Composition for analyzing chemical structure of nucleic acid, method for producing sample for analyzing chemical structure of nucleic acid, and method for analyzing chemical structure of nucleic acid

WO2026164049A1PCT designated stage Publication Date: 2026-08-06YAMASA SHOYU CO LTD
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
YAMASA SHOYU CO LTD
Filing Date
2026-01-26
Publication Date
2026-08-06

Smart Images

  • Figure JP2026002520_06082026_PF_FP_ABST
    Figure JP2026002520_06082026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention enables simple analysis by a method for analyzing the chemical structure of a nucleic acid, the method comprising: (a) a step for obtaining a nucleic acid fragment having a phosphate group at the 3'-end thereof from a nucleic acid to be analyzed; (b) a step for performing a dephosphorylation reaction of the phosphate group present at the 3'-end of the nucleic acid fragment obtained in the step (a); and (c) a step for analyzing the nucleic acid fragment obtained in the step (b) by liquid chromatography.
Need to check novelty before this filing date? Find Prior Art

Description

Composition for Analyzing Chemical Structure of Nucleic Acid, Method for Producing Sample for Analyzing Chemical Structure of Nucleic Acid, and Method for Analyzing Chemical Structure of Nucleic Acid

[0001] The present invention relates to a composition for analyzing the chemical structure of nucleic acid, a method for producing a sample for analyzing the chemical structure of nucleic acid, and a method for analyzing the chemical structure of nucleic acid.

[0002] In recent years, the development of mRNA (messenger RNA) pharmaceuticals, including mRNA vaccines for preventing novel coronavirus and mRNA therapeutic agents, has been actively carried out. mRNA acquires functions such as stability and translational activity expression by taking a Cap structure at the 5'-end. The Cap structure is based on the Cap0 structure in which 7-methylguanosine is 5'-5' bonded to the 5'-end (0th nucleotide) of mRNA, and the 2'-position of each ribose of the subsequent 1st, 2nd, 3rd, and 4th nucleotides is modified with an O-Methyl group. The mRNA is called Cap1 structure, Cap2 structure, Cap3 structure, and Cap4 structure, respectively, and the mRNA having Cap0 structure to Cap4 structure is called Cap0-type mRNA to Cap4-type mRNA, respectively.

[0003] As a method for analyzing the chemical structure of mRNA, there are known a method of cleaving an arbitrary position at the 5'-end of mRNA using RNase H and analyzing the terminal fragment by LC (Patent Document 1, Non-Patent Document 1), and a method for analyzing the Cap structure by denaturing polyacrylamide gel electrophoresis and LC-MS (Non-Patent Document 2).

[0004] Japanese Patent Publication No. 2024-520636 International Publication No. 2017 / 098468 Japanese Unexamined Patent Application Publication No. 2021-145616 Japanese Patent Publication No. 2001-518292

[0005] RNA. 2022 Aug; 28(8):1144-1155. doi: 10.1261 / rna. 079173.122. Epub 2022 Jun 9. Nat Commun. 2023 May 11;14(1):2657. doi: 10.1038 / s41467-023-38244-8. Proc Natl Acad Sci USA. 1997 Apr 29;94(9):4262-6. doi: 10.1073 / pnas. 94.9.4262. Nucleic Acids Res. 2002 Jun 15;30(12):e56. doi: 10.1093 / nar / gnf055. J Am Chem Soc. 2005 Sep 28;127(38):13124-5. doi: 10.1021 / ja0533702.

[0006] The inventors of this invention have identified a problem with conventional methods for analyzing the chemical structure of the 5' end of nucleic acids: they involve complicated and difficult steps, such as determining the assignment of peaks in mass spectrometry, making it impossible to analyze the chemical structure of the 5' end of nucleic acids without using advanced analytical instruments.

[0007] Furthermore, in mRNA synthesis methods, when RNA is synthesized by adding chemically synthesized capping reagents called Cap analogs as substrates during RNA synthesis, the resulting RNA is either uncapped or capped with the Cap analog. Therefore, a system capable of separating and analyzing these is sufficient. However, considering mRNA synthesis by enzymatic capping reactions, for example, if the target Cap is of type Cap2, then intermediate Cap0 and Cap1 mRNAs are impurities. Therefore, the development of more efficient separation methods for separating and analyzing these impurities is required.

[0008] In other words, the object of the present invention is to provide a simple method for analyzing the chemical structure at the 5' end of nucleic acids that does not require advanced analytical equipment and can analyze only the target Cap isomer, as well as a composition used in the analysis method and a method for producing an analytical sample.

[0009] The inventors of this invention discovered that the chemical structure at the 5' end of a nucleic acid to be analyzed can be easily analyzed by performing a dephosphorylation reaction of the phosphate group located at the 3' end of the nucleic acid to be analyzed. Based on this finding, they proceeded with further investigations and completed the present invention.

[0010] In other words, the present invention relates to a composition for analyzing the chemical structure of nucleic acids, characterized by containing a dephosphorylation composition for the phosphate group located at the 3' end of a nucleic acid.

[0011] The present invention also relates to a method for producing a sample for chemical structure analysis of nucleic acids, comprising the steps of (1) obtaining a nucleic acid fragment having a phosphate group at the 3' end from a nucleic acid to be analyzed, and (2) performing a dephosphorylation reaction of the phosphate group present at the 3' end of the nucleic acid fragment obtained in (1), characterized in that step (2) is performed after step (1), or steps (1) and (2) are performed simultaneously.

[0012] Furthermore, the present invention relates to a method for analyzing the chemical structure of nucleic acids, comprising the steps of: (a) obtaining a nucleic acid fragment having a phosphate group at the 3' end from a nucleic acid to be analyzed; (b) performing a dephosphorylation reaction of the phosphate group present at the 3' end of the nucleic acid fragment obtained in (a); and (c) analyzing the nucleic acid fragment obtained in (b) by liquid chromatography, characterized in that step (b) is performed after step (a) or (a) and (b) are performed simultaneously.

[0013] The present invention provides a simple method for analyzing the chemical structure at the 5' end of nucleic acids, as well as a composition used in the analysis method and a method for producing analytical samples.

[0014] Figure 1 is a chromatogram showing the separation of mRNA cleavage ends with various Cap structures in LC in Example 1. Figure 2 is a superimposed view of the chromatograms shown in Figure 1, with adjusted retention times. Figure 3 is an LC chromatogram from Example 2 when the capping efficiency in co-transcription capping using ARCA was measured using the method of the present invention. Figure 4 is an LC chromatogram from Example 2 when the capping efficiency in co-transcription capping using Clean Cap AG was measured using the method of the present invention. Figure 5 is an LC chromatogram from Example 2 when the capping efficiency in co-transcription capping using Clean Cap AG 3'OMe was measured using the method of the present invention.

[0015] The embodiments of the present invention will be described in detail below. The present invention is not limited to the embodiments described below, and it should be understood that modifications, improvements, etc., made to the embodiments described below, based on the ordinary knowledge of those skilled in the art, without departing from the spirit of the invention, also fall within the scope of the present invention.

[0016] <Definition of Terms> In this specification, "nucleic acid" refers to the collective term for ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). In this specification, when "nucleic acid" is used simply, it does not include ribonucleotides and deoxyribonucleotide monomers.

[0017] In this specification, "ribonucleic acid (RNA)" refers to a basic structure consisting of ribonucleotides with ribose as the sugar component, and taking the form of a polynucleotide, which is a chain of nucleotides. RNA in this specification includes not only nucleotides with a base structure selected from four types: adenine, guanine, cytosine, and uracil, but also those that contain modified nucleotides such as pseudouridine or 2'-O-methylated nucleotides as constituent elements, those that have a modified structure in part (for example, those with a Cap0 structure, Cap1 structure, Cap2 structure, Cap3 structure, Cap4 structure, or more methylated structures at the 5' end), those that have phosphate diester bonds as the mode of bonding between nucleotides, and those that have bonding modes other than phosphate diester bonds as the mode of bonding between nucleotides (for example, phosphorothioate bonds).

[0018] RNA is classified into various types based on its function, including mRNA (RNA that is translated), non-coding RNA (ncRNA), ribosomal RNA (rRNA), a component of ribosomes, transfer RNA (tRNA), which carries amino acids to ribosomes during translation, small nuclear RNA (snRNA), small nucleolar RNA (snoRNA), microRNA (miRNA), short interacting RNA (siRNA), PIWI-interacting RNA (piRNA), and antisense oligoRNA. However, in this specification, RNA is a concept that encompasses all of the above RNA types. Furthermore, RNA in this specification also includes fragments of the above RNAs.

[0019] In this specification, "deoxyribonucleic acid (DNA)" refers to a basic structure consisting of deoxyribonucleotides with deoxyribose as the sugar component, and which takes the form of a polynucleotide, a structure in which nucleotides are linked together. In this specification, DNA includes not only nucleotides with a base structure selected from four types: cytosine, guanine, adenine, and thymine, as in RNA in the previous section, but also DNA containing modified deoxyribonucleotides, DNA with some modified structures, DNA with phosphate diester bonds as the bonding mode between deoxyribonucleotides, and DNA with bonding modes other than phosphate diester bonds (e.g., phosphorothioate bonds) as the bonding mode between nucleotides. Furthermore, DNA in this specification also includes functional and structural classifications such as dsDNA and ssDNA, as well as fragments of the above-mentioned DNA.

[0020] Furthermore, the nucleic acids in this specification may contain, in addition to ribonucleotides and deoxyribonucleotides, unnatural nucleotides such as cross-linked nucleotides as constituent units of polynucleotides.

[0021] In this specification, "mRNA" means RNA that is known to be translated or is presumed to be translated.

[0022] In this specification, "5' end" and "3' end" refer to the fragments obtained by cleaving and fragmenting the nucleic acid to be analyzed by any method, specifically the fragments consisting of the polynucleotide that constituted the 5' end and the fragments consisting of the polynucleotide that constituted the 3' end, respectively. Furthermore, "5' end" refers to the chemical structure located at the 5' position of the leading nucleotide of the nucleic acid to be analyzed or the polynucleotide that constitutes the fragment obtained by fragmentation, and "3' end" refers to the chemical structure located at the 3' or 2' position, respectively.

[0023] In this specification, "the 5' end of the nucleic acid to be analyzed" means the nucleic acid or nucleic acid fragment from 3 to 100 mer from the first base of the 5' end of the nucleic acid to be analyzed, unless otherwise defined, such as "the phosphate group located at the 3' end of the nucleic acid to be analyzed" below. Similarly, "the 3' end of the nucleic acid to be analyzed" means the nucleic acid or nucleic acid fragment from 3 to 100 mer from the last base of the 3' end of the nucleic acid to be analyzed.

[0024] In this specification, "phosphate group located at the 3' end of the nucleic acid to be analyzed" means a phosphate group that coordinates to the 2' and / or 3' of the ribose of the last base at the 3' end of the nucleic acid to be analyzed.

[0025] In this specification, "dephosphorylation composition for phosphate groups at the 3' end of nucleic acids" means a composition that causes a reaction to remove a phosphate group from a nucleic acid having a phosphate group at its 3' end. In this specification, "dephosphorylation composition for phosphate groups at the 3' end of nucleic acids" includes enzymes generally called phosphatases and compositions that carry out the dephosphorylation reaction based on organic chemical principles.

[0026] In this specification, "2',3' cyclic phosphate diester decomposition composition" means a composition that causes a reaction to remove the 2',3' cyclic phosphate diester structure from a nucleic acid having a 2',3' cyclic phosphate diester structure at its 3' end.

[0027] In this specification, "dephosphorylation activity" means the activity of dephosphorylating the 3' end of RNA or mRNA and mRNA fragments excised therefrom, thereby preparing a 3'-OH structure.

[0028] In this specification, "phosphate monoester hydrolase" means an enzyme defined in EC 3.1.3. X, and "phosphate diester hydrolase" means an enzyme defined in EC 3.1.4. X. "2',3' cyclic phosphate diesterase" means an enzyme that degrades 2',3' cyclic phosphate diesters.

[0029] In this specification, "nucleic acid fragment" means a fragment of nucleic acid that has a base sequence homologous to a portion of the nucleic acid to be analyzed, resulting from the fragmentation of the nucleic acid to be analyzed. Similarly, in this specification, "RNA fragment" means a fragment of nucleic acid that has a base sequence homologous to a portion of the RNA to be analyzed, resulting from the fragmentation of the RNA to be analyzed, and "mRNA fragment" means a fragment of nucleic acid that has a base sequence homologous to a portion of the mRNA to be analyzed, resulting from the fragmentation of the mRNA to be analyzed.

[0030] In this specification, "composition for preparing nucleic acid fragments" means a composition that causes a reaction in which nucleic acid fragments corresponding to a part of the nucleic acid to be analyzed are produced from the nucleic acid to be analyzed.

[0031] In this specification, "2',3' cyclic phosphate diester generating composition" means a composition that causes a reaction to produce a 2',3' cyclic phosphate diester. That is, in this specification, when a composition is described as, for example, a composition for preparing nucleic acid fragments that produces a 2',3' cyclic phosphate diester at the 3' end of a nucleic acid, it means a composition that causes a reaction to produce a nucleic acid fragment from the nucleic acid to be analyzed, which corresponds to a portion of the nucleic acid to be analyzed and has a 2',3' cyclic phosphate diester as the chemical structure at its 3' end.

[0032] In this specification, "deoxyribozyme (DNAzyme)" means single-stranded DNA that can specifically bind to target RNA and cleave the RNA.

[0033] In this specification, "liquid chromatography" refers to general-purpose high-performance liquid chromatography, which in principle is an analytical method that separates a sample dissolved in a liquid through its interaction with the mobile or stationary phase of the liquid, and detects compounds that absorb light at a specific UV wavelength using a UV detector.

[0034] <Aspects of the Invention> The present invention relates to a composition used for chemical structure analysis of nucleic acids, a method for producing a sample used for analysis, and a method for analysis.

[0035] One aspect of the present invention is a composition used for chemical structure analysis of nucleic acids.

[0036] The composition used for chemical structure analysis of nucleic acids in the present invention is characterized by containing a dephosphorylation composition for the phosphate group located at the 3' end of the nucleic acid to be analyzed. The dephosphorylation composition that can be used in the present invention may be any dephosphorylation composition based on organic chemical principles, as long as it has the activity to dephosphorylate the phosphate group located at the 3' end of the nucleic acid. However, enzymes are preferred because the reaction can proceed under mild conditions. Examples of enzymes include compositions containing phosphate monoester hydrolases, defined by EC3.1.3.X, and phosphate diester hydrolases, defined by EC3.1.4.X, both generally called phosphatases.

[0037] As the dephosphorylation composition of the present invention, it is preferable to use a phosphate diester hydrolase, since the reaction can proceed as long as water molecules are present in addition to the reaction substrate. More preferable is a 2',3' cyclic phosphate diester hydrolase, since many nucleic acid-specific endonucleases have cleavage ends that result in 2',3' cyclic phosphate diesters. Even more preferable are T4 polymeric nucleotide kinase or CNPase (EC 3.1.4.37), or enzymes having equivalent dephosphorylation activity, since they can react with polymeric nucleic acids as substrates and have dephosphorylation activity at the 3' end. Among these, T4 polymeric nucleotide kinase is more preferable in terms of availability and versatility.

[0038] The concentration of the dephosphorylation composition for the phosphate group located at the 3' end of the nucleic acid to be analyzed in the present invention can be appropriately selected according to the purpose. Taking T4 polymeric acid kinase as an example, the content of T4 polymeric acid kinase in the dephosphorylation composition is preferably 1 to 1000 U / mL, more preferably 10 to 500 U / mL, and even more preferably 100 to 250 U / mL, from the viewpoint of allowing the reaction to proceed completely.

[0039] The composition used in the chemical structure analysis of nucleic acids according to the present invention contains a dephosphorylation composition for the phosphate group present at the 3' end of the nucleic acid to be analyzed, thereby enabling a simple method for analyzing the chemical structure of nucleic acids.

[0040] Although the mechanism of action is not entirely clear, it is believed that in analytical samples containing nucleic acids with a phosphate group at the 3' end, hydrolysis of the phosphate group can result in the formation of multiple types of nucleic acids with different phosphorylation states at the 3' end within the sample. This prevents the compound from maintaining its unity, making it difficult to analyze its structure easily in the past.

[0041] On the other hand, the present invention treats the 5' cleavage fragment of the nucleic acid to be analyzed with a dephosphorylation composition for the phosphate group present at the 3' end of the nucleic acid, thereby removing the phosphate group at the 3' end that causes the aforementioned problem, and completely proceeding with the hydrolysis of the phosphate group at the 3' end. This makes the nucleic acid a single compound in the phosphorylated state of the 3' end, enabling simple analysis.

[0042] In other words, the nucleic acids to be analyzed by the composition of the present invention have a phosphate group at the 3' end. Possible phosphate groups that nucleic acids have at the 3' end include monophosphate esters and diphosphate esters. Among these, nucleic acids having 2',3' cyclic diphosphate esters are preferred because they hinder the simple analysis in conventional nucleic acid structural analysis methods.

[0043] The composition used for the chemical structure analysis of nucleic acids in the present invention may also contain a composition for preparing nucleic acid fragments.

[0044] As a composition for preparing a nucleic acid fragment when performing chemical structure analysis at the 5'-end of a nucleic acid to be analyzed, a composition containing any endonuclease is exemplified. The endonuclease is preferably a 2',3'-cyclic phosphate generating composition capable of causing a reaction to generate a nucleic acid fragment having a 2',3'-cyclic phosphate diester as a chemical structure at the 3'-end. Examples of the 2',3'-cyclic phosphate generating composition include DNA oligonucleotides having acid cleavage activity such as those exemplified by deoxyribozyme (DNAzyme), and enzymes that specifically cleave RNA such as those exemplified by MazF (Takara Bio Inc.). Among them, DNAzyme is more preferable in terms of the flexibility of the cleavable sequence.

[0045] As a composition for preparing a nucleic acid fragment when performing analysis of chemical structure analysis at a non-5'-end of a nucleic acid to be analyzed, deoxyribozyme (DNAzyme) or forming a DNA-RNA hybrid complementary to the sequence to be cleaved and using RNaseH is preferable in that it is easy to arbitrarily determine the cleavage site, and it is preferable to use deoxyribozyme (DNAzyme).

[0046] The composition for preparing a nucleic acid fragment used for the analysis of chemical structure analysis of the nucleic acid of the present invention may use one kind of composition for preparing a nucleic acid fragment or two or more kinds of compositions for preparing a nucleic acid fragment according to a desired purpose. Among these, at least one kind of composition for preparing a nucleic acid fragment is preferably a 2',3'-cyclic phosphate generating composition at the 3'-end of the nucleic acid.

[0047] The concentration of the composition for preparing a nucleic acid fragment used in the present invention can be appropriately selected according to the purpose. Taking DNAzyme as an example, as the content of DNAzyme in the composition for preparing a nucleic acid fragment, 1 to 100 μM is preferable, 1 to 50 μM is more preferable, and 2 to 10 μM is more preferable from the point of allowing the reaction to proceed completely.

[0048] As is clear from the foregoing, the composition used for the analysis of the chemical structure of the nucleic acid of the present invention may contain both a dephosphorylated composition of the phosphate group present at the 3'-end of the nucleic acid and a composition for preparing nucleic acid fragments. For example, it may contain both T4 polynucleotide kinase and DNAzyme.

[0049] When the composition of the present invention contains a composition for preparing nucleic acid fragments obtained from the nucleic acid to be analyzed, there is no limitation on the length of the nucleic acid to be analyzed. However, from the perspective of variations in the form as a nucleic acid medicine that can be used in the future, 50 to 20,000 mers are preferable. The nucleic acid fragments generated by the composition for preparing nucleic acid fragments are not particularly limited as long as they are shorter than the length of the nucleic acid to be analyzed. However, from the point of view of being able to analyze accurately, 3 mers or more and 100 mers or less are preferable, 5 mers or more and 50 mers or less are more preferable, and 10 mers or more and 30 mers or less are more preferable.

[0050] The composition of the present invention can be used for the analysis of the chemical structure of nucleic acids in a simple manner.

[0051] There is no particular limitation on the type of nucleic acid to be analyzed, which may be DNA, RNA, or a mixture of DNA and RNA. Among them, mRNA is preferable because application research as pharmaceuticals and the like is progressing and its industrial utility is high.

[0052] In addition, the nucleic acid to be analyzed may be synthesized by chemical synthesis, synthesized by enzymatic synthesis, synthesized chemoenzymatically using chemical synthesis methods and enzymatic synthesis methods, or isolated from a nucleic acid-containing sample. Among them, from the industrial utility, mRNA synthesized by chemical synthesis, mRNA synthesized by enzymatic synthesis, and mRNA synthesized chemoenzymatically using chemical synthesis methods and enzymatic synthesis methods are preferable. From the point that there is a need for an analysis method for impurity control and the like, mRNA synthesized by enzymatic synthesis and mRNA synthesized chemoenzymatically using chemical synthesis methods and enzymatic synthesis methods are preferable, and mRNA synthesized by enzymatic synthesis as in the following examples is preferable.

[0053] The sample containing the nucleic acid to be analyzed is not particularly limited. Examples of nucleic acid-containing samples to be analyzed in the present invention include nucleic acid synthesis solutions obtained by chemical synthesis, nucleic acid synthesis solutions obtained by enzymatic synthesis, nucleic acid-containing solutions obtained from nature, nucleic acid extracts, and solutions purified from these nucleic acid-containing samples. Among these, mRNA synthesis solutions obtained by chemical synthesis, mRNA synthesis solutions obtained by enzymatic synthesis, mRNA-containing solutions obtained from nature, mRNA extracts, and solutions purified from these mRNA-containing samples are preferred.

[0054] The concentration of the nucleic acid to be analyzed in a sample containing nucleic acids can be set as appropriate according to the purpose, but a suitable example is 300 to 1000 ng / μL.

[0055] Samples containing nucleic acids to be analyzed may contain impurities such as uncap structures, nucleic acids with chain lengths different from the target nucleic acid, nucleic acid degradation products, compounds such as detached functional groups and unreacted cap structures, proteins such as capping enzymes and mRNA synthases, compositions related to in vitro transcription reactions, and various nucleotide triphosphates that serve as substrates for nucleic acid synthesis.

[0056] For preferred embodiments of the present invention when mRNA is selected as the target of analysis, the above-mentioned description of nucleic acids to be analyzed can be read as referring to mRNA.

[0057] The chemical structure of the nucleic acid to be analyzed is not particularly limited. The chemical structure to be analyzed may or may not be located at the 5' end. In particular, it is preferable that the chemical structure be located at the 5' end of the nucleic acid, as applied research as pharmaceuticals and other products is progressing and it has high industrial utility.

[0058] Suitable examples of chemical structures at the 5' end of nucleic acids to be analyzed include the uncap structure, Cap0 structure, Cap1 structure, Cap2 structure, Cap3 structure, Cap4 structure, and even more methylated structures at the 5' end of nucleic acids, as these are useful in the development of nucleic acid drugs. An example of analysis using the composition of the present invention is the measurement of the content of each Cap structure in a sample containing nucleic acids.

[0059] As mentioned above, the chemical structure at the 5' end of the nucleic acid to be analyzed in the present invention is not limited to the Cap structure, and can also be used to measure the presence or absence and introduction rate of chemical modification structures other than 2'-O-methyl group modification. Examples of chemical modification structures other than 2'-O-methyl group modification are not particularly limited, but include modifications of 2'-halogen compounds, phosphorothioate modifications as a backbone, and chemical modifications of the base portion (5-methylcytidine, pseudouridine, N1-methylpseudridine, N6-methyladenosine, etc.). Preferred examples of chemical structures at the non-5' end of nucleic acids include methylation modifications of ribosomal RNA (rRNA) and N6-methyladenosine modifications of long non-coding RNA (lncRNA).

[0060] The composition of the present invention enables simple analysis by completely carrying out hydrolysis at the 3' end of the nucleic acid to be analyzed while maintaining the compound's unity.

[0061] Since the composition of the present invention provides a simple method for analyzing the chemical structure of nucleic acids, it can be provided together with mRNA capping enzymes and RNA endonucleases.

[0062] One aspect of the present invention is a method for producing a sample used for analyzing the chemical structure of nucleic acids.

[0063] The present invention provides a method for producing a sample used for analyzing the chemical structure of nucleic acids, comprising: (1) obtaining a nucleic acid fragment having a phosphate group at its 3' end from a nucleic acid to be analyzed; and (2) performing a dephosphorylation reaction of the phosphate group present at the 3' end of the nucleic acid fragment obtained in (1).

[0064] In the method for producing a sample used for analyzing the chemical structure of nucleic acids according to the present invention, (1) in the step of obtaining a nucleic acid fragment having a phosphate group at the 3' end from the nucleic acid to be analyzed, the nucleic acid fragment is obtained from the nucleic acid to be analyzed using the nucleic acid fragment preparation composition described above. For preferred embodiments, refer to the description in the section on compositions described above.

[0065] In the method for producing a sample used for analyzing the chemical structure of nucleic acids of the present invention, (2) in the dephosphorylation reaction of the phosphate group present at the 3' end of the nucleic acid fragment obtained in (1) above, the dephosphorylation reaction is carried out using the aforementioned dephosphorylation composition for the phosphate group present at the 3' end of nucleic acids. For preferred embodiments, refer to the description in the section on compositions above.

[0066] In the method for producing a sample used for analyzing the chemical structure of nucleic acids according to the present invention, step (2) may be performed after step (1), or steps (1) and (2) may be performed simultaneously.

[0067] Performing (2) after process (1) means starting process (2) only after process (1) has been completed sufficiently.

[0068] Performing steps (1) and (2) simultaneously means producing the sample under conditions in which both reactions proceed. In this case as well, essentially, after nucleic acid fragments are obtained by step (1), the dephosphorylation reaction of the phosphate group located at the 3' end of the nucleic acid fragments obtained in (1) proceeds by step (2).

[0069] As mentioned above, there are no limitations on the length of the nucleic acid to be analyzed in step (1), but from the viewpoint of variations in form as nucleic acid drugs that may be used in the future, 50 to 20,000 mer is preferred. As mentioned above, there are no particular limitations on the nucleic acid fragments obtained by step (1), as long as they are shorter than the length of the nucleic acid to be analyzed, but from the viewpoint of being able to analyze with good accuracy, 3 mer to 100 mer, 5 mer to 50 mer, and 10 mer to 30 mer are preferred.

[0070] The nucleic acid fragment obtained by step (1) may or may not contain the 5' end of the nucleic acid to be analyzed in step (1). Among these, nucleic acid fragments containing the 5' end of the nucleic acid to be analyzed in step (1) are preferred because applied research as pharmaceuticals and other products is progressing and they have high industrial utility.

[0071] The method for producing a sample used for analyzing the chemical structure of nucleic acids according to the present invention may include a step of synthesizing the nucleic acid to be analyzed before step (1). Examples of the step of synthesizing the nucleic acid to be analyzed include a step of chemically synthesizing nucleic acids by solid-phase synthesis, a step of chemically synthesizing nucleic acids by liquid-phase synthesis, a step of enzymatically synthesizing nucleic acids, and a step of chemoenzymatically synthesizing nucleic acids using a chemical synthesis method and an enzymatic synthesis method.

[0072] The process of synthesizing the nucleic acid to be analyzed may include a step of adding a Cap structure to the nucleic acid to be analyzed. Examples of methods for adding a Cap structure to the nucleic acid to be analyzed include chemical addition, enzymatic addition, and chemoenzymatic addition using a combination of chemical and enzymatic synthesis methods.

[0073] In the method for producing a sample used for analyzing the chemical structure of nucleic acids according to the present invention, if the method includes a step of synthesizing the nucleic acid to be analyzed before step (1), it may also include a step of purifying the nucleic acid synthesis solution. Examples of the purification step include, but are not limited to, general silica membrane purification.

[0074] For preferred embodiments of preparing a sample for analysis of the chemical structure of mRNA using the sample preparation method of the present invention, the above description concerning the nucleic acid to be analyzed can be read as referring to mRNA.

[0075] One aspect of the present invention is a method for analyzing the chemical structure of nucleic acids.

[0076] The present invention provides a method for analyzing the chemical structure of nucleic acids, comprising the steps of: (a) obtaining a nucleic acid fragment having a phosphate group at its 3' end from a nucleic acid to be analyzed; (b) performing a dephosphorylation reaction of the phosphate group present at the 3' end of the nucleic acid fragment obtained in (a); and (c) analyzing the nucleic acid fragment obtained in (b) by liquid chromatography.

[0077] Preferred embodiments of steps (a) and (b) should be referred to in the section on the method of producing the sample described above.

[0078] The present invention provides a method for analyzing the chemical structure of nucleic acids, which includes, after steps (a) and (b), a step of analyzing the nucleic acid fragment obtained in (b) by liquid chromatography.

[0079] Examples of liquid chromatography that can be used in the analytical method of the present invention include, but are not limited to, reversed-phase ion-pair chromatography, which is commonly used for analyzing nucleic acids.

[0080] In the analytical method of the present invention, in addition to liquid chromatography, analytical methods based on different principles, such as mass spectrometry and fluorescence detectors, may be combined. From the viewpoint of simpler analysis, analysis using only liquid chromatography is preferred.

[0081] For preferred embodiments of the analytical method of the present invention used to analyze the chemical structure of mRNA, the above-mentioned description of the nucleic acid to be analyzed can be read as "mRNA" and referred to accordingly.

[0082] The embodiments of the present invention have been described above, but these are merely examples, and various other configurations can be adopted. Furthermore, the configurations described in the above embodiments can be combined and adopted.

[0083] According to one aspect of the present invention, nucleic acids can be detected as a single peak in liquid chromatography. This makes it possible to separate the Cap structure of the nucleic acid to be analyzed into Cap0, Cap1, Cap2, Cap3, Cap4 or more using liquid chromatography.

[0084] According to one aspect of the present invention, it is possible to quantitatively and easily measure the content of uncapped nucleic acids that may be impurities, or nucleic acids having an intermediate capped structure, in enzymatic capping or co-transcriptional capping.

[0085] According to one aspect of the present invention, even users without advanced analytical equipment can easily analyze the chemical structure at the 5' end of nucleic acids to be analyzed. This enables impurity control when preparing the desired Cap structure, and can contribute to the research and expansion of the possibilities for Cap structures as nucleic acid, particularly mRNA, capping enzymes, and nucleic acid drugs.

[0086] According to one aspect of the present invention, methods are provided for analyzing the chemical structure at the non-5' end of a nucleic acid, for analyzing nucleic acids to which chemically synthesized Cap analogs have been added, for analyzing Cap structures having modifications other than methyl groups that may be developed in the future, and for analyzing chemically modified structures other than 2'-O-methyl group modifications (for example, modifications of 2'-halogen compounds, phosphorothioate modifications as a backbone, and chemical modifications of the base portion by 5-methylcytidine, pseudouridine, N1-methylpseudridine, N6-methyladenosine, etc.).

[0087] The present invention will be described in detail below with reference to examples, but the interpretation of the present invention is not limited to these examples.

[0088] <Experimental Example 1> Measurement of mRNA Capping Efficiency In this example, Cap1, Cap2, Cap3, Cap4, or higher Cap structures are synthesized using triphosphate-terminated mRNA prepared by a normal in vitro transcription reaction as a substrate through cooperative activity with Cap0-transferase and various Cap methyltransferases. It is shown that these structures are detected as peaks with independent and different retention times on LC analysis, thereby demonstrating that a simple quantitative analysis of capping efficiency using the LC area is possible.

[0089] The mRNA used for evaluation was the model sequence shown in Sequence ID No. 1. The oligonucleotide used to cleave this sequence is as shown in Sequence ID No. 2.

[0090] <Sequence of the Array 1 model mRNA> GGCGCCAAUAUAAGGUGAACGCGUGGCCUCGAACACCGAGCGCACCCUGCCAGCGCACCCCUUAAAAGCUUGGCCAAUUCCCGGUUCCAAUAGCUUGGUCAAAAAGCCCAACACCGAAGAAUUUCGUUGGGGCCAACAGACACAGCUGC AAGUCCUUGAACAGGGAGGUGUGUCCAGUUUGUUUCAGAAUCUCGGGGUGUCCGUAACUCCGAUCCAAAGGAUUGUCCUGA GCGGUGAAAAUGGGCUGAAGAUCGACAUCCAUGUCAUCAUCCCGUAUGAAGGUCUGAGCGGCGACCAAAUGGGCCAGAUCGA AAAAAUUUUUAAAGGUGGUGUACCCUGUGGAUGAUCAUCACUUUAAAGGUGAUCCUGCACUAUGGGCACACUGGUAAUCGACGG GGUUACGCCGAACAUGAUCGACUAUUUCGGACGGCCGUAUGAAGGCAUCGCCGUGUUCGACGGCAAAAAAGAUCACUGUAAC AGGGACCCUGUGGAACGGCAACAAAAUUAUCGACGAGCGCCUGAUCAACCCCGACGGCUCCCUGCUGUUCCGAGGUAACCAU CAACGGAGUGACCGGCUGGCGGCUGUGGCGAACGCAUUCUGGCGUAAUUCUAGAAAAAAAAAAAAAAAAAA

[0091] <Sequence of the deoxyribozyme (DNAzyme) for model mRNA cleavage (SEQ ID NO: 2)> 5'-ACACGCGTCAGGCTAGCTACACGAACCTTTAATATGC-3'

[0092] Model sequence mRNA was synthesized in vitro and purified using NucleoSpin® RNA (Takara Bio Inc.). This mRNA was reacted with 1 μL of NFW solution of Vaccinia Capping Enzyme (Takara Bio Inc.) and 0.3 mg / mL of Cap1-transferase (Takara Bio Inc. mRNA Cap2'-O-Methyltransferase) and / or 1 μL of NFW solution of Cap2-transferase and / or Cap3,4-transferase (for the enzymes, see the applicant's international patent applications PCT / JP2025 / 022206 and PCT / JP2025 / 022211) until the reaction was completely completed, and an m7G Cap structure and / or Cap methylated structure were added to the 5' end. These Cap-modified mRNAs were purified again using NucleoSpin® RNA to obtain various Cap-type mRNAs.

[0093] Next, the purified mRNA was cleaved using DNAzyme. To 15 μL of a solution containing various Cap-type mRNAs at 1000 ng / uL, 5 μL of Tris-HCl, 0.5 μL of MgCl2, 15 μL of 10 μM DNAzyme solution, and 50 U of T4 Polyribonucleotide kinase were added, and the total volume was adjusted to 100 μL using NFW. This reaction mixture was incubated at 37°C for 15 hours, after which LC analysis was performed.

[0094] LC analysis was performed under the following conditions: System: Nexera XSi UPLC system (Shimadzu Corporation) Column: Biozen® Oligo, particle size 1.7 μm, inner diameter 2.1 mm × length 150 mm (Phenomenex Corporation) Injection volume: 10 μL Temperature: 65°C Flow rate: 0.3 mL / min Eluent A: Aqueous solution of 1% hexafluoroisopropanol (HFIP) and 0.1% diisopropylethylamine (DIPEA) Eluent B: Aqueous solution of 0.75% hexafluoroisopropanol (HFIP), 0.0375% diisopropylethylamine (DIPEA), and 35% acetonitrile Elution mode: Gradient elution

[0095] The results of this experiment are shown in Figures 1 and 2.

[0096] Figure 1 shows the LC analysis results of the 5' cleavage end of the Cap-modified mRNA prepared as described above. Figure 2 shows the results of these analyses superimposed with adjusted retention times.

[0097] It was confirmed that the 5' end peaks of the uncapped phase and Cap0, Cap1, Cap2, and Cap3 could each be detected as single, independent peaks.

[0098] As a result of this embodiment, it was demonstrated that the content of each Cap structure can be calculated from the area value of the LC corresponding to each Cap structure. Therefore, it can be said that the present invention has made it possible to construct a system for easily measuring the capping efficiency of nucleic acids using LC.

[0099] <Experimental Example 2> Measurement of Capping Efficiency of mRNA Prepared by Co-transcription Capping Using Cap Analogues Co-transcription capping is a technique that allows for the simultaneous in vitro transcription reaction and the addition of a Cap structure to the 5' end of mRNA by mixing a pre-synthesized Cap analogue into the reaction solution during the synthesis of mRNA in an in vitro transcription reaction. In this example, ARCA (Anti-Reverse Cap Analogue, Thermo Fisher Scientific), Clean Cap AG (registered trademark, TriLink), and Clean Cap AG 3'OMe (registered trademark, TriLink) were used as Cap analogues, and the capping efficiency of each co-transcription capping was measured using the method of the present invention.

[0100] <Composition of reaction solution for co-transcription capping using ARCA> 10x reaction buffer: 5 μL (final concentration 1X) 100 mM ATP: 3.75 μL (final concentration 7.5 mM) 100 mM GTP: 0.75 μL (final concentration 1.5 mM) 100 mM UTP: 3.75 μL (final concentration 7.5 mM) 100 mM CTP: 3.75 μL (final concentration 7.5 mM) 100 mM ARCA: 3 μL (final concentration 6 mM) Linear template DNA: (total 1 μg) T7 RNA polymerase mix: 4 μL The mixture of the above compositions was made up to 50 μL using NFW, reacted at 37°C for 4.5 hours, and then purified with NucleoSpin® RNA (manufactured by Takara Bio Inc.).

[0101] <Co-transcription Capping using Clean Cap AG or Clean Cap AG 3'OMe> 10x reaction buffer: 2 μL (final concentration 0.5X) 100 mM ATP: 2 μL (final concentration 5 mM) 100 mM GTP: 2 μL (final concentration 5 mM) 100 mM UTP: 2 μL (final concentration 5 mM) 100 mM CTP: 2 μL (final concentration 5 mM) 100 mM CleanCap® AG or AG (3'OMe): 1.6 μL (final concentration 4 mM) Linear template DNA: (total 1 μg) T7 RNA polymerase mix: 4 μL The mixture of the above compositions was made up to 50 μL using NFW, reacted at 37°C for 4.5 hours, and then purified with NucleoSpin® RNA (manufactured by Takara Bio Inc.).

[0102] The obtained mRNA samples were prepared by cleavage reactions under the same conditions as in Example 1. These samples were analyzed under the LC analysis conditions described in Example 1, and the capping efficiency of the mRNA obtained by each co-transcription capping method was calculated.

[0103] The experimental results for this example are shown in Figures 3-5. The calculated capping efficiency of the mRNA obtained by each co-transcription capping is shown below. According to this, the results were calculated as follows: ARCA: Uncapped mRNA; 35.0%, ARCA-Capped mRNA; 65.0%, Clean Cap AG: Uncapped mRNA; 19.8%, Clean Cap AG-Capped mRNA; 80.2%, Clean Cap AG 3'OMe: Uncapped mRNA; 17.4%, Clean Cap AG 3'OMe-Capped mRNA; 82.6%.

[0104] The results of this embodiment demonstrate that the capping efficiency of nucleic acids prepared by co-transcription capping using a Cap analog can also be easily measured using the present invention.

[0105] Accordingly, the present invention can be in the following embodiments: <1> A composition for analyzing the chemical structure of a nucleic acid, characterized by containing a dephosphorylation composition for a phosphate group located at the 3' end of a nucleic acid. <2> The composition according to <1>, characterized in that the dephosphorylation composition is a 2',3' cyclic phosphate diester decomposition composition. <3> The composition according to <1>, characterized in that the dephosphorylation composition contains T4 polyribonucleotide kinase and / or an enzyme having equivalent activity. <4> The composition according to any one of <1> to <3>, further comprising a composition for preparing nucleic acid fragments. <5> The composition according to <4>, characterized in that the composition for preparing nucleic acid fragments is a 2',3' cyclic phosphate diester generating composition for the 3' end of a nucleic acid. <6> The composition according to <4>, characterized in that the composition for preparing nucleic acid fragments contains a DNA oligonucleotide (DNAzyme) having nucleic acid cleavage activity and / or an enzyme that sequence-specifically cleaves RNA. <7> The composition according to any one of claims 1 to 6, characterized in that the nucleic acid is mRNA.

[0106] <8> A method for producing a sample for chemical structure analysis of nucleic acids, comprising the steps of: (1) obtaining a nucleic acid fragment having a phosphate group at the 3' end from a nucleic acid to be analyzed; and (2) performing a dephosphorylation reaction of the phosphate group present at the 3' end of the nucleic acid fragment obtained in (1), characterized in that step (2) is performed after step (1), or steps (1) and (2) are performed simultaneously. <9> The method according to <8>, characterized in that the nucleic acid is mRNA. <10> The method according to <9>, characterized in that step (1) is performed by a cleavage reaction using DNAzyme or an enzyme that cleaves RNA sequence-specifically. <11> The method according to any one of <8> to <10>, characterized in that step (2) is performed by T4 polyribonucleotide kinase. <12> The method according to any one of <8> to <11>, characterized in that the nucleic acid fragment obtained in step (1) is 3 mer or more and 100 mer or less.

[0107] <13> A method for analyzing the chemical structure of a nucleic acid, comprising: (a) obtaining a nucleic acid fragment having a phosphate group at the 3' end from a nucleic acid to be analyzed; (b) performing a dephosphorylation reaction of the phosphate group present at the 3' end of the nucleic acid fragment obtained in (a); and (c) analyzing the nucleic acid fragment obtained in (b) by liquid chromatography, characterized in that step (b) is performed after step (a) or (a) and (b) are performed simultaneously. <14> The method according to <13>, characterized in that the nucleic acid is mRNA.

Claims

1. A composition for analyzing the chemical structure of nucleic acids, characterized by containing a dephosphorylation composition for the phosphate group located at the 3' end of the nucleic acid.

2. The composition according to claim 1, characterized in that the dephosphorylated composition is a 2',3' cyclic phosphate diester decomposition composition.

3. The composition according to claim 1, characterized in that the dephosphorylation composition contains T4 polyribonucleotide kinase and / or an enzyme having equivalent activity.

4. The composition according to any one of claims 1 to 3, further comprising a composition for preparing nucleic acid fragments.

5. The composition according to claim 4, characterized in that the nucleic acid fragment preparation composition is a composition for producing 2',3' cyclic phosphate diesters of the 3' end of a nucleic acid.

6. The composition according to claim 4, characterized in that the nucleic acid fragment preparation composition contains a DNA oligonucleotide (DNAzyme) having nucleic acid cleavage activity and / or an enzyme that cleaves RNA in a sequence-specific manner.

7. The composition according to any one of claims 1 to 3, characterized in that the nucleic acid is mRNA.

8. A method for producing a sample for chemical structure analysis of nucleic acids, comprising the steps of (1) obtaining a nucleic acid fragment having a phosphate group at the 3' end from a nucleic acid to be analyzed, and (2) performing a dephosphorylation reaction of the phosphate group present at the 3' end of the nucleic acid fragment obtained in (1), characterized in that step (2) is performed after step (1), or steps (1) and (2) are performed simultaneously.

9. The manufacturing method according to claim 8, characterized in that the nucleic acid is mRNA.

10. The manufacturing method according to claim 9, characterized in that step (1) is carried out by a cleavage reaction using an enzyme that sequence-specifically cleaves DNAzyme or RNA.

11. The manufacturing method according to any one of claims 8 to 10, characterized in that step (2) is performed by T4 polyribonucleotide kinase.

12. The manufacturing method according to any one of claims 8 to 10, characterized in that the nucleic acid fragment obtained in step (1) is 3 mer or more and 100 mer or less.

13. A method for analyzing the chemical structure of nucleic acids, comprising: (a) obtaining a nucleic acid fragment having a phosphate group at the 3' end from a nucleic acid to be analyzed; (b) performing a dephosphorylation reaction of the phosphate group present at the 3' end of the nucleic acid fragment obtained in (a); and (c) analyzing the nucleic acid fragment obtained in (b) by liquid chromatography, characterized in that step (b) is performed after step (a), or steps (a) and (b) are performed simultaneously.

14. The method according to claim 13, characterized in that the nucleic acid is mRNA.