was evaluated with unconstrained, conscious mice using echocardiography (Visual Sonics, #Vevo 3100, MS400C probe). The parasternal long-axis view of B-mode images at the left ventricular outflow tract level and the parasternal short-axis view of M-mode images at the level of papillary muscles were captured and analyzed to determine different parameters. The heart rate was also recorded. Left ventricular volume at end-diastole (LVEDV) and at end-systole (LVESV), Left ventricular internal diameters at end-diastole (LVID, diastolic) and at end-systole (LVID, systolic) were measured from M-mode recording images. Ejection fraction (EF = [LVEDV – LVESV]x100 / LVEDV) and fractional shortening (FS = [LVID, diastolic - LVID, systolic]x100 / LVID, diastolic) were calculated. The mice fed with HFD have decreased systolic heart function, evidenced by decreased EF and FS, which are reversed by treatment with Ang-(1-9) (Figure 2A-B). HFD, angiotensin-(1-9), and HFD + angiotensin-(1-9) treatments did not modify heart rate, stroke volume, cardiac output, LV mas cor, diastolic LVID. LVEDV, systolic and diastolic LVAW and systolic and diastolic LVPW (Figure 2C). HFD treatment increased systolic LVID and LVESV. Angiotensin-(1-9) reverts these changes (Figure 2C).

[0053] To assess cardiac fibrosis, mouse hearts were collected and fixed in 10% neutralized formalin for 48 h at 4°C. Paraffin sections of 5-μm thickness were used. Heart sections were deparaffinized and rehydrated for wheat germ agglutinin (WGA) staining to visualize the cell contour. After blocking with 5% BSA in PBS for 1 hour, sections were incubated in blocking buffer (5% BSA in PBS) with Alexa Fluor 594-conjugated WGA (Thermo Fisher Scientific, Catalog #W11262, 10 µg / mL) for 1 hour. After 3 washes with PBS, sections were mounted using ProLong gold antifade reagent with DAPI (Thermo Fisher Scientific, catalog #P36935). Masson’s trichrome stain kit (Abcam, catalog #ab150686) was used following kit instructions for connective / collagen tissue staining. We observed that HFD feeding increases the heart's cardiomyocyte area and collagen deposits. However, Ang-(1-9) reduces heart both parameters (Figure 2A-B).

[0054] Finally, pathological markers of cardiac remodeling were measured at the messenger RNA level to corroborate that remodeling is due to an adaptive change in the heart. To do this, total RNAs were extracted from cardiac tissues and cultured cells using Aurum Total RNA Fatty and Fibrous Tissue kits (Bio-Rad, #7326870) and Quick-RNA Micro-Prep kits (Zymo Research, #R1055), respectively. Approximately 500 ng RNAs from each sample were used for reverse transcription with PrimeScript RT Master Mix (Takara, #PR036A). After dilution with ddH2O (1:20), a cDNA template (2 μL) was used for real-time PCR with Bio-Rad CFX384. 2X Universal SYBR Green Fast qPCR Mix (ABclonal, #RK21203) was used to detect mRNA levels. Relative expression was normalized to internal control 18s rRNA and calculated with the 2-ΔΔct method. The primers used are listed below.

[0055] Table 1.GenesForwardReverse18s (mouse)agggttcgattccggagaggcaactttaatatacgctattggAnp (mouse)cttcttcctcgtcttggcctctgcttcctcagtctgctcaBnp (mouse)catggatctcctgaaggtgcccttcaagagctgtctctggbMHC (mouse)aagcagcagttggatgagcgcctcgatgcgtgcctgaagcRcan1.4 (mouse)cccgtgaaaaagcagaatgctccttgtcatatgttctgaagagggTgf-b (mouse)atggctctccttcgacgtgaaatctcgcctcgagctcCtgf (mouse)tgcacttgcctggatggggcagttggctcgcatcataaSMA (mouse)gtcccagacatcagggagtaatcggatacttcagcgtcaggaCollagen 3 (mouse)gaggaatgggtggctatccgtcgtccaggtcttcctgact18S (rat)aaacggctaccacatccaagcctccaatggatcctcgttaAt2r (rat)agcctgcattttaaggagtgctccaaatgcttatctgccggt

[0056] We determined that hypertrophic markers, such as ANP, BNP, β-MHC, and Rcan1.4, and fibrotic markers, such as TGF-β, CTGF, α-SMA, and collagen, were found to be increased in diabetic hearts of HFD-fed mice. However, Ang-(1-9) treatment reverses these pathological changes (Figure 3C). These results demonstrate that Ang-(1-9) reverses diabetic cardiomyopathy in HFD-fed mice.

[0057] EXAMPLE 2. Angiotensin-(1-9) improves glucose homeostasis in HFD-fed mice.

[0058] To assess the metabolic diseases, glucose homeostasis was assessed in the HFD mice obesity model described in example 1. We found that a 3-week treatment with Ang-(1-9) improves whole-body glucose homeostasis in HFD-fed animals (). First, we found that Ang-(1-9) treatment did not change the body weight of both chow- and HFD-fed mice (Figure 4A). Then, in the HFD-fed mice group, we found a lower peak and area under the curve in the OGTT in Ang-(1-9)-treated animals compared to saline-fed mice (Figure 4B-C). Furthermore, Ang-(1-9)-treated animals showed reduced fasting plasma glucose and insulin levels and a consequent decrease in the HOMA-IR index (Figure 4D-F). Notably, the effect of Ang-(1-9) on plasma glucose regulation was dose-dependent, as no changes in OGTT or fasting plasma glucose were observed at a dose of 600 ng / kg / min (). Together, these results suggest that Ang-(1-9) treatment ameliorates, in a dose-dependent manner, the HFD-induced insulin resistance in mice.

[0059] EXAMPLE 3: Angiotensin-(1-9) increases insulin sensitivity in a tissue-dependent manner.

[0060] To assess the metabolic diseases, insulin sensitivity was assessed in the HFD mice obesity model described in example 1. Whole-cell lysates from the heart, liver, epididymal white adipose tissue (eWAT), and skeletal (Sk.) muscle were prepared in RIPA buffer (NaCl 150 mM, NP40 1%, sodium deoxycholate 0.5%, SDS 0.1%, Tris 25mM), and the Pierce protease and phosphatase inhibitor cocktail was added (Thermo Fisher Scientific, A32961). Pierce BCA Protein Assay Kit was used to determine the protein concentration (Thermo Fisher Scientific, 23227). Proteins were separated on 4-20% Criterion TGX Precast Midi Protein gels (Bio-Rad, 5671095) and transferred to nitrocellulose membranes using the Trans-Blot Turbo Blotting System (Bio-Rad). The membranes were blocked in 3% bovine serum albumin solution at room temperature for 1 h and incubated with the following primary antibody overnight at 4°C: phospho-Akt (s473) (cell signaling, 9271, 1:1,000), phospho-Akt (t308) (cell signaling, 9275, 1:1,000), and Akt (cell signaling, 2920, 1:1,000), Membranes were washed 3 times with TBS-Tween buffer. Then they were incubated with secondary antibody (LI-COR, Goat anti-Rabbit #32211 and Goat anti-Mouse #68070, 1:10,000) and scanned with an Odyssey CLx Imaging scanner (LI-COR Biosciences).

[0061] To find out whether this was a global response to Ang-(1-9) treatment or whether a particular tissue was responsible for the improvement in whole-body glucose homeostasis, we assessed insulin signaling in the heart and the principal tissues controlling plasma glucose homeostasis, liver, adipose tissue, and skeletal muscle (). Our results showed that HFD feeding induces insulin desensitization in all tissues tested. Furthermore, Ang-(1-9) treatment did not modify insulin sensitivity in mice fed with a chow diet. Surprisingly, we found that in HFD-fed mice, Ang-(1-9) treatment improved insulin signaling in the heart and skeletal muscle but showed no effects in adipose tissue or liver. These results suggest that Ang-(1-9) has a tissue-specific impact, preferentially acting on cardiac and skeletal muscle.

[0062] EXAMPLE 4. Angiotensin-(1-9) prevents cardiomyocyte insulin desensitization.

[0063] To test the mechanism by which Ang-(1-9) would act in the heart, neonatal rat cardiomyocytes (NRVM) were used. First, we determine whether Ang-(1-9) could trigger Akt phosphorylation. NRVMs were isolated from ventricles of 1 to 2-day-old Sprague-Dawley rats (Charles River Laboratories) using a Neonatal Cardiomyocyte Isolation System kit (Worthington, Catalog #LK003300) following manufacturer instructions. Briefly, we incubated ventricles with trypsin 50 µg / mL overnight. After that, we digested the ventricles with collagenase in a platform rocker at 37ºC, then we centrifuged and collected the cells in several rounds. After 1 hour of pre-plating to remove neonatal fibroblasts, NRVMs were plated at a density of 1,250 cells / mm2 in plating medium (DMEM / M199 = 3:1) with 5% FBS, 10% horse serum, 1% penicillin / streptomycin, and bromodeoxyuridine (BrdU, 100 μM). After 24 hours of plating, NRVMs were washed with PBS and cultured in Low glucose medium (DMEM / M199 = 3:1, 1g / L glucose, 2% FBS, 1% penicillin / streptomycin, and 100 μM BrdU). NRVMs were then subjected to various treatments, including siRNA knockdown. Akt phosphorylation was determined as described in example 3. We observed that within 1 h, Ang-(1-9) treatment did not alter the levels of Akt phosphorylation (Figure 7A-B). We then investigated whether Ang-(1-9) could alter the insulin response of NRVMs. Our findings revealed that, at various insulin doses, Ang-(1-9) did not affect insulin-induced Akt phosphorylation (Figure 7C-D).

[0064] Our next step was to create an in vitro model of insulin desensitization in NRVMs. We used a lipotoxicity model made using a high-glucose medium with palmitate. First, we prepared the BSA-conjugated palmitate. Using a low glucose or high glucose medium 2% FBS, we dissolved 2% fatty acid-free BSA (GeminiBio, catalog #700-107P) for 30 minutes at 37ºC in a platform rocker. Then, we added sodium palmitate (Sigma, catalog #P9767), previously dissolved in a 50% ethanol solution at 55ºC, up to a concentration of 80 µM, and we mixed for 60 minutes at 37ºC in a platform rocker. After 24 hours in a 2% FBS low-glucose medium to stabilize the cells, we treated NRVMs with a 2% FBS low-glucose medium with 2% BSA as control or 2% FBS high-glucose medium plus BSA-conjugated palmitate 80 µM for 24 hours. We observed that treating cells with a high-glucose medium did not alter the insulin response, and treating NRVMs with palmitate marginally decreased Akt phosphorylation. In contrast, combining a high-glucose medium plus palmitate (HG+Palm) was sufficient to reduce insulin sensitivity in NRVMs (Figure 7E-F). Treatment with Ang-(1-9) for 24 h does not modify the insulin response in NRVMs treated with a low glucose medium (Figure 6G-H). In contrast, co-treatment with Ang-(1-9) and HG+Palm shows a recovery in Akt phosphorylation levels (Figure 7G-H).

[0065] These results suggest that Ang-(1-9) does not modify the insulin response directly but rather prevents the damage by lipotoxic stress that induces insulin desensitization in NRVM.

Claims

Use of angiotensin-(1-9) for the manufacture of pharmaceutical compositions useful for treating metabolic diseases in a subject, wherein said disease is selected from glucose intolerance, insulin resistance, type 2 diabetes, or diabetic cardiomyopathy.Use of angiotensin-(1-9) according to claim 1, wherein the treatment of glucose intolerance involves the improvement of insulin sensitivity.Use of angiotensin-(1-9) according to claim 1, wherein the treatment of insulin resistance involves the improvement of insulin sensitivity.Use of angiotensin-(1-9) according to claim 1, wherein the treatment of type 2 diabetes involves the improvement of insulin sensitivity.Use of angiotensin-(1-9) according to claims 1, 3, and 4, wherein the improvement of insulin sensitivity is associated with a decrease in insulinemia.Use of angiotensin-(1-9) according to claims 1, 3, and 4, wherein the improvement of insulin sensitivity is associated with a decrease in HOMA.Use of angiotensin-(1-9) according to claims 1 and 3, wherein the improvement of insulin sensitivity occurs in the heart.Use of angiotensin-(1-9) according to claims 1 and 3, wherein the improvement of insulin sensitivity occurs in the skeletal muscle.Use of angiotensin-(1-9) according to claims 1 and 7, wherein the treatment of diabetic cardiomyopathy involves simultaneously the improvement of the heart insulin sensitivity and the ejection fraction and / or the fractional shortening.Use of angiotensin-(1-9) according to claims 1 and 7, wherein the treatment of diabetic cardiomyopathy involves simultaneously the improvement of the heart insulin sensitivity and the reduction of cardiac fibrosis.Use of angiotensin-(1-9) according to claims 1 and 7, wherein the treatment of diabetic cardiomyopathy involves simultaneously the improvement of the heart insulin sensitivity and the reduction of cardiac hypertrophy.Use of angiotensin-(1-9) according to claims 1 and 3, to prevent insulin receptor desensitization.Use of angiotensin-(1-9) according to claims 1 and 12, wherein the insulin receptor desensitization occurs in the heart.Use of angiotensin-(1-9) according to claims 1 and 12, wherein the insulin receptor desensitization occurs in the skeletal muscle.Use of angiotensin-(1-9) according to claims 1 and 14, wherein the subject is a mammal selected from human, horse, dog and cat.Use of angiotensin-(1-9) according to claims 1 and 15, wherein the pharmaceutically acceptable composition is administered systemically or locally.Angiotensin-(1-9) to treat metabolic diseases in a subject, wherein said disease is selected from glucose intolerance, insulin resistance, type 2 diabetes, or diabetic cardiomyopathy.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claim 17, wherein the treatment of glucose intolerance involves the improvement of insulin sensitivity.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claim 17, wherein the treatment of insulin resistance involves the improvement of insulin sensitivity.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claim 17, wherein the treatment of type 2 diabetes involves the improvement of insulin sensitivity.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17, 19, and 20, wherein the improvement of insulin sensitivity is associated with a decrease in insulinemiaAngiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17, 19, and 20, wherein the improvement of insulin sensitivity is associated with a decrease in Homeostasis Model Assessment (HOMA).Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17 and 19, wherein the improvement of insulin sensitivity occurs in the heart.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17 and 19, wherein the improvement of insulin sensitivity occurs in the skeletal muscle.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17 and 23, wherein the treatment of diabetic cardiomyopathy involves simultaneously the improvement of the heart insulin sensitivity and the ejection fraction and / or the fractional shortening.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17 and 23, wherein the treatment of diabetic cardiomyopathy involves simultaneously the improvement of the heart insulin sensitivity and the reduction of cardiac fibrosis.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17 and 23, wherein the treatment of diabetic cardiomyopathy involves simultaneously the improvement of the heart insulin sensitivity and the reduction of cardiac hypertrophy.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17 and 19, wherein said treatment prevents insulin receptor desensitization.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17 and 28, wherein the insulin receptor desensitization occurs in the heart.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17 and 28, wherein the insulin receptor desensitization occurs in the skeletal muscle.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17 and 30, wherein the subject is a mammal selected from human, horse, dog and cat.Angiotensin-(1-9) to treat metabolic diseases in a subject according to claims 17 and 31, wherein the pharmaceutically acceptable composition is administered systemically or locally.Method for treating glucose intolerance, insulin resistance, type 2 diabetes, or diabetic cardiomyopathy in a subject, wherein said method comprises administering to the subject a therapeutically effective amount of a pharmaceutically acceptable composition comprising angiotensin-(1-9).The method of claim 33, wherein said method involves the improvement of insulin sensitivity.The method of claim 33, wherein said method involves the decrease in insulinemia.The method of claim 33, wherein said method involves the decrease in Homeostasis Model Assessment (HOMA).The method of claim 33, wherein said method involves simultaneously the improvement of the heart insulin sensitivity and the reduction of cardiac hypertrophy.The method of claim 33, wherein said method involves simultaneously the improvement of the heart insulin sensitivity and the ejection fraction and / or the fractional shortening.The method of claim 33, wherein said method involves simultaneously the improvement of the heart insulin sensitivity and the reduction of cardiac fibrosis.The method of claim 33, wherein said method involves simultaneously the improvement of the heart insulin sensitivity and the reduction of cardiac hypertrophy.The method of claim 33, wherein said method prevents insulin receptor desensitization.The method of claims 33 and 41, wherein insulin receptor desensitization occurs in the heart.The method of claims 33 and 41, wherein the insulin receptor desensitization occurs in the skeletal muscle.The method of claim 33, wherein the pharmaceutically acceptable composition is administered systemically or locally.The method of claims 33 and 44, wherein said subject is a mammal selected from human, horse, dog and cat.

Images