Platform for lysosomal-based protein degradation, and therapeutic agent using same

Abstract

The present invention relates to a novel CMATAC molecule and a therapeutic use thereof. CMATAC according to one aspect can direct a target protein to a lysosome by using a novel lysosome-binding motif in the composition so as to effectively induce chaperone-mediated autophagy, and thus can be used for preventing, alleviating or treating cancer and / or immune diseases.

Description

[0001] specification

[0002] Title of Invention: Lysosome-based Protein Degradation Platform and Therapeutic Agent Using the Same Technical Field

[0003] The present invention relates to a lysosome-based protein degradation platform and its uses.

[0004] Background alcohol

[0005] Cancer development is a complex process influenced by various factors beyond genetic mutations, one possible factor being the overactivation of tumor-inducing proteins due to defects in target protein degradation. Chaperone-mediated autophagy is a lysosomal-selective protein degradation pathway, and its impact on tumor formation is not clearly known.

[0006] Retinoic acid receptor responder 1 (RARRES1) is a RAR agonist gene that was initially identified as a novel retinoid-inducible gene in the skin. It has been reported that RARRES1 expression is suppressed by promoter DNA hypermethylation in various cancer types, including prostate, breast, lung, liver, and colorectal cancers. However, there is controversy regarding whether RARRES1 functions as a tumor suppressor or an oncogene, and research on this matter remains insufficient [ Sahab ZJ, Hal 1 MD, Me Sung Y, Dakshanamurthy S, J i Y, Kumar D, et al. Tumor suppressor RARRES1 interacts with cytoplasmic carboxypeptide AGBL2 to regulate the alpha-tubules in tyrosinization eye 1 e. Cancer Res. 2011:71(4): 1219-28. ] .

[0007] Meanwhile, the inventors confirmed that after RARRES1 binds to CDK1 and PDL1, it is moved to the lysosome by LLYKQ, a sequence within the KFERQ-like motif of RARRES1, and CDK1 is degraded. Through this, the inventors constructed a novel platform for CMATAC (Chaperone-Mediated Autophagy Targeting Chimaeras) technology, which can degrade any protein based on the lysosome using LLYKQ, a sequence within the KFERQ-like motif, thereby completing the present invention.

[0008] Detailed description of the invention

[0009] Technical challenges

[0010] One aspect provides a conjugate for target protein degradation comprising a lysosome-binding moiety and a target protein-binding moiety, wherein the lysosome-binding moiety comprises the following amino acid sequence:

[0011] X1LX3KX5

[0012] Xi is L, Q, or R, X3 is Y or Do, and X5 is Q or L.

[0013] Another aspect is to provide a pharmaceutical composition for the prevention or treatment of cancer comprising the above-mentioned binder.

[0014] Another aspect is to provide a health functional food for the prevention or improvement of cancer containing the above-mentioned binder.

[0015] Another aspect is to provide a pharmaceutical composition for the prevention or treatment of immune diseases comprising the above-mentioned conjugate.

[0016] Another aspect is to provide a health functional food for the prevention or improvement of immune diseases containing the above-mentioned complex.

[0017] Another aspect provides a method for preventing, treating, or improving cancer, comprising the step of administering an effective amount of the said conjugate to an individual in need thereof. Another aspect provides a use of the said conjugate for the prevention, treatment, or improvement of cancer.

[0018] Another aspect is to provide the use of the above-mentioned binder for the manufacture of pharmaceutical preparations for the prevention, treatment, or improvement of cancer.

[0019] Another aspect provides a method for preventing, treating, or improving an immune disease, comprising the step of administering an effective amount of the conjugate to an individual in need thereof. Another aspect provides a use of the conjugate for the prevention, treatment, or improvement of an immune disease.

[0020] Another aspect is to provide the use of the above-mentioned conjugate for the manufacture of pharmaceutical preparations for the prevention, treatment, or improvement of immune diseases.

[0021] technical solution

[0022] One aspect provides a conjugate for target protein degradation comprising a lysosome-binding moiety and a target protein-binding moiety, wherein the lysosome-binding moiety comprises the following amino acid sequence:

[0023] X1LX3KX5

[0024] Xi is L, Q, or R, and

[0025] X3 is Y or degrees, and

[0026] X5 is Q or L.

[0027] In the present invention, the lysosome-binding moiety can perform a function similar to the KFERQ motif. The "KFERQ motif" is a cytoplasmic protein region recognized by chaperones that forms a complex with the chaperone to target the substrate to the lysosome surface, specifically LAMP-2A (lysosome-associated membrane protein type 2A). When the substrate binds to the LAMP-2A monomer, the assembly of the LAMP-2A multiplex begins. This multiplex acts as an active potential complex through which the substrate can pass after unfolding, and after translocation, the substrate protein can be rapidly degraded by degradation proteins within the lysosome. That is, the lysosome-binding moiety of the present invention is a moiety that performs the function of the aforementioned KFERQ, and can induce selective autophagy by delivering the substrate to LAMP-2A. More specifically, it can induce chaperone-mediated autophagy (CMA).

[0028] In one specific example, the lysosome binding moiety may be a fragment comprising one or more amino acid sequences selected from the group consisting of LLYKQ (Sequence No. 1), LLYKL (Sequence No. 2), LLEKQ (Sequence No. 3), LLEKL (Sequence No. 4), QLYKQ (Sequence No. 5), QLYKL (Sequence No. 6), QLEKQ (Sequence No. 7), QLEKL (Sequence No. 8), RLYKQ (Sequence No. 9), RLYKL (Sequence No. 10), RLEKQ (Sequence No. 11), and RLEKL (Sequence No. 12).

[0029] In one specific example, the lysosome binding moiety may be a fragment containing the amino acid sequence of LLYKQ (Sequence No. 1).

[0030] In one specific example, the lysosome-binding moiety may be a fragment of RARRES1 containing the amino acid sequence. More specifically, the lysosome-binding moiety may be a fragment containing an amino acid corresponding to positions 160 to 164 of RARRES1.

[0031] In this specification, "corresponding amino acid" refers to an amino acid residue at a corresponding position in a polypeptide, or an amino acid residue that is similar, identical, or homologous to the amino acid residue at that position. Identifying the amino acid at the corresponding position may involve determining a specific amino acid in a sequence that references a specific sequence. In the present invention, "corresponding position" generally refers to a similar or corresponding position in the amino acid sequence of a related protein or in a reference sequence. For example, any amino acid sequence can be aligned with X1LX3KX5, and based on this, each amino acid residue of the said amino acid sequence can be numbered by referring to the numerical position of the amino acid residue corresponding to the amino acid residue of X1LX3KX5. For example, through a sequence alignment algorithm known in the art, the position of the corresponding amino acid, or the position where modifications such as substitution, insertion, or deletion occur, can be identified by comparing it with a query sequence (also referred to as a "reference sequence").

[0032] In the present invention, the target protein binding moiety may include, but is not limited to, one or more of an antibody or its antigen-binding fragment that binds to a target protein, a partial domain of an interacting protein, a ligand, and the C-terminus of RARRES1, and may include any moiety that binds to or can bind to a target protein and change its activity. Specifically, the target protein binding moiety may be the C-terminus of RARRES1.

[0033] In one specific example, the C-terminus of RARRES1 may comprise an amino acid sequence represented by sequence number 17 or 18 or an amino acid sequence having at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% identity with respect to it.

[0034] In one embodiment, the target protein may be a tumor-inducing protein. Specifically, it may be a cell cycle regulator and / or immune checkpoint protein of a tumor cell. In one embodiment, the target protein may be CDK1, CDK4 / 6, Cycl in DI, Cycl in B, RAS, EGFR, HER2, VEGFR, MYC, STAT3, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, B7-1, or B7-2.

[0035] In one specific example, the antibody or its antigen-binding fragment may comprise one or more selected from the group consisting of a monoclonal antibody, a domain antibody (dAb), a single chain antibody (scAb), a Fab fragment, a Fab' fragment, a F(ab')2 fragment, a scFab fragment, a Fv fragment, a dsFv fragment, a single chain variable antibody (scFv), a scFv-Fc fragment, a single domain heavy chain antibody, a single domain light chain antibody, a variant antibody, a multimeric antibody, a minibody, a diamond, a bispecific antibody, and a multispecific antibody. Preferably, the above antibody or its antigen-binding fragment may be a scFv-Fc fragment.

[0036] In one specific example, the lysosome-binding moiety and the target protein-binding moiety may be connected directly or via a linker.

[0037] In this specification, "linker" may be a peptide linker or a non-peptide linker (e.g., a linker containing ethylene glycol repeating units).

[0038] The term "peptide linker" refers to a linker containing one or more amino acids, and may, for example, contain from one to 1,000 amino acids, but is not specifically limited thereto. In order to connect the lysosome-binding moiety and the target protein-binding moiety in the present invention, various known peptide linkers may be used in the present invention, specifically including [GS]n linkers, [GGGS]n linkers, and [GGGGGS]n linkers, etc., where n may be a natural number greater than or equal to 1. However, the above examples are not limited thereto.

[0039] The above linker may be a short oligopeptide or polypeptide linker, and is not specifically limited in its length or type, and any linker known in the art may be applied without limitation.

[0040] The above linker may be a flexible linker. For example, it may be a peptide linker composed of glycine, serine, alanine, or proline, and more specifically, it may be (GS)n, (GGGGS)n, (GGGGA)n, (GGGGP)n, (GGGA)n, (GGS)n, (GSGGS)n, or (GGGS)n, etc. The copy number "n" is any natural number and can be adjusted considering the optimization of the linker.

[0041] The term "non-peptide linker" includes a biocompatible polymer comprising two or more repeating units. The repeating units are connected to each other through any covalent bond other than a peptide bond. In the present invention, the non-peptide linker includes a reactive group at its terminal end and can form a complex through a reaction with other components constituting the complex. The non-peptide linker may be a component forming a moiety of the complex of the present invention.

[0042] The non-peptide linker that can be used in the present invention may be a non-peptide polymer that is resistant to in vivo proteolytic enzymes without limitation. In the present invention, the non-peptide linker may be used in combination with the non-peptide polymer. Specifically, the non-peptide linker may be selected from the group consisting of fatty acids, saccharides, high molecular weight polymers, low molecular weight compounds, nucleotides, and combinations thereof.

[0043] In one specific example, the non-peptide linker may be selected from the group consisting of polyethylene glycol, polypropylene glycol, copolymers of ethylene glycol and propylene glycol, polyoxyethylated polyols, polyvinyl alcohol, polysaccharides (e.g., dextran, etc.), polyvinyl ethyl ether, biodegradable polymers such as PLA (poly lactic acid) and PLGA (polylactic-glycolic acid), lipid polymers, chitins, hyaluronic acid, oligonucleotides, and combinations thereof, but is not limited thereto.

[0044] Another aspect provides a pharmaceutical composition for the prevention or treatment of cancer comprising the above-mentioned binder.

[0045] Another aspect provides a pharmaceutical composition for the prevention or treatment of immune diseases comprising the above-mentioned conjugate.

[0046] In this specification, "prevention" means any act of administering the composition of the present invention to an individual to suppress or delay disease. For preventive benefits, the composition may be administered to a subject at risk of developing a specific disease, disease, or symptom, or to a subject reporting one or more physiological symptoms of a disease, even if the disease, disease, or symptom has not yet appeared.

[0047] In this specification, "treat" refers to any act of administering the composition of the present invention to an individual to improve or benefit from the symptoms of a disease. The terms "treat," "relief," or "improvement" as used herein may be used interchangeably. A therapeutic benefit refers to any therapeutically significant improvement of one or more diseases, conditions, or symptoms under treatment, or an effect thereon.

[0048] The cancer of the present invention may be a cancer that expresses a target antigen recognized by the conjugate of the present invention. Specifically, the cancer may be a cancer that expresses CDK1 and / or PD-L1. That is, the composition may be a composition for the prevention or treatment of cancer, solid tumors and / or hematological malignancies that express CDK1 and / or PD-L1.

[0049] The above types of cancer are not particularly limited and include solid tumors and blood cancers. Specifically, the cancer may include one or more selected from the group consisting of breast cancer, lung cancer, skin cancer, kidney cancer, colorectal cancer, head and neck cancer, stomach cancer, colon cancer, prostate cancer, bladder cancer, rectal cancer, thyroid cancer, liver cancer, cervical cancer, melanoma, rectal cancer, anal cancer, urethral cancer, ovarian cancer, esophageal cancer, and pancreatic cancer.

[0050] The pharmaceutical composition of the present invention may be in any form suitable for the intended method of administration. In the pharmaceutical composition of the present invention, "administration" means introducing a specific substance to a patient by any appropriate method, and the route of administration of said pharmaceutical composition may be administered through any general route as long as the drug can reach the target tissue. Examples include, but are not limited to, ocular local administration (e.g., periocular (e.g., subtenon's), subconjunctival, intraocular, intravitreal, anterior chamber, subretinal, supracorbital, and posterior ocular administration), intraperitoneal administration, intravenous administration, intramuscular administration, subcutaneous administration, intradermal administration, oral administration, local administration, intranasal administration, intrapulmonary administration, rectal administration, etc. Additionally, the pharmaceutical composition of the present invention may be administered by any device capable of transporting the active ingredient to target cells. It is preferable that the administration route of the pharmaceutical composition of the present invention be determined according to the type of disease to which it is applied.

[0051] The pharmaceutical composition of the present invention may be used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, or parenteral formulations such as suspensions, emulsions, lyophilized preparations, topical preparations, suppositories, sterile injectable solutions, and implantable preparations, formulated according to conventional methods. In addition to the active ingredient, the pharmaceutical composition may further include pharmaceutically acceptable excipients that can be used for formulation.

[0052] The above excipients are a carrier, vehicle, diluent, solvent, e.g., monohydric alcohol, e.g., ethanol, isopropanol, and polyhydric alcohol, e.g., glycerol, and edible oil, e.g., soybean oil, coconut oil, olive oil, safflower oil, cottonseed oil, oily ester, e.g., ethyl oleate, isopropyl myristate; It may include one or more selected from the group consisting of binders, adjuvants, solubilizers, thickeners, stabilizers, disintegrants, lubricants, buffers, emulsifiers, wetting agents, suspending agents, sweeteners, coloring agents, flavoring agents, coating agents, preservatives, antioxidants, processing agents, drug delivery modifiers and enhancers, e.g., calcium phosphate, magnesium stearate, talc, monosaccharides, disaccharides, starch, gelatin, cellulose, methylcellulose, sodium carboxymethylcellulose, dextrose, hydroxypropyl-p-cyclodextrin, polyvinylpyrrolidone, low melting point waxes, ion exchange resins, etc., but is not limited thereto.

[0053] The above-mentioned carrier is one that is commonly used in formulations and includes, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, wetting agents, sweeteners, flavoring agents, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington's Pharmaceutical Sciences (19th ed., 1995).

[0054] The pharmaceutical composition of the present invention being formulated into an oral administration formulation may be, for example, tablets, pills, hard or soft capsules, liquids, suspensions, emulsifiers, syrups, granules, elixirs, etc. Depending on the conventional composition of each formulation, such oral administration formulations may include, in addition to the active ingredient, pharmaceutically acceptable carriers such as diluents such as lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and / or glycine, or lubricants such as silica, talc, stearic acid and its magnesium or calcium salts and / or polyethylene glycol.

[0055] When the above oral formulation is a tablet, it may include a binder such as magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose and / or polyvinylpyrrolidine, and in some cases, it may include a disintegrant such as starch, agar, alginic acid or its sodium salt, a boiling mixture and / or an absorbent, a coloring agent, a flavoring agent or a sweetener, etc.

[0056] The fact that the pharmaceutical composition of the present invention is formulated in the form of a parenteral administration formulation may mean that it is administered by a method of administration such as subcutaneous injection, intravenous injection, intramuscular injection, or intrathoracic injection. In this case, in order to formulate the pharmaceutical composition into the parenteral administration formulation, the active ingredient of the pharmaceutical composition is mixed in water with a stabilizer or a buffer to be prepared as a solution or suspension, and such a solution or suspension may be prepared in a unit dosage form of an ampoule or vial.

[0057] In addition, the above pharmaceutical composition may be sterilized or further include adjuvants such as preservatives, stabilizers, hydrating agents or emulsifying promoters, salts and / or buffers for osmotic pressure regulation, and further include other therapeutically useful substances, and may be formulated according to conventional methods of mixing, granulation, or coating.

[0058] The content of the binder in the composition of the present invention can be appropriately adjusted according to the symptoms of the disease, the degree of progression of the symptoms, the condition of the patient, etc. For example, it may be 0.0001 to 99.9% by weight or 0.001 to 50% by weight based on the total weight of the composition, but is not limited thereto. The above content ratio is a value based on the dry weight after removing the solvent.

[0059] The composition according to the present invention may further include a pharmaceutically acceptable carrier. For oral administration, binders, lubricants, disintegrants, excipients, solubilizers, dispersants, stabilizers, suspenders, colorants, flavors, etc. may be used; for injectables, buffers, preservatives, analgesics, solubilizers, isotonic agents, stabilizers, etc. may be mixed and used; and for topical administration, bases, excipients, lubricants, preservatives, etc. may be used. The formulations of the pharmaceutical composition of the present invention may be prepared in various ways by mixing with the pharmaceutically acceptable carriers described above. For example, for oral administration, it may be prepared in the form of tablets, lozenges, capsules, ellipsis, suspensions, syrups, wafers, etc., and for injectables, it may be prepared in the form of unit dosing ampoules or multi-dose dosing ampoules. In addition, the above anticancer composition may typically include a surfactant that facilitates movement across a membrane. Such surfactants may be derived from steroids, cationic lipids such as N-[1-(2,3-dioleoyl)propyl-citric-trimethylammonium chloride, or various compounds such as cholesterol hemisuccinate, phosphatidyl glycerol, etc.

[0060] The above composition may be administered in combination with additional anticancer agents. Examples of additional anticancer agents may include alkylating agents, antimetabolites, spindle inhibitors, plant alkaloids, cytotoxic / antitumor antibiotics, topoisomerase inhibitors, antibodies, photosensitizers, and kinase inhibitors. Examples of the above anticancer agents may include compounds used in targeted therapy and conventional chemotherapy. In addition, examples of the above antibodies include alemtuzumab, apolizumab, aselizumab, atlitzumab, bapinuzumab, bevacizumab, vivartuzumab mertansine, cantuzumab mertansine, cedelizumab, sertolizumab pegol, sidfusituzumab, sidtuzumab, daclizumab, eculizumab, epalizumab, epratuzumab, erlizumab, felbizumab, fontolizumab, gemtuzumab ozogamicin, inotuzumab ozogamicin, ipilimumab, labetuzumab, lintuzumab, matuzumab, mepolizumab, motavizumab, motobizumab, natalizumab, nimotuzumab, nolovizumab, numabizumab, ocrelizumab, and O'Malley Zumab, palibizumab, pascolizumab, peckfucituzumab, pectuzumab, pertuzumab, pexelizumab, lalibizumab, ranibizumab, reslibizumab, reslibizumab, resaibizumab, rovellizumab, luflizumab, cibrotuzumab, siplizumab, sontuzumab, tacatuzumab, tetraxetan, tadocizumab, talizumab, tepivazumab, tocilizumab, toralizumab, trastuzumab, tucotuzumab, selmoleukin, tucucituzumab, umabizumab, urtoxazumab, and bicilizumab may be included.

[0061] The pharmaceutical composition of the present invention may be administered in a pharmaceutically effective amount. "Pharmaceutically effective amount" means an amount sufficient to treat or prevent a disease with a reasonable benefit / risk ratio applicable to medical treatment or prevention, and may be adjusted according to factors including the type of disease of the patient, the severity of the disease, the type of active ingredient administered, the type of formulation, the patient's age, gender, weight, health status, diet, sensitivity, the time and method of drug administration, the combination of the composition or drugs used concurrently, and other factors well known in the medical field.

[0062] The pharmaceutical composition of the present invention can prevent or treat a disease in an individual by including the step of administering to the individual an amount effective for preventing or treating the disease. The individual may be a mammal. The mammal may be a human, dog, cat, cattle, goat, or pig. Another aspect provides a method for preventing, treating, or improving cancer by including the step of administering an effective amount of the conjugate to an individual in need.

[0063] Another aspect provides the use of the above-mentioned combination for the prevention, treatment, or improvement of cancer.

[0064] Another aspect provides the use of the above-mentioned binder for the manufacture of pharmaceutical preparations for the prevention, treatment, or improvement of cancer.

[0065] Another aspect provides a method for preventing, treating, or improving an immune disease, comprising the step of administering an effective amount of the conjugate to an individual in need. Another aspect provides a use of the conjugate for the prevention, treatment, or improvement of an immune disease.

[0066] Another aspect provides the use of the above conjugate for the manufacture of pharmaceutical preparations for the prevention, treatment, or improvement of immune diseases.

[0067] Another aspect provides a health functional food for the prevention or improvement of cancer comprising the above-mentioned binder.

[0068] Another aspect provides a health functional food for the prevention or improvement of immune diseases comprising the above-mentioned binder.

[0069] In this specification, "health functional food" refers to a food manufactured or processed by methods such as extraction, concentration, purification, or mixing of specific ingredients contained in food ingredients, or using specific ingredients as raw materials for the purpose of health supplementation, and refers to a food designed and processed to fully exert biological regulatory functions on the body, such as biological defense, regulation of biological rhythms, and prevention and recovery from disease, through said ingredients.

[0070] There are no special restrictions on the types of the above foods. Examples of the above foods include formulations selected from the group consisting of powders, granules, tablets, capsules, pills, gels, jellies, suspensions, emulsions, syrups, tea bags, infused teas, gum, candies, and health drinks, and include all health foods in the conventional sense.

[0071] The above-mentioned health functional food may include food-grade acceptable food additives and may include a suitable carrier commonly used in the manufacture of health functional foods.

[0072] The terms and methods, etc. described for the above inventions apply equally among the inventions.

[0073] The present invention is capable of various modifications and may have various embodiments. Specific embodiments are illustrated in the drawings and described in detail in the detailed description below. However, this is not intended to limit the present invention to specific embodiments, and it should be understood that it includes all modifications, equivalents, and substitutions that fall within the spirit and scope of the present invention. In describing the present invention, detailed descriptions of related prior art are omitted if it is determined that such detailed descriptions may obscure the essence of the present invention.

[0074] Effects of the invention

[0075] CMATAC, depending on the pattern, can effectively induce chaperone-mediated autophagy by directing target proteins into lysosomes through novel motifs within its composition. Accordingly, it can be used for the prevention, improvement, or treatment of cancer and / or immune diseases.

[0076] Brief explanation of the drawing

[0077] Figure 1 is a summary diagram of the types of CDK1 and its substrate proteins identified in anti-RARRES1 immunoprecipitation proteins and the cellular processes regulated by them.

[0078] Figure 2 is a graph showing the MST measurement results for the affinity of purified CDK1 protein to GFP-RARRES1 and GFP alone.

[0079] Figure 3 is a graph (left) quantifying CDK1 mRNA expression and protein levels in RARRES1-transfected HEK293 cells (top) and MEE cells (bottom), and a Western blotting image (right) of CDK1 in the lysate of said cells.

[0080] Figure 4 is an image showing the results of immunoblot analysis of CDK1 after exogenous introduction of RARRES1 and Western blot analysis after CHX treatment.

[0081] Figure 5 is an image showing the results of Western blot analysis of the indicated protein after treatment with a protein degradation pathway inhibitor.

[0082] Figure 6 is a table showing the types of proteins involved in various chaperone-mediated autophagy, including LAMP1, in anti-RARRES1 immunoprecipitates.

[0083] Figure 7 is an image showing the results of immunoblot analysis of CDK1 and lysosomal proteins in anti-RARRES1 immunoprecipitates.

[0084] Figure 8 is a graph showing the confocal image and fluorescence intensity indicating the co-localization of CDK1 and LAMP1 in the late stage of cell division.

[0085] Figure 9 is an image showing the results of an immunoblot analysis of CDK1 protein in HEK293 cells with or without siRNA targeting VPS4 or LAMP2A.

[0086] Figure 10 shows the amino acid sequence similarity of the KFERQ-like motif present in RARRES1 between mammals and the results of CDK1 immunoblot analysis in KFERQ-like motif mutants. Figure 11 shows a confocal image of PLA and an image showing the quantification results of PLA puncta.

[0087] Figure 12 is an image showing the results of immunoblot analysis of HEK293 cell lysates co-transfected with CDK1 and RARRES1 WT or Y162A mutations.

[0088] Figure 13 is an image showing the results of immunoblot analysis of binding of RARRES1 full length (FL) or truncated mutants with CDK1.

[0089] Figure 14 is an image showing the domain structure of the RARRES1 protein and the amino acid sequence similarity of the carboxyl group terminus between mammals.

[0090] Figure 15 is an image showing the modeling structure of CDK1 complexed with a RARRES1-derived peptide.

[0091] Figure 16 is a graph showing the fluorescence intensity of the H2B isolation enzyme biosensor on the chromosomes of Rarresl+ / + (WT, n=7) and Rarresl- / - (KO, n=14) MEE cells.

[0092] Figure 17 is a graph showing the duration / time of cell cycle phases calculated by the fluorescence intensity of fluorescent ubiquitination-based cell cycle markers in Rarresl+ / +(WT, n=32) and Rarresl- / -(KO, n=51) MEE cells.

[0093] Figure 18 is an image of the immunoblot analysis of cyclins D, E, and B using agarose-conjugated anti-CDK1 antibodies in Rarresl+ / +(WT) and Rarresl- / -(KO) MEE cells.

[0094] Figure 19 is a graph showing the growth of Rarresl+ / +(WT) and Rarresl- / -(KO) MEE cells and the growth when human RARRES1 is added to KO MEE cells.

[0095] Figure 20 is a graph showing the number and size of spheroidized cells and their quantification when human RARRES1 was added to Rarresl+ / +(WT) and Rarresl- / -(KO) MEE cells or not. Figure 21 is a schematic diagram of the strategy for generating Rarresl- / - knockout mice.

[0096] Figure 22 is a graph showing the genomic (top) and mRNA (bottom) levels of Rarresl and its surrounding genes (Gfml and Mfsdl) measured in the lungs of Rarresl- / - embryos.

[0097] Figure 23 is the Kap 1 an-Meier overall survival curve of Rarresl+ / +(WT, n=50) and Rarresl- / -(KO, n=53) mice.

[0098] Figure 24 shows the incidence rate graph and tumor images of various tumors in Rarresl+ / +(WT, n=51) and Rarresl- / -(KO, n=59) mice.

[0099] Figure 25 is an image monitoring FDG uptake in Rarresl+ / +(WT, n=6) and Rarresl- / -(KO, n=6) mice.

[0100] Figure 26 shows micrographs and quantification results of NKX2.1+CDK1- or NKX2.1+CDK1+ cells in WT and Rarresl- / - mouse (K0) lung tissues.

[0101] Figure 27 shows the results of immunoblot analysis of lysosomal proteins and cell cycle-related proteins in WT and Rarresl- / - mouse (K0) lung tissues.

[0102] Figure 28 shows the acid viscosity representing the correlation between CDK1 protein abundance and RARRES1 mRNA expression.

[0103] Figure 29 is a heat map of cell-specific gene expression in lung tissues of WT, Rarresl- / - mice (K0) and human TCGA LUAD cohorts.

[0104] Figure 30 shows microscopic images and quantitative results of IHC staining for [RARRESL] in human lung tissue.

[0105] Figure 31 shows the results of PD-L1 immunoblot analysis upon RARRES1 overexpression and subsequent interferon gamma (IFN-B) treatment.

[0106] Figure 32 shows the results of PD-L1 immunoblot analysis according to glucose concentration in cell culture medium after overexpression of human RARRES1 normal type (WT) and mutant Y162A in human colorectal cancer cell lines.

[0107] Figure 33 is a graph showing the volume of colon cancer cells in mice overexpressing human RARRES1 in Rarresl - / -(KO) mice.

[0108] Figure 34 is the result of an immunoblot analysis confirming the binding of RARRES1 and Cycl in Bl in a human-derived cell line (HEK293).

[0109] Figure 35 is a confocal image confirming the endogenous Cycl in Bl level upon RARRES1-GFP overexpression in a human-derived cell line (HEK293).

[0110] Figure 36 is the result of an immunoblot analysis confirming the binding of RARRES1 full length (FL) or truncated mutants with Cycl in Bl in a human-derived cell line (HEK293).

[0111] Figure 37 is the result of an immunoblot analysis confirming Cycl in Bl protein levels after concentration-dependent overexpression of RARRES1 in human-derived cell lines (HEK293).

[0112] Figure 38 is the result of an immunoblot analysis confirming the expression of endogenous Cycl in Bl protein with and without RARRES1 upon treatment with a lysosomal degradation inhibitor in human-derived cell lines (HEK293).

[0113] Figure 39 is a design for fabricating a RARRES1 C-terminal defect (RAI AC) and its 80S or BAK1 fusion.

[0114] FIG. 40 is the result of an immunoblot analysis confirming the induction of target protein degradation when an 80S or BAK1 binding sequence is fused to a RARRES1 C-terminal deletion (RAI AC). An embodiment for carrying out the invention

[0115] The following examples will be explained in more detail. However, these examples are intended to illustrate one or more specific examples, and the scope of the present invention is not limited to these examples.

[0116] See example

[0117] Reference Example 1. Cell Culture

[0118] HEK293 cells were purchased from ATCC and cultured in DMEM containing 10% (v / v) fetal bovine serum (FBS), 10,000 units / ml penicillin, 10,000 pg / ml streptomycin, and sodium pyruvate.

[0119] Mouse embryonic fibroblasts (MEFs) and mouse embryonic epithelial cells (MEEs) were isolated from 13.5-day-old embryos. MEFs were cultured in DMEM containing 10% (v / v) FBS, 2 mM L-glutamine, 0.1 mM MEM non-essential amino acids, 55 pM beta-mercaptoethanol, 100 units / ml penicillin, and 100 pg / ml streptomycin. MEE was cultured in DMEM / F-12 medium containing 1% (v / v) FBS, 1 mg insulin, 1 mg hydrocortisone, 12.5 pg EGF, 10 mg ascorbic acid, 10 mg transferrin, 14 mg phosphoethanolamine, 2.6 ng Na selenite, 1 pg cholera toxin, 6.5 pg triiodothyronine, 35 mg bovine pituitary gland extract, 6 pl / ml ethanolamine, 50 uni ts / ml penicillin, and 50 pg / ml streptomycin. Cells were cultured at 37°C in a 5% CO2 humidified chamber.

[0120] Human colorectal cancer cell line HCT116 was cultured in DMEM (Dulbecco's Modified Eagle's Media) medium (Invitrogen, Carlsbad, USA) supplemented with 10% FBS and 1% penicillin-streptomycin (P / S) under conditions of 5% CO2 atmosphere and 37°C.

[0121] MC38, a mouse colorectal cancer cell line, was cultured in DMEM (Dulbecco's Modified Eagle's Media) medium (Invitrogen, Carlsbad, USA) supplemented with 10% FBS and 1% penicillin-streptomycin (P / S) under conditions of 5% CO2 atmosphere and 37°C.

[0122] Reference Example 2. Construction of a Plasmid

[0123] For gene delivery using plasmid LTX / PLUS (Invitrogen), Lipofectamine 3000 (Invitrogen), or soliethylenenimin (PEI) were used according to the manufacturer's instructions.

[0124] Specifically, human RARRESKGenBank (NM_206963) cDNA was subcloned and inserted into the pcDNA3.1 expression vector (Invi trogen) using the BamHI / EcoRV restriction site. RARRES1 cDNA amplified by PCR was downcloned into pcDNA3.1 using the BamHI / EcoRV restriction site to generate RARRES1 cleavages (1-269aa, 43-269aa, 51-294aa, RARRES1AC, RARRES1AN,C, and RARRES1AN, respectively), and sequence information is shown in Table 2. The RARRES1 fusion plasmid was constructed by downcloning WT RARRES1 cDNA amplified by PCR into the SacI / BamHI restriction site using the pAcGFP-Cl vector (Clontech). The GST-RARRES1:269-294aa construct was generated by subcloning PCR-amplified RARRES1:269-294aa cDNA into the EcoRI / BamHI site of the pEBG-2T-GST vector. Mutagenic products were generated using the QuickChange or Q5 site-directed mutagenesis kit according to the manufacturer's instructions, and include the following:

[0125] The primers used for mutagenesis of the RARRES1-Y162A (160LLAKQ164) and 3KA (147-153 mut) (147RLIEAAA153) mutations, GST-RAARRES1: 269-294aa, and the non-phosphorylationable mutation of Thr273 (T273A) are shown in Table 1 below. All sequences were verified via automated DNA sequencing. For virus generation, H2B isolate was subcloned and inserted into a pMSCVpuro retroviral vector containing multiple replication sites, which was generated using the BgH I / EcoRI restriction site as a modified version of the pMSCVpuro vector (Addgene).

[0126] 【Table 11

[0127] Mutation Sequence (5' — 3' ) Tm (°C) RARRES1- sense caagaggattacctgcttgccaagcaaatgaagcaac (sequence number

[0128] Y162A 21)

[0129] ant isense gttgcttcatttgcttggcaagcaggt aatcctcttg (sequence number 60

[0130] 22)

[0131] RARRES1- sense ggcaagacaacaagaggattacctg (sequence number 23)

[0132] 147- 153mut ant isense gctgcctcgatgagccgtgtaca (sequence number 24) 62

[0133]

[0134] [Table 2]

[0135] Sequence name amino acid DNA

[0136] RARRES1 1-269 (RARRES1AC) Sequence No. 14 Sequence No. 48 RARRES1 43-269 Sequence No. 15 Sequence No. 49 (RARRES1AN,C )

[0137] RARRES1 51-294 (RARRES1AN) Sequence No. 16 Sequence No. 50 RARRES1 269-294 Sequence No. 17 Sequence No. 51

[0138]

[0139] RARRES1 270-284 Sequence No. 18 Sequence No. 52

[0140] Reference Example 3. Immunoprecipitation (IP)

[0141] Cells were lysed in TAP buffer (25 mM Tris, 140 mM NaCl, 0.5% NP-40, 10 mM NaF, 1 mM DTT, 1 mM phenylmethylsulfonyl fluoride (PMSF), 1 mM EDTA, 1 mM Na3V04, 1 mM p-glycerophosphorus, 10% glycerol and 0.2% protease inhibitor cocktail and phosphate hydrolase inhibitor; pH 7.4) and then sonicated (Cosmo Bio, Bioruptor). The protein concentration of the lysate was quantified using a BCA protein assay kit (Pierce). Whole cell lysates were incubated overnight or for 4 hours in 4T with the primary antibody against Ni-NTA (QIAGEN) or RARRES1 (R&D Systems, AF4255), normal goat IgG (Santa Cruz, SC-2028), agarose-conjugated CDKKS (Santa Cruz, SC-54 AC), or normal mouse IgG-agarose (Santa Cruz, SC-2343); then, the lysates were washed with TAP buffer, suspended in 2x Laemml i-buffer (4% sodium dodecyl sulfate (SDS), 20% glycerol, 10% 2-mer captoethanol, 0.2 M DTT, 0.004% bromophenol blue, 0.125 M Tris-HCl; pH 6.8), boiled for 5 minutes, and then subjected to SDS-polyacrylamide gel electrophoresis (SDS-PAGE). Turned on when applied.

[0142] Reference Example 4. Liquid chromatography—mass spectrometry (LC—MS)

[0143] RARRES1-transfected HEK293 cells were immunoprecipitated with IgG (Santa Cruz, SC-2028) or anti-RAARRES1 antibody (R&D Systems, AF4255) and then analyzed by LC-MS. Proteins from samples excised from Coomassie-stained polyacrylamide gel slices were reduced with 10 mM dithiothreitol (DTT), alkylated with iodoacetamide, and then digested with trypsin at 37T for 12 hours. Digested peptides were desalted using C18 spin columns (Thermo Fisher Scientific) and analyzed using a Q Exactive hybrid quadr upo 1 e-or bi-trap mass spectrometer (Thermo Fisher Scientific) connected to an Ult iMate 3000 RSLCnano system (Thermo Fisher Scientific). Peptides were loaded onto a trap column (100 pm x 2 cm) filled with Acclaim PepMaplOO C18 resin, separated in an analysis column (EASY-Spray column, 75 pm x 50 cm; Thermo Fisher Scientific), and then ionized with a nano ESI source. The Q Exactive Orbitrap mass spectrometer operated in the top 10 data-dependent modes. The entire MS scan was collected in the 300–2,000 m / z range with a resolution of 70,000 (at m / z 200). The Auto Gain Control (AGC) target value was 1.00E+06. The 10 most intense peaks with charge state 2 were fragmented in a high-energy collision dissociation (HCD) collision cell with a normalized collision energy of 25, and the tandem mass spectra were collected at m / z 200 with a resolution of 17,500 using an Orbitrap mass spectrometer. Database search for all raw data files is Proteome Discoverer 2.The procedure was performed using the software (Thermo Fisher Scientific). SEQUEST-HT was used to search the SwissProt Homo sapiens database. Additionally, searches were performed on the corresponding reverse database to evaluate the False Discovery Rate (FDR) of peptide identification. The database search parameters were as follows: precursor ion mass tolerance, 20 ppm; fragment ion mass tolerance, 0.08 Da; fixed variant, carbamidomethylcysteine; variable variant, methionine oxidation. Results were filtered for high peptide confidence, with an FDR of less than 1% at the peptide level.

[0144] Reference Example 5. Imaging of a living cell

[0145] Cell division dynamics were investigated in HEK293 cells infected with pAcGFP-C1 (GFP-Ctr 1) or pAcGFP-Cl-RARRES1 (GFP-RARRES1). Images were captured every 10 minutes for 2 days (Carl Zeiss), and phase-contrast images were used to determine the phases of cell division. To measure isolate enzyme activity, live cell imaging was performed after infecting Rarresl WT and Rarresl- / - MEE cells with the H2B isolate enzyme sensor retrovirus (40 pg / wel l, Lab-Tek II chamber (Nunc)). Images were acquired at 5-minute intervals using an LSM780 microscope with a 20x objective lens and analyzed quantitatively using ZEN blue 3.1 software. Fluorescence density within the nuclear region was measured in mCherry and eGFP images using a freehand tool, and the mCherry / eGFP ratio was calculated before and after sister chromatin separation (anaphase onset, time 0). After the onset of metaphase, the mCherry / eGFP ratio was calculated using the average fluorescence of the two daughter cells. For cell cycle duration measurements, Rarresl+ / +;Fucci2aKI / + and Rarresl- / -;Fucci2aKI / + MEE cells were seeded in a glass-bottom Lab-Tek II chamber, and images (2x2 tier scan and Z-stack) were acquired every 20 minutes using a 20x objective lens with an LSM880 microscope. Nuclear fluorescence intensity measured using a freehand tool was recorded in mCherry and Venus images. The G1 time point was defined as the time from immediately after cell division until just before yellow fluorescence appeared, the G1 / S stage was indicated by the appearance of yellow fluorescence, and the S / G2 / M time point was defined as the time from immediately after yellow fluorescence was converted to green fluorescence until the time of the second cell division.

[0146] Reference Example 6. Immunoblotting

[0147] Cells were lysed in lysis buffer (20 mM Tr is, 5 mM EDTA, 10 mM Na4P2O7, 10 mM NaF, 1% NP-40, 1 mM PMSF, 0.2% protease inhibitor cocktail and phosphatase inhibitor; pH 7.4) on ice for at least 30 minutes. The protein concentration of the cell lysate was quantified using a BCA protein assay kit. Subsequently, the protein lysate was resuspended in loading buffer, boiled for 5 minutes, and then transferred to a nitrocellulose membrane (GE Healthcare) via SDS-PAGE. The membrane was blocked in triple-buffered saline containing Tween 20 (TBS-T) and 5% skim milk at room temperature for 20 to 30 minutes, and then incubated overnight with the primary antibody at 4T. Afterward, the membrane was washed three times with TBST and incubated with secondary antibodies at room temperature for 2 hours. Protein expression was measured by chemiluminescence using Super Signal West Pico Chemi luminescent Substrate (Pierce). The major antibodies used are shown in Table 3. As secondary antibodies, HRP (horse radish peroxidase) conjugated anti-mouse IgG (Jackson ImmunoResearch, 315-035-045), anti-rabbit IgG (Jackson ImmunoResearch, 111-035-144), anti-goat IgG (Invi trogen, 611620), and anti-rat IgG (Jackson ImmunoResearch, 112-035-175) were used.

[0148] [Table 3]

[0149] Antibody Cat no. Company

[0150] RARRES1 AF4255 R&D Systems

[0151] CDK1 SC-54 Santa Cruz

[0152] CDK1 abl31450 Abeam

[0153] Beta-act in A5441 Sigma-Aldrich

[0154] Alpha-tubul in T6199 Sigma-Aldrich

[0155] p62 610832 BD

[0156] Cathepsin D (CTSD) ab6313 Abeam

[0157]

[0158] CHIP #2080 Cel 1 Signal ing TechnologyHSPA1B #4873 Cel 1 Signal ing Technology HSPA1B MA3014 Invitrogen

[0159] LAMP1 ab24170 Abeam

[0160] LAMP2A abl8528 Abeam

[0161] VPS4 SC-133122 Santa Cruz

[0162] Cycl in E SC-481 Santa Cruz

[0163] Cycl in E SC-248 Santa Cruz

[0164] Cycl in DI SC-246 Santa Cruz

[0165] Cycl in Bl #4135 Cel 1 Signal ing Technology PD-L1 #13684 Cel 1 Signal ing Technology

[0166] PD-L1 MAB90781 R&D Systems

[0167] AMPKa #2532 Cel 1 Signal ing Technology Pho spho - AMPKa ( Thr 172 ) #2535 Cel 1 Signal ing Technology

[0168] E-cadher in #3195 Cel 1 Signal ing Technology

[0169]

[0170] GST LF-PA0189 Abfront ier

[0171] Reference Example 7. Microscale Thermophoresis (MST) Analysis To measure the binding affinity of CDK1 to GFP-tagged RARRES1 or free GFP, an MST analysis was performed. For the purified full-length CDK1 protein, CDK1 was cloned and inserted into a modified pFastBac vector with an N-terminal HislO-tagged and expressed in Sf9 insect cells (Life Technologics) using the pFastBac baculovirus system (Thermo Fisher Scientific). Cells were lysed in a buffer containing 20 mM Tris-HCl (pH 7.9), 500 mM sodium chloride, 50 mM imidazole, 5% glycerol, 5 mM p-mercaptoethanol, ImM PMSF, and 0.5% NP-40 using a microscale fluidizer (Micronox) and then centrifuged (25,400 xg). CDK1 protein was purified by a two-step chromatography method using a HiTrap Chelating HP column (GE Healthcare) and a Hi Load 16 / 60 Super dex 200 column (GE Healthcare) equilibrated with Buffer A (20 mM sodium phosphate (pH 6.8), 200 mM NaCl, 5% glycerol, and 2 mM Tris(2-carboxyethyl phosphine). HEK293 cells were infected with pAcGFP-C1 (control) or pAcGFP-Cl-RARRES1, and the cell lysates were diluted with lysates from uninfected HEK293 cells to achieve final concentrations that are similar in fluorescence signal of the GFP-tagged proteins and significantly higher than the detection limit of the Monolithic NT.115 instrument (NanoTemper Technologics). Lysates from untransfected HEK293 cells were used to evaluate background fluorescence because no background fluorescence was detected even in the undiluted lysates.CDK1 (192 pM) was diluted 1:1 in 10 oz of buffer A, and a similar two-fold dilution series of 16 samples was generated. 10 microliters of each cell lysate were mixed with 10 oz of CDK1 protein at various concentrations ranging from 192 pM to 5.86 nM and incubated at room temperature for 10 minutes prior to MST analysis. GFP-RARRES1-CDK1 and GFP-CDK1 solutions were loaded into NT.115 standard-coated capillaries (NanoTemper Techno logics), and MST was performed with parameters of 25°C, 40% LED excitation power, and 60% MST power. Fluorescence signals were monitored for 20 seconds during thermophoresis, and changes in fluorescence were analyzed through thermophoresis with temperature jumps (T-jumps). The KD was calculated by fitting the standard coupling curve to the average of three independent dilution series (n = 3; mean sd).

[0172] Reference Example 8. RT-PCR and Real-time PCR

[0173] Total effluent was extracted from cells using TRIzol reagent, and 1 pg of it was reverse transcribed into cDNA using Superscript® III reverse transcriptase (Invitrogen) according to the manufacturer's instructions. Real-time PCR was performed using Light Cycler 480 SYBR Green I Master Mix (Roche, 04707516001) and a Light Cycler 96 instrument (Roche), and relative gene expression was evaluated using Light Cycler 96 SW1.1 software (Roche). RT-PCR (Table 4), real-time PCR (Table 5), and genotyping PCR (Table 6) were performed using the primers listed in the table below.

[0174] [Table 4]

[0175] Gene Sequence (5' — 3') Tm Product size (°C) (bp) Rarresl sense gcgctgcacttcttcaactt (Sequence No. 29) 60 506

[0176] ant isense agaacagtgaagtcaaagt cgatg(sequence number

[0177] 30)

[0178] Rarresl sense gcgctgcacttcttcaactt (sequence number 29) 60 653

[0179] ant isense gccatagctgatgcttccat (sequence number 31)

[0180] Act in sense acggccaggtcatcactattg(sequence number 60 87

[0181] 32)

[0182] ant isense cacaggat t ccat acccaagaag(sequence number

[0183] 33)

[0184] Gapdh sense tgcaccaccaactgctta (sequence number 34) 60 177

[0185]

[0186] ant isense ggatgcagggatgatgttc (sequence number 35)

[0187] [Table 5]

[0188] Gene Sequence (5' — 3') Tm Product size (°C) (bp) CDK1 sense caggatgtgcttatgcagga (Sequence No. 36) 60 338

[0189] ant isense gctgaccccagcaatacttc (sequence number 37)

[0190] GAPDH / sense tgcaccaccaactgctta (sequence number 34) 60 177 Gapdh

[0191]

[0192] ant isense ggatgcagggatgatgttc (sequence number 35)Cdkl sense ttgaaagegaggaagaagga (sequence number 38) 60 195

[0193]

[0194] ant isense aatccatgaactgcccagga (sequence number 39)

[0195] [Table 6]

[0196] Gene Sequence (5' — 3') Tm Product size (°C) (bp) Wi ld-type Pl ctgggttctagccagtttacagtt (Sequence No. 40) 60 593 al lele P2 actcagctttgggtagcattagtc (Sequence No. 41)

[0197] Knock-out P3 cagttggtctggtgtcaaaaataa (sequence number 42) 60 478 al lele P4 ctcaggttctagacttccctgaaa (sequence number

[0198]

[0199] 43)

[0200] Reference Example 9. Immunofluorescence

[0201] Cells were plated on coverslips and fixed with methanol on ice for 5 minutes. Cells were blocked in PBS with 3% BSA at room temperature for 30 minutes and incubated overnight with primary antibodies in 4T. The primary antibodies used were as follows: anti-CDKl (Santa Cruz, SC-54 and Abeam, abl31450), anti-LAMP1 (Abeam, ab24170), and anti-cycl inBl (Cel 1 Signaling Technology, #4135). After PBS washing, cells were incubated with secondary antibodies (anti-mouse A488, A594, and A647; anti-rabbit A594; Life Technologics) at room temperature for 2 hours. After staining the nuclei with 0.5 pg / ml 4',6-diamidino-2-phenylindole (DAPI), coverslips were mounted with ProLong Gold anti-discoloration reagent (Life Technologics), and slides were observed using a confocal microscope (LSM780 or LSM880 Airyscan, Carl Zeiss). Reference Example 10. Proximity ligation assay (PLA)

[0202] For protein-protein interaction analysis, HEK293 cells were seeded onto coverslips and co-transfected with His-CDKl and RARRES1 WT or Y162A. After 24 hours, cells were fixed with 4% paraformaldehyde (PFA) for 15 minutes at room temperature, followed by permeation with cold methanol for 20 minutes at 4T. The Duo ink In Situ Orange Starter Kit (Sigma-Aldrich, DU092102) was used according to the manufacturer's instructions. For the primary antibodies, mouse anti-His-Tag (#2366, 1:200:Cel 1 Signaling Technology) and rabbit anti-LAMP2A (abl8528, 1:200:Abeam) were used. After collecting images using a confocal microscope (LSM880, Carl Zeiss), the number of PLA puncta was calculated using ZEN blue 3.1 software (Carl Zeiss).

[0203] Reference Example 11. Modeling and Docking. Docking studies were performed using Glide software from the Schrodinger suite 2021-02. The structure of the receptor CDK1 (Protein Data Bank ID: 4YC6) was prepared by removing ligand and water molecules from the structure using the Protein Preparation Wizard. The deleted regions (amino acids 155–158) from the CDK1 structure were modeled using Prime in the Schrodinger suite. Using the receptor grid generation panel in Glide, a grid box suitable for peptide docking was generated with a size of 36 A x 36 A x 36 A to create a grid box covering most of the CDK1 structure. The structure of the RARRES1 peptide, which is phosphorylated at Thr273 and spans from Glu270 to Ser284 as the ligand, was prepared using LigPrep with 0PLS4 force field. Docking was performed using Glide's ligand docking tool in SP-peptide precision mode suitable for peptide docking, and the docking results were evaluated using molecular dynamics (MD) simulations.

[0204] Reference Example 12. Molecular Dynamics (MD) Simulation

[0205] The complex model for CDK1 and RARRES1 peptides from the docking results was prepared using the Protein Preparation Wizard in Schrodinger suite 2021-02. All MD simulations were implemented using Desmond in Schrodinger suite 2020-4. Periodic boundary conditions using a buffered orthorhombic box at a distance of 10 A x 10 A x 10 A were applied to the explicit solvent simulations. For the solvation of the system, water and 150 mM NaCl were added according to the TIP3P water model after the system was electrically neutralized with sodium (or chloride) ions. After the solvated system was relaxed and the energy was minimized for 100 ps, ​​MD simulations were performed using an NPT (isothermal and isobaric simulation) ensemble. Here, the Martyna-Tobias-Klein method Nose-Hoover thermostat was adopted for isotropic pressure (latm) and constant temperature (300 K), respectively. This system was simulated for 300ns at 0PLS2005 force field. MD simulation trajectories were saved at 300ps intervals and analyzed using Desmond's Simulation Interaction Diagram tool.

[0206] Reference Example 13. Reverse Transcription Virus Transmission and Infection

[0207] Platinum-E reverse transcriptase virus-packaged cells (Cel l Biolabs, RV-101) in 6 x 10 10cm dishes 6Cells were inoculated at a cell density into whole DMEM (10% FBS and 1% penicillin / streptomycin) containing 10 pg / ml blasticidin and 1 pg / ml puromycin. The following day, the cells were transfected with the pMSCVpuro-H2B isolase reverse transcriptase virus vector using antibiotic-free whole DMEM and a solution containing 10% FBS. The supernatant containing the reverse transcriptase virus was collected 2 days after transfection and concentrated using a Retro-X™ concentrator (Clontech) according to the manufacturer's instructions. Briefly, the supernatant was filtered through a 0.45 pm filter and mixed with the Retro-X concentrator (3:1 ratio) overnight at 4T. After centrifugation (1,500xg), the supernatant was removed, and the resulting pellet was resuspended in PBS. MEE cells were exposed to a virus containing 8 pg / ml polybrene to increase virus delivery efficiency.

[0208] Reference Example 14. Cell proliferation

[0209] MEE cells were seeded in 48-well plates at a density of 1 x 10³ cells per well and quadrupled for 5 consecutive days. For reconstitution experiments, double-planted MEE cells were cultured triple-planted in 24-well plates and counted on day 3. Cells were fixed with 4% PFA for 10 minutes at RT, treated with 0.5% Triton X-100 for 5 minutes at RT, and stained with 0.5 pg / ml DAPI for 10 minutes at RT. Cell growth was measured using a Cytation 3 instrument (BioTek), and the total number of cells was counted using Gen5 data analysis software (version 2.09.1).

[0210] Reference Example 15. Reconfiguration of RARRES1

[0211] To reconstitute human RARRES1 into K0 (knockout) MEE cells, cells were seeded in 10 cm dishes at a concentration of 2 x 10⁵ cells / dishes. The following day, plasmid DNA (pcDNA3.1 or pcDNA3.1-RARRES1) was infected using Lipofectamine 3000 reagent, followed by a second infection two days later. Twenty-four hours after the second infection, cells were seeded into 6-well or 24-well plates for sphere formation analysis or cell growth analysis, respectively. Cell growth was measured four days after the second infection using a Cytation 3 instrument (BioTek).

[0212] Reference Example 16. Sphere Formation Analysis

[0213] RARRES1 was reconstituted for sphere formation analysis, and cells were prepared as previously described. The diameter of the spheres was measured on the 5th day of culture.

[0214] Reference Example 17. PET / CT image

[0215] Axial raw data were acquired from a PET scanner 60 minutes after intravenous injection of FDG (370 MBq) during the interstitial period, and the acquisition time was approximately 20 minutes. Axial images were reconstructed using a Shepp-Logan filter (cutoff frequency, 0.35 cycles per pixel) and realigned in the coronal and sagittal planes. The spatial resolution was 6.1 x 6.1 x 4.3 mm (GE Healthcare, eXplore Vista-CT). Reference Example 18. Histopathological and immunohistochemical analysis

[0216] All tissues collected from mice were immediately fixed in 10% neutral buffered formalin, and paraffin-contaminated tissue sections were placed on silicone-coated slides to remove the paraffin and rehydrate. Hematoxylin and eosin (H&E) staining was used for histopathological diagnosis.

[0217] Reference Example 19. Genetically modified knockout mouse model

[0218] ES cell clones carrying the tmla allele of the murine Rarresl gene were purchased from the Knockout Mouse Project (KOMP) repository. Rarresl* 1 丄 1 Mice were generated by microinjection of ES cells. The Rarresl~mi \ 1 allele was generated by crossing a mouse expressing Cre (zp3-Cre; The Jackson Laboratory, strain 003651) with a Rarresl tmla / + mouse.

[0219] Rarresl'; Fucci 2 mice 1 / + Mice were generated by breeding Rarresl 1 / + ~ mice with Fucci2 mice (52) for cell cycle analysis. Genotypic primers used to amplify WT and null alleles are listed in Table 5. + / The mouse model maintained a C57BL / 6 genetic background and all animal studies and procedures were approved by the Institutional Animal Care and Use Committee (IACUC) of the National Cancer Center (NCC-11-138). See Reference 20. Statistical Analysis

[0220]

[0221] ​All statistical analyses were performed using GraphPad Prism 10. Normal values ​​were expressed as mean SD or mean SEM. P-values ​​for normally distributed data were determined using unpaired two-sided Student's t-tests for group comparisons. For non-normally distributed data, nonparametric analyses were performed using the Mann-Whitney test or one-way analysis of variance (AN0VA). Survival data were analyzed using the Log-rank (Mantel-Cox) test. All P-values ​​are shown in the figure, and values ​​<0.05, <0.01, and <0.001 were considered significant.

[0222] Experimental Example

[0223] Experimental Example 1. Confirmation of CDK1 activation by RARRES1

[0224] 1.1 Verify CDK1-RARRES1 binding

[0225] First, to confirm the role of RARRES1, cell lysates of HEK293 cells overexpressing RARRES1 were immunoprecipitated (IP) with IgG (Santa Cruz, SC-2028) or anti-RARRES1 antibody (R&D Systems, AF4255). Subsequently, proteins were excised from polyacrylamide gel slices, and proteolytic peptides were analyzed by liquid chromatography-mass spectrometry (LC-MS). Proteins that bind to the RARRES1 antibody at more than twice the rate of IgG, as indicated by LC-MS, were analyzed using the David functional annotation tool, and the results are shown in Figure 1.

[0226] As shown in Figure 1, CDK1 and its substrate proteins were found to be part of the RARRES1 binding protein family involved in various activities including DNA replication, RNA processing, the cell cycle, and mitosis.

[0227] After confirming that CDK1 could be a major functional partner of RARRES1, microscale thermophoresis (MST) measurements of the affinity of purified CDK1 protein were performed to confirm the direct interaction between CDK1 and RARRES1, and the results are shown in Figure 2.

[0228] As shown in Figure 2, CDK1 bound to purified CDK1 protein in vitro with a dissociation constant (KD) of 64.6 pM and 33.3 pM.

[0229] 1.2 Confirmation of the effect of RARRES1 on CDK1 protein expression levels

[0230] After confirming that RARRES1 binds to CDK1 in Experimental Example 1.1, the effect of RARRES1 on the function or activation of CDK1 was investigated.

[0231] First, the results of quantifying CDK1 mRNA expression in RARRES1-transfected HEK293 cells and MEE cells with RARRES1 knockout (K0) (Rarres1- / - MEE) and measuring the protein levels of CDK1 by performing Western blotting for CDK1 in each cell lysate are shown in Figure 3.

[0232] As shown in Figure 3, even if CDK1 mRNA expression did not change significantly, overexpression or depletion of RARRES1 could affect CDK1 protein levels.

[0233] Accordingly, the effect of RARRES1 on CDK1 protein levels was investigated. Specifically, the results of Western blot analysis on WT and Rarresl- / - MEE cell lysates following exogenous introduction of RARRES1 and treatment with 200 pM cycloheximide (CHX) (Sigma-Aldr ich) are shown in Figure 4.

[0234] As shown in Figure 4, the protein level of CDK1 decreased in a dose-dependent manner after expression with RARRES1 and remained higher in Rarresl- / - MEE cells than in WT cells for up to 9 hours after CHX treatment. These results indicate that RARRES1 binds to CDK1 and that the amount of CDK1 protein is regulated by RARRES1.

[0235] Experimental Example 2. Confirmation of association with lysosomal protein degradation pathway

[0236] 2.1 Identification of Protein Degradation Pathways

[0237] The underlying mechanism of RARRES1-mediated CDK1 degradation was investigated by administering various protein degradation pathway inhibitors to cells overexpressing both CDK1 and RARRES1. Immunoblot results are shown in Figure 5 after administering 100 nM Baf (Sei Leckchem, S1413), 10 pg / ml E-64d (Enzo, BML-PI107), and 10 pg / ml pepstat in A (Sigma-Aldrich, P5318) as lysosomal inhibitors and 5 pM MG132 (Calbiochem, 474790) as a proteasome inhibitor.

[0238] As shown in Figure 5, treatment with the lysosomal inhibitors baf i lomycin Al (Baf) and E-64d / pepstat in A (E / P) restored RARRES1-dependent CDK1 protein degradation, whereas the proteasome inhibitor (MG132) restored this degradation less. However, RARRES1 itself was stabilized by the lysosomal and proteasome inhibitors.

[0239] Additionally, LC-MS / MS analysis and immunoblot analysis of the lysosomal membrane protein LAMP1 in anti-RARRES1 immunoprecipitates were performed. The results are shown in Figures 6 and 7, respectively.

[0240] As shown in Figures 6 and 7, RARRES1 bound to lysosomal protein degradation pathway-related proteins such as cathepsin D (CTSD), CHIP, and HSPA1B, as well as the lysosomal membrane protein LAMP1. In addition, it was observed that these proteins undergo co-IP (co-IP) when RARRES1 and CDK1 bind to each other.

[0241] 2.2 Investigation of CDK1 Lysosomal Localization

[0242] Whether CDK1 is localized to lysosomes was investigated in cells at various cell cycle stages, and the results are shown in Figure 8.

[0243] As shown in Figure 8, during the late cell cycle, CDK1 in the lysosome was partially co-localized with LAMP1 due to the presence of spots as previously reported.

[0244] 2.3 Confirmation of Selective Autophagy in RARRES1-Dependent Lysosomal Protein Degradation Pathway To confirm whether RARRES1-dependent lysosomal CDK1 degradation is a selective autophagy pathway, the amount of CDK1 protein was determined after depleting VPS4 or LAMP2A by treating with siRNA, and the results of the immunoblot analysis are shown in Figure 9.

[0245] siRNA delivery was performed using the Amaxa Nucleofector (Lonza) according to the manufacturer's instructions, and the sequence was designed as follows:

[0246] - Human LAMP2A : 5 ' - ggcaggaguacuuauucuagu- 3 ' (Sequence No. 44) - Mouse LAMP2A : 5 ' -gcugcagcugaacaucacu- 3 ' (Sequence No. 45)

[0247] - Human VPS4A : 5 ' - ccgagaagcugaaggauua- 3 ' (Sequence No. 46)

[0248] - Control si RNA : 5' - guucagcguguccgag- 3' (Sequence No. 47) .

[0249] As shown in Figure 9, the knockdown of VPS4, which is required for lysosomal microautophagy, did not affect RARRES1-dependent CDK1 protein degradation. The presence of CDK1 protein was observed after the knockdown of LAMP2A, an important component of chaperone-mediated autophagy (CMA). According to the results, overexpression of RARRES1 decreased CDK1 levels, but LAMP2A knockdown partially restored CDK1 levels.

[0250] The above results imply that RARRES1-dependent CDK1 degradation depends on lysosomal protein degradation, specifically lysosome-targeted protein degradation during the late stages of cell division. Furthermore, it implies that RARRES1-dependent CDK1 degradation depends on CMA. In addition, as shown in Figure 8, since the RARRES1 protein was stabilized by proteasome and lysosomal protein degradation inhibitors, these results suggest that RARRES1 stability may be regulated by two pathways. Protein stability was increased by transfection with a specific LAMP2A siRNA, but not by transfection with VPS4 siRNA.

[0251] Experimental Example 3. Confirmation of CDK1 decomposition motif in RARRES1

[0252] 3.1 Confirmation of KFERQ-like motifs in RARRES1

[0253] We investigated the presence of the KFERQ motif within RARRES1, a recognition site essential for chaperone-mediated autophagy (CMA), and confirmed whether KFERQ-like peptides potentially affect CDK1 degradation. The results of the immunoblot analysis on CDK1 are shown in Figure 10.

[0254] As shown in Figure 10, there were two potential KFERQ-like motifs in RARRES1 that met the physical properties required to recognize CMA substrates through post-translational modifications (PTMs), such as phosphorylation (160LLYKQ164) or acetylation (147RLIEKKK153). When these two motifs were transfected with mutants Y162A (160LLAKQ164) and 3KA (147RLIEAAA153) (147RLIEAAA153), it was observed that both RARRES1 mutants were stabilized, but only mutant Y162A (160LLAKQ164) reversed CDK1 degradation.

[0255] 3.2 Verification of the effect of LLAKQ on CDK1

[0256] To further investigate the effect of LLAKQ on CDK1 degradation, cells were co-transfected with His-CDK1, WT RARRES1, or Y162A mutants, and a proximity ligation assay (PLA) between CDK1 and lysosomal proteins was performed 24 hours later, and the results are shown in Figure 11.

[0257] In addition, the results of immunoprecipitation and immunoblotting with an anti-CDK1 antibody on cells co-transfected with CDK1 and RARRES1 WT or Y162A mutations are shown in Fig. 12. As shown in Figs. 11 and 12, CDK1 bound to LAMP2A regardless of the presence of RARRES1. However, this interaction was promoted in the presence of WT RARRES1 and inhibited in cells transfected with the Y162A mutation.

[0258] These results imply that the motif containing LLYKQ of RARRES1, which is conserved throughout vertebrates, promotes CMA, and that CDK1 is a direct substrate of CMA.

[0259] Experimental Example 4. Confirmation of target protein binding motif in RARRES1

[0260] 4.1 Verification of the function of the RARRES1 C-terminal region for CDK1

[0261] To clarify the specific region where RARRES1 interacts with CDK1, the sequence conservation and intrinsic structure of the domain were analyzed. N- and / or C-terminal deletion variants of RARRES1 (residues 1-269, 43-269, and 51-294; RARRES1AC (SEQ No. 14), RARRES1AN,C (SEQ No. 15), and RARRES1AN (SEQ No. 16), respectively) were generated and binding evaluations were performed, and the results are shown in Figure 13.

[0262] As shown in Figure 13, it was confirmed that the C-terminal fragment (residues 269-294) was immunoprecipitated, and while the binding to CDK1 was reduced for RARRES1AN,C and RARRES1AC, the binding to CDK1 was sustained for RARRES1AN, which retained the C-terminal region. These results indicate that the C-terminal region of RARRES1 is essential for binding to CDK1 and is different from its homologous chain, latexin (LXN).

[0263] 4.2 Verification of the Structural Coupling Mode of RARRES1 and CDK1

[0264] First, an analysis of the sequence conservation of the C-terminal region of RARRES1 (residues 269-294, sequence number 17) in vertebrates including humans and mice revealed sequence similarity, particularly in residues 270-284 (Fig. 20). Accordingly, to investigate the mechanism by which RARRES1 binds to CDK1, a docking study was performed using the RARRES1 peptide of the C-terminal region with an inactive CDK1 structure (residues 270-284, sequence number 18). The phosphopeptide of RARRES1 was sequenced using LC-nanospray ionization mass spectrometry (nanoLC-NSI / MS / MS).

[0265] The RARRES1 peptide spanning from Glu270 to Ser284 with Thr273 phosphorylation was docked to the structure of CDK1 (Protein Data Bank ID: 4YC6) using the Schrodinger solution Glide. The RARRES1 peptide is shown as a rod.

[0266] Figure 15 is an image showing a model in which a combined RARRES1-derived peptide or the entire RARRES1 protein can bind based on a schematic cartoon of the entire structure of CDK1 and an electrostatic distribution map of the protein surface.

[0267] As shown in Fig. 15, the RARRES1 peptide was bound to the surface of CDK1 and interacted with the aC helix, activation loop, and catalytic loop, extending from the N-leaf to the C-leaf. It was confirmed that the RARRES1 peptide consists mainly of hydrophilic residues and forms electrostatic interactions with CDK1, and that several glutamate amino acids of the RARRES1 peptide bind to the basic patches on the surface of the CDK1 C-leaf.

[0268] The above results imply that the C-terminus of RARRES1 is an important region for binding to the inactive form of CDK1, and indicate the subtle nature of this protein-protein interaction and its role in the degradation of CDK1 through the KFERQ-like motif (160LLYKQ164) of RARRES1.

[0269] Experimental Example 5. Confirmation of the association between RARRES1-dependent degradation and cell growth

[0270] 5.1 Verification of the effect on CDK1 activity

[0271] First, to determine whether RARRES1-dependent degradation of CDK1 protein affects CDK1 activity, the fluorescence intensity of an H2B dissociation enzyme sensor responding to CDK1 activity in the nuclei of WT and Rarres1- / - MEE cells was measured through living cell imaging, and the results are shown in Figure 16.

[0272] As shown in Figure 16, the relative fluorescence intensity of Rarresl- / - MEE cells increased significantly after the start of chromosome separation (time 0) and remained high even after cell division.

[0273] 5.2 Confirmation of effects on cell cycle progression

[0274] To determine the effect of increased CDK1 activity on cell cycle progression, FUCCI2a mice were crossed with Rarresl+ / - mice (generated by Rarresl+ / +;Fucci2aKI / + or Rarresl- / -;Fucci2aKI / + mice) and the cell cycle was observed. Fluorescence intensity was measured in Rarresl+ / +;Fucci2aKI / + (n=32) or Rarresl- / -;Fucci2aKI / + (n=51) MEE cells via time-lapse imaging, and the results are shown in Figure 17.

[0275] As shown in Fig. 17, Rarresl- / - MEE cells had a shorter cell cycle compared to WT MEE cells. Specifically, the G1 phase was shortened, which accounted for 66% of the total reduction in cell cycle duration. Since the G1 phase of the cell cycle is affected, the binding of CDK1 with G1 cyclin, cyclin D, and cyclin D was further evaluated, and the results of the immunoblot analysis of cyclin D using an agarose-conjugated anti-CDK1 antibody in WT and Rarresl- / - MEE cells are shown in Fig. 18.

[0276] As shown in Figure 18, cyclin E and CDK1 bound better in Rarresl- / - MEE cells than in wild-type cells. However, binding with cyclin E was unaffected. In other words, Rarresl depletion enhances CDK1 activity through an increase in CDK1-cyclin E binding after cell division, which implies that this is similar to what occurs during the cell cycle of ES cells.

[0277] 5.3 Confirmation of effects on cell growth

[0278] Figure 19 shows the results of observing the growth of WT and Rarresl- / - MEE cells for 5 days, as well as the growth of Rarresl- / - MEE cells transformed with an empty vector (pcDNA3.1) or human RARRES1 in DAPI-stained cells using Cytation 3. Confirmation of RARRES1 reconstitution at the mRNA level was performed via RT-PCR.

[0279] As shown in Fig. 19, the growth of Rarresl- / - cells was observed to be greater than that of WT cells, and the growth of cells re-expressing human RARRES1 was observed to be inhibited compared to Rarresl- / - MEE cells transfected with a mock vector. Additionally, to investigate whether increased binding between CDKl-Cycle E and accelerated growth of Rarresl- / - MEE cells contribute to pluripotency, the number and size of cell spheres were observed through spherogenesis analysis, and the results are shown in Fig. 20.

[0280] As shown in Figure 20, the number and size of spheres were significantly increased in Rarresl-deficient MEE cells. Consistent with these results, when Rarresl-nul l MEE cells were reconstituted with human RARRES1, the spheroid-forming ability of the cells decreased compared to control cells transformed with a mock vector.

[0281] These results suggest that RARRES1 can potentially affect the plasticity of epithelial cells by regulating the activity of the CDK1 protein, which ultimately affects cell proliferation.

[0282] Experimental Example 6. Confirmation of the association between Rarresl deficiency and tumor development

[0283] To investigate the functions related to RARRESL proliferation and plasticity under physiological conditions, constitutive Rarresl knockout mice were generated, and their survival rate and tumorigenesis were assessed. Rarresl- / - mice were generated by disrupting the gene locus of exon 3 using the loxP-ZP3 Cre nuclease system and the reporter gene p-galactosidase, the schematic diagram of which is shown in Fig. 21. Whole-genome and RNA sequencing results showed that Rarresl exon 3 was completely deleted and Rarresl mRNA expression was absent, but the mRNA levels of neighboring genes Gfml and Mfsdl were unaffected (Fig. 22). The survival rate of the generated Rarresl- / - mice was assessed and is shown in Fig. 23, and the tumorigenesis was assessed and is shown in Figs. 24 and 25.

[0284] As shown in Figures 23 and 24, compared to wild-type mice, the overall survival rate of Rarresl- / - mice decreased by more than 40% at 18 months of age, and the intensity of 18F-fluorodioxyglucose (FDG) labeling increased significantly in PET-CT images of 14- or 15-month-old Rarresl- / - mice. This finding was consistent with a decrease in survival rate after about 1 year.

[0285] As shown in Figures 24 and 25, Rarresl- / - mice developed various types of spontaneous malignant tumors in endoderm-derived organs, including the lungs, liver, stomach, and thyroid, and benign tumors in the small and large intestines up to 18 months of age (Total, P=0.0099). In contrast, WT mice showed benign tumors in both the lungs and small intestines. Notably, thyroid tumors in Rarresl- / - mice metastasized to the liver. The incidence of lymphoma was nearly threefold higher in Rarresl-deficient mice compared to WT mice (Total, P=0.0107), and disseminated lymphoma occurred only in Rarresl-deficient mice. On the other hand, the incidence of histiocytic sarcoma was similar in both genotypes of mice.

[0286] In other words, tumors caused by Rarres1 deficiency are observed in various organs and progress to malignancy through the development of adenocarcinoma, metastasis, and disseminated lymphoma, and these results indicate that RARRES1 plays a role in tumor suppression.

[0287] Experimental Example 7. Confirmation of the association between Rarresl deficiency and tumor development

[0288] The effect of Rarresl on the regulation of CDK1 protein expression in a precursor population was investigated in mouse lung progenitor cells as follows.

[0289] As shown in Figure 26, the lungs of 18-month-old rats with Rarresl deficiency had 2.3 times more AT2 lineage progenitor cells (NKX2.1 labeled cells) and higher nuclear CDK1 expression (more than 7 times) than the lungs of WT rats.

[0290] As shown in Figure 27, the lungs of Rarresl- / - rats had higher levels of CDK1 and cyclin E proteins than the lungs of WT rats.

[0291] In addition, as shown in Figure 28, the C1 subgroup in the human TCGA-LUAD dataset showed an inverse correlation between CDK1 protein levels and RARRES1 mRNA expression. That is, we found an increase in the progenitor cell population in the normal lung tissue of Rarres1- / - mice.

[0292] To better understand this phenomenon, gene expression profiling in lung adenomas / adenocarcinomas developed in these mice was used to identify the abundance of 24 different lung cell types, as shown in Fig. 29, and stained micrographs and quantitative results of the lung tissue were shown in Fig. 30.

[0293] As shown in Figure 29, tumor samples from Rarresl- / - mice showed a significant abundance of AT2 cells and embryonic lung stem-like cells (pluripotent progenitor cells) (FC 2.8), but most other cell types were similar between Rarresl- / - normal and tumor samples. The abundance of 24 lung cell types known from the TCGA-LUAD dataset was determined. The C1 subgroup with the lowest RARRES1 expression in the human TCGA-LUAD cohort also had the highest proportion of alveolar pluripotent progenitor cells and AT2 cells, which is consistent with the results in the mouse model (FC= 2.7).

[0294] Furthermore, consistent with these data, as shown in Fig. 30, RARRES1 was expressed in cuboidal alveolar epithelial cells of normal tissue adjacent to the tumor, and expression was low in human LUAD tissue.

[0295] The above results indicate that in the absence of RARRES1, degradation via CMA is inhibited, leading to an increase in CDK1 protein levels, which in turn results in vigorous AT2 cell expansion and tumor development.

[0296] Experimental Example 8. Confirmation of PD-L1 expression levels by RARRES1

[0297] 8.1 Confirmation of changes in PD-L1 levels after RARRES1 expression

[0298] First, we checked whether there was a difference in the amount of PD-L1 protein when RA1 was overexpressed using HCT116, a human colorectal cancer cell line with almost no RA1 expression, and the results are shown in Figure 31.

[0299] As shown in Figure 31, it was confirmed that the amount of PD-L1 protein decreased compared to the control group when RA1 was overexpressed.

[0300] 8.2 Confirmation of changes in RA1 and PD-L1 levels after RARRES1 overexpression

[0301] Using HCT116, a human colorectal cancer cell line with almost no RA1 expression, we overexpressed the RAI Y162A gene, which is a variant of RA1's KFERQ like motif, and then checked whether there was a difference in PD-L1 protein amount and ubiquitination, and the results are shown in Fig. 32.

[0302] As shown in Figure 32, the amount of PD-L1 decreased due to RARRES1 overexpression, and at that time, the band of the bigla-like form of RA1 (band near 35 kDa) increased.

[0303] Experimental Example 9. Confirmation of tumor-forming ability after RARRES1 overexpression

[0304] We wanted to determine if there was a difference in tumor-forming ability when RA1 was overexpressed and transplanted into a syngeneic mouse model.

[0305] For tumor cell harvesting, the cells were subjected to two washing steps using opt i-MEM (Gibco) medium, resuspended in opt i-MEM, and passed through a filter once to convert them into single cells. Mouse-derived tumor cells constructed after respiratory anesthesia with isoflurane using 8-12 week old wild type B6 mice were 1xlO 5 100 M was injected subcutaneously into mice using a cel Is insulin syringe. After injecting the tumor cells, the tumor and mouse body weight were measured twice a week. The tumor volume was (shortened) 2 X (long axis) X 0.5 mm 3 The results were calculated and shown in Table 7 and Figure 33.

[0306] [Table 7]

[0307] DAY3 DAY6 DAY10 DAY13 DAY17 DAY20 DAY24 DAY27 Mock 0 0.72 10.10 51.75 112.19 323.77 411.52 568.87 RA1 0 0.61 4.11 11.19 39.65 67.94 171.10 291.91 SD-Mock 0 1.06 8.27 39.73 90.72 220.15 399.27 396.57 SD-RA1 0 1.06 6.38 18.58 75.77 91.37 205.40 454.22

[0308]

[0309] p. value #DIV / O! 0.87 0.24 0.05 0.18 0.03 0.27 0.33 As shown in Table 7 and Figure 33, it was confirmed that tumors formed more slowly in the mouse group transplanted with MC38 cells overexpressing RA1.

[0310] Experimental Example 10. Confirmation of binding between RARRES1 C-terminus and Cycl in Bl

[0311] First, the binding of RARRES1 to Cycl in Bl in HEK293 cells was confirmed by immunoblotting and is shown in Fig. 34, and by intracellular imaging (immunofluorescence) and is shown in Fig. 35.

[0312] As shown in Figure 34, when the binding of RARRES1 and Cycl in Bl was confirmed in HEK293 cells, it was confirmed that Cycl in Bl binds to RARRES1.

[0313] As shown in Figure 35, it was confirmed that Cycl in Bl binds to RARRES1 by confirming that the endogenous Cycl in Bl level decreased in HEK293 cells in the presence of RARRES1, and that the level of Cycl in Bl increased in cells with low expression of RARRES1.

[0314] Additionally, the binding of RARRES1 full length (FL) or truncated mutants (l-269aa, 43-269aa, 51-294aa) to Cycl in Bl in HEK293 cells was confirmed by immunoblotting and is shown in Figure 36.

[0315] As shown in Figure 36, when the binding of Cycl in Bl with RARRES1 full length (FL) or truncated mutants was confirmed in HEK293 cells, the binding of Cycl in Bl was reduced in the mutants with the truncated C-terminus of RARRES1, confirming that the C-terminus of RARRES1 is important for the binding of Cycl in Bl and RARRES1.

[0316] Experimental Example 11. Confirmation of Cycl in Bl expression levels and regulatory pathways mediated by RARRES1

[0317] When RARRES1 was overexpressed in HEK293 cells in a concentration-dependent manner, the expression level of Cycl in Bl was confirmed by immunoblotting and is shown in Figure 37.

[0318] As shown in Figure 37, it was confirmed that the protein level of Cycl in Bl reduced RARRES1 in a concentration-dependent manner.

[0319] Additionally, protein expression of endogenous Cycl in Bl in the presence or absence of RARRES1 was confirmed by immunoblotting after treatment with the lysosomal inhibitor Baf i lomycin Al (BafAl), and this is shown in Fig. 38.

[0320] As shown in Figure 38, when treated with BafAl, a lysosome-mediated degradation inhibitor, the Cycl in Bl protein level was not degraded by RARRES1 and was restored to the level of the empty vector, confirming that RARRES1 regulates Cycl in Bl through the lysosome-mediated degradation process.

[0321] Experimental Example 12. Confirmation of target protein degradation induction using RARRES1 fusion protein. To confirm whether a fusion of the RARRES1 C-terminal deletion and the target binding domain can selectively degrade a specific target protein within a cell, the following experiment was performed.

[0322] First, A549 and NCI-H358 cells were cultured in RPMI 1640 medium containing 10% (v / v) FBS and 1x antibiotic-antifungal solution in a humidified incubator maintained at 37 °C and 5% CO2. For plasmid introduction, Lipofectamine 3000 (Thermo Fisher Scientist ic) was introduced according to the manufacturer's instructions. After performing transfection, the cells were cultured in Opt i-MEM medium to induce serum deficiency conditions.

[0323] RARRES1:1-269 aa expressions were constructed by subcloning PCR-amplified RARRES1 cDNA (GenBank: NM_206963) into the pcDNA3.1 expression vector. Fusion plasmids (RARRES1:1-269 aa-SOS and -BAK1) were constructed by inserting the synthesized S0S1 or BAK amino acid sequences into the C-terminus of the RARRES1:1-269 aa vector. The amino acid sequences of S0S1 and BAK1 used for cloning were SOS, FEGIYRLELLKAEEAN (SEQ No. 19); BAK1, GQVGRQLAI IGDDINRRYDSEFQ (SEQ No. 20), respectively (Fig. 39).

[0324] Cells were lysed in lysis buffer (20 mM Tr is, 5 mM EDTA, 10 mM Na4P2O7, 100 mM NaF, 1% NP-40, 1 mM PMSF, 0.2% protease inhibitor, and phosphatase inhibitor; pH 7.4) on ice for at least 30 minutes. The cell lysate was quantified using BCA Protein Assay Kit, resuspended in loading buffer, and boiled for 5 minutes. The samples were separated by SDS-PAGE and transferred to a nitrocellulose membrane. The membrane was blocked in a solution of TBS-T with 5% skim milk added at room temperature for 30 minutes, and then incubated overnight with the primary antibody at 4°C. After washing the membrane three times with TBS-T, it was incubated with the secondary antibody for 2 hours at room temperature. Protein expression was detected using Super Signal West Pico Chemi luminescent Substrate (Thermo Fisher Scientific).

[0325] As shown in Figure 40, it was confirmed that when an 80S binding chain was fused to the RARRES1 C-terminal deletion (RAI AC), the degradation of the target protein RAS was effectively induced.

[0326] Based on the above results, it was confirmed that CMATAC according to one specific example binds to lysosomes through a moiety containing an amino acid sequence including X1LX3KX5 and binds to proteins such as CDK1, PD-L1, and cyclin Bl through a target protein binding moiety, thereby recruiting target proteins into lysosomes to induce chaperone-mediated autophagy and degrade target proteins. In other words, the CMATAC of the present invention has the potential to be a therapeutic agent for cancer and / or immune diseases by degrading or inactivating proteins closely associated with tumor formation and activation.

[0327] The foregoing description of the present invention is for illustrative purposes only, and those skilled in the art will understand that other specific forms can be easily modified without altering the technical spirit or essential features of the present invention. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims

Scope of the claim

1. As a conjugate for target protein degradation comprising a lysosome-binding moiety and a target protein-binding moiety, The above lysosome-binding moiety is a complex comprising the following amino acid sequence: X1LX3KX5 X1 is L, Q, or R, and , X3 is Y or degrees, and X5 is Q or L.

2. In claim 1, the lysosome binding moiety is a conjugate in which the fragment of RARRES1 contains the amino acid sequence.

3. In claim 1, the lysosome binding moiety is a conjugate comprising a fragment containing the amino acid sequence of LLYKQ (SEQ No. 1).

4. The conjugate of claim 1, wherein the target protein binding moiety comprises one or more of an antibody or its antigen-binding fragment, a ligand, and the C-terminus of RARRES1 that binds to the target protein.

5. The conjugate of claim 1, wherein the target protein is one or more selected from the group consisting of CDK1 and PD-L1.

6. In claim 1, the lysosome-binding moiety and the target protein-binding moiety are connected directly or by a linker, forming a complex.

7. A pharmaceutical composition for the prevention or treatment of cancer comprising a combination of any one of claims 1 to 6, The above target protein is a pharmaceutical composition that is CDK1, CDK4 / 6, Cyc l in DI, Cyc l in B, RAS, EGFR, HER2, VEGFR, MYC, STAT3, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, HIF-la, B7-1, or B7-2.

8. A health functional food for the prevention or improvement of cancer comprising a combination of any one of claims 1 to 6, The above target proteins are CDK1, CDK4 / 6, Cyc l in DI, Cyc l in B, RAS, EGFR, HER2, VEGFR, MYC, STAT3, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, HIF-la, B7-1 or B7-2, health functional food.

9. A pharmaceutical composition for the prevention or treatment of an immune disease comprising a combination of any one of claims 1 to 6, The above target protein is a pharmaceutical composition that is CDK1, CDK4 / 6, Cyc l in DI, Cyc l in B, RAS, EGFR, HER2, VEGFR, MYC, STAT3, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, HIF-la, B7-1, or B7-2.

10. In claim 9, the pharmaceutical composition wherein the immune disease is Sjögren's syndrome.

11. A health functional food for the prevention or improvement of immune diseases comprising a combination of any one of claims 1 to 6, The above target proteins are CDK1, CDK4 / 6, Cyc l in DI, Cyc l in B, RAS, EGFR, HER2, VEGFR, MYC, STAT3, PD-1, PD-L1, CTLA-4, LAG-3, TIM-3, HIF-la, B7-1 or B7-2, health functional food.

Images