Helper plasmids and uses thereof

Abstract

The technology described herein relates generally to compositions and methods for preparing viral, e.g., adeno-associated viral (AAV) particles.

Description

HELPER PLASMIDSAND USES THEREOFCROSS REFERENCE TO RELATED APPLICATIONS

[0001] This application claims benefit under one or more of 35 U. S. C. §§ 119(a)-(d) of European Patent Application No. EP2538206 filed January 31, 2025, the contents of which are incorporated herein by reference in their entirety.SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically as an XML document in the ST.26 format and is hereby incorporated by reference in its entirety. Said XML copy, created on January 26, 2026, is named “046192-000136WOPT_SL.xml” and is 441,225 bytes in size.TECHNICAL FIELD

[0003] The technology described herein relates generally to compositions and methods for preparing viral, e.g., adeno-associated viral (AAV) particles.BACKGROUND

[0004] Production of recombinant adeno-associated vectors (rAAV) involves consideration of both efficiency and safety. The production of rAAVs usually requires the expression of and / or infection by both the desired vector as well as additional components necessary for robust production. In some cases, this may require the incorporation and expression of up to three large plasmids into one single cell. Successfully delivering three plasmids to one cell is a relatively inefficient process. For larger-scale manufacturing efforts, transient delivery of plasmid requires excess quantities of DNA, adding to the overall cost of production and purification.

[0005] In addition to delivery of the plasmids, the efficiency of the plasmids can also be considered. Helper viruses, such as adenovirus, a herpesvirus, or vaccinia, as well as adenovirus helper nucleic acids (Ad helpers) contain components, that assist in the production of rAAV. Ad helpers can contain proteins used for rAAV production. Efficient production of these proteins allows for the production of higher titers of rAAV.

[0006] Ad helpers have been regarded as safer alternatives to helper adenovirus infections because they only produce proteins for producing rAAV and not the infectious virus. Minimizing exposure to infectious virus is a consideration in the production of rAAV. Since this is a safer alternative, optimizing the delivery of Ad helpers can contribute to producing high titers of rAAV.

[0007] The present disclosure addresses these needs.SUMMARY

[0008] In one aspect, provided herein is a polynucleotide comprising a nucleotide sequence encoding: (a) an adenoviral E2a region; (b) an adenoviral E4 region; and (c) an adenoviral virus associated (VA) RNA region. Generally, the polynucleotide does not comprise a nucleotide sequence encoding at least I (e.g., 2, 3, 4, or all 5) of: (i) a full length adenoviral L4-100K protein or a portion, e.g., a functional portion thereof; (ii) a full length adenoviral L5 fiber protein or a portion, e g., a functional portion thereof; (iii) a full length adenoviral pVIII protein or a portion, e.g., a functional portion thereof; (iv) a full length adenoviral L1-52K / 55K protein or a portion, e g., a functional portion thereof; or a full length adenoviral precursor terminal protein (pTP) or a portion, e g., a functional portion thereof. In some embodiments, the polynucleotide comprises at least one (e.g., 1, 2, 3, 4, 5, 7 or all 7) of: (i) a deletion of G2 and G3 in a nucleotide sequence encoding an adenoviral L-22K protein (e.g., SEQ ID NO: 103) and / or a L-33K protein (e.g., SEQ ID NO: 104); (ii) a deletion of G2 and G3 in a nucleotide sequence encoding an adenoviral L4-100K protein (e.g., SEQ ID NO: 105); (iii) a deletion of G2 in a nucleotide sequence encoding adenoviral pVIII protein (e.g., SEQ ID NO:106); (iv) a AC TT mutation at positions 149-150 of a nucleotide sequence encoding adenoviral pVIII protein (e.g., SEQ ID NO: 106); (v) a deletion of G2 in a nucleotide sequence encoding adenoviral fiber protein (e.g., SEQ ID NO: 107); (vi) a C T mutation at position 503 of a nucleotide encoding adenoviral L5 fiber protein (e.g., SEQ ID NO: 103); and (vii) a TACG mutation at positions 1692-1693 of a nucleotide encoding adenoviral L5 fiber protein (e.g., SEQ ID NO: 107).

[0009] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 5. For example, the polynucleotide comprises a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 5. In some embodiments, the polynucleotide comprises a nucleotide sequence having 100% identity to SEQ ID NO: 5.

[0010] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity' to SEQ ID NO: 6. For example, the polynucleotide comprises a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity' to SEQ ID NO: 6. In some embodiments, the polynucleotide comprises a nucleotide sequence having 100% identity to SEQ ID NO: 6.

[0011] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 4. For example, the polynucleotide comprises a nucleotide sequence having at least 90% (e g., at least 91 %, at least 92%, at least 93%, at least 94%, at least 959%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 4, In some embodiments, the polynucleotide comprises a nucleotide sequence having 100% identity to SEQ ID NO: 4.

[0012] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% (e.g.. at least 85%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity io SEQ ID NO: 3. For example, the polynucleotide comprises a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO: 3. In some embodiments, the polynucleotide comprises a nucleotide sequence having 100% identity to SEQ ID NO: 3.

[0013] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%;, at least 93%;, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 2. For example, the polynucleotide comprises a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%), at least 99 or 100%) identity to SEQ ID NO: 2. In some embodiments, the polynucleotide comprises a nucleotide sequence having 100% identity to SEQ ID NO: 2.

[0014] In some embodiments, the polynucleotide comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%o or 100%o) identity to SEQ ID NO:1. For example, the polynucleotide comprises a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO: 1. In some embodiments, the polynucleotide comprises a nucleotide sequence having 100% identity to SEQ ID NO: 1.

[0015] In some embodiments, the polynucleotide does not comprise nucleotides 26197-26198 relative to Genbank Accession Number AC_000008.

[0016] In some embodiments, the the polynucleotide does not comprise nucleotides 24063- 24064 relative to Genbank Accession Number AC_000008.

[0017] In some embodiments, the polynucleotide does not comprise nucleotide 27176 relative to Genbank Accession Number AG 000008.

[0018] In some embodiments, the polynucleotide comprises AC TT mutation at positions 27322-27324 relative to Genbank Accession Number AC_000008.

[0019] In some embodiments, the polynucleotide does not comprise nucleotide 31024 relative to Genbank Accession Number AC 000008.

[0020] In some embodiments, the polynucleotide comprises C -> T mutation at positions 31544 relative to Genbank Accession Number AC 000008.

[0021] In some embodiments, the polynucleotide comprises TACG mutation at positions 32733-32734 relative to Genbank Accession Number AC_000008.

[0022] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising, e.g., at its N-terminus an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity io SEQ ID NO: 94 or 95.

[0023] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding: full length adenoviral L4-22K protein or a portion, e.g., a functional portion thereof. For example, the polynucleotide comprises a nucleotide sequence encoding a less than full length fragment of adenoviral L4-22K protein. In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a truncated adenoviral L4-22K protein. For example, the polynucleotide does not comprise a nucleotide sequence encoding the first 10, II, 12, 13, 14, 15.16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71. 72, 73, 74, 75, or 76 amino acids that are present at the N-tenninus of the full-length adenoviral L4-22K protein. In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding the first 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 amino acids that are present at the N-tenninus of the full-length adenoviral L4-22K protein. For example, the polynucleotide does not comprise a nucleotide sequence encoding the first 30, 31, 32. 33. or 34, preferably the first 33 or 34, more preferably die first 34 amino acids that are present at the N-terminus of the full-length adenoviral L4-22K protein. In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding the first 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 76 amino acids that are present at the N-terminus of tire full-length adenoviral L4-22K protein. For example, the polynucleotide does not comprise a nucleotide sequence encoding the first 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 76, preferably the first 75 or 76, more preferably the first 76 amino acids that are present at the N-terminus of the full-length adenoviral I.4-22K protein.

[0024] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 92 or 93, and wherein the protein does not comprise, e.g., at its N-terminus an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94 or 95. For example, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an amino acid sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 92 or 93, and wherein the protein does not comprise, e.g., al its N-terminus an ammo acid sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94 or 95. In some embodiments, the poly nucleotide comprises a nucleotide sequence encoding a protein comprising an ammo acid sequence having 100% identity to SEQ ID NO: 92 or 93, and wrier ein the protein does not comprise, e.g., at its N-terminus an ammo acid sequence having 100% identity to SEQ ID NO: 94 or 95.

[0025] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 92 or 93, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a full length adenoviral L4-22K protein having the ammo acid sequence SEQ ID NO: 7. For example,, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an amino acid sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 92 or 93, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a full length adenoviral L4-22K protein having the amino acid sequence SEQ ID NO: 7. In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an amino acid sequence ha ving 100% identity to SEQ ID NO: 92 or 93, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a full length adenoviral I..4-22K protein having the ammo acid sequence SEQ ID NO: 7.

[0026] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding: full length adenoviral L4-33K protein or a portion, e.g, a functional portion thereof. For example, the polynucleotide comprises a nucleotide sequence encoding a less than full length fragment of adenoviral L4-33K protein. In some embodiments, the polynucleotide comprises anucleotide sequence encoding a truncated adenoviral L4-33K protein. For example, the polynucleotide does not comprise a nucleotide sequence encoding the first 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25. 26. 27, 28, 29, 30, 31, 32, 33, 34, 35, 36. 37. 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 76 ammo acids that are present at the N-terminus of the full-length adenoviral L4-33K protein. In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding the first 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, or 34 ammo acids that are present at the N-terminus of the full-length adenoviral 1.4-33K protein. For example, the polynucleotide does not comprise a nucleotide sequence encoding the first 30, 31, 32, 33, or 34, preferably the first 33 or 34, more preferably the first 34 amino acids that are present at the N-terminus of the full-length adenoviral I..4-33K protein. In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding the first 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73. 74, 75, or 76 amino acids that are present at the N-terminus of the full-length adenoviral L4-33K protein. For example, the polynucleotide does not comprise a nucleotide sequence encoding the first 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, or 76, preferably the first 75 or 76, more preferably the first 76 amino acids that are present at the N- terminus of the full-length adenoviral L4-33K protein

[0027] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 90 or 91, and wherein the protein does not comprise, e.g., at its N-terminus an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 94 or 95. For example, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an ammo acid sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 90 or 91, and wherein the protein does not comprise, e.g., at its N-terminus an ammo acid sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94 or 95. In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an amino acid sequence having 100% identity to SEQ ID NO: 90 or 91, and wherein the protein does not comprise, e.g., at its N-terminus an ammo acid sequence having 100% identity to SEQ ID NO: 94 or 95.

[0028] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 90 or 91, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a full length adenoviral L-4-33K protein having the ammo acid sequence SEQ ID NO: 8. For example,, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an ammo acid sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 90 or 91, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a full length adenoviral L4-33K protein having the amino acid sequence SEQ ID NO: 8. In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a protein comprising an ammo acid sequence having 100% identity to SEQ ID NO: 90 or 91, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a full length adenoviral L4-33K protein having the amino acid sequence SEQ ID NO: 8.

[0029] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding the L4-100K protein or a portion, e.g., a functional portion thereof. In some embodiments, the full length L4-100K protein has the amino acid sequence SEQ ID NO: 9. Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 9, or at least a portion, e.g., a functional portion of SEQ ID NO: 9.

[0030] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding the L5 fiber protein or a portion, e.g., a functional portion thereof. In some embodiments, the full length L5 fiber protein has the amino acid sequence SEQ ID NO: 10. Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 10, or at least a portion, e.g., a functional portion of SEQ ID NO: 10.

[0031] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding the pVIII protein or a portion, e.g., a functional portion thereof. In some embodiments, the full length pVIII protein has the amino acid sequence SEQ ID NO: 11. Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 11, or at least a portion, e.g., a functional portion of SEQ ID NO: II.

[0032] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding the L1-52K / 55K protein or a portion, e.g., a functional portion thereof, in some embodiments, the full length L1-52K / 55K protein has the amino acid sequence SEQ ID NO: 12.Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 12, or at least a portion, e.g., a functional portion of SEQ ID NO: 12.

[0033] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding the pTP protein or a portion, e.g., a functional portion thereof. In some embodiments, the full length pTP protein has the amino acid sequence SEQ ID NO: 13. Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 13, or at least a portion, e.g., a functional portion of SEQ ID NO: 13.

[0034] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding one or more of: (i) the full length L4- 100K protein or a portion, e.g., a functional portion thereof; (ii) the full length L1-52K / 55K protein or a portion, e.g., a functional portion thereof; (iii) the full length L4-33K protein or a portion, e.g.. a functional portion thereof; (iv) the full length L4-22K protein or a portion, e.g., a functional portion thereof; (v) the full length L5 fiber protein or a portion, e g., a functional portion thereof; (vi) the full length pVIII protein or a portion, e.g, a functional portion thereof; and / or (vii) the full length pTP or a portion, e.g., a functional portion thereof. For example, the polynucleotide does not comprise a nucleotide sequence encoding (i) a full length L4-100K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 9, or a portion, e.g., a functional portion thereof; (ii) a full length L1-52K / 55K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 13, or a portion, e.g., a functional portion thereof; (iii) a full length L4-33K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8, or a portion, e.g., a functional portion thereof; (iv) a full length L4-22K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO:7, or a portion, e.g., a functional portion thereof; (v) a full length L5 fiber protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%. at least 93%. at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 10, or a portion, e.g., a functional portion thereof; (vi) a full length pVIII protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 11, or a portion, e.g., a functional portion thereof; and / or (vii) a full length pTP protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 13, or a portion, e.g., a functional portion thereof.

[0035] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding one or more of: (i) a full length adenoviral E3 region or a portion, e.g., a functional portion thereof; (ii) a full length adenoviral U exon protein (UXP) exon 1 or a portion, e.g., a functional portion thereof; (iii) a full length L4 I00K protein or a portion, e.g., a functional portion thereof; (iv) a full length L1-52K / 55K protein or a portion, e.g., a functional portion thereof; (v) a full length L4-33K protein or a portion, e.g., a functional portion thereof; (vi) a full length L4-22K protein or a portion, e.g., a functional portion thereof; (vii) a full length L5 fiber protein or a portion, e.g., a functional portion thereof; (viii) a full length pVIII protein or a portion, e.g., a functional portion thereof; and / or (ix) a full length pTP or a portion, e.g., a functional portion thereof.

[0036] For example, the polynucleotide does not comprise a nucleotide sequence encoding one or more of: (i) a full length adenoviral E3 region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 21 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity' to a nucleotide sequence complementary to SEQ ID NO: 21, or a portion, e.g., functional portion thereof; (ii) a full length adenoviral UXP exon 1 comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 102 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 102, or a portion, e.g., a functional portion thereof; (iii) a full length 1,4-100K protein comprising an amino acid sequence having at least 80% (e g., at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 9, or a portion, e.g., a functional portion thereof; (iv) a full length L1-52K / 55K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity' to SEQ ID NO: 13, or a portion, e.g., a functional portion thereof; (v) a full length L4-33K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%,at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8, or a portion, e.g., a functional portion thereof; (vi) a full length L4-22K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7, or a portion, e g., a functional portion thereof; (vii) a full length L5 fiber protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 10, or a portion, e.g., a functional portion thereof; (viii) a full length pVIII protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 11, or a portion, e.g., a functional portion thereof; and / or (ix) a full length pTP protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO:13, or a portion, e.g., a functional portion thereof.

[0037] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding one or more of: (i) a full length adenoviral E3 region or a portion, e.g., a functional portion thereof; (ii) a full length adenoviral U exon protein promoter or a portion, e.g., a functional portion thereof; (iii) a full length adenoviral U exon protein (UXP) exon 1 or a portion, e.g., afunctional portion thereof; (iv) a full length L4-100K protein or a portion, e.g., a functional portion thereof; (v) a full length L1-52K / 55K protein or a portion, e.g., a functio al portion thereof; (vi) afull length L4-33K protein or a portion, e.g., a functional portion thereof; (vii) a full length L4-22K protein or a portion, e.g., a functional portion thereof; (viii) a full length L5 fiber protein or a portion, e.g., a functional portion thereof; (ix) a full length pVIII protein or a portion, e.g.. a functional portion thereof; and / or (x) a full length pTP or a portion, e.g., a functional portion thereof.

[0038] For example, the polynucleotide does not comprise a nucleotide sequence encoding one or more of: (i) a full length adenoviral E3 region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 21 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 21, or a portion, e.g., functional portion thereof (ii) a full length adenoviral U exon protein promoter 1 comprising a nucleotide sequence having at least 80% (e.g., at least 85%. at least 90%, at least 91%, at least 92%. at least 93%, atleast 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 101 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%. at least 93%. at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 101, or a portion, e.g., functional portion thereof; (iii) a full length adenoviral UXP exon 1 comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 102 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 102, or a portion, e.g., a functional portion thereof; (iv) a full length L4-100K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 9. or a portion, e.g., a functional portion thereof; (v) a full length Ll-52K / 55K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 13, or a portion, e.g., a functional portion thereof; (vi) a full length L4-33K protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8, or a portion, e.g., a functional portion thereof; (vii) a full length L4-22K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7. or a portion, e.g., a functional portion thereof; (viii) a full length L5 fiber protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 10, or a portion, e.g., a functional portion thereof; (ix) a full length pVIII protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 11, or a portion, e.g, a functional portion thereof; and / or (x) a full length pTP protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO:13, or a portion, e.g., a functional portion thereof.

[0039] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding a full length adenoviral L4-33K protein and a full length L4-22K protein, and wherein the polynucleotide does not comprise a nucleotide sequence encoding one or more of: (i) a full length adenoviral E3 region or a portion, e.g., a functional portion thereof; (ii) a full length adenoviral U exon protein promoter or a portion, e.g., a functional portion thereof; (iii) a full length adenoviral Id exon protein (UXP) exon 1 or a portion, e.g., a functional portion thereof; (iv) a full length L4 TOOK protein or a portion, e.g., a functional portion thereof; (v) a full length L1-52K / 55K protein or a portion, e.g., a functional portion thereof; (vi) a full length L5 fiber protein or a portion, e.g., a functional portion thereof; (vii) a full length pVIII protein or a portion, e g., a functional portion thereof; and / or (viii) a full length pTP or a portion, e.g., a functional portion thereof.

[0040] For example, the polynucleotide comprises a nucleotide sequence encoding: (i) a full length L4-33K protein comprising an ammo acid sequence hatting at least 80% (e.g., at least 85%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8, or a portion, e.g., a functional portion thereof; and (ii)) a full length L4-22K protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7, or a portion, e.g, a functional portion thereof, and wherein the polynucleotide does not comprise a nucleotide sequence encoding one or more of: (i) a full length adenoviral E3 region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%. at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 21 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 21, or a portion, e.g., functional portion thereof; (ii) a full length adenoviral U exon protein promoter 1 comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 101 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 101, or a portion, e.g., functional portion thereof; (iii) a full length adenoviral UXP exon 1 comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 102 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, atleast 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 102, or a portion, e.g., a functional portion thereof; (iv) a full length L4-100K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 9, or a portion, e.g., a functional portion thereof, (v) a full length L1-52K / 55K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 13, or a portion, e.g., a functional portion thereof; (vi) a full length L5 fiber protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 10, or a portion, e g., a functional portion thereof; (vii) a full length pVIII protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 9.3%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 11, or a portion, e.g., a functional portion thereof; and / or (viii) a full length pTP protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%. at least 93%. at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO:13, or a portion, e.g., a functional portion thereof.

[0041] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding an adenoviral E3 region or a portion, e.g., a functional portion thereof.

[0042] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding an adenoviral E3 12.5k protein or a portion, e.g., a functional portion thereof. In some embodiments, the full length E3 12.5k protein has the ammo acid sequence SEQ ID NO: 14. Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 14, or at least a portion, e.g., a functional portion ofSEQ ID O: 14.

[0043] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding an adenoviral E3 CR1 -alpha protein or a portion, e.g., a functional portion thereof In some embodiments, the full length E3 CR1 -alpha protein has the amino acid sequence SEQ ID NO: 15. Thus, m some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 15, or at least a portion, e.g., a functional portion of SEQ ID NO: 15.

[0044] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding an adenoviral E3 gp19k protein or a portion, e.g., a functional portion thereof. In someembodiments, the full length E3 gpl9k protein has the amnio acid sequence SEQ ID NO: 16. Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 16, o al least a portion, e.g., a functional portion ofSEQ IDNO: 16.

[0045] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding an adenoviral E3 10.5kd protein or a portion, e.g., a functional portion thereof. In some embodiments, the full length E3 10.5kd protein has the amino acid sequence SEQ ID NO: 17. Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 17, oral least a portion, e.g., a functional portion of SEQ ID NO: 17.

[0046] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding an adenoviral E3 RID-alpha protein or a portion, e.g., a functional portion thereof. In some embodiments, the full length E3 RID-alpha protein has the ammo acid sequence SEQ ID NO: 18. Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 18, or at least a portion, e.g., a functional portion of SEQ ID NO: 18.

[0047] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding an adenoviral E3 RID-beta protein or a portion, e.g., a functional portion thereof. In some embodiments, the full length E3 RID-beta protein has the amino acid sequence SEQ ID NO: 19. Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 19, or at least a portion, e.g., a functional portion of SEQ ID NO: 19

[0048] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding an adenoviral E3 14.7k protein or a portion, e.g., a functional portion thereof. In some embodiments, the full length E3 14.7k protein has the amino acid sequence SEQ ID NO: 20. Thus, in some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising the sequence of SEQ ID NO: 20, or at least a portion, e.g., a functional portion of SEQ ID NO: 20.

[0049] In some embodiments, the polynucleotide comprises a nucleotide sequence encoding an adenoviral E3 region. For example, the polynucleotide comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 21 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity' to a nucleotide sequence complementary to SEQ ID NO: 21.

[0050] The E3 region can be downstream or upstream of the E2a region. Thus, in some embodiments, the E3 region downstream of the E2a region. In some other embodiments, the E3 region is upstream of the E2a region. Preferably, the E3 region is downstream of the E2a region.

[0051] Similarly, the E3 region can be downstream or upstream of the E4 region. Thus, in the E3 region is downstream of the E4 region. In some other embodiments, wherein tire E3 region upstream of the E4 region. Preferably, the E3 region is upstream of the E4 region.

[0052] In some embodiments, the E3 region can be between the E2a region and the E4 region.

[0053] It is noted that the VA region, the E2a region and the E4 region can be oriented independently in a 5’->3’ direction or in a 3’->5’ direction. In some embodiments, the VA region is oriented in a 5 ’->3’ direction. In some embodiments, the E2a region is oriented in a 3 ’->5’ direction. In some embodiments, the E4 region is oriented in a 3 ’->5’ direction.

[0054] In some embodiments, the polynucleotide comprises in senes: the poly A site, the VA RNA region, the E2a region, and the E4 region.

[0055] In some embodiments, VARNA region is flanked on each side by at least one restriction site. For example, the polynucleotide comprises at least 2, e.g., 3, 4, 5 or more restriction sites upstream of the VA RNA region. In some embodiments, the polynucleotide comprises at least one restriction site downstream of the VARNA region, and wherein the restriction site is between the VA region and the E2a region. In some embodiments, the polynucleotide comprises at least one restriction site downstream of the E4 region. The polynucleotide can also comprise a nucleotide sequence encoding a polyadenylation (poly A) site. For example, the polynucleotide comprises a nucleotide sequence encoding a polyadenylation (poly A) site, optionally, the poly A site is upstream of the VA RNA region. In some embodiments, the polynucleotide a polyadenylation (poly A) site having a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 22 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 22, and optionally, the poly A site is upstream of the VA RNA region. In some embodiments, the poly A site is flanked by at least one restriction site on each side. In some embodiments, the polynucleotide comprises at least three restriction sites upstream of the poly A site. In some embodiments, the polynucleotide comprises at least one restriction site downstream of the poly A site. For example, the polynucleotide comprises at least three restriction sites upstream of the poly A site and the at least one restriction site is between the poly A site and the VA region.

[0056] The polynucleotide can also comprise one or more inverted terminal repeat (ITR) sequences selected independently from AAV ITR sequences and adenoviral HR sequences. Insome embodiments, the ITR comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO: 23 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 23.

[0057] It is noted that the ITR sequence can be present anywhere in the polynucleotide. For example, the ITR sequence can be upstream or downstream of the E4 region, in some embodiments, the polynucleotide comprises at least one ITR sequence upstream of the E4 region. In some other embodiments, the polynucleotide comprises at least one ITR sequence downstream of the E4 region. Preferably, the ITR sequence is downstream of the E4 region.

[0058] Generally, the VA region comprises a VA RAN I region and / or a VA II region. In some embodiments, the VA RNA region comprises a VA RNA I region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 24 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 24. In some embodiments, the VA RNA region comprises a VA RNA II region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 25 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 25.

[0059] In some preferred embodiments, the VA region comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 26 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 26.

[0060] In some embodiments, the polynucleotide comprises a E2a region comprising a nucleotide sequence encoding an adenoviral DNA binding protein (DBP). For example, the polynucleotide comprises a E2a region comprising a nucleotide sequence encoding an adenoviral DNA binding protein (DBP) and having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. atleast 99% or 100%) identity to SEQ ID NO: 27 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 27. In some embodiments, the polynucleotide comprises a E2a region comprising a nucleotide sequence encoding a DBF having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 28 or a functional equivalent or ortholog thereof.

[0061] In some embodiments, the polynucleotide comprises a E2a region comprising an adenoviral U exon protein ( L'XPi exon 3 sequence. For example, the polynucleotide comprises a E2a region comprising UXP exon 3 having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 29 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 29.

[0062] In some embodiments, the polynucleotide comprises a E2a region comprising an adenoviral E2a exon2 / leader sequence. For example, the polynucleotide comprises a E2a region comprising E2a exon2 / Ieader sequence having at least 80% (e g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 30 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 30.

[0063] In some embodiments, the polynucleotide comprises a E2a region comprising an adenoviral UXP exon 2 sequence. For example, the polynucleotide comprises a E2a region comprising UXP exon 2 sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 30 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 30.

[0064] In some embodiments, the polynucleotide comprises a E2a region comprising an adenoviral E2a late promoter sequence. For example, the polynucleotide comprises a E2a region comprising E2a late promoter sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%. at least98%, at least 99% or 100%) identity to SEQ ID NO: 31 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 31

[0065] In some embodiments, the polynucleotide comprises a E2a region comprising an adenoviral E2a exon 1 sequence. For example, the polynucleotide comprises a E2a region comprising E2a exon 1 sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 32 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 32.

[0066] The E2a can be under the control of one or more promoters. In some embodiments, E2a is not under the control of a chicken p-actm promoter or a SV40 promoter.

[0067] In some embodiments, the polynucleotide comprises a E2a region comprising an adenoviral E2a early promoter sequence. For example, the polynucleotide comprises a E2a region comprising E2a early promoter sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity7to SEQ ID NO: 33 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 33

[0068] In some embodiments, the polynucleotide comprises a E2a region comprising an adenoviral E2a late primary transcript sequence. For example, the polynucleotide comprises a E2a region comprising E2a late primary transcript sequence having at least 80% (e.g.. at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 34 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 34

[0069] In some embodiments, the poly ucleotide comprises a E2a region comprising an adenoviral E2a early primary transcript sequence. For example, the polynucleotide comprises a E2a region comprising E2a early primary transcript sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 35 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 35.

[0070] In some embodiments, the E2a region comprises a nucleotide having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 36 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 36.

[0071] The E4 region can comprise one or more open reading frame (orf). Accordingly, in some embodiments, the polynucleotide comprises an E4 region comprising an adenoviral E4 orf6 / 7 sequence. For example, the polynucleotide comprises an E4 region comprising an adenoviral E4 orf6 / 7 sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 37 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 37. In some embodiments, the polynucleotide comprises an E4 region encoding an adenoviral E4 orf6 / 7 protein having an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 38 or a functional equivalent or ortholog thereof.

[0072] In some embodiments, the polynucleotide comprises an E4 region comprising a nucleotide sequence encoding e an adenoviral E434K protein having the ammo acid sequence an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 39 or a functional equivalent or ortholog thereof.

[0073] In some embodiments, the polynucleotide comprises an E4 region comprising an adenoviral E4 orf4 sequence. For example, the polynucleotide comprises an E4 region comprising an adenoviral E4 orf4 sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. at least 99% or 100%) identity to SEQ ID NO: 40 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 40. In some embodiments, the polynucleotide comprises an E4 region encoding an adenoviral E4 orf4 protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 41 or a functional equivalent or ortholog thereof.

[0074] In some embodiments, the polynucleotide comprises an E4 region comprising an adenoviral E4 orf3 sequence. For example, the polynucleotide comprises an E4 region comprising an adenoviral E4 orf3 sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 42 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 42. In some embodiments, the polynucleotide comprises an E4 region encoding an adenoviral E4 orf3 protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 43 or a functional equivalent or ortholog thereof.

[0075] In some embodiments, the polynucleotide comprises an E4 region comprising an adenoviral E4 orf8 sequence. For example, the polynucleotide comprises an E4 region comprising an adenoviral E4 orf8 sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 44 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary' to SEQ ID NO: 44. In some embodiments, the polynucleotide comprises an E4 region encoding an adenoviral E4 orf8 protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 45 or a functional equivalent or ortholog thereof.

[0076] In some embodiments, the polynucleotide comprises an E4 region comprising an adenoviral E4 orfl sequence. For example, the polynucleotide comprises an E4 region comprising an adenoviral E4 orfl sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 46 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 46. In some embodiments, the polynucleotide comprises an E4 region encoding an adenoviral E4 orfl protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 47 or a functional equivalent or ortholog thereof.

[0077] In some embodiments, the polynucleotide comprises an E4 region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 48 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 48. For example, the E4 region comprises a nucleotide sequence having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 48 or having at least 90% (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 48.

[0078] In some embodiments, the polynucleotide comprises an E4 region comprising a nucleotide sequence having 100% identity to SEQ ID NO: 48 or having 100% identity to a sequence complementary to SEQ ID NO: 48.

[0079] The E4 region can be under the control of one or more promoters. In some embodiments, E4 region is not under the control of a chicken P-actin promoter or a SV40 promoter.

[0080] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral El region or a functional portion thereof In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral El region or a functional portion thereof.

[0081] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof. In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof. In some embodiments, the adenoviral protease has the amino acid sequence SEQ ID NO: 49. Accordingly, in some embodiments, the polypeptide does not comprise a nucleotide sequence encoding a protein having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 49 or a functional equivalent or ortholog thereof.

[0082] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral Ela 13S protein or a functional portion thereof. In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof. In some embodiments, the adenoviral Ela 13 S protein has the amino acid sequence SEQ ID NO: 50.Accordingly, in some embodiments, the polypeptide does not comprise a nucleotide sequence encoding a protein having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 50 or a functional equivalent or ortholog thereof

[0083] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral Ela 12S protein or a functional portion thereof. In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof In some embodiments, the adenoviral Ela 12S protein has the amino acid sequence SEQ ID NO: 51. Accordingly, in some embodiments, the polypeptide does not comprise a nucleotide sequence encoding a protein having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 51 or a functional equivalent or ortholog thereof.

[0084] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral Ela 11S protein or a functional portion thereof. In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof. In some embodiments, the adenoviral Ela 11S protein has the amino acid sequence SEQ ID NO: 52.Accordingly, m some embodiments, the polypeptide does not comprise a nucleotide sequence encoding a protein having at least 80% (e.g., at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 52 or a functional equivalent or ortholog thereof.

[0085] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral Ela 10S protein or a functional portion thereof. In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof. In some embodiments, the adenoviral Ela 10S protein has the amino acid sequence SEQ ID NO: 53.Accordingly, in some embodiments, the polypeptide does not comprise a nucleotide sequence encoding a protein having at least 80% (e.g.. at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 53 or a functional equivalent or ortholog thereof.

[0086] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral Ela 9S protein or a functional portion thereof. In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof. In some embodiments, the adenoviral Ela 9S protein has the amino acid sequence SEQ ID NO: 54.Accordingly, in some embodiments, the polypeptide does not comprise a nucleotide sequence encoding a protein having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 54 or a functional equivalent or ortholog thereof.

[0087] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral Elb 19K protein or a functional portion thereof. In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof. Insome embodiments, the adenoviral Elb 19K protein has the amino acid sequence SEQ ID NO: 55.Accordingly, in some embodiments, the polypeptide does not comprise a nucleotide sequence encoding a protein having at least 80% (e.g.. at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 55 or a functional equivalent or ortholog thereof.

[0088] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral Elb 55K protein or a functional portion thereof. In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof. In some embodiments, the adenoviral Elb protein 55K protein has the amino acid sequence SEQ ID NO: 56 Accordingly, in some embodiments, the polypeptide does not comprise a nucleotide sequence encoding a protein having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 56 or a functional equivalent or ortholog thereof.

[0089] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral hexon protein or a functional portion thereof. In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof in some embodiments, the adenoviral Elb hexon protein has the amino acid sequence SEQ ID NO: 57. Accordingly, in some embodiments, the polypeptide does not comprise a nucleotide sequence encoding a protein having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 57 or a functional equivalent or ortholog thereof.

[0090] The polypeptide can also comprise a nucleotide sequence encoding an adenoviral peripentonal hexon-associated protein or a functional portion thereof. In some embodiments, the polypeptide does not comprise a nucleotide sequence encoding an adenoviral protease or a functional portion thereof. In some embodiments, the adenoviral Elb peripentonal hexon-associated protein has the amino acid sequence SEQ ID NO: 58. Accordingly, in some embodiments, the polypeptide does not comprise a nucleotide sequence encoding a protein having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 58 or a functional equivalent or ortholog thereof.

[0091] In some embodiments, the polynucleotide is about 16,500 nucleotides or less in size. For example, the polynucleotide is about 15,500 nucleotides, about 14,000 nucleotides, about 12,500 nucleotides, about 12,000 nucleotides, about 11,000 nucleotides or less in size.

[0092] It is noted that the polynucleotide can be single-stranded or double-stranded. In some embodiments, the polypeptide is single-stranded. In some other embodiments, the polynucleotideis double-stranded. Further, the polynucleotide can be linear, circular, or close ended linear duplexed DNA (clDNA) or no end DNA (neDNA).

[0093] In some preferred embodiments, the polynucleotide does not comprise a chicken 0-actin promoter and / or an SV40 promoter. For example, the expression of E2a region and / or E4 open reading frames is not under the control of a chicken 0-actin promoter and / or an SV40 promoter.

[0094] In another aspect provided herein is vector comprising a polynucleotide described herein In some embodiments, the vector is viral vector, e.g., a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a herpes simplex viral vector. Preferably, the viral vector is an adenoviral vector. In some embodiments, the vector does not comprise a nucleotide sequence encoding full length L-22K and / or a full length L-33K protein. For example, the vector does not comprise a polynucleotide encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 and / or 8, or ortholog thereof.

[0095] In yet another aspect provided herein is plasmid comprising a polynucleotide described herein. In some embodiments, the plasmid does not comprise a nucleotide sequence encoding full length L-22K and / or a full length L-33K protein. For example, the vector does not comprise a polynucleotide encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identify to SEQ ID NO: 7 and / or 8, or ortholog thereof.

[0096] In some embodiments, a polynucleotide, vector or plasmid described herein, further comprises a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes. For example, a polynucleotide, vector or plasmid described herein, further comprises nucleotide sequence encoding a AAV capsid and AAV Rep genes. It is noted that the AAV capsid and AAV Rep genes can be from the same AAV serotypes or form different serotypes. In some embodiments, a polynucleotide, vector or plasmid described herein, further comprises a nucleotide sequence encoding a AAV2 Rep and AAV Cap genes from a AAV serotype other than AAV2. For example, a polynucleotide, vector or plasmid described herein, further comprises nucleotide sequence encoding a AAV2 Rep and AAV Cap genes from AAV9, AAV6 or AAV8. It is noted that the nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes can be operably linked to a promoter. In some embodiments, a polynucleotide as described herein, further comprising nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes isintegrated in host cell genome, where the host cell generated thereby can successfully produce recombinant virus e.g. recombinant AAV (rAAV), either when the host cell is supplied with vector including AAV ITR flanked transgene in trans or when the host cell genome further integrated AAV ITR flanked transgene.

[0097] Without wishing to be bound by theory, polynucleotide, vector or plasmid described herein, further comprises a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and non-structural replication (e.g., AAV Rep) genes are suitable for viral particle production using a two-plasmid system. This can reduce costs.

[0098] In some embodiments, a polynucleotide, vector or plasmid described herein, further comprises a stuffer sequence. For example, a polynucleotide, vector or plasmid described herein, further comprises: (i) a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and (2) a stuffer sequence. In some embodiments, a polynucleotide, vector or plasmid described herein, further comprises further comprises: (i) a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and (2) a stuffer sequence, and wherein the stuffer sequence is within the nucleotide sequence encoding the viral capsid (e.g., AAV capsid) and / or the non-structural replication (e.g., AAV Rep) genes. For example, a polynucleotide, vector or plasmid described herein, further comprises further comprises: (i) a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and non-structural replication (e.g., AAV Rep) genes; and (2) a stuffer sequence, and wherein the stuffer sequence is within the nucleotide sequence encoding the non-structural replication (e.g., AAV Rep) genes. Stuffer sequence can also be at positions as described in International Patent Application No: PCT / US2024 / 034993, which is incorporated by reference in its entirety. In some embodiments, the AAV Rep is an AAV Rep as described in US Patent Nos.9,169,494, 10,233,428; 10,858,632; 11,542,478.

[0099] Exemplary stuffer sequences are described herein below. In some embodiments, the stuffer sequence comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to one of SEQ ID NO: 108-114. For example, the stuffer sequence comprises a nucleotide sequence having at least 80% (e g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 113.

[0100] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding at least one capsid protein (e.g., VP1, VP2, or VP3) from the AAV serotypes listed in Table 2. In some embodiments, a polynucleotide as described herein is capable of producing AAV particle or rAAV from host cell, where the host cell either integrates additionalnucleotides encoding necessary adenoviral helper or AAV helper proteins or host cell is supplied with necessary helper proteins in trans, and where the produced rAAV is selected from the AAV serotypes listed in Table 2 or the produced rAAV has at least one of VP1, VP2 or VP3 selected from the AAV serotypes listed in Table 2.

[0101] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding at least one AAV Rep (e.g., Rep78, Rep 68, Rep52 or Rep 40) from the AAV serotypes listed in Table 2.

[0102] In some embodiments, at least one capsid protein (e.g., VP1, VP2, or VP3) from the AAV serotypes listed in Table 2 and at least one Rep (e.g., Rep78, Rp 68, Rep52 or Rep 40) from the AAV serotypes listed in Table 2, where the serotype of the capsid and the Rep are independent of each other.

[0103] In still another aspect, provided herein is a cell comprising a polynucleotide, vector or plasmid descri bed herein. The cell can be an insect cell or a mammalian cell, preferably the cell is a mammalian cell. In some embodiments, the cell is a HeLa cell, COS cell, COS-1 cell, COS-7 cell, HEK293 cell, A549 cell, BHK cell, BSC-1 cell, BSC-40 cell, Vero cell, Sf’c9 cell, Sf -21 cell, Tn-368 cell, BTI-Tn-5Bl-4 (High-Five) cell, Saos cell, C2C12 cell, L cell, HT1080 cell, HepG2 cell, WEH1 cell, 3T3 cell, 10T1 / 2 cell, MDCK cell, BMT-10 cell, WI38 cell, or a primary fibroblast, hepatocyte or myoblast cells derived from a mammal. Preferably, the cell is a HEK293 cell or HeLa cell.

[0104] In some embodiments, the cell can be a suspension adapted cell.

[0105] In some embodiments, the cell is a producer cell.

[0106] In some embodiments, the cell further comprises a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L-ITR and / or R-ITR), and wherein the L-ITR and R-ITR are selected independently from AAV ITRs and adenoviral ITRs.

[0107] In some embodiments, the cell further comprises a polynucleotide encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes.

[0108] In some embodiments, the cell further comprises: (i) a polynucleotide, vector or plasmid described herein; (ii) a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L-ITR and / or R-ITR); and (iii) a polynucleotide encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes. In some embodiments, the polynucleotide of (i)the polynucleotide of (ii) are the same. Stated in another way, the the polynucleotide of (i) and the polynucleotide of (ii) are covalently linked, e.g., by an internucleotide linkage (e.g., phosphodiester bond) or by a nucleotide sequence to each other. In some embodiments, polynucleotide of (i) and the polynucleotide of (iii) are the same. Stated in another way, the the polynucleotide of (i) and the polynucleotide of (ii) are covalently linked, e.g., by an internucleotide linkage (e.g., phosphodiester bond) or by a nucleotide sequence to each other. For example, a polynucleotide, vector or plasmid described herein, further comprises nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes.

[0109] In some embodiments, the cell comprises (i) a polynucleotide, vector or a plasmid described herein; and (ii) a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-AAV ITR) and / or right ITR (R-AAV ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L-AAV ITR and / or R-AAV ITR), and wherein the polynucleotide of (i) further comprises a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes. For example, the polynucleotide of (i) further comprises nucleotide sequence encoding a AAV capsid and AAV Rep genes.

[0110] In some embodiments, the host cell comprises (i) a polynucleotide, vector or a plasmid described herein; and (ii) a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-AAV ITR) and / or right ITR (R-AAV ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L-AAV ITR and / or R-AAV ITR), and wherein the polynucleotide of (i) further comprises: (a) a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and (b) a stuffer sequence.

[0111] In some embodiments, the cell comprising a polypeptide, vector or plasmid described herein does not comprise a polynucleotide encoding a full length L-22K and / or a full length L-33K protein. For example, the cell does not comprise a polynucleotide encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8, or ortholog thereof.

[0112] Without wishing to be bound by a theory, a polypeptide, vector, or plasmid described herein, or a cell comprising same can be used for producing recombinant adeno-associated viral (rAAV) particles. Accordingly, in yet still another aspect, the disclosure provides a method for producing recombinant adeno-associated viral (rAAV) particles, the method comprising: culturing a cell described herein in a culture medium under conditions in which rAAV particles are produced.

[0113] In one aspect, provided herein is a method for producing recombinant adeno-associated viral (rAAV) particles, the method comprising: culturing a host cell in a culture medium under conditions in which rAAV particles are produced, where the host cell comprises in cis or in trans: (i) a polynucleotide, vector or a plasmid described herein; (ii) a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-AAV ITR) and / or right ITR (R-AAV ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L-AAVITR and / or R-AAV ITR); and (iii) a polynucleotide encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes. In some embodiments, the polynucleotide of (i) the polynucleotide of (ii) are the same. Stated in another way, the the polynucleotide of (i) and the polynucleotide of (ii) are covalently linked, e.g., by an internucleotide linkage (e.g., phosphodiester bond) or by a nucleotide sequence to each other. In some embodiments, polynucleotide of (i) and the polynucleotide of (iii) are the same. Stated in another way, the the polynucleotide of (i) and the polynucleotide of (ii) are covalently linked, e.g., by an internucleotide linkage (e.g., phosphodiester bond) or by a nucleotide sequence to each other. For example, a polynucleotide, vector or plasmid described herein, further comprises nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes.

[0114] In some embodiments, the host cell comprises (i) a polynucleotide, vector or a plasmid described herein; and (ii) a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-AAV ITR) and / or right ITR (R-AAV ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L-AAV ITR and / or R-AAV ITR), and wherein the polynucleotide of (i) further comprises a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes. For example, the polynucleotide of (i) further comprises nucleotide sequence encoding a AAV capsid and AAV Rep genes.

[0115] In some embodiments, the host cell comprises (i) a polynucleotide, vector or a plasmid described herein; and (ii) a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-AAV ITR) and / or right ITR (R-AAV ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L-AAV ITR and / or R-AAV ITR), and wherein the polynucleotide of (i) further comprises: (a) a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and (b) a stuffer sequence.

[0116] In some embodiments, the cell culture is substantially free of a polynucleotide encoding a full-length L-22K protein and / or a full-length L-33K protein. For example, the cell culture is substantially free of a polynucleotide encoding a protein having an amino acid sequence having atleast 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at feast 93%, at feast 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 er 8, or ortholog thereof.

[0117] As used herein, the term “substantially free” means that the cell culture does not comprise a polynucleotide encoding a full-length L-22K protein and / or a full-length L-33K protein m such an amount that a full-length L-22K protein and / or a full-length L-33K protein is produced in a detectable amount. Thus, in some embodiments, a full-length L-22K protein and / or a full-length L-33K protein is not expressed during the culturing of the cell. For example, a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8, or ortholog thereof, is not expressed during the culturing of the cell.

[0118] In some embodiments, the method for producing viral particles, e.g., recombinant adeno-associated viral (rAAV) particles further comprises a step of transfecting the cell with a polynucleotide vector or plasmid described herein. For example, the method comprises a step of transfecting the cell with a polynucleotide vector or plasmid described herein, and transfecting the cell with: (i) a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L-ITR and / or R-ITR); and / or (ii) a polynucleotide encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes. In some embodiments, the polynucleotide of (i) the polynucleotide of (ii) are the same. Stated in another way, the the polynucleotide of (i) and the polynucleotide of (ii) are covalently linked, e.g., by an internucleotide linkage (e.g., phosphodiester bond) or by a nucleotide sequence to each other.

[0119] The cells can be cultured for at least 10 hours (e.g., at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours, at least 19 hours, at least 20 hours, at least 21 hours, at least 22 hours, at least 23 hours, at least 24 hours, at least 25 hours, at least 26 hours, at least 27 hours, at least 28 hours, at least 29 hours, at least 30 hours, at least 31 hours, at least 32 hours, at least 33 hours, at least 34 hours, at least 35 hours, at least 36 hours, at least 37 hours, at least 38 hours, at least 39 hours, at least 40 hours, at least 41 hours, at least 42 hours, at least 43 hours, at least 44 hours, at least 45 hours, at least 46 hours, at least 47 hours, at least 48 hours, at least 49 hours, at least 50 hours, at least 51 hours, at least 52 hours, at least 53 hours, at least 54 hours, at least 55 hours, at least 56 hours, at least 57 hours, at least 58 hours, at least 59 hours, at least 60 hours, at least 61 hours, at least 62 hours, at least 63 hours, at least 64 hours, at least 65 hours, at least 66 hours, at least 67 hours, atleast 68 hours, at least 69 hours, at least 70 hours, at least 71 hours, at least 72 hours, at least 73 hours, at least 74 hours, at least 75 hours, at least 76 hours, at least 77 hours, at least 78 hours, at least 79 hours, at least 80 hours, at least 81 hours, at least 82 hours, at least 83 hours, at least 84 hours, at least 85 hours, at least 86 hours, at least 87 hours, at least 88 hours, at least 89 hours, at least 90 hours, at least 91 hours, at least 92 hours, at least 93 hours, at least 94 hours, at least 95 hours, at least 96 hours, at least 97 hours, at least 98 hours, at least 99 hours, at least 100 hours or more).

[0120] In some embodiments, the method for producing viral particles, e.g., recombinant adeno-associated viral (rAAV) particles further comprises a step, e.g., a post-lysis step of removing or reducing an amount of impurities, e.g., hcDNAfrom the cell culture or cell culture supernatant. Without limitation, the step of removing or reducing the amount of impurities can comprise adding a cationic amine or nuclease to the cell culture or cell culture supernatant. In some embodiments, the step of removing or reducing the amount of impurities comprises adding a selective precipitation agent to the cell culture or cell culture supernatant.

[0121] In some embodiments, the method for producing viral particles, e.g., recombinant adeno-associated viral (rAAV) particles further comprises a step of clarifying the cell culture or cell culture supernatant. Without limitations, the step of clarifying the cell culture or cell culture supernatant can comprise depth filtration.

[0122] In some embodiments, the method for producing recombinant adeno-associated viral (rAAV) particles further comprises a step of concentrating the clarified cell culture or cell culture supernatant, e.g., via tangential flow filtration.

[0123] In some embodiments, the method for producing viral particles, e.g., recombinant adeno-associated viral (rAAV) particles further comprises a step of enriching or purifying rAAV particles. For example, the method further comprises a step of enriching or purifying rAAV particles by chromatography, e.g., affinity chromatography and / or anion exchange chromatography.

[0124] In some embodiments, wherein at least about 50%, (e.g., at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 95%, at least about 95% or a higher percentage) of the rAAV particles produced are full capsid particles.

[0125] In some embodiments, a method described herein produces at least about 1 x 104(e.g., e.g., at least about 2 x 104, 3 x 104, 4 x 104, 5 x 104, 7 x 104, 7 x 104, 8 x 104, 9 x 104, or 1 x 105or more) vector genome-containing particles per cell, e.g., prior to or after purification.

[0126] In some embodiments, a method for producing viral particles, e.g., recombinant adeno-associated viral (rAAV) particles described herein provides at least about 1e12vector genome perml (vg / ml) (e.g., at least about 1.5e12vg / ml, at least about 2e12vg / ml, at least about 2.5e12vg / ml, at least about 3e12vg / ml, at least about 3.5e12vg / ml, at least about 4e12vg / ml, at least about 4.5e12vg / ml, at least about 5e12vg / ml, at least about 5.5e12vg / ml, at least about 6e12vg / ml, at least about 6.5e12vg / ml, at least about 7e12vg / ml, at least about 7.5e12vg / ml, at least about 8e12vg / ml, at least about 8.5e12vg / ml, at least about 9e12vg / ml, at least about 9.5e13vg / ml, at least about le13vg / ml, at least about 1.5e13vg / ml, at least about 2e13vg / ml, at least about 2.5e13vg / ml, at least about 3 e13vg / ml, at least about 3.5e13vg / ml, at least about 4e13vg / ml, at least about 4.5e13vg / ml, at least about 5e13vg / ml, at least about 5.5e13vg / ml, at least about 6e13vg / ml, at least about 6.5e13vg / ml, at least about 7e13vg / ml, at least about 7.5e13vg / ml, at least about 8e13vg / ml, at least about 8.5e13vg / ml, at least about 9e13vg / ml, at least about 9.5e13vg / ml, at least about le14vg / ml or more), e.g., prior to or after purification, such as after affinity purification.

[0127] In some embodiments, a method for producing viral particles, e.g., recombinant adeno-associated viral (rAAV) particles described herein provides at least about le12viral particles per ml (vp / ml) at least about le12viral particles per ml (vp / ml) (e.g., at least about 1.5e12vp / ml, at least about 2e12vp / ml, at least about 2.5e12vp / ml, at least about 3e12vp / ml, at least about 3.5e12vp / ml, at least about 4e12vp / ml, at least about 4.5e12vp / ml, at least about 5e12vp / ml, at least about 5.5e12vp / ml, at least about 6e12vp / ml, at least about 6.5e12vp / ml, at least about 7e12vp / ml, at least about 7.5e12vp / ml, at least about 8e12vp / ml, at least about 8.5e12vp / ml, at least about 9e12vp / ml, at least about 9.5e13vp / ml, at least about le13vp / ml, at least about 1.5e13vp / ml, at least about 2e13vp / ml, at least about 2.5e13vp / ml, at least about 3e13vp / ml, at least about 3.5e13vp / ml, at least about 4e13vp / ml, at least about 4.5e13vp / ml, at least about 5e13vp / ml, at least about 5.5e13vp / ml, at least about 6e13vp / ml, at least about 6.5e13vp / ml, at least about 7e13vp / ml, at least about 7.5e13vp / ml, at least about 8e13vp / ml, at least about 8.5e13vp / ml, at least about 9e13vp / ml, at least about 9.5e13vp / ml, at least about le14vp / ml or more), e.g., prior to or after purification, such as after affinity purification.

[0128] Without limitations, the rAAV particles can be AAV-1, AAV-2, AAV-218, AAV-3, AAV- 4, AAV-5, AAV-6, AAV-7, AAV-8, AAV-9, AAV-10, AAVrhlO, AAV- 11, AAV-12, AAV-13, AAV- 14, AAV-15, AAV-16 or a chimera, derivative, modification, or pseudotype thereof.

[0129] In some embodiments, the rAAV particle comprises at least one capsid protein (e.g., VP1, VP2, or VP3) from the AAV serotypes listed in Table 2.

[0130] Without wishing to be bound by a theory, a polynucleotide described herein is capable of producing recombinant adeno-associated viral (rAAV) particles in an amount that is at least 80% of an amount produced under similar conditions with a similar polynucleotide that further comprises a nucleotide sequence encoding a full-length L-22K protein and / or a full-length L-33K protein.

[0131] Again, without wishing to be bound by a theory, a packaging efficiency of the polynucleotide in a method of producing rAAV is at least 80% of a packaging efficiency of a similar polypeptide that further comprises a nucleotide sequence encoding a full-length L-22K protein and / or a full-length L-33K protein.

[0132] In yet another aspect, the disclosure provides a recombinant adeno-associated virus in combination with a polynucleotide, vector, plasmid, or cell described herein.

[0133] Sequences are shown in Table 3.BRIEF DESCRIPTION OF THE DRAWINGS

[0134] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawings will be provided by the Office upon request and payment of the necessary fee.

[0135] FIGS. 1-6 are schematic sequence map of exemplary helper plasmids pHADl (SEQ ID NO: 1, FIG. 1), pHAD2 (SEQ ID NO: 2, FIG.2), pHAD3 (SEQ ID NO: 3, FIG.3), pHAD4 (SEQ ID NO: 4, FIG. 4), pHAD5 (SEQ ID NO: 5, FIG.5), and pHAD6 (SEQ ID NO: 6, FIG.6).

[0136] FIG. 7 is a schematic sequence map of TR_Lux2A-GFP recombinant AAV vector plasmid (SEQ ID NO: 77).

[0137] FIG. 8 shows AAV8 total vector particles (VP) and vector genomes (VG) obtained through affinity purification from small-scale (62.5 mL) triple transfections with exemplary helper plasmids. Small-scale AAV productions were performed in duplicate with each helper plasmid. Vector particles titers were measured by SEC-HPLC and vector genomes titers by ITR qPCR.

[0138] FIG. 9 shows AAV6 total vector particles (VP) and vector genomes (VG) obtained through affinity purification from small-scale (62.5 mL) triple transfections with exemplary helper plasmids. Small-scale AAV productions were performed in duplicate with each helper plasmid. Vector particles titers were measured by SEC-HPLC and vector genomes titers by ITR qPCR.

[0139] FIG. 10 shows AAV2, AAV8 and AAV9 vector particles (vp) and vector genomes (vg) titers obtained through affinity purification from small-scale (32.25 mL) triple transfections with exemplary helper plasmids. Small-scale AAV productions were performed in duplicate with each of the seven different helper plasmids. Vector particles titers were measured by capsid ELISA and vector genomes titers by ITR qPCR.

[0140] FIG. 11 shows AAV8 vectors titers and total yields obtained after purification from 2-liter bioreactors with exemplary plasmids. Vector genomes were quantified by ITR qPCR and ITR ddPCR, and viral particles by SEC-HPLC.

[0141] FIG. 12 shows residual plasmid sequences concentrations in purified AAV8 vectors produced in 2-liter bioreactors. Residual plasmid DNA concentration was measured by ddPCR targeting the E4 region in the helper plasmids, the Rep coding sequence in the rep-cap plasmid, and the kanamycin-resistance gene present in all three plasmid backbones. The PCR targets concentrations (copies / mL) are presented in logarithmic scale.

[0142] FIG. 13 depicts AAV8 vector purity by SDS-PAGE and silver staining. Vectors produced with the different helper plasmids were loaded onto duplicate wells.

[0143] FIG. 14 shows percentages of empty, partial, and full vector particles in AAV8 final products as determined by AUC.

[0144] FIG. 15 shows luciferase transgene expression following transduction of GM16095 cells with purified AAV8 vectors. Vectors were added to the cells at a multiplicity of 5E+5 or 1E+6 VG / cell, and luciferase activity was measured after 48-hours and normalized to total proteins concentration. Statistical analysis: One-way ANOVA with Kruskal-Wallis test.

[0145] FIG. 16 shows AAV6 vectors titers and total yields obtained after purification from 2-liter bioreactors. Vector genomes were quantified by ITR qPCR and ITR ddPCR, and viral particles by SEC-HPLC.

[0146] FIG. 17 shows residual plasmid sequences concentrations in purified AAV6 vectors produced in 2-liter bioreactors. Residual plasmid DNA concentration was measured by ddPCR targeting the E4 region in the helper plasmids, the Rep coding sequence in the rep-cap plasmid, and the kanamycin-resistance gene present in all three plasmid backbones. The PCR targets concentrations (copies / mL) are presented in logarithmic scale.

[0147] FIG. 18 shows AAV6 vector purity by SDS-PAGE and silver staining. Vectors produced with the different helper plasmids were loaded onto duplicate wells.

[0148] FIG. 19 shows percentages of empty, partial, and full vector particles in AAV6 final products as determined by AUC.

[0149] FIG. 20 shows luciferase transgene expression following transduction of GM16095 cells with purified AAV6 vectors. Vectors were added to the cells at a multiplicity of 1E+5 or 5E+5 VG / cell, and luciferase activity was measured after 48-hours and normalized to total proteins concentration. Statistical analysis: One-way ANOVA with Kruskal-Wallis test.

[0150] FIG. 21 shows AAV9 vector particles (VP) and vector genomes (VG) titers obtained through affinity purification from small-scale (62.5 mL) triple transfections. VP were measured by SEC-HPLC and VG by ITR ddPCR and ITR qPCR. Statistical analysis was performed by oneway ANOVA with Kruskal Wallis test and Dunn's correction for multiple comparison.

[0151] FIG. 22 shows percentages of empty, partial, and full vector particles in affinity-purified small-scale AAV9 vectors as determined by AUC. The graph represents mean values of triplicate transfections.

[0152] FIG. 23 shows AAV9 vector particles (VP) and vector genomes (VG) titers obtained after purification from 2-liter bioreactors. Viral particles were quantified by SEC-HPLC and vector genomes by ITR qPCR and ITR ddPCR.

[0153] FIG. 24 shows residual plasmid sequences concentrations in purified AAV9 vectors produced in 2-liter bioreactors. Residual plasmid DNA concentration was measured by ddPCR targeting the Rep coding sequence in the rep-cap plasmid, the E4 region in the helper plasmid, and the kanamycin-resistance gene present in all three plasmid backbones.

[0154] FIG. 25 shows AAV9 vector purity by SDS-PAGE and silver staining. Vectors produced with the different helper plasmids were loaded onto duplicate wells.

[0155] FIG. 26 shows percentages of empty, partial, and full vector particles in AAV9 vectors purified from 2-Liters bioreactors as determined by AUC.

[0156] FIG. 27 shows luciferase transgene expression following transduction of HeLa cells with purified AAV9 vectors. Vectors were added to the cells at a multiplicity of 5E+5 or 1E+6 VG / cell, and luciferase activity was measured after 48-hours and normalized to total proteins concentration. Statistical analysis: One-way ANOVA with Kruskal-Wallis test.

[0157] FIG. 28 shows AAV8 vector genomes concentration (VG / mL) obtained in duplicate small-scale (62.5 mL) triple transfection in the transfected cells pool at harvest (TP), in the bulk lysate (BL), and in the bulk virus pool after affinity purification (BVP). VG were measured by ITR qPCR.

[0158] FIG. 29 shows AAV6 vector genomes (VG / mL) concentration obtained in duplicate small-scale (62.5 mL) triple transfection in the transfected cells pool at harvest (TP), in the bulk lysate (BL), and in the bulk virus pool after affinity purification (BVP). VG were measured by ITR qPCR.

[0159] FIG. 30 shows AAV9 vector genomes concentration (VG / L) obtained in triplicate small-scale (62.5 mL) triple transfection in the in the bulk lysate (BL), and in the bulk virus pool after affinity purification (BVP). VG were measured by ITR qPCR in the bulk lysate (BL), and in the bulk virus pool after affinity purification (BVP)

[0160] FIG. 31 is a schematic sequence map of ssAAV-CMV-eGFP recombinant AAV vector plasmid (Campos et al., “Orthogonal approaches to AAV vector characterization: Validating quantitative TEM for partially filled particles.” Molecular Therapy Methods & Clinical Development (2025), Volume 33, Issue 3, 101530) (SEQ ID NO: 115).

[0161] FIG. 32 is a schematic sequence map of scAAV-CMV-eGFP recombinant AAV vector plasmid (Campos et al.) (SEQ ID NO: 116).

[0162] FIG. 33 is a schematic sequence map of plasmid pARC9, which contains an AAV2 rep and AAV9 cap expression cassette cloned upstream of the synthetic polyadenylation signal into pHAD5 helper plasmid.

[0163] FIG. 34 is a schematic sequence map of plasmid pARC9v2, which contains an AAV2 rep and AAV9 cap expression cassette cloned upstream of the synthetic polyadenylation signal into pHAD6 helper plasmid.

[0164] FIG. 35 is a schematic sequence map of plasmid pHelp-RC9-A, which contains an oversized AAV2 rep and AAV9 cap expression cassette cloned upstream of the synthetic polyadenylation signal into pHAD6 helper plasmid, where the start codon for Rep78 / 68 coding sequence is an ATG, and the rep gene includes a synthetic 2-kb intronic sequence (SEQ ID NO: 113) inserted downstream the AAV2 pl 9 promoter.

[0165] FIG. 36 is a schematic sequence map of plasmid pHelp-RC9-B, which contains an oversized AAV2 rep and AAV9 cap expression cassette cloned upstream of the synthetic polyadenylation signal into pHAD6 helper plasmid, where the start codon for Rep78 / 68 coding sequence is an ACG, and the rep gene includes a synthetic 2-kb intronic sequence (SEQ ID NO: 113 corresponds to SEQ ID NO 13 in PCT / US2024 / 034993 - WO 2024 / 263896) inserted downstream the AAV2 pl 9 promoter.

[0166] FIG. 37 shows AAV9 vector genomes titers (vg / mL) obtained by ITR qPCR after purification from 2-liter bioreactors with exemplary plasmids.

[0167] FIG. 38 shows residual plasmid sequences concentrations in purified AAV9 vectors produced in 2-liter bioreactors. PCR targets concentrations are presented as percentage relative to vector genome titers.

[0168] FIG. 39 shows AAV9 vector particles titers (VP / mL) and A260 / A280 ratio obtained by SEC-HPLC after purification from 2-liter bioreactors with exemplary plasmids.

[0169] FIG. 40 shows percentages of empty, partial, and full vector particles in AAV9 vectors purified from 2-Liters bioreactors as determined by mass photometry.

[0170] FIG. 41 shows AAV9 vector genome titers (vg / mL) determined by ITR qPCR in clarified lysates from small-scale (32.25 mL) triple transfections using pssAAV-CMV-eGFP vector plasmid, performed with the optimal plasmid ratio determined for pXX680 helper plasmid (Ctrl pXX680), same plasmid ratio applied to pHAD5 (Ctrl pHAD5), and varying ratio of the three plasmids using pHAD5 as the helper (Condi through Cond 12).

[0171] FIG. 42 shows relative amounts (%) of full, partially filled, and empty AAV9 particles determined by mass photometry following affinity purification from small-scale (32.25 mL) tripletransfections using pssAAV-CMV-eGFP vector plasmid, with the optimal plasmid ratio determined for pXX680 helper plasmid (Ctrl pXX680), same plasmid ratio applied to pHAD5 (Ctrl pHAD5), and varying ratio of the three plasmids using pHAD5 as the helper (Condi through Cond 12).

[0172] FIG. 43 shows AAV9 vector genome titers (vg / mL) determined by ITR qPCR in affinity pool and final product samples from 2-liter scale productions performed with pHAD5 helper plasmid with and without ReVIT enhancer addition in the transfection mix.

[0173] FIG. 44 shows AAV9 vector particles titers (vp / mL) determined by SEC-HPLC in affinity pool and final product samples from 2-liter scale productions performed with pHAD5 helper plasmid with and without RevIT enhancer addition in the transfection mix. The graph also shows A260 / A280 values calculated for each sample.

[0174] FIG. 45 shows the relative percentages of full, partially filled, and empty AAV9 particles measured by mass photometry in affinity pool and final product samples from 2-liter scale productions performed with pHAD5 helper plasmid with and without ReVIT enhancer.

[0175] FIG. 46 shows the relative percentages of full, partially filled, and empty AAV9 particles measured by AUC in affinity pool and final product samples from 2-liter scale productions performed with pHAD5 helper plasmid with and without ReVIT enhancer.

[0176] FIG. 47 shows the amount of residual host cell DNA normalized to the vector genome titer (in pg / lE+9 vg) in affinity pool and final product samples from 2-liter scale AAV9 productions performed with pHAD5 helper plasmid with and without ReVIT enhancer.

[0177] FIG. 48 shows the percentages of residual plasmid DNA KanR, p5 and Rep sequences normalized to the vector genome titer in affinity pool and final product samples from 2-liter scale AAV9 productions performed with and without ReVIT enhancer.

[0178] FIG. 49 shows AAV9 vector genome titers (VG / mL) by ITR qPCR and vector particles titers (VP / mL) by SEC-HPLC obtained following triplicate small-scale (62.5 mL) transfection and affinity purification. A control triple-transfection was performed with pHAD5 as the helper plasmid, and double-transfections were performed with pARC9, pARC9_v2, pHelp-RC9-A and pHelp-RC9-B, all with the same pTR_Lux2A-GFP vector plasmid. Helper / rep-cap plasmids concentrations for double transfection were adjusted to reach same rep-cap sequence copy number as in the triple-transfection control.

[0179] FIG. 50 shows the mean relative percentages of full, partially filled, and empty AAV9 particles measured by mass photometry following triplicate small-scale (62.5 mL) transfection and affinity purification. A control triple-transfection was performed with pHAD5 as the helper plasmid, and double-transfections were performed with pARC9, pARC9_v2, pHelp-RC9-A and pHelp-RC9-B, all with the same pTR_Lux2A-GFP vector plasmid. Helper / rep-cap plasmidsconcentrations for double transfection were adjusted to reach same rep-cap sequence copy number as in the triple-transfection control.

[0180] FIG. 51 shows residual plasmid DNA concentration (copies / mL) measured by ddPCR targeting the KanR sequence in affinity -purified samples from triplicate small-scale (62.5 mL) transfections. A control triple-transfection was performed with pHAD5 as the helper plasmid, and double-transfections were performed with pARC9, pARC9_v2, pHelp-RC9-A and pHelp-RC9-B, all with the same pTR_Lux2A-GFP vector plasmid. Helper / rep-cap plasmids concentrations for double transfection were adjusted to reach same rep-cap sequence copy number as in the tripletransfection control.

[0181] FIG. 52 shows AAV9 vector genome titers (VG / mL) by ITR qPCR and vector particles titers (VP / mL) by SEC-HPLC obtained following affinity purification of small-scale (62.5 mL) transfections performed with three plasmids as a control, using pHAD5 or pHAD6 as the helper, or two plasmids, using pARC9 or pARC9_v2, at different relative concentrations, together with pTR_Lux2A-GFP vector plasmid.

[0182] FIG. 53 shows relative amounts (%) of full, partially filled, and empty AAV9 particles determined by mass photometry following affinity purification from small-scale (62.5 mL) transfections performed with three plasmids as a control, using pHAD5 or pHAD6 as the helper, or two plasmids, using pARC9 or pARC9_v2, at different relative concentrations, together with pTR_Lux2A-GFP vector plasmid.

[0183] FIG. 54 shows percentage of residual plasmid DNA (relative to ITR qPCR vector genome titers) measured by ddPCR targeting the KanR sequence in affinity-purified samples from triplicate small-scale (62.5 mL) transfections performed with three plasmids as a control, using pHAD5 or pHAD6 as the helper, or two plasmids, using pARC9 or pARC9_v2, at different relative concentrations, together with pTR_Lux2A-GFP vector plasmid.

[0184] FIG. 55 shows AAV9 vector genome titers (vg / mL) determined by ITR qPCR and viral particles titers (VP / mL) determined by SEC-HPLC of final product samples from 2-liter scale productions performed through triple transfection with pHAD5 helper plasmid or double transfection with pARC9 helper / rep-cap plasmid and pTR_Lux2A-GFP vector plasmid.

[0185] FIG. 56 shows the relative percentages of full, partially filled, and empty AAV9 particles measured by mass photometry in affinity pool and final product samples from 2-liter scale productions performed with pHAD5 helper or pARC9 helper / rep-cap plasmid and pTR_Lux2A-GFP vector plasmid.

[0186] FIG. 57 shows percentage of residual plasmid DNA (relative to ITR qPCR vector genome titers) measured by ddPCR targeting the Rep, p5, and KanR sequences in final productsamples from 2-liter scale AAV9 productions performed with pHAD5 helper or pARC9 helper / rep-cap plasmid and pTR_Lux2A-GFP vector plasmid.

[0187] FIG. 58 shows AAV9 vector genome titers (vg / mL) determined by ITR qPCR and viral particles titers (VP / mL) determined by SEC-HPLC of final product samples from 2-liter scale productions performed through triple transfection with pHAD5 helper plasmid or double transfection with pARC9 helper / rep-cap plasmid and scAAV-CMV-eGFP vector plasmid.

[0188] FIG. 59 shows the relative percentages of full, partially filled, and empty AAV9 particles measured by mass photometry in affinity pool and final product samples from 2-liter scale productions performed with pHAD5 helper or pARC9 helper / rep-cap plasmid and scAAV-CMV-eGFP vector plasmid.

[0189] FIG. 60 shows percentage of residual plasmid DNA (relative to ITR qPCR vector genome titers) measured by ddPCR targeting the Rep, p5, and KanR sequences in final product samples from 2-liter scale AAV9 productions performed with pHAD5 helper or pARC9 helper / rep-cap plasmid and scAAV-CMV-eGFP vector plasmid.

[0190] FIG. 61 is a schematic sequence map of plasmid pARC6, which contains an AAV2 rep and AAV6 cap expression cassette cloned upstream of the synthetic polyadenylation signal into pHAD5 helper plasmid.

[0191] FIG. 62 is a schematic sequence map of plasmid pARC8, which contains an AAV2 rep and AAV8 cap expression cassette cloned upstream of the synthetic polyadenylation signal into pHAD5 helper plasmid.

[0192] FIGS. 63A and 63B show Western blot analysis of L4-33K protein expression in HEK293 transfected with pHAD5 (1) or pHAD6 (2) helper plasmid. Non-transfected cells (3) were used as a negative control, and Ad5-infected cells (4) as a positive control. Protein separation was performed using 10% (FIG. 63A) or 14% (FIG. 63B) SDS-PAGE. Mw: Precision Plus Protein Dual Color Standards (Bio-Rad); a: L4-33K protein; b: Cross-reacting cellular protein; c: N-terminal truncated 33K proteins (2 IK and 17K).

[0193] FIG. 64 shows a schematic map of the Ad5 L4-22K / 33K coding region. Location of the truncated 33K and 22K candidates coding sequences (2 IK, 17K, and 18K, 13K, respectively) are shown below their respective wild-type sequences. The 33K C-terminal region used as the immunogenic peptide to generate the anti-33K polyclonal antibody is highlighted.DETAILED DESCRIPTION

[0194] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise.

[0195] The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, and treatises, are hereby expressly incorporated by reference in their entirety for any purpose.

[0196] In some embodiments, the polynucleotides described herein are smaller than the leading commercially available adenovirus helper plasmids. For example, the polynucleotides described herein have a reduced overall size relative to presently available adenoviral helper plasmids such as pXX680 at 18.932 kbp, pALD-X80 at 18.876 kbp, pFAdDeltaF6 at 15.420 kbp, and / or pHelper at 11.635 kbp.

[0197] In some embodiments, a polynucleotide of the present disclosure is approximately between about 6 kb and 17 kb. In some embodiments, a polynucleotide of the present disclosure has a size that is about 6 kb, about 6.5 kb, about 7 kb, about 7.5 kb, about 8 kb, about 8.5 kb, about 9 kb, about 9.5 kb, about 10 kb, about 10.5 kb, about 11 kb, about 11.5 kb, about 12 kb, about 12.5 kb, about 13 kb, about 13.5 kb, about 14 kb, about 14.5 kb, about 15 kb, about 15.5 kb, about 16 kb, about 16.5 kb or about 17kb. In some embodiments, a polynucleotide of the present disclosure has a size that is about 6-7 kb; about 6.5-7.5 kb; about 7-8 kb; about 7.5-8.5 kb; about 8-9 kb; about 8.5-9.5 kb; about 9-10 kb; about 9.5-10.5 kb; about 10-11 kb; about 10.5-11.5 kb; about 11-12 kb; about 11.5-12.5 kb; about 12-13 kb; about 12.5-13.5 kb; about 13-14 kb; about 13.5-14.5 kb; about 14-15 kb; about 14.5-15.5kb; about 15-16kb; about 15.5-16.5kb; or about 16-17kb.

[0198] In some embodiments, a polynucleotide described herein can be at most about 7900, at most about 8000, at most about 8100, at most about 8200, at most about 8300, at most about 8400, at most about 8500, at most about 8600, at most about 8700, at most about 8800, at most about 8900, at most about 9000, at most about 9100, at most about 9200, at most about 9300, at most about 9400, at most about 9500, at most about 9600, at most about 9700, at most about 9800, at most about 9900, at most about 10000, at most about 10100, at most about 10200, at most about 10300, at most about 10400, at most about 10500, at most about 10600, at most about 10700, at most about 10800, at most about 10900, at most about 11000, at most about 11100, at most about 11200, at most about 11300, at most about 11400, at most about 11500, at most about 11600, at most about 11700, at most about 11800, at most about 11900, at most about 12000, at most about 12100, at most about 12200, at most about 12300, at most about 12400, at most about 12500, at most about 12600, at most about 12700, at most about 12800, at most about 12900, at most about 13000, at most about 13100, at most about 13200, at most about 13300, at most about 13400, at most about 13500, at most about 13600, at most about 13700, at most about 13800, at most about 13900, at most about 14000, at most about 14100, at most about 14200, at most about 14300, at most about 14400, at most about 14500, at most about 14600, at most about 14700, at most about14800, at most about 14900, at most about 15000, at most about 15100, at most about 15200, at most about 15300, at most about 15400, at most about 15500, at most about 15600, at most about 15700, at most about 15800, at most about 15900, at most about 16000, at most about 16100, at most about 16200, at most about 16300, at most about 16400, at most about 16500, at most about 16600, at most about 16700, at most about 16,800, at most about 16,900, or at most about 17,000 nucleotides in length.

[0199] In some embodiments, a polynucleotide described herein is less than about 17,000 nucleotides, or less than about 16,750 nucleotides, or less than about 16,500 nucleotides, or less than about 16,250 nucleotides, or less than about 16,000 nucleotides, or less than about 15,750 nucleotides, or less than about 15,500 nucleotides, or less than about 15,250 nucleotides, or less than about 15,000, or less than about 14,750 nucleotides, or less than about 14,500 nucleotides, or less than about 14,250 nucleotides, or less than about 14,000 nucleotides, or less than about 13,750 nucleotides, or less than about 13,500 nucleotides, or less than about 13,250 nucleotides, or less than about 13,000 nucleotides, or less than about 12,750 nucleotides, or less than about 12,500 nucleotides, or less than about 12,250 nucleotides, or less than about 12,000 nucleotides, or less than about 11,750 nucleotides, or less than about 11,500 nucleotides, or less than about 11,250 nucleotides, or less than about 11,000 nucleotides, or less than about 10,750 nucleotides, or less than about 10,500 nucleotides, or less than about 10,250 nucleotides, or less than about 10,000 nucleotides, or less than about 9,750 nucleotides, or less than about 9,500 nucleotides, or less than about 9,250 nucleotides, or less than about 9,000 nucleotides, or less than about 8,750 nucleotides, or less than about 8,500 nucleotides, or less than about 8,250 nucleotides, or less than about 8,000 nucleotides, or less than about 7,750 nucleotides, or less than about 7,500 nucleotides, in length.

[0200] Without wishing to be bound by a theory, the polynucleotides described herein allow for safer and less costly production of rAAVs in producer cell expression systems. The smaller size of the polynucleotides describe herein enables the simpler and less costly production of AAV at the quantities necessary for large-scale manufacturing of AAV. In addition, removing genes and / or portions of genes makes a polynucleotide described herein can be safer because the producing cells would not produce the adenovirus structural proteins (e.g., fiber), that could copurify with AAV during downstream processing and would therefore present a lower risk of inadvertently introducing adenovirus structural proteins to patients. Further, removal of helper genes resulting in a smaller size enables addition of supplementary genes to further improve AAV quality and yield. Although these supplementary genes increase the size of the polypeptide relative to the smallest versions, they enable comparable or higher AAV productivity and are therefore worth the additional cost to produce. Importantly, these polynucleotides are still smaller thancommercially available helper plasmids such as, for example pXX6-80, pALD-X80, pFAdDeltaF6, and pHelper.

[0201] It is known in the art that the adenovirus late proteins, L4-22K / L4-33K, are essential for recombinant adeno-associated viral (rAAV) production. See for example, Adsero et al., “A Novel Role for the Adenoviral L4 region 22K and 33K Proteins in Adeno-Associated Virus Production.” Human Gene Therapy (2024), 35(1 -2): 59); (stating: “the adenoviral 22K protein is essential for rAAV production” and “the 33K protein synergistically increases rAAV yield” (Abstract)) and Su et al., “AAV production in stable packaging cells requires expression of adenovirus 22 / 33K protein to allow episomal amplification of integrated rep / cap genes.” Scientific Reports (2023), 13:21670 (stating: “expression of the adenovirus L4 22 / 33K unit is essential for rep / cap amplification” (Abstract)). See also WO2024107985 (stating: “these data indicate that the L4 region (containing 33K and 22K ORFs), JEP / GEP regional requirements, and adequate E2a production is important for the production of AAV” (para.

[0120] ). However, contrary to what the prior teaches, polypeptides described herein that do not encode for a full length L-22K protein and / or a full length L-33K protein unexpectedly and surprisingly can produce rAAV in an amount substantially similar to the amount of rAAV produced with a similar polynucleotide that also encodes for a full-length L-22K protein and / or a full-length L-33K protein. In addition, the packaging efficiency of the polynucleotides that don’t encode for a full-length length L-22K protein and a full-length L-33K protein is also unexpectedly and surprisingly substantially similar to the packaging efficiency of a similar polynucleotide that also encodes for a full-length L-22K protein and / or a full-length L-33K protein.

[0202] Thus, without wishing to be bound by a theory, a polypeptide described herein that does not include a nucleotide sequence encoding a full length L-22K protein and / or a full length L-33K protein can produce recombinant adeno-associated viral (rAAV) particles in an amount that is at least 80% (e.g., at least 85%, at least 90%, at least 95%, at least 100% (i.e., substantially similar), at least 105%. at least 110%, at least 115%, at least 120%, at least 125%. at least 130%, at least 135%, at least 140%, at least 145%, at least 150%) or higher of an amount produced under similar conditions with a similar polynucleotide that further comprises a nucleotide sequence encoding a full-length L-22K protein and / or a full-length L-33K protein.

[0203] Without wishing to be bound by a theory, a packaging efficiency of a polypeptide described herein that does not include a nucleotide sequence encoding a full length L-22K protein and / or a full length L-33K protein in a method of producing rAAV can be at least 80% (e g., at least 85%, at least 90%, at least 95%, at least 100% (i.e., substantially similar), at least 105%, at least 110%, at least 115%, at least 120%, at least 125%, at least 130%, at least 135%, at least 140%, at least 145%, at least 150%) or more of a packaging efficiency of a similar polypeptide that furthercomprises a nucleotide sequence encoding a full-length L-22K protein and / or a full-length L-33K protein.

[0204] A polynucleotide described herein can be single-stranded or double-stranded. In some embodiments of any one of the aspects described herein, the polynucleotide is linear, e.g., a linear DNA. In some embodiments of any one of the aspects described herein the polynucleotide is circular. For example, the polynucleotide is a closed ended linear duplex DNA (clDNA). Alternatively, clDNA is termed as no-end DNA or, neDNA. Exemplary closed linear duplexed DNA molecules, or no-end DNA molecules include, but are not limited to, doggybone DNA (dbDNA), dumbbell shaped DNA as described in U. S. Patent No. 6,451,563; Efficient production of superior dumbbell-shaped DNA minimal vectors for small hairpin RNA expression-Nucleic Acids Res. 2015 Oct 15; 43(18): e!20; High-Purity Preparation of a Large DNA Dumbbell-Antisense & nucleic acid drug development 11:149-153 (2001); US 9,109,250; U. S. Patent No.9,499,847; U. S. Patent No. 10,501,782; and International Publication No. WO 2018033730 Al, and mini-circle DNA as described in U. S. Patent No. 8,828,726, and U. S. Patent No. 7,897,380.L4-22K protein

[0205] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of L4-22K protein. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of L4-22K protein from an adenovirus, e.g., Ad5. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length L4-22K protein. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length L4-22K protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 7 (Ad5 L4-22K).

[0206] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein having, e.g., at its N-terminus an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94 or 95.

[0207] In some embodiments, the polynucleotide comprises a deletion of G3 and G4 in a nucleotide sequence encoding an adenoviral L-22K protein. For example, the polynucleotide does not comprise nucleotides 26197-26198 relative to Genbank Accession Number AC 000008.

[0208] Inventors have discovered inter alia that AAV production with polynucleotides described herein that lack a sequence encoding a full length L4-22K and / or L4-33K proteinunexpectedly and surprisingly is better compared to similar polypeptides that encode for a full length L4-22K protein and / or L4-33K protein. In other words, polypeptides that encode only for a fragment of L4-22K and / or L4-33K protein as described herein unexpectedly and surprisingly can provide a more efficient helper function for AAV production.

[0209] Thus, in some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 7 (Ad5 L4-22K) or a functional equivalent thereof. For example, the polynucleotide comprises nucleotide sequence encoding a truncated L4-22K protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO:92 nr 93. In some embodiments, the truncated L4-22K protein is at least 2 (e.g., 3, 4, 5, 6, 7, 8, 9, 10 or more) amino acids shorter than the full-length L4-22K protein. For example, the truncated L4-22K protein encoded by the polypeptide is at least 11 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) amino acids shorter than the full-length L4-22K protein. In some embodiments, the truncated L4-22K protein encoded by the polypeptide is at least 21 (e.g., 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) amino acids shorter than the full-length L4-22K protein. For example, the truncated L4-22K protein encoded by the polypeptide is at least 31 (e.g., 32, 33, 34, 35 or more) amino acids shorter than the full-length L4-22K protein.

[0210] In some embodiments, the truncated L4-22K protein is no more than 180 (e.g., no more than 179, 178, 176, 175, 174, 173, 172, 171, 170, 169, 168, 167, 166, 165 or less) ammo acids in length. In some embodiments, the truncated L4-22K protein is about 155 to about 165 amino acids in length. For example, the truncated L4-22K protein is about 156, 157, 158, 159, 160, 161, 162, 163 or 164 amino acids in length. In some embodiments, the truncated L4-22K protein is 160, 161, 162, 163, or 164 amino acids in length. In a preferred embodiment, the truncated L4-22K protein is about 162 amino acids in length.

[0211] In some embodiments, the truncated L4-22K protein is about 115 to about 125 amino acids in length. For example, the truncated L4-22K protein is about 116, 117, 118, 119, 120, 111, 122, 123 or 144 amino acids in length. In some embodiments, the truncated L4-22K protein is 118, 119, 120, 121, or 122 amino acids in length. In a preferred embodiment, the truncated L4-22K protein is about 120 amino acids in length.

[0212] In some embodiments, the polynucleotide comprises nucleotide sequence encoding a truncated L4-22K protein comprising or consisting of an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 92 or 93, and wherein the polynucleotide does not comprise a nucleotide sequence encodinga L4-22K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7.

[0213] In some embodiments, the polynucleotide comprises nucleotide sequence encoding a truncated L4-22K protein comprising consisting of an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 92 or 93, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a L4-22K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7, and having a length of at least 175 (e.g., 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195 or more) amino acids.

[0214] In some embodiments, the truncated L4-22K protein does not comprise an amino acid sequence having at least 80% (e.g., at least 85%. at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94 or 95, e.g., at its N-terminus.

[0215] In some embodiments, the polynucleotide comprises nucleotide sequence encoding a truncated L4-22K protein comprising an amino acid sequence having at least 80% (e.g, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 92, and wherein the truncated L4-22K protein does not comprise an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94, e.g., at its N-terminus.

[0216] In some embodiments, the polynucleotide comprises nucleotide sequence encoding a truncated L4-22K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 93, and wherein the truncated L4-22K protein does not comprise an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 95, e.g., at its N-terminus.

[0217] The term "truncated" in relation to a protein relates to a shortened form of the protein, e.g., where at least 2 (e.g., 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23,24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35 or more) amino acids from the N- and / or C-terminus of the protein are deleted. It is noted that the truncated form of the protein may or may not retain the function of the parent protein.L4-33K protein

[0218] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of L4-33k protein. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of L4-33k protein from an adenovirus, e.g., Ad5. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length L4-33k protein. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length L4-33k protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 8 (Ad5 L4-33k).

[0219] In some embodiments, the polynucleotide does not comprise a nucleotide sequence encoding a protein having, e.g., at its N-terminus an amino acid sequence having at least 80% (e g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94 or 95.

[0220] In some embodiments, the polynucleotide comprises a deletion of G3 and G4 in a nucleotide sequence encoding an adenoviral L-33K protein. For example, the polynucleotide does not comprise nucleotides 26197-26198 relative to Genbank Accession Number AC_000008.

[0221] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 8 (Ad5 L4-33k) or a functional equivalent thereof. For example, the polynucleotide comprises nucleotide sequence encoding a truncated L4-33k protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 90 or 91. In some embodiments, the truncated L4-33k protein is at least 2 (e.g., 3, 4, 5, 6, 7, 8, 9, 10 or more) amino acids shorter than the full-length L4-33k protein. For example, the truncated L4-33k protein encoded by the polypeptide is at least 11 (e.g., 12, 13, 14, 15, 16, 17, 18, 19, 20 or more) amino acids shorter than the full-length L4-33k protein. In some embodiments, the truncated L4-33k protein encoded by the polypeptide is at least 21 (e.g., 22, 23, 24, 25, 26, 27, 28, 29, 30, or more) amino acids shorter than the full-length L4-33k protein. For example, the truncated L4-33kprotein encoded by the polypeptide is at least 31 (e.g., 32, 33, 34, 35 or more) amino acids shorter than the full-length L4-33k protein.

[0222] In some embodiments, the truncated L4-33k protein is no more than 215 (e.g., no more than 214, 213, 212, 211, 210, 209, 208, 206, 205 or less) amino acids in length. In some embodiments, the truncated L4-33k protein is about 185 to about 205, e.g. about 190 to about 200 amino acids in length. For example, the truncated L4-33k protein is about 185, 186, 187, 188, 189,190, 192, 192, 193, 194, 195, 196, 197, 198, 199, 200, 201, 202, 203 or 204 ammo acids in length. In some embodiments, the truncated L4-33k protein is 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200 amino acids in length. In a preferred embodiment, the truncated L4-33k protein is about 195 amino acids in length.

[0223] In some embodiments, the truncated L4-33k protein is about 145 to about 160 amino acids in length. For example, the truncated L4-33k protein is about 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 158, or 159 amino acids in length. In some embodiments, the truncated L4-33k protein is 151, 152, 153, 154 or 155 amino acids in length. In a preferred embodiment, the truncated L4-33k protein is about 153 amino acids in length.

[0224] In some embodiments, the polynucleotide comprises nucleotide sequence encoding a truncated L4-33k protein comprising or consisting of an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 90 or 91, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a L4-33k protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8.

[0225] In some embodiments, the polynucleotide comprises nucleotide sequence encoding a truncated L4-33k protein comprising consisting of an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 90 or 91, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a L4-33k protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8, and having a length of at least 175 (e.g., 176, 177, 178, 179, 180, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195 or more) amino acids.

[0226] In some embodiments, the truncated L4-33k protein does not comprise an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94 or 95, e.g., at its N-terminus.

[0227] In some embodiments, the polynucleotide comprises nucleotide sequence encoding a truncated L4-33k protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 90, and wherein the truncated L4-33k protein does not comprise an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94, e g, at its N-terminus.

[0228] In some embodiments, the polynucleotide comprises nucleotide sequence encoding a truncated L4-33k protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 91, and wherein the truncated L4-33k protein does not comprise an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 95, e g, at its N-terminus.VA RNA Region

[0229] A polynucleotide described herein comprises a nucleotide sequence encoding a VA RNA region. As used herein, the term “VA RNA region” refers to a nucleotide sequence that produces virus or viral associated RNAs (VA RNAs). VA RNAs interfere with one or more host systems that interface with double-stranded RNAs (dsRNAs), such as their sensing by protein kinase R (PKR), export by Exportin-5, processing by Dicer, editing by ADAR, or activation of oligoadenylate synthetases (OAS), etc. Without wishing to be bound by a theory, VA RNAs improve the efficiency of translation, increase the stability of capsid mRNA, and / or help prevent degradation of one or more gene products, e.g., a Rep protein. It is noted that the VA RNA region can comprises a nucleotide sequence encoding a wild-type VA RNA, a derivative thereof, or an artificial VA RNA having an equivalent function to a wild-type VA RNA. Generally, the VA RNA region comprises a nucleotide sequence encoding an adenovirus VA RNA or a functional equivalent thereof. For example, the VA RNA region comprises a nucleotide sequence encoding a VA RNA from adenovirus serotype 5 (Ad5) or a functional equivalent thereof.

[0230] In some embodiments, the VA RNA region comprises a nucleotide sequence encoding a VA RNA I or a functional equivalent thereof. For example, the VA RNA region comprises anucleotide sequence encoding a VA RNA I from Ad5 or a functional equivalent thereof. Accordingly, in some embodiments, the VA RNA region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 24. For example, the VA RNA region comprises a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 24.

[0231] In some embodiments, the VA RNA region comprises a nucleotide sequence encoding a VA RNA II or a functional equivalent thereof. For example, the VA RNA region comprises a nucleotide sequence encoding a VA RNA II from Ad5 or a functional equivalent thereof. Accordingly, in some embodiments, the VA RNA region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 25. For example, the VA RNA region comprises a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 25.

[0232] In some embodiments, the VA RNA region comprises a nucleotide sequence encoding: (i) a VA RNA I or a functional equivalent thereof; and (ii) a VA RNA II or a functional equivalent thereof. For example, the VA RNA region comprises a nucleotide sequence encoding: (i) a VA RNA I from Ad5 or a functional equivalent thereof; and (ii) a VA RNA II from Ad5 or a functional equivalent thereof. Accordingly, in some embodiments, the VA RNA region comprises: (i) a first nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity to SEQ ID NO: 24; and (ii) second nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity to SEQ ID NO: 25.For example, the VA RNA region comprises: (i) a first nucleotide sequence having 100% identity (e.g., is completely identical) to SEQ ID NO: 24; and (ii) a first nucleotide sequence having 100% identity (e.g., is completely identical) to SEQ ID NO: 25.

[0233] In some embodiments, the VA RNA region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 26. For example, the VA RNA region comprises a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 26.Polyadenylation sequence

[0234] In some embodiments, the polynucleotide comprises a polyadenylation sequence or polyadenylation signal sequence. As used herein, the term “polyadenylation sequence” or “polyadenylation signal sequence” refers to a nucleotide sequence that contains a transcription termination signal and which, when it appears in an RNA transcript (e.g., mRNA), allows for said RNA transcript to be polyadenylated. As used herein, the term “polyadenylation”, as used herein, refers to the addition of a polyadenine stretch to the 3'-end of an RNA transcript, e.g., an mRNA. The polyadenylation sequence or polyadenylation signal sequence is also referred to as a polyadenylation (poly A) site herein.

[0235] Any polyadenylation sequence which is functional in a host cell of choice, e.g., a eukaryotic cell can be used. For example, the polyadenylation sequence can be a mammalian or a viral polyadenylation sequence. Exemplary polyadenylation sequences include, but are not limited to, the polyadenylation signal of adenovirus 5 Elb, the SV40 early-late polyadenylation signal, the poly adenylation signal of HSV thymidine kinase, the polyadenylation signal of the protamine gene, the polyadenylation signal of the bovine growth hormone, the poly adenylation signal of the human variant of the growth hormone, the rabbit beta-globin polyadenylation signal, and similar ones.

[0236] In some embodiments, the polyadenylation sequence comprises the nucleotide sequence aataaaatatctttattttcattacatctgtgtgttggttttttgtgtg (SEQ ID NO: 22).

[0237] The polyadenylation signal sequence can be present on the 5 ’-end or the 3 ’-end of the VA RNA region. In some embodiments, the polyadenylation signal sequence can be present at the 5 ’-end of the VA RNA region.

[0238] The polyadenylation signal sequence and the VA RNA region can be linked directly to each other, i.e., the polyadenylation signal sequence and the VA RNA region can be linked to each other via a single internucleotide linkage, e.g., a phosphodiester bond. Alternatively, the polyadenylation signal sequence and the VA RNA region can be linked to each other via a nucleotide sequence comprising a few nucleotides to 100’s of nucleotides. For example, there can be from 1 to about 250 nucleotides between the polyadenylation signal sequence and the VARNA region. In some embodiments, the polyadenylation signal sequence and the VA RNA region can be linked to each other via a nucleotide sequence comprising from about 20 to about 250 nucleotides, e.g., from about 30 to about 200 nucleotides or from about 40 to about 190 nucleotides, or from about 50 to about 180 nucleotides, or from about 60 to about 160 nucleotides, or from about 70 to about 150 nucleotides, or from about 80 to about 140 nucleotides, or from about 90 to about 130 nucleotides, or from about 100 to about 125 nucleotides, or from about 110 to about 120 nucleotides. In some embodiments, the polyadenylation signal sequence and the VA RNA region can be linked to each other via a nucleotide sequence comprising about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 115, about 120, about 125, about 130, about 135, about 140, about 145, about 150, about 155, about 160, about 165, about 170, about 175, about 180, about 185, about 190, about 195, about 200, about 210, about 215, about 220, about 225, about 230, about 235, about 240, about 245, or about 250 nucleotides. For example, the polyadenylation signal sequence and the VA RNA region can be linked to each other via a nucleotide sequence comprising about 100, about 110, about 115, about 120, or about 125 nucleotides. In some embodiments, the polyadenylation signal sequence and the VA RNA region can be linked to each other via a nucleotide sequence comprising about 115 nucleotides.

[0239] It is noted that the nucleotide sequence linking the polyadenylation signal sequence and the VA RNA region can be a random sequence. In other words, the nucleotide sequence linking the polyadenylation signal sequence and the VA RNA region may not be encoding a particular polypeptide sequence. In some embodiments, the nucleotide sequence linking the polyadenylation signal sequence and the VA RNA region can be derived from an adenovirus, e.g., adenovirus serotype 5 (Ad5) or similar.

[0240] In some embodiments, the nucleotide sequence linking the polyadenylation signal sequence and the VA RNA region does not comprise an open reading frame.

[0241] In some embodiments, the nucleotide sequence linking the polyadenylation signal sequence and the VA RNA region comprises a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity to SEQ ID NO: 69. For example, the nucleotide sequence linking the polyadenylation signal sequence and the VA RNA region comprises a sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 69.

[0242] In some embodiments, the polynucleotide comprises, linked to 5 ’-end of the polyadenylation signal sequence, a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity to SEQ ID NO: 80. For example, the polynucleotide comprises, linked to 5 ’-end of the polyadenylation signal sequence, a sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 80.E2a region

[0243] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding an E2a region or a functional equivalent thereof. As used herein, “E2a region” refers to a nucleotide sequence that encodes a 72-kDa DNA-binding protein (DBP) or a functional equivalent thereof. The DBP plays a crucial role during the elongation phase of Ad DNAreplication. It regulates the promoter of AAV, helps AAV genome replication and is involved in increased capsid protein production through splicing of Rep mRNA and enhanced stability of capsid mRNA.

[0244] It is noted that the E2a region can comprise a nucleotide sequence encoding a wild-type DBP, a derivative thereof, or an artificial DBP having an equivalent function to a wild-type DBP Generally, the DBP region comprises a nucleotide sequence encoding an adenovirus DBP or a functional equivalent thereof. For example, the E2 region comprises a nucleotide sequence encoding a DBP from adenovirus serotype 5 (Ad5) or functional equivalent thereof.

[0245] In some embodiments, the E2a region comprises a nucleotide sequence encoding a DBP and having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 27. For example, the E2a region comprises a nucleotide sequence encoding a DBP and that is 100% identical (e.g., is completely identical) to SEQ ID NO: 27.

[0246] In some embodiments, the E2 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 28 or a functional equivalent thereof. For example, the E2 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 27 or an ortholog of SEQ ID NO: 27.UXP exon 3

[0247] In some embodiments, the E2a region can comprise a nucleotide sequence encoding UXP exon 3 or a functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding UXP exon 3 from adenovirus serotype 5 (Ad5) or functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding UXP exon 3 and having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 29. For example, the E2a region comprises a nucleotide sequence encoding UXP exon 3 and that is 100% identical (e.g., is completely identical) to SEQ ID NO: 29.E2a exon2 / leader sequence

[0248] In some embodiments, the E2a region can comprise a nucleotide sequence encoding E2a exon2 / leader sequence or a functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a exon2 / leader sequence from adenovirus serotype 5 (Ad5) or functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a exon2 / leader sequence and having at least 80% (e.g., at least 85%, at least90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 30. For example, the E2a region comprises a nucleotide sequence encoding E2a exon2 / leader sequence and that is 100% identical (e.g., is completely identical) to SEQ ID NO: 30.UXP exon 2

[0249] In some embodiments, the E2a region can comprise a nucleotide sequence encoding UXP exon 2 or a functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding UXP exon 2 from adenovirus serotype 5 (Ad5) or functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding UXP exon 2 and having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 30. For example, the E2a region comprises a nucleotide sequence encoding UXP exon 2 and that is 100% identical (e.g., is completely identical) to SEQ ID NO: 30.E2a late promoter

[0250] In some embodiments, the E2a region can comprise a nucleotide sequence encoding E2a late promoter or a functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a late promoter from adenovirus serotype 5 (Ad5) or functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a late promoter and having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 31. For example, the E2a region comprises a nucleotide sequence encoding E2a late promoter and that is 100% identical (e.g., is completely identical) to SEQ ID NO: 31E2a exon 1

[0251] In some embodiments, the E2a region can comprise a nucleotide sequence encoding E2a exon 1 or a functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a exon 1 from adenovirus serotype 5 (Ad5) or functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a exon 1 and having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 32. For example, the E2a region comprises a nucleotide sequence encoding E2a exon 1 and that is 100% identical (e.g., is completely identical) to SEQ ID NO: 32.E2a early promoter

[0252] In some embodiments, the E2a region is under the control of a promoter. In some embodiments, the E2a region is under the control of a promoter and wherein the promoter is not a chicken P-actin promoter or a SV40 promoter.

[0253] In some embodiments, the E2a region can comprise a nucleotide sequence encoding E2a early promoter or a functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a early promoter from adenovirus serotype 5 (Ad5) or functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a early promoter and having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 33. For example, the E2a region comprises a nucleotide sequence encoding E2a early promoter and that is 100% identical (e.g., is completely identical) to SEQ ID NO: 33E2a late primary transcript sequence

[0254] In some embodiments, the E2a region comprises a nucleotide sequence encoding E2a late primary transcript sequence or a functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a late transcript primary sequence from adenovirus serotype 5 (Ad5) or functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a late transcript primary sequence and having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 34.For example, the E2a region comprises a nucleotide sequence encoding E2a late primary transcript sequence and that is 100% identical (e.g., is completely identical) to SEQ ID NO: 34.E2a early primary transcript sequence

[0255] In some embodiments, the E2a region can comprise a nucleotide sequence encoding E2a early primary transcript sequence or a functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a early primary transcript sequence from adenovirus serotype 5 (Ad5) or functional equivalent thereof. For example, the E2a region comprises a nucleotide sequence encoding E2a early primary transcript sequence and having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 35. For example, the E2a region comprises a nucleotide sequence encoding E2a earlyprimary transcript sequence and that is 100% identical (e.g., is completely identical) to SEQ ID NO: 35

[0256] In some embodiments, the E2a region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 36. For example, the E2a region comprises a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 36.

[0257] In some embodiments, the E2a region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 76. For example, the E2a region comprises a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 76.

[0258] The E2a region can be on the 5 ’-end or the 3 ’-end of the VA RNA region. In some embodiments, the E2a region is present at the 3 ’-end of the VA RNA region.

[0259] The E2a region and the VA RNA region can be linked directly to each other, i.e., the E2a region and the VA RNA region can be linked to each other via a single internucleotide linkage, e.g., a phosphodiester bond. Alternatively, the E2a region and the VA RNA region can be linked to each other via a nucleotide sequence comprising a few nucleotides to 100’s of nucleotides. For example, there can be from 1 to about 250 nucleotides between the E2a region and the VA RNA region. In some embodiments, the E2a region and the VA RNA region can be linked to each other via a nucleotide sequence comprising from about 10 to about 200 nucleotides, e.g., from about 20 to about 190 nucleotides, or from about 30 to about 180 nucleotides, or from about 40 to about 160 nucleotides, or from about 50 to about 150 nucleotides, or from about 60 to about 140 nucleotides, or from about 70 to about 130 nucleotides, or from about 80 to about 120 nucleotides, or from about 90 to about 110 nucleotides.

[0260] In some embodiments, the polyadenylation signal sequence and the VA RNA region can be linked to each other via a nucleotide sequence comprising about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 115, about 120, about 125, about 130, about 135, about 140, about 145, about 150, about 155, about 160, about 165, about 170, about 175, about 180, about 185, about 190, about 195, about 200, about 210, about 215, about 220, about 225, about 230, about 235, about 240, about 245, or about 250 nucleotides. For example, the E2a region and the VA RNA region can be linked to each other via a nucleotide sequence comprising about 85, about 90, about 95, about 100, or about 110 nucleotides. In someembodiments, the E2a region and the VA RNA region can be linked to each other via a nucleotide sequence comprising about 95 nucleotides.

[0261] It is noted that the nucleotide sequence linking the E2a region and the VA RNA region can be a random sequence. In other words, the nucleotide sequence linking the E2a region and the VA RNA region may not be encoding a particular polypeptide sequence. In some embodiments, the nucleotide sequence linking the E2a region and the VA RNA region is derived from an adenovirus, e.g., adenovirus serotype 5 (Ad5) or similar.

[0262] In some embodiments, the nucleotide sequence linking the E2a region and the VA RNA region does not comprise an open reading frame.

[0263] In some embodiments, the nucleotide sequence linking the E2a region and the VA RNA region comprises a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity to SEQ ID NO: 70. For example, the nucleotide sequence linking the E2a region and the VA RNA region comprises a sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 70.E4 region

[0264] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding an E4 region or a functional equivalent thereof. As used herein, an “E4 region” refers to a group of genes that are present in the Adenovirus genome next to the right ITR and are expressed in the early phase of the virus replication cycle. The E4 region includes at least six open reading frames (ORFs). The E4 region encodes at least six proteins involved in several distinct functions related to viral mRNA splicing and transport, host-cell mRNA transport, viral and cellular transcription and transformation. The products of the E4 region promote viral gene expression and replication, interact with host cell components, and participate in lytic infection and oncogenesis. Generally, the E4 region comprises one or more ORF nucleotide sequences from an E4 region of an adenovirus, e.g., E4 region of Ad5 or an ortholog thereof. For example, the E4 region comprises one or more of E4orfl, E4orf3, E4orf4, E4orf6 (E4 34K), Eorf6 / 7 and / or E4orf8 from an adenovirus, e.g., Ad5.

[0265] In some embodiments, the E4 region comprises a E4orf6 / 7 nucleotide sequence from adenovirus serotype 5 (Ad5) or an ortholog thereof. For example, the E4 region comprises E4orf6 / 7 with a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 37. In some embodiments the E4 regioncomprises E4orf6 / 7 with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 37

[0266] In some embodiments, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 38 (E4orf6 / 7 protein) or a functional equivalent thereof. For example, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 37 or an ortholog of SEQ ID NO: 37.

[0267] In some embodiments, the E4 region comprises aE4orf6 (E434K) nucleotide sequence from adenovirus serotype 5 (Ad5) or an ortholog thereof. For example, the E4 region comprises E4orf6 with a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 60. In some embodiments the E4 region comprises E4orf6 with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 59

[0268] In some embodiments, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 39 (E4orf6 or E4 34K protein) or a functional equivalent thereof.

[0269] In some embodiments, the E4 region comprises a E4orf4 nucleotide sequence from adenovirus serotype 5 (Ad5) or an ortholog thereof. For example, the E4 region comprises E4orf4 with a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 40. In some embodiments the E4 region comprises E4orf4 with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 40

[0270] In some embodiments, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 41 (E4orf4 protein) or a functional equivalent thereof. For example, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 40 or an ortholog of SEQ ID NO: 40.

[0271] In some embodiments, the E4 region comprises a E4orf3 nucleotide sequence from adenovirus serotype 5 (Ad5) or an ortholog thereof. For example, the E4 region comprises E4orf3 with a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 42. In some embodiments the E4 region comprisesE4orf3 with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 42

[0272] In some embodiments, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 43 (E4orf3 protein) or a functional equivalent thereof. For example, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 42 or an ortholog of SEQ ID NO: 42.

[0273] In some embodiments, the E4 region comprises a E4orf8 nucleotide sequence from adenovirus serotype 5 (Ad5) or an ortholog thereof. For example, the E4 region comprises E4orf8 with a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 44. In some embodiments the E4 region comprises E4orf8 with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 44

[0274] In some embodiments, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 45 (E4orf8 protein) or a functional equivalent thereof. For example, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 44 or an ortholog of SEQ ID NO: 44.

[0275] In some embodiments, the E4 region comprises a E4orfl nucleotide sequence from adenovirus serotype 5 (Ad5)or an ortholog thereof. For example, the E4 region comprises E4orfl with a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 46. In some embodiments the E4 region comprises E4orfl with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 46

[0276] In some embodiments, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 47 (E4orfl protein) or a functional equivalent thereof. For example, the E4 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 46 or an ortholog of SEQ ID NO: 46.

[0277] In some embodiments, the E4 region is operably linked to a promoter. For example, the E4 region is operably linked to a E4 mini promoter comprising the sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO:100 or at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to a sequence complementary to SEQ ID NO: 100, In some embodiments, the E4 region is operably linked to a promoter and wherein the promoter is not a chicken P-actin promoter or a SV40 promoter.

[0278] In some embodiments, the E4 region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 48. For example, the E4 region comprises a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 48

[0279] The E4 region can be on the 5 ’-end or the 3 ’-end of the E2A region. In some embodiments, the E4 region is present at the 3 ’-end of the E2A region.

[0280] The E4 region and the E2a region can be linked directly to each other, i.e., the E4 region and the E2a region can be linked to each other via a single internucleotide linkage, e.g., a phosphodiester bond. Alternatively, the E4 region and the E2a region can be linked to each other via a nucleotide sequence comprising a few nucleotides to 1000’s of nucleotides. For example, there can be from about 100 to about 10000 nucleotides between the E4 region and the E2a region. In some embodiments, the E4 region and the E2a region can be linked to each other via a nucleotide sequence comprising from about 150 to about 9000 nucleotides, e.g., from about 200 to about 800 nucleotides, or from about 300 to about 7500 nucleotides, or from about 400 to about 7000 nucleotides,, or from about 5000 to about 7000 nucleotides, or from about 5100 to about 6900 nucleotides, or from about 5200 to about 6700 nucleotides, or from about 5300 to about 6700 nucleotides, or from about 5400 to about 6600 nucleotides, or from 5500 to about 6500 nucleotides, or from about 5600 to about 6400 nucleotides, or from about 5700 to about 6000 nucleotides, or from about 4000 to about 5200 nucleotides, or from about 4100 to about 5100 nucleotides, or from 4200 to about 5000 nucleotides, or from 4300 to about 4900 nucleotides, or from about 4400 to about 4800 nucleotides, or from about 4500 to about 4700 nucleotides, or from about 2500 to about 3600 nucleotide, from about 2600 to about 3500 nucleotide, or from about 2700 to about 3400 nucleotides, or from about 2800 to about 3300 nucleotide, or from about 2900 to about 3200 nucleotides, or from about 1500 to about 2500 nucleotides, or from about 1600 to about 2400 nucleotides, or from about 1700 to about 2300 nucleotides, or from about 1800 to about 2200 nucleotides, or from about 1900 to about 2100 nucleotides, or from about 200 to about 700 nucleotides, or from about 300 to about 600 nucleotides, or from about 400 to about 500 nucleotides.

[0281] In some embodiments, the polyadenylation signal sequence and the E2a region can be linked to each other via a nucleotide sequence comprising about 200, about 210, about 215, about 220, about 225, about 230, about 235, about 240, about 245, about 250 nucleotides, about 250, about 255, about 260, about 265, about 270, about 275, about 280, about 285, about 290, about 295, about 300, about 310, about 315, about 320, about 325, about 330, about 335, about 340, about 345, about 350 nucleotides, about 350, about 355, about 360, about 365, about 370, about 375, about 380, about 385, about 390, about 395, about 400, about 410, about 415, about 420, about 425, about 430, about 435, about 440, about 445, about 450 nucleotides, about 450, about 455, about 460, about 465, about 470, about 475, about 480, about 485, about 490, about 495, about 500, about 510, about 515, about 520, about 525, about 530, about 535, about 540, about 545, about 550 nucleotides, about 550, about 555, about 560, about 565, about 570, about 575, about 580, about 585, about 590, about 595, about 600, about 610, about 615, about 620, about 625, about 630, about 635, about 640, about 645, about 650 nucleotides, about 650, about 655, about 660, about 665, about 670, about 675, about 680, about 685, about 690, about 695, about 700, about 710, about 715, about 720, about 725, about 730, about 735, about 740, about 745, about 750 nucleotides, about 750, about 755, about 760, about 765, about 770, about 775, about 780, about 785, about 790, about 795, about 800, about 810, about 815, about 820, about 825, about 830, about 835, about 840, about 845, about 850 nucleotides, about 850, about 855, about 860, about 865, about 870, about 875, about 880, about 885, about 890, about 895, about 900, about 910, about 915, about 920, about 925, about 930, about 935, about 940, about 945, about 950 nucleotides, about 950, about 955, about 960, about 965, about 970, about 975, about 980, about 985, about 990, about 995, or about 1000 nucleotides. For example, the E4 region and the E2a region can be linked to each other via a nucleotide sequence comprising about 400, about 410, about 415, about 420, about 425, about 430, about 435, about 440, about 445, about 450 nucleotides, about 450, about 455, about 460, about 465, about 470, about 475, about 480, about 485, about 490, about 495, or about 500, nucleotides. In some embodiments, the E4 region and the E2a region can be linked to each other via a nucleotide sequence comprising about 450 nucleotides.

[0282] It is noted that the nucleotide sequence linking the E4 region and the E2a region can be a random sequence. In other words, the nucleotide sequence linking the E4 region and the E2a region may not be encoding a particular polypeptide sequence. In some embodiments, the nucleotide sequence linking the E4 region and the E2a region is derived from an adenovirus, e.g., adenovirus serotype 5 (Ad5) or similar.

[0283] In some embodiments, the nucleotide sequence linking the E2 region and the E4 region does not comprise an open reading frame.

[0284] In some embodiments, the E2a region is located between the VA RNA region and the E4 region. For example, the polynucleotide comprises from 5 ’ to 3 ’ direction the VA RNA region, the E2a region and the E4 region.

[0285] In some embodiments, the nucleotide sequence linking the E2a region and the E4 region comprises a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity one of SEQ ID NO: 71-75. For example, the nucleotide sequence linking the E2a region and the VA RNA region comprises a sequence that is 100% identical (e.g., is completely identical) to one of SEQ ID NO: 71-75. In some preferred embodiments, the nucleotide sequence linking the E2a region and the E4 region comprises a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity to SEQ ID NO: 75. More preferably, the nucleotide sequence linking the E2a region and the VA RNA region comprises a sequence that is 100% identical (e.g., is completely identical) to one of SEQ ID NO: 75.Fiber

[0286] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of fiber protein or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of fiber protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length fiber protein or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length fiber protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 10 (Ad5 fiber) or a functional equivalent thereof.

[0287] In some embodiments, the polynucleotide comprises a deletion of Gs in a nucleotide sequence encoding an adenoviral fiber protein. For example, the polynucleotide does not comprise nucleotide 31024 relative to Genbank Accession Number AC_000008.

[0288] In some embodiments, the polynucleotide comprises a restriction enzyme site in a nucleotide sequence encoding an adenoviral fiber protein. For example, the polynucleotide comprises C -> T mutation at positions 31544 relative to Genbank Accession Number AC 000008.In another non-limiting example. the polynucleotide comprises TA CG mutation at positions 32733-32734 relative to Genbank Accession Number AC 000008L1-52 / 55K protein

[0289] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of L1-52 / 55K (Packaging Protein 3) or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of L1-52 / 55K protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length L1-52 / 55K protein or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length L1-52 / 55K protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 12 (Ad5 L1-52 / 55K) or a functional equivalent thereof.

[0290] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 10 (Ad5 L1-52 / 55K).L4-100K protein

[0291] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of L4-100K protein or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of L4-100K protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length L4-100K protein or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length L4-100K protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 9 (Ad5 L4-100K) or a functional equivalent thereof.

[0292] In some embodiments, the polynucleotide comprises a deletion of G3 and G4 in a nucleotide sequence encoding an adenoviral L4-100K protein. For example, the polynucleotide does not comprise nucleotides 24063-24064 relative to Genbank Accession Number AC 000008.

[0293] In some embodiments, the polynucleotide comprises ACTT mutation at positions 27322-27324 relative to Genbank Accession Number AC 000008.

[0294] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 9 (Ad5 L4-100K) or a functional equivalent thereof.Protein VIII (pVIII)

[0295] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of protein VIII or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of protein VIII from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length protein VIII or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length protein VIII from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 11 (pVIII) or a functional equivalent thereof.

[0296] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 11 (pVIII) or a functional equivalent thereof.Terminal Protein (TP)

[0297] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of precursor terminal protein (pTP) or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of a precursor terminal protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length precursor terminal protein or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length precursor terminal protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 13 (pTP) or a functional equivalent thereof.

[0298] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 13 (pTP) or a functional equivalent thereof.23K endoprotease

[0299] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of an endoprotease or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of an endoprotease (e.g., 23K endoprotease) from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length an endoprotease (e.g., 23K endoprotease) or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length 23K endoprotease from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 49 (23K endoprotease) or a functional equivalent thereof.

[0300] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 49 (23k endoprotease) or a functional equivalent thereof.E3 region

[0301] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding an E3 region or a functional equivalent thereof. In some other embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding an E3 region or a functional equivalent thereof.

[0302] As used herein, an “E3 region” refers to a group of genes that are present in the Adenovirus genome next to the right ITR and are expressed in the early phase of the virus replication cycle. The E3 region includes at least 7 open reading frames (ORFs). The E3 region encodes at least six proteins involved in several distinct functions related to viral mRNA splicing and transport, host-cell mRNA transport, viral and cellular transcription and transformation. The products of the E3 region promote viral gene expression and replication, interact with host cell components, and participate in lytic infection and oncogenesis. Generally, the E3 region comprises one or more ORF nucleotide sequences from an E3 region of an adenovirus, e.g., E3 region of Ad5 or an ortholog thereof. For example, the E3 region comprises a nucleotide sequence encoding one or more E3 protein 12.5K, E3 protein CR1 -alpha, E3 protein gp19k, E3 protein CRl-beta, E3 protein RID-alpha, E3 protein RID-beta, and E3 protein 14.7k from an adenovirus, e.g., Ad5.

[0303] In some embodiments, the E3 region comprises an E3 12K nucleotide sequence from Ad5 or an ortholog thereof. For example, the E3 region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 60 (E3 12K nt). In some embodiments the E3 region comprises (E3 12K nt) with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: XX.

[0304] In some embodiments, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 60 (E3 12K nt sequence) or by an ortholog of SEQ ID NO: 60. For example, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 14 (E3 12K protein) or a functional equivalent thereof.

[0305] In some embodiments, the E3 region comprises an E3 CR1 -alpha nucleotide sequence from Ad5 or an ortholog thereof. For example, the E3 region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 61 (E3 CR1 -alpha nt). In some embodiments the E4 region comprises (E3 CR1-alpha nt) with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 61

[0306] In some embodiments, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 61 (E3 CR1 -alpha nt sequence) or an ortholog of SEQ ID NO: XX. For example, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 15 (E3 CR1 -alpha protein) or a functional equivalent thereof.

[0307] In some embodiments, the E3 region comprises anE3 gp!9K nucleotide sequence from Ad5 or an ortholog thereof. For example, the E4 region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 62 (E3 gp!9 K nt). In some embodiments the E3 region comprises (E3 gp!9K nt) with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 62.

[0308] In some embodiments, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 62 (E3 gp!9 K nt sequence) or an ortholog of SEQ ID NO: 62. For example, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 16 (E3 gp!9 K protein) or a functional equivalent thereof.

[0309] In some embodiments, the E3 region comprises anE3 10.5K nucleotide sequence from Ad5 or an ortholog thereof. For example, the E4 region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 63 (E3 10.5K nt). In some embodiments the E3 region comprises (E3 10.5 nt) with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 63.

[0310] In some embodiments, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 63 (E3 10.5K nt sequence) or an ortholog of SEQ ID NO: 63. For example, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 17 (E3 10.5K protein) or a functional equivalent thereof.

[0311] In some embodiments, the E3 region comprises an E3 RID-alpha nucleotide sequence from Ad5 or an ortholog thereof. For example, the E4 region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 64 (E3 RID-alpha nt). In some embodiments the E3 region comprises (E3 RID-alpha nt) with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 64

[0312] In some embodiments, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 64 (E3 RID-alpha nt sequence) or an ortholog of SEQ ID NO: 64. For example, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 18 (E3 RID-alpha protein) or a functional equivalent thereof.

[0313] In some embodiments, the E3 region comprises an E3 RID-beta nucleotide sequence from Ad5 or an ortholog thereof. For example, the E4 region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 65 (E3 RID-beta nt). In some embodiments the E3 region comprises (E3 RID-beta nt) with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 65

[0314] In some embodiments, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 65 (E3 RID-beta nt sequence) or an ortholog of SEQ ID NO: 65. For example, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 19 (E3 RID-beta protein) or a functional equivalent thereof.

[0315] In some embodiments, the E3 region comprises anE3 14.7K nucleotide sequence from Ad5 or an ortholog thereof. For example, the E4 region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 66 (E3 14.7K nt). In some embodiments the E3 region comprises (E3 14.7Knt) with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 66.

[0316] In some embodiments, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 66 (E3 14.7K nt sequence) or an ortholog of SEQ ID NO: 66. For example, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 20 (E3 14.7K protein) or a functional equivalent thereof.

[0317] In some embodiments, the E3 region comprises an E3 CRl-beta nucleotide sequence from Ad5 or an ortholog thereof. For example, the E4 region comprises a nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 67 (E3 CRl-beta nt). In some embodiments the E3 region comprises (E3 CRl-beta nt) with a nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 67

[0318] In some embodiments, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising an amino acid sequence encoded by SEQ ID NO: 67 (E3 CRl-beta nt sequence) or an ortholog of SEQ ID NO: 67. For example, the E3 region comprises a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 68 (E3 CRl-beta protein) or a functional equivalent thereof.

[0319] In some embodiments, a polynucleotide described herein does not comprise an E3 region or a portion thereof. For example, the polynucleotide does not comprise a nucleotide sequence encoding one or more of E3 12K, E3 CR1 -alpha, E3 gp!9K, E3 CRl-beta, E3 RID-alpha, E3 RID-beta, E3 14.7K, or a functional equivalent thereof.

[0320] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein 12K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein 12K from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein 12K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encodinga full-length E3 protein 12K from an adenovirus, e.g., Ad5, or a functional equivalent thereof. Thus, in some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 14 (E3 12Kprotein) or a functional equivalent thereof.

[0321] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein CR1 -alpha or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein CRl-alpha from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein CRl-alpha or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein CRl-alpha from an adenovirus, e.g., Ad5, or a functional equivalent thereof. Thus, in some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 15 (E3 CRl-alpha protein) or a functional equivalent thereof.

[0322] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein gp!9K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein gp!9K from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein gp!9K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein gp!9K from an adenovirus, e.g., Ad5, or a functional equivalent thereof Thus, in some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 16 (E3 gp!9K protein) or a functional equivalent thereof.

[0323] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein 10.59K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein 10.5K from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein 10.5K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein 10.5K from an adenovirus, e.g., Ad5, or a functional equivalent thereof Thus, in some embodiments, a polynucleotide described herein does not comprise a nucleotidesequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 17 (E3 10.5K protein) or a functional equivalent thereof.

[0324] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein RID-alpha or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein RID-alpha from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein RID-alpha or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein RID-alpha from an adenovirus, e.g., Ad5, or a functional equivalent thereof. Thus, in some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 18 (E3 RID-alpha protein) or a functional equivalent thereof.

[0325] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein RID-beta or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein RID-beta from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein RID-beta or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein RID-beta from an adenovirus, e.g., Ad5, or a functional equivalent thereof. Thus, in some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 19 (E3 RID-beta protein) or a functional equivalent thereof.

[0326] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein 14.7K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein 14.7K from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein 14.7K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein 14.7K from an adenovirus, e.g., Ad5, or a functional equivalent thereof. Thus, in some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 20 (E3 14.7K protein) or a functional equivalent thereof.

[0327] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein CRl-beta or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E3 protein CRl-beta from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein CRl-beta or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E3 protein CRl-beta from an adenovirus, e.g., Ad5, or a functional equivalent thereof. Thus, in some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 68 (E3 CRl-beta protein) or a functional equivalent thereof.

[0328] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding E3 protein 12K or a portion thereof, E3 protein CR1 -alpha or a portion thereof, E3 protein gp19K or a portion thereof, E3 protein CR1-beta or a portion thereof, and E3 protein RID-alpha or a portion thereof.ITR

[0329] In some embodiments, a polynucleotide described herein comprises an inverted terminal repeat (ITR) nucleotide sequence. It is noted that the ITR sequence can be selected independently from an ITR sequence of an adenoviral ITR and / or AAV ITR. For example, the ITR sequence can be selected independently from an ITR sequence of AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh74, AAVrhlO, pol, AAV9-PHP. B, AAV9-ePHP. B, AAV LK03, AAV Anc80L65, AAVDJ, AAVIA611, AAV1P5H, AAV4A1H, AAV7P41, AAV9A11, AAV9A21, AAV9A61, AAV9P11, AAV9P21, AAV9P51, AAVrhlOAli, AAVrhlOA2i, AAVrhlOPli, AAV12P211, AAVS10P11, AAV JEA, AAV2 3xA P2i, AAVDJ P2i, AAV 218, AAV2G9, AAV2.5i82g9, AAV2.5, AAVrl0pLDB_L2, AAVrl0pLDB_P31, AAV4E, and AAV4A and / or any chimeras thereof. It is noted when polynucleotide described herein comprises two or more ITR sequences, the ITR sequences can be from the same AAV serotype or from differ AAV serotypes. Thus, in some embodiments of any one of the aspects described herein, the ITR sequences are from the same AAV serotype. In some other embodiments of any one of the aspects described herein, the ITR sequences are from the different AAV serotypes. In some embodiments, when polynucleotide described herein comprises two or more ITR sequences, one of the ITR sequence can be from an AAV ITR and one of the ITR sequence can be from an adenoviral ITR. AAV ITR can be 145 bp long AAV2 ITR or any truncation or deletion thereof e.g., AAV ITR can be 130 bp long or 119 bp long. In some embodiments, AAV ITR can bean ITR as described in US Patent No.s 9,169,494, 10,233,428; 10,858,632; 11,542,478. In some embodiments, AAV ITR can be as described in US Patent No: 9,447,433.

[0330] In some embodiments, the polynucleotide comprises an ITR nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 23 or 81-89 (ITR nt). In some embodiments, the polynucleotide comprises an ITR nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 23 or 81-89.

[0331] In some embodiments, the polynucleotide comprises an ITR nucleotide sequence that is at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identical to SEQ ID NO: 23 (ITR nt). In some embodiments, the polynucleotide comprises an ITR nucleotide sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 23.

[0332] The ITR nucleotide sequence can be 5’ or 3’ of the E4 region. In some embodiments, the ITR sequence can be located 3 ’-end of the E4 region

[0333] The ITR sequence and the E4 region can be linked directly to each other, i.e., the ITR sequence and the E4 region can be linked to each other via a single internucleotide linkage, e.g., a phosphodiester bond. Alternatively, the ITR sequence and the E4 region can be linked to each other via a nucleotide sequence comprising a few nucleotides to 100’s of nucleotides. For example, there can be from 1 to about 250 nucleotides between the ITR sequence and the E4 region. In some embodiments, the ITR sequence and the E4 region can be linked to each other via a nucleotide sequence comprising from about 10 to about 1000 nucleotides, e.g., from about 25 to about 600 nucleotides, or from about 50 to about 575 nucleotides, or from 75 to about 550 nucleotides, or from about 100 to about 525 nucleotides, or from about 125 to about 500 nucleotides, or from about 150 to about 475 nucleotide, or from about 175 to about 450 nucleotides, or from about 200 to about 400 nucleotides, or from about 225 to about 375 nucleotides, or from about 250 to about 350 nucleotides.

[0334] In some embodiments, the ITR sequence and the E4 region can be linked to each other via a nucleotide sequence comprising about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60, about 65, about 70, about 75, about 80, about 85, about 90, about 95, about 100, about 110, about 115, about 120, about 125, about 130, about 135, about 140, about 145, about 150, about 155, about 160, about 165, about 170, about 175, about 180, about 185, about 190, about 195, about 200, about 210, about 215, about 220, about 225, about 230, about 235, about 240, about 245, about 250, about 255, about 260, about 265, about 270, about 275, about 280, about 285, about 290, about 295, about 300, about 310, about 315, about 320, about325, about 330, about 335, about 340, about 345, about 350, about 355, about 360, about 365, about 370, about 375, about 380, about 385, about 390, about 395, about 400, about 410, about 415, about 420, about 425, about 430, about 435, about 440, about 445, about 450, about 455, about 460, about 465, about 470, about 475, about 480, about 485, about 490, about 495, about 500, about 510, about 515, about 520, about 525, about 530, about 535, about 540, about 545, about 550, about 555, about 560, about 565, about 570, about 575, about 580, about 585, about 590, about 595, about 600, about 610, about 615, about 620, about 625, about 630, about 635, about 640, about 645, about 650, about 655, about 660, about 665, about 670, about 675, about 680, about 685, about 690, about 695, about 700, about 710, about 715, about 720, about 725, about 730, about 735, about 740, about 745, about 750, about 755, about 760, about 765, about 770, about 775, about 780, about 785, about 790, about 795, about 800, about 810, about 815, about 820, about 825, about 830, about 835, about 840, about 845, about 850, about 855, about 860, about 865, about 870, about 875, about 880, about 885, about 890, about 895, about 900, about 910, about 915, about 920, about 925, about 930, about 935, about 940, about 945, about 950, about 955, about 960, about 965, about 970, about 975, about 980, about 985, about 990, about 995, or about 1000 nucleotides. For example, the ITR sequence and the E4 region can be linked to each other via a nucleotide sequence comprising about 200, about 210, about 215, about 220, about 225, about 230, about 235, about 240, about 245, about 250, about 255, about 260, about 265, about 270, about 275, about 280, about 285, about 290, about 295, about 300, about 310, about 315, about 320, about 325, about 330, about 335, about 340, about 345, about 350, about 355, about 360, about 365, about 370, about 375, about 380, about 385, about 390, about 395, or about 400 nucleotides. In some embodiments, the ITR sequence and the E4 region can be linked to each other via a nucleotide sequence comprising about 275, about 280, about 285, about 290, about 295, about 300, about 310, about 315, about 320 or about 325 nucleotides, e.g., about 310 nucleotides.

[0335] It is noted that the nucleotide sequence linking the ITR sequence and the E4 region can be a random sequence. In other words, the nucleotide sequence linking the ITR sequence and the E4 region may not be encoding a particular polypeptide sequence. In some embodiments, the nucleotide sequence linking the ITR sequence and the E4 region can be derived from an adenovirus, e.g., adenovirus serotype 5 (Ad5) or similar.

[0336] In some embodiments, the nucleotide sequence linking the ITR sequence and the E4 region does not comprise an open reading frame.

[0337] In some embodiments, the nucleotide sequence linking the ITR sequence and the E4 region comprises a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity to SEQ ID NO: 78. For example, the nucleotide sequence linkingthe ITR sequence and the E4 region comprises a sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 78.

[0338] In some embodiments, the polynucleotide comprises, linked to 3 ’-end of the ITR, a sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) identity to SEQ ID NO: 79. For example, the polynucleotide comprises, linked to 3 ’-end of the ITR, a sequence that is 100% identical (e.g., is completely identical) to SEQ ID NO: 79.El regionEl A protein 13S

[0339] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E1A protein 13S or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E1A protein 13S from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length El A protein 13 S or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length El A protein 13S from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 50 (E1A 13S) or a functional equivalent thereof.

[0340] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 50 (E1A 13S) or a functional equivalent thereof.

[0341] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a polypeptide of SEQ ID NO: 50 (El A 13S) or a functional equivalent thereof.El A protein 12S

[0342] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of El A protein 12S or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E1A protein 12S from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length El A protein 12S or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encodinga full-length El A protein 12S from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 51 (El A 12S) or a functional equivalent thereof.

[0343] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 51 (E1A 12S) or a functional equivalent thereof.

[0344] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a polypeptide of SEQ ID NO: 51 (El A 12S) or a functional equivalent thereof.El A protein IIS

[0345] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion ofElA protein 1 IS or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of El A protein 1 IS from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E1A protein 1 IS or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length El A protein 1 IS from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 52 (El A 1 IS) or a functional equivalent thereof.

[0346] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 52 (El A IIS) or a functional equivalent thereof.

[0347] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a polypeptide of SEQ ID NO: 52 (El A 11 S) or a functional equivalent thereof.El A protein 10S

[0348] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E1A protein 10S or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of El A protein 10S from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length El A protein 10S or a functional equivalent thereof.For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length El A protein 10S from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 53 (El A 10S) or a functional equivalent thereof.

[0349] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 53 (E1A 10S) or a functional equivalent thereof.

[0350] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a polypeptide of SEQ ID NO: 53 (El A 10S) or a functional equivalent thereof.El A protein 9S

[0351] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of El A protein 9S or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of El A protein 9S from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length El A protein 9S or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length El A protein 9S from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 54 (E1A 9S) or a functional equivalent thereof.

[0352] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 54 (E1A 9S) or a functional equivalent thereof.

[0353] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a polypeptide of SEQ ID NO: 54 (El A 9S) or a functional equivalent thereof.E1B protein 19K

[0354] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E1B protein 19K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E1B protein 19K from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprisea nucleotide sequence encoding a full-length E1B protein 19K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E1B protein 19K from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 55 (E1B 19K) or a functional equivalent thereof.

[0355] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 55 (E1B 19K) or a functional equivalent thereof.

[0356] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a polypeptide of SEQ ID NO: 55 (E1B 19K) or a functional equivalent thereof.E1B protein 55K

[0357] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E1B protein 55K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of E1B protein 55K from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E1B protein 55K or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length E1B protein 55K from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 56 (E1B 55K) or a functional equivalent thereof.

[0358] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 56 (E1B 55K) or a functional equivalent thereof.

[0359] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a polypeptide of SEQ ID NO: 56 (E1B 55K) or a functional equivalent thereof.Hexon protein

[0360] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of a hexon protein or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of hexon protein from an adenovirus, e.g., Ad5, or a functionalequivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length hexon protein or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length hexon protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 57 (hexon protein) or a functional equivalent thereof.

[0361] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 57 (hexon protein) or a functional equivalent thereof.

[0362] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a polypeptide of SEQ ID NO: 57 (hexon protein) or a functional equivalent thereof.Peripentonal hexon-associated protein

[0363] In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of a peripentonal hexon-associated protein or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding at least a portion of peripentonal hexon-associated protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length peripentonal hexon-associated protein or a functional equivalent thereof. For example, a polynucleotide described herein does not comprise a nucleotide sequence encoding a full-length peripentonal hexon-associated protein from an adenovirus, e.g., Ad5, or a functional equivalent thereof. In some embodiments, a polynucleotide described herein does not comprise a nucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO: 58 (peripentonal hexon-associated protein) or a functional equivalent thereof.

[0364] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a fragment, i.e., less than full-length of SEQ ID NO: 58 (peripentonal hexon-associated protein) or a functional equivalent thereof.

[0365] In some embodiments, a polynucleotide described herein comprises a nucleotide sequence encoding a polypeptide of SEQ ID NO: 58 (peripentonal hexon-associated protein) or a functional equivalent thereof.Restriction sites

[0366] In some embodiments, the polynucleotide comprises a restriction site or restriction recognition site for a restriction enzyme. As used herein, the term "restriction site" or “restriction recognition site” refers to a recognition nucleotide sequence that is necessary for the manifestation of the action of a restriction enzyme, and includes a site of catalytic cleavage. It is appreciated that a site of cleavage may or may not be contained within a portion of a restriction site that comprises a low ambiguity sequence (i.e., a sequence containing the principal determinant of the frequency of occurrence of the restriction site). When an enzyme (e.g. a restriction enzyme) is said to "cleave" a polynucleotide, it is understood to mean that the restriction enzyme catalyzes or facilitates a cleavage of a polynucleotide. Exemplary restriction enzymes and their recognition sequences are provided in Table 1.Table 1: Exemplary restriction enzymes and their recognition sequences.Enzyme Recognition site / sequenceAcc65I G / GTACCAccI GT / MKACAcil CCGC(-3 / -l)Acll AA / CGTTAcul CTGAAG(16 / 14)Afel AGC / GCTAflll C / TTAAGAfUII A / CRYGTAgel Agel-HF® A / CCGGTAhdI GACNNN / NNGTCAlel CACNN / NNGTGAlul AG / CTAlwl GGATC(4 / 5)AlwNI CAGNNN / CTGApaLI G / TGCACApol ApoI-HF R / AATTYAsci GG / CGCGCCAsel AT / TAATAsiSI GCGAT / CGCAval BsoBI C / YCGRGA v nil G / GWCCAvril C / CTAGGBaeGI GKGCWCBael (10 / 15)ACNNNNGTAYC(12 / 7)BamHI BamHI-HF'® G / GATCCBanI G / GYRCCBand GRGCY / CBbsI BbsLHF® GA AGAC (2 / 6 )BbvCI CCTCAGC(~5 / -2)Bbvl GCAGC(8 / I2)Bed CCATC(4 / 5)Bee Al ACGGC'(12 / 14)BegI ( 10 / 12)CGANNNNNdrGC( 12 / 10) BciVI GTATCC(6 / 5)Bell T / GATCABfal C / 'TAGBgll GCCNNNN / NGGCBgin A'GATCTBlpI GC / FNAGCBmgBI CACGTC(~3 / ~3)BmrI ACrr(3G<l(5 / 4)Bmtl Bmtl-HF® GCI AG'CBpml CTGGAG(16 / 14)BpulOI CCTNAGC(-5 / -2)BpuEI CTTGAG(I6 / 14)BsaAI YAC / GTRBsaBI GATNN / NNATCBsaHI GR / CGYCBsal Bsal-HF® (K3TCTC(l / 5)BsaJI C / CNAGGBsaWI W / CCGGWBsaXI (9 / 12)ACNNNNNCTCC(l 0 / 7) BseRI GAGGAG( 10 / 8)BseYI CCCAGC(-5 / -I)Bsgl GfGCAGf 16 / 14)BsiEI CGRY / CGBsiHKAI (JW(K / W7CBsiWI BsiWLHF® C / GTACGBslI CCNNNNN / NNGGBsmAI BcoDI GTCTC(l / 5)BsmBI CGTCTCfl / 5)BsinFI GGGAC(10 / 14)BsmI GAATGC(1 / “1)Bsp 12861 GDGCH / CBspCNI CTCAG(9 / 7)BspEI T / CCGGABspffl 17CATGABspMI BfuAI ACCI'GC(4 / 8)BsrBI CCGGTC(--3 / --3)BsrDI GCAATG(2 / 0)BsrFI BsrFal R / CCGGYBsiGI BsrGI-HF® T / GTACABsrI ACTGGfl / - -1)BssHII G / CGCGCBssKI StyD4I / CCNGGBssSI BssSal CACGAC(-5 / -DBstAPI GCANNNN / NTGCBstBI TT / CGAABstEII BstEIEHF® G / Gl'NACCBstNI CC / WGGBstUI CG / CGBstXI CCANNNNNZNIXIGBstZ17I GTA / TACBstZ17I-HF® GTATACBsu36I CC / INAGGBtgl C / CRYGGBtgZI GCGATG(10 / 14)BtsCI GGA f G(2 / 0)BisI Bisal GC. AGT (..(2 / 0)BisIlMutl CAGTG(2 / 0)Cac8I GCN / NGCCl al BspDI AT / CGATCspCI (11 / 13 )C AANNNNNGTGGf 12 / 10) CviAII C / ATGCviKI-1 RG / CYCviQI G' I ACDdel C / TNAGDpnl GA / 1" CDral T FT / AAADrain Dralll-HF® CACNNN / GTGDrdI GACNANN / NNGTCEael Y7GGCCREagI Eagl-HF® C / GGCCGEarl CTcrrc(i / 4)Beil GGCGGA(l 1 / 9)Eco531d GAG / CTCEcoNI CCTNN / NNNAGGEcoOl 091 RG / GNCCYEcoPLSI CAGCAG(25 / 27)EcoRI EcoRI-HF® Ci / AATTCEcoRV EcoRV -HF® GAT / ATCFail / CATGFaul CCCGC(4 / 6)Fnu4HI GC / NGCFold GGATG(9 / l 3)Fsel GGCCGG'CCFspEI CC( 12 / 16)FspI TGC / GCAHaell RGCGC / YHaeTII Phol GG / CCHgal GACG€'(5 / i 0)Hhal GCG / CHindi GFY / RACHindlll Hindlll-HF® A AGCTTIM G / ANTCHinPlI G''CGCHpal GTT / AACHphI GGTGA(8 / 7)Hpy 16611 GTN / NACHpy 1881 TCN / GAHpyl88III TC / NNGAHpy AV CCTTC(6 / 5)HpyCH4IH ACN / GFHpyCH4IV A / CGFHpyCH4V TG / CAI-Ceul ■rAACFI'Al'AACXjCFfCC'rAAGGI'AGFXjAA (-9 / -13) I-Scel T AGGG AT A A C AGGGT A AT(-9G 13 )KasI G / GCGCCKpnl KpnI-HF® GGI'AC / CI..pnPI CCDG(10 / 14)Mbd Sau3AI DpnTI / GATCBfiiCdMboII GAAGA(8 / 7)Mfel MfeLHF® C / AATTGMluCI Tsp509I / AATTMid Mhii-HF® A / GGCG;FMlyl GAGTC(5 / 5)Mmd TCCRAC(20 / 18)MscI TGCFCCAMsel T / TAAMslI CAYNN / NNRTGMspAlI CMG / CKGMspI Hpall C / CGGMspJI CNNR(9 / 13)Mull CCTC(7 / 6)Mwol GCNNNNNZNNGCNad GCC / GGCNad GGZCGCCNb. BbvCI CCTCACR:Nb. BsmI GAATGCNb. BssSI CACGAGNeil CCZSGGNcol NcoI-HF® CZCATGGNclel CATATGNgoMIV G''CCGGCNhel Nhel-HF® G / CTAGCNlalll CAI'GZNSaIV GGN / NCCNmeAIII GCCGAG(2I / 19)Notl Notl-HF® GC / GGCCGCNrul NruLHF® 'FCG / CGANsil \>: MH ' ATGCA'TNspI RCATG / YNt. AIwI GGATC(4 / -5)Nt. BbvCI CCTCAGC(-5 / -7)Nt. BsmAI GTCTC(I / '--S)Nt. BspQI GCTCTTC(lA-7)Nt. BstNBI GAGTC0 / -5)Nt. CviPII (OZ-l)CCDPad TTAAT / I'AAPciI A'CATGTpn\n CCANNNNZNTGPl-PspI TGGC A A ACAGCT ATTATGGGT ATT ATGGGT (- 13 Z- 17) PT-Scel ATCT ATGTCGGGTGCGGAGA A AGAGGTA AT (- 15Z- 19) Piel GAGTC(4Z5)Pmel GTTI7AAACPmH CAC / GTGPpuMI RGZGWCCYPshAI GACNNZNNGTCPAI TTA / TA. A / CCWGGPspOMI G / GGCCCPspXI VCZTCGAGBPstI Pstl-HF® CTGCA'GPvul PvuI-HF® CGATZCGPvuil PvuIRHF® CAGZCTGPlsnl GT / ACRsrII CG / GWCCGSadi CCGCZGGSadi Sadl-HF® GAGCTZCSapI BspQI GCTCTTC(l / 4)Sau96I G / GNCCSbfl Sbfl-HF® CCTGCAZGGSeal Scal-HF® AG 17 ACTScrFI CC / NGGSex Al A3CCWGG1'SfaNI GCA T C (5 / 9)SIH GGGCNNNN / NGGCCSgrAI CRZC C GGY GSmal CCC / GGGSmll C / T YR AGSnaBI TAC7GTASpd Spd-HF® A / CTAGTSphI SphI -HF® GCATG / CSrfl GO C C7 GGGCSspI SspI-HF® AAT / ATTStul AGG / CCTStyl Styl-HF® C / CWWGGSwal ATTT / AAATTaqaI T / CGATfil G / AWTCTsel ApeKI G / C ’WGCTsp45I, / GTSACTspRI NNCASTGNN / Tthl l ll PflFI GACN / NNGTCXbal 17CI AGAXcml CCANNNNN / NNNNTGGXhol PaeR7I THI C / TCGAGXmal TspMI C / CCGGGXmnI GAANN / NNTTCZral GAC / GTC

[0367] In some embodiments, the polynucleotide comprises a restriction site or restriction recognition site upstream of the VA RNA region. For example, the polynucleotide comprises a restriction site for an enzyme selected from the enzyme listed in Table 1, and wherein the restriction site is upstream of the VA RNA region. In some embodiments, the polynucleotide comprises a restriction site for Sall and wherein the restriction site is upstream of the VA RNA region.

[0368] In some embodiments, the polynucleotide comprises a restriction site or restriction recognition site upstream of the VA RNA region and downstream of a polyadenylation sequence. In other words, the restriction site is located between the polyadenylation sequence and 5 ’-end of the VA RNA region. For example, the polynucleotide comprises a restriction site for an enzyme selected from the enzyme listed in Table 1, and wherein the restriction site is upstream of the VA RNA region and downstream from a polyadenylation sequence. In some embodiments, the polynucleotide comprises restriction site for Sall located upstream of the VA RNA region and located between a polyadenylation sequence and the VA RNA region.

[0369] In some embodiments, the polynucleotide comprises a restriction site or restriction recognition site downstream of the VA RNA region. For example, the polynucleotide comprises a restriction site for an enzyme selected from the enzyme listed in Table 1, and wherein the restriction site is downstream of the VA RNA region. In some embodiments, the polynucleotide comprises a restriction site for Nsil and wherein the restriction site is downstream of the VA RNA region.

[0370] In some embodiments, the polynucleotide comprises a restriction site downstream of the VA RNA region and upstream of the E2A region. In other words, the restriction site is locatedbetween the VA RNA region and the E2A region. For example, the polynucleotide comprises a restriction site for an enzyme selected from the enzyme listed in Table 1, and wherein the restriction site is downstream from the VA RNA region and is located between the VA RNA region and the E2A region. In some embodiments, the polynucleotide comprises restriction site for Nsil downstream from the VA RNA region and located between the VA RNA region and the E2A region.Stuff er sequences

[0371] Embodiments of the various aspects include a stuffer sequence. As used herein, “stuffer” sequence refers to a non-coding sequence, optionally of non-viral origin. A stuffer sequence preferably has no or minimal regulatory effect on coding sequences in the same nucleic acid molecule. Generally, a stuffer sequence does not comprise one or more (e.g., 1, 2, 3, 4, 5, 6, 7, 8 or all 9) of a TATA box, CpG dinucleotides, an endonuclease cleavage site, a transcription factor binding site, an open reading frame (ORF) longer than 10 amino acids, a donor or acceptor splicing site, a regulatory element, a repetitive or palindrome sequence, optionally a repetitive or palindrome sequence longer than 5 nucleotides, an AAV Rep binding site. In some embodiments, the stuffer sequence does not comprise more than one (e.g., 1, 2, 3, 4, 5, 6, 7 or 8) of the following: a transcription factor binding site; a regulatory element; an AAV Rep binding site; a donor or acceptor splicing site; an endonuclease cleavage site, optionally where the endonuclease is ApaLI, BamHI, Clal, DrdI, FspI, RsrII, Xbal, Ncol, SacII, Csil, Aflll, or PacI; a repetitive or palindrome sequence longer than 5 nucleotides; and / or a strong secondary structure; or a repetitive or palindrome sequence, optionally a repetitive or palindrome sequence longer than 5 nucleotides. In some embodiments, the stuffer sequence has a GC content of less than about 50%, e.g., a GC content of less than about 45%, less than about 40%, or less than about 35%. In some embodiments, the stuffer sequence comprises a donor or acceptor splicing site, e.g., an intron sequence.

[0372] Generally, the stuffer sequence has length greater than about 1.5 kb. For example, the stuffer sequence has a length greater than about 2 kb, 2. Ikb, greater than about 2.2kb, greater than about 2.3kb, greater than about 2.4kb, greater than about 2.5kb, greater than about 2.6kb, greater than about 2.7kb, greater than about 2.8kb, greater than about 2.9kb, or greater than about 3.0kb. In some embodiments, the stuffer sequence has a length greater than about 3. Ikb, greater than about 3.2kb, greater than about 3.3kb, greater than about 3.4kb, greater than about 3.5kb, greater than about 3.6kb, greater than about 3.7kb, greater than about 3.8kb, greater than about 3.9kb, or greater than about 4.0kb. For example, the stuffer sequence has a length greater than about 4. Ikb, greater than about 4.2kb, greater than about 4.3kb, greater than about 4.4kb, greater than about 4.5kb, greater than about 4.6kb, or greater than about 4.7kb, greater than about 4.8kb, greater than about4.9kb, or greater than about 5.0kb. In some embodiments, the stuffer sequence sequence of sufficient length to increase the size of polynucleotide, vector or a plasmid described herein over the DNA packaging limit of the AAV capsid, which is around 5 kb. Exemplary stuffer sequences are described in International PCT publications WO2024263896 and WO2023250416, the contents of both of which are incorporated herein by reference in their entireties.

[0373] In some embodiments, the stuffer sequence comprises a nucleotide sequence having at least 85% (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100%, i.e., fully identical) identity to a contiguous fragment of at least about 250 nucleotides, e.g. a contiguous fragment of from about 250 nucleotides to about 1500 nucleotides of any one of SEQ ID NO: 110-116. In some embodiments, the stuffer sequence comprises a nucleotide sequence having at least 85% (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100%, i.e., fully identical) identity to any one of SEQ ID NO: 110-116. In some embodiments, the stuffer sequence comprises a nucleotide sequence having at least 85% (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100%, i.e., fully identical) identity to SEQ ID NO: 113. For example, the stuffer sequence comprises a nucleotide sequence having 100% identity to SEQ ID NO: 113. In another embodiment, the stuffer sequence comprises a nucleotide sequence having at least 85% (e.g., at least 90%, at least 92%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, at least 99.5% or 100%, i.e., fully identical) identity to SEQ ID NO: 114. For example, the stuffer sequence comprises a nucleotide sequence having 100% identity to SEQ ID NO: 114.

[0374] It is noted that the stuffer sequence can be present anywhere in a polynucleotide, vector or plasmid described herein. For example, the stuffer sequence can be located upstream (e.g., 5’-end), downstream (e.g., 3 ’-end), or within a nucleotide sequence encoding a protein or gene described herein. In some embodiments, the stuffer sequence can be present between the nucleotide sequence encoding a protein or gene described herein and a promoter operably linked to said nucleotide sequence.

[0375] In some embodiments, a polynucleotide, vector or plasmid described herein further comprises: (i) a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and (ii) a stuffer sequence. In such embodiments, the stuffer sequence can be located upstream (e.g., 5 ’-end), downstream (e.g., 3 ’-end), or within the nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes. For example, the stuffer sequence can be located within a nucleotide sequence encoding viral non-structural replication (e.g., AAV Rep) genes.

[0376] In some embodiments, a polynucleotide, vector or plasmid described herein further comprises: (i) a nucleotide sequence encoding an AAV capsid and AAV Rep genes; and (ii) a stuffer sequence, wherein the stuffer sequence is located within the sequence encoding AAV capsid or AAV Rep genes. For example, the stuffer sequence is located within the nucleotide sequence encoding the AAV Rep.Vectors

[0377] In another aspect, provided herein is a composition comprising a polynucleotide described herein.

[0378] In some embodiments of any one of the aspects described herein, the polynucleotide described herein is a vector.

[0379] As used herein, a “vector” refers to a compound used as a vehicle to carry foreign genetic material into another cell, where it can be replicated and / or expressed. A cloning vector containing foreign nucleic acid is termed a recombinant vector. Exemplary vectors include, but are not limited to, plasmids, phagemids, bacmids, cosmids, viral vectors, and artificial chromosomes (e.g., bacterial or yeast artificial chromosome). In some embodiments of any one of the aspects described herein, the polynucleotide described herein is a plasmid. In some other embodiments, the polynucleotide described herein is a bacmid. In yet other embodiments, the polynucleotide described herein is a cosmid. Recombinant vectors typically contain an origin of replication, a multicloning site, and a selectable marker. The nucleotide sequence typically consists of an insert (recombinant nucleic acid or transgene) and a larger sequence that serves as the “backbone” of the vector. The purpose of a vector which transfers genetic information to another cell is typically to isolate, multiply, or express the insert in the target cell. Expression vectors (expression constructs) are for the expression of the exogenous gene in the target cell, and generally have a promoter sequence that drives expression of the exogenous gene / ORF. Insertion of a vector into the target cell is referred to transformation or transfection for bacterial and eukaryotic cells, although insertion of a viral vector is often called transduction. The term “vector” may also be used in general to describe items that serve to carry foreign genetic material into another cell, such as, but not limited to, a transformed cell or a nanoparticle.

[0380] In some embodiments, the vector is an expression vector. As used herein, the term “expression vector” refers to a vector that directs expression of an RNA or polypeptide from sequences linked to transcriptional regulatory sequences on the vector. The sequences expressed will often, but not necessarily, be heterologous to the cell. An expression vector can comprise additional elements. For example, the expression vector can have two replication systems; thus, allowing it to be maintained in two organisms, for example in human cells for expression and in aprokaryotic host for cloning and amplification. Examples of eukaryotic expression vectors include, but are not limited to, pW-LNEO, pSV2CAT, pOG44, pXTl and pSG available from Stratagene; pSVK3, pBPV, pMSG and pSVL available from Amersham Pharmacia Biotech; and pCMVDsRed2-express, pIRES2-DsRed2, pDsRed2-Mito, pCMV-EGFP available from Clontech. Many other vectors are well-known and commercially available. For mammalian cells adenoviral vectors, the pSV and the pCMV series of vectors are particularly well-known non-limiting examples. There are many well-known yeast expression vectors including, without limitation, yeast integrative plasmids (Yip) and yeast replicative plasmids (YRp). For plants the Ti plasmid of agrobacterium is an exemplary expression vector, and plant viruses also provide suitable expression vectors, e.g., tobacco mosaic virus (TMV), potato virus X, and cowpea mosaic virus.

[0381] In some embodiments, a vector described herein does not comprise a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. For example, the vector does not comprise a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7. In another example, the vector does not comprise a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8. In yet another example, the vector does not comprise a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8.

[0382] In some embodiments, the expression vector is a plasmid. Such a plasmid can include a variety of other functional nucleic acid sequences, such as one or more selectable markers, one or more origins of replication, polycloning sites and the like.

[0383] In some embodiments, the polynucleotide is a helper plasmid. As used herein, the term “helper plasmid” refers to a plasmid used when producing copies of a helper virus-dependent viral vector, such as adeno-associated virus, which does not have the ability to replicate on its own. The helper plasmid is used to co-infect cells alongside the viral vector and provides the necessary proteins for replication of the genome of the viral vector.

[0384] In some embodiments, the plasmid does not comprise a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. For example, the plasmid does not comprise a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%. atleast 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7. In another example, the plasmid does not comprise a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8, In yet another example, the plasmid does not comprise a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8. In some embodiments, the plasmid does not comprise a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. For example, the plasmid does not comprise a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 In another example, the plasmid does not comprise a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%. at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8. In yet another example, the plasmid does not comprise a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8.Compositions

[0385] In another aspect, provided herein is a composition comprising a polynucleotide described herein.

[0386] In some embodiments, the composition further comprises a transfection agent. The term “transfection agent” as used herein generally refers to a molecule or composition capable of delivering molecules, e.g., nucleic acids to cells. Exemplary classes of transfection agents include, but are not limited to, cationic compounds (compounds having a net positive charge) and charge neutral compounds. By way of example, suitable transfection agents can include cationic and non-cationic polymers and cationic and noncationic lipids. Exemplary cationic lipids include, but are not limited to, 3P-[N-(N', N'-dimethylaminoethane)-carbamoyl]cholesterol hydrochloride (DC-cholesterol); l,2-dioleoyl-3-trimethylammonium-propane (DOTAP); dimethyldioctadecylammonium (DDAB); 1,2-dioleoyl-sn-glycero-3-ethylphosphocholine (EPC); l,2-di-O-octadecenyl-3 -trimethylammonium propane(DOTMA); l,2-di-(9Z-octadecenoyl)-3-dimethylammonium-propane (DODAP); 1,2-dilinoleyloxy-3 -dimethylaminopropane (DLinDMA); l,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE); cholesterol; l,2-dioctadecanoyl-sn-glycero-3-phosphocholine (DSPC); l,2-distearoyl-sn-glycero-3 -phosphoethanolamine (DSPE); and derivatives thereof. Other exemplary lipids can include, but are not limited to, lipidoids, atuplex formulations, and PEGylated forms of lipids described above. Transfection agents can also include polycation containing cyclodextrin, histones, cationized human serum albumin, aminopolysaccharides such as chitosan, peptides such as poly-L-lysine, poly-L-omithine, and poly(4-hydroxy-L-proline ester, and polyamines such as polyethylenimine (PEI), polypropylenimine, polyamidoamine dendrimers, and poly(beta-aminoesters). In some preferred embodiments, the transfection agent is PEI.

[0387] In some embodiments of the any one of the aspects described herein, the composition further comprises a nucleic acid comprising a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes.

[0388] In some other embodiments of the any one of the aspects described herein, the composition further comprises a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR).

[0389] In some embodiments of any one of the aspects described herein, the composition comprises: i) a polynucleotide described herein; ii) a nucleic acid comprising a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and iii) a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR). It is noted that the nucleic acid encoding the viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) gene viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) gene can be in a separate polynucleotide. Alternatively, the nucleic acid encoding the viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) gene viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) gene can be a part of the polynucleotide described herein. In other words, the polynucleotide described herein and the nucleic acid encoding the viral capsid and non-structural replication genes are the same, i.e., the polynucleotide further comprises a nucleotide sequence encoding the viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes.

[0390] In some embodiments, the composition does not comprise a polynucleotide comprising a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. Forexample, the composition does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7. In another example, the composition does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identify to SEQ ID NO: 8. In yet another example, the composition does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identify to SEQ ID NO: 7 or 8. In some embodiments, the composition does not comprise a polynucleotide comprising a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. For example, the composition does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%>, at least 94%, at least 95%>, at least 96%>, at least 97%>, at least 98'%., at least 99% or 100%) identity to SEQ ID NO: 7. In another example, the composition does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%. at least 93%. at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identify to SEQ ID NO: S. In yet another example, the composition does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8.Cells

[0391] In another aspect, provided herein is a cell comprising a polynucleotide described herein. As used herein, the term “cell” refers to a single cell as well as to a population of (i.e., more than one) cells. Further, unless otherwise indicated, the terms “cell” or “cell line” are understood to include modified or engineered variants of the indicated cell or cell line.

[0392] A cell comprising a polynucleotide described herein can be a mammalian, bacterial, insect or yeast cell. Some exemplary cells include, but are not limited to HeLa cell, COS cell, COS-1 cell, COS-7 cell, HEK293 cell, A549 cell, BHK cell, BSC-1 cell, BSC-40 cell, Vero cell,Sf’c9 cell, Sf -21 cell, Tn-368 cell, BTI-Tn-5Bl-4 (High-Five) cell, Saos cell, C2C12 cell, L cell, HT1080 cell, HepG2 cell, WEHI cell, 3T3 cell, 10T1 / 2 cell, MDCK cell, BMT-10 cell, WI38 cell, or primary fibroblast, hepatocyte or myoblast cells derived from mammals.

[0393] In some embodiments, the cell comprising a polynucleotide described herein is a mammalian cell. Exemplary mammalian cells include, but are not limited to, Chinese hamster ovary (CHO) cell for example of KI lineage (ATCC CCL 61) including the Pro5 variant (ATCC CRL 1281); the fibroblast-like cells derived from SV40-transformed African Green monkey kidney of the CV-1 lineage (ATCC CCL 70), of the COS-1 lineage (ATCC CRL 1650) and of the COS-7 lineage (ATCC CRL 1651; murine L-cells, murine 3T3 cells (ATCC CRL 1658), murine C127 cells, human embryonic kidney cells of the 293 lineage (ATCC CRL 1573), human carcinoma cells including those of the HeLa lineage (ATCC CCL 2), and neuroblastoma cells of the lines IMR-32 (ATCC CCL 127), SK-N-MC (ATCC HTB 10) and SK-N-SH (ATCC HTB 11). In some embodiments, the cell comprising a polynucleotide described herein is a HEK293 cell. In another embodiment, the cell comprising a polynucleotide described herein is a HeLa cell.

[0394] In some embodiments, the cell comprising a polynucleotide described herein is a microbial cell. For example, the cell comprising a polynucleotide described herein is a bacterial cell such as E. coli cell, or yeast cell such as S. cerevisiae cell.

[0395] In some embodiments, the cell comprising a polynucleotide described herein is a host cell or a producer cell. The terms “host cell” and “producer cell” are used interchangeably herein and refer to any cell or cells capable of producing a recombinant virus, e.g., recombinant adeno-associated virus particles. Host cell can be a mammalian, bacterial, or yeast cell. In some embodiments, the host cell is a mammalian cell.

[0396] In some embodiments, the cell comprising a polynucleotide described herein is a modified or engineered cell. For example, the cell comprising a polynucleotide described herein is a suspension adapted cell. In some embodiments, the cell comprising a polynucleotide described herein is a suspension-adapted cell derived from the human embryonic kidney cell line 293 (HEK293). For example, the cell comprising a polynucleotide described herein is a PRO10™ cell line (AskBio, NC, USA), a suspension-adapted and serum-free cell line derived from the human embryonic kidney cell line 293 (HEK293).

[0397] In some embodiments of the any one of the aspects described herein, the cell further comprises a nucleic acid comprising a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes.

[0398] In some other embodiments of the any one of the aspects described herein, the cell further comprises a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or arecombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR).

[0399] In some embodiments of any one of the aspects described herein, the cell comprises: i) a polynucleotide described herein; ii) a nucleic acid comprising a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and iii) a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR).

[0400] It is noted that the nucleic acid encoding the viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) gene viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) gene can be in a separate polynucleotide. Alternatively, the nucleic acid encoding the viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) gene viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) gene can be a part of the polynucleotide described herein. In other words, the polynucleotide described herein and the nucleic acid encoding the viral capsid and non-structural replication genes are the same, i.e., the polynucleotide further comprises a nucleotide sequence encoding the viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes.

[0401] In some embodiments, the cell comprises an endogenous or exogenous polynucleotide encoding at least one recombinase. The term “recombinase” refers to an enzyme that catalyzes DNA exchange at a specific target site, for example, a palindromic sequence, by excision / insertion, inversion, translocation and exchange. Exemplary recombinases include, but are not limited to, TelN, Tel, Tel (gp26 K02 phage) Cre, Flp, phiC31, Int and other lambdoid phage integrases, e.g., phi 80, HK022 and HP1 recombinases.

[0402] In some embodiments, the cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. For example, the cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7. In another example, the cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8. In yet another example, the cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%. at least 91%. atleast 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8. In some embodiments, the cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. For example, the cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7. In another example, the cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8. In yet another example, the cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8.Kits

[0403] In another aspect, provided herein is a kit comprising a polynucleotide described herein. The kit is an assemblage of materials or components, including at least one of the polynucleotides described herein. Optionally, the kit can also contain other useful components and reagents, such as, transfection agents, cells, other nucleic acids, measuring tools, diluents, buffers, instructions for use, and / or other useful paraphernalia as will be readily recognized by those of skill in the art. It is noted that the exact nature of the components configured in the kit depends on its intended purpose. In some embodiments, the kit is configured for industrial applications. In some embodiments, the kit is configured for research applications.

[0404] In some embodiments, the kit includes instructions for use. “Instructions for use” typically include a tangible expression describing the technique to be employed in using the components of the kit.

[0405] In some embodiments of any one of the aspects described herein, the kit further comprises a transfection agent.

[0406] In some embodiments of any one of the aspects described herein, the kit further comprises a nucleic acid comprising a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes.

[0407] In some embodiments of any one of the aspects described herein, the kit further comprises a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionallyflanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR).

[0408] In some embodiments of any one of the aspects described herein, the kit comprises: i) a polynucleotide described herein; ii) a transfection agent; iii) a nucleic acid comprising a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and iv) a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR).

[0409] In some embodiments, the kit comprises a polynucleotide described herein and a cell, e.g., a host cell. In some embodiments, the kit comprises a cell, e.g., a host cell comprising a polynucleotide described herein.

[0410] The materials or components assembled in the kit can be provided to the practitioner stored in any convenient and suitable ways that preserve their operability and utility. For example, the components can be in dissolved, dehydrated, or lyophilized form; they can be provided at room, refrigerated or frozen temperatures. The components are typically contained in suitable packaging material(s). As employed herein, the phrase “packaging material” refers to one or more physical structures used to house the contents of the kit, such as inventive compositions and the like. The packaging material is constructed by well-known methods, preferably to provide a sterile, contaminant-free environment. The packaging may also preferably provide an environment that protects from light, humidity, and oxygen. As used herein, the term “package” refers to a suitable solid matrix or material such as glass, plastic, paper, foil, polyester (such as polyethylene terephthalate, or Mylar) and the like, capable of holding the individual kit components in a format suitable for use. Thus, for example, a package can be a glass vial or a plastic vial used to contain suitable quantities of a component included in the kit therein. The packaging material generally has an external label which indicates the contents and / or purpose of the kit and / or its components.

[0411] In some embodiments, the kit does not comprise a polynucleotide comprising a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. For example, the kit does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 7. In another example, the kit does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%. at least99% or 100%) identity to SEQ ID NO: 8. In yet another example, the kit does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8. In some embodiments, the kit does not comprise a polynucleotide comprising a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. For example, the kit does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7. In another example, the kit does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8. In yet another example, the kit does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8.Uses and methods

[0412] The polynucleotides and cells, e.g. host or producer cells described herein can be used in manufacturing recombinant virus e.g., recombinant adeno-associated virus (rAAV) particles. For example, polynucleotides described herein can be used in a method of producing a plurality of viral particles, e.g., rAAV particles. Exemplary methods for producing rAAV are described in PCT / US2022 / 013279 (published as WO2022159679), and in PCT / US2021 / 013689 (published as WO / 2021 / 146591), contents of both of which are incorporated herein by reference in their entireties. It is noted that virus particle (e.g., rAAV particle) and virus capsid (e.g., rAAV capsid) are used interchangeably herein.

[0413] Thus, in another aspect, provided herein is a method of producing recombinant virus e.g., rAAV particles. Generally, the method comprises culturing a host cell comprising a polynucleotide described herein in a culture medium under conditions in which viral particles, e.g., rAAV particles are produced. In some embodiments, the host cell used for rAAV production is contacted (e.g. in trans) with the polynucleotides described herein. In some embodiments, the host cell genome comprises (e.g. in cis) the polynucleotides described herein. In some embodiments, the host cell further comprises a nucleic acid encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes and / or a nucleic acid encoding a virus genome. For example, the host cell comprises: (i) a polynucleotide described herein; (ii) a nucleic acid encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and (iii) a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR).

[0414] In some embodiments, the cell, e.g., the host cell or a producer cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. For example, the cell, e.g., the host cell or a producer cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity' to SEQ ID NO: 7. In another example, the cell, e.g., the host cell or a producer cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8. In yet another example, the cell, e.g., the host cell or a producer cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g, at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8. In some embodiments, the cell, e.g., the host cell or a producer cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein. For example, the cell, e.g., the host cell or a producer cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7. In another example, the cell, e.g., the host cell or a producer cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity' to SEQ ID NO: 8. In yet another example, the cell, e.g., the host cell or a producer cell does not comprise a polynucleotide comprising a nucleotide sequence encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%,at least 90%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8.

[0415] The host cell can be a mammalian, bacterial, or yeast cell. In some embodiments of any one of the aspect, the host cell can be HeLa cell, COS cell, COS-1 cell, COS-7 cell, HEK293 cell, A549 cell, BHK cell, BSC-1 cell, BSC-40 cell, Vero cell, Sf’c9 cell, Sf -21 cell, Tn-368 cell, BTI-Tn-5Bl-4 (High-Five) cell, Saos cell, C2C12 cell, L cell, HT1080 cell, HepG2 cell, WEHI cell, 3T3 cell, 10T1 / 2 cell, MDCK cell, BMT-10 cell, WI38 cell, or primary fibroblast, hepatocyte or myoblast cells derived from mammals. In some embodiments, the host cell is a mammalian cell. In some embodiments, PROIO™ cell line (AskBio, NC, USA), a suspension-adapted and serum-free cell line derived from the human embryonic kidney cell line 293 (HEK293), can be used to produce the recombinant virus, e.g., rAAV particles.

[0416] It is noted that a recombinant viral particle, e.g., rAAV can be produced from a host or producer cell using any suitable method known in the art. In order to achieve maximum production of viral, e.g., rAAV capsid particles, the host cells can be cultured for a few hours to several days. In some embodiments, the host cells are cultured for at least 10 hours. For example, the host cells can be cultured for at least 11 hours, at least 12 hours, at least 13 hours, at least 14 hours, at least 15 hours, at least 16 hours, at least 17 hours, at least 18 hours, at least 19 hours, at least 20 hours, at least 21 hours, at least 22 hours, at least 23 hours, at least 24 hours, at least 25 hours, at least 26 hours, at least 27 hours, at least 28 hours, at least 29 hours, at least 30 hours, at least 31 hours, at least 32 hours, at least 33 hours, at least 34 hours, at least 35 hours, at least 36 hours, at least 37 hours, at least 38 hours, at least 39 hours, at least 40 hours, at least 41 hours, at least 42 hours, at least 43 hours, at least 44 hours, at least 45 hours, at least 46 hours, at least 47 hours, at least 48 hours, at least 49 hours, at least 50 hours, at least 51 hours, at least 52 hours, at least 53 hours, at least 54 hours, at least 55 hours, at least 56 hours, at least 57 hours, at least 58 hours, at least 59 hours, at least 60 hours, at least 61 hours, at least 62 hours, at least 63 hours, at least 64 hours, at least 65 hours, at least 66 hours, at least 67 hours, at least 68 hours, at least 69 hours, at least 70 hours, at least 71 hours, at least 72 hours, at least 73 hours, at least 74 hours, at least 75 hours, at least 76 hours, at least 77 hours, at least 78 hours, at least 79 hours, at least 80 hours, at least 81 hours, at least 82 hours, at least 83 hours, at least 84 hours, at least 85 hours, at least 86 hours, at least 87 hours, at least 88 hours, at least 89 hours, at least 90 hours, at least 91 hours, at least 92 hours, at least 93 hours, at least 94 hours, at least 95 hours, at least 96 hours, at least 97 hours, at least 98 hours, at least 99 hours, at least 100 hours or more.

[0417] In some embodiments, the host cells can be cultured in suspension and / or under serum free conditions. The host cells can be cultured in animal component-free conditions. The animal component-free medium can be any animal component-free medium (e.g., serum-free medium)compatible with a given cell line, for example, HEK293 cells. Examples include, without limitation, SFM4Transfx-293 (HYCLONE), Ex-Cell 293 (JRH BIOSCIENCES), LC-SFM (INVITROGEN), and Pro293-S (LONZA) Pro- 10 cells (as described in US Patent No. 9,441,206, content of which is incorporated herein by reference in its entirety.

[0418] Generally, the copy number of the polynucleotide described herein, that is used to produce recombinant virus e.g., rAAV, is at least about 2000 copies per cell to at least about 20,000 copies per cell. For example, the copy number of the polynucleotide, that is used to produce recombinant virus e.g., rAAV, is at least about 5000 copies per cell to at least about 12000 copies per cell. In some embodiments, the copy number of the polynucleotide, that is used to produce recombinant virus e.g., rAAV, is at least about 1000 copies per cell, at least about 1500 copies per cell, at least about 2000 copies per cell, at least about 2500 copies per cell, at least about 3000 copies per cell, at least about 3500 copies per cell, at least about 4000 copies per cell, at least about 4500 copies per cell, at least about 5000 copies per cell, at least about 5500 copies per cell, at least about 6000 copies per cell, at least about 6500 copies per cell, at least about 7000 copies per cell, at least about 7500 copies per cell, at least about 8000 copies per cell, at least about 8500 copies per cell, at least about 9000 copies per cell, at least about 9500 copies per cell, at least about 10000 copies per cell, at least about 12000 copies per cell, at least about 14000 copies per cell, at least about 16000 copies per cell, at least about 18000 copies per cell, at least about 20000 copies per cell or higher.

[0419] The host cells can be transfected with one or more nucleic acids, e.g., polynucleotide described herein to produce the recombinant virus, e.g., rAAV virus particles. Thus, in some embodiments, the method of manufacturing viral, e.g., rAAV particles comprises: (a) transfecting host cells with: i) a polynucleotide described herein; ii) a nucleic acid comprising a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and iii) a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR); and (b) culturing the transfected host cells for a sufficient period of time to produce rAAV capsid particles.

[0420] As used herein, “transfection” refers to the insertion of a nucleic acid into a target cell, e.g., ahost cell. There are two different types of transfection: (i) stable transfection and (ii) transient transfection. Stable transfection incorporates exogenous nucleic acids into the transfected cell’s genome whereas in transient transfection, the exogenous nucleic acids are present only for a limited time in the cell and do not integrate with the transfected cell’s genome. In some embodiments, the transfection method used is transient transfection. In some embodiments, the transfection methodused is stable transfection. Transfection can be performed with a variety of methods including, but not limited to, calcium phosphate, electroporation, and / or cationic lipid-mediated methods (e.g., LIPOFECTAMINE, polyethylenimine (PEI)). In some embodiments, the transfection method uses polyethylenimine. Transfection can require an optimal cell density based on the cell type, application, and / or transfection technology. Additional description of transfection can be found in Shin et al. Recombinant Adeno-Associated Viral Vector Production and Purification. Methods Mol Biol. 2012; 798: 267-284; Grieger et al. Production of Recombinant Adeno-associated Virus Vectors Using Suspension HEK293 Cells and Continuous Harvest of Vector from the Culture Media for GMPFIX and FLT1 Clinical Vector. Mol Then 2016 Feb; 24(2): 287-297; and Meier et al. The Interplay between Adeno-Associated Virus and Its Helper Viruses. Viruses. 2020 Jun; 12(6): 662, contents of each of which are incorporated herein by reference in their entireties.

[0421] Transfection of multiple nucleic acids into the same cells can occur simultaneously or it can occur within 5 minutes, within 10 minutes, within 15 minutes, within 20 minutes, within 25 minutes, within 30 minutes, within 35 minutes, within 40 minutes, within 45 minutes, within 50 minutes, within 60 minutes, within 65 minutes, within 70 minutes, within 75 minutes, within 80 minutes, within 85 minutes, within 90 minutes, within 95 minutes, within 100 minutes, within 110 minutes, within 120 minutes, within 130 minutes, within 140 minutes, within 150 minutes, within 160 minutes, within 170 minutes, within 180 minutes, within 190 minutes, within 200 minutes, within 210 minutes, within 220 minutes, within 230 minutes, within 240 minutes, within 250 minutes, within 260 minutes, within 270 minutes, within 280 minutes, within 290 minutes, within 300 minutes, within 310 minutes, within 320 minutes, within 330 minutes, within 340 minutes, within 350 minutes, within 360 minutes or more between transfection of the first nucleic acid and transfection of subsequent nucleic acids.

[0422] Without wishing to be bound by a theory, where the polynucleotides described herein are used as one of the nucleic acids (e.g., plasmids) in transient transfection system using two, three, or more nucleic acids (e.g., plasmids), the polynucleotide or component thereof can be stably integrated in the host cell, e.g., AAV producer cell.

[0423] As one of skill in the art is aware, a sufficient cell mass is needed for transfection. As used herein, “sufficient cell mass” refers to an optimal cell density for transfection, based on the cell type, application, and / or transfection technology. In some embodiments, the cells can be transfected at a cell density of from about 1 xl06to about 8x107viable cells / ml. In some embodiments, transfected cells are expanded to produce sufficient cell mass to seed a bioreactor from at least a 25L scale.

[0424] In some embodiments, the method further comprises harvesting the cell culture or cell culture supernatant and / or clarifying the cell culture or cell culture supernatant to produce a harvestmedia comprising recombinantly expressed virus, e.g., rAAV particles. In some embodiments, the method comprises a step of lysing a host cell in the cell culture or cell culture supernatant prior to clarification. Thus, in some embodiments, the method comprises: (a) transfecting host cells with: i) a polynucleotide described herein; ii) a nucleic acid comprising a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and iii) a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR); (b) culturing the transfected host cells for a sufficient period of time to produce rAAV capsid particles; and (c) lysing a host cell in the cell culture or cell culture supernatant.

[0425] As described herein, the polynucleotide described herein can comprise a nucleic acid comprising a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes. Thus, in some embodiments, the method comprises: (a) transfecting host cells with: i) a polynucleotide described herein, wherein the polynucleotide further comprises a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and non-structural replication (e.g., AAV Rep) genes; and iii) a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR); (b) culturing the transfected host cells for a sufficient period of time to produce rAAV capsid particles; and (c) lysing a host cell in the cell culture or cell culture supernatant. For example, the method comprises: (a) transfecting host cells with: i) a polynucleotide described herein, wherein the polynucleotide further comprises a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and non-structural replication (e.g., AAV Rep) genes, and a stuffer sequence, optionally present in the nucleotide sequence encoding the non-structural replication (e.g., AAV Rep) genes; and iii) a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR); (b) culturing the transfected host cells for a sufficient period of time to produce rAAV capsid particles; and (c) lysing a host cell in the cell culture or cell culture supernatant.

[0426] Methods and compositions for lysing host cells are well known in the art. For example, a surfactant, e.g., a non-ionic surfactant, can be added to the cell culture or cell culture supernatant for lysing a host cell present therein. Generally, the non-ionic surfactant is added to the cell culture or cell culture supernatant to a final concentration of at least about 0.05%, 0.1%, 0.15%, 0.2%, 0.25%, 0.3%, 0.35%, 0.4%, 0.45%, 0.5%, 0.55%, 0.6%, 0.65%, 0.7%, 0.75%, 0.8%, 0.85%, 0.9%,0.95%, 1% (w / v, w / w or v / v) or higher. For example, the non-ionic surfactant is added to the cell culture or cell culture supernatant to a final concentration of from about 0.05% to about 1%, from about 0.1% to about 0.95%, from about 0.15% to about 0.9%, from about 0.2% to about 0.85%, from about 0.25% to about 0.8%, from about 0.3% to about 0.75%, from about 0.35% to about 0.65% from about 0.4% to about 0.6% or from 0.45% to about 0.55%. In some embodiments, the non-ionic surfactant is added to the cell culture or cell culture supernatant to a final concentration of about 0.05%, 0.1%., about 0.15%, about 0.2%, about 0.25%, about 0.3%, about 0.35%, about 0.4%, about 0.45%, about 0.5%, about 0.55%, about 0.6%, about 0.65%, about.7%, about 0.75%, about 0.8%, about 0.85%, about 0.9%, about 0.95%, or about 1%. For example, the non-ionic surfactant can be added to the cell culture or cell culture supernatant to a final concentration of about 0.5%.

[0427] After addition, the the non-ionic surfactant is allowed to mix with the cell culture or cell culture supernatant for a sufficient period of time to lyse host cells present in the cell culture or cell culture supernatant. For example, the non-ionic surfactant is mixed with the cell culture or cell culture supernatant for a period of from about 15 minutes to about 2 hours. In some embodiments, the non-ionic surfactant is mixed with the cell culture or cell culture supernatant for a period of from about 30 minutes to about 60 minutes. The mixing can be at ambient temperature or an elevated temperature. For example, the mixing with the non-ionic surfactant can be at a temperature from about 15°C to about 37°C. In some embodiments, the mixing with the non-ionic surfactant can be at a temperature of about 18°C, 19°C, 20°C, 21°C, 22°C, 23°C, 24°C, 25°C, 26°C, 27°C, 28°C, 28°C, 30°C, 31°C, 32°C, 33°C, 34°C, 35°C, 36°C, or 37°C.

[0428] It is noted that, any desired non-ionic surfactant can be used for lysing the host cells. Exemplary non-ionic surfactants and classes of non-ionic surfactants for lysing host cells can include polyarylphenol polyethoxy ethers; polyalkylphenol polyethoxy ethers; polyglycol ether derivatives of saturated fatty acids; polyglycol ether derivatives of unsaturated fatty acids; polyglycol ether derivatives of aliphatic alcohols; polyglycol ether derivatives of cycloaliphatic alcohols; fatty acid esters of polyoxyethylene sorbitan; alkoxylated vegetable oils; alkoxylated acetylenic dials; polyalkoxylated alkylphenols; fatty acid alkoxylates; sorbitan alkoxylates; sorbitol esters; C8 to C22 alkyl or alkenyl polyglycosides; polyalkoxy styrylaryl ethers; alkylamine oxides; block copolymer ethers; polyalkoxylated fatty glyceride; polyalkylene glycol ethers; linear aliphatic or aromatic polyesters; organo silicones; polyaryl phenols; sorbitol ester alkoxylates; and mono- and diesters of ethylene glycol and mixtures thereof; ethoxylated tri styrylphenol; ethoxylated fatty alcohol; ethoxylated lauryl alcohol; ethoxylated castor oil; and ethoxylated nonylphenol; alkoxylated alcohols, amines or acids. In some embodiments of any one of the aspects, the the non-ionic surfactant for lysing the host cells is selected from the group consistingof polyoxyethylene fatty alcohol ethers, polyoxyethylene alkylphenyl ethers, polyoxyethylenepolyoxypropylene block copolymers, alkylglucosides, alkylphenol ethoxylates, preferably polysorbates, polyoxyethylene alkyl phenyl ethers, and any combinations thereof. Specific exemplary non-ionic surfactants for lysing host cells include, but are not limited to, ECOSURF EH-9, polysorbates (such as polysorbate 20 (TWEEN 20), polysorbate 28, polysorbate 40, polysorbate 60, polysorbate 65, polysorbate 80, polysorbate 81, and polysorbate 85), ECOSURF EH- 14, TWEEN 60 nonionic detergent, PPG-PEG-PPG Pluronic 10R5, Polyoxyethylene (18) tri decyl ether, Polyoxyethylene (12) tri decyl ether, MERPOL SH surfactant, MERPOL OJ surfactant, MERPOL HCS surfactant, IGEPAL CO-720, IGEPAL CO-630, IGEPAL CA-720, Bnj S20, BnjSlO, Brij 010, Bnj CIO, BRIJ 020, TERGITOL 15-S-7, ECOSURF SA-15, TERGITOL15-S-9, TERGITOL 15-S-12, TERGITOL L-64, TERGITOLNP-7, TERGITOL NP-8, TERGITOL NP-9, TERGITOL NP-9.5, TERGITOL NP-10, TERGITOL NP-11, TERGITOL NP-12, and TERGITOLNP-13 and any combinations thereof. Preferably, the non-onic surfactant for lysing host cells is not Triton X-100.

[0429] In some embodiments, a zwitterionic surfactant can be added to the cell culture or cell culture supernatant for lysing the host cell. Exemplary zwitterionic surfactants include, but are not limited to, sulfonates, such as CHAPS (3-[(3-Cholamidopropyl)dimethylammonio]-l-propanesulfonate), CHAPSO (3-{(3-cholamidopropyl)dimethylammonio}-2-hydroxy-l-propane-sulfonate), 3 -(decyldimethylammonio)propanesulfonate, 3 -(dodecyldimethylammonio) propanesulfonate, 3 -(N, N-dimethylmyristylammonio)propanesulfonate, 3 -(N, N-dimethyl octadecylammonio)propanesulfonate, 3-(N, N-dimethyloctylammonio) propanesulfonate, and 3-(N, N dimethylpalmitylammonio)propanesulfonate; sultaines, such as cocamidopropyl hydroxysultaine; betaines, e.g., cocamidopropyl betaine; and phosphates, such as lecithin.

[0430] In some embodiments, the surfactant, e.g., the zwitterionic surfactant can be an amine oxide surfactant. For example, an amine oxide surfactant can be added to the cell culture or cell culture supernatant for lysing the host cell. An amine oxide surfactant that can be used in methods described herein can be a trialkyl amine N-oxide, e.g., an amine oxide of formula R'R2R3NO, wherein R1is a substituted or unsubstituted alkyl or alkenyl containing from about 8 to about 30 carbon atoms; and R2and R3are independently substituted or unsubstituted alkyl or alkenyl groups containing from about 1 to about 18 carbon atoms. Non limiting examples of trialkyl amine N-oxide and trialkyl amine N-oxide surfactants of use are described in WO1998055581, which is incorporated herein by reference in its entirety.

[0431] In some embodiments, the method does not comprise a step of lysing a host cell prior to clarification.

[0432] The cell culture or cell culture supernatant may comprise impurities, e.g., host cell DNA(hcDNA). Therefore, the method can comprise a step, e.g., apost-lysis step of removing or reducing the amount of impurities, e.g., hcDNA from the cell culture or cell culture supernatant. Methods and compositions for reducing the amount of host cell DNA cell cultures or cell culture supernatants are well known in the art. For example, a cationic amine or nuclease can be added to the cell culture or cell culture supernatant. In some embodiments, the step of removing or reducing the amount of impurities comprise adding a selective precipitation agent to reduce or remove impurities such as hcDNA from the cell culture or cell culture supernatant. As used herein, a “selective precipitation agent” refers to any agent, compound or such which, when added to a preparation comprising a population of recombinant virus particles and contaminating nucleic acid molecules, will affect the selective precipitation of at least a substantial amount of contaminating nucleic acid molecules away from the recombinant virus particles. Exemplary agents for adding to the cell culture or cell culture supernatant in the post-lysis step include, but are not limited to cetyl trimethylammonium bromide, cetylpyridinium chloride, benzethonium chloride, tetradecyltrimethyl-ammonium chloride, polyethylene imine and combinations thereof.

[0433] In some embodiments, a nuclease, e.g., an endonuclease is added to the cell culture or cell culture supernatant for reducing or removing impurities such as hcDNA. Exemplary endonucleases include endonucleases derived from both Prokaryotes and Eukaryotes. In some embodiments, the nuclease is BENZONASE® or a salt active nuclease (SAN). Generally, the nuclease is added to the cell culture or cell culture supernatant to a final concentration of at least about 0.05%, 0.1%., 0.15%, 0.2%, 0.25%, 0.3%, 0.35%, 0.4%, 0.45%, 0.5%, 0.55%, 0.6%, 0.65%, 0.7%, 0.75%, 0.8%, 0.85%, 0.9%, 0.95%, 1% (w / v, w / w or v / v) or higher. For example, the nuclease is added to the cell culture or cell culture supernatant to a final concentration of from about 0.05% to about 1%, from about 0.1% to about 0.95%, from about 0.15% to about 0.9%, from about 0.2% to about 0.85%, from about 0.25% to about 0.8%, from about 0.3% to about 0.75%, from about 0.35% to about 0.65% from about 0.4% to about 0.6%, from 0.45% to about 0.55% from about 0.05% to about 0.4%, or from about 0.2% to about 0.4%. In some embodiments, the nuclease is added to the cell culture or cell culture supernatant to a final concentration of about 0.05%, 0.1%., about 0.15%, about 0.2%, about 0.25%, about 0.3%, about 0.35%, about 0.4%, about 0.45%, about 0.5%, about 0.55%, about 0.6%, about 0.65%, about.7%, about 0.75%, about 0.8%, about 0.85%, about 0.9%, about 0.95%, or about 1%. For example, the nuclease can be added to the cell culture or cell culture supernatant to a final concentration of about 0.2%. In some embodiments, the nuclease can be added to the cell culture or cell culture supernatant to a final concentration of about 0.05% to about 0.4%.

[0434] After adding, the agent or nuclease is allowed to mix with the cell culture or cell culture supernatant for a period of about 15, 20, 30, 35, 40, 45, 50, 55 minutes or longer. In someembodiments, the agent or nuclease is allowed to mix with the cell culture or cell culture supernatant for a period of from about 10 minutes to about 4 hours. For example, the agent or nuclease is mixed with the cell culture or cell culture supernatant for a period of from about 15 minutes to about 3 hours. In some embodiments, the agent or nuclease is mixed with the cell culture or cell culture supernatant for a period of from about 30 minutes to about 120 minutes. For example, the agent or nuclease is mixed with the cell culture or cell culture supernatant for a period of about 30 minutes.

[0435] In some embodiment, the method further comprises a step of clarifying the cell culture or cell culture supernatant. For example, the method comprises a step of clarifying the cell culture or cell culture supernatant by depth filtration to produce the clarified composition (e.g., harvest media) comprising recombinantly expressed virus, e.g., rAAV particles. Thus, in some embodiments, the method comprises: (a) transfecting host cells with: i) a polynucleotide described herein; ii) a nucleic acid comprising a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and iii) a nucleic acid encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising nucleic acid encoding a transgene, optionally flanked by L-ITR and / or R-ITR); (b) culturing the transfected host cells for a sufficient period of time to produce rAAV capsid particles; and (c) optionally, lysing a host cell in the cell culture or cell culture supernatant; and (d) clarifying the cell culture or cell culture supernatant, e.g., by depth filtration to produce a harvest media comprising recombinantly expressed virus, e.g., rAAV particles

[0436] Exemplary depth filters for use include, but are not limited to, CUNO® Zeta PLUS® Delipid filters, CUNO® Emphaze AEX filters, CUNO® 30 / 60ZA filters, CUNO® 90ZB08A filters, CUNO® DELI08A Delipid filters, and CUNO® DELIP08A Delipid plus filters (3M, St. Paul, Minn.), Clansolve® grade 60HX, 40MS, 20MS, MillistakF® HC grade C0HC, D0HC, A1HC, B1HC, X0HC, F0HC, MillistakF® HC Pro grade D0SP, C0SP, and X0SP Milhpore filters (EMD Millipore, Billerica, Mass.), and Sartopore® bi-layer filter cartridges.

[0437] Without wishing to be bound by a theory, at least about 15% of the viral, e.g., rAAV capsid particles in the harvest media (e.g., the clarified cell culture or clarified cell culture supernatant) comprising recombinantly expressed virus, e.g., rAAV particles are full capsid particles. In certain embodiments, at least about 18% of the viral, e.g., rAAV capsid particles in the harvest media are full capsid particles. For example, at least about 20%, at least about 22%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, or a higher percentage of the viral, e.g., rAAV capsid particles in the harvest media are full capsid particles.

[0438] A “filled particle” or “full particle” (also interchangeably referred to as “full AAV particle,” “full AAV capsid particle”, or “full rAAV capsid particle”) refers to a viral particle that comprises an intact viral particle (e...

Claims

1. CLAIMSWhat is claimed is:

1. A polynucleotide comprising a nucleotide sequence encoding:a. an adenoviral E2a region;b. an adenoviral E4 region; andc. an adenoviral virus associated (VA) RNA region, andwherein the polynucleotide does not comprise a nucleotide sequence encoding at least 1 (e.g., 2, 3, 4, or all 5) of:a full length adenoviral L4-100K protein or a portion thereof;a full length adenoviral L5 fiber protein or a portion thereof;a full length adenoviral pVIII protein or a portion thereof;a full length adenoviral L1-52K / 55K protein or a portion thereof; anda full length adenoviral precursor terminal protein (pTP) or a portion thereof; and wherein the polynucleotide comprises at least one (e.g., 1, 2, 3, 4, 5, 6 or all 7) of:a deletion of G3 and G4 in a nucleotide sequence encoding an adenoviral L-22K protein (e.g., SEQ ID NO: 103) and / or a L-33K protein (e.g., SEQ ID NO: 104);a deletion of G3 and G4 in a nucleotide sequence encoding an adenoviral L4-100K protein (e.g., SEQ ID NO: 105);a deletion of G3 in a nucleotide sequence encoding adenoviral pVIII protein (e.g., SEQ ID NO: 106);a ACTT mutation at positions 149-150 of a nucleotide sequence encoding adenoviral pVIII protein (e.g., SEQ ID NO: 106);a deletion of G3 in a nucleotide sequence encoding adenoviral fiber protein (e.g., SEQ ID NO: 107);aCT mutation at position 503 of a nucleotide encoding adenoviral L5 fiber protein (e.g., SEQ ID NO: 107); anda TA CG mutation at positions 1692-1693 of a nucleotide encoding adenoviral L5 fiber protein (e.g., SEQ ID NO: 107).

2. The polynucleotide of claim 1, wherein the polynucleotide comprises:a. a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 5;b. a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO: 6; c. a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO: 4; d. a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO: 3; e. a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO: 2; or f. a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO:

1. preferably the polynucleotide comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%. at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 5.

3. The polynucleotide of any one of claims 1-2, wherein:a. the polynucleotide does not compri se ucl eoti des 26197-26198 rel h ve to Genbank Accession Number AC 000008;b. the polynucleotide does not comprise nucleotides 24063-24064 relative to Genbank Accession Number AC_000008;c. the polynucleotide does not comprise nucleotide 27176 relative to Genbank Accession Number AC 000008,d. the polynucleotide comprises ACTT mutation at positions 27322-27324 relative to Genbank Accession Number AC 000008;e. the polynucleotide does not comprise nucleotide 31024 relative to Genbank Accession Number AC 000008;f. the polynucleotide comprises C -> T mutation at positions 31544 relative to Genbank Accession Number AC_000008; and / org. the polynucleotide comprises TA CG mutation at positions 32733-32734 relative to Genbank Accession Number AC_000008.

4. The polynucleotide of any one of claims 1-3, wherein the polynucleotide does not comprise a nucleotide sequence encoding a protein comprising, e.g., at its N-terminus an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94 or 95.

5. The polynucleotide of claim 1. wherem the polynucleotide does not comprise a nucleotide sequence encoding: (i) full length adenoviral L4-22K protein or a portion thereof; and / or (ii) full length adenoviral L4-33K protein or a portion thereof. te6. The polynucleotide of claim 5. wherem the polynucleotide comprises a nucleotide sequence encoding a less than full length fragment of adenoviral L4-22K protein and / or a less than full length fragment of adenoviral L4-33K protein, i.e., polynucleotide comprises a nucleotide sequence encoding a truncated adenoviral L4-22K protein and / or a nucleotide sequence encoding a truncated adenoviral L4-33K protein.

7. The polynucleotide of claim 5 or 6, wherein:a. the polynucleotide comprises a nucleotide sequence encoding a protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91 To, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%. at least 97%, at least 98%, at least: 99% or 100%) identity to SEQ ID NO: 92 or 93, and wherein the protein does not comprise, e.g., at its N-terminus an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94 or 95; b. the polynucleotide comprises a nucleotide sequence encoding a protein cornprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 92 or 93, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a full length adenoviral L4-22K protein having the ammo acid sequence SEQ ID NO: 7;c. the polynucleotide comprises a nucleotide sequence encoding a protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 90 or 91, and wherein the protein does not comprise at its N-terminus an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 94 or 95; or d. wherein the polynucleotide comprises a nucleotide sequence encoding a protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 90 or 91, and wherein the polynucleotide does not comprise a nucleotide sequence encoding a full-length adenoviral L4-33K protein having the ammo acid sequence SEQ ID NO: 8.

8. The polynucleotide of claim 1, wherein:a. the polynucleotide does not comprise a nucleotide sequence encoding a full length L4-I00K protein or a portion thereof, optionally, the full-length L4-100K protein has the ammo acid sequence SEQ ID NO: 9;b. the polynucleotide does not comprise a nucleotide sequence encoding a full- length L5 fiber protein or a portion thereof, optionally, the full-length L5 fiber protein has the amino acid sequence SEQ ID NO: 10,c. the polynucleotide does not comprise a nucleotide sequence encoding a full length pVIH protein or a portion thereof, optionally, the full-length pVIII protein has the amino acid sequence SEQ ID NO: 11,d. the polynucleotide does not comprise a nucleotide sequence encoding aLl- 52K / 55K protein or a portion thereof, optionally, the full length L1-52K / 55K protein has the amino acid sequence SEQ ID NO: 12, and / ore. the polynucleotide does not comprise a nucleotide sequence encoding a pTP or a portion thereof, optionally the full-length pTP has the amino acid sequence SEQ ID NO: 13.

9. The polynucleotide of claim 1, wherein:a. the polynucleotide does not comprise a nucleotide sequence encoding:a full length adenoviral E3 region or a portion thereof;a full length adenoviral U exon protein promoter or a portion thereof;a full length adenoviral U exon protein exon 1 or a portion thereof;a full length L4-100K protein or a portion thereof;a full length L1-52K / 55K protein or a portion thereof;a full length L4-33K protein or a portion thereof;a full length L4-22K protein or a portion thereof;a full length L5 fiber protein or a portion thereof;a full length pVIII protein or a portion thereof; anda full length pTP or a portion thereof,optionallythe polynucleotide does not comprise a nucleotide sequence encoding: a full length adenoviral E3 region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 21 or having at least 80% (e.g., at least 85%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 21, or a portion thereof;a full length adenoviral U exon protein promoter 1 comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 101 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 101, or a portion thereof;a full length adenoviral UXP exon 1 comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 102 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 102, or a portion thereof;a full length L4-100K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least97%, at feast 98%, at least 99% or 100%) identity to SEQ ID NO: 9, or a portion thereof;a full length L1-52K / 55K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 13, or a portion thereof;a full length L4-33K protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8, or a portion thereof;a full length L4-22K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7, or a portion thereof;a full length L5 fiber protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 10, or a portion thereof;a full length pVIII protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, ai least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 11, or a portion thereof; anda full length pTP protein comprising an ammo acid sequence having at least 80% (e g., at least 85%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 13, or a portion thereof;b. the polynucleotide does not comprise a nucleotide sequence encoding:a full length L4-100K protein or a portion thereof;a full length L1-52K / 55K protein or a portion thereof;a full length L4-33K protein or a portion thereof;a full length L4-22K protein or a portion thereof;a full length L5 fiber protein or a portion thereof;a full length pVIII protein or a portion thereof; anda full length pTP or a portion thereof,optionallythe polynucleotide does not comprise a nucleotide sequence encoding:a full length L4 100K protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 9, or a portion thereof;a full length L1-52K / 55K protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%. at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 13, or a portion thereof;a full length L4-33K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8, or a portion thereof;a full length L4-22K protein comprising an am o acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7, or a portion thereof;a full length L5 fiber protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%. at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 10, or a portion thereof;a full length pVIII protein comprising an amnio acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, atleast 98%, at least 99% or 100%) identity to SEQ ID NO: 11, or a portion thereof; anda full length pTP protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at feast 1%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 13, or a portion thereof;c. the polynucleotide does not comprise a nucleotide sequence encoding:a full length adenoviral E3 region or a portion thereof;a full length adenoviral U exon protein (UXP) exon 1 or a portion thereof; a full length 1. -100K protein or a portion thereof;a full length L1-55K protein or a portion thereof;a full length L4-33K protein or a portion thereof;a full length L4-22K protein or a portion thereof;a full length L5 fiber protein or a portion thereof;a full length pVIII protein or a portion thereof; anda full length pTP or a portion thereof,optionally,the polynucleotide does not comprise a nucleotide sequence encoding:a full length adenoviral E3 region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity' to SEQ ID NO: 21 or having at least 80% (e.g., at least 85%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 21, or a portion thereof;a full length adenoviral UXP exon 1 comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 102 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identityto a nucleotide sequence complementary to SEQ ID NO:

102. or a portion thereof:a full length L4-100K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 9, or a portion thereof;a full length L1-52K / 55K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 13, or a portion thereof;a full length L4-33K protein compri ing an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8, or a portion thereof;a full length L4-22K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7, or a portion thereof;a full length L5 fiber protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 10, or a portion thereof;a full length pVIII protein comprising an amino acid sequence having at least 80% (e.g., at least 85%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 11, or a portion thereof; anda full length pTP protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, atleast 98%, at least 99% or 100%) identity to SEQ ID NO:13, or a portion thereof; ord. the polynucleotide comprises a nucleotide sequence encoding;a full-length L4-33K protein; anda full-length L4-22K protein, andwherein the wherein the polynucleotide does not comprise a nucleotide sequence encoding:a full length adenoviral E3 region or a portion thereof;a full length adenoviral U exon protein promoter or a portion thereof; a full length adenoviral U exon protein exon 1 or a portion thereof;a full length I 4 - 100K protein or a portion thereof;a full length L1-55K protein or a portion thereof;a Full length L5 fiber protein or a portion thereof;a full length pVIII protein or a portion thereof; anda full length pTP or a portion thereof,option ally.the polynucleotide comprises a nucleotide sequence encoding:a L4-33K protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91 %, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 8, or a portion thereof; anda L4-22K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 7, or a portion thereof; andthe polynucleotide does not comprise a nucleotide sequence encoding: a full length adenoviral E3 region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 21 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or100%) identity to a nucleotide sequence complementary to SEQ ID NO: 21, or a portion thereof;a full length adenoviral U exon protein promoter 1 comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO: 101 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 101, or a portion thereof;a full length adenoviral UXP exon 1 comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 102 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 102, or a portion thereof;a full length 1,4-100K protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 9, or a portion thereof;a full length L1-52K / 55K protein comprising an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 13, or a portion thereof;a full length L5 fiber protein comprising an amino acid sequence having at least 80% (e.g., at least 85%. at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 10, or a portion thereof;a full length pVIII protein comprising an ammo acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 11, or a portion thereof; anda full length pTP protein comprising an ammo acid sequence having at least 80% (e.g.. at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%. at least 98%, at least 99% or 100%) identity to SEQ ID NO: 13, or a portion thereof.

10. The polynucleotide of any one of claims 1-9, wherein:a. the polynucleotide does not compri e a nucleotide sequence encoding an adenoviral E3 region or a portion thereof,optionallythe polynucleotide does not comprise a nucleotide sequence encoding:i. an adenoviral E3 12.5k protein or a portion thereof, e.g., a protein having the amino acid sequence SEQ ID NO: 14;u. encoding an adenoviral E3 CR1 -alpha protein or a portion thereof, e.g., a protein having the amino acid sequence SEQ ID NO: 15;lit. an adenoviral E3 gpl9k protein or a portion thereof, e.g., a protein having the amino acid sequence SEQ ID NO: 16;iv. an adenoviral E3 10.5kd protein or a portion thereof, e.g., a protein having the amino acid sequence SEQ ID NO: 17;v. an adenoviral E3 RID-alpha protein or a portion thereof, e.g., a protein having the amino acid sequence SEQ ID NO: 18;vi. an adenoviral E3 RID-beta protein, e.g., a protein having the amino acid sequence SEQ ID NO: 19; and / orvii. an adenoviral E3 14.7k protein or a portion thereof, e.g., a protein having the amino acid sequence SEQ ID NO: 20;b. the polynucleotide comprises a nucleotide sequence encoding an adenoviral E3 region, and wherein the E3 region comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 21 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, atleast 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a nucleotide sequence complementary to SEQ ID NO: 21;and / orc. the polynucleotide does not comprise a nucleotide sequence encoding:i. an adenoviral El region or a portion thereof;ii. an adenoviral protease or a portion thereof, optionally the protease has the amino acid sequence SEQ ID NO: 49,in. an adenoviral E 1 a protein 13 S or a portion thereof, optionally the E 1 a protein 13 S has the amino acid sequence SEQ ID NO: 50,iv. an adenoviral El a protein 12S or a portion thereof, optionally the El a protein 12S has the amino acid sequence SEQ ID NO: 51;v. an adenoviral El a protein 11 S or a portion thereof, optionally the E l a protein 1 IS has the amino acid sequence SEQ ID NO: 52;vi. the polynucleotide does not comprise a nucleotide sequence encoding an adenoviral El a protein 10S or a portion thereof, optionally the El a protein 10S has the amino acid sequence SEQ ID NO: 53;vat. an adenoviral El a protein 9S or a portion thereof, optionally the E I a protein 9S has the amino acid sequence SEQ ID NO: 54;vrii. an adenoviral E l b protein 19K or a portion thereof, optionally the Elb protein 19K has the amino acid sequence SEQ ID NO: 55:ix. an adenoviral Elb protein 55K or a portion thereof, optionally the El b protein 55K has the ammo acid sequence SEQ ID NO: 56;x an adenoviral hexon protein or a portion thereof, optionally the hexon protein has the amino acid sequence SEQ ID NO: 57; and / orxi. an adenoviral peripemonal hexomassociated protein or a portion thereof, optionally the peripentonal hexon-associated protein has the ammo acid sequence SEQ ID NO: 58.

11. The polynucleotide of any one of claims 1-10, wherein the VA RNA region is flanked on each side by at least one restriction site, optionallya the polynucleotide comprises at least 2, e.g., 3, 4, 5 or more restriction sites upstream of the VA RNA region;b. the polynucleotide comprises at least one restriction site downstream of the VA RNA region, and wherein the restriction site is between the VA region and the E2a region; and / orc. the polynucleotide comprises at least one restriction site downstream of the E4 region.

12. The polynucleotide of any one of claims 1-11, wherein:a. the polynucleotide comprises a nucleotide sequence encoding a polyadenylation (poly A) site, optionallyi. the poly A site is upstream of the VA RNA region;ii. the poly A site comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 22 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 22;iii. the poly A site is flanked by at least one restriction site on each side; iv. the polynucleotide comprises at least three restriction sites upstream of the poly A site; and / orv the polynucleotide comprises at least one restriction site downstream of the poly A site, and wherein the at least one restriction site is between the poly A site and the VA region.; and / orb the polynucleotide comprises at least one inverted terminal repeat (ITR) sequence, optional iyi. the polynucleotide comprises at least one inverted terminal repeat (ITR) sequence upstream of the E4 region; and / orii. the ITR comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or I 00%) identity to SEQ ID NO: 23 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 23.

13. The polynucleotide of any one of claims 1-12, wherein:a. the VA RNA region comprises a VA RNA I region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, atleast 98%, at least 99% or 100%) identity to SEQ ID NO: 24 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 24;b. the VA RNA region comprises a VA RNA II region comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 25 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 25 and / or c. the VA region comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 26 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 2614. The polynucleotide of any one of claims 1-13, wherein:a. the E2a region comprises a nucleotide sequence encoding an adenoviral DNA binding protein (DBP), optionallyi. the E2a region comprises a nucleotide sequence encoding an adenoviral DNA binding protein (DBP) and having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 27or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 27; and / or ii. the E2a region comprises a nucleotide sequence encoding a DNA binding protein (DBP) having the amino acid sequence SEQ ID NO: 28;b. the E2a region comprises an adenoviral U exon protein (UXP) exon 3 sequence, optionally the E2a region comprises an adenoviral UXP exon 3 sequence having at least 8% identity' to SEQ ID NO: 29 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%,at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 29;c. the E2a region comprises an adenoviral E2a exon2 / leader sequence, optionally the E2a region comprises an adenoviral E2a exon2 / leader sequence comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 30 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 30;d. the E2a region comprises an adenoviral UXP exon 2 sequence, optionally the E2a region comprises an adenoviral UXP exon 2 sequence comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 30 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 30;e. the E2a region comprises an adenoviral E2a late promoter sequence, optionally the E2a region comprises an adenoviral E2a late promoter sequence comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 31 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 31;f. the E2a region comprises an adenoviral E2a exon 1 sequence, optionally the E2a region comprises an adenoviral E2a exon 1 sequence comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 32 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 32;g. the E2a region is under the control of one or more of promoters, optionally the promoter is not a chicken 6-actm promoter or a SV40 promoter;h. the E2a region comprises an adenoviral E2a early promoter sequence, optionally i. the E2a region comprises an adenoviral E2a early promoter sequence comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 33 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 33; j. the E2a region comprises an adenoviral E2a late primary transcript sequence, optional lyk. the E2a region comprises an adenoviral E2a late primary transcript sequence comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 34 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 34;l. the E2a region comprises an adenoviral E2a early primary transcript sequence, optionally the E2a region comprises an adenoviral E2a early primary transcript sequence comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%. at least 92%, at least 9.3%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 35 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 35; and / orm. the E2a region comprises a nucleotide having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%. at least 99% or 100%) identity to SEQ ID NO: 36 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, atleast 98%, at least 99% or 100%) identity to a sequence complementary' to SEQ ID NO: 36.

15. The polynucleotide of any one of claims 1-14, wherein;a. the E4 region comprises an adenoviral E4 orf6 / 7 sequence, optionally i. the E4 region comprises an adenoviral E4 orf6 / 7 sequence comprising a nucleotide sequence having at least 80% (e.g.. at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity io SEQ ID NO: 37 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) i dentity to a sequence complementaiy to SEQ ID NO: 37,and / orii. the E4 region comprises a nucleotide sequence encoding an adenoviral E4 orf6 / 7 protein having the amino acid sequence SEQ ID NO: 38;b. the E4 region comprises a nucleotide sequence encoding an adenoviral E4 34K protein having the amino acid sequence SEQ ID NO: 39;c. the E4 region comprises an adenoviral E4 orf4 sequence, optionallyi. the E4 region comprises an adenoviral E4 orl4 sequence comprising a nucleotide sequence having at least 80% (e g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 40 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%. at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 40 and / orii. the E4 region comprises a nucleotide sequence encoding an adenoviral E4 orf4 protein having the ammo acid sequence SEQ ID NO: 41;d. the E4 region comprises an adenoviral E4 orf3 sequence, optionallyi. the E4 region comprises an adenoviral E4 orf3 sequence comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 42 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%. at least 93%, at least 94%, at least 95%, at least 96%.at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 42; and / oru. the E4 region comprises a nucleotide sequence encoding an adenoviral E4 orfi protein having the ammo acid sequence SEQ ID NO: 43; e. the E4 region comprises an adenoviral E4 orf8 sequence, optionallyi. the E4 region comprises an adenoviral E4 orf4 sequence comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 44 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 44; and / orii. the E4 region comprises a nucleotide sequence encoding an adenoviral E4 orf4 protein having the amino acid sequence SEQ ID NO: 45; f. the E4 region comprises an adenoviral E4 orfl sequence, optionallyi. the E4 region comprises an adenoviral E4 orfl sequence comprising a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 46 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 46, and / orii. the E4 region comprises a nucleotide sequence encoding an adenoviral E4 orfl protein having the ammo acid sequence SEQ ID NO: 47; g. the E4 region comprises a nucleotide sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 48 or having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to a sequence complementary to SEQ ID NO: 48; and / orh. the E4 region is operably linked to a promoter, optionally the promoter is not a chicken P-actin promoter or a SV40 promoter.

16. The polynucleotide of any one of claims 1-15, wherein:a. the polynucleotide is about 16,500 nucleotides or less in size, e.g., about 1,500 nucleotides or less in size, about 14,000 nucleotide or less in size, about 12,500 nucleotides or less in size, about 12,000 nucleotides or less in size, or about 11,000 nucleotides or less in size:b. the polynucleotide is double-stranded;c. the polynucleotide is single-stranded;d. the polynucleotide is linear;e. the polynucleotide is circular, and / orf. the polynucleotide is a close ended linear duplexed DNA (clDNA).

17. The polynucleotide of any one of claims 1-16, wherein:a. the polynucleotide is capable of producing recombinant adeno-associated viral (rAAV) particles in an amount that is at least 80% of an amount produced under similar conditions with a similar polynucleotide that further comprises a nucleotide sequence encoding a full-length L-22K protein and / or a full-length L- 33K protein; and / or a packaging efficiency of the polynucleotide in a method of producing rAAV is at least 80% of a packaging efficiency of a similar polypeptide that further comprises a nucleotide sequence encoding a full-length L-22K protein and / or a full-length L-33K protein.

18. A cell, plasmid or vector comprising a polynucleotide of any one of claims 1-17, optionallya. the cell, plasmid or vector does not comprise a nucleotide sequence encoding a full length L-22K and / or a full length L-33K protein, e.g., the cell, plasmid or vector does not comprise a polynucleotide encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least: 94%, at least 95%. at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity'- to SEQ ID NO: 7 or 8. b. vector is a viral vector, e.g., a retroviral vector, a lentiviral vector, an adenoviral vector, an adeno-associated viral vector, or a herpes simplex viral vector, preferably an adenoviral vector;c. the celli. is an insect cell or a mammalian cell, preferably the cell is a mammalian cell;h. is a HeLa cell, COS cell, COS-1 cell, COS-7 cell, HEK293 cell, A549 cell, BHK cell, BSC-1 cell, BSC-40 cell, Vero cell, Sf’c9 cell, Sf -21 cell.Tn-368 cell, BTI-Tn-5Bl-4 (High-Five) cell, Saos cell, C2C12 cell, L cell, HT1080 cell, HepG2 cell, WEHI cell, 3T3 cell, 10T1 / 2 cell, MDCK cell, BMT-10 cell, WI38 cell, or a primary fibroblast, hepatocyte or myoblast cells derived from a mammal, preferably the cell is a HEK293 cell or HeLa cell;iii. is a suspension adapted cell; and / oriv. is a producer cell;v. further comprises a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-ITR) and / or right ITR (R-ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L- ITR and / or R-ITR), and wherein the L-ITR and R-ITR are selected independently from AAV ITRs and adenoviral ITRs;vi. further comprises a polynucleotide encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes.

19. Use of a polynucleotide of any one of claims 1-17, or a cell, plasmid or vector of vector of claim 18, for producing recombinant adeno-associated viral (rAAV) particles.

20. A method for producing recombinant adeno-associated viral (rAAV) particles, the method comprising: culturing a cell of claim 18 in a culture medium under conditions in which rAAV particles are produced.

21. A method for producing recombinant adeno-associated viral (rAAV) particles, the method comprising: culturing a host cell in a culture medium under conditions in which rAAV particles are produced, where the host cell comprises: (i) a polynucleotide of any one of claims 1-17, or a plasmid or vector of claim 18, wherein the polypeptide of claims 1-17 or the plasmid of claim 18 further comprises a nucleotide sequence encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes; and (ii) a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminal repeat (L-AAV ITR) and / or right ITR (R-AAV ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L-AAVITR and / or R-AAV ITR).

22. A method for producing recombinant adeno-associated viral (rAAV) particles, the method comprising: culturing a host cell in a culture medium under conditions in which rAAV particles are produced, where the host cell comprises: (i) a polynucleotide of any one of claims 1-17, or a plasmid or vector of claim 18; (ii) a polynucleotide encoding a virus genome (e.g., an AAV endogenous genome, optionally flanked by left inverted terminalrepeat (L-AAV ITR) and / or right ITR (R-AAV ITR), or a recombinant AAV genome comprising polynucleotide encoding a transgene, optionally flanked by L-AAVITR and / or R-AAV ITR); and (iii) a polynucleotide encoding viral capsid (e.g., AAV capsid) and / or non-structural replication (e.g., AAV Rep) genes.

23. The method of any one of claims 20-22, wherein:a. the cell culture is substantially free of a polynucleotide encoding a full-length L- 22K protein and / or a full-length L-33K protein, e.g., the cell culture is substantially free of a polynucleotide encoding a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity to SEQ ID NO: 7 or 8: and / orb. a full-length L-22K protein and / or a ful l-length L-33K protein is not expressed during the culturing of the cell, e.g., a protein having an amino acid sequence having at least 80% (e.g., at least 85%, at least 90%, at least 91%, at least 92%, at least 93%. at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%) identity io SEQ ID NO: 7 and / or 8 is not expressed during the culturing of the cell.

Images