SARS-COV-2 replication-defective virus system

Abstract

Provided herein is a replication-defective coronavirus having in its genome a modification, wherein the modification results in a reduced expression of the M gene compared to a coronavirus lacking the modification.

Description

Attorney Docket No. 06527-2505244SARS-COV-2 REPLICATION-DEFECTIVE VIRUS SYSTEMCROSS-REFERENCE TO RELATED APPLICATION

[0001] The present application claims priority to United States Provisional Patent Application No. 63 / 752,250, filed January 31, 2025, the disclosure of which is hereby incorporated by reference in its entirety.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under grant number AI175795 awarded by the National Institutes of Health. The government has certain rights in the invention.REFERENCE TO A SEQUENCE LISTING

[0003] The Sequence Listing associated with this application is filed in electronic format via Patent Center and is hereby incorporated by reference into the specification in its entirety. The name of the file containing the Sequence Listing is 2505244. xml. The size of the file is 231,382 bytes, and the file was created on December 22, 2025.BACKGROUND OF THE INVENTIONField of the Invention

[0004] The present disclosure relates, generally, to modified coronaviruses that are replication defective, and, in non-limiting embodiments, to modified SARS-CoV-2 viruses that are replication defective, as well as methods of producing such modified viruses and kits and systems making used of such viruses.Description of Related Art

[0005] Three deadly human coronaviruses (CoVs) have emerged in the past 17 years: severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV) in 2002, Middle Eastern respiratory syndrome coronavirus (MERS-CoV) in 2012, and SARS-CoV-2 in 2019. Infection with SARS-CoV-2 causes COVID-19, a highly transmissible acute respiratory infection, which while presenting mild symptoms in many individuals, can result in severe pneumonia and death.

[0006] Despite highly effective vaccines in preventing COVID-19, SARS-CoV-2 has evolved into variants of concern (VOCs) to be more transmissible, to be more virulent and to escape immune responses, requiring regular boosters against new VOCs.6A40151. DOCX 1Attorney Docket No. 06527-2505244

[0007] Accordingly, there is a need in the art for additional tools to allow for further investigation into coronaviruses, including for therapeutics for the same.SUMMARY OF THE INVENTION

[0008] Provided herein is a replication-defective coronavirus having in its genome a modification, wherein the modification results in a reduced expression of the M gene compared to a coronavirus lacking the modification.

[0009] Also provided herein is a pharmaceutical composition including a replicationdefective coronavirus as described herein.

[0010] Also provided herein is a method of screening a composition for use against a coronavirus, including exposing a replication-defective coronavirus as described herein to a composition.

[0011] Also provided herein is a method of making a replication-defective coronavirus, including introducing at least one modification to the coronavirus genome that results in a reduced expression of the M gene compared to a coronavirus lacking the modification.

[0012] Also provided herein is a replication-defective severe acute respiratory syndrome (SARS) coronavirus particle including in its genome a modification in the M gene, wherein the modification results in a reduced expression of the M gene compared to a coronavirus lacking the modification and wherein the modification does not affect expression of the ORF6 gene.

[0013] Also provided herein is a kit including a replication-defective coronavirus as described herein in a vessel.

[0014] Also provided herein is a recombinant mammalian cell modified to express a coronavirus M gene.

[0015] Also provided herein is a method of producing a recombinant cell including introducing into the cell a viral vector having the sequence of SEQ ID NO: 1, and / or SEQ ID NO: 37, or a viral vector having at least 90% sequence identity thereto.

[0016] Also provided herein is a kit including a replication-defective coronavirus as described herein, or a replication-defective viral particle as described herein, and a recombinant cell as described herein.

[0017] Further non-limiting embodiments are set forth in the following numbered clauses:6A40151. DOCX 2Attorney Docket No. 06527-2505244

[0018] 1. A replication-defective coronavirus or virus particle comprising in its genome a modification, wherein the modification results in a reduced expression of the M gene compared to a coronavirus lacking the modification.

[0019] 2. The replication-defective coronavirus or virus particle of clause 1, wherein the modification is at least one addition, substitution, and / or deletion in the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

[0020] 3. The replication-defective coronavirus or virus particle of clause 1 or clause 2, wherein the modification is a deletion of at least one nucleic acid in the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

[0021] 4. The replication-defective coronavirus or virus particle of any of clauses 1 -3, wherein the modification is a deletion of at least nucleic acids 1 -467 of the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

[0022] 5. The replication-defective coronavirus or virus particle of any of clauses 1-4, wherein the modification is a deletion of no more than the first 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, and / or 665 nucleic acids of the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

[0023] 6. The replication-defective coronavirus or virus particle of any of clauses 1-5, further comprising at least one addition, substitution, and / or deletion in the transcription regulatory sequence (TRS) of the M gene.

[0024] 7. The replication-defective coronavirus or virus particle of any of clauses 1-6 wherein the deletion is a deletion of substantially the entire TRS of the M gene.

[0025] 8. The replication-defective coronavirus or virus particle of any of clauses 1-7, wherein the coronavirus is a severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV).

[0026] 9. The replication-defective coronavirus or virus particle of any of clauses 1-8, wherein the coronavirus is severe acute respiratory syndrome (SARS) coronavirus 2 (SARS-CoV-2).6A40151. DOCX 3Attorney Docket No. 06527-2505244

[0027] 10. The replication-defective coronavirus or virus particle of any of clauses 1-9, wherein the coronavirus is Middle Eastern respiratory syndrome coronavirus (MERS-CoV).

[0028] 11. The replication-defective coronavirus or virus particle of any of clauses 1-10, wherein the modification includes a further modification that results in a reduced expression of the E gene compared to a coronavirus lacking the further modification.

[0029] 12. The replication-defective coronavirus of any of clauses 1-11, wherein the modification further comprises at least one addition, substitution, and / or deletion in the nucleic acid sequence of SEQ ID NO: 33 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 33.

[0030] 13. The replication-defective coronavirus or virus particle of any of clauses 1-12, wherein the modification further comprises a deletion of at least one nucleic acid in the nucleic acid sequence of SEQ ID NO: 33 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 33.

[0031] 14. A pharmaceutical composition comprising the replication-defective coronavirus of any of clauses 1 -13.

[0032] 15. The pharmaceutical composition of clause 14, configured for subcutaneous, intradermal, intramuscular, transdermal, intravenous, oral, intraocular, inhalation, insufflation, and / or mucosal delivery.

[0033] 16. A method of screening a composition for use against a coronavirus, comprising exposing a replication-defective coronavirus according to any of clauses 1-13 to a composition.

[0034] 17. The method of clause 16, further comprising providing the M protein to replication-defective virus, and wherein the composition is determined to be effective against the coronavirus when replication of the replication-defective coronavirus is decreased relative to a coronavirus lacking the modification.

[0035] 18. The method of clause 16 or clause 17, wherein the composition is a binding reagent.

[0036] 19. The method of any of clauses 16-18, wherein the binding reagent is an antibody or a fragment thereof, an scFv, a nanobody, and / or an aptamer.

[0037] 20. The method of any of clauses 16-19, wherein the composition is a nonbinding reagent coronavirus inhibitor.

[0038] 21. The method of any of clauses 16-20, wherein the composition is a purported coronavirus inhibitor.6A40151. DOCX 4Attorney Docket No. 06527-2505244

[0039] 22. The method of any of clauses 16-21, wherein the method is performed in a multiplexed assay in which at least two different compositions are screened at different addressable locations.

[0040] 23. The method of any of clauses 16-22, wherein replication of the replication-defective coronavirus is determined by RT-PCR, qRT-PCR, an assay based on fluorescent and / or bioluminescent proteins (such as NLuc), immunoblotting, flow cytometry, immunofluorescence, and / or ELISA.

[0041] 24. A method of making a replication-defective coronavirus, comprising introducing at least one modification to the coronavirus genome that results in a reduced expression of the M gene compared to a coronavirus lacking the modification.

[0042] 25. The method of clause 24, wherein the modification comprises at least one substitution and / or deletion in the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

[0043] 26. The method of clause 24 or clause 25, wherein the modification is a deletion of at least one nucleic acid in the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

[0044] 27. The method of any of clauses 24-26, wherein the modification is a deletion of at least nucleic acids 1 -467 of the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

[0045] 28. The method of any of clauses 24-27, wherein the modification is a deletion of no more than the first 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, and / or 665 nucleic acids of the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

[0046] 29. The method of any of clauses 24-28, further comprising at least one substitution and / or deletion in the transcription regulatory sequence (TRS) of the M gene.

[0047] 30. The method of any of clauses 24-29, wherein the deletion is a deletion of substantially the entire TRS of the M gene.6A40151. DOCX 5Attorney Docket No. 06527-2505244

[0048] 31. The method of any of clauses 24-30, wherein the coronavirus is severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV).

[0049] 32. The method of any of clauses 24-31, wherein the coronavirus is severe acute respiratory syndrome (SARS) coronavirus 2 (SARS-CoV-2).

[0050] 33. The method of any of clauses 24-32, wherein the coronavirus is Middle Eastern respiratory syndrome coronavirus (MERS-CoV).

[0051] 34. The method of any of clauses 24-33, wherein the modification further results in a reduced expression of the E gene than a coronavirus lacking the modification.

[0052] 35. A replication-defective severe acute respiratory syndrome (SARS) coronavirus particle comprising in its genome a modification in the M gene, wherein the modification results in a reduced expression of the M gene compared to a coronavirus lacking the modification and wherein the modification does not affect expression of the ORF6 gene.

[0053] 36. The replication-defective SARS coronavirus particle of clause 35, further comprising in its genome a modification in the E gene, wherein the modification results in a reduced expression of the E gene compared to a coronavirus lacking the modification.

[0054] 37. A replication-defective coronavirus or virus particle, comprising a deletion of a portion of the M gene and / or the transcription regulatory sequence (TRS) of the M gene that eliminates expression or function of the M protein but does not substantially delete a TRS or other regulatory element for controlling expression of a gene of the coronavirus other than M.

[0055] 38. A kit comprising the replication-defective coronavirus of any of clauses 1-13, or a replication-defective viral particle of any of clauses 35-37, in a vessel.

[0056] 39. A recombinant mammalian cell modified to express a coronavirus M gene.

[0057] 40. The recombinant cell of clause 39, wherein the recombinant cell is a Vero cell.

[0058] 41. The recombinant cell of clause 39 or clause 40, wherein the cell is a BHK cell.

[0059] 42. The recombinant cell of any of clauses 39-41, wherein the cell is a HEK cell.6A40151. DOCX 6Attorney Docket No. 06527-2505244

[0060] 43. The recombinant cell of any of clauses 39-42, wherein expression of the coronavirus M gene is under the control of an inducible promotor.

[0061] 44. The recombinant cell of any of clauses 39-43, wherein the inducible promotor is a doxycycline-inducible promotor.

[0062] 45. The recombinant cell of any of clauses 39-44, wherein the coronavirus M gene is codon optimized for the cell.

[0063] 46. The recombinant cell of any of clauses 39-45, wherein the cell is further modified to express a coronavirus E gene.

[0064] 47. The recombinant cell of any of clauses 39-46, wherein the coronavirus E gene is codon optimized.

[0065] 48. A method of producing a recombinant cell comprising introducing into the cell a viral vector having the sequence of SEQ ID NO: 1, and / or SEQ ID NO: 37, or a viral vector having at least 90% sequence identity thereto.

[0066] 49. A kit comprising the replication-defective coronavirus of any of clauses 1-13, or a replication-defective viral particle of any of clauses 35-37 in a vessel, and the recombinant cell of any of clauses 39-47.

[0067] 50. The kit of clause 49, further comprising a nucleic acid comprising the coronavirus M gene and / or the coronavirus M gene TRS.

[0068] 51. The kit of clause 49 or clause 50, wherein the nucleic acid has the sequence of SEQ ID NO: 34.

[0069] 52. The kit of any of clauses 49-51, further comprising an artificial chromosome, a plasmid, a vector, and / or a virus comprising a nucleic acid comprising the coronavirus M gene and / or the coronavirus M gene TRS.

[0070] 53. The kit of any of clauses 49-52, wherein the vector has the sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 36, and / or SEQ ID NO: 38, or a sequence having at least 90% sequence identity thereto.

[0071] 54. The kit of any of clauses 49-53, further comprising a nucleic acid comprising the coronavirus E gene and / or the coronavirus E gene TRS.

[0072] 55. The kit of any of clauses 49-54, wherein the nucleic acid has the sequence of SEQ ID NO: 33.

[0073] 56. The kit of any of clauses 49-55, further comprising an artificial chromosome, a plasmid, a vector, and / or a virus comprising a nucleic acid comprising the coronavirus E gene and / or the coronavirus E gene TRS.6A40151. DOCX 7Attorney Docket No. 06527-2505244

[0074] 57. The kit of any of clauses 49-56, wherein the vector has the sequence of SEQ ID NO: 2 and / or SEQ ID NO: 38, or a sequence having at least 90% sequence identity thereto.BRIEF DESCRIPTION OF THE DRAWINGS

[0075] FIG. 1 shows Production of SARS-CoV-2 cDNA in a bacterial artificial chromosome (BAC) with and without the nanoluciferase (nLuc) and mNeonGreen (mNeon) reporter genes in place of ORF7a / b;

[0076] FIG. 2 shows AM SARS-CoV-2 design and complementation. (A) The E, M, and ORF6 genes of the WT SARS-CoV-2 genome are shown (top). The M transcription regulatory sequence (TRS) and 71.5% of the M gene (green) were deleted to produce AM SARS-CoV-2. (B) The codon-optimized SARS-CoV-2 M gene was cloned into an inducible lentiviral vector downstream of the mRuby3 fluorescent protein gene, separated by the T2A peptide. Other versions include codon-optimized E following an internal ribosome entry site (IRES) and / or other reporter genes instead of mRuby3;

[0077] FIG. 3 shows a schematic for characterizing WT and AM SARS-CoV-2 virus production and infectivity. To provide M in trans, Vero E6-hAT cells were produced to stably express mRuby3 and codon-optimized M (coM) separated by the T2A peptide sequence (shown in FIG. 2B) and under a doxycycline-inducible promoter (mRuby3-T2A-coM);

[0078] FIGS. 4A-4C show infectivity of SARS-CoV-2 reporter viruses produced by transfection of the BAC in BHK cells and co-cultured with Vero E6 cells. SARS-CoV-2 encoding mNeon or nLuc was produced by BHK and Vero E6 cell co-culture (P0 / P1 ) and used to infect Vero E6 cells (P2). mNeon expression was measured in P2 by (A) immunofluorescence or (B) flow cytometry. nLuc expression was measured for luminescence in (C) producer cells or (D) infected cells. (E) Infectious titer of SARS-CoV-2 expressing nLuc shown in D was determined by a plaque assay. ND, not detected; Error bars indicate standard error of the mean (SEM) for two technical replicates.

[0079] FIG. 5 shows Infectivity of AE, AM, and AEAM SARS-CoV-2 encoding nLuc. (A) Viruses were produced by transfection of BAC in cells with or without induced expression of E, M, or E+M (P0). nLuc expression was measured for luminescence.6A40151. DOCX 8Attorney Docket No. 06527-2505244(B) Virus produced in cells in A were used to infect Vero E6-hAT cells (P1) and nLuc activity was measured. Dashed lines represent the limits of nLuc detection;

[0080] FIG. 6 shows susceptibility of WT and AM SARS-CoV-2 viruses to a neutralizing antibody and remdesivir in Vero E6-hAT cells. Viruses were (A) preincubated with serial dilutions of Ly-COV555 1 h prior to infection of cells or (B) added to cells 1h prior to treatment with remdesivir (RDV) serial dilutions. Infectivity was measured by nLuc activity and normalized to viruses in the absence of treatment. Averages are shown for three independent experiments. Error bars represent SEM;

[0081] FIG. 7 shows a genetic map of a portion of an exemplary SARS-CoV-2 genome, including regions of the E gene, M gene, ORF6 gene, ORF 7a / 7b, and ORF8 gene;

[0082] FIG. 8 shows an exemplary nucleotide sequence of the SARS-CoV-2 genome;

[0083] FIG. 9 shows an exemplary sequence of the SARS-CoV-2 E gene;

[0084] FIG. 10 shows an exemplary sequence of the SARS-CoV-2 M gene; and

[0085] FIG. 11 shows an exemplary sequence of the SARS-CoV-2 ORF6 gene.

[0086] FIGS. 12A-12I show trans-complementation of M in AM SARS-CoV-2 produces single-cycle infectious virus. (A) RNA was isolated from Vero E6-hAT (WT and DM) or E6-hAT cells stably expressing coM (AM only) infected with WT or AM SARS-CoV-2-nanoLuc virus. RT-PCR was performed with SARS-CoV-2 sgRNA specific primers and products were run on an agarose gel; Negative stain EM of WT and AM SARS-CoV-2-nanoLuc produced with and without trans-complementation of M. Representative micrographs of two independent experiments are shown. (B-F) WT and AM SARS-CoV-2-nanoLuc viruses were serially passaged three times in Vero E6-hAT cells (WT and AM) or E6-hAT cells stably expressing coM in trans (AM only). The third passage of AM SARS-CoV-2-nanoLuc virus produced in E6-hAT cells expressing coM was passaged an additional three times in E6-hAT cells lacking coM expression. Dotted lines represent the assay limits of detection. Error bars represent SEM for three independent experiments. For each passage, nanoLuc activity in producer cells (B) and freshly infected Vero E6-hAT cells (C), gRNA (ORF1a) copies in producer cells (D) and virus supernatant (E), and plaque titers (F) were measured. (G) Plaque assays are shown for WT SARS-CoV-2-nanoLuc infection of Vero E6-hAT cells and AM SARS-CoV-2-nanoLuc infection of Vero E6-hAT cells with or without stable expression of coM. Numbers represent log dilution of virus. (H-l) RNA quantitation of endogenous 6A40151. DOCX 9Attorney Docket No. 06527-2505244M (I) or trans-complemented coM (J) copies were measured by qRT-PCR in producer cells (left) and virus (right) from serial passages of WT and AM SARS-CoV-2-nanoLuc shown in (B-F). Dotted lines represent the assay limits of detection. Error bars represent SEM for three independent experiments.

[0087] FIGS. 13A-13B show ER-Golgi Intermediate Complex (ERGIC) organization and S localization are altered without M during SARS-CoV-2 infection. (A) Vero E6-hAT cells were infected with WT or AM SARS-CoV-2 virus for 24h, stained for M (red), ERGIC-53 (green), and Hoechst (blue), and imaged by confocal microscopy. Solid white bar represents 20 pm. (B) Vero E6-hAT cells were infected with WT or AM SARS-CoV-2 virus for 24h, stained for M (red), S (green), and Hoechst (blue), and imaged by confocal microscopy. Solid white bars represent 20 pm.

[0088] FIGS. 14A-14E show Remdesivir (RDV) inhibits SARS-CoV-2 virion assembly via the M protein. (A) Vero E6-hAT cells without (WT and AM) and with (AM only) stable expression of M (with and without indicated point mutations) were infected with WT or AM SARS-CoV-2 for 1 h, treated with a range of concentrations of RDV, and assayed for nanoLuc activity after 24h. Error bars indicate SEM for 3-4 independent experiments. (B) Workflow for in vitro selection of RDV resistance. (C) WT SARS-CoV-2 was serially passaged on Vero E6-hAT cells with and without indicated concentration of RDV and harvested when producer cells exhibited at least 50% CPE. Accelerated viral replication in the presence of RDV was taken as indication of drug resistance. (D-E) Virus passage 13 indicated with red arrow in (C) was plaque titrated (D) and (E) assayed for RDV resistance versus virus passaged without RDV treatment.DESCRIPTION OF THE INVENTION

[0089] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients, reaction conditions, and so forth used in the specification and claims are to be understood as being modified in all instances by the term "about". Accordingly, unless indicated to the contrary, the numerical parameters set forth in the following specification and attached claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the application of the doctrine of equivalents to the scope of the claims, each numerical6A40151. DOCX 10Attorney Docket No. 06527-2505244parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

[0090] Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. Any numerical values, however, inherently contain certain errors necessarily resulting from the standard deviation found in their respective testing measurements. Furthermore, when numerical ranges of varying scope are set forth herein, it is contemplated that any combination of these values inclusive of the recited values may be used.

[0091] Also, it should be understood that any numerical range recited herein is intended to include all sub-ranges subsumed therein. For example, a range of "1 to 10" is intended to include all sub-ranges between and including the recited minimum value of 1 and the recited maximum value of 10, that is, having a minimum value equal to or greater than 1 and a maximum value of equal to or less than 10.

[0092] As used herein "a" and "an" refer to one or more.

[0093] As used herein, the term "comprising" is open-ended and may be synonymous with "including", "containing", or "characterized by".

[0094] As used herein, the term "patient" or "subject" refers to members of the animal kingdom including but not limited to human beings, and "mammal" refers to all mammals, including, but not limited to human beings.

[0095] For purposes of the description hereinafter, the terms "end," "upper," "lower," "right," "left," "vertical," "horizontal," "top," "bottom," "lateral," "longitudinal," and derivatives thereof shall relate to the embodiments as they are oriented in the drawing figures. However, it is to be understood that the present disclosure may assume various alternative variations and step sequences, except where expressly specified to the contrary. It is also to be understood that the specific devices and processes illustrated in the attached drawings, and described in the following specification, are simply exemplary and non-limiting embodiments or aspects of the disclosed subject matter. Hence, specific dimensions and other physical characteristics related to the embodiments or aspects disclosed herein are not to be considered as limiting.

[0096] Unless stated otherwise, nucleotide sequences are recited herein in a 5’ to 3’ direction, and amino acid sequences are recited herein in an N-terminal to C-terminal direction according to convention.6A40151. DOCX 11Attorney Docket No. 06527-2505244

[0097] " Therapeutically effective amount," as used herein, is intended to include the amount of a therapeutic agent, such as an immunogen, as described herein that, when administered to a subject having a disease, is sufficient to effect treatment of the disease (e.g., by diminishing, ameliorating or maintaining the existing disease or one or more symptoms of disease). The "therapeutically effective amount" may vary depending on compound or composition, how it is administered, the disease and its severity and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the subject to be treated.

[0098] A "therapeutical ly-effective amount" also includes an amount of an agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. Compounds and compositions described herein may be administered in a sufficient amount to produce a reasonable benefit / risk ratio applicable to such treatment. For example, a therapeutically-effective amount of a virus vaccine useful for eliciting an immune response in a subject and / or for preventing infection by the virus.

[0099] A “vaccine” refers to a preparation of immunogenic material capable of stimulating an immune response, administered for the prevention, inhibition, amelioration, or treatment of infectious, such as coronavirus, e.g. SARS-CoV-2, infections, or other types of disease. The immunogenic material may include attenuated or inactivated (killed) microorganisms (such as bacteria or viruses), or antigenic proteins, peptides, or DNA derived from them. An attenuated virus is a virulent organism that has been modified to produce a less virulent form, but nevertheless retains the ability to elicit antibodies and cell-mediated immunity against the virulent form. An inactivated (killed) virus is a previously virulent organism that has been inactivated with chemicals, heat, or other treatment, but elicits antibodies against the organism. Vaccines may elicit both prophylactic (preventative or protective) and therapeutic responses. Methods of administration vary according to the vaccine, but may include inoculation, ingestion, inhalation or other forms of administration. Vaccines may be administered with an adjuvant to boost the immune response.

[0100] In the context of the present disclosure, a therapeutically effective amount of a coronavirus, e.g., a SARS-CoV-2, virus vaccine, for example, is an amount sufficient to increase resistance to, prevent, ameliorate, and / or treat infection caused by a coronavirus, e.g., a SARS-CoV-2 virus in a subject without causing a substantial 6A40151. DOCX 12Attorney Docket No. 06527-2505244cytotoxic effect in the subject. The effective amount of a coronavirus, e.g., a SARS-CoV-2, virus vaccine or immunogen useful for increasing resistance to, preventing, ameliorating, and / or treating infection in a subject will be dependent on, for example, the subject being treated, the manner of administration of the therapeutic composition and other factors.

[0101] A non-limiting range for a therapeutically effective amount of the disclosed immunogen within the methods and immunogenic compositions of the disclosure is about 0.0001 mg / kg body weight to about 10 mg / kg body weight, such as about 0.01 mg / kg, about 0.02 mg / kg, about 0.03 mg / kg, about 0.04 mg / kg, about 0.05 mg / kg, about 0.06 mg / kg, about 0.07 mg / kg, about 0.08 mg / kg, about 0.09 mg / kg, about 0.1 mg / kg, about 0.2 mg / kg, about 0.3 mg / kg, about 0.4 mg / kg, about 0.5 mg / kg, about 0.6 mg / kg, about 0.7 mg / kg, about 0.8 mg / kg, about 0.9 mg / kg, about 1 mg / kg, about 1.5 mg / kg, about 2 mg / kg, about 2.5 mg / kg, about 3 mg / kg, about 4 mg / kg, about 5 mg / kg, or about 10 mg / kg, for example, 0.01 mg / kg to about 1 mg / kg body weight, about 0.05 mg / kg to about 5 mg / kg body weight, about 0.2 mg / kg to about 2 mg / kg body weight, or about 1.0 mg / kg to about 10 mg / kg body weight. In some embodiments, the dosage includes a set amount of a disclosed immunogen such as from about 1-300 pg, for example, a dosage of about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100, 150, 200, 250, or about 300 pg.

[0102] Dosage can be varied by the attending clinician to maintain a desired concentration at a target site (for example, systemic circulation). Higher or lower concentrations can be selected based on the mode of delivery, for example, trans-epidermal, rectal, oral, pulmonary, or intranasal delivery versus intravenous or subcutaneous delivery. The actual dosage of disclosed immunogen will vary according to factors such as the disease indication and particular status of the subject (for example, the subject's age, size, fitness, extent of symptoms, susceptibility factors, and the like), time and route of administration, other drugs or treatments being administered concurrently, as well as the specific pharmacology of the composition for eliciting the desired activity or biological response in the subject. Dosage regimens can be adjusted to provide an optimum prophylactic or therapeutic response. A therapeutically effective amount is also one in which any toxic or detrimental side effects of the disclosed immunogen and / or other biologically active agent is outweighed in clinical terms by therapeutically beneficial effects.6A40151. DOCX 13Attorney Docket No. 06527-2505244

[0103] An “immunogen” is an antigen able to induce a humoral and / or a cell-mediated immune response. A composition comprising an immunogen includes additional carriers or excipients, including, for example, and without limitation:Lipid(s), as with liposomes, micellar structures, emulsions, and lipid nanoparticles comprising the immunogen or a nucleic acid, such as mRNA or DNA, encoding a polypeptide immunogen;Water, salt(s), buffer(s), and / or rheology modifier(s); and adjuvant(s).

[0104] Further, preventing, treating or ameliorating a disease: “Preventing” a disease refers to inhibiting the full development of a disease or infection, such as a coronavirus, e.g. a SARS-Cov-2 infection, from a subsequent exposure. “Treating” refers to a therapeutic intervention that ameliorates a sign or symptom of a disease or pathological condition after it has begun to develop. “Ameliorating” refers to the reduction in the number or seventy of one or more signs or symptoms of a disease or infection. A prime-boost vaccination refers to an immunotherapy including administration of a first immunogenic composition (the primer vaccine) followed by administration of a second immunogenic composition (the booster vaccine) to a subject to elicit an immune response. The primer vaccine and / or the booster vaccine may include a vector (such as a viral vector, RNA, or DNA vector) expressing the antigen to which the immune response is directed, or can include a protein immunogen. The booster vaccine is administered to the subject after the primer vaccine; the skilled artisan will understand a suitable time interval between administration of the primer vaccine and the booster vaccine, and examples of such timeframes are disclosed herein. In some embodiments, the primer vaccine, the booster vaccine, or both primer vaccine and the booster vaccine additionally include an adjuvant.

[0105] The prime and boost immunizations may deliver the same immunogen or sequence encoding the immunogen by the same route to the patient, as is commonly performed.

[0106] The prime immunization may deliver the immunogen or a sequence encoding the immunogen, by a first route to the patient, and the boost immunization may deliver the same immunogen or sequence encoding the immunogen by a different route to the patient. A first immunization may be delivered intramuscularly, with the boost immunization delivered mucosally, intranasally, nasopharyngeally, or 6A40151. DOCX 14Attorney Docket No. 06527-2505244intradermally. Alternatively, first immunization may be delivered mucosally, intranasally, nasopharyngeally, or intradermally, with the boost immunization delivered intramuscularly. The immunization may be via an adenoviral vector as described herein, for example when the route of delivery is to a patient’s mucosa, as in nasal or nasopharyngeal delivery. Delivery intramuscularly, intradermally, or subdermally may utilize an mRNA-lipid nanoparticle vaccine, or a purified protein, optionally with adjuvant vaccine.

[0107] The phrase "pharmaceutically-acceptable carrier" as used herein means a pharmaceutically-acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, manufacturing aid (e.g., lubricant, talc magnesium, calcium or zinc stearate, or steric acid), or solvent encapsulating material, involved in carrying or transporting the subject compound from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation and not injurious to the subject being treated. Some examples of materials which can serve as pharmaceutically-acceptable carriers include: (1) sugars, such as lactose, glucose and sucrose; (2) starches, such as corn starch and potato starch; (3) cellulose, and its derivatives, such as sodium carboxymethyl cellulose, ethyl cellulose and cellulose acetate; (4) powdered tragacanth; (5) malt; (6) gelatin; (7) lubricating agents, such as magnesium state, sodium lauryl sulfate, and talc; (8) excipients, such as cocoa butter and suppository waxes; (9) oils, such as peanut oil, cottonseed oil, safflower oil, sesame oil, olive oil, corn oil, and soybean oil; (10) glycols, such as propylene glycol; (11) polyols, such as glycerin, sorbitol, mannitol, and polyethylene glycol; (12) esters, such as ethyl oleate and ethyl laurate; (13) agar; (14) buffering agents, such as magnesium hydroxide and aluminum hydroxide; (15) alginic acid; (16) pyrogen-free water; (17) isotonic saline; (18) Ringer's solution; (19) ethyl alcohol; (20) pH buffered solutions; (21) polyesters, polycarbonates, and / or polyanhydrides; (22) bulking agents, such as polypeptides and amino acids (23) serum component, such as serum albumin, HDL and LDL; and (22) other non-toxic compatible substances employed in pharmaceutical formulations. Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, Pa., 21st Edition (2005), describes compositions and formulations suitable for pharmaceutical delivery of one or more therapeutic compositions, such as a chimeric virus, and additional pharmaceutical agents.6A40151. DOCX 15Attorney Docket No. 06527-2505244

[0108] In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol or the like as a vehicle. For solid compositions (for example, powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, or magnesium stearate. In addition to biologically-neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non-toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

[0109] Therapeutic agents, for example and without limitation, bioactive agents, drugs, active pharmaceutical ingredients, or biologicals, may be incorporated into the compositions and combination devices described herein. Non-limiting examples of therapeutic agents include: anti-inflammatories, such as, without limitation, NSAIDs (non-steroidal anti-inflammatory drugs) such as salicylic acid, indomethacin, sodium indomethacin trihydrate, salicylamide, naproxen, colchicine, fenoprofen, sulindac, diflunisal, diclofenac, indoprofen sodium salicylamide, anti-inflammatory cytokines, and anti-inflammatory proteins or steroidal anti-inflammatory agents); antibiotics; anticlotting factors such as heparin, Pebac, enoxaprin, aspirin, hirudin, plavix, bivalirudin, prasugrel, idraparinux, warfarin, coumadin, clopidogrel, PPACK, GGACK, tissue plasminogen activator, urokinase, and streptokinase; growth factors; or antibiotics, such as, without limitation: acyclovir, afloxacin, ampicillin, amphotericin B, atovaquone, azithromycin, ciprofloxacin, clarithromycin, clindamycin, clofazimine, dapsone, diclazaril, doxycycline, erythromycin, ethambutol, fluconazole, fluoroquinolones, foscarnet, ganciclovir, gentamicin, iatroconazole, isoniazid, ketoconazole, levofloxacin, lincomycin, miconazole, neomycin, norfloxacin, ofloxacin, paromomycin, penicillin, pentamidine, polymixin B, pyrazinamide, pyrimethamine, rifabutin, rifampin, sparfloxacin, streptomycin, sulfadiazine, tetracycline, tobramycin, trifluorouridine, trimethoprim sulphate, Zn-pyrithione, ciprofloxacin, norfloxacin, afloxacin, levofloxacin, gentamicin, tobramycin, neomycin, erythromycin, trimethoprim sulphate, polymixin B, and silver salts such as chloride, bromide, iodide and periodate; cytokines or chemoattractants; an anti-inflammatory protein; a steroidal antiinflammatory agent; or an anti-clotting agents, such as heparin. Other therapeutic 6A40151. DOCX 16Attorney Docket No. 06527-2505244agents that may promote immunogenicity of the described immunogen may also be included.

[0110] As used herein, administering a composition (e.g., an immunogenic composition, such as a vaccine) to a subject means to give, apply or bring the composition into contact with the subject. Administration can be accomplished by any of a number of routes, such as, for example, topical, oral, subcutaneous, intradermal intramuscular, transdermal, mucosal, intraperitoneal, intravenous, intrathecal, and intramuscular.

[0111] Coronaviruses (Coronoviridae) are members of the Nidovirales order, and are enveloped, non-segmented positive-sense RNA viruses. SARS-CoV, MERS-CoV, and SARS-CoV-2 are members of the betacoronavirus (or group 2 coronavirus) genera. Coronavirus proteins include, for example and without limitation, and among others: spike (S1 and S2) proteins, envelope (E) protein, membrane (M) protein, nucleocapsid (N) protein, ORFIab (ORFIa and ORF1b) polyproteins, ORF3 proteins, ORF6a proteins, ORF7a proteins, ORF7b proteins, ORF8 proteins, and ORF10 proteins, the sequences of which are broadly published and are freely available (See, e.g., GenBank Accession No. MT246667, including Version MT246667.1, “Severe acute respiratory syndrome coronavirus 2 strain FDAARGOS_983 isolate SARS-CoV-2 / human / USA / USA-WA1 / 2020”). Those of skill will appreciate that there may be various strains and / or isolates of coronaviruses (e.g., NCBI Reference Sequence: NC_045512.2, Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1 ), and that the modifications disclosed herein are expected to be useful in all of such strains. Accordingly, while the sequences provided in the attached figures and discussed below are those of strain FDAARGOS_983 isolate SARS-CoV-2 / human / USA / USA-WA1 / 2020, the disclosure should not be interpreted so narrowly. Immunogens may comprise any full-length or partial sequences of any coronavirus protein, or epitope(s) thereof.

[0112] A conservative substitution is a substitution of one amino acid residue in a protein sequence for a different amino acid residue having similar biochemical properties. Typically, conservative substitutions have little to no impact on the activity of a resulting polypeptide. For example, ideally, a coronavirus protein including one or more conservative substitutions (for example 1-10, 2-5, or 10-20, or no more than 2, 5, 10, 20, 30, 40, or 50 substitutions) retains the structure and function of the wild-type protein, namely, in the context of the present disclosure, the ability to elicit an 6A40151. DOCX 17Attorney Docket No. 06527-2505244immunological response, such as a neutralizing immunological response to SARS-CoV-2, e.g., the spike protein of SARS-CoV-2. A polypeptide can be produced to contain one or more conservative substitutions by manipulating the nucleotide sequence that encodes that polypeptide using, for example, standard procedures such as site-directed mutagenesis or PCR. In one example, such variants can be readily selected for additional testing by infecting cells with a virus containing a variant protein and determining its ability to replicate, by producing virus containing a variant protein and determining its virulence or cell-invasion properties, and / or by testing antibody cross-reactivity.

[0113] A nucleic acid molecule (a nucleic acid) refers to a polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. A nucleotide refers to a ribonucleotide, deoxynucleotide or a modified form of either type of nucleotide. The term “nucleic acid molecule” as used herein is synonymous with “nucleic acid” and “polynucleotide.” The term includes single- and double-stranded forms of DNA. A polynucleotide may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and / or non-naturally occurring nucleotide linkages. A “codon-optimized” nucleic acid refers to a nucleic acid sequence that has been altered such that the codons are optimal for expression in a particular system (such as a particular species or group of species). For example, a nucleic acid sequence can be optimized for expression in mammalian cells. Codon optimization does not alter the amino acid sequence of the encoded protein.

[0114] A first nucleic acid is said to be operably linked to a second nucleic acid when the first nucleic acid is placed in a functional relationship with the second nucleic acid. Generally, operably linked DNA sequences are contiguous (e.g., in c / s) and, where the sequences act to join two protein coding regions, in the same reading frame. Operably linked nucleic acids include a first nucleic acid contiguous with the 5' or 3' end of a second nucleic acid. In other examples, a second nucleic acid is operably linked to a first nucleic acid when it is embedded within the first nucleic acid, for example, where the nucleic acid construct includes (in order) a portion of the first nucleic acid, the second nucleic acid, and the remainder of the first nucleic acid.

[0115] A promoter is an array of nucleic acid control sequences which direct transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the start site of transcription. A promoter also optionally includes distal enhancer 6A40151. DOCX 18Attorney Docket No. 06527-2505244or repressor elements. A “constitutive promoter” is a promoter that is continuously active and is not subject to regulation by external signals or molecules. In contrast, the activity of an “inducible promoter” is regulated by an external signal or molecule (for example, a transcription factor).

[0116] A recombinant nucleic acid refers to a nucleic acid molecule (or protein or virus) that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e.g., by genetic engineering techniques such as those described in Sambrook et al., (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 1989. The term recombinant includes nucleic acids and proteins that have been altered solely by addition, substitution, or deletion of a portion of a natural nucleic acid molecule or protein.

[0117] “Sequence identity” refers to the similarity between nucleic acid or amino acid sequences is expressed in terms of the similarity between the sequences, otherwise referred to as sequence identity. Sequence identity may be measured in terms of percentage identity (or similarity or homology); the higher the percentage, the more similar the two sequences are. Homologs, orthologs, or variants of a polypeptide will possess a relatively high degree of sequence identity when aligned using standard methods. Methods of alignment of sequences for comparison are well-known in the art. Various programs and alignment algorithms are described in the art.: Smith & Waterman, Adv. Appl. Math. 2:482, 1981; Needleman & Wunsch, J. Mol. Biol. 48:443, 1970; Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85:2444, 1988; Higgins & Sharp, Gene, 73:237-44, 1988; Higgins & Sharp, CABIOS 5:151-3, 1989; Corpet et al., Nuc. Acids Res. 16:10881-90, 1988; Huang et al., Computer Appls. In the Biosciences 8, 155-65, 1992; and Pearson et al., Meth. Mol. Bio. 24:307-31, 1994. Altschul et al., J. Mol. Biol. 215:403-10, 1990, presents a detailed consideration of sequence alignment methods and homology calculations.

[0118] Once aligned, the number of matches may be determined by counting the number of positions where an identical nucleotide or amino acid residue is present in both sequences. The percent sequence identity is determined by dividing the number of matches either by the length of the sequence set forth in the identified sequence, or by an articulated length (such as 100 consecutive nucleotides or amino acid 6A40151. DOCX 19Attorney Docket No. 06527-2505244residues from a sequence set forth in an identified sequence), followed by multiplying the resulting value by 100. For example, a peptide sequence that has 1166 matches when aligned with a test sequence having 1554 amino acids is 75.0 percent identical to the test sequence (1166-1554*100=75.0). The percent sequence identity value is rounded to the nearest tenth. For example, 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2. The length value will always be an integer.

[0119] For sequence comparison of nucleic acid sequences, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are entered into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. Default program parameters are used. Methods of alignment of sequences for comparison are well known in the art. Optimal alignment of sequences for comparison can be conducted, e.g., by the local homology algorithm of Smith & Waterman, Adv. Appt. Math. 2:482, 1981, by the homology alignment algorithm of Needleman & Wunsch, J. Mol. Biol. 48:443, 1970, by the search for similarity method of Pearson & Lipman, Proc. Nat'l. Acad. Sci. USA 85:2444, 1988, by computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by manual alignment and visual inspection (see, e.g., Sambrook et al. (Molecular Cloning: A Laboratory Manual, 4th ed, Cold Spring Harbor, N. Y., 2012) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, through supplement 104, 2013)). One example of a useful algorithm is PILEUP. PILEUP uses a simplification of the progressive alignment method of Feng & Doolittle, J. Mol. Evol.35:351-360, 1987. The method used is similar to the method described by Higgins & Sharp, CABIOS 5:151-153, 1989. Using PILEUP, a reference sequence is compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps. PILEUP can be obtained from the GCG sequence analysis software package, e.g., version 7.0 (Devereaux et al., Nuc. Acids Res. 12:387-395, 1984).

[0120] Another example of algorithms that are suitable for determining percent sequence identity and sequence similarity are the BLAST and the BLAST 2.0 6A40151. DOCX 20Attorney Docket No. 06527-2505244algorithm, which are described in Altschul et al., J. Mol. Biol. 215:403-410, 1990 and Altschul et al., Nucleic Acids Res. 25:3389-3402, 1977. Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information (ncbi.nlm.nih.gov). The BLASTN program (for nucleotide sequences) uses as defaults a word length (W) of 11, alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands. The BLASTP program (for amino acid sequences) uses as defaults a word length (W) of 3, and expectation (E) of 10, and the BLOSUM62 scoring matrix (see Henikoff & Henikoff, Proc. Natl. Acad. Sci. USA 89: 10915, 1989). An oligonucleotide is a linear polynucleotide sequence of up to about 100 nucleotide bases in length.

[0121] As used herein, reference to “at least 80% identity” (or similar language) refers to “at least 80%, at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identity” to a specified reference sequence. As used herein, reference to “at least 90% identity” (or similar language) refers to “at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identity” to a specified reference sequence.

[0122] A “transformed” cell is a cell into which has been introduced a nucleic acid molecule (such as a heterologous nucleic acid) by any useful molecular biology technique. The term encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including, without limitation, transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, or particle gun acceleration.

[0123] A vector is a nucleic acid molecule allowing insertion of foreign nucleic acid without disrupting the ability of the vector to replicate and / or integrate in a host cell. A vector can include nucleic acid sequences that permit it to replicate in a host cell, such as an origin of replication. An insertional vector is capable of inserting itself into a host nucleic acid. A vector can also include one or more selectable marker genes and other genetic elements. An expression vector is a vector that contains the necessary regulatory sequences to allow transcription and translation of inserted gene or genes.

[0124] By "expression" or “gene expression,” it is meant the overall flow of information from a gene orfunctional / structural RNA, and a polyadenylation sequence, to produce a gene product (typically a protein, optionally post-translationally modified 6A40151. DOCX 21Attorney Docket No. 06527-2505244or a functional / structural RNA). A “gene” refers to a functional genetic unit for producing a gene product, such as RNA or a protein in a cell, or other expression system encoded on a nucleic acid and comprising: a transcriptional control sequence, such as a promoter and other c / s-acting elements, such as transcriptional response elements (TREs) and / or enhancers; an expressed sequence that may encode a protein (referred to as an open-reading frame or ORF), and a polyadenylation sequence. By "expression of genes under transcriptional control of," or alternately "subject to control by," a designated sequence such as TRE or transcription control element, it is meant gene expression from a gene containing the designated sequence operably linked (functionally attached, typically in c / s) to the gene. A "gene for expression of" a stated gene product is a gene capable of expressing that stated gene product when placed in a suitable environment--that is, for example, when transformed, transfected, transduced, etc. into a cell, and subjected to suitable conditions for expression. In the case of a constitutive promoter "suitable conditions" means that the gene typically need only be introduced into a host cell. In the case of an inducible promoter, "suitable conditions" means when factors that regulate transcription, such as DNA-binding proteins, are present or absent - for example an amount of the respective inducer is available to the expression system (e.g., cell), or factors causing suppression of a gene are unavailable or displaced - effective to cause expression of the gene.

[0125] Unless otherwise explained, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. It is to be understood that all base sizes or amino acid sizes, and all molecular weight or molecular mass values, given for nucleic acids or polypeptides are approximate, and are provided for description. Unless otherwise indicated, polymer molecular weight is expressed as number-average molecular weight (Mn). Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present disclosure, suitable methods and materials are described below. All publications, patent applications, patents, and other references mentioned herein are incorporated by reference in their entirety. In case of conflict, the present specification, including explanations of terms, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.6A40151. DOCX 22Attorney Docket No. 06527-2505244

[0126] Provided herein are modified coronaviruses, including HCoV-229E, HCoV-NL63, HCoV-OC43, HCoV-HKLH, SARS-CoV, SARS-CoV-2, and / or MERS-CoV viruses, that are replication defective (e.g., a virus that can infect a cell, but which cannot produce new viruses unless complemented with a gene and / or gene product). As used herein, the terms “replication-defective coronavirus” and “replication-defective coronavirus particle” are used interchangeably. Such viruses may be used as vaccines and in screening assays for potential therapeutics. Those of skill in the field will appreciate that, in view of the known, high degree of sequence homology between coronavirus genomes, the methods described herein may be applicable to other coronaviruses as well. In non-limiting embodiments, the coronavirus is SARS-CoV-2, having a genome that has a sequence of SEQ ID NO: 32, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 32.

[0127] In non-limiting embodiments, the replication-defective coronavirus is modified in its M gene. A non-limiting genetic map of a coronavirus genome, showing the location of the M gene, is shown in FIG. 7. The M gene encodes the M protein, which is a structural viral protein, believed to be critical for virus assembly and membrane budding. See, e.g., Siu et al. The M, E, and N structural proteins of the severe acute respiratory syndrome coronavirus are required for efficient assembly, trafficking, and release of virus-like particles. J. Virol. 82, 11318-11330 (2008). n non¬ limiting embodiments, the modification to the M gene results in a reduced expression of the M gene (e.g., reduced levels of M protein), compared to a coronavirus lacking the modification. Expression of the M gene may be reduced 100%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5% 1%, or any value or subrange therebetween. In non-limiting embodiments, the modification results in a level of functional M protein that is below that needed for the virus to replicate in a host cell, while other viral genes (e.g., ORF6) are substantially fully expressed. In non-limiting embodiments, the modification results in no detectable expression of the M gene by the modified virus.

[0128] In non-limiting embodiments, the modification to the M gene is a substitution, addition, or deletion of one or more nucleic acids of the M gene and / or a regulatory sequence associated therewith, for example the M gene transcription regulatory sequence (TRS). Those of skill in the art will appreciate that, in embodiments, any modification to the M gene and / or its TRS that results in decreased6A40151. DOCX 23Attorney Docket No. 06527-2505244expression of the M gene, but that does not affect expression of other coronavirus genes, falls within the scope of this disclosure.

[0129] In non-limiting embodiments, the M gene has a sequence of SEQ ID NO: 34, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, and / or SEQ ID NO: 76, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive. In nonlimiting embodiments, the M gene encodes a protein having the sequence of SEQ ID NO: 80, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 80, all values and subranges therebetween inclusive. In non-limiting embodiments, the M gene TRS has a sequence of S'-CUAAAC-S' or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to S’-CUAAAC-S', all values and subranges therebetween inclusive.

[0130] In non-limiting embodiments, the modification is a deletion of one or more nucleic acids of the M gene (e.g., SEQ ID NO: 34, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, and / or SEQ ID NO: 76, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive) and / or the M gene TRS (or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to the TRS, all values and subranges therebetween inclusive). In non-limiting embodiments, the modification is a deletion of substantially the entire M gene TRS and at least the first 1, 5, 10, 15, 20, 25, 50, 100, 150, 200, 250, 300, 350, 400, 450, and / or 476 nucleic acids of the M gene (e.g., SEQ ID NO: 34, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, and / or SEQ ID NO: 76 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive). In non-limiting embodiments, the deletion is of the entire M gene. In non-limiting embodiments, the modification is a deletion of no more than the first 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, and / or 665 nucleic acids of the nucleic acid sequence of SEQ ID NO: 34, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, and / or SEQ ID NO: 76, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence thereto, all values and subranges therebetween inclusive. In non-limiting embodiments, the modification is a deletion of at least some, in non-limiting embodiments all, of the M gene TRS. In non-limiting 6A40151. DOCX 24Attorney Docket No. 06527-2505244embodiments, the modification is a substitution in the M gene TRS, such that the TRS no longer has sequence homology with the SARS-CoV-2 TRS-L 5’ leader sequence, such that M gene sgRNA is not created and the M gene is not expressed. In nonlimiting embodiments, the modification is the deletion of only the ATG start codon of the M gene. In non-limiting embodiments, the modification is a deletion of substantially, in non-limiting embodiments all, of the nucleic acids between the M gene TRS and the M gene. In non-limiting embodiments, the modification is the insertion of one or more stop codons (or substitutions to produce one or more stop codons) within the M gene. In non-limiting embodiments, the M gene may be replaced by another gene, for example a reporter gene. In non-limiting embodiments, the modification is a relocation of the ORF6 gene TRS. For example, and without limitation, the ORF6 gene TRS could be moved to a position 3’ of the M gene. In non-limiting embodiments, at least 42 nucleic acids of the M gene remain in the modified coronavirus genome following the modification. In non-limiting embodiments, the modification of the M gene and / or the M gene TRS is such that the secondary structure of the viral genome is not substantially different from a coronavirus that is not so modified. In non-limiting embodiments, the modified M gene has the sequence of SEQ ID NO: 42 and / or SEQ ID NO: 67, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence thereto, all values and subranges therebetween inclusive.

[0131] In non-limiting embodiments, the modified M gene has a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity, all values and subranges therebetween inclusive, to SEQ ID NO: 34, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, and / or SEQ ID NO: 76, with mutation that causes a substitution in an amino acid of SEQ ID NO: 80 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive. In non-limiting embodiments the substitution is a P132S, an S99A, and / or a R44S substitution.

[0132] Those of skill will appreciate that due to a sequence homology in the M protein between coronaviruses (e.g., about 90%, see Gorkhali et al., Structure and Function of Major SARS-CoV-2 and SARS-CoV Proteins. Bioinform Biol. Insights 15, 2021)), other coronaviruses, as well as novel coronaviruses that have not yet been discovered, may be rendered replication defective by modifications as described herein without undue experimentation.6A40151. DOCX 25Attorney Docket No. 06527-2505244

[0133] In non-limiting embodiments, a modified, replication-defective coronavirus may further include a modification to the coronavirus E gene, such that the coronavirus exhibits a reduced expression of the E gene (e.g., reduced levels of E protein) as compared to a coronavirus lacking the modification. As with the modification to the M gene described above, expression of the E gene may be reduced 100%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 1%, or any value or subrange therebetween. In non-limiting embodiments, the modification results in a level of functional E protein that is below that needed for the virus to replicate in a host cell, while other viral genes (other than the M gene) are substantially fully expressed. In non-limiting embodiments, the modification of the M gene, E gene, M gene TRS, and / or E gene TRS (e.g., 5’-CUAAAC-3') is such that the secondary structure of the viral genome is not substantially different from a coronavirus that is not so modified.

[0134] In non-limiting embodiments, the E gene has a sequence of SEQ ID NO: 33, SEQ ID NO: 41, and / or SEQ ID NO: 74, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive. In non-limiting embodiments, the modification is a deletion of one or more nucleic acids of SEQ ID NO: 33, SEQ ID NO: 41, and / or SEQ ID NO: 74, (or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive). In non-limiting embodiments, the modification is a deletion of substantially the entire E gene and / or a TRS associated with the E gene, in non-limiting embodiments the modification is a deletion of the entire E gene. Modifications to the E gene may be accomplished using techniques, for example as shown in DeDiego et al., A severe acute respiratory syndrome coronavirus that lacks the E gene is attenuated in vitro and in vivo. J Virol 2007, 81: 1701-1713.

[0135] Those of skill will appreciate that due to a sequence homology in the E protein between coronaviruses (e.g., about 95%, see Gorkhali et al., Structure and Function of Major SARS-CoV-2 and SARS-CoV Proteins. Bioinform Biol. Insights 15, 2021)), other coronaviruses, as well as novel coronaviruses that have not yet been discovered, may be rendered replication defective by modifications as described herein without undue experimentation.

[0136] Also provided herein are pharmaceutical compositions including a replication-defective virus, or virus particle, as described herein. Suitable 6A40151. DOCX 26Attorney Docket No. 06527-2505244pharmaceutical compositions may include any useful pharmaceutically-acceptable carrier or excipient, and may be formulated for any useful route of administration, including oral, subcutaneous, intradermal, intramuscular, transdermal, intravenous, intraocular, inhalation, insufflation, and / or mucosal delivery. Those of skill will appreciate that pharmaceutically-acceptable carrier or excipients are known, as are methods for producing pharmaceutical compositions for various routes of delivery, for example as set forth in Remington: The Science and Practice of Pharmacy, The University of the Sciences in Philadelphia, Editor, Lippincott, Williams, & Wilkins, Philadelphia, Pa., 21st Edition (2005).

[0137] Modified coronaviruses as described herein may be useful in screening assays, for example, in assays for identifying active agents, for example therapeutic compositions, that bind to and / or depend on expression of the M gene and / or expression of the E gene and the M gene, for efficacy. Thus, in non-limiting embodiments, provided herein is a screening method that includes exposing a replication-defective coronavirus as described herein with an active agent. Suitable active agents may be binding reagents, for example an antibody or a fragment thereof. As used herein, the term “antibody” means an immunoglobulin molecule produced by B lymphoid cells with a specific amino acid sequence. As used herein, the term “antibody fragment” refers to any derivative of an antibody which is less than full-length. In exemplary embodiments, the antibody fragment retains at least a significant portion of the full-length antibody's specific binding ability. Examples of antibody fragments, but are not limited to, Fab, Fab', F(ab')2, Fv, Fd, dsFv, scFv, diabody, triabody, tetrabody, di-scFv (dimeric single-chain variable fragment), bi-specific T-cell engager (BiTE), single-domain antibody (sdAb), nanobody, or antibody binding domain fragments. The antibody fragment may be produced by any means. For instance, the antibody fragment may be enzymatically or chemically produced by fragmentation of an intact antibody, or it may be recombinantly or synthetically produced. The antibody fragment may optionally be a single chain antibody fragment. Alternatively, the fragment may comprise multiple chains which are linked together, for instance, by disulfide linkages. The fragment may also optionally be a multi-molecular complex. A functional antibody fragment may consist of at least about 50 amino acids or at least about 200 amino acids. Antibody fragments also include miniaturized antibodies or other engineered binding reagents, such as scFvs, that exploit the modular nature of antibody structure, comprising, often as a single chain, 6A40151. DOCX 27Attorney Docket No. 06527-2505244one or more antigen-binding or epitope-binding (e.g., paratope) sequences and, at a minimum, any other amino acid sequences needed to ensure appropriate specificity, delivery, and stability of the composition. In non-limiting embodiments, the binding reagent may be an scFv, a nanobody, and / or an aptamer.

[0138] Antibodies may be evoked in humans or other animals by a specific antigen (immunogen). Antibodies are characterized by reacting specifically with the antigen in some demonstrable way, antibody and antigen each being defined in terms of the other. “Eliciting an antibody response” refers to the ability of an antigen or other molecule to induce the production of antibodies.

[0139] Accordingly, also provided herein are methods of screening compositions for efficacy in neutralizing a coronavirus and / or treating a disease caused by a coronavirus. Suitable methods may include exposing a replication-defective virus or viral particle as described herein to a potential therapeutic composition. The method may include assessing efficacy of the potential therapeutic composition across a plurality of dosages (e.g., weights, volumes, and / or concentrations). In non-limiting embodiments, the replication-defective virus or viral particle may be modified, for example on a temporally-limited basis, by supplying the M protein. In non-limiting embodiments, efficacy may thus be determined when replication of the replicationdefective coronavirus (supplied with the M protein) is decreased relative to a coronavirus lacking the original modification (e.g., the modification resulting in a replication-defective virus, for example a modification in the M gene and / or M protein).

[0140] The potential therapeutic may be any composition that may be believed to be efficacious against the coronavirus, for example a binding reagent, such as an antibody or a fragment thereof.

[0141] In non-limiting embodiments, the potential therapeutic is a coronavirus inhibitor or a purported coronavirus inhibitor, a small molecule drug, a cocktail of monoclonal antibodies (REGN-COV2), and / or the like. Inhibitors of coronaviruses are known, and include, without limitation, antivirals that target RNA-dependent and RNA polymerase (RdRp), including remdesivir, nirmatrelvir, favipiravir, and galidesiv. Potential inhibitors (e.g., potential therapeutics) may be used in screening assays disclosed herein to determine efficacy and / or required proteins / domains, such as the M protein or the M protein and the E protein, and may be identified as is known in the art, for example as set forth in Southey et al., Introduction to small molecule drug discovery and preclinical development, Front. Drug Discov. 3:1314077. Efficacy of 6A40151. DOCX 28Attorney Docket No. 06527-2505244potential therapeutics, such as inhibitors, may be assessed based on infectivity, which may be determined based on known assays, for example those measuring titer and / or expression of reporter or viral proteins in cells, for example RT-PCR, qRT-PCR, and / or those based on fluorescent and / or bioluminescent proteins, such as NLuc, mNeonGreen, and / or those for the expression of viral proteins by methods such as immunoblotting, flow cytometry, immunofluorescence, or ELISA (enzyme-linked immunosorbent assay). Efficacy of potential therapeutics could also be measured by examining the effects of infection on the cells by, for example, visual examination of cytopathic effect (CPE) or syncytia formation, cellular production of lactate dehydrogenase (LDH), cytokines, interferons, and / or the like. In non-limiting embodiments, for example as described herein, a replication-defective coronavirus may be complemented with a nucleic acid encoding an M and / or E gene that includes one or more additions, deletions, and / or substitutions, thereby encoding an M and / or E protein with one or more additions, deletions, or substitutions. Such modified M and / or E proteins may be used in assays for evaluating potential therapeutics.

[0142] In non-limiting embodiments, a screening method includes exposing a replication-defective coronavirus as disclosed herein (e.g., HCoV-229E, HCoV-NL63, HCoV-OC43, HCoV-HKU1, SARS-CoV, SARS-CoV-2, and / or MERS-CoV, and / or the like) with a binding reagent, followed by introducing the replication-defective coronavirus to a cell, for example a cell (e.g. a Vero cell, a HEK cell, a BHK cell, and / or the like) modified to conditionally and / or inducibly express coronavirus M and / or E protein. Infectivity (e.g., replication) of the replication-defective coronavirus may then be assessed using any suitable method, for example RT-PCR, qRT-PCR, nLuc and / or mNeonGreen activity, and the like know to those of skill in the art, for example as set forth in Bland et al., A Multiplex One-Step RT-qPCR Protocol to Detect SARS-CoV-2 in NP / OP Swabs and Saliva. Curr Protoc. 2021 May;1(5):e145. For example, in nonlimiting embodiments, a potential therapeutic composition may be determined to require the expression of the M gene for efficacy where infectivity (e.g., replication) is decreased relative to a wild-type virus (e.g., a coronavirus lacking the modification(s) described herein).

[0143] In non-limiting embodiments, a screening method includes introducing a replication-defective coronavirus as disclosed herein (e.g., HCoV-229E, HCoV-NL63, HCoV-OC43, HCoV-HKU1, SARS-CoV, SARS-CoV-2, and / or MERS-CoV, and the like) to a cell, for example a cell (e.g. a Vero cell, a HEK cell, a BHK cell, and / or the 6A40151. DOCX 29Attorney Docket No. 06527-2505244like) modified to conditionally and / or inducibly express coronavirus M and / or E protein, followed by exposing the infected cell to a potential therapeutic, for example a potential coronavirus inhibitor or a known coronavirus inhibitor. Infectivity (e.g., replication) of the replication-defective coronavirus may then be assessed using any suitable method, for example RT-PCR, qRT-PCR, an assay based on fluorescent and / or bioluminescent proteins (such as NLuc, mNeonGreen, and the like), enzyme reporters (e.g., beta-galactosidase, chloramphenicol, acetyltransferase, and the like), immunoblotting, flow cytometry, immunofluorescence, and / or ELISA.

[0144] In non-limiting embodiments, the method may be a multiplexed method, whereby a plurality of potential therapeutic compositions may be screened. In nonlimiting embodiments, the method is performed in a multiplexed assay in which at least two different compositions are screened at different addressable locations (e.g., of the virus).

[0145] Also provided herein are methods of modifying a coronavirus as described herein (e.g., HCoV-229E, HCoV-NL63, HCoV-OC43, HCoV-HKU1, SARS-CoV, SARS-CoV-2, and / or MERS-CoV, and the like) to render the virus replication defective. Such methods may include introducing at least one modification to the coronavirus genome that results in a reduced expression of the M gene and / or the E gene compared to a coronavirus lacking the modification. In non-limiting embodiments, suitable methods may include modifying the coronavirus genome, to provide modifications as described herein (e.g., additions, deletions, and / or substitutions in the M gene, the M gene TRS, the E gene, and / or the E gene TRS that do not substantially impair expression of other coronavirus genes). In non-limiting embodiments, the modification may include at least one substitution and / or deletion in the transcription regulatory sequence (TRS) of the M gene and / or the E gene, and, in non-limiting embodiments, a deletion of substantially the entire TRS of the M gene and / or the E gene.

[0146] In non-limiting embodiments, a replication-defective coronavirus may be engineered through use of an artificial chromosome, such as a bacterial artificial chromosome (BAC), for example as described in Chiem et al., Generation of recombinant SARS-CoV-2 using bacterial artificial chromosome, Curr. Protoc. Microbiol. 2020, 59(1): e126. In non-limiting embodiments, the BAC may be based on the US / WA-1 / 2020 strain of SARS-CoV-2. In non-limiting embodiments, other strains,6A40151. DOCX 30Attorney Docket No. 06527-2505244as well as other coronaviruses including human coronaviruses, zoonotic coronaviruses, and / or as-yet undiscovered coronaviruses) may be utilized.

[0147] In non-limiting embodiments, the method may include introducing at least one substitution and / or deletion in the nucleic acid sequence of SEQ ID NO: 34, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 67, SEQ ID NO: 76, and / or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive. In nonlimiting embodiments, the modification may be a deletion of at least one nucleic acid in the nucleic acid sequence of SEQ ID NO: 34, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 67, SEQ ID NO: 76, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive.

[0148] In non-limiting embodiments, the method of generating a replicationdefective virus may include modifying an M gene with a mutation that causes a substitution in an amino acid of SEQ ID NO: 80 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive. In non-limiting embodiments the substitution is a P132S, an S99A, and / or a R44S substitution.

[0149] In non-limiting embodiments, the modification is one that is described herein. In non-limiting embodiments, the modification may be a deletion of at least nucleic acids 1-467 of the nucleic acid sequence of SEQ ID NO: 34, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 76, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive. In non-limiting embodiments, the modified nucleic acid has the sequence of SEQ ID NO: 42 and / or SEQ ID NO: 67 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive.

[0150] In non-limiting embodiments the modification is a deletion of no more than the first 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, and / or 665 nucleic acids of the nucleic acid sequence of SEQ ID NO: 34, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 76, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto.6A40151. DOCX 31Attorney Docket No. 06527-2505244

[0151] Also provided herein are kits that may include a replication-defective coronavirus according to any non-limiting embodiment described herein. Suitable kits may include one or more viruses or virus particles as described herein, in a dried state, or in a pharmaceutically-acceptable carrier or excipient.

[0152] Also provided herein are recombinant cells, for example recombinant mammalian cells, which may be modified to express an M gene (from the same coronavirus, strain, variant, and / or isolate as the replication-defective coronavirus, or a different coronavirus, strain, variant, and / or isolate) and / or an E gene (from the same strain as the replication-defective coronavirus, or a different strain, variant, and / or isolate) of a coronavirus. Recombinant technology is known to those of skill in the art, and, as noted herein, exemplary sequences for the coronavirus M (e.g., SEQ ID NO: 34) and E (e.g., SEQ ID NO: 33) genes are known. In non-limiting embodiments, the cell is transduced with a viral vector having the sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 36, and / or SEQ ID NO: 38, or a vector having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive. Such cells may be useful for, among other purposes, complementing a replication-defective coronavirus as described herein, to provide the M gene / M protein and / or E gene / E protein, to allow for assessment of the efficacy of potential therapeutics on, among other characteristics of a coronavirus, ability to replicate.

[0153] In non-limiting embodiments, a recombinant cell may include a nucleic acid encoding a reporter protein, for example a mRuby3 fluorescent reporter protein, in any location within the genome. In non-limiting embodiments, the cell may include a different fluorescent reporter protein or a different type of reporter protein, or no reporter protein could be used. In non-limiting embodiments, the recombinant cell may include a nucleic acid encoding a T2A peptide, for example as a spacer or separator between a nucleic acid encoding a reporter (e.g., mRuby) and the nucleic acid encoding the M protein. In non-limiting embodiments, the cell may include a nucleic acid encoding different 2A peptide, and / or may include a self-cleaving ribozyme such as the Hepatitis Delta Virus (HDV) ribozyme or Hammerhead ribozyme, or with an internal ribosome entry site (IRES).

[0154] In non-limiting embodiments, the cell may include a mRuby3-T2A-coM M-expression payload. In non-limiting embodiments, such a payload could be altered to6A40151. DOCX 32Attorney Docket No. 06527-2505244produce mRNA that resembles a SARS-CoV-2 subgenomic RNA (sgRNA) rather than a host cell mRNA.

[0155] In non-limiting embodiments, the cell may include a codon-optimized nucleic acid encoding the M (and / or E) protein. In non-limiting embodiments, the nucleic acid may include the original M (and / or E) gene nucleic acid.

[0156] In non-limiting embodiments, the cell may be transformed and / or transduced with a lentiviral vector. In non-limiting embodiments, the cell may be transformed and / or transduced with a different type of viral vector, such as those based on adenoviruses and / or others known in the art.

[0157] In non-limiting embodiments, an antibiotic resistance cassette may be included, to allow for antibiotic selection of cells successfully transduced with the M (and / or E) trans-complementation payload. In non-limiting embodiments, no antibiotic selection could be performed, and instead an M (and / or E)-expressing cell population may be enriched using as clonal selection or cell sorting as is known in the art.

[0158] In non-limiting embodiments, gene knock-in of an M (and / or E) gene into cells may be used, for example with CRISPR-Cas9 as is known in the art.

[0159] In non-limiting embodiments, expression of the M gene may be constitutive. In non-limiting embodiments, expression of the M gene may be transient. Such transient expression may be based on lentiviral vectors, adenoviral vectors, and / or plasmids (introduced into the cell, for example, by lipofection, nucleofection, electroporation, and other methods known to those of skill in the art).

[0160] In non-limiting embodiments, a cell may be modified to provide an M gene with one or more amino acid substitutions, for example one or more amino acid substitutions that affect binding and / or interaction of potential therapeutics to the coronavirus. In non-limiting embodiments, the modification may be a P132S substitution, an S991 substitution, and / or an R44S substitution (in an amino acid sequence of SEQ ID NO: 80, or an amino acid sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive). In non-limiting embodiments, the cell is transduced with a vector having a nucleic acid sequence of SEQ ID NO: 3, SEQ ID NO: 4, and / or SEQ ID NO: 36, or a vector having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive.

[0161] In non-limiting embodiments the cell is a Vero cell, a BHK cell, and / or a HEK cell, though those of skill in the art will appreciate that other options are available.6A40151. DOCX 33Attorney Docket No. 06527-2505244In non-limiting embodiments the cell is modified to express the M gene and / or E gene, where one or both may be codon-optimized for the recombinant cell type, under control of an inducible promotor. Inducible promotors are known to those of skill in the art and include, without limitation, antibiotic-inducible promotors, such as doxycycline-inducible promotors.

[0162] Also provided herein are methods of making a recombinant cell to produce a replication-defective virus as described herein. In non-limiting embodiments, the method may include introducing into the cell a viral vector having the sequence of SEQ ID NO: 1 and / or SEQ ID NO: 37, or a viral vector having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive. Kits including a vector and non-recombinant cells, or recombinant cells, are also provided. A kit may further include a vector including a gene encoding the M gene and / or the E gene, for generating a recombinant cell expressing the M gene and / or the E gene (with or without the respective TRS) as described herein (e.g., a viral vector having the sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 36, and / or SEQ ID NO: 38, or a vector having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive). In non-limiting embodiments the gene is the M gene (with or without the M gene TRS) and the kit includes a nucleic acid, virus, plasmid, artificial chromosome (e.g., a BAC), and / or vector including the nucleic acid of SEQ ID NO: 34, SEQ ID NO: 52, SEQ ID NO: 56, SEQ ID NO: 60, SEQ ID NO: 64, SEQ ID NO: 67, and / or SEQ ID NO: 76, or a nucleic acid having least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive. The nucleic acid may include the M gene TRS.

[0163] In non-limiting embodiments the gene is the E gene (with or without the E gene TRS) and the kit includes a nucleic acid, virus, plasmid, artificial chromosome (e.g., a BAC), and / or vector as described herein (e.g., a viral vector having the sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 36, and / or SEQ ID NO: 38, or a vector having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive). In nonlimiting embodiments, the kit includes a nucleic acid, virus, plasmid, artificial chromosome (e.g., a BAC), and / or vector having the nucleic acid of SEQ ID NO: 33, SEQ ID NO: 41, and / or SEQ ID NO: 74, or a sequence having at least 70%, 75%,6A40151. DOCX 34Attorney Docket No. 06527-250524480%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive. The nucleic acid may include the E gene TRS.

[0164] Also provided herein are recombinant cells, for example those transformed and / or transduced (or otherwise modified), for example by a method as described herein, to produce a replication-defective coronavirus as described herein. In nonlimiting embodiments, the recombinant cell may be transduced by introducing into the cell a viral vector encoding a replication-defective coronavirus as described herein. In non-limiting embodiments, the viral vector may have a nucleic acid sequence of SEQ ID NO: 1 and / or SEQ ID NO: 37, or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity thereto, all values and subranges therebetween inclusive.

[0165] In non-limiting embodiments, a replication-defective coronavirus as described herein may be used in a pharmaceutical composition. In non-limiting embodiments, the pharmaceutical composition may be configured for subcutaneous, intradermal, intramuscular, transdermal, intravenous, oral, intraocular, inhalation, insufflation, and / or mucosal delivery to a patient. In non-limiting embodiments, the pharmaceutical may be a vaccine, for immunization against a coronavirus. In nonlimiting embodiments, the pharmaceutical composition may include a pharmaceutically acceptable excipient, as is known in the art.

[0166] In non-limiting embodiments, a replication-defective coronavirus as described herein may be “rescued” (e.g., the ability to replicate in a host cell) may be restored by introducing the virus into a cell, for example a recombinant cell, that expresses the M gene (e.g., produces M protein). Accordingly, in non-limiting embodiments, also provided herein is a recombinant (e.g., transformed) cell, for example a recombinant mammalian cell, that is genetically modified to express the coronavirus M gene. In non-limiting embodiments, the M gene is codon optimized. In non-limiting embodiments, the recombinant cell also expresses the E gene, which may, in non-limiting embodiments, be codon optimized. In non-limiting embodiments, the M gene and / or the E gene may be under the control of an inducible promotor. Suitable inducible promotors are known to those of skill in the art. In non-limiting embodiments, the M gene and / or the E gene is under control of a doxycycline-inducible promotor. In non-limiting embodiments the cell may be a Vero cell, a BHK cell, and / or an HEK (e.g., HEK 293) cell. In non-limiting embodiments, a replicationdefective coronavirus as described herein may be provided with a recombinant cell as 6A40151. DOCX 35Attorney Docket No. 06527-2505244described herein, for example in a kit. In non-limiting embodiments, a kit may include a replication-defective coronavirus and a vector, plasmid, virus, and / or artificial chromosome (e.g., a bacterial artificial chromosome and / or a yeast artificial chromosome) that includes a nucleic acid comprising the coronavirus M gene, the coronavirus E gene, the coronavirus M gene TRS, and / or the coronavirus E gene TRS. In non-limiting embodiments, the nucleic acid has the sequence of SEQ ID NO: 34.Example 1Materials and MethodsSARS-CoV-2 bacterial artificial chromosome (BAC)

[0167] We developed a BAC system encoding the USA_WA1 / 2020 viral genome, which was obtained as 7 individual cDNA fragments each within pUC57 or pCC1 BAC via a Materials Transfer Agreement from the University of Texas Medical Branch. ORF7a / b had been replaced by the mNeonGreen (mNeon) reporter gene. This SARS-CoV-2 BAC system can be used to produce virus in cells via RNA transfection or DNA transfection. First, the entire SARS-CoV-2 genome was produced with the nanoluciferase (nLuc) reporter gene in place of mNeon. With Gibson cloning, we replaced the mNeon gene in fragment 7 with the codon-optimized nano-luciferase (nLuc) gene from a lentiviral genome (pNL4-nLucCO-6ATRi-BAL) that we previously produced.

[0168] SARS-CoV-2 genome fragments 1-4 and fragments 5-7 were each assembled using the Golden Gate Assembly kit per the manufacturer’s instructions (NEB; FIG. 1). A mammalian expression cassette was produced via gene synthesis (GenScript) and cloned into pCC1 BAC. This was engineered so that the CMV and T7 promoters were added upstream of the viral genome leader sequence and the polyA(29) tail, HDV ribozyme, and bovine hormone polyadenylation signal sequences were added downstream of the 3' UTR. The new mammalian expression BAC was digested with BsiWI and Xhol and incubated with digested fragments 1-4 (BsiWI restriction enzyme) and fragments 5-7 (Xhol restriction enzyme) together with T4 ligase to produce the full SARS-CoV-2 genome with a nLuc reporter (FIG. 1).AM SARS-CoV-2 BAC

[0169] We designed a BAC system in which the M gene was eliminated by deletion of both its transcription regulatory sequence (TRS) and the first 476 bp of the gene. The remaining 190 bp of M was left intact to preserve the TRS for expression of the ORF6 gene (FIG. 2, top panel). To produce AM SARS-CoV-2, fragment 7 from UTMB was PCR amplified and Topo cloned into pCR2.1-TOPO (ThermoFisher Scientific).6A40151. DOCX 36Attorney Docket No. 06527-2505244Deletion of M was performed by Gibson cloning. The fragments were then assembled as described above. AEAM SARS-CoV-2 was produced in a similar manner with Gibson cloning primers to remove the TRS and the first 186 bases of the E gene in fragments 6 and 7.Cells

[0170] Vero E6 cells are African green monkey (Cercopithecus aethiops) kidney cells (ATCC), BHK cells are Syrian hamster (Mesocricetus auratus) kidney cells, and HEK 293T cells are human epithelial cells. These cells were grown in Dulbecco's Modified Eagle Medium (DMEM) containing 10% fetal bovine serum (FBS; Atlanta Biologicals), 100 ll / rnl penicillin, 100 pg / ml streptomycin, and 2 mM L-glutamine (PSG; ThermoFisher Scientific), termed DMEM-10 medium, at 37°C and 5% CO2. Vero E6 cells expressing human ACE-2 and TMPRSS2 (Vero E6-hAT cells) were obtained from BEI Resources and grown in DMEM-10 supplemented with 10 pg / ml puromycin.

[0171] Cells transduced with pLVX-TetOne vectors were maintained in DMEM-10 supplemented with either 3 pg / ml puromycin (BHK) or 500 pg / ml G418 (Vero E6-hAT). Induction of TetOne was induced with 100 ng / ml doxycycline 48h prior to use, which was maintained throughout the course of the experiment.Inducible M expression constructs with or without E

[0172] To trans-complement AM SARS-CoV-2 with M in cells, a lentiviral vector was produced for expression of the fluorescent reporter gene mRuby3 and codon-optimized SARS-CoV-2 M (coM) separated by a T2A peptide, for co-translation of both mRuby3 and M, and under a doxycycline-inducible promoter (FIG. 2, bottom panel). pLVX-TetOne-Puro-mRuby3co-T2A-SARS2-coM was produced by gene synthesis by modification of the pLVX-TetOne-Puro-hAXL plasmid (Addgene) and Gibson cloning of the codon-optimized version of the Wuhan HU1 (identical to 2019-nCoV / US / WA1) obtained from Addgene. A variation was produced to replace the puromycin resistance gene with the G418 resistance gene to produce pLVX-TetOne-G418-mRuby3co-T2A-coM.

[0173] Similarly, co-expression of codon-optimized M and E was performed for rescue of AEAM SARS-CoV-2 infectivity. The above plasmids were modified by Gibson cloning, such that M and E were separated by an internal ribosome entry site (FIG. 2, bottom panel). The resulting plasmids were designated pLVX-TetOne-Puro / G418-mRuby3co-T2A-SARS2-coM-i-coE.6A40151. DOCX 37Attorney Docket No. 06527-2505244

[0174] pLVX viruses were produced by Lipofectamine 2000 (ThermoFisher Scientific) transfection in 293T cells with the psPAX2 lentiviral packaging plasmid and the pL-VSV-G plasmid. Virus was harvested 48h later.

[0175] After transfection of BHK cells via Lipofectamine or stable transduction of BHK and Vero E6-hAT cells followed by 48h of induction with doxycycline, expression of mRuby3 and coM was assessed. mRuby3 expression was assessed by fluorescence microscopy and flow cytometry. coM expression was assessed by quantitative RT-PCR.Production of SARS-CoV-2 virions

[0176] Transfection of 20 pg viral cDNA into 4 x 106BHK cells in a 10 cm dish was performed with Lipofectamine 2000. The medium was removed after 24h and the cells were split 1:2 and overlaid onto two plates each of 5 x 106Vero E6-hAT cells. The cells were incubated for 3 days. Supernatants were harvested and aliquoted frozen at -80°C or lysed in TRIzol-LS (ThermoFisher Scientific). For AM SARS-CoV-2 or AEAM SARS-CoV-2 virus production, transfections were performed in BHK and Vero E6-hAT cells stably transduced with mRuby3-T2A-coM or mRuby3-T2A-coM-i-coE and induced with doxycycline.SARS-CoV-2 replication and passaging

[0177] To characterize AM SARS-CoV-2 and compare it to WT SARS-CoV-2, each virus was produced via BAC transfection, which were passaged on Vero E6-hAT cells with or without stable, doxycycline-induced expression of mRuby3-T2A-coM for 3 days for three independent passages (FIG. 3). Cells were maintained in doxycycline (+M) or without doxycycline (-M) for the passages. This was performed in three independent experiments.Nanoluciferase assay

[0178] nLuc from transfected or infected cells was measured by lysing cells in Nano-Gio Luciferase Assay Buffer (Promega), incubation with Nano-Gio Luciferase Assay Substrate (Promega), and detection on a BioTek Synergy2 Multi-Detection Microplate Reader.RT-PCR

[0179] RNA was isolated from Trizol-treated virus or cell lysates as previously described. RT-PCRs were performed using primers shown in Table 1 and PCR reactions were run on an agarose gel for visualization. Quantitative RT-PCRs were6A40151. DOCX 38Attorney Docket No. 06527-2505244performed using primers and probes listed in Table 1 with plasmids used as standards and run on a Bio-Rad CFX96 Real-Time PCR System.Table 1Gene Use Forward primer (5' - Reverse primer (5' Probe (5'-FAM > 3') -> 3') -> 3'-BHQ1) ORF1a gRNA gel GGCCAATTCTGCT CAGTGCAAGCAGT GTCAAATTA (SEQ TTGTGTAG (SEQID NO: 5) ID NO: 6)S sgRNA gel CCAACCAAC I I I C TGATTCTCTTCCTGATCTC (SEQ ID GTTCC (SEQ IDNO: 7) NO: 8)ORF3a sgRNA gel CCAACCAAC I I I C C l I I IACTCCAGATGATCTC (SEQ ID TCCC (SEQ ID NO:NO: 9) 10)E sgRNA gel CCAACCAAC I I I C GAAGG I I I IACAAGATCTC (SEQ ID GACTCACG (SEQNO: 11) ID NO: 12)M sgRNA gel CCAACCAAC I I I C CGGTGATCCAATTGATCTC (SEQ ID TATTCTG (SEQ IDNO: 13) NO: 14)ORF6 sgRNA gel CCAACCAAC I I I C TCTCCATTGGTTGGATCTC (SEQ ID CTCTTC (SEQ IDNO: 15) NO: 6)nLuc sgRNA gel CCAACCAAC I I I C AACCCCATCAATTAGATCTC (SEQ ID CCAG (SEQ ID NO:NO: 17) 18)ORF8 sgRNA gel CCAACCAAC I I I C CGCACTACAAGACGATCTC (SEQ ID TACCCA (SEQ IDNO: 19) NO: 20)N sgRNA gel CCAACCAAC I I I C GAGGAAGTTGTAGGATCTC (SEQ ID CACGA (SEQ IDNO: 21) NO: 22)ORF1a qRT-PCR GGCCAATTCTGCT CAGTGCAAGCAGT ACAGATGTCT GTCAAATTA (SEQ TTGTGTAG (SEQ TGTGCTGCC ID NO: 23) ID NO: 24) GGTA(SEQ ID NO: 25) M qRT-PCR GTTAAI I I I CC I C I CGGTGATCCAATT TG I I I I GTGC GGCTG (SEQ ID TATTCTG (SEQ ID TTGCTGCTGT NO: 26) NO: 27) (SEQ ID NO:28)coM qRT-PCR CGTGGAGGAACTG CTGTTGCGGTTAG GCTTCCTGTT AAGAAGC (SEQ ID CGTAGG (SEQ ID CCTGACCTG NO: 29) NO: 30) GATCTGC (SEQ ID NO:31)Plaque assay6A40151. DOCX 39Attorney Docket No. 06527-2505244

[0180] Vero E6-hAT cells were plated at 1 x 106cells / well overnight in 6-well plates. Virus was diluted in 10-fold serial dilutions in OptiMEM medium (ThermoFisher Scientific) + 2% FBS. Medium was removed from the cells and 200 pl virus dilutions were added in duplicate to the wells and incubated at 37°C, 5% CO2 for 1 h, with plates tilted every 15 min. The virus was removed from all wells and cells were washed once with phosphate buffered saline (PBS) before overlay with 3 ml of 1.25% colloidal microcrystalline cellulose (Avicel; Millipore Sigma) in EMEM medium with 10% FBS, PSG, and NEAA. Plates were incubated 2-5 days and the Avicel was removed in PBS. Cells were fixed in 10% formalin for 24h at room temperature. Wells were washed with PBS and stained with 0.2% crystal violet in 25% methanol for 15 min at room temperature. Stained plates were washed in water to remove excess stain and allowed to air dry overnight. Plaques were imaged on a scanner and counted.Electron microscopy

[0181] SARS-CoV-2 virions were fixed in equal volumes of 4% paraformaldehyde with 10 mM HEPES for 48h and ultracentrifuged at 117,250 x g. Samples were provided to Dr. James Conway, Department of Structural Biology, University of Pittsburgh School of Medicine.Antiviral assays

[0182] WT and AM SARS-CoV-2 were incubated with serial dilutions of Ly-COV555 antibody (kind gift from Dr. Kevin McCarthy, Department of Microbiology and Molecular Genetics, University of Pittsburgh School of Medicine) for 1h at 37°C. Virus was added to Vero E6-hAT cells for 24h and assayed for nLuc activity.

[0183] WT and AM SARS-CoV-2 were added to Vero E6-hAT cells for 1 h at 37°C. Serial dilutions of remdesivir (Medkoo) were added to the infected cells for 24h. nLuc activity was measured.ResultsReverse genetics system for SARS-CoV-2

[0184] Production of and introduction of mutations in CoVs, including SARS-CoV-2, has been performed using bacterial or yeast artificial chromosomes (BACs or YACs, respectively) that encode the entire recombinant DNA viral genome. BACs encoding the SARS-CoV-2 genome with the mNeon or nLuc reporter genes in place of ORF7a / b were used to produce virus by either 1) direct transfection into cells or 2) production of genomic RNA in vitro that was electroporated into cells (data not shown).6A40151. DOCX 40Attorney Docket No. 06527-2505244

[0185] We demonstrated that WT SARS-CoV-2 produced in this manner is infectious and replicates in cells expressing human ACE-2 and TMPRSS2 (Vero E6-hAT cells). Expression of the mNeon or nLuc gene can be used as a measure of virus infectivity in cells (FIG. 4, panels A-D). Infectivity of the nLuc virus was also measured by plaque assay (FIG. 4, panel E).Deletion of M abolishes SARS-CoV-2 infectious virus

[0186] AM SARS-CoV-2 leads to no infectious virus being produced. We designed a BAC system in which the M gene was eliminated by deletion of both its transcription regulatory sequence (TRS) and the first 476 bp of the gene. The remaining 190 bp of M was left intact in order to preserve the TRS for expression of the ORF6 gene (FIG.2, top panel). This was confirmed by sequencing and by lack of production of M sgRNA, as determined by RT-PCR.

[0187] To characterize AM SARS-CoV-2 and compare it to WT SARS-CoV-2, we produced each virus via BAC transfection, which were passaged on Vero E6-hAT cells for 3 days for three passages (FIG. 3). While WT SARS-CoV-2 had increasing nLuc expression between P1 and P3, AM SARS-CoV-2 nLuc activity decreased by 100,000-fold to just above the limit of detection. WT virus had titers of between 106- 108pfu / ml, whereas AM SARS-CoV-2 had undetectable infectious virus.

[0188] To determine if addition of M in trans could rescue AM virus infectivity, AM SARS-CoV-2 was produced in cells stably expressing a plasmid encoding the fluorescent reporter gene mRuby3 and codon-optimized SARS-CoV-2 M (coM) separated by a T2A peptide, for co-translation of both mRuby3 and M, and under a doxycycline-inducible promoter (FIG. 2, bottom panel). As coronavirus recombination relies upon sequence homology, especially with the TRS, the coM transcomplementation system was explicitly designed to exclude the TRS and to express a codon-optimized version of the M gene, in which the sequence differs substantially from the native SARS-CoV-2 M gene to remove sequence homology and to prevent recombination with the AM SARS-CoV-2 genome.

[0189] When mRuby3-T2A-coM cells were treated with doxycycline, both mRuby3 and M were produced, allowing M expression to be verified by visualization of mRuby3 by fluorescence microscopy (data not shown). AM SARS-CoV-2 produced in coM-expressing cells led to similar nLuc expression as WT SARS-CoV-2. AM SARS-CoV-2 infectivity could be partially rescued (103- 105pfu / ml) over three passages with increasing titers over six passages (106pfu / ml) (Figure 6B). After three passages 6A40151. DOCX 41Attorney Docket No. 06527-2505244when AM SARS-CoV-2 was passaged in cells without M expression (P4 through P6), nLuc expression decreased to the limit of detection and infectivity was immediately undetectable.Deletion of M in SARS-CoV-2 abolishes virion production

[0190] Electron microscopy was performed on supernatants of cells infected with WT SARS-CoV-2 BAC or AM SARS-CoV-2 BAC after fixation and ultracentrifugation. In addition, supernatants from cells expressing M transfected with AM SARS-CoV-2 BAC (AM + M) were fixed, ultracentrifuged, and imaged. While electron micrographs show WT SARS-CoV-2 virions with classical spikes and of sizes consistent with previous studies, virions were not visualized from the AM SARS-CoV-2 supernatant, suggesting that no viruses were produced when M was deleted from the viral genome. Production of AM + M virions were less numerous and generally malformed, which could reflect fewer particles and / or less stable particles that do not survive ultracentrifugation.

[0191] In addition to electron microscopy, genomic SARS-CoV-2 RNA was quantified both in infected cells and in supernatants for WT, AM, and AM+M viruses during passaging. As expected, WT SARS-CoV-2 led to increasing ORF1a RNA levels in both cells and supernatants. This was consistent with M RNA levels. In contrast, while ORF1a RNA was detected in both cells and virus of AM SARS-CoV-2, it was reduced 10,000-fold in cells by passage 2 and was undetectable by passage 3. M RNA was undetectable in cells and supernatants of AM SARS-CoV-2, consistent with the deletion of M in the BAC construct. Virus production of AM virus was nearly 1000-fold less than WT after passage 1 and was undetectable by passage 3, suggesting AM SARS-CoV-2 leads to a single cycle of infection that is does not result in replication.

[0192] For trans-complementation of M in cells, doxycycline treated cells with stable codon-optimized M (coM) were quantified for coM RNA by a different set of primers than those that recognize viral M. Only cells treated with doxycycline had coM RNA expression that was maintained at levels similar to those of M RNA levels in cells infected with WT SARS-CoV-2. Unlike in normal cells, AM SARS-CoV-2 ORF1a RNA levels were sustained in cells expressing coM in trans over 6 passages. When AM+M SARS-CoV-2 was passaged in cells lacking coM expression, ORF1a RNA was reduced similar to AM SARS-CoV-2, showing that M expression is required for AM6A40151. DOCX 42Attorney Docket No. 06527-2505244SARS-CoV-2 replication. Interestingly, coM RNA was detected in supernatants from AM+M virus passaged in M-expressing cells at >1000- to 10,000-fold less than M RNA detected in supernatants from cells infected with WT SARS-CoV-2, suggesting that coM RNA may be incorporated to some degree in virions and / or extracellular vesicles. coM RNA was undetectable in the supernatant after AM+M SARS-CoV-2 was passaged in cells lacking coM expression.

[0193] As the coM construct lacks the TRS and has substantial sequence differences from the genomic M sequence, recombination should not occur in the AM SARS-CoV-2 system. Sequencing of the S, ORF3a, E, and M genes of AM+M SARS-CoV-2 virions after 3 passages showed no evidence of repair of the M deletion, suggesting that recombination did not occur between coM expression in trans with genomic SARS-CoV-2 RNA.Deletion of M with E abolishes SARS-CoV-2 infectivity

[0194] Our hypothesis was that deletion of both the SARS-CoV-2 M and E genes would also lead to loss of virus infectivity. The E and M genes were deleted in the DNA genome in the SARS-CoV-2 BAC to produce AEAM SARS-CoV-2, which was confirmed by sequencing and by lack of production of E sgRNA and M sgRNA, as determined by RT-PCR. The BACS encoding AE, AM, and AEAM SARS-CoV-2 transfected in cells led to nLuc expression in the producer cells regardless of whether or not E, M, or both E and M were expressed (FIG. 5, panel A). While AE SARS-CoV-2 was infectious in both the absence and presence of E expression, AM and AEAM SARS-CoV-2 were not infectious in cells lacking M or E and M, respectively (FIG. 5, panel B). As shown above, expression of M rescued AM SARS-CoV-2 infectivity. Similarly, expression of both E and M rescued AEAM SARS-CoV-2 infectivity.Demonstration of AM SARS-CoV-2 inhibition by inhibitors

[0195] To evaluate whether AM SARS-CoV-2 could be used to screen inhibitors of WT SARS-CoV-2, we compared WT and AM SARS-CoV-2 inhibition by a neutralizing antibody, Ly-COV555, that targets SARS-CoV-2 S to prevent virus entry, and remdesivir that inhibits viral RNA synthesis. First, the viruses were pre-incubated for 1h with serial dilutions of the antibody prior to addition to Vero E6-hAT cells. nLuc activity of the infected cells showed similar levels of virus inhibition (FIG. 6, panel A), suggesting that WT and AM viruses have similar levels of S incorporation and are inhibited similarly.6A40151. DOCX 43Attorney Docket No. 06527-2505244

[0196] WT and AM SARS-CoV-2 were also used to infect Vero E6-hAT cells for 1 hour prior to treatment with serial dilutions of remdesivir. The effective concentration that inhibits 50% infection (ECso) for WT SARS-CoV-2 in these cells was 1.6 AM (FIG.6, panel B), which is consistent with previous reports 32,33. Surprisingly, AM SARS-CoV-2 had 37-fold resistance to remdesivir compared to WT virus. Two groups suggested that SARS-CoV-2 M could bind to remdesivir and be involved in its antiviral activity. This should be confirmed by repeating this assay with trans-complementation of M during infection. Importantly, we believe there are no other assays that can differentiate inhibitor effects on M during SARS-CoV-2 infection.Conclusions

[0197] In conclusion, we provide data here showing that SARS-CoV-2 lacking the M gene cannot produce infectious virus or replicate. When M is provided in trans in producer cells, AM SARS-CoV-2 is limited to a single cycle of infection. There was no evidence of recombination of codon-optimized M RNA expressed in cells with the AM SARS-CoV-2 genome, suggesting that AM SARS-CoV-2 is stable in the presence of coM in trans with minimal risk of reversion to an infectious phenotype.

[0198] This system could be used to safely screen novel SARS-CoV-2 inhibitors, including ones that specifically target the M and / or E proteins. This system likely could be developed for other coronaviruses, including ones that may cause future pandemics. In addition, assays that require specialized equipment not necessarily available in BSL-3 laboratories (e.g., live-cell confocal microscopy) can be used with this downgraded system.Example 2Materials and MethodsA / W SARS-CoV-2 BAC

[0199] The SARS-CoV-2 BAC has been previously described9. The M TRS and the first 476 bp of the M gene were deleted from the SARS-CoV-2 genome to produce AM SARS-CoV-2 that lacked expression of M but preserved the expression of the downstream ORF6 gene and all subsequent genes. Briefly, a portion of fragment 7 of the USA-WA1 / 2020 viral genome obtained via a Materials Transfer Agreement from the University of Texas Medical Branch was PCR amplified and Topo cloned into pCR2.1-TOPO (ThermoFisher Scientific). Deletion of M was performed by Gibson cloning and the modified portion was cloned back into fragment 7 via restriction enzyme cloning. The fragments were then assembled as previously described. The6A40151. DOCX 44Attorney Docket No. 06527-2505244full AM SARS-CoV-2 genome sequence within the BAC was verified by Sanger sequencing.Inducible SARS-CoV-2 M expression constructs

[0200] pLVX-TetOne-Puro-mRuby3co-T2A-coE and pLVX-TetOne-G418-mRuby3co-T2A-coE were previously described. pLVX-TetOne-Puro-mRuby3co-T2A-coM and pLVX-TetOne-G418-mRuby3co-T2A-coM were produced by replacing coE with the codon-optimized M gene (coM) from the pDONR207-SARS-CoV-2-M plasmid (Addgene) via Gibson cloning. Versions of pLVX-TetOne-G418-mRuby3co-T2A-coM bearing R44S, S99A, or P132S point mutations in coM were produced via QuikChange site-directed mutagenesis (Agilent Technologies) using primers.Cells

[0201] BHK cells are Syrian hamster (Mesocricetus auratus) kidney cells, Vero E6 cells are AGM (Cercopithecus aethiops) kidney cells (ATCC), 16HBE14o- cells (16HBE) are human bronchial epithelial cells, and HEK293T cells are human epithelial cells. Cells were grown in Dulbecco's Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS; Atlanta Biologicals), 100 ll / rnl penicillin, 100 pg / ml streptomycin, and 2 mM Lglutamine (PSG; ThermoFisher Scientific), referred to as DMEM-10 medium, at 37° C and 5% CO2. Vero E6-hAT cells (BEI Resources) were grown in DMEM-10 with 10 pg / ml puromycin (Invivogen).

[0202] BHK-coM cells were produced by stable transduction of BHK cells with pLVX-TetOne-PuromRuby3-T2A-coM lentivirus and maintained in DMEM-10 with 3 pg / ml puromycin. Vero E6-hAT-coM cells were produced by stable transduction of Vero E6-hAT cells with pLVX-TetOne-G418-mRuby3-T2A-coM lentivirus and maintained in DMEM-10 with 10 pg / ml puromycin and 500 pg / ml G418 (Gibco). Vero E6-hAT-coM cells were also produced bearing coM point mutations R44S, S99A, or P132S.Lentivirus production

[0203] pLVX-based lentiviruses were produced by transfection of 293T cells with the pCAGGS-PAX2 lentiviral packaging plasmid and the pL-VSV-G plasmid using Lipofectamine 2000 reagent (ThermoFisher Scientific). After 48 h, virus was harvested, centrifuged at 2000 x g for 20 m, filtered through a 0.45 pm polyethersulfone (PES) filter (Millipore), aliquoted, and frozen at -80° C.SARS-CoV-2 virus production6A40151. DOCX 45Attorney Docket No. 06527-2505244

[0204] SARS-CoV-2 virus was produced via BAC plasmid transfection of BHK cells overlaid upon Vero E6-hAT cells as previously described9. Briefly, 20 pg BAC plasmid was transfected for 24 h onto BHK cells, which were subsequently split 1:2 and overlaid onto Vero E6-hAT cells for 72 h. For AM SARS-CoV-2 virus production, transfections were performed in cells with and without stable expression of coM via doxycycline induction.Plaque titration

[0205] SARS-CoV-2 virus titer was determined by plaque assay as previously described. Briefly, 10-fold serial dilutions of virus were inoculated onto Vero E6-hAT cells in duplicate 6-well plates for 1h prior to overlay with 1.25% Avicel (Millipore Sigma). After 2-3 d, overlay was removed with PBS, cells were fixed in 10% formalin for 24h at RT, washed with PBS, and stained with 0.2% crystal violet in 25% methanol for 15 m at RT. For AM SARS-CoV-2 virus, Vero E6-hAT cells stably expressing coM were used to facilitate generation of viral plaques.RT-PCR

[0206] RNA was isolated from TRIzol-LS-treated virus or TRIzol-treated cell lysates as previously described. RT-PCRs were performed with primers in Table S2 and PCR reactions were visualized on an agarose gel. Band intensities were quantified via a Bio-Rad Gel Doc EZ Imager and Image Lab software. Quantitative RT-PCRs were performed using primers and probes with plasmids used as standards and run on a Bio-Rad CFX96 Real-Time PCR System.nanoLuc assay

[0207] nanoLuc from transfected or infected cells was measured by lysing cells with Nano-Gio Luciferase Assay Bu'er or Gio Lysis Bu'er (Promega), incubating with Nano-Gio Luciferase Assay Substrate (Promega), and detection on a BioTek Synergy2 Multi-Detection Microplate Reader.EM

[0208] SARS-CoV-2 virus was produced as described above, supplemented postfiltration with 10 mM HEPES, ultracentrifuged through a 20% sucrose cushion in NTE bu'er (100 mM NaCI, 10 mM Tris-HCI, 1 mM EDTA, pH 7.6) for 2.5 h, 4° C at 117,250 x g, and resuspended in 4% paraformaldehyde (PFA). Negative stain EM was performed as previously described.

[0209] Immunofluorescence microscopy6A40151. DOCX 46Attorney Docket No. 06527-2505244

[0210] Vero E6-hAT cells were seeded overnight at 3 x 105 cells / dish in 35 mm glass-bottom dishes (MatTek), infected with virus (MOI=0.01) for 1 h, washed with PBS, and fed with fresh DMEM-10 medium. After 24 h, cells were fixed with 4% PFA for 1 h at RT, permeabilized with 0.1% Triton X-100 (ThermoFisher Scientific) for 15 m at RT, blocked with 5% normal goat serum (Invitrogen) for 1 h at RT, incubated with primary antibodies against M (rabbit a-M, PAB31758, Abnova, 1:250) and either ERGIC-53 (mouse a-ERGIC-53, C-6, Santa Cruz, 1:100) or S (mouse a-S, GTX632604, Genetex, 1:500) for 1 h at RT, incubated with secondary antibodies (goat a-mouse-AlexFluor488, Invitrogen, 1:500 and goata-rabbit-AlexaFluor568, Invitrogen, 1:500) for 1 h at RT, counterstained with Hoechst 33342 (1:2000, ThermoFisher Scientific) for 15 m at RT, and mounted with 1.5 glass coverslips. Blocking and immunofluorescence staining / wash buffers contained 0.5% bovine serum albumin (ThermoFisher Scientific) and 1% glycine (Millipore Sigma) in PBS. Confocal laser scanning microscopy was performed on a Nikon A1 microscope equipped with a 60X objective and motorized piezo Z stage, and images were analyzed with Nikon Elements.Neutralizing antibody assay

[0211] Vero E6-hAT cells or induced E6-hAT-coM cells were seeded at 1.25 x 105cells / well in 24-well plates. WT and AM SARS-CoV-2 virus was pre-treated for 1 h at 37 °C with a range of concentrations of SARS-CoV-2 S NAb LY-CoV555, a kind gift of Dr. Kevin R. McCarthy. Cells were infected in triplicate with virus (MOI=0.01) or mock infected and assayed for nanoLuc activity after 24 h.RDV drug inhibition assay

[0212] Vero E6-hAT cells or induced E6-hAT-coM cells were seeded at 1.25 x 105cells / well in 24-well plates overnight and infected with WT or AM SARS-CoV-2 (MOI=0.01). After 1 h, cells were washed once with PBS and fed with fresh DMEM-10 medium supplemented with a range of doses of RDV. Medium for E6-hAT-coM cells was additionally supplemented with 250 ng / mL doxycycline. Cells were assayed for nanoLuc activity after 24 h.In vitro selection of RDV drug resistance

[0213] Vero E6-hAT cells were seeded overnight at 7 x 105cells / dish in 35 mm dishes, infected with WT SARS-CoV-2 (MOI=0.01) for 1 h, washed once with PBS, and fed with fresh DMEM-10 medium with and without supplementation with RDV. The initial RDV concentration used was 3.5 pM, or two times the ECso previously reported 6A40151. DOCX 47Attorney Docket No. 06527-2505244for Vero cells'! 2. Cells were monitored daily by phase contrast microscopy and viruses were harvested when cells exhibited CPE > 50% and used to infect fresh Vero E6-hAT cells. A reduction in the time for RDV-treated cells to reach CPE > 50% over successive passages was taken as the development of drug resistance. When the harvest time of cells treated with RDV approached the harvest time of untreated cells, the RDV concentration of subsequent passages was doubled. Passages of WT virus treated with RDV with putative drug resistance were plaque titered and examined by RDV drug inhibition assay. RNA was isolated from virus with demonstrated RDV resistance as previously described and the region of the viral genome encompassing the E, M, and ORF6 genes was sequenced by Nanopore sequencing (Plasmidsaurus). Statistics

[0214] Results were analyzed for statistical significance with Prism software (GraphPad). Unless otherwise specified, significance was determined by two-sided Welch’s t test. A p-value of less than or equal to 0.05 was used to indicate statistical significance.ResultsDeletion of M leads to single-cycle SARS-CoV-2 that can be rescued by transcomplementation of M

[0215] BAC and YAC systems in which S was deleted from the SARS-CoV-2 genome produced no infectious virions after transfection unless S was expressed in the cells. DS SARS-CoV-2 produced in S-expressing cells led to infectious virus that could infect cells in a single round but that could not replicate during additional passaging (i.e., single cycle of infection). To study the role of M in SARS-CoV-2 infection and to try to design another single-cycle SARSCoV-2 system, M was deleted in a SARS-CoV-2 BAC with a reporter gene. Previously we produced a a mammalianexpression BAC encoding the SARS-CoV-2 (USA-WA1 / 2020) genome with the codon-optimized nanoLuc gene in place of ORF79. The M gene was eliminated by deletion of both its transcription regulatory sequence (TRS) and the first 476 bp of the gene in the SARS-CoV-2 BAC to produce AM SARS-CoV-2. The remaining 190 bp of M was left intact to preserve the TRS for expression of the ORF6 gene (FIG. 12A).For trans-complementation, codon-optimized M (coM) was fused to mRuby3 and separated by a T2A peptide sequence and encoded in a doxycycline-inducible lentiviral vector for ectopic expression in cells. The mRuby3-T2A-coM construct was cloned into doxycyclineinducible lentiviral vectors and transduced into BHK and Vero 6A40151. DOCX 48Attorney Docket No. 06527-2505244E6-hAT cells. Prior to each use, the cell lines were induced with doxycycline for 48h and visually confirmed by microscopy to express mRuby3, as well as coM.

[0216] Production of SARS-CoV-2 was performed by transfection of the BAC into BHK cells that were overlayed onto Vero E6 cells stably expressing human ACE2 and TMPRSS2 (Vero E6-hAT cells) to amplify virus production, as previously described9. Lack of M expression after introduction of AM SARS-CoV-2 into cells was confirmed by visualizing sgRNAs after infection of AM SARS-CoV-2 in Vero E6-hAT cells (FIG.12A) and by sequencing. While transfection of AM SARS-CoV-2 in cells lacking M expression did not lead to production of virions by electron microscopy, transfection in cells expressing M led to detectable virions by EM (EM; Fig. 12A), suggesting that M in trans could rescue virus production.

[0217] A multi-passage workflow was developed to characterize infectivity and replication of AM SARS-CoV-2 virus produced in BHK cells expressing coM compared to WT SARS-CoV-2. The initial passages (P1) of WT and AM SARS-CoV-2-nanoLuc viruses (the latter with and without M trans-complementation) were inoculated onto fresh Vero E6-hAT or Vero E6- hAT-coM cells (P2), which were subsequently passaged again (P3). For each passage, the virus supernatant and the producer cells were collected and characterized. While WT SARSCoV-2 had increasing nanoLuc expression in cells between P1 and P3, AM SARS-CoV-2 nanoLuc activity decreased by nearly 5-log (FIG. 12B). Similarly, infectivity of WT virus in the supernatants was measured by nanoLuc expression on new cells and by plaque assay, showing increased infectious virus for each passage (FIG. 12C, F). Similarly, WT SARS-CoV-2 gRNA levels increased in cells and cell supernatants with each passage (FIG. 12D, E). In contrast, infectivity of AM SARS-CoV-2 was completely undetectable by plaque assay (FIG. 12F) and was undetectable by nanoLuc expression or gRNA levels by P3 (FIG. 12E)

[0218] To confirm whether expression of M in trans could rescue virus production and infectivity, AM SARS-CoV-2 was transfected in cells induced to express coM (AM + M). AM + M SARS-CoV-2 expression of nanoLuc in cells (FIG. 12B), infectivity of virus as measured by nanoLuc expression (FIG. 12C) or titer (FIG. 12F), and gRNA expression (FIG. 12D, E) was rescued significantly over three passages. Plaque sizes of AM + M virus were similar to WT SARS-CoV-2 plaques (FIG. 12G). As M is required for virus production, we hypothesized that removing M expression would lead to a loss of infectious virus. Thus, P3 AM + M SARS-CoV-2 was further passaged in cells with 6A40151. DOCX 49Attorney Docket No. 06527-2505244or without induced coM (P4 - P6). Infectivity and virus production of AM + M SARS-CoV-2 was undetectable in the absence of trans-complementation.

[0219] To determine whether the M gene deletion was repaired during passaging of AM SARS-CoV-2 with and without M trans-complementation, qRT-PCR was performed to measure M RNA in cells and supernatants. No detection of M sgRNA was detected in cells during passaging of AM SARS-CoV-2 regardless of M expression in trans (FIG. 12H, top). Similarly, M was not detected in supernatants from the cells FIG. 12H, bottom), confirming a lack of endogenous M expression from the viral genome. While coM was designed not only for optimal expression in cells but also to avoid sequence homology with the viral genome, we tested whether coM mRNA was detected in AM or AM + M virions. As expected, coM RNA was detected only in cells induced with doxycycline as expected, albeit 3-log lower than M expressed in cells infected with WT SARS-CoV-2 (FIG. 121, top). Although coM RNA was detected in AM + M SARSCoV-2 supernatants, it was 4-log lower than endogenous M detected in WT SARS-CoV-2 and became undetectable as soon as virus was passed on cells lacking coM expression (FIG. 121, bottom). Sequencing confirmed that the M deletion was maintained in AM + M SARS-CoV-2 after 3 passages (data not shown). Collectively, these data show that AM SARS-CoV-2 can be used as a single-cycle virus system.Deletion of M leads to SARS-CoV-2 disruption of the ERGIC

[0220] Previously, we showed that deletion of the E gene in SARS-CoV-2 led to reorganization of the ERGIC. To determine if deletion of M led to the same phenotype, Vero E6-hAT cells were infected with WT or AM SARS-CoV-2 and stained for the ERGIC-53 protein. Similar to our previous report, ERGIC-53 staining in uninfected cells showed curved perinuclear expression on one side of the cell consistent with ERGIC localization (FIG. 13A). Infection with WT SARS-CoV-2 also showed perinuclear expression of ERGIC-53 but with less curvature, consistent with some reorganization of the ERGIC and Golgi, as previously described. AM SARS-CoV-2 infection led to diffuse staining of ERGIC-53 (FIG. 13A), consistent with our previous results with DE SARS-CoV-2 and close interactions of E and M needed for virion release. Loss of E led to mislocalization of S from the ERGIC during infection, leading us to explore whether deletion of M affected S localization in cells. While WT SARS-CoV-2 infection showed colocalization of M and S presumably in the ERGIC as well as some diffuse expression, AM SARS-Cov-2 infection led to only diffuse expression 6A40151. DOCX 50Attorney Docket No. 06527-2505244(FIG. 13B). This suggests that M either directly or indirectly via E is required for S localization in the ERGIC where virion assembly occurs.Loss of M expression during infection confers SARS-CoV-2 resistance to remdesivir

[0221] To show that AM SARS-CoV-2 could be used to screen inhibitors in a single-cycle infection assay, it was compared with WT virus in inhibition assays using a NAb targeting S, LY-CoV555, or a small molecule inhibitor, remdesivir (RDV). Preincubation of WT and AM SARS-CoV-2 with serial dilutions of LY-CoV555 led to similar inhibition of both viruses in Vero E6-hAT cells (ECso of 5 pg / ml and 4 pg / ml, respectively). AM SARS-CoV-2 infection of Vero E6-hAT cells expressing coM did not affect LY-CoV555 inhibition.

[0222] RDV is a nucleoside analog prodrug that is triphosphorylated in cells and incorporated into viral RNA by the SARS-CoV-2 RNA-dependent RNA polymerase (nsp12), leading to delayed termination of viral RNA synthesis'l l. Vero E6-hAT cells were infected with WT and AM SARSCoV-2 for 1 h prior to treating with serial dilutions of RDV. RDV inhibited WT virus with an ECso of 1.6 pM (FIG. 14A), which is consistent with previous studies (0.77-1.7 pM)12,13. Unexpectedly, AM SARS-CoV-2 had 13-fold resistance to RDV compared to WT virus. We hypothesized that RDV could target SARS-CoV-2 M function during infection, which is consistent with two in silico modeling studies that proposed that RDV could bind to M. Thus, we repeated the RDV inhibition assay with AM SARS-CoV-2 in Vero E6-hAT-coM cells (AM + M). This led to an ECso of 2.9, which was <2-fold higher than for WT SARS-CoV-2 infection (FIG.14A).

[0223] Recently, two groups identified small molecules that inhibit SARS-CoV-2 M activity through agnostic screens. One inhibitor was shown by cryoEM to bind in a pocket formed by M that was abrogated by several amino acid substitutions, including S99A and P132S that conferred 97- and 43-fold resistance. These mutations also conferred 58-fold resistance to the other inhibitor. We introduced these mutations individually into our pLVX-TetOne-PuromRuby3-T2A-coM construct and made separate stable Vero E6-hAT cells with inducible expression of M. P132S conferred 6-fold resistance compared to WT SARS-CoV-2, and S99A did not confer resistance (FIG. 14A)

[0224] A recent study sought to identify RDV-resistant mutations in 49 COVID-19 patients before and after treatment with RDV18. While diversity of nsp12 was similar pre- and post-RDV treatment (and lower than untreated control COVID-19 patients), 6A40151. DOCX 51Attorney Docket No. 06527-2505244the M gene had higher diversity after RDV treatment compared to pre-RDV samples. One M amino acid substitution identified by this group was R44S, which led to poor viral replication. R44S M conferred 4-fold resistance for AM + M SARS-CoV-2 (FIG.14A).

[0225] To determine whether P132S M could lead to infectious virus, AM +M-P132S SARS-CoV-2 was characterized. First, expression of P132S coM had similar colocalization with ERGIC-53 as WT coM, suggesting that the mutation did not a'ect proper localization within cells. Supernatant from cells to make AM +M SARS-CoV-2 produced significant amounts of gRNA, which suggested that virus was produced. Infectivity was measured by nanoLuc expression on new cells and was similar to AM SARS-CoV-2 and AM + M SARS-CoV-2, suggesting that AM +M-P132S SARS-CoV-2 does not confer a replication defect.

[0226] To identify M residue changes that could inhibit RDV sensitivity, WT SARS-CoV-2 was passaged with or without increasing concentrations of RDV (FIG. 14B).After 4 passages, the virus replicated similarly in the presence or absence of 2-fold the ECso of RDV, at which time the RDV concentration was increased to 4 times the EC50 (FIG. 14C). At passage 13, SARS-CoV-2 replicated similarly with or without RDV and viral RNA was harvested from both flasks. The titer of RDV-selected SARS-CoV-2 was approximately 1 -log lower than virus grown without drug (FIG. 14D) and had ~4-fold resistance to RDV inhibition (FIG. 14E). Nanopore sequencing was performed for mutations in ORF3, E, M, and ORF6. No mutations were identified in ORF3 or ORF6. One M mutation (E19Q) was identified at 99% frequency in virus grown with and without RDV, suggesting it is a cell culture adaptive change. The only mutation observed in only in RDV-selected SARS-CoV-2 and not virus grown without drug was an P71 L at 72% frequency in E. This mutation is frequently observed in SARS-CoV-2 isolated from people.Sequences

[0227] SEQ ID NO: 1 is a BAC including nucleic acids with a modification to the M gene, and includes nucleic acids encoding S (SEQ ID NO: 39), ORF3a (SEQ ID NO: 40), E (SEQ ID NO: 41) M (SEQ ID NO: 42), ORF6 (SEQ ID NO: 43), ORF7a (SEQ ID NO: 44), ORF7b (SEQ ID NO: 45), ORF8 (SEQ ID NO: 46), N nucleocapsid (SEQ ID NO: 47), ORF10 (SEQ ID NO: 48).6A40151. DOCX 52Attorney Docket No. 06527-2505244

[0228] SEQ ID NO: 2 is a lentiviral vector including a codon-optimized M gene, including a TetOn (SEQ ID NO: 49), mRuby (SEQ ID NO: 50), T2A (SEQ ID NO: 51), and M (SEQ ID NO: 52).

[0229] SEQ ID NO: 3 is a lentiviral vector including an M gene that encodes a P132S substitution in the M protein and includes a TetOn (SEQ ID NO: 53), mRuby (SEQ ID NO: 54), T2A (SEQ ID NO: 55), and the M (SEQ ID NO: 56).

[0230] SEQ ID NO: 4 is a lentiviral vector including an M gene that encodes an S99A substitution in the M protein and includes a TetOn (SEQ ID NO: 57), mRuby (SEQ ID NO: 58), T2A (SEQ ID NO: 59), and the M (SEQ ID NO: 60).

[0231] SEQ ID NO: 36 is a lentiviral vector including an M gene that encodes an R44S substitution in the M protein and includes a TetOn (SEQ ID NO: 61), mRuby (SEQ ID NO: 62), T2A (SEQ ID NO: 63), and the M (SEQ ID NO: 64).

[0232] SEQ ID NO: 37 is a BAC including nucleic acids with a modification to the M and E genes, and includes nucleic acids encoding S (SEQ ID NO: 65), ORF3a (SEQ ID NO: 66), M (SEQ ID NO: 67), ORF6 (SEQ ID NO: 68), nanoLuc (SEQ ID NO: 69), ORF7b (SEQ ID NO: 70), ORF8 (SEQ ID NO: 71), N nucleocapsid (SEQ ID NO: 72), and ORF10 (SEQ ID NO: 73).

[0233] SEQ ID NO: 38 is a lentiviral vector including a codon-optimized M and E gene, and includes the E (SEQ ID NO: 74), an IRES (SEQ ID NO: 75), the M (SEQ ID NO: 76), T2A (SEQ ID NO: 77), mRuby (SEQ ID NO: 78), and TetOn (SEQ ID NO: 79).

[0234] The present invention has been described with reference to certain exemplary embodiments, dispersible compositions and uses thereof. However, it will be recognized by those of ordinary skill in the art that various substitutions, modifications or combinations of any of the exemplary embodiments may be made without departing from the spirit and scope of the invention. Thus, the invention is not limited by the description of the exemplary embodiments, but rather by the appended claims as originally filed.6A40151. DOCX 53

Claims

1. Attorney Docket No. 06527-2505244THE INVENTION CLAIMED IS1. A replication-defective coronavirus comprising in its genome a modification, wherein the modification results in a reduced expression of the M gene compared to a coronavirus lacking the modification.

2. The replication-defective coronavirus of claim 1, wherein the modification is at least one addition, substitution, and / or deletion in the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

3. The replication-defective coronavirus of claim 1, wherein the modification is a deletion of at least one nucleic acid in the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

4. The replication-defective coronavirus of claim 1, wherein the modification is a deletion of at least nucleic acids 1-467 of the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

5. The replication-defective coronavirus of claim 1, wherein the modification is a deletion of no more than the first 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, and / or 665 nucleic acids of the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

6. The replication-defective coronavirus of claim 2, further comprising at least one addition, substitution, and / or deletion in the transcription regulatory sequence (TRS) of the M gene.

7. The replication-defective coronavirus of claim 6, wherein the deletion is a deletion of substantially the entire TRS of the M gene.

8. The replication-defective coronavirus of claim 1, wherein the coronavirus is a severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV).6A40151. DOCX 54Attorney Docket No. 06527-25052449. The replication-defective coronavirus of claim 8, wherein the coronavirus is severe acute respiratory syndrome (SARS) coronavirus 2 (SARS-CoV-2).

10. The replication-defective coronavirus of claim 1, wherein the coronavirus is Middle Eastern respiratory syndrome coronavirus (MERS-CoV).

11. The replication-defective coronavirus of claim 1, wherein the modification includes a further modification that results in a reduced expression of the E gene compared to a coronavirus lacking the further modification.

12. The replication-defective coronavirus of claim 1, wherein the modification further comprises at least one addition, substitution, and / or deletion in the nucleic acid sequence of SEQ ID NO: 33 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 33.

13. The replication-defective coronavirus of claim 1, wherein the modification further comprises a deletion of at least one nucleic acid in the nucleic acid sequence of SEQ ID NO: 33 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 33.

14. A pharmaceutical composition comprising the replicationdefective coronavirus of claim 1.

15. The pharmaceutical composition of claim 14, configured for subcutaneous, intradermal, intramuscular, transdermal, intravenous, oral, intraocular, inhalation, insufflation, and / or mucosal delivery.

16. A method of screening a composition for use against a coronavirus, comprising exposing a replication-defective coronavirus according to claim 1 to a composition.

17. The method of claim 16, further comprising providing the M protein to replication-defective virus, andwherein the composition is determined to be effective against the coronavirus when replication of the replication-defective coronavirus is decreased relative to a coronavirus lacking the modification.6A40151. DOCX 55Attorney Docket No. 06527-250524418. The method of claim 16, wherein the composition is a binding reagent.

19. The method of claim 16, wherein the binding reagent is an antibody or a fragment thereof, an scFv, a nanobody, and / or an aptamer.

20. The method of claim 16, wherein the composition is a non-binding reagent coronavirus inhibitor.

21. The method of claim 16, wherein the composition is a purported coronavirus inhibitor.

22. The method of claim 16, wherein the method is performed in a multiplexed assay in which at least two different compositions are screened at different addressable locations.

23. The method of claim 16, wherein replication of the replicationdefective coronavirus is determined by RT-PCR, qRT-PCR, an assay based on fluorescent and / or bioluminescent proteins, immunoblotting, flow cytometry, immunofluorescence, and / or ELISA.

24. A method of making a replication-defective coronavirus, comprising introducing at least one modification to the coronavirus genome that results in a reduced expression of the M gene compared to a coronavirus lacking the modification.

25. The method of claim 24, wherein the modification comprises at least one substitution and / or deletion in the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

26. The method of claim 24, wherein the modification is a deletion of at least one nucleic acid in the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.6A40151. DOCX 56Attorney Docket No. 06527-250524427. The method of claim 24, wherein the modification is a deletion of at least nucleic acids 1-467 of the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

28. The method of claim 24, wherein the modification is a deletion of no more than the first 470, 475, 480, 485, 490, 495, 500, 505, 510, 515, 520, 525, 530, 535, 540, 545, 550, 555, 560, 565, 570, 575, 580, 585, 590, 595, 600, 605, 610, 615, 620, 625, 630, 635, 640, 645, 650, 655, 660, and / or 665 nucleic acids of the nucleic acid sequence of SEQ ID NO: 34 or a sequence having at least 70%, 75%, 80%, 85%, 90%, 95%, or 99% sequence identity to SEQ ID NO: 34.

29. The method of claim 24, further comprising at least one substitution and / or deletion in the transcription regulatory sequence (TRS) of the M gene.

30. The method of claim 24, wherein the deletion is a deletion of substantially the entire TRS of the M gene.

31. The method of claim 24, wherein the coronavirus is severe acute respiratory syndrome (SARS) coronavirus (SARS-CoV).

32. The method of claim 24, wherein the coronavirus is severe acute respiratory syndrome (SARS) coronavirus 2 (SARS-CoV-2).

33. The method of claim 24, wherein the coronavirus is Middle Eastern respiratory syndrome coronavirus (MERS-CoV).

34. The method of claim 24, wherein the modification further results in a reduced expression of the E gene than a coronavirus lacking the modification.

35. A replication-defective severe acute respiratory syndrome (SARS) coronavirus particle comprising in its genome a modification in the M gene, wherein the modification results in a reduced expression of the M gene compared to a coronavirus lacking the modification and wherein the modification does not affect expression of the ORF6 gene.6A40151. DOCX 57Attorney Docket No. 06527-250524436. The replication-defective SARS coronavirus particle of claim 35, further comprising in its genome a modification in the E gene, wherein the modification results in a reduced expression of the E gene compared to a coronavirus lacking the modification.

37. A replication-defective coronavirus or virus particle, comprising a deletion of a portion of the M gene and / or the transcription regulatory sequence (TRS) of the M gene that eliminates expression or function of the M protein but does not substantially delete a TRS or other regulatory element for controlling expression of a gene of the coronavirus other than M.

38. A kit comprising the replication-defective coronavirus of claim 1 in a vessel.

39. A recombinant mammalian cell modified to express a coronavirus M gene.

40. The recombinant cell of claim 39, wherein the recombinant cell is a Vero cell.

41. The recombinant cell of claim 39, wherein the cell is a BHK cell.

42. The recombinant cell of claim 39, wherein the cell is a HEK cell.

43. The recombinant cell of claim 39, wherein expression of the coronavirus M gene is under the control of an inducible promotor.

44. The recombinant cell of claim 39, wherein the inducible promotor is a doxycycline-inducible promotor.

45. The recombinant cell of claim 39, wherein the coronavirus M gene is codon optimized for the cell.

46. The recombinant cell of claim 39, wherein the cell is further modified to express a coronavirus E gene.

47. The recombinant cell of claim 39, wherein the coronavirus E gene is codon optimized.6A40151. DOCX 58Attorney Docket No. 06527-250524448. A method of producing a recombinant cell comprising introducing into the cell a viral vector having the sequence of SEQ ID NO: 1, and / or SEQ ID NO: 37, or a viral vector having at least 90% sequence identity thereto.

49. A kit comprising the replication-defective coronavirus of claim 1, and a recombinant cell modified to express a coronavirus M gene.

50. The kit of claim 49, further comprising a nucleic acid comprising the coronavirus M gene and / or the coronavirus M gene TRS.

51. The kit of claim 49, wherein the nucleic acid has the sequence of SEQ ID NO: 34.

52. The kit of claim 49, further comprising an artificial chromosome, a plasmid, a vector, and / or a virus comprising a nucleic acid comprising the coronavirus M gene and / or the coronavirus M gene TRS.

53. The kit of claim 52, wherein the vector has the sequence of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 36, and / or SEQ ID NO: 38, or a sequence having at least 90% sequence identity thereto.

54. The kit of any of claim 49, further comprising a nucleic acid comprising the coronavirus E gene and / or the coronavirus E gene TRS.

55. The kit of claim 54, wherein the nucleic acid has the sequence of SEQ ID NO: 33.

56. The kit of claim 49, further comprising an artificial chromosome, a plasmid, a vector, and / or a virus comprising a nucleic acid comprising the coronavirus E gene and / or the coronavirus E gene TRS.

57. The kit of claim 56, wherein the vector has the sequence of SEQ ID NO: 2 and / or SEQ ID NO: 38, or a sequence having at least 90% sequence identity thereto.6A40151. DOCX 59

Images