Morpholino cationic lipids

Abstract

Provided herein are a class of ionizable lipids or pharmaceutically acceptable salts thereof. The ionizable lipids provided herein can be useful for delivery and expression of mRNA and encoded protein, e.g., as a component of a liposomal delivery vehicle, and accordingly can be useful for treating various diseases, disorders and conditions, such as those associated with deficiency of one or more proteins.

Description

773158: SA9-886PC / / PAT25019-WO-PCTMorpholino Cationic LipidsCROSS REFERENCE TO RELATED APPLICATIONSThis application claims priority to U. S. Application No. 63 / 751,962, filed January 31, 2025, the disclosure of which is incorporated herein by reference in its entirety.SEQUENCE LISTINGThe instant application contains a Sequence Listing which has been submitted herewith and is hereby incorporated by reference in its entirety. Said.xml copy, created on January 29, 2026, is named 773158_SA9-886PC-SL, and is 7,400 bytes in size.BACKGROUNDEffective targeted delivery of biologically active substances such as nucleic acid molecules (e.g., mRNA) represents a continuing medical challenge. In particular, the delivery of nucleic acids to cells is made difficult by their low in vivo stability, propensity toward rapid degradation, and low cell permeability.Lipid-containing nanoparticle compositions have proven effective as transport vehicles into cells and / or intracellular compartments for biologically active substances such as small molecule drugs, proteins, and nucleic acids. Such compositions generally include one or more ionizable or cationic lipid that possesses a positive charge at low pH; helper lipids (e g., phospholipids, including polyunsaturated lipids); structural lipids, such as cholesterol-based lipids; and / or stealth lipids (e.g., PEGylated lipids). While liposomal-based vehicles that comprise an ionizable or cationic lipid have shown promising results with regards to encapsulation, stability, and site localization, there remains a great need for improvement of liposomal-based delivery systems. In particular, there remains a need for improved ionizable or cationic lipids that demonstrate improved pharmacokinetic properties and w hich are capable of delivering macromolecules, such as nucleic acids, to a wide variety of cell types and tissues with enhanced efficiency. Importantly, there also remains a particular need for novel ionizable and cationic lipids that are characterized as having reduced toxicity and are capable of efficiently delivering encapsulated nucleic acids and polynucleotides to cells, tissues, and organs by various routes of administration.181859815v2773158: SA9-886PC / / PAT25019-WO-PCTSUMMARYThe present disclosure provides, inter alia, an ionizable lipid that is a compound having a structure according to Formula (I):(I),or a pharmaceutically acceptable salt thereof, wherein:each X is independently for each occurrence -C(1-8)alkylene-;each Y is independently for each occurrence -C(1-8)alkylene-;R1independently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selectedfrom the group consisting of -OH,R2independently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selectedfrom the group consisting of -OH,R3is H, -C(1-8)alkyl, or -C(O)-C(1-8)alkyl, wherein the C(1-8)alkyl and -C(O)-C(1-8)alkyl are optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl;RAindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl;281859815v2773158: SA9-886PC / / PAT25019-WO-PCTRBindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl;RNindependently for each occurrence is H or -C(1-3)alkyl; andn is 1-10.The present disclosure further provides an ionizable lipid that is a compound having a structure according to Formula (I):R1L ) R1NIR3(I),or a pharmaceutically acceptable salt thereof, wherein:each X is independently for each occurrence -C(1-8)alkylene-;each Y is independently for each occurrence -C(1-8)alkylene-;R1independently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected^A0 / RAYfrom the group consisting of -OH,u, and °;R2independently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected0 / RAYfrom the group consisting of -OH,u, and0;R3is H, -C(1-8)alkyl, or -C(O)-C(1-8)alkyl, wherein the C(1-8)alkyl and -C(O)-C(1-8)alkyl are optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl;RAindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl;81859815v2773158: SA9-886PC / / PAT25019-WO-PCTRBindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl;RNindependently for each occurrence is H or -C(1-3)alkyl; andn is 1-10.In some embodiments, each X is -CH2-.OIn some embodiments, L independently for each occurrence isOIn some embodiments, the compound has a structure according to Formula Ic:(Ic),or a pharmaceutically acceptable salt thereof.In some embodiments, each Y is -C(2-4)alkylene-. In some embodiments, Y independently for each occurrence is -CH2CH2CH2- or -CH2CH2CH2CH2-.In some embodiments, the compound has a structure according to Formula Ic-i:or a pharmaceutically acceptable salt thereof.In some embodiments, the compound has a structure according to Formula Ic-ii:481859815v2773158: SA9-886PC / / PAT25019-WO-PCTor a pharmaceutically acceptable salt thereof.In some embodiments, the compound has a structure according to Formula Ic-iii:(Ic-iii),or a pharmaceutically acceptable salt thereof.In some embodiments, R1independently for each occurrence is -C(4-30)alkyl or -C(4-30)alkenyl, each of which is optionally substituted with one or two substituents selected fromthe group consisting of -OH,In some embodiments, R1independently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl, each of which is optionally substituted with one or two substituents selected from the group consisting of -OH,In some embodiments, R1independently for each occurrence is -C(8-20)alkenyl that is optionally substituted with a -OH group. In some embodiments, R1independently for each occurrence is -C(4-20)alkyl that is optionally substituted with one ortwo substituents selected from the group consisting of -OH,In some embodiments, R1independently for each occurrence is -C(8-20)alkyl that is optionally substituted with a -OH group. In some embodiments, R1independently for each occurrence is -C(4-10)alkyl, wherein the -C(4-10)alkyl is substituted with one substituent selected fromand O, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group. In some embodiments, R1independently for each occurrence is -C(4- 20)alkyl that is optionally substituted with one or two substituents independently selected fromthe group consisting of -OH,581859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R2independently for each occurrence is -C(4-30)alkyl or -C(4-30)alkenyl, each of which is optionally substituted with one or two substituents selected from O \ O RBYthe group consisting of -OH,°, and0. In some embodiments, R2independently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl, each of which is optionally substituted with one or two substituents selected from the group consisting of -OH, O V O RBVY-RAYu, and O. In some embodiments, R2independently for each occurrence is -C(8-20)alkenyl that is optionally substituted with a -OH group. In some embodiments, R2independently for each occurrence is -C(4-20)alkyl that is optionally substituted with one or two substituents selected from the group consisting of -OH,u, and ° In some embodiments, R2independently for each occurrence is -C(8-20)alkyl that is optionally substituted with a -OH group. In some embodiments, R2independently for each occurrence is -C(4-io)alkyl, wherein the -C(4-io)alkyl is substituted with one substituent selected fromRBu, and0, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group. In some embodiments, R2independently for each occurrence is -C(4-20)alkyl that is optionally substituted with one or two substituents independently selected from the group consisting of -OH, In some embodiments, RAindependently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl. In some embodiments, each RAis -C(4-20)alkyl. In some embodiments, each RAis -C(4-20)alkenyl.In some embodiments, RBindependently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl. In some embodiments, each RBis -C(4-20)alkyl. In some embodiments, each RBis -C(4-20)alkenyl.In some embodiments, R1and R2are independently for each occurrence selected from the group consisting ofOH681859815v2773158: SA9-886PC / / PAT25019-WO-PCTOHOHOHOOH OO0OOIn some embodiments, R1and R2are independently for each occurrence selected from the group consisting of:OH781859815v2773158: SA9-886PC / / PAT25019-WO-PCTOIn some embodiments, R3is H. In some embodiments, R3is -C(1-6)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 6-membered heteroaryl. In some embodiments, R3is -C(1-6)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(CH3)2, -(OCH2CH2)2-OH, and imidazolyl. In some embodiments, R3is selected from the group consisting of -CH3,OHIn some embodiments, R3is -C HEIGHT="71" WIDTH="451" SRC="imgf000008_0004.tif" / > H3or OH.In some embodiments, R3is -C(O)-C(i-6)alkyl that is optionally substituted with -N(RN)2. In some embodiments, R3is HEIGHT="68" WIDTH="195" SRC="imgf000008_0003.tif" / > R3isIn some embodiments, the present disclosure provides an ionizable lipid that is a compound selected from the group consisting of:881859815v2773158: SA9-886PC / / PAT25019-WO-PCT2 / i 7 I 77\ \ \ \ / / ° ° - —O O ZZ '—^3 OH OHy J1< ° T | o o ° >o z—> z ' - — '\ X / ° / \ OH4 O o1 T “r\ P r\ P -*- i\ \ ° ' —5 00 S H HTJ Y1o6 0A 0 00II HO A1 / \ / \ X IlO.0. / \ X IlY Y 0 / \XN / \ / \ X. CL / =\ \ / / \\Y / '\\Y / ' OH L J L OH 007n | o oo < ii ii AN |. X O T T O X / \ / X NY\ / \ Y\ A T o0 I Ax o8 x^xx^x / ^xx-°-x^^X / 0H 0H°o < II II oN |.\^ / \\ / X- o X ^o^ Y o X / -\ / X N.X\X\XYXX'°TXXX\XX^ L J k °o OH ’i'H0-'Y / \YY'''''''-^^981859815v2773158: SA9-886PC / / PAT25019-WO-PCT1081859815v2773158: SA9-886PC / / PAT25019-WO-PCT1181859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the present disclosure provides an ionizable lipid that is a compound selected from the group consisting of:1281859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the present disclosure provides an ionizable lipid that is acompound selected from the group consisting of:25 ) ) o —— \ozo26 OH o OHN N ^O^V0o z — Y^O NN\HL JH^x ^x ^x ^x J. / L / X. / X / X / 1 o HO29 9 OH0H0 0 o / / L A, 0 / x Jx 1 110 N 0 Y Y O N 0OH T O II H OH \ / > O—30 / / 1O OO ° N '' '^0ON HO'' ^OH1Hor a pharmaceutically acceptable salt thereof.The present disclosure further provides a compound having a structure according to Formula (II):or a pharmaceutically acceptable salt thereof, wherein:X is -C(1-8)alkylene-;1381859815v2773158: SA9-886PC / / PAT25019-WO-PCTR1is -C(4-30)alkyl, -C(4-30)alkenyl. or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected from the group consisting of -R2is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected from the group consisting of -RAindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl; andRBindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl. In some embodiments, X is -C(1-4)alkylene-. In some embodiments, R1is -C(4-10)alkyl,OU / RAwherein the -C(4-io)alkyl is substituted with one substituent selected from0. and 3VO, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group. In some embodiments, R2is -C(4-10)alkyl, wherein the -C(4-10)alkyl is substituted with H O RBO / RAYone substituent selected fromu, and O, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group. In some embodiments, each RAis -C(4-20)alkyl. In some embodiments, each RBis -C(4-20)alkyl.In some embodiments, the present disclosure provides an ionizable lipid that is a compound selected from the group consisting of:271481859815v2773158: SA9-886PC / / PAT25019-WO-PCTThe present disclosure further provides a composition comprising: (1) one or more compounds of the present disclosure, or a pharmaceutically acceptable salt thereof (2) one or more helper lipids, (3) one or more structural lipids, and (4) one or more stealth lipids.In some embodiments, the one or more helper lipids is selected from the group consisting of l,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE); 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); l,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); l,2-dielaidoyl-sn-glycero-3-phosphoethanolamine (DEPE); and l,2-dioleoyl-sn-glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-Distearoylphosphatidylethanolamine (DSPE), or 1.2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE), for example 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE).In some embodiments, the one or more structural lipids is a sterol-based lipid, for example a cholesterol-based lipid, for example cholesterol.In some embodiments, the one or more stealth lipids is a PEG-modified lipid.In some embodiments, the composition is a lipid nanoparticle, optionally a liposome. In some embodiments, the one or more compound of the present disclosure constitute(s) about 20 mol% to about 60 mol% of the lipid nanoparticle. In some embodiments, the one or more helper lipids constitute(s) about 10 mol% to about 50 mol% of the lipid nanoparticle. In some embodiments, the one or more stealth lipid(s) constitute(s) about 1 mol% to about 4 mol% of the lipid nanoparticle. In some embodiments, the one or more structural lipids constitute(s) about 10 mol% to about 50 mol% of the lipid nanoparticle.In some embodiments, the lipid nanoparticle encapsulates a nucleic acid. In some embodiments, the nucleic acid is an mRNA encoding a peptide or protein.In some embodiments, the lipid nanoparticles have an encapsulation percentage for mRNA of: (i) at least 50%; (ii) at least 55%; (iii) at least 60%; (iv) at least 65%; (v) at least 70%; (vi) at least 75%; (vii) at least 80%; (viii) at least 85%; (ix) at least 90%; or (x) at least1581859815v2773158: SA9-886PC / / PAT25019-WO-PCT95%. In some embodiments, the lipid nanoparticles have an encapsulation percentage for mRNA of: (i) at least 85%; (ii) at least 90%; or (iii) at least 95%.The present disclosure further provides a vaccine comprising a composition as described herein.The present disclosure further provides a composition described herein for use in therapy.The present disclosure further provides a composition described herein for use in a method of treating or preventing a disease amenable to treatment or prevention by the peptide or protein encoded by the mRNA, optionally wherein the mRNA encodes an antigen and / or the disease is (a) a protein deficiency, optionally wherein the protein deficiency affects the liver, lung, brain or muscle, (b) an autoimmune disease, (c) an infectious disease, or (d) cancer. In some embodiments, the composition for use is administered intravenously, intrathecally, or intramuscularly, or by pulmonary delivery, optionally through nebulization. In some embodiments, the composition for use is administered intramuscularly. In some embodiments, the composition for use is administered intravenously.The present disclosure further provides a method for treating or preventing a disease wherein said method comprises administering to a subject in need thereof the composition of any one of claims 49-51 and wherein the disease is amenable to treatment or prevention by the peptide or protein encoded by the mRNA, optionally wherein the mRNA encodes an antigen and / or the disease is (a) a protein deficiency, optionally wherein the protein deficiency affects the liver, lung, brain or muscle, (b) an autoimmune disease, (c) an infectious disease, or (d) cancer. In some embodiments, the composition is administered intravenously, intrathecally, or intramuscularly, or by pulmonary delivery, optionally through nebulization. In some embodiments, the composition is administered intramuscularly. In some embodiments, the composition is administered intravenously.DETAILED DESCRIPTIONThe present disclosure provides, inter alia, a class of ionizable lipid compounds that may be incorporated into lipid nanoparticle (LNP) formulations for delivering cargo, such as a nucleic acid molecule (e.g., mRNA), to a target cell. LNPs comprising the ionizable lipids of the present disclosure exhibit enhanced expression of proteins encoded by cargo nucleic acid molecules. Furthermore, the ionizable lipids of the present disclosure are expected to have an improved safety and reactogenicity profile as compared to ionizable lipids in the art owing the stability of the central morpholine ring.1681859815v2773158: SA9-886PC / / PAT25019-WO-PCTI. DefinitionsUnless otherwise defined herein, scientific and technical terms used in this application shall have the meanings that are commonly understood by those of ordinary skill in the art.As used in the specification and in the claims, the term ‘“comprising'’ can include the embodiments “consisting of’ and “consisting essentially of.” The terms “compnse(s),” “include(s),” “having,” “has,” “‘can,” “contain(s),” and variants thereof, as used herein, are intended to be open-ended transitional phrases, terms, or words that require the presence of the named ingredients / steps and permit the presence of other ingredients / steps. However, such description should be construed as also describing compositions or processes as “consisting of’ and “consisting essentially of’ the enumerated ingredients / steps, which allows the presence of only the named ingredients / steps and excludes other ingredients / steps.As used herein, the term “approximately” or “about,” as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In certain embodiments, the term “approximately” or “‘about” refers to a range of values that fall within 25%, 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1 %, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value).As used herein, the term “‘delivery” encompasses both local and systemic delivery. For example, delivery of mRNA encompasses situations in which an mRNA is delivered to a target tissue and the encoded protein is expressed and retained within the target tissue (also referred to as “local distribution” or “local delivery”), and situations in which an mRNA is delivered to a target tissue and the encoded protein is expressed and secreted into patient's circulation system (e.g., serum) and systematically distributed and taken up by other tissues (also referred to as “systemic distribution” or “systemic deliver}').As used herein, “expression” of a nucleic acid sequence refers to translation of an mRNA into a polypeptide, assembly of multiple polypeptides (e.g., heavy chain or light chain of antibody) into an intact protein (e.g., antibody), and / or post-translational modification of a polypeptide or fully assembled protein (e.g., antibody). In this application, the terms “expression” and “production,” and grammatical equivalent, are used inter-changeably.1781859815v2773158: SA9-886PC / / PAT25019-WO-PCTAs used herein, the term “half-life"’ is the time required for a quantity such as nucleic acid or protein concentration or activity to fall to half of its value as measured at the beginning of a time period.As used herein, the terms “improve,” “increase” or “reduce,” or grammatical equivalents, indicate values that are relative to a baseline measurement, such as a measurement in the same individual prior to initiation of the treatment described herein, or a measurement in a control subject (or multiple control subject) in the absence of the treatment described herein.As used herein, the term “in vitro” refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, etc., rather than within a multi-cellular organism.As used herein, the term “in vivo” refers to events that occur within a multi-cellular organism, such as a human and a non-human animal. In the context of cell-based systems, the term may be used to refer to events that occur within a living cell (as opposed to, for example, in vitro systems).As used herein, the term "liposome" refers to any lamellar, multilamellar, or solid nanoparticle vesicle. Typically, a liposome as used herein can be formed by mixing one or more lipids or by mixing one or more lipids and polymer(s). In some embodiments, a liposome suitable for the present disclosure contains an ionizable or cationic lipid(s) and optionally non-cationic lipid(s), optionally cholesterol-based lipid(s). and / or optionally PEG-modified lipid(s).As used herein, the term “messenger RNA (mRNA)” refers to a polynucleotide that encodes at least one polypeptide. mRNA as used herein may encompass both modified and unmodified RNA. mRNA may contain one or more coding and non-coding regions. mRNA can be purified from natural sources, produced using recombinant expression systems and optionally purified, chemically synthesized, etc. Where appropriate, e.g., in the case of chemically synthesized molecules, mRNA can comprise nucleoside analogs such as analogs having chemically modified bases or sugars, backbone modifications, etc. An mRNA sequence is presented in the 5' to 3' direction unless otherwise indicated. In some embodiments, an mRNA is or comprises natural nucleosides (e.g., adenosine, guanosine, cytidine, uridine); nucleoside analogs (e.g., 2-aminoadenosine, 2-thiothymidine, inosine, pyrrolo-pyrimidine, 3-methyl adenosine, 5-methylcytidine, C-5 propynyl-cytidine, C-5 propynyl-undine, 2-aminoadenosine, C5-bromouridine, C5-fluorouridine, C5-iodouridine, C5-propynyl-uridine, C5-propynyl-cytidine, C 5 -methyl cytidine, 2-aminoadenosine, 7- 1881859815v2773158: SA9-886PC / / PAT25019-WO-PCTdeazaadenosine, 7-deazaguanosine, 8-oxoadenosine, 8-oxoguanosine, O(6)-methylguanine, and 2-thiocytidine); chemically modified bases; biologically modified bases (e.g., methylated bases); intercalated bases; modified sugars (e.g., 2'-fluororibose, ribose, 2'-deoxyribose, arabinose, and hexose); and / or modified phosphate groups (e.g., phosphorothioates and 5'-N-phosphoramidite linkages).As used herein, the term “nucleic acid.” in its broadest sense, refers to any compound and / or substance that is or can be incorporated into a polynucleotide chain. In some embodiments, a nucleic acid is a compound and / or substance that is or can be incorporated into a polynucleotide chain via a phosphodiester linkage. In some embodiments, “nucleic acid” refers to individual nucleic acid residues (e.g., nucleotides and / or nucleosides). In some embodiments, “nucleic acid” refers to a polynucleotide chain comprising individual nucleic acid residues. In some embodiments, “nucleic acid” encompasses RNA as well as single and / or double-stranded DNA and / or cDNA.The term “pharmaceutically acceptable” as used herein, refers to substances that, within the scope of sound medical judgment, are suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit / risk ratio.Pharmaceutically acceptable salts are well known in the art. For example, S. M. Berge et al., describes pharmaceutically acceptable salts in detail in J. Pharmaceutical Sciences (1977) 66:1-19. Pharmaceutically acceptable salts of the compounds of this disclosure include those derived from suitable inorganic and organic acids and bases.As used herein, the term “subject” refers to a human or any non-human animal (e.g., mouse, rat, rabbit, dog, cat, cattle, swine, sheep, horse or primate). A human includes pre-and post-natal forms. In many embodiments, a subject is a human being. A subject can be a patient, which refers to a human presenting to a medical provider for diagnosis or treatment of a disease. The term “subject” is used herein interchangeably with “individual” or “patient.” A subject can be afflicted with or is susceptible to a disease or disorder but may or may not display symptoms of the disease or disorder.As used herein, the term “substantially” refers to the qualitative condition of exhibiting total or near-total extent or degree of a characteristic or property of interest. One of ordinary skill in the biological arts will understand that biological and chemical phenomena rarely, if ever, go to completion and / or proceed to completeness or achieve or avoid an absolute result. The term “substantially” is therefore used herein to capture the potential lack of completeness inherent in many biological and chemical phenomena.1981859815v2773158: SA9-886PC / / PAT25019-WO-PCTAs used herein, the term “target tissues’" refers to any tissue that is affected by a disease to be treated. In some embodiments, target tissues include those tissues that display disease-associated pathology, symptom, or feature.As used herein, the term “therapeutically effective amount” of a therapeutic agent means an amount that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, diagnose, prevent, and / or delay the onset of the symptom(s) of the disease, disorder, and / or condition. It will be appreciated by those of ordinary skill in the art that a therapeutically effective amount is typically administered via a dosing regimen comprising at least one unit dose.As used herein, the term “treatment” or “treating,” is defined as the application or administration of a therapeutic agent to a patient, or application or administration of a therapeutic agent to an isolated tissue or cell line from a patient (e g., for diagnosis or ex vivo applications), who has a disorder or disease as described herein, a symptom thereof; where the purpose of the application or administration is to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disorder or disease, or its symptoms. Such treatments may be specifically tailored or modified, based on knowledge obtained from the field of pharmacogenomics.As used herein, the term “prevent” or “prevention” means no disorder or disease development if none had occurred, or no further disorder or disease development if there had already been development of the disorder or disease. Also considered is the ability of one to prevent some or all of the symptoms associated with the disorder or disease.Compounds described herein can comprise one or more asymmetric centers, and thus can exist in various isomeric forms, e.g., enantiomers and / or diastereomers. For example, the compounds described herein can be in the form of an individual enantiomer, diastereomer or geometric isomer, or can be in the form of a mixture of stereoisomers, including racemic mixtures and mixtures enriched in one or more stereoisomer. Isomers can be isolated from mixtures by methods known to those skilled in the art, including chiral high performance liquid chromatography (HPLC) and the formation and crystallization of chiral salts; or preferred isomers can be prepared by asymmetric syntheses. See, for example, Jacques et al., Enantiomers. Racemates and Resolutions (Wiley Interscience, New York, 1981); Wilen et al., Tetrahedron 33:2725 (1977); Eliel, E. L. Stereochemistry of CarbonCompounds (McGraw-Hill, NY, 1962); and Wilen, S. H. Tables of Resolving Agents and Optical Resolutions p. 268 (E. L. Eliel, Ed., Univ, of Notre Dame Press, Notre Dame, Ind.2081859815v2773158: SA9-886PC / / PAT25019-WO-PCT1972). The present disclosure additionally contemplates compounds as individual isomers substantially free of other isomers, and alternatively, as mixtures of various isomers.When a range of values is listed, it is intended to encompass each value and sub-range within the range. For example “Ci-6 alkyl” is intended to encompass, Ci, C2, C3, C4, C5, Ce, C1-6, C1-5, C1-4, C1-3, C1-2, C2-6, C2-5, C2-4, C2-3, C3-6, C3-5, C3-4, C4-6, C4-5, and C5-6 alkyl.As used herein, ‘“lipophilic” refers to the ability of a group to dissolve in fats, oils, lipids, and lipophilic non-polar solvents such as hexane or toluene. In general, a lipophilic group refers to an unsubstituted n-alkyl or unsubstituted n- alkenyl group having 6 to 50 carbon atoms, e.g., 6 to 40, 6 to 30, 6 to 20, 8 to 20, 8 to 19, 8 to 18, 8 to 17, 8 to 16, or 8 to 15 carbon atoms.As used herein, the term “alkyl” refers to a straight or branched saturated hydrocarbon. For example, an alkyl group can have 1 to 30 carbon atoms (i.e., (Ci-C3o)alkyl), 1 to 20 carbon atoms (i.e., (Ci-C2o)alkyl), 1 to 12 carbon atoms (i.e., (Ci-Ci2)alkyl), 1 to 6 carbon atoms (i.e., (Ci-Ce)alkyl), or 1 to 3 carbon atoms (i.e., (Ci-C3)alkyl). Examples of alkyl groups include, but are not limited to, methyl (Me, -CH3). ethyl (Et, -CH2CH3). 1-propyl (w-Pr, w-propyl, -CH2CH2CH3), isopropyl (z-Pr, z-propyl, -CH(CH3)2), 1 -butyl (rz-bu, w-butyl, -CH2CH2CH2CH3), 2-butyl (s-bu, s-butyl, -CH(CH3)CH2CH3), tert-butyl (t-bu, t-butyl, -C(CH3)3), 1 -pentyl (n-pentyl, -CH2CH2CH2CH2CH3), 2-pentyl (-CH(CH3) CH2CH2CH3), neopentyl (CH2C(CH3)3), 1 -hexyl (-CH2CH2CH2CH2CH2CH3), 2-hexyl (-CH(CH3)CH2CH2CH2CH3), heptyl (-(CH2)6CH3). octyl (-(CH2)7CH3), 2.2.4-tnmethylpentyl (-CH2C(CH3)2CH2CH(CH3)2), nonyl (-(CH2)8CH3), decyl (-(CH2)9CH3), undecyl (-(CH2)10CH3), and dodecyl (-(CH2)11CH3).As used herein, the term “alkylene” refers to a divalent alkyl group.As used herein, the term “alkenyl” refers to a straight or branched saturated hydrocarbon having at least one site of carbon-carbon double bond unsaturation. For example, an alkenyl group can have 2 to 30 carbon atoms (i.e., (C2-C3o)alkenyl), 2 to 20 carbon atoms (i.e., (C2-C2o)alkenyl), 2 to 12 carbon atoms (i.e., (C2-Ci2)alkenyl) or 2 to 6 carbon atoms (i.e., (C2-C6)alkenyl), and the alkenyl group can contain 1, 2, 3, or 4 carboncarbon double bonds. The one or more carbon-carbon double bonds can be internal (such as in 2-butenyl) or terminal (such as in 1-butenyl). Included within this term are the cis and trans isomers or mixtures of these isomers. Nonlimiting examples of alkenyl groups include prop-2-enyl, but-2-enyl, but-3-enyl, 2-methylprop-2-enyl, hex-2 -enyl, hex- 5-enyl. 2,3-dimethylbut-2-enyl, and the like.2181859815v2773158: SA9-886PC / / PAT25019-WO-PCTAs used herein, the term “alkynyl” refers to a straight or branched saturated hydrocarbon having at least one site of carbon-carbon triple bond unsaturation occurring at any stable point along the chain. For example, an alkynyl group can have 2 to 30 carbon atoms (i.e., (C2-C3o)alkynyl), 2 to 20 carbon atoms (i.e., (C2-C2o)alkynyl), 2 to 12 carbon atoms (i.e., (C2-Ci2)alkynyl) or 2 to 6 carbon atoms (i.e., (C2-Ce)alkynyl), and the alkynyl group can contain 1, 2. 3, or 4 carbon-carbon triple bonds. The one or more carbon-carbon triple bonds can be internal or terminal. Optionally, the alkynyl group may include one or more double bonds (e.g., 1, 2, 3, or 4 double bonds). For purposes of the present disclosure, a hydrocarbon group having one or more triple bonds and one or more double bonds (e.g., an “ene-yne”) is categorized as an alkynyl moiety. Nonlimiting examples of an alkynyl groups include prop-2-ynyl, but-2-ynyl. but-3-ynyl. pent-2-ynyl, 3-methylpent-4-ynyl. hex-2-ynyl, hex-5-ynyl, etc.The term “heteroaryl” refers to a single aromatic ring that has at least one atom other than carbon in the ring, wherein the atom is selected from the group consisting of oxygen, nitrogen and sulfur. The term “heteroaryl” includes single aromatic rings of from 1 to 6 carbon atoms and 1 to 4 heteroatoms selected from the group consisting of oxygen, nitrogen and sulfur. Exemplary heteroaryl ring systems include but are not limited to pyridinyl, pyrimidinyl, pyrazinyl, pyridazinyl, pyrimidinyl, pyrazolyl, oxazolyl, oxadiazolyl, isoxazolyl, triazolyl, imidazolyl, tetrazolyl, thienyl, thiazolyl, isothiazolyl, thiadiazolyl, or furyl.As used herein, a “counteranion” is a negatively charged group associated with a positively charged quarternary amine in order to maintain electronic neutrality. Exemplary counteranions include halide ions (e.g., F —, Cl —, Br —, I — ), NO3-, C1O4-, OH —, H2PO4-, HSO4-, sulfonate ions (e.g., methanesulfonate, trifluoromethanesulfonate, p-toluenesulfonate, benzenesulfonate, 10-camphor sulfonate, naphthalene-2-sulfonate, naphthalene- 1 -sulfonic acid-5-sulfonate, ethan-1 -sulfonic acid-2-sulfonate, and the like), and carboxylate ions (e g., acetate, ethanoate, propanoate, benzoate, glycerate, lactate, tartrate, glycolate, and the like). In some embodiments, the compounds disclosed herein comprise a positively charged quaternary amin associated with a counterion.As used herein, the term “saturated” refers to a ring moiety that does not contain a double or triple bond, i.e., the ring contains all single bonds.Nitrogen atoms can be substituted or unsubstituted as valency permits, and include primary, secondary, tertiary, and quarternary nitrogen atoms.Exemplary methods and materials are described below, although methods and materials similar or equivalent to those described herein can also be used in the practice or 2281859815v2773158: SA9-886PC / / PAT25019-WO-PCTtesting of the present disclosure. In case of conflict, the present specification, including definitions, will control. Generally, nomenclature used in connection with, and techniques of, cell and tissue culture, molecular biology, virology, immunology, microbiology, genetics, analytical chemistry, synthetic organic chemistry, medicinal and pharmaceutical chemistry, and protein and nucleic acid chemistry and hybridization described herein are those well-known and commonly used in the art. Enzymatic reactions and purification techniques are performed according to manufacturer’s specifications, as commonly accomplished in the art or as described herein. Further, unless otherwise required by context, singular terms shall include pluralities and plural terms shall include the singular.Although a number of documents are cited herein, this citation does not constitute an admission that any of these documents forms part of the common general knowledge in the art.II. Ionizable LipidsThe present disclosure provides ionizable lipids that that afford a positively charged environment at low pH to facilitate efficient encapsulation of a negatively charged mRNA drug substance. In particular, the present disclosure relates to ionizable lipids having a morpholine group that have a net positive charge at a selected pH, such as physiological pH.Accordingly, in an aspect, the present disclosure provides an ionizable lipid that is a compound having a structure according to Formula (I):R(I),or a pharmaceutically acceptable salt thereof, wherein:each X is independently for each occurrence -C(1-8)alkylene-;-;2381859815v2773158: SA9-886PC / / PAT25019-WO-PCTeach L is independently for each occurrence0,0each Y is independently for each occurrence -C(i-8)alkylene-;R1independently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected O H9 Uk / RBII VN. / RB / RAY \^N / RAY from the group consisting of -OH,° O H and O;R2independently for each occurrence is -C(4-30)alkyl, -C<4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected O Ho er, RB|| b / rBY-RAYRAY from the group consisting of -OH,uO H and O;R3is H, -C(i-8)alkyl, or -C(O)-C(i-8)alkyl, wherein the C<i-8)alkyl and -C(O)-C(i-8)alkyl are optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl;RAindependently for each occurrence is -C<4-30)alkyl, -C(4-30)alkenyl, or -C<4-30)alkynyl;RBindependently for each occurrence is -C(4-30)alkyl, -C<4-30)alkenyl, or -C(4-30)alkynyl;RNindependently for each occurrence is H or -C(i-3)alkyl; andn is 1-10.In some embodiments, the present disclosure provides an ionizable lipid that is a compound having a structure according to Formula (I):2481859815v2773158: SA9-886PC / / PAT25019-WO-PCT(I),or a pharmaceutically acceptable salt thereof, wherein:each X is independently for each occurrence -C(1-8)alkylene-;each Y is independently for each occurrence -C(1-8)alkylene-;R1independently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected 2 O RBA0 / RAYfrom the group consisting of -OH,u, and0;R2independently for each occurrence is -C(4-30)alkyl, -C<4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected O v o RBfrom the group consisting of -OH,u, and0;R3is H, -C(i-8)alkyl, or -C(O)-C(i-8)alkyl, wherein the C<i-8)alky 1 and -C(O)-C(i-8)alkyl are optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl;RAindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl;RBindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl;RNindependently for each occurrence is H or -C(1-3)alkyl; andn is 1-10.In some embodiments, the present disclosure provides an ionizable lipid that is a compound having a structure according to Formula (I):2581859815v2773158: SA9-886PC / / PAT25019-WO-PCT(I),or a pharmaceutically acceptable salt thereof, wherein:each X is independently for each occurrence -C(1-8)alkylene-;<O Veach L is independently for each occurrenceor Oeach Y is independently for each occurrence -C(i-8)alkylene-;R1independently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl, each of which is optionally substituted with one or two substituents selected from the group consisting of -0^RB / RAOH,0, and OR2independently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl, each of which is optionally substituted with one or two substituents selected from the group consisting of - O RB / RAOH,0, and oR3is H or -C(i-8)alkyl, wherein the C(i-8)alkyl is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl:RAindependently for each occurrence is -C<4-20)alkyl or -C(4-20)alkenyl;RBindependently for each occurrence is -C<4-20)alkyl or -C(4-20)alkenyl;RNindependently for each occurrence is H or -C(i-3)alkyl; andn is 1-10.In some embodiments, the present disclosure provides an ionizable lipid that is a compound having a structure according to Formula (Ic):or a pharmaceutically acceptable salt thereof, wherein:each Y is independently for each occurrence -C(2-4)alkylene-;R1and R2independently for each occurrence are selected from the group consisting of:2681859815v2773158: SA9-886PC / / PAT25019-WO-PCT(i) -C(8-20)alkyl;(ii) -C(8-20)alkyl that is substituted with one -OH group;OL / RA(iii) -C(4-10)alkyl that is substituted with one substituent selected from \°YRBand O;(iv) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl O \ O RB^ Y is further substituted with one substituent selected fromuand0;(v) -C(8-20)alkenyl; and(vi) -C(8-20)alkenyl that is substituted with one -OH group;R3is -C(i-6)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 6-membered heteroaryl;RAindependently for each occurrence is -C<4-20)alkyl or -C(4-20)alkenyl;RBindependently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl;RNindependently for each occurrence is H or -C(i-3)alkyl; andn is 1-10.In some embodiments, the present disclosure provides an ionizable lipid that is a compound having a structure according to Formula (Ic):or a pharmaceutically acceptable salt thereof, wherein:each Y is independently -CH2CH2CH2- or -CH2CH2CH2CH2-;R1and R2independently for each occurrence are selected from the group consisting81859815v2773158: SA9-886PC / / PAT25019-WO-PCTR3is -C(i-4)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(CH3)2, -(OCH2CH2)2-OH, and imidazolyl;RNindependently for each occurrence is H or -C(i-3)alkyl; andn is 1-10.In some embodiments, the present disclosure provides an ionizable lipid that is a compound having a structure according to Formula (Id-i):2881859815v2773158: SA9-886PC / / PAT25019-WO-PCT(Id-i),or a pharmaceutically acceptable salt thereof, wherein:R1and R2independently for each occurrence are selected from the group consisting of:(i) -C(8-20)alkyl that is substituted with one -OH group;O / RA(ii) -C(4-10)alkyl that is substituted with one substituent selected from, and(iii) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl O V o RB^ Y is further substituted with one substituent selected fromuand0In some embodiments, the present disclosure provides an ionizable lipid that is a compound having a structure according to Formula (le-i):R1(le-i),or a pharmaceutically acceptable salt thereof, wherein:R1and R2independently for each occurrence are selected from the group consisting of:(i) -C(8-20)alkyl that is substituted with one -OH group;0 / RA(ii) -C(4-10)alkyl that is substituted with one substituent selected fromO, and RB0; and2981859815v2773158: SA9-886PC / / PAT25019-WO-PCT(iii) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl o \ o RB^ Y is further substituted with one substituent selected fromuand0In some embodiments, each X is -C(i-4)alkylene-. In some embodiments, each X is -CH2-. In some embodiments, each X is -CH2CH2-. In some embodiments, each X is -CH2CH2CH2-. In some embodiments, each X is -CH2CH2CH2CH2-. In some embodiments, each X is -(CH2)s-. In some embodiments, each X is -(CH2)6-. In some embodiments, each X is -(CH2)?-. In some embodiments, each X is -(CH2)s-.In some embodiments, the present disclosure provides a compound having a structure according to Formula (la):RxN IR1or a pharmaceutically acceptable salt thereof.In some embodiments, L independently for each occurrence is O. In some. H Hembodiments, L independently for each occurrence is O. In some embodiments.OL independently for each occurrence isor O. In some embodiments, L H Hindependently for each occurrence is O or O. In some embodiments,H HL independently for each occurrence is O or O. In someOembodiments, L independently for each occurrence isor O. In some3081859815v2773158: SA9-886PC / / PAT25019-WO-PCTembodiments, L independently for each occurrence isHor O. In someembodiments, L independently for each occurrence isbIn some embodiments, the present disclosure provides a compound having a structure according to Formula (lb):R2O(lb),or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (Ic):O'or a pharmaceutically acceptable salt thereof.In some embodiments, each Y is -C(i-4)alkylene-. In some embodiments, each Y is -C(2-4)alkylene-. In some embodiments, each Y is -C(3-4)alkylene-. In some embodiments, each Y is -CH2-. In some embodiments, each Y is -CH2CH2-. In some embodiments, each Y is -CH2CH2CH2-. In some embodiments, each Y is -CH2CH2CH2CH2-. In some embodiments, each Y is -(CH2)5-. In some embodiments, each Y is -(CH2)e-. In some embodiments, each Y is -(CH2)?-. In some embodiments, each Y is -(CH2)s-. In some embodiments, Y independently for each occurrence is -CH2CH2CH2- or -CH2CH2CH2CH2-.In some embodiments, the present disclosure provides a compound having a structure according to Formula (Ic-i):81859815v2773158: SA9-886PC / / PAT25019-WO-PCTor a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (Ic-ii):R2(Ic-ii),or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (Ic-iii):(Ic-iii),or a pharmaceutically acceptable salt thereof.In some embodiments, R1independently for each occurrence is -C(4-20)alkyl, -C(4-20)alkenyl, or -C(4-20)alkynyl, each of which is optionally substituted with one or twoO / RAsubstituents independently selected from the group consisting of -OH,°, and ^RBO3281859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R1independently for each occurrence is -C(4-30)alkyl or -C(4-30)alkenyl, each of which is optionally substituted with one or two substituents selected fromthe group consisting of -OH,In some embodiments, R1independently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl, each of which is optionally substituted with one or two substituents selected fromthe group consisting of -OH,In some embodiments, R1independently for each occurrence is -C(4-30)alkynyl that is optionally substituted with one or two substituents independently selected from the groupconsisting of -OH,and O. in some embodiments, R1independently for each occurrence is -C(4-20)alkynyl that is optionally substituted with one or twoO RAsubstituents independently selected from the group consisting of -OH,‘O', and0. In some embodiments, R1independently for each occurrence is -C(8-20)alkynyl that is optionally substituted with one -OH group. In some embodiments. R1independently for each occurrence is -C(4-io)alkynyl that is substituted with one substituent selected from0, and wherein the -C(4-io)alkynyl is optionally further substituted with one -OH group.In some embodiments, R1independently for each occurrence is -C(4-30)alkenyl that is optionally substituted with one or two substituents independently selected from the groupconsisting of -OH,In some embodiments, R1independently for each occurrence is -C(4-20)alkenyl that is optionally substituted with one or twosubstituents independently selected from the group consisting of -OH,and81859815v2773158: SA9-886PC / / PAT25019-WO-PCT0. In some embodiments. R1independently for each occurrence is -C(8-20)alkenyl that is optionally substituted with one -OH group. In some embodiments, R1independently for each occurrence is -C(4-10)alkenyl that is substituted with one substituent selected fromand0. and wherein the -C(4-10)alkenyl is optionally further substituted with one -OH group.In some embodiments, R1independently for each occurrence is -C(4-30)alkyl that is optionally substituted with one or two substituents independently selected from the group H O O RB, RAN / RAconsisting of -OH, O O H. and O. In some embodiments, R1independently for each occurrence is -C(4-30)alkyl that is optionally substituted with one or two substituents independently selected from the group consisting of - Oand °. In some embodiments, R1independently for each occurrence is -C(4-20)alkyl that is optionally substituted with one or two substituentsindependently selected from the group consisting of -OH,l\k ^RBO. In some embodiments, R1independently for each occurrence is -C(4-20)alkyl that is optionally substituted with one or two substituents independentlyselected from the group consisting of -OH,and °. In some embodiments, R1independently for each occurrence is -C(8-20)alkyl that is optionally substituted with one -OH group. In some embodiments. R1independently for each occurrenceis -C(4-io)alkyl that is substituted with one substituent selected from3481859815v2773158: SA9-886PC / / PAT25019-WO-PCTO Hhk ^RBN / RAH, and O, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group. In some embodiments, R1independently for each occurrence is -C(4-10)alkylB / RAio)alkyl that is substituted with one substituent selected fromO and o and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group. In some embodiments, R1independently for each occurrence is -C(4-io)alkyl that is substituted with O, HVN RB / RAANone substituent selected fromH and °, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group.In some embodiments, R1independently for each occurrence is selected from the group consisting of:(i) -C(8-20)alkyl;(ii) -C(8-20)alkyl that is substituted with one -OH group; / RA(iii) -C(4-10)alkyl that is substituted with one substituent selected from0 CX _RBand o(iv) -C(4-10)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl RB / RAis further substituted with one substituent selected from0and oRA(v) -C(4-10)alkyl that is substituted with one substituent selected from, and H RB(vi) -C(4-10)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl0,H. RRBRAis further substituted with one substituent selected fromand O 3581859815v2773158: SA9-886PC / / PAT25019-WO-PCT(vii) -C(8-20)alkenyl; and(viii) -C(8-20)alkenyl that is substituted with one -OH group.In some embodiments, R1independently for each occurrence is selected from the group consisting of:(i) -C(8-20)alkyl;(ii) -C(8-20)alkyl that is substituted with one -OH group;(iii) -C(4-10)alkyl that is substituted with one substituent selected fromex _, RBand O(iv) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl0UX ^RB / RAis further substituted with one substituent selected from0and O (v) -C(8-20)alkenyl; and(vi) -C(8-20)alkenyl that is substituted with one -OH group.In some embodiments, R1independently for each occurrence is selected from the group consisting of:(i) -C(8-20)alkyl that is substituted with one -OH group;o / RA(ii) -C(4-10)alkyl that is substituted with one substituent selected fromO, and, RB0; and(iii) -C(4-10)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl O / RAis further substituted with one substituent selected fromO and In some embodiments, R1independently for each occurrence is selected from the group consisting of:3681859815v2773158: SA9-886PC / / PAT25019-WO-PCT3781859815v2773158: SA9-886PC / / PAT25019-WO-PCT3881859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R1independently for each occurrence is selected from the group consisting of:3981859815v2773158: SA9-886PC / / PAT25019-WO-PCTOHOHOOOIn some embodiments, R1independently for each occurrence is selected from the4081859815v2773158: SA9-886PC / / PAT25019-WO-PCT4181859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R1independently for each occurrence is selected from the group consisting ofOHOHOHO4281859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R1independently for each occurrence is selected from the group consisting of:4381859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R1independently for each occurrence is selected from the group consisting of:4481859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R1independently for each occurrence is selected from the group consisting of:In some embodiments, R2independently for each occurrence is -C(4-2t>)alkyl, -C(4-20)alkenyl, or -C(4-20)alkynyl, each of which is optionally substituted with one or twoO / RAsubstituents independently selected from the group consisting of -OH,0, and4581859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R2independently for each occurrence is -C(4-30)alkyl or -C(4-30)alkenyl, each of which is optionally substituted with one or two substituents selected from O \ O RBA ^ Ythe group consisting of -OH,u, and0In some embodiments, R2independently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl, each of which is optionally substituted with one or two substituents selected from O K o RBA ^ Ythe group consisting of -OH,u, and0In some embodiments, R2independently for each occurrence is -C(4-30)alkynyl that is optionally substituted with one or two substituents independently selected from the group O o RBYz Yconsisting of -OH,u, and0. In some embodiments, R2independently for each occurrence is -C(4-20)alkynyl that is optionally substituted with one or twoOL / rAsubstituents independently selected from the group consisting of -OH, X Oanc|°YRB0. In some embodiments, R2independently for each occurrence is -C(8-20)alkynyl that is optionally substituted with one -OH group. In some embodiments. R2independently for each occurrence is -C(4-io)alkynyl that is substituted with one substituent selected from O V O RBA * ^ Yuand0, and wherein the -C(4-10)alkynyl is optionally further substituted with one -OH group.In some embodiments, R2independently for each occurrence is -C(4-30)alkenyl that is optionally substituted with one or tw o substituents independently selected from the groupconsisting of -OH,In some embodiments, R2independently for each occurrence is -C(4-20)alkenyl that is optionally substituted with one or twoO / RAsubstituents independently selected from the group consisting of -OH,O, and81859815v2773158: SA9-886PC / / PAT25019-WO-PCT0. In some embodiments. R2independently for each occurrence is -C(8-20)alkenyl that is optionally substituted with one -OH group. Tn some embodiments, R2independently for each occurrence is -C(4-io)alkenyl that is substituted with one substituent selected fromand0. and wherein the -C(4-10)alkenyl is optionally further substituted with one -OH group.In some embodiments, R2independently for each occurrence is -C(4-30)alkyl that is optionally substituted with one or two substituents independently selected from the group H O O RB, RAN / RAconsisting of -OH, O O H. and O. In some embodiments, R2independently for each occurrence is -C(4-30)alkyl that is optionally substituted with one or two substituents independently selected from the group consisting of - Oand °. In some embodiments, R2independently for each occurrence is -C(4-20)alkyl that is optionally substituted with one or two substituentsindependently selected from the group consisting of -OH,In some embodiments, R2independently for each occurrence is -C(4-20)alkyl that is optionally substituted with one or two substituents independentlyselected from the group consisting of -OH,and °. In some embodiments, R2independently for each occurrence is -C(8-20)alkyl that is optionally substituted with one -OH group. In some embodiments. R2independently for each occurrenceis -C(4-io)alkyl that is substituted with one substituent selected from4781859815v2773158: SA9-886PC / / PAT25019-WO-PCTO Hhk ^RBN / RAH, and O, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group. In some embodiments, R2independently for each occurrence is -C(4-10)alkylB / RAio)alkyl that is substituted with one substituent selected fromO and O and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group. In some embodiments, R2independently for each occurrence is -C(4-io)alkyl that is substituted with O, HVN RB / RAANone substituent selected fromH and °, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group.In some embodiments, R2independently for each occurrence is selected from the group consisting of:(i) -C(8-20)alkyl;(ii) -C(8-20)alkyl that is substituted with one -OH group;O / RA(iii) -C(4-10)alkyl that is substituted with one substituent selected from0 CX _RBand o(iv) -C(4-10)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl o vxx _RB / RAis further substituted with one substituent selected from0and o O RA(v) -C(4-10)alkyl that is substituted with one substituent selected from, and H RBO(vi) -C(4-10)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl0,H. RRBRAis further substituted with one substituent selected fromand O4881859815v2773158: SA9-886PC / / PAT25019-WO-PCT(vii) -C(8-20)alkenyl; and(viii) -C(8-20)alkenyl that is substituted with one -OH group.In some embodiments, R2independently for each occurrence is selected from the group consisting of:(i) -C(8-20)alkyl;(ii) -C(8-20)alkyl that is substituted with one -OH group;(iii) -C(4-10)alkyl that is substituted with one substituent selected fromand0(iv) -C(4-10)alkyl that is substituted with one -OH group, and wherein the -C(4-10)alkyl is further substituted with one substituent selected fromuand °;(v) -C(8-20)alkenyl; and(vi) -C(8-20)alkenyl that is substituted with one -OH group.In some embodiments, R2independently for each occurrence is selected from the group consisting of:(i) -C(8-20)alkyl that is substituted with one -OH group;O / RA(ii) -C(4-10)alkyl that is substituted with one substituent selected from'Y O, and(iii) -C(4-10)alkyl that is substituted with one -OH group, and wherein the -C(4-10)alkylis further substituted with one substituent selected fromIn some embodiments, R2independently for each occurrence is selected from the group consisting of:4981859815v2773158: SA9-886PC / / PAT25019-WO-PCT5081859815v2773158: SA9-886PC / / PAT25019-WO-PCT5181859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R2independently for each occurrence is selected from the group consisting of:5281859815v2773158: SA9-886PC / / PAT25019-WO-PCTOHOHOOOIn some embodiments, R2independently for each occurrence is selected from the5381859815v2773158: SA9-886PC / / PAT25019-WO-PCT5481859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R2independently for each occurrence is selected from the group consisting ofOHOHOHO5581859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R2independently for each occurrence is selected from the group consisting of:5681859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R2independently for each occurrence is selected from the group consisting of:5781859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R2independently for each occurrence is selected from the group consisting of:20)alkenyl, or -C(4-20)alkynyl. In some embodiments, RAindependently for each occurrence is -C(6-20)alkyl, -C(6-20)alkenyl, or -C(6-20)alkynyl.In some embodiments, RAindependently for each occurrence is -C(4-30)alkyl or -C(4-30)alkenyl. In some embodiments, RAindependently for each occurrence is -C(4-20)alkyl or -C(4-2o>alkenyl. In some embodiments, RAindependently for each occurrence is -C(6-20)alkyl or -C(6-20)alkenyl.5881859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, RAindependently for each occurrence is -C(4-30)alkyl. In some embodiments, RAindependently for each occurrence is -C(4-20)alkyl. In some embodiments, RAindependently for each occurrence is -C(6-20)alkyl.In some embodiments, RAindependently for each occurrence is -C(4-30)alkenyl. In some embodiments, RAindependently for each occurrence is -C(4-20)alkenyl. In some embodiments, RAindependently for each occurrence is -C(6-20)alkenyl.In some embodiments, RAindependently for each occurrence is -C(4-30)alkynyl. In some embodiments, RAindependently for each occurrence is -C(4-20)alkynyl. In some embodiments, RAindependently for each occurrence is -C(6-20)alkynyl.In some embodiments, RAindependently for each occurrence is selected from thegroup consisting ofIn some embodiments, each RAisv'2-18. in some embodiments, each RAisIn some embodiments, each RAis' '1-10 ' '1-10In some embodiments, RAindependently for each occurrence is selected from the group consisting ofIn some embodiments, each RAisembodiments, each RAisIn some embodiments, each RAisIn some embodiments, each RAis5981859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, RBindependently for each occurrence is -C(4-20)alkyl, -C(4-20)alkenyl, or -C(4-20)alkynyl. In some embodiments. RBindependently for each occurrence is -C(6-20)alkyl, -C(6-20)alkenyl, or -C(6-20)alkynyl.In some embodiments, RBindependently for each occurrence is -C(4-30)alkyl or -C(4-30)alkenyl. In some embodiments, RBindependently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl. In some embodiments, RBindependently for each occurrence is -C(6-20)alkyl or -C(6-20)alkenyl.In some embodiments, RBindependently for each occurrence is -C(4-30)alkyl. In some embodiments, RBindependently for each occurrence is -C(4-20)alkyl. In some embodiments, RBindependently for each occurrence is -C(6-20)alkyl.In some embodiments, RBindependently for each occurrence is -C(4-30)alkenyl. In some embodiments, RBindependently for each occurrence is -C(4-20)alkenyl. In some embodiments, RBindependently for each occurrence is -C(6-20)alkenyl.In some embodiments, RBindependently for each occurrence is -C(4-30)alkynyl. In some embodiments, RBindependently for each occurrence is -C(4-20)alkynyl. In some embodiments, RBindependently for each occurrence is -C(6-20)alkynyl.In some embodiments, RBindependently for each occurrence is selected from thegroup consisting ofIn some embodiments, each RBis. In some embodiments, each RBis2-10. In some embodiments, each RBis10.In some embodiments, RBindependently for each occurrence is selected from the group consisting of:6081859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, each RBis. In someembodiments, each RBis. In some embodiments, each RBis. In some embodiments, each RBisIn some embodiments, R1and R2independently for each occurrence are selected from the group consisting of:(i) -C(8-20)alkyl;(ii) -C(8-20)alkyl that is substituted with one -OH group:O / RA(iii) -C(4-10)alkyl that is substituted with one substituent selected fromO RBand O(iv) -C(4-10)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl RB / RAis further substituted with one substituent selected from0and O(v) -C(4-io)alky 1 that is substituted with one substituent selected from, and Hl\k ^RB(vi) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl0,HRRA Vfk „RBis further substituted with one substituent selected fromand O (vii) -C(8-20)alkenyl; and(viii) -C(8-20)alkenyl that is substituted with one -OH group.In some embodiments, R1and R2independently for each occurrence are selected from the group consisting of:6181859815v2773158: SA9-886PC / / PAT25019-WO-PCT(i) -C(8-20)alkyl;(ii) -C(8-20)alkyl that is substituted with one -OH group;(iii) -C(4-10)alkyl that is substituted with one substituent selected from(iv) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl O \ O RB^ Y is further substituted with one substituent selected fromuand0;(v) -C(8-20)alkenyl; and(vi) -C(8-20)alkenyl that is substituted with one -OH group.In some embodiments, R1and R2independently for each occurrence are selected from the group consisting of:(i) -C(8-20)alkyl that is substituted with one -OH group;Ol, RA(ii) -C(4-10)alkyl that is substituted with one substituent selected from °, and(iii) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkylis further substituted with one substituent selected fromIn some embodiments, each R1is -C(8-20)al ky 1 that is substituted with one -OH group, and each R2is -C(8-20)alkyl that is substituted with one -OH group.In some embodiments, each R1is -C(4-io)alkyl that is substituted with one substituent OO l\L „RBRA / RAsel O' Nected fromH, and O; and each R2is -C<4-6281859815v2773158: SA9-886PC / / PAT25019-WO-PCTloalkyl that is substituted with one substituent selected fromIn some embodiments, each R1is -C(4-io)alkyl that is substituted with one substituent Oselected fromand each R2is -C(4-io)alkyl that is substitutedwith one substituent selected fromIn some embodiments, each R1is -Cw-iii.alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl is further substituted with one substituent selected from9 O H / RBII / RBJVRAY V-N'RA° O H and Y O; and each R2is -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl is further substituted with one O H RBsubstituent selected fromIn some embodiments, each R1is -Cf4-i o >al k - 1 that is substituted with one -OH group, and wherein the -C(4-io)alkyl is further substituted with one substituent selected fromO; and each R2is -C(4-10)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl is further substituted with one substituent selected fromIn some embodiments, R1and R2independently for each occurrence are selected from the group consisting of:OH6381859815v2773158: SA9-886PC / / PAT25019-WO-PCT6481859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R1and R2independently for each occurrence are selected from the group consisting of:6581859815v2773158: SA9-886PC / / PAT25019-WO-PCT6681859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R1and R2independently for each occurrence are selected from the group consisting of6781859815v2773158: SA9-886PC / / PAT25019-WO-PCTOHIn some embodiments, each R1isandeach R2iseach R2is O' In some embodiments, both R1substituents are identical. In some embodiments, both R2substituents are identical.6881859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R3is H or -C(i-s)alkyl, wherein the -C(i-8)alkyl is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl.In some embodiments, R3is H or -C(i-6)alkyl, wherein the -C(i-6)alkyl is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 6-membered heteroaryl.In some embodiments, R3is H or -C(i-6)alkyl, wherein the -C(i-6)alkyl is optionally substituted with a substituent selected from the group consisting of -OH, -N(CHs)2, -(OCH2CH2)2-OH, and imidazolyl.In some embodiments, R3is H.In some embodiments, R3is -C(i-8)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl.In some embodiments, R3is -C(i-6)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2. -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 6-membered heteroaryl.In some embodiments, R3is -C(i-6)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(CH3)2, -(OCH2CH2)2-OH, and imidazolyl.In some embodiments. R3is -C(i-4)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(CH3)2, -(OCH2CH2)2-OH, and imidazolyl.In some embodiments, R3is -C(i-4)alkyl that is optionally substituted with -OH. In some embodiments, R3is -C(i-4)alkyl. In some embodiments. R3is -C(i-4)alkyl that is substituted with -OH. In some embodiments, R3is -C(i-4)alkyl that is substituted with -N(CH3)2. In some embodiments, R3is -C(i-4)alkyl that is substituted with -(OCH2CH2)n-OH. In some embodiments, R3is -C(i-4,alkyl that is substituted with -(OCH2CH2)2-OH. In some embodiments, R3is -C(i-4)alkyl that is substituted with imidazolyl.In some embodiments, RJis -CH3, OH, OH Ir O OH or r in some embodiments, RJis -CH3 or ^^OH.81859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R3is -CH3. In some embodiments, R3isOH. In someN embodiments, R3isOH. in some embodiments, R3is I. In someembodiments, R3isO OH. In some embodiments, R3isIn some embodiments, R3is -C(O)-C(i-8)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl.In some embodiments, R3is -C(O)-C(i-6)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl.In some embodiments, R3is -C(O)-C(i-4)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2. -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl.In some embodiments, R3is -C(O)-C<i-4)alkyl that is optionally substituted with -N(RN)2. In some embodiments, R3is -C(O)-C(i-4)alkyl that is optionally substituted with -N(CH3)2.I N NIn some embodiments, R3isO or O I. In some embodiments, NNR3is0. In some embodiments, R3is0IIn some embodiments, the present disclosure provides a compound having a structure according to Formula (In some embodiments, the present disclosure provides a compound having a structure according to Formula (Id):(Id),or a pharmaceutically acceptable salt thereof.7081859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the present disclosure provides a compound having a structure according to Formula (Id-i):or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (le):(le),or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having a structure according to Formula (le-i):(le-i),or a pharmaceutically acceptable salt thereof.In some embodiments, RNindependently for each occurrence is H or -CH3. In some embodiments, each RNis H. In some embodiments, each RNis -CH3.In some embodiments, n is 1-5. In some embodiments, n is 1-3. In some embodiments, n is 5-10. In some embodiments, n is 1. In some embodiments, n is 2. In some embodiments, n is 3. In some embodiments, n is 4. In some embodiments, n is 5. In some7181859815v2773158: SA9-886PC / / PAT25019-WO-PCTembodiments, n is 6. In some embodiments, n is 7. In some embodiments, n is 8. In some embodiments, n is 9. In some embodiments, n is 10.kxX.. R2\ r NWhen the twoRgroups of the compound are identical, the compound possesses rotational symmetry and can be rotated 180° about the axis running through the oxygen and nitrogen atoms of the morpholine ring and still appear identical to its original position. Accordingly, in some embodiments, the compound has rotational symmetry.In some embodiments, the central morpholine ring of the compounds described herein contains two asymmetric carbons, denoted with "*" in the following structure:R< / X. * / R2N r NR1L J R1NIR3In some embodiments, the substituents at the two asymmetric carbons are in a cis conformation. For example, the compound may have the following orientation of substituents about the morpholine ring:R2 / O. *^X. / Y-.. R2N L N I IR1k, R1NIR3or, alternately, the following:R2Ak. X,, * JX *ksX. / R2N L< Y y \P NR1J R1N IR3VX^ / R2A ir NiIn such instances, when the twoRgroups are identical, the compound is a meso compound with an internal plane of symmetry.In other embodiments, the substituents at the two asymmetric carbons are in a trans conformation. For example, the compound may have the following orientation of substituents about the morpholine ring:7281859815v2773158: SA9-886PC / / PAT25019-WO-PCTR2, Y. / O. *0X. _R2N L< y LY NR1S R1NIR3or, alternately, the following:NIR3In such instances, the compound does not have an internal plane of symmetry.In some embodiments, the two asymmetric carbons of the morpholine ring are in an (R, R) or (S, S) configuration. In some embodiments, the compound does not have an internal plane of symmetry.In some embodiments, the two asymmetric carbons of the morpholine ring are in an (R, S) or (S, R) configuration. In some embodiments, the compound has an internal plane of symmetry. In some embodiments, the compound is a meso compound.In some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of Compounds 1-24, or a pharmaceutically acceptable salt7381859815v2773158: SA9-886PC / / PAT25019-WO-PCT4 OH OH / / N X / XX0\x- / x0A X / / N. XXX^X''X / V / \XAHkA HO^X^VX^X^X^X / / N\5 o0 S LI H°1o6 0°OjV^o\ A 0 IxxxAAx _ ^x V Y Y o A / ^V y Y° OH L J L OH 007. 0I 1 0 0 X^x X" X x\ JAxA / \ X\ X*X / o <N / -x A, Ox A x^x 1 / « / / N0 N / x\oz, - z - / ,-',z^ 8 x x' x OH 0 x^x / Al?N ^x A / -x o A i / \ / -x ^l ^ Axx- 1 J > 0AA^XAA I0n01H^h 1A nQ A / VxA / - XA A'xY^ / -XxA / ^XA / ~XXA X-~XA / -'XA / 9 OH OH A^A^X^AAY O O YAAX / A / ^\ / <. N x / \ A o- / \ YA A / \ o-X / \ / N. >AX-AAXAXXAQH110 OH OHxx^\ZXxX / ^x^x / \Q 0[Ax / x^ / x^'^^^8, N. x / / XX / Ao^ / X X Ax Xx ^^-x0^ A Xx / ^~Xxx x-- N x x\X-^X^X^X^XXXX-XA^OH^N>HOA / \X^X / X^X / \ / 111 OH OH AAAX'A / AAX ° O A^^A'X^X'X^X J|XX / \A x-X. Ox. / X A, Z\ / X 1N A Y | °Nx, \A\AXZAAO_ NHOA^AX^XX^X^X-7481859815v2773158: SA9-886PC / / PAT25019-WO-PCT12OH Oz O ^13 \ \ / H ° — / / x\ A ^hTo140 0 J- A / 0 ° N^ ■ - o z— '" o"'o0o15— °Y— TOHo o x^ oXCCS o L / \ / k x\,0. / -x A TO N O Y Y O No0THi16\-'x'''^^ \ \ ° ' — / O x°H A OH0o / , N. JL o, / \ / O. Y o \ / \^OH17 OH OH0 o, N. A Xk A, N.r o Y Y o >OH18o k / \. X / \.o. / -x A / \ f Tl0XN 0 Y Y0 N> o0OH7581859815v2773158: SA9-886PC / / PAT25019-WO-PCT7681859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of Compounds 25, 26, 29, and 30, or a pharmaceutically acceptable salt thereof:In some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of Compounds la, 2a, 3a, 4a, 5a, 6a, 7a, 7a', 8a, 8a', 9a, 10a, Ila, 12a, 13a, 14a, 15a, 16a, 17a, 18a, 19a, 20a, 21a, 22a, 23a, and 24a, or a pharmaceutically acceptable salt thereof:H(meso)7781859815v2773158: SA9-886PC / / PAT25019-WO-PCT2a OH OH, N. / x A _ / O. Zx / N.1(meso)3a OH OH / Nx / \ AwAYk >*-x^ A z\, N.p / o Y^ ° >''^x / ^x^^ <N>Ho'A^z^x'z\z / \z''OH(meso)4a OH OH / / N z xx / X ' x / / x0Z^ A -xy-^0 / A "xx X""\ / N, \\N>H0Az^zZ'XXX / "\ZZ(meso)5a 00kS.?— — INI L Ao(meso)6a 0J\ 0 0 ^ ^^^^ ^^ ^ ° OH L J L OH 0'HOX^YrO^=^^ / 0(meso)7a 0 ^I 0 0O A(S, R)7881859815v2773158: SA9-886PC / / PAT25019-WO-PCT7a’ ^\^\^\^\^\ / O^x^xx^ oI o o x^ x\ A J. / 0 \ ii Il r 0(R, S)8a / ^x^^ / ^v / Ov^^X / OH OH 0N / Z - x O ^»- JJxX\XX ' ' 0 x^^^x.0^^^^ ^^0^ " T0" 0T if 'N^ A / -\ A / \ / \ x. x 0 OH 1 HO 0(S, R)8 a’ X / OH 0 '" '' xXXx 'I o o Az\ / xA„A x\xx xx x N / k. x-\. JL x-\ xx / \ xx xx / ^-x_x^\x^xA O0HI HO 0(R,S)9a OH OH 'X^X^X / \x^o 0^^x-x^x^x^ / / N. / X JL x^Sx / 0. ^ZX^ JL / N.< o >< o > \ / '"'X / X\ / 'X^ / < OH HOXA'X'''''X''~Z^^1(meso)10a OH OH0 0[^X^v^Xz^XxX^x / < / N < / \ A oA / S. A ^zx o^ Jk / ^x / N. >XX"\ / XXZX^XZKAOH1(meso)Ila OH OHN-''"''x / '''Xz^O^N(meso)12a OH OH \^X^X^\^X^X^ 0 0 [ / -J'x^--x^ / ^^X 'X. X / 'xX_ XxXx._x XxX_x XxX_ xxkx0H!HOx Jxx^ X / ~xX^ XxXx^ XxXx^ X / Xx^ xx- (meso)7981859815v2773158: SA9-886PC / / PAT25019-WO-PCT13a OH OHO 0 [A / XX / VXx-'X''(meso)14a0 0o L. A / -v. A i 110 N N00'''' '^1N1 o(meso)15a— Y-r o o A^OAAAA^ o k / \ x^ A A. >x A / x l T0 N CT ^y 1 ^0 N.00THiH0^- (meso)16a OH OH0 0r o o >k|\r HO^X / X^ / X^'X / ^OH(meso)17a OH OH XX^xX^XxXX^ 0 o ^AxX\^X^X / X^P, N. / \ A 0^-^ / 0. O Ax. / ~\ -, N. >\^Xx-xx^^xXx^^0H<N>HQAXXX\XX / XXOH(meso)18a0 Oo0^N^^^A^O^XXOX^^OA / ^X / ^I^IOII \ I I > 0 AAAJ OH(meso)8081859815v2773158: SA9-886PC / / PAT25019-WO-PCT19a0 O / / / / / / / N\ A( / ( / / / ,-■' OH(meso)20a OH OH 'x / Xx^xz^X / X / ^0 0. IX J-L. / ^< / O. A / \< o oZNXX\ / \ / \z / X / \A''OH HOA / XX\X\Z\X<°orOH(meso)21a OH OH Xx^x / X / X / ^0 0xx. N. \^ / XX\ AQ-x*. / O.QJL X~\. N.\xxx\x / \^xx\^^ no^x^v^ / x / OH(meso)22a OH OH\xx\ / -\' / X^^ 0 0 pX-k^x\ / \^^^N^-xX^X^0x-K / °\>^0x^L^x^-x^N\x / x\'-xX x\X / ^\_ / \Z X OH ^NTHOx / L'-xX X\^ x\'-^.x--^X / X-\\ / / OH(meso)23a OH OHXX'x / ^XXVX^x / \^ °0[X'ks / X\ / x\ / -^^N ''~''- / ''^X^OX'^ - - - XXN'''XX'~\XX~\ / X^^^ n nO^V^^V / VzX^ / ^ / OH8181859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of Compounds 25a, 26a, 29a, and 30a, or apharmaceutically acceptable salt thereof:25a OH OHN ^^^^ 0 N. _ _ _ _ 1ki\r 1 _ _.(meso)26a OH OH0 0N Nz^OZ\°x> AxOz^ N N „rHL JH1 4r / L / '^ / \ / '^ / X / X / X'OH | HO(meso)29a 9 OH / X / / ff'' / x' z0H0 0OH II(meso)30a H OH Y^^^ o o z- / z zO. / / ,z- 0 ° N N0ONH0- ^1 OH H(meso)In some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of compound lb-24b and lc-24c, or a pharmaceutically acceptable salt thereof:8281859815v2773158: SA9-886PC / / PAT25019-WO-PCTlb OH OH0 o yA^^ / r o > o >kiA HQA^ / SS / XZXZ H(S,S)1c OH OH0 0P o < 0 >H(R, R)2b OH OH'x~-''''~^^o o / , N. A0^ / ^ ’’uy / -O. \.oA, N. \1(S,S)2c OH OHr / N. / \ o < / O. o A1(R, R)3b OH OHr / Nx / \ / X, o., ZK, OX> •''\ oAA / '\ / N. >OH(S, S)3c OH OHo 0 / A^'v^ / Xx / / N. ^'\AA / '',. / O. ^. A. / \. N.p o Y o >OH(R, R)8381859815v2773158: SA9-886PC / / PAT25019-WO-PCT4b OH OH / 'x / / \ z-x Q / V / O. Q \ / N\(S,S)4c OH OH0 0 / N. / O. >zx^A, N.<N> HO'^^''''^^'"''^ / N\(R, R)5b 0o A0 0z z z z •" -0AA S °0(S, S)5c 0o S |J u / x^ / Xz^^z^0As / x / x / ^N O ‘A Y^O N YV s00(R, R)6b 0J\ 0 0HH° A A 0 T 0A o N nOH L J L OH 00(S, S)6c 0A 0 0uH0O Y^O A’A N nOH LkJ L OH 0' nAA^o^^^08481859815v2773158: SA9-886PC / / PAT25019-WO-PCT(R, R)7bI O 1k ou o ii r ^x xx 0 xTC3(S,S)7c& k 9 9 x\^^A0A^^^x j1 / ■'' x-'0°z' / / uxxxxxxxxx-^^x^xxxxx l l > °xxxxAA o f xxx0-' xxx (R, R)8b -'' / OH 0 •''XX / XZ I I > 0xXx^ 0 OH KH0^Xxxx^Qxxxx^xxxXxXX (S, S)8c OH 0°Ni ' '0(R, R)9b OH OHo o< / N. Jk o^ / A^ / O. >•,< X\ o JL ^. N. > '\^X^X^^XAX-OH1(S,S)9c OH OH '^SX^S^^^^X^AX| Q Q< o •< >< 0 >\ / ^ / -x^x^ <N> no^x^^x / ^1(R, R)10b OH OH ''•^x / \^ / x^vA0 0^A^X^X^X^X^X- / ' r zNxX\ XJ^ ^0X XX / OxX." X A Q A XXXX X^XN. X x~x\xx^xx~xx~xx^X0Hkj^x1noXx^Xx^vXx^xX 1(S, S)8581859815v2773158: SA9-886PC / / PAT25019-WO-PCT10c OH OH8 0 < / 0\>*x 0A. x,Nx >1(R, R)11b OH OH0 0 Y^^XX^X / \X"N.-''^Q-^XX^XX^XN'^ / Xx-X^-X^^OH ’i(S, S)lie OH OH X / ^XX / ^X^X o ON- -^x^o / '--^°X^^o-^X^^x^N\ x-\ _X\ XX. X-^X ^bT xL XX x\ XX X (R, R)12b OH OH X ^ A XN^X / X^XQ^Y0^ •''XO^XXX / XNX ^^ XXXX XX XX X'XXX X'XXX J'^xOH ^b |rH0X / -LX~X XXX~X XXX~X XXX~X XXX~X X (S, S)12c OH OH VXXXxXXxJ^ 0 0 Y'1'''^-''''^^N Y° X^X \X X'XXX X'XXX X'X'XX X'X\X x'LX0H!H0X JXx_ XXXX_ X / xX^ X / xX^ X / Xx_ X / (R, R)13b OH OHxx"vXx^x"\^-J^ ° O Y^'''-'''''''''-^^N-^XX^XX^0'^Y°'> •''^0^- / "'''^''N.x Xx X'XXX XXXx X'X" — X " XXx X'X\x J'x'-0H| HO Jx XX - XX - XX - XX - XX - X (S,S)13c OH OHX^X'Xx-'Xx-'X^X-'XX'X^Y0 0Y^-'''''''^^N / xxxJ^o / ^^°y^'OAx'xXNXxxXx^Xx-XxxXxxXx-x0HNHO-'Vx'X^xX^xX^xX^xx^(R, R)8681859815v2773158: SA9-886PC / / PAT25019-WO-PCT14b0 00 k A,-■«<,0 A 1 10 N 0 ^' V 0 N00(S,S)14co0 L N ^^ ^ A.0 / •. r AX 1 ^0 Jk N r,00 i(R, R)15b00 L N A cr ^ AX s'x A / \ / \ f 1H<N>> 0 NT 100 0i(S, S)15co 0rT^^oyCCCC THN i(R,R)16b OH OH0 0A / V^x / -x^ / / \ / - o -\. o / '\ \ / / N. \HOz\ / x\ / X^^X / ^OH(S, S)16c OH OH0 0< 0 < 0 >^OH(R, R)8781859815v2773158: SA9-886PC / / PAT25019-WO-PCT17b OH OH00p'A / -'''''xx-x'^^ / N. JI Ar o A^ > o >OH(S, S)17c OH OHo o^x^ A. / "-. / O. >*-^A ^x, N.X^'X / V^X / ^A'Q^^ <N>Ho^x^'^ / 'x / "x / X / OH(R,R)18b / / / ^ o oz / ,o ^x / x / x / Ak - ^ A I J 1?OH(S, S)18co L / -x / \ A / / , ^x. A / \ f n0 N ■ < A^ O ^AAAA ^No0"" o''OH(R, R)19b^OCOx^x^0 O p / 'x^''X~^o><y-'X^ 'X^^A ^NX / 'AA-^CK.''\AA-''\ / N. A"\ / \ '^- / \Z\ / \Ax^00J ° Jn ^hr k o0j L \^^O> AA-^X^X^\0HA^x^x^X (S, S)8881859815v2773158: SA9-886PC / / PAT25019-WO-PCT8981859815v2773158: SA9-886PC / / PAT25019-WO-PCT9081859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of compound 25b, 26b, 29b, 30b, 25c, 26c, 29c, and 30c,9181859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of compounds 2, 3, 14, and 15, or a pharmaceutically acceptable salt thereof:9281859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of compounds 2a, 3a, 14a, and 15a, or a pharmaceutically acceptable salt thereof:2a OH OH00, N. / x A. N.p o "y0>1(meso)3a OH OHo op / N. A o y^ "y o A, N. >OH(meso)14a0 00000 ^2x30^°^^^ xx / oz / / / / / (meso)9381859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the present disclosure provides a compound having the following structure:(Compound 2),or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 2a),or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 3),or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:9481859815v2773158: SA9-886PC / / PAT25019-WO-PCT(Compound 3a),or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 14),or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having the following structure:(Compound 14a).or a pharmaceutically acceptable salt thereof.In some embodiments, the present disclosure provides a compound having theIn some embodiments, the present disclosure provides a compound having the following structure:9581859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn another aspect, the present disclosure provides an ionizable lipid that is a compound having a structure according to Formula (II):or a pharmaceutically acceptable salt thereof, wherein:X is -C(1-8)alkylene-;R1is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30>alkynyl, each of which is optionally substituted with one or two substituents independently selected from the group consisting of -R2is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected from the group consisting of -RAindependently for each occurrence is -C(4-30)alkyl, -C<4-30)alkenyl, or -C(4-30)alkynyl; andRBindependently for each occurrence is -C(4-30)aIkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl. In some embodiments, X is -C(i-4)alkylene-. In some embodiments, X is -CH2-. In some embodiments, X is -CH2CH2-. In some embodiments, X is -CH2CH2CH2-. In some embodiments, X is -CH2CH2CH2CH2-. In some embodiments, X is -(CH2)s-. In some embodiments, X is -(CH2)e-. In some embodiments. X is -(CFfc)?-. In some embodiments, X is -(CH2)8-.9681859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R1is -C(4-20)alkyl, -C(4-20)alkenyl, or -C(4-20)alkynyl, each of which is optionally substituted with one or two substituents independently selected from the O \ o RB^ Ygroup consisting of -OH,u, and0In some embodiments, R1is -C(4-30)alkyl or -C(4-30)alkenyl, each of which is optionally substituted with one or two substituents selected from the group consisting of -OH,H VO RBO, and OIn some embodiments, R1is -C(4-20)alkyl or -C(4-20)alkenyl, each of which is optionally- substituted with one or two substituents selected from the group consisting of -OH,O V O RB^ Y®, and OIn some embodiments, R1is -C(4-30)alkynyl that is optionally substituted with one or O / RAtwo substituents independently selected from the group consisting of -OH,Y0, and0. In some embodiments, R1is -C(4-20)alkynyl that is optionally substituted with one or two substituents independently selected from the group consisting of -OH,O \ o RBY°, and O. in some embodiments, R1is -C(8-20)alkynyl that is optionally substituted with one -OH group. In some embodiments, R1is -C 4-io)alkynyl that is substituted 1? \0XRBwith one substituent selected fromuand O?and wherein the -C(4-10)alkynyl is optionally further substituted with one -OH group.In some embodiments, R1is -C(4-30)alkenyl that is optionally substituted with one or OL / RAtwo substituents independently selected from the group consisting of -OH,0, and X°¥RB0. In some embodiments, R1is -C(4-20)alkenyl that is optionally substituted with81859815v2773158: SA9-886PC / / PAT25019-WO-PCTone or two substituents independently selected from the group consisting of -OH,In some embodiments, R1is -C(8-20)alkenyl that is optionally substituted with one -OH group. In some embodiments, R1is -C(4-10)alkenyl that is substituted H O RBLO / RAYwith one substituent selected fromuand0. and wherein the -C<4- io)alkenyl is optionally further substituted with one -OH group.In some embodiments, R1is -C<4-30)alkyl that is optionally substituted with one or two OYsubstituents independently selected from the group consisting of -OH, °RA0 Hvx / RBII / RBY \VRAY0H and0. In some embodiments, R1is -C(4-30)alkyl that is optionally substituted with one or two substituents independently selected from the groupconsisting of -OH,and0. In some embodiments, R1is -C(4-20)alkyl that is optionally substituted with one or two substituents independently selected from thegroup consisting of -OH, embodiments, R1is -C(4-20)alkyl that is optionally substituted with one or two substituentsindependently selected from the group consisting of -OH.some embodiments, R1is -C(8-20)alkyl that is optionally substituted with one -OH group. In some embodiments, R1is -C(4-io)alkyl that is substituted with one substituent selected fromoptionally further substituted with one -OH group. In some embodiments, R1is -C(4-io)alkylthat is substituted with one substituent selected from81859815v2773158: SA9-886PC / / PAT25019-WO-PCTwherein the -C -iojalkyl is optionally further substituted with one -OH group. In some embodiments, R1is -C -io.alkyl that is substituted with one substituent selected fromH and °, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group.In some embodiments, R1is selected from the group consisting of:(i) -C(8-20)alkyl;(ii) -C(8-20)alkyl that is substituted with one -OH group;0 / RA(iii) -C(4-10)alkyl that is substituted with one substituent selected from0(iv) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl O \ o RB^A0 / RAY is further substituted with one substituent selected fromuand0;(v) -C(4-10)alkyl that is substituted with one substituent selected fromH, and(vi) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkylis further substituted with one substituent selected fromH and O;(vii) -C(8-20)alkenyl; and(viii) -C(8-20)alkenyl that is substituted with one -OH group.In some embodiments, R1independently for each occurrence is selected from the group consisting of:(i) -C(8-20)alkyl that is substituted with one -OH group;81859815v2773158: SA9-886PC / / PAT25019-WO-PCTO / RA(ii) -C(4-10)alkyl that is substituted with one substituent selected from°, and. RBO; and(iii) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl o RB / RAis further substituted with one substituent selected from0and o In some embodiments, R1is selected from the group consisting of:10081859815v2773158: SA9-886PC / / PAT25019-WO-PCT10181859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R1is selected from the group consisting of:10281859815v2773158: SA9-886PC / / PAT25019-WO-PCT10381859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R2is -C(4-20)alkyl, -C(4-20)alkenyl, or -C(4-20)alkynyl, each of which is optionally substituted with one or two substituents independently selected from the O V O RBgroup consisting of -OH,u, and0In some embodiments, R2is -C(4-30)alkyl or -C(4-30)alkenyl, each of which is optionally substituted with one or two substituents selected from the group consisting of -OH,H VO RBO, and OIn some embodiments, R2is -C(4-20)alkyl or -C(4-20)alkenyl, each of which is optionally substituted with one or two substituents selected from the group consisting of -OH,O V O RB, and OIn some embodiments, R2is -C(4-30)alkynyl that is optionally substituted with one or O / RAtwo substituents independently selected from the group consisting of -OH,Y0, and X°YRB0. In some embodiments, R2is -C(4-20)alkynyl that is optionally substituted with one or two substituents independently selected from the group consisting of -OH,O O RBAY°, and O. in some embodiments, R2is -C(8-20)alkynyl that is optionally substituted with one -OH group. In some embodiments, R2is -C(4-10)alkynyl that is substituted with one substituent selected fromY „-RA■ TRBwith one substituent selected fromuand O?and wherein the -C(4-10)alkynyl is optionally further substituted with one -OH group.In some embodiments, R2is -C(4-30)alkenyl that is optionally substituted with one or OL / RAtwo substituents independently selected from the group consisting of -OH, Y O,anc| X°YRB0. In some embodiments, R2is -C(4-20)alkenyl that is optionally substituted with10481859815v2773158: SA9-886PC / / PAT25019-WO-PCTone or two substituents independently selected from the group consisting of -OH,In some embodiments, R2is -C(8-20)alkenyl that is optionally substituted with one -OH group. In some embodiments, R2is -C(4-10)alkenyl that is substituted H O RBLO / RAYwith one substituent selected fromuand0. and wherein the -C<4- io)alkenyl is optionally further substituted with one -OH group.In some embodiments, R2is -C<4-30)alkyl that is optionally substituted with one or two OYsubstituents independently selected from the group consisting of -OH, °RA0 Hvx / RBII / RBY \VRAY0H and0. In some embodiments, R2is -C(4-30)alkyl that is optionally substituted with one or two substituents independently selected from the groupconsisting of -OH,and0. In some embodiments, R2is -C(4-20)alkyl that is optionally substituted with one or two substituents independently selected from thegroup consisting of -OH, embodiments, R2is -C(4-20)alkyl that is optionally substituted with one or two substituentsindependently selected from the group consisting of -OH.some embodiments, R2is -C(8-20)alkyl that is optionally substituted with one -OH group. In some embodiments, R2is -C(4-io)alkyl that is substituted with one substituent selected fromoptionally further substituted with one -OH group. In some embodiments, R2is -C(4-io)alkylthat is substituted with one substituent selected from81859815v2773158: SA9-886PC / / PAT25019-WO-PCTwherein the -C -iojalkyl is optionally further substituted with one -OH group. In some embodiments, R2is -C(4-10)alkyl that is substituted with one substituent selected fromH and °, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group.In some embodiments, R2is selected from the group consisting of:(i) -C(8-20)alkyl;(ii) -C(8-20)alkyl that is substituted with one -OH group;0 / RA(iii) -C(4-10)alkyl that is substituted with one substituent selected from0(iv) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkyl O \ o RB^A0 / RAY is further substituted with one substituent selected fromuand0;(v) -C(4-10)alkyl that is substituted with one substituent selected fromH, and(vi) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkylis further substituted with one substituent selected fromH and O;(vii) -C(8-20)alkenyl; and(viii) -C(8-20)alkenyl that is substituted with one -OH group.In some embodiments, R2independently for each occurrence is selected from the group consisting of:(i) -C(8-20)alkyl that is substituted with one -OH group;10681859815v2773158: SA9-886PC / / PAT25019-WO-PCTO / RA(ii) -C(4-10)alkyl that is substituted with one substituent selected from°, andand(iii) -C(4-io)alkyl that is substituted with one -OH group, and wherein the -C(4-io)alkylis further substituted with one substituent selected fromIn some embodiments, R2is selected from the group consisting of:10781859815v2773158: SA9-886PC / / PAT25019-WO-PCT10881859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, R2is selected from the group consisting of:10981859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, RAindependently for each occurrence is -C(4-20)alkyl, -C(4-20)alkenyl, or -C(4-20)alkynyl. In some embodiments, RAindependently for each occurrence is - C(6-20)alkyl, -C(6-20)alkenyl, or -C(6-20)alkynyl.11081859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, RAindependently for each occurrence is -C(4-30)alkyl or -C(4-30)alkenyl. In some embodiments, RAindependently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl. In some embodiments, RAindependently for each occurrence is -C(6-20)alkyl or -C(6-20)alkenyl.In some embodiments, RAindependently for each occurrence is -C(4-30)alkyl. In some embodiments, RAindependently for each occurrence is -C(4-20)alkyl. In some embodiments, RAindependently for each occurrence is -C(6-20)alkyl.In some embodiments, RAindependently for each occurrence is -C(4-30)alkenyl. In some embodiments, RAindependently for each occurrence is -C(4-20)alkenyl. In some embodiments, RAindependently for each occurrence is -C(6-20)alkenyl.In some embodiments, RAindependently for each occurrence is -C(4-30)alkynyl. In some embodiments, RAindependently for each occurrence is -C(4-20)alkynyl. In some embodiments, RAindependently for each occurrence is -C(6-20)alkynyl.In some embodiments, RAindependently for each occurrence is selected from thegroup consisting of' '2-18 and ' '2-10. In some embodiments, each RAis' '2-18.^,0In some embodiments, each RAis ' '2-10In some embodiments, RAindependently for each occurrence is selected from the group consisting of:In some embodiments, each RAis. In someembodiments, each RAis In some embodiments, each RAis11181859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, RBindependently for each occurrence is -C(4-20)alkyl, -C(4-20)alkenyl, or -C(4-20)alkynyl. In some embodiments. RBindependently for each occurrence is -C(6-20)alkyl, -C(6-20)alkenyl, or -C(6-20)alkynyl.In some embodiments, RBindependently for each occurrence is -C(4-30)alkyl or -C(4-30)alkenyl. In some embodiments, RBindependently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl. In some embodiments, RBindependently for each occurrence is -C(6-20)alkyl or -C(6-20)alkenyl.In some embodiments, RBindependently for each occurrence is -C(4-30)alkyl. In some embodiments, RBindependently for each occurrence is -C(4-20)alkyl. In some embodiments, RBindependently for each occurrence is -C(6-20)alkyl.In some embodiments, RBindependently for each occurrence is -C(4-30)alkenyl. In some embodiments, RBindependently for each occurrence is -C(4-20)alkenyl. In some embodiments, RBindependently for each occurrence is -C(6-20)alkenyl.In some embodiments, RBindependently for each occurrence is -C(4-30)alkynyl. In some embodiments, RBindependently for each occurrence is -C(4-20)alkynyl. In some embodiments, RBindependently for each occurrence is -C(6-20)alkynyl.In some embodiments, RBindependently for each occurrence is selected from thegroup consisting of' '2-18and ' '2-10. In some embodiments, each RBis' '2-18.In some embodiments, each RBis ' '2-10In some embodiments, RBindependently for each occurrence is selected from the group consisting of:81859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, each RBis. In someembodiments, each RBis In some embodiments, each RBisIn some embodiments, each R1isOIn some embodiments, the central morpholine ring of the compounds of Formula (II) contains two asymmetric carbons, denoted with "*" in the following structure:11381859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the substituents at the two asymmetric carbons are in a cis conformation. For example, the compound may have the following orientation of substituents about the morpholine ring:or, alternately, the following:In such instances, the compound is a meso compound with an internal plane of symmetry.In other embodiments, the substituents at the two asymmetric carbons are in a trans conformation. For example, the compound may have the following orientation of substituents about the morpholine ring:or, alternately, the following:In such instances, the compound does not have an internal plane of symmetry.In some embodiments, the two asymmetric carbons of the morpholine ring are in an (R, R) or (S, S) configuration. In some embodiments, the compound does not have an internal plane of symmetry.11481859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the two asymmetric carbons of the morpholine ring are in an (R, S) or (S, R) configuration. In some embodiments, the compound has an internal plane of symmetry. In some embodiments, the compound is a meso compound.In some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of Compounds 27 and 28, or a pharmaceuticallyIn some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of Compounds 27a and 28a, or a pharmaceuticallyIn some embodiments, the present disclosure provides a compound having a structure selected from the group consisting of Compounds 27b, 27c, 28a, and 28c, or a pharmaceutically acceptable salt thereof:11581859815v2773158: SA9-886PC / / PAT25019-WO-PCTIII. Lipid Nanoparticles CompositionsThe present disclosure also provides a composition comprising a lipid nanoparticle (LNP), wherein the LNP comprises an ionizable lipid of the present disclosure (e.g., a lipid of Formula I, la, lb, Ic, Ic-i, Ic-ii, Ic-iii, Id, Id-i, le, le-i, II).In some embodiments, the LNP further comprises at least one of a helper lipid, a structural lipid or a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid of the present disclosure, a helper lipid, and a structural lipid. In some embodiments, the LNP comprises an ionizable lipid of the present disclosure, a helper lipid, and a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid of the present disclosure, a11681859815v2773158: SA9-886PC / / PAT25019-WO-PCTstructural lipid, and a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid of the present disclosure, a helper lipid, a structural lipid, and a stealth lipid.A. Helper LipidsA helper lipid enhances the structural stability of the LNP and helps the LNP in endosomal escape. A helper lipid may improve uptake and release of an mRNA drug payload encapsulated in the LNP. In some embodiments, the helper lipid is a zwitterionic lipid.Without wishing to be bound by theory, the helper lipid can have fusogenic properties for enhancing uptake and release of the drug payload. Examples of helper lipids are 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE); l,2-distearoyl-sn-glycero-3 -phosphocholine (DSPC); 1.2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); 1.2-dielaidoyl-sn-glycero-3-phosphoethanolamine (DEPE); and l,2-dioleoyl-sn-glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), l,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-Distearoylphosphatidylethanolamine (DSPE), and l,2-dilauroyl-sn-glycero-3-phosphoethanolamine (DLPE).Other exemplary helper lipids are dioleoylphosphatidylcholine (DOPC), dioleoylphosphatidylglycerol (DOPG), dipalmitoylphosphatidylglycerol (DPPG), palmitoyloleoylphosphatidylcholine (POPC), palmitoyloleoyl-phosphatidylethanolamine (POPE), dioleoyl-phosphatidylethanolamine 4-(N-maleimidomethyl)-cyclohexane-l-carboxylate (DOPE-mal), dipalmitoyl phosphatidyl ethanolamine (DPPE), dimyristoylphosphoethanolamine (DMPE), phosphatidylserine, sphingolipids, cerebrosides, gangliosides, 16-O-monomethyl PE, 16-O-dimethyl PE, 18-1-trans PE, l-stearoyl-2-oleoyl-phosphatidyethanolamine (SOPE), or a combination thereof.In particular embodiments, the helper lipid is l,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE).B. Structural LipidsA structural lipid component provides stability to the lipid bilayer structure within the lipid nanoparticle. In some embodiments, the LNP comprises one or more structural lipid. In some embodiments, the structural lipid is a cholesterol-based lipid. Suitable cholesterol-based lipids include, for example: DC-Choi (N, N-dimethyl-N-ethylcarboxamidocholesterol), 1,4-bis(3-N-oleylamino-propyl)piperazine (Gao et al.. Biochem Biophys Res Comm. (1991) 179:280; Wolf et al.. BioTechniques (1997) 23:139; U. S. Pat. 5,744,335), imidazole cholesterol ester (“ICE”; WO2011 / 068810), sitosterol (22,23-dihydrostigmasterol), β- 11781859815v2773158: SA9-886PC / / PAT25019-WO-PCTsitosterol, sitostanol, fucosterol, stigmasterol (stigmasta-5,22-dien-3-ol), ergosterol, desmosterol (3B-hydroxy-5,24-cholestadiene). lanosterol (8,24-lanostadien-3b-ol), 7-dehydrocholesterol (A5,7-cholesterol), dihydrolanosterol (24,25-dihydrolanosterol), zymosterol (5a-cholesta-8,24-dien-3B-ol), lathosterol (5a-cholest-7-en-3B-ol), diosgenin ((30,25R)-spirost-5-en-3-ol), campesterol (campest-5-en-3B-ol), campestanol (5a-campestan-3b-ol), 24-methylene cholesterol (5,24(28)-cholestadien-24-methylen-3B-ol). cholesteryl margarate (cholest-5-en-3B-yl heptadecanoate), cholesteryl oleate, cholesteryl stearate and other modified forms of cholesterol.In some embodiments, the structural lipid is cholesterol.C. Stealth LipidsA stealth lipid component provides control over particle size and stability of the nanoparticle. The addition of such components may prevent complex aggregation and provide a means for increasing circulation lifetime and increasing the delivery of a lipidnucleic acid pharmaceutical composition to target tissues. Typically, the stealth lipid is a polyethylene gly col-conjugated (PEGylated) lipid. These components may be selected to rapidly exchange out of the pharmaceutical composition in vivo (see, e.g., U. S. Pat.5,885,613).Contemplated PEGylated lipids include, but are not limited to, a polyethylene glycol (PEG) chain of up to 5 kDa in length covalently attached to a lipid with alkyl chain(s) of Ce-C20 (e.g., Cs, C10, C12, C14, Ci6, or Cis) length, such as a derivatized ceramide (e.g., N-octanoyl-sphingosine-l-[succinyl(methoxypolyethylene glycol)] (C8 PEG ceramide)). In some embodiments, the PEGylated lipid is l,2-dimyristoyl-rac-glycero-3-methoxypolyethylene glycol (DMG-PEG); l,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylene glycol (DSPE- PEG); l,2-dilauroyl-sn-glycero-3-phosphoethanolamine-poly ethylene glycol (DLPE-PEG); or 1,2-distearoyl-rac-glycero-polyethelene glycol (DSG-PEG).In some embodiments, the PEG has a high molecular weight, e.g., 2000-2400 g / mol. In some embodiments, the PEG is PEG2000 (or PEG-2K). In some embodiments, the PEGylated lipid is DMG-PEG2000, DSPE-PEG2000, DLPE-PEG2000, DSG-PEG2000, or C8 PEG2000. In some embodiments, the PEGylated lipid is dimyristoyl-PEG2000 (DMG-PEG2000).11881859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the stealth lipid is a polyoxazoline polymer-conjugated lipid. Polyoxazoline polymer-conjugated lipids suitable for the LNP compositions of the present disclosure are described, for example, in WO2022 / 173667 and WO2023 / 031394.In some embodiments, the stealth lipid is a polysarcosine-conjugated (pSar) lipid. In some embodiment, the polysarcosine comprises 25-45 sarcosine units. In some embodiment, the polysarcosine comprises 25 sarcosine units. In some embodiment, the polysarcosine comprises 35 sarcosine units. In some embodiment, the polysarcosine comprises 45 sarcosine units. Nonlimiting examples of pSar lipids include N-tetradecyl-pSar25, N-hexadecyl-pSar25, N-octadecyl-pSar25, N-dodecyl-pSar25, l,2-dimyristoyl-sn-glycero-3-succinyl-N-polysarcosine-25 (DMG-pSar25), l,2-dioleoyl-sn-glycero-3-phosphoethanolamine-N-polysarcosine-25 (18:1 PE (DOPE) pSar25), N, N-ditetradecylamine-N-succinyl[methyl(polysarcosine)45], N, N-ditetradecylamine-N-succinyl[methyl(polysarcosine)35], and N, N-ditetradecyl-polysarcosine-25. Further examples of pSar lipids suitable for the LNP compositions of the present disclosure are described in W02020 / 070040.D. Combinations of Lipid Components and Molar RatiosIn some embodiments, the LNP comprises an ionizable lipid of Formula (I) and a helper lipid. In some embodiments, the LNP comprises an ionizable lipid of Formula (I) and a structural lipid. In some embodiments, the LNP comprises an ionizable lipid of Formula (I) and a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid of Formula (I), a helper lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises an ionizable lipid of Formula (la), (lb), (Ic), (Ic-i), (Ic-ii), (Ic-iii), (Id). (Id-i), (le), or (le-i), and a helper lipid. In some embodiments, the LNP comprises an ionizable lipid of Formula (la), (lb), (Ic), (Ic-i), (Ic-ii), (Ic-iii), (Id), (Id-i), (le), or (le-i), and a structural lipid. In some embodiments, the LNP comprises an ionizable lipid of Formula (la), (lb), (Ic), (Ic-i), (Ic-ii), (Ic-iii), (Id), (Id-i), (le), or (le-i) and a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid of Formula (la), (lb), (Ic), (Ic-i), (Ic-ii), (Ic-iii), (Id), (Id-i), (le), or (le-i); a helper lipid; a structural lipid; and a stealth lipid.In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 1-26, 29. and 30 and a helper lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 1-26, 29, and 30 and a structural lipid. In some embodiments, the LNP comprises an ionizable lipid 11981859815v2773158: SA9-886PC / / PAT25019-WO-PCTselected from the group consisting of compounds 1-26, 29, and 30 and a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 1-26, 29, and 30; a helper lipid; a structural lipid; and a stealth lipid.In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 1-24 and a helper lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 1-24 and a structural lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 1-24 and a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 1-24, a helper lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds la, 2a, 3a, 4a, 5a, 6a, 7a, 7a’, 8a, 8a’, 9a, 10a, I la, 12a, 13a, 14a, 15 a, 16a, 17a, 18a, 19a, 20a, 21a, 22a, 23 a, and 24a and a helper lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds la, 2a, 3a, 4a, 5a, 6a, 7a. 7a’, 8a, 8a’, 9a, 10a, Ila, 12a. 13a, 14a. 15a, 16a. 17a, 18a. 19a, 20a. 21a, 22a, 23a, and 24a and a structural lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds la, 2a, 3a, 4a, 5a, 6a, 7a, 7a’, 8a, 8a’, 9a, 10a, Ila, 12a, 13a, 14a, 15a, 16a, 17a, 18a, 19a, 20a, 21a, 22a, 23a, and 24a and a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds la, 2a, 3a. 4a. 5a, 6a, 7a, 7a’. 8a, 8a’. 9a. 10a, I la. 12a, 13a.14a, 15a, 16a, 17a, 18a, 19a, 20a, 21a, 22a, 23a, and 24a; a helper lipid; a structural lipid; and a stealth lipid.In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 2, 3, 14, and 15 and a helper lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 2, 3, 14, and 15 and a structural lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 2, 3, 14, and 15 and a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 2, 3, 14, and 15; a helper lipid; a structural lipid; and a stealth lipid.In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 2a, 3a, 14a, and 15a and a helper lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 2a, 3a, 14a, and 15a and a structural lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 2a, 3a, 14a, and 15a and a stealth lipid.12081859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 2a. 3a, 14a, and 15a; a helper lipid; a structural lipid; and a stealth lipid.In some embodiments, the LNP comprises an ionizable lipid of Formula (II) and a helper lipid. In some embodiments, the LNP comprises an ionizable lipid of Formula (II) and a structural lipid. In some embodiments, the LNP comprises an ionizable lipid of Formula (II) and a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid of Formula (II), a helper lipid, a structural lipid, and a stealth lipid.In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 27 and 28 and a helper lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 27 and 28 and a structural lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 27 and 28 and a stealth lipid. In some embodiments, the LNP comprises an ionizable lipid selected from the group consisting of compounds 27 and 28, a helper lipid, a structural lipid, and a stealth lipid.In some embodiments, the ionizable lipid may constitute about 35 mol% to about 50 mol% of the total lipid content present in the lipid nanoparticle. In some embodiments, the ionizable lipid may constitute about 35 mol% to about 45 mol% of the total lipid content present in the lipid nanoparticle. In some embodiments, the ionizable lipid may constitute about 40 mol% of the total lipid content present in the lipid nanoparticle.In some embodiments, the helper lipid may constitute about 10 mol% to about 35 mol% of the total lipid content present in the lipid nanoparticle. In some embodiments, the helper lipid may constitute about 20 mol% to about 35 mol% of the total lipid content present in the lipid nanoparticle. In some embodiments, the helper lipid may constitute about 30 mol% of the total lipid content present in the lipid nanoparticle.In some embodiments, the structural lipid may constitute about 20 mol% to about 50 mol% of the total lipid content present in the lipid nanoparticle. In some embodiments, the structural lipid may constitute about 20 mol% to about 35 mol% of the total lipid content present in the lipid nanoparticle. In some embodiments, the structural lipid may constitute about 25 mol% of the total lipid content present in the lipid nanoparticle. In some embodiments, the structural lipid may constitute about 28.5 mol% of the total lipid content present in the lipid nanoparticle.In some embodiments, the stealth lipid may constitute about 1 mol% to about 5 mol% of the total lipid content present in the lipid nanoparticle. In some embodiments, the stealth 12181859815v2773158: SA9-886PC / / PAT25019-WO-PCTlipid may constitute about 1.5 mol% of the total lipid content present in the lipid nanoparticle. In some embodiments, the stealth lipid may constitute about 5 mol% of the total lipid content present in the lipid nanoparticle.In some embodiments, the LNP comprises the ionizable lipid in an amount that is about 35 mol% to about 50 mol% of the total lipid content, the helper lipid in an amount that is about 10 mol% to about 35 mol% of the total lipid content, the structural lipid in an amount that is about 20 mol% to about 50 mol% of the total lipid content, and the stealth lipid in an amount that is about 1 mol% to about 5 mol% of the total lipid content.In some embodiments, the LNP comprises the ionizable lipid in an amount that is about 35 mol% to about 45 mol% of the total lipid content, the helper lipid in an amount that is about 20 mol% to about 35 mol% of the total lipid content, the structural lipid in an amount that is about 20 mol% to about 35 mol% of the total lipid content, and the stealth lipid in an amount that is about 1 mol% to about 5 mol% of the total lipid content.In some embodiments, the LNP comprises the ionizable lipid in an amount that is about 40 mol% of the total lipid content, the helper lipid in an amount that is about 30 mol% of the total lipid content, the structural lipid in an amount that is about 25 mol% of the total lipid content, and the stealth lipid in an amount that is about 5 mol% of the total lipid content.In some embodiments, the LNP comprises the ionizable lipid in an amount that is about 40 mol% of the total lipid content, the helper lipid in an amount that is about 30 mol% of the total lipid content, the structural lipid in an amount that is about 28.5 mol% of the total lipid content, and the stealth lipid in an amount that is about 1.5 mol% of the total lipid content.To calculate the actual amount of each lipid to be put into an LNP formulation, the molar amount of the cationic or ionizable lipid is first determined based on a desired N / P ratio, where N is the number of nitrogen atoms in the cationic lipid and P is the number of phosphate groups in the mRNA to be transported by the LNP. Next, the molar amount of each of the other lipids is calculated based on the molar amount of the cationic lipid and the molar ratio selected. These molar amounts are then converted to weights using the molecular weight of each lipid.E. Active Ingredients of the LNPsThe active ingredient of the present LNP composition may be an mRNA that encodes a polypeptide of interest. In certain embodiments, the polypeptide is an antigen. In certain embodiments, the polypeptide is a therapeutic polypeptide. The therapeutic polypeptide may 12281859815v2773158: SA9-886PC / / PAT25019-WO-PCTbe an antibody (e.g., an antibody heavy chain or an antibody light chain. The therapeutic polypeptide may be an enzyme.The mRNA molecule encapsulated by the present disclosure LNPs may comprise at least one ribonucleic acid (RNA) comprising an ORF encoding a polypeptide of interest. In certain embodiments, the mRNA further comprises at least one 5’ UTR, 3’ UTR, a poly (A) tail, and / or a 5' cap.i.5’ CapAn mRNA 5' cap can provide resistance to nucleases found in most eukaryotic cells and promote translation efficiency. Several types of 5’ caps are known. A 7-methylguanosine cap (also referred to as “m7G” orL‘Cap-0”), comprises a guanosine that is linked through a 5’ - 5’ - triphosphate bond to the first transcribed nucleotide.A 5' cap is typically added as follows: first, an RNA terminal phosphatase removes one of the terminal phosphate groups from the 5’ nucleotide, leaving two terminal phosphates; guanosine triphosphate (GTP) is then added to the terminal phosphates via a guanylyl transferase, producing a 5 ‘5 ’5 triphosphate linkage; and the 7-nitrogen of guanine is then methylated by a methyltransferase. Examples of cap structures include, but are not limited to, m7G(5’)ppp, (5’(A, G(5’)ppp(5’)A, and G(5')ppp(5’)G. Additional cap structures are described in U. S. Publication No. US 2016 / 0032356 and U. S. Publication No. US 2018 / 0125989. which are incorporated herein by reference.5 ’-capping of polynucleotides may be completed concomitantly during the in vitro-transcription reaction using the following chemical RNA cap analogs to generate the 5’-guanosine cap structure according to manufacturer protocols: 3’-O-Me-m7G(5’)ppp(5')G (the ARCA cap); G(5’)ppp(5’)A; G(5’)ppp(5’)G; m7G(5’)ppp(5’)A; m7G(5’)ppp(5’)G; m7G(5')ppp(5')(2'OMeA)pG; m7G(5')ppp(5')(2'OMeA)pU; m7G(5')ppp(5')(2'OMeG)pG (New England BioLabs, Ipswich, MA; TriLink Biotechnologies). 5’-capping of modified RNA may be completed post-transcriptionally using a vaccinia virus capping enzyme to generate the Cap 0 structure: m7G(5’)ppp(5’)G. Cap 1 structure may be generated using both vaccinia virus capping enzyme and a 2’-0 methyl-transferase to generate: m7G(5’)ppp(5’)G-2’-O-methyl. Cap 2 structure may be generated from the Cap 1 structure followed by the 2’-O-methylation of the 5 ’-antepenultimate nucleotide using a 2 -0 methyl-transferase. Cap 3 structure may be generated from the Cap 2 structure followed by the 2'-O-methylation of the 5’-preantepenultimate nucleotide using a2’-0 methyl-transferase.12381859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn certain embodiments, the mRNA of the disclosure comprises a 5’ cap selected from the group consisting of 3'-O-Me-m7G(5')ppp(5')G (the ARCA cap), G(5')ppp(5')A, G(5’)ppp(5’)G, m7G(5’)ppp(5’)A, m7G(5’)ppp(5’)G, m7G(5')ppp(5')(2'OMeA)pG, m7G(5')ppp(5')(2'OMeA)pU, and m7G(5')ppp(5')(2'OMeG)pG.In certain embodiments, the mRNA of the disclosure comprises a 5’ cap of:oii. Untranslated Region (UTR)In some embodiments, the mRNA of the disclosure includes a 5’ and / or 3’ untranslated region (UTR). In mRNA, the 5’ UTR starts at the transcription start site and continues to the start codon but does not include the start codon. The 3’ UTR starts immediately following the stop codon and continues until the transcriptional termination signal.In some embodiments, the mRNA disclosed herein may comprise a 5’ UTR that includes one or more elements that affect an mRNA’s stability or translation. In some embodiments, a 5’ UTR may be about 10 to 5,000 nucleotides in length. In some embodiments, a 5’ UTR may be about 50 to 500 nucleotides in length. In some embodiments, the 5’ UTR is at least about 10 nucleotides in length, about 20 nucleotides in length, about 30 nucleotides in length, about 40 nucleotides in length, about 50 nucleotides in length, about 100 nucleotides in length, about 150 nucleotides in length, about 200 nucleotides in length, about 250 nucleotides in length, about 300 nucleotides in length, about 350 nucleotides in length, about 400 nucleotides in length, about 450 nucleotides in length, about 500 nucleotides in length, about 550 nucleotides in length, about 600 nucleotides in length, about 650 nucleotides in length, about 700 nucleotides in length, about 750 nucleotides in length, about 800 nucleotides in length, about 850 nucleotides in length, about 900 nucleotides in length, about 950 nucleotides in length, about 1,000 nucleotides in length, about 1,500 nucleotides in length, about 2,000 nucleotides in length, about 2.500 nucleotides in length, about 3,000 nucleotides in length, about 3,500 nucleotides in length, about 4,000 nucleotides in length, about 4,500 nucleotides in length or about 5,000 nucleotides in length.12481859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, the mRNA disclosed herein may comprise a 3’ UTR comprising one or more of a polyadenylation signal, a binding site for proteins that affect an mRNA’s stability of location in a cell, or one or more binding sites for miRNAs. In some embodiments, a 3’ UTR may be 50 to 5,000 nucleotides in length or longer. In some embodiments, a 3’ UTR may be 50 to 1,000 nucleotides in length or longer. In some embodiments, the 3' UTR is at least about 50 nucleotides in length, about 100 nucleotides in length, about 150 nucleotides in length, about 200 nucleotides in length, about 250 nucleotides in length, about 300 nucleotides in length, about 350 nucleotides in length, about 400 nucleotides in length, about 450 nucleotides in length, about 500 nucleotides in length, about 550 nucleotides in length, about 600 nucleotides in length, about 650 nucleotides in length, about 700 nucleotides in length, about 750 nucleotides in length, about 800 nucleotides in length, about 850 nucleotides in length, about 900 nucleotides in length, about 950 nucleotides in length, about 1,000 nucleotides in length, about 1,500 nucleotides in length, about 2,000 nucleotides in length, about 2,500 nucleotides in length, about 3,000 nucleotides in length, about 3,500 nucleotides in length, about 4,000 nucleotides in length, about 4,500 nucleotides in length, or about 5,000 nucleotides in length.In some embodiments, the mRNA disclosed herein may comprise a 5’ or 3’ UTR that is derived from a gene distinct from the one encoded by the mRNA transcript (i.e., the UTR is a heterologous UTR).In certain embodiments, the 5’ and / or 3’ UTR sequences can be derived from mRNA which are stable (e g., globin, actin, GAPDH, tubulin, histone, or citric acid cycle enzymes) to increase the stability of the mRNA. For example, a 5’ UTR sequence may include a partial sequence of a CMV immediate-early 1 (IE1) gene, or a fragment thereof, to improve the nuclease resistance and / or improve the half-life of the mRNA. Also contemplated is the inclusion of a sequence encoding human growth hormone (hGH), or a fragment thereof, to the 3’ end or untranslated region of the mRNA. Generally, these modifications improve the stability and / or pharmacokinetic properties (e.g., half-life) of the mRNA relative to their unmodified counterparts, and include, for example, modifications made to improve such mRNA resistance to in vivo nuclease digestion.Exemplary 5’ UTRs include a sequence derived from a CMV immediate-early 1 (IE1 ) gene (U. S. Publication Nos. 2014 / 0206753 and 2015 / 0157565, each of which is incorporated herein by reference), or the sequence GGGAUCCUACC (SEQ ID NO:1) (U. S. Publication No. 2016 / 0151409, incorporated herein by reference).12581859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn various embodiments, the 5' UTR may be derived from the 5’ UTR of a TOP gene. TOP genes are typically characterized by the presence of a 5 ’-terminal oligopyrimidine (TOP) tract. Furthermore, most TOP genes are characterized by growth-associated translational regulation. However, TOP genes with a tissue specific translational regulation are also known. In certain embodiments, the 5’ UTR derived from the 5‘ UTR of a TOP gene lacks the 5’ TOP motif (the oligopyrimidine tract) (e.g., U. S. Publication Nos. 2017 / 0029847, 2016 / 0304883, 2016 / 0235864, and 2016 / 0166710, each of which is incorporated herein by reference).In certain embodiments, the 5’ UTR is derived from a ribosomal protein Large 32 (L32) gene (U. S. Publication No. 2017 / 0029847, supra).In certain embodiments, the 5’ UTR is derived from the 5’ UTR of an hydroxysteroid (17-b) dehydrogenase 4 gene (HSD17B4) (U. S. Publication No. 2016 / 0166710, supra).In certain embodiments, the 5’ UTR is derived from the 5’ UTR of an ATP5A1 gene (U. S. Publication No. 2016 / 0166710, supra).In some embodiments, an internal ribosome entry site (IRES) is used instead of a 5’ UTR.In some embodiments, the 5 ’UTR comprises a nucleic acid sequence reproduced below:GGACAGAUCGCCUGGAGACGCCAUCCACGCUGUUUUGACCUCCAUAGAAGACA CCGGGACCGAUCCAGCCUCCGCGGCCGGGAACGGUGCAUUGGAACGCGGAUUC CCCGUGCCAAGAGUGACUCACCGUCCUUGACACG.(SEQ ID NO:2) In some embodiments, the 3 ’UTR comprises a nucleic acid sequence reproduced below:CGGGUGGCAUCCCUGUGACCCCUCCCCAGUGCCUCUCCUGGCCCUGGAA GUUGCCACUCCAGUGCCCACCAGCCUUGUCCUAAUAAAAUUAAGUUGCAUC.(S EQ ID NO:3)The 5’ UTR and 3’UTR are described in further detail in W02012 / 075040, incorporated herein by reference.iii. Polyadenylated TailAs used herein, the terms “poly(A) sequence,” “poly(A) tail,” and “poly(A) region” refer to a sequence of adenosine nucleotides at the 3’ end of the mRNA molecule. The poly(A) tail may confer stability to the mRNA and protect it from exonuclease degradation. The poly(A) tail may enhance translation. In some embodiments, the poly(A) tail is12681859815v2773158: SA9-886PC / / PAT25019-WO-PCTessentially homopolymeric. For example, a poly (A) tail of 100 adenosine nucleotides may have essentially a length of 100 nucleotides. In certain embodiments, the poly (A) tail may be interrupted by at least one nucleotide different from an adenosine nucleotide (e.g., a nucleotide that is not an adenosine nucleotide). For example, a poly(A) tail of 100 adenosine nucleotides may have a length of more than 100 nucleotides (comprising 100 adenosine nucleotides and at least one nucleotide, or a stretch of nucleotides, that are different from an adenosine nucleotide). In certain embodiments, the poly(A) tail comprises the sequence AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGCAUAUGACUAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAA.(SEQ ID NO: 4)The “poly(A) tail,” as used herein, typically relates to RNA. However, in the context of the disclosure, the term likewise relates to corresponding sequences in a DNA molecule (e.g., a“poly(T) sequence”).The poly (A) tail may comprise about 10 to about 500 adenosine nucleotides, about 10 to about 200 adenosine nucleotides, about 40 to about 200 adenosine nucleotides, or about 40 to about 150 adenosine nucleotides. The length of the poly(A) (SEQ ID NO: 5) tail may be at least about 10, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, or 500 adenosine nucleotides.In some embodiments where the nucleic acid is an RNA, the poly(A) tail of the nucleic acid is obtained from a DNA template during RNA in vitro transcription. In certain embodiments, the poly(A) tail is obtained in vitro by common methods of chemical synthesis without being transcribed from a DNA template. In various embodiments, poly(A) tails are generated by enzymatic polyadenylation of the RNA (after RNA in vitro transcription) using commercially available polyadenylation kits and corresponding protocols, or alternatively, by using immobilized poly(A)polymerases. e.g., using methods and means as described in WO2016 / 174271.The nucleic acid may comprise a poly(A) tail obtained by enzymatic polyadenylation, wherein the majority of nucleic acid molecules comprise about 100 (+ / -20) to about 500 (+ / -50) or about 250 (+ / -20) adenosine nucleotides.In some embodiments, the nucleic acid may comprise a poly(A) tail derived from a template DNA and may additionally’ comprise at least one additional poly(A) tail generated by enzy matic polyadenylation, e.g., as described in W02016 / 091391.In certain embodiments, the nucleic acid comprises at least one polyadenylation signal.In various embodiments, the nucleic acid may comprise at least one poly(C) sequence.12781859815v2773158: SA9-886PC / / PAT25019-WO-PCTThe term “poly(C) sequence (SEQ ID NO: 6),” as used herein, is intended to be a sequence of cytosine nucleotides of up to about 200 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 10 to about 200 cytosine nucleotides, about 10 to about 100 cytosine nucleotides, about 20 to about 70 cytosine nucleotides, about 20 to about 60 cytosine nucleotides, or about 10 to about 40 cytosine nucleotides. In some embodiments, the poly(C) sequence comprises about 30 cytosine nucleotides.iv. Chemical ModificationThe mRNA disclosed herein may be modified or unmodified. In some embodiments, the mRNA may comprise at least one chemical modification. In some embodiments, the mRNA disclosed herein may contain one or more modifications that typically enhance RNA stability. Exemplary modifications can include backbone modifications, sugar modifications, or base modifications. In some embodiments, the disclosed mRNA may be synthesized from naturally occurring nucleotides and / or nucleotide analogues (modified nucleotides) including, but not limited to, purines (adenine (A) and guanine (G)) or pyrimidines (thymine (T), cytosine (C), and uracil (U)). In certain embodiments, the disclosed mRNA may be synthesized from modified nucleotide analogues or derivatives of purines and pyrimidines, such as, e.g., 1-methyl-adenine, 2-methyl -adenine, 2-methylthio-N-6-isopentenyl-adenine, N6-methyl -adenine, N6-isopentenyl-adenine, 2-thio-cytosine. 3-methyl-cytosine, 4-acetyl-cytosine. 5-methyl-cytosine. 2,6-diaminopurine. 1-methyl-guanine. 2-methyl-guanine, 2.2-dimethyl -guanine, 7-methyl-guanine, inosine, 1 -methyl -inosine, pseudouracil (5-uracil), dihydro-uracil, 2-thio-uracil, 4-thio-uracil, 5-carboxymethylaminomethyl-2-thio-uracil, 5-(carboxyhydroxymethyl)-uracil, 5-fluoro-uracil, 5-bromo-uracil, 5-carboxymethylaminomethyl-uracil, 5-methyl-2 -thio-uracil, 5-methyl-uracil, N-uracil-5-oxy acetic acid methyl ester, 5-methylaminomethyl-uracil, 5-methoxyaminomethyl-2-thio-uracil, 5’ -methoxy carbonylmethyl-uracil, 5-methoxy -uracil, uracil-5-oxy acetic acid methyl ester, uracil-5-oxyacetic acid (v), 1-methyl-pseudouracil, queosine, P-D-mannosyl-queosine, phosphorami dates, phosphorothioates. peptide nucleotides, methylphosphonates. 7-deazaguanosine, 5-methylcytosine, and inosine.In some embodiments, the disclosed mRNA may comprise at least one chemical modification including, but not limited to, pseudouridine, N1 -methylpseudouridine, 2-thiouridine, 4’-thiouridine, 5-methylcytosine, 2-thio-l-methyl-l-deaza-pseudouridine, 2-thio-1-methyl-pseudouridine, 2-thio-5 -aza-uridine, 2-thio-dihydropseudouridine, 2-thio-dihydrouridine, 2-thio-pseudouridine, 4-methoxy-2-thio-pseudouridine, 4-methoxy- 12881859815v2773158: SA9-886PC / / PAT25019-WO-PCTpseudouridine, 4-thio-l-methyl-pseudouridine, 4-thio-pseudouridine, 5 -aza-uridine, dihydropseudouridine, 5 -methyluridine, 5 -methyluridine, 5-methoxyuridine, and 2'-O-methyl uridine.In some embodiments, the chemical modification is selected from the group consisting of pseudouridine, N1 -methylpseudouridine, 5-methylcytosine, 5-methoxyuridine, and a combination thereof.In some embodiments, the chemical modification comprises N1 -methylpseudouridine. In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in the mRNA are chemically modified.In some embodiments, at least 20%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 85%, at least 90%, at least 95%, or 100% of the uracil nucleotides in the ORF are chemically modified.The preparation of such analogues is described, e.g., in U. S. Pat. No. 4,373,071, U. S. Pat. No. 4,401.796, U. S. Pat. No. 4,415.732, U. S. Pat. No. 4,458,066. U. S. Pat. No.4,500,707, U. S. Pat. No. 4,668,777, U. S. Pat. No. 4,973,679, U. S. Pat. No. 5,047,524, U. S. Pat. No. 5,132,418, U. S. Pat. No. 5,153,319, U. S. Pat. No. 5,262,530, and U. S. Pat. No. 5,700,642.v. mRNA SynthesisThe mRNAs disclosed herein may be synthesized according to any of a variety of methods. For example, mRNAs according to the present disclosure may be synthesized via in vitro transcription (IVT). Some methods for in vitro transcription are described, e g., in Geall et al. (2013) Semin. Immunol. 25(2): 152-159; Brunelle et al. (2013) Methods Enzymol. 530:101-14. Briefly, IVT is typically performed with a linear or circular DNA template containing a promoter, a pool of ribonucleotide triphosphates, a buffer system that may include DTT and magnesium ions, an appropriate RNA polymerase (e.g., T3, T7, or SP6 RNA polymerase), DNase I, pyrophosphatase, and / or RNase inhibitor. The exact conditions may vary according to the specific application. The presence of these reagents is generally undesirable in a final mRNA product and these reagents can be considered impurities or contaminants which can be purified or removed to provide a clean and / or homogeneous mRNA that is suitable for therapeutic use. While mRNA provided from in vitro transcription reactions may be desirable in some embodiments, other sources of mRNA can be used12981859815v2773158: SA9-886PC / / PAT25019-WO-PCTaccording to the instant disclosure including wild-type mRNA produced from bacteria, fungi, plants, and / or animals.Where desired, the LNP or the LNP formulation may be multi-valent. In some embodiments, the LNP may carry mRNAs that encode more than one polypeptide (e.g., antigen), such as two, three, four, five, six, seven, eight, nine, ten, or more poly peptides. For example, the LNP may carry multiple mRNA molecules, each encoding a different polypeptide; or carry a polycistronic mRNA that can be translated into more than one polypeptide (e.g., each polypeptide-coding sequence is separated by a nucleotide linker encoding a self-cleaving peptide such as a 2A peptide). An LNP carrying different mRNA molecules typically comprises (encapsulate) multiple copies of each mRNA molecule. For example, an LNP carrying or encapsulating two different mRNA molecules typically carries multiple copies of each of the two different mRNA molecules.In some embodiments, a single LNP formulation may comprise multiple kinds (e.g., two, three, four, five, six, seven, eight, nine, ten, or more) of LNPs, each kind carrying a different mRNA.F. Buffer and Other ComponentsTo stabilize the nucleic acid and / or LNPs (e.g., to prolong the shelf-life of the vaccine product), to facilitate administration of the LNP pharmaceutical composition, and / or to enhance in vivo expression of the nucleic acid, the nucleic acid and / or LNP can be formulated in combination with one or more carriers, targeting ligands, stabilizing reagents (e.g., preservatives and antioxidants), and / or other pharmaceutically acceptable excipients.Examples of such excipients are parabens, thimerosal, thiomersal, chlorobutanol, bezalkonium chloride, and chelators (e.g., EDTA).The LNP compositions of the present disclosure can be provided as a frozen liquid form or a lyophilized form. A variety of cry oprotectants may be used, including, without limitations, sucrose, trehalose, glucose, mannitol, mannose, dextrose, and the like. The cryoprotectant may constitute 5-30% (w / v) of the LNP composition. In some embodiments, the LNP composition comprises trehalose, e.g., at 5-30% (e.g., 10%) (w / v). Once formulated with the cryoprotectant, the LNP compositions may be frozen (or lyophilized and cryopreserved) at -20°C to -80°C.The LNP compositions may be provided to a patient in an aqueous buffered solution -thawed if previously frozen, or if previously lyophilized, reconstituted in an aqueous buffered solution at bedside. The buffered solution may be isotonic and suitable for e.g.,13081859815v2773158: SA9-886PC / / PAT25019-WO-PCTintramuscular or intradermal injection. In some embodiments, the buffered solution is a phosphate-buffered saline (PBS). In some embodiments, the buffered solution is a Tris buffered solution.G. Processes for Making the Present LNP FormulationsThe present LNPs can be prepared by various techniques presently known in the art. For example, multilamellar vesicles (MLV) may be prepared according to conventional techniques, such as by depositing a selected lipid on the inside wall of a suitable container or vessel by dissolving the lipid in an appropriate solvent, and then evaporating the solvent to leave a thin film on the inside of the vessel or by spray drying. An aqueous phase may then be added to the vessel with a vortexing motion that results in the formation of MLVs.Unilamellar vesicles (ULV) can then be formed by homogenization, sonication or extrusion of the multilamellar vesicles. In addition, unilamellar vesicles can be formed by detergent removal techniques.Various methods are described in US 2011 / 0244026, US 2016 / 0038432, US 2018 / 0153822, US 2018 / 0125989, and PCT / US2020 / 043223 (filed July 23, 2020) and can be used to practice the present disclosure. One exemplary process entails encapsulating mRNA by mixing it with a mixture of lipids, without first pre-forming the lipids into lipid nanoparticles, as described in US 2016 / 0038432. Another exemplary process entails encapsulating mRNA by mixing pre-formed LNPs with mRNA, as described in US 2018 / 0153822.In some embodiments, the process of preparing mRNA-loaded LNPs includes a step of heating one or more of the solutions to a temperature greater than ambient temperature, the one or more solutions being the solution comprising the pre-formed lipid nanoparticles, the solution comprising the mRNA and the mixed solution comprising the LNP-encapsulated mRNA. In some embodiments, the process includes the step of heating one or both of the mRNA solution and the pre-formed LNP solution, prior to the mixing step. In some embodiments, the process includes heating one or more of the solutions comprising the preformed LNPs, the solution comprising the mRNA and the solution comprising the LNP-encapsulated mRNA, during the mixing step. In some embodiments, the process includes the step of heating the LNP- encapsulated mRNA, after the mixing step. In some embodiments, the temperature to which one or more of the solutions is heated is or is greater than about 30°C, 37°C, 40°C, 45°C, 50°C, 55°C, 60°C. 65°C, or 70°C. In some embodiments, the temperature to which one or more of the solutions is heated ranges from about 25-70°C,13181859815v2773158: SA9-886PC / / PAT25019-WO-PCTabout 30-70°C, about 35-70°C, about 40-70°C, about 45-70°C, about 50-70°C, or about 60-70°C. In some embodiments, the temperature is about 65°C.Various methods may be used to prepare an mRNA solution suitable for the present disclosure. In some embodiments, mRNA may be directly dissolved in a buffer solution described herein. In some embodiments, an mRNA solution may be generated by mixing an mRNA stock solution with a buffer solution prior to mixing with a lipid solution for encapsulation. In some embodiments, an mRNA solution may be generated by mixing an mRNA stock solution with a buffer solution immediately before mixing with a lipid solution for encapsulation. In some embodiments, a suitable mRNA stock solution may contain mRNA in water or a buffer at a concentration at or greater than about 0.2 mg / ml, 0.4 mg / ml, 0.5 mg / ml. 0.6 mg / ml, 0.8 mg / ml, 1.0 mg / ml, 1.2 mg / ml, 1.4 mg / ml, 1.5 mg / ml, or 1.6 mg / ml, 2.0 mg / ml, 2.5 mg / ml, 3.0 mg / ml, 3.5 mg / ml, 4.0 mg / ml, 4.5 mg / ml, or 5.0 mg / ml.In some embodiments, an mRNA stock solution is mixed with a buffer solution using a pump. Exemplary pumps include but are not limited to gear pumps, peristaltic pumps and centrifugal pumps. Typically, the buffer solution is mixed at a rate greater than that of the mRNA stock solution. For example, the buffer solution may be mixed at a rate at least lx, 2x, 3x, 4x, 5x, 6x, 7x, 8x, 9x, lOx, 15x, or 20x greater than the rate of the mRNA stock solution. In some embodiments, a buffer solution is mixed at a flow rate ranging between about 100-6000 ml / minute (e.g., about 100-300 ml / minute, 300-600 ml / minute, 600-1200 ml / minute. 1200-2400 ml / minute, 2400-3600 ml / minute, 3600-4800 ml / minute, 4800-6000 ml / minute, or 60-420 ml / minute). In some embodiments, a buffer solution is mixed at a flow rate of, or greater than, about 60 ml / minute, 100 ml / minute, 140 ml / minute, 180 ml / minute, 220 ml / minute. 260 ml / minute, 300 ml / minute, 340 ml / minute, 380 ml / minute, 420 ml / minute, 480 ml / minute. 540 ml / minute, 600 ml / minute, 1200 ml / minute, 2400 ml / minute, 3600 ml / minute, 4800 ml / minute, or 6000 ml / minute.In some embodiments, an mRNA stock solution is mixed at a flow rate ranging between about 10-600 ml / minute (e.g., about 5-50 ml / minute, about 10-30 ml / minute, about 30-60 ml / minute, about 60-120 ml / minute, about 120-240 ml / minute. about 240-360 ml / minute, about 360-480 ml / minute, or about 480-600 ml / minute). In some embodiments, an mRNA stock solution is mixed at a flow rate of or greater than about 5 ml / minute, 10 ml / minute, 15 ml / minute, 20 ml / minute, 25 ml / minute, 30 ml / minute, 35 ml / minute, 40 ml / minute, 45 ml / minute, 50 ml / minute, 60 ml / minute, 80 ml / minute, 100 ml / minute, 200 ml / minute, 300 ml / minute, 400 ml / minute, 500 ml / minute, or 600 ml / minute.13281859815v2773158: SA9-886PC / / PAT25019-WO-PCTThe process of incorporation of a desired mRNA into a lipid nanoparticle is referred to as “loading.’" Exemplary methods are described in Lasic et al.. FEBS Lett. (1992) 312:255-8. The LNP-incorporated nucleic acids may be completely or partially located in the interior space of the lipid nanoparticle, within the bilayer membrane of the lipid nanoparticle, or associated with the exterior surface of the lipid nanoparticle membrane. The incorporation of an mRNA into lipid nanoparticles is also referred to herein as “encapsulation” wherein the nucleic acid is entirely or substantially contained within the interior space of the lipid nanoparticle.Suitable LNPs may be made in various sizes. In some embodiments, decreased size of lipid nanoparticles is associated with more efficient delivery of an mRNA. Selection of an appropriate LNP size may take into consideration the site of the target cell or tissue and to some extent the application for which the lipid nanoparticle is being made.A variety7of methods known in the art are available for sizing of a population of lipid nanoparticles. Preferred methods herein utilize Zetasizer Nano ZS (Malvern Panalytical) to measure LNP particle size. In one protocol. 10 pl of an LNP sample are mixed with 990 pl of 10% trehalose. This solution is loaded into a cuvette and then put into the Zetasizer machine. The z-average diameter (nm), or cumulants mean, is regarded as the average size for the LNPs in the sample. The Zetasizer machine can also be used to measure the poly dispersity index (PDI) by using dynamic light scattering (DLS) and cumulant analysis of the autocorrelation function. Average LNP diameter may be reduced by sonication of formed LNP. Intermittent sonication cycles may be alternated with quasi-elastic light scattering (QELS) assessment to guide efficient lipid nanoparticle synthesis.In some embodiments, the majority of purified LNPs, i.e., greater than about 50%, 55%. 60%. 65%. 70%. 75%. 80%. 85%. 90%. 95%. 96%. 97%. 98%. or 99% of the LNPs. have a size of about 70-150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm). In some embodiments, substantially all (e.g., greater than 80 or 90%) of the purified lipid nanoparticles have a size of about 70-150 nm (e.g., about 145 nm, about 140 nm, about 135 nm, about 130 nm, about 125 nm, about 120 nm, about 115 nm, about 110 nm, about 105 nm, about 100 nm, about 95 nm, about 90 nm, about 85 nm, or about 80 nm).In some embodiments, the LNPs in the present composition have an average size of less than 150 nm, less than 120 nm, less than 100 nm, less than 90 nm, less than 80 nm, less than 70 nm, less than 60 nm, less than 50 nm, less than 30 nm, or less than 20 nm.13381859815v2773158: SA9-886PC / / PAT25019-WO-PCTIn some embodiments, greater than about 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%. 99% of the LNPs in the present composition have a size ranging from about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, about 60-70 nm), about 40-90 nm (e.g., about 45-85 nm, about 50-80 nm, about 55-75 nm, about 60-70 nm), or about 50-70 nm (e.g., 55-65 nm) are particular suitable for pulmonary delivery' via nebulization.In some embodiments, the dispersity, or measure of heterogeneity in size of molecules (PD1), of LNPs in a pharmaceutical composition provided by the present disclosure is less than about 0.5. In some embodiments, an LNP has a PDI of less than about 0.5, less than about 0.4, less than about 0.3, less than about 0.28, less than about 0.25, less than about 0.23, less than about 0.20, less than about 0.18, less than about 0.16, less than about 0.14, less than about 0.12. less than about 0.10. or less than about 0.08. The PDI may be measured by a Zetasizer machine as described above.In some embodiments, greater than about 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% of the purified LNPs in a pharmaceutical composition provided herein encapsulate an mRNA within each individual particle. In some embodiments, substantially all (e.g., greater than 80% or 90%) of the purified lipid nanoparticles in a pharmaceutical composition encapsulate an mRNA within each individual particle. In some embodiments, a lipid nanoparticle has an encapsulation efficiency of between 50% and 99%; or greater than about 60, 65, 70, 75, 80, 85, 90, 92, 95, 98, or 99%. Typically, lipid nanoparticles for use herein have an encapsulation efficiency of at least 90% (e.g., at least 91, 92, 93, 94, or 95%).In some embodiments, an LNP has aN / P ratio of between 1 and 10. In some embodiments, a lipid nanoparticle has aN / P ratio above 1, about 1, about 2, about 3, about 4, about 5, about 6, about 7, or about 8. In further embodiments, a typical LNP herein has an N / P ratio of 4.In some embodiments, a pharmaceutical composition according to the present disclosure contains at least about 0.5 pg, 1 pg, 5 pg, 10 pg, 100 pg, 500 pg, or 1000 pg of encapsulated mRNA. In some embodiments, a pharmaceutical composition contains about 0.1 pg to 1000 pg, at least about 0.5 pg, at least about 0.8 pg, at least about 1 pg, at least about 5 pg, at least about 8 pg, at least about 10 pg, at least about 50 pg, at least about 100 pg, at least about 500 pg, or at least about 1000 pg of encapsulated mRNA.Packaging and Use of the mRNA-LNPThe mRNA-LNP can be packaged for parenteral (e.g., intramuscular, intradermal, subcutaneous, or intravenous) administration, nasopharyngeal (e.g., intranasal)13481859815v2773158: SA9-886PC / / PAT25019-WO-PCTadministration, or mucosal (e.g., intranasal, oral, rectal) administration. The compositions may be in the form of an extemporaneous formulation, where the LNP composition is lyophilized and reconstituted with a physiological buffer (e.g., PBS) just before use. The compositions also may be shipped and provided in the form of an aqueous solution or a frozen aqueous solution and can be directly administered to subjects without reconstitution (after thawing, if previously frozen).Accordingly, the present disclosure provides an article of manufacture, such as a kit, that provides the mRNA-LNP in a single container, or provides the mRNA-LNP in one container and a physiological buffer for reconstitution in another container. The container(s) may contain a single-use dosage or multi-use dosage. The containers may be pre-treated glass vials or ampules. The article of manufacture may include instructions for use as well.In some embodiments, the present disclosure provides methods of preventing or treating a disease or disorder by administering the composition of the disclosure to a subject in need thereof. In some embodiments, the subject is suffering from or susceptible to an infection.In some embodiments, the present disclosure provides methods of eliciting an immune response in a subject in need thereof, comprising administering to the subject a prophylactically effective amount of a composition described herein.In some embodiments, the present disclosure provides methods of preventing an infection or reducing one or more symptoms of an infection in a subject in need thereof, comprising administering to the subject a prophylactically effective amount of the composition.In some embodiments of the methods described herein, the composition is administered to the subject mucosally. intramuscularly, intranasally, intravenously, subcutaneously, or intradermally. In some embodiments of the methods described herein, the composition is administered to the subject intravenously, intrathecally, or intramuscularly, or by pulmonary delivery. In some embodiments, the composition is administered intramuscularly. In some embodiments, the composition is administered intravenously.In some embodiments of the methods described herein, the subject is administered one or more doses of the composition, wherein each dose comprises 1-250 pg of mRNA. In some embodiments, each dose comprises 2.5-135 pg of mRNA. In some embodiments, each dose comprises 2.5., 5, 15, 45, or 135, pg of mRNA.In some embodiments of the methods described herein, the subject is administered two doses of the composition. In some embodiments, the two doses of the composition are 13581859815v2773158: SA9-886PC / / PAT25019-WO-PCTadministered with an interval of 1-6 weeks, e.g., 2-6 weeks. In some embodiments, the two doses of the composition are administered with an interval of 1. 2, 3, 4. 5, or 6 weeks. In some embodiments, the two doses of the composition are administered with an interval of 4 weeks.In some embodiments of the methods described herein, the subject is administered more than two doses of the composition. For example, the subject is administered three, four, five, or six doses of the composition. In some embodiments, the three, four, five, or six doses of the composition are administered with an interval of 1-6 weeks, e g., 2-6 weeks. In some embodiments, the three, four, five, or six doses of the composition are administered with an interval of 1, 2, 3, 4, 5, or 6 weeks. In some embodiments, the three, four, five, or six doses of the composition are administered with an interval of 4 weeks.The present disclosure also provides the use of a composition described herein for the manufacture of a medicament for use in any of the methods described herein.The present disclosure further provides a kit comprising a composition of the present disclosure. In some embodiments, the kit comprises a containing comprising a single-use or multi-use dosage of the composition. In some embodiments, the containing is a vial. In some embodiments, the container is a pre-filled nasal spray device.IV. Particular EmbodimentsEXAMPLESAbbreviations:Herein and throughout the disclosure, the following abbreviations may be usedACN acetonitrileAnhy. anhydrousAq. aqueousDCM dichloromethaneDMAP 4-dimethylamiinopyridineEA, EtOAc ethyl acetateEDC l-ethyl-3-(3-dimethylaminopropyl)carbodiimideELSD evaporative light scattering detectorEt2O diethyl etherh hour(s)13681859815v2773158: SA9-886PC / / PAT25019-WO-PCTIPA isopropyl alcoholLCMS liquid chromatography-mass spectrometryMeOH methanolmin minuteNMR nuclear magnetic resonance spectroscopyRBF round bottom flaskRM reaction mixtureRT room temperatureSM starting materialTFA trifluoroacetic acidTFAA trifluoroacetic anhydrideTHF tetrahydrofuranTLC thin-layer chromatographyExample 1: Synthesis of morpholine-2.,6-diylbis(methylene) bis(4-(bis(2- hvdroxydodecyl)amino)butanoate) (Compound 1, meso form)Synthetic Protocol13781859815v2773158: SA9-886PC / / PAT25019-WO-PCT[INT 8] is produced as a mix of diastereomers that can be separated via column chromatograph. The meso form of the compound (i.e., the (R, S) form) can be isolated and is referred to as [INT 8a], Subsequent intermediates having (R, S) (or (S. R)) stereochemistry on the morpholine ring are also identified with a lower case “a.” Similarly, a mixture of the (R, R) and (S,S) enantiomers of [INT 8] can be isolated and is referred to as [INT 8b].Subsequent intermediates having (R, R) and / or (S, S) stereochemistry on the morpholine ring are also identified with a lower case b4-(bis(2-hydroxydodecyl)amino)butanoic acid [INT 3]OHTo a stirred solution of 4-aminobutanoic acid (10 g, 97 mmol) [INT 1] in methanol (50 mL, 1.23 mol) was added 2-decyloxirane (44.7 g, 2.5 eq., 242 mmol) [INT 2] followed by addition of ethylbis(propan-2-yl)amine (42.3 mL, 2.5 eq., 242 mmol). Reaction mass was heated to 90°C for 16h. Progress of reaction mixture was monitored by TLC / ELSD. SM was consumed. Reaction mass was cooled to RT. Added water (0.1 L, 5.55 mol) and tetrahydrofuran (50 mL, 614 mmol) then lithium(l+) hydroxide (4.65 g, 2 eq., 194 mmol). Reaction mixture was stirred for 4 h. Progress of reaction mixture was monitored by TLC / ELSD. Reaction mass was acidified with IN HC1 up to pH-3 and extracted with ethyl acetate (3x 100 mL), dried over anhy. Na2SO4and removed solvent under reduced pressure. Crude was purified by column chromatography using 0-65% ethyl acetate and then 0-105 MeOH in DCM to obtained pure 4-(bis(2-hydroxydodecyl)amino)butanoic acid (24 g, yield 53 %) [INT 3] as white solid.Results:LCMS analysis'. Purity 95.39 %, Calculated C28H57NO4 = 471.43, Observed = 472.40 (m / z, M+H+).4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoic acid [INT 4]13881859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo a stirred solution of 4-(bis(2-hydroxydodecyl)amino)butanoic acid [INT 3] (30 g, 63.6 mmol) in dichloromethane (750 mL. 11.7 mol) was added IH-imidazole (43.3 g. 10 eq., 636 mmol), followed by addition of tert-butyl(chloro)dimethylsilane (57.5 g, 6.0 eq., 382 mmol). Reaction mass was stirred at RT for 16 h. Progress of reaction was monitored by ELSD / TLC. TLC was showing SM nil. Reaction mass cooled to 0°C. Filtered through sintered funnel. Organic layer was washed with water (500 ml), dried over sodium sulphate, and removed solvent under reduced pressure. Obtained crude was purified over silica gel column using 2-5% EA in N-hexane. Obtained pure 4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoic acid (25 g, yield 56 %) [INT 4] as a colourless liquid mass.Results:EELSD analysis'. Purity 99.73 %, Calculated C4oH8sN04Si2 = 699.60, Observed = 700.45 (m / z, M+H+).3,3'-(benzylazanediyl)bis(l-(benzyloxy)propan-2-ol) [INT 7]il [0HIk OBnTo a stirred solution of 1 -phenylmethanamine [INT 6] (5 g, 46.7 mmol) in propan-2-ol (25 mL) was added 2-[(benzyloxy)methyl]oxirane [INT 5] (15.3 g, 2 eq., 93.3 mmol). Reaction was heated to 60 °C for 16 h. Progress of the reaction was monitored by LCMS / ELSD / TLC. Reaction was cooled to RT then evaporated under reduced pressure to get the crude compound. The crude was purified over silica 0-60% ethyl acetate in heptane to give product 3,3'-(benzylazanediyl)bis(l-(benzyloxy)propan-2-ol) (13 g, yield 68%) [INT 7] as a colourless liquid.Results:EELSD analysis'. Purity 100 %, Calculated C27H33NO4 = 435.24, Observed = 436.25 (m / z, M+H+).4-hen~yl-2 / >-his((ben~,yloxy)methyl)m<>rpholine [INT 8a], OBn13981859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo a stirred solution of sodium hydnde (2.22 g, 2.1 eq., 55.4 mmol) in tetrahydrofuran (138 mL, 1.7 mol) at 0 °C temperature were added 3.3'-(benzylazanediyl)bis(l-(benzyloxy)propan-2-ol) (11.5 g, 26.4 mmol) [INT 7] stirred for 30 minutes at ambient temperature, then added 4-methylbenzene-l -sulfonyl chloride (5.03 g, 26.4 mmol) and stirred for 16 h. Reaction progress was monitored by TLC and ELSD. After completion, reaction was quenched with ice cold water (50 mL) and extracted with ethyl acetate (2x 50 mL), organic layer was separated and dried over sodium sulphate and evaporated under reduced pressure. The crude compound was purified by silica gel column chromatography 0-40% ethyl acetate / heptane, and afforded two peaks. The second peak, which corresponds to the meso compound, was collected as a colourless liquid (3.5 g, yield 36%).Results:EELSD analysis'. Purity 99.51 %, Calculated C27H31NO3 = 417.23, Observed = 418.30 (m / z, M+H+).2,6-bis((benzyloxy)methyl)morpholine [INT 9 a]^OBnI0HN, X -OBnTo a stirred solution of 4-benzyl-2,6-bis [(benzyloxy )methyl]morpholine [TNT 8a] (2 g, 4.79 mmol) in methanol (66.7 mL, 1.65 mol) was added palladium on carbon (10 % w / w, 50 % moisture) (0.7 g, 1.4 eq., 6.58 mmol) at ambient temperature under nitrogen. Reaction mixture was degassed and allowed to stir under H2 atmosphere (balloon) for 16 h. Progress of reaction was monitored by ELSD / TLC. Reaction mixture was filtered through celite bed and concentrated under reduced pressure to get the compound as a 2,6-bis((benzyloxy)methyl)morpholine [INT 9a] (1.5 g, yield 95%) as a colourless liquid.Results:EELSD analysis'. Purity 98.64 %, Calculated C20H25NO3 = 327.18, Observed = 328.25 (m / z, M+H+).tert-butyl 2, 6-bis(benzyloxy)methyl)morpholin e-4-carboxylate [INT 1 OaJJDBnI„NL0, OBnBoc14081859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo a stirred solution of 2,6-bis((benzyloxy)methyl)morpholine [INT 9a] (1.5 g, 4.58 mmol) in dichloromethane (13.8 mL, 216 mmol) was added triethylamine (1.93 mL. 3 eq., 13.7 mmol), followed by di-tert-butyl dicarbonate (1.16 mL, 1.1 eq., 5.04 mmol). Reaction was stirred at ambient temperature for 16 h. Progress of reaction was monitored by ELSD and TLC. Reaction mixture was diluted with water (50 mL) and extracted with (2x 25 mL) DCM. Organic layer was dried over sodium sulphate and concentrated under reduced pressure. The crude was purified over silica using 0-50% EtOAC / Heptane to give tert-butyl 2,6-bis((benzyloxy)methyl)morpholine-4-carboxylate [INT 10a] (1.2 g, yield 60.6 %) as a colourless liquid.Results:ELSD analysis: Purity 99.47%, Calculated C25H33NO5= 427.24, Observed = 450.20 (m / z, M+Na+).tert-butyl 2,6-bis(hydroxymethyl)morpholine-4-carboxylate [INT Ila] / OH\0„ -N. / / OHBocTo a stirred solution of tert-butyl 2,6-bis((benzyloxy)methyl)morpholine-4-carboxylate [INT 10a] (1 g, 2.34 mmol) in ethanol (18.8 mL, 321 mmol), tetrahydrofuran (18.8 mL, 230 mmol), was added palladium on carbon (10 % w / w, 50 % moisture) (0.5 g, 2 eq., 4.7 mmol) at ambient temperature under nitrogen. Reaction mixture was degassed and allowed to stir under EL atmosphere (balloon) 5 h. Progress of reaction was monitored by ELSD / TLC. Reaction mass was filtered through celite bed and concentrated under reduced pressure to get the compound as a tert-butyl 2,6-bis(hydroxymethyl)morpholine-4-carboxylate [INT Ila] (350 mg. yield 60%) as a colourless liquid.Results:ELSD analysis: Purity 98.80 %, Calculated C11H21NO5= 247.14, Observed = 192.30 (m / z, M+H+-56).(4-(tert-butoxycarbonyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 12a]14181859815v2773158: SA9-886PC / / PAT25019-WO-PCT OTBDMS OTBDMSBocTo a stirred solution of starting material 4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoic acid [INT 4] (8.5 g, 2 eq., 12.1 mmol) in dichloromethane (159 mL, 2.48 mol), EDC. HC1 (2.79 g, 2.4 eq., 14.6 mmol) and DMAP (3.59 g, 4.8 eq., 29.1 mmol) were added at room temperature then allowed to stirred for 15 min. After that tert-butyl 2,6-bis(hydroxymethyl)morpholine-4-carboxylate [INT Ila] (1.5 g, 6.07 mmol) was also added at RT under inert atmosphere and resultant reaction mass was allowed to stirred at RT for 16h. The progress of reaction was monitor by ELSD. SM was consumed completely. Reaction mass was evaporated under reduced pressure. The crude was purified by silica gel column chromatography using 3-5% EtOAc in Heptane to get (4-(tert-butoxycarbonyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 12a] (9 g, yield 91%) as colourless liquid.Results:ELSD analysis: Purity 99.67 %, Calculated C91H187N3O11Si4=1610.32, Observed = 1611.85 (m / z, M+H+).morpholine-2,6-diylbis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) (Compound 1, meso form)OH OHHTo a stirred solution of (4-(tert-butoxycarbonyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) (0.5 g, 310 pmol) [INT 12a] in dichloromethane (5 mL, 78.1 mmol), was added IN-hydrogen chloride in Et? O (1 mL) at 0°C. Reaction mixture was allowed to keep at room temperature for 16h. Reaction was monitored by checking TLC / ELSD. Reaction mixture was evaporated under reduced pressure, then basified with saturated aq. NaHCO3solution (40 mL) and extracted with DCM (2x 25 ML). Organic layer was separated and dried over sodium sulphate and concentrated under reduced pressure. The crude compound was purified over silica using 0-10%14281859815v2773158: SA9-886PC / / PAT25019-WO-PCTMeOH / DCM to get morpholine-2,6-diylbis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) [Compound 1, meso form] (80 mg, yield 24.4%) as a colourless liquid.Results:1H-NMR (400MHz, CDCl3)- δ4.17-4.03 (m, 4H), 3.87-3.73 (m, 2H), 3.69-3.57 (m, 4H), 2.93-2.90 (d, J= 12Hz, 2H), 2.65-2.52 (m, 6H), 2.53-2.35 (m, 13H), 1.85-1.77(m, 4H), 1.50-1.21 (m, 72H). 0.87 (t, J=6.4 Hz, 3H).ELSD analysis: Purity 99.90 %, Calculated C62H123N3O9= 1053.93, Observed = 1054.60 (m / z, M+H+)Example 2: Synthesis of morpholine-2.,6-diylbis(methylene) bis(4-(bis(2-hvdroxydodecyl)amino)butanoate) (Compound 1, (R,R) or (S, S) form)OH OHHSynthetic ProtocolThe (R, R) or (S, S) form of Compound 1 was prepared using the same synthetic protocol as for the meso form of Compound 1 in Example 1, with the exception that the (R, R) or (S, S) form of [INT 8] was used in subsequent steps.4-benzyl-2,6-bis((benzyloxy)methyl)morpholine [INT 8b]To a stirred solution of sodium hydride (918 mg, 4 eq., 23 mmol) in tetrahydrofuran (0.1 L, 1.23 mol) at 0 °C temperature, was added 3,3'-(benzylazanediyl)bis(l-(benzyloxy)propan-2-ol) [INT 7] (2.5 g, 5.74 mmol) and stirred for 30 minutes at ambient temperature. Then added 4-methylbenzene-l -sulfonyl chloride (1.09 g, 5.74 mmol) and stirred for 16 h. Progress of reaction was monitored by TLC and ELSD. After completion, reaction was quenched with ice cold water (100 mL) and extracted with ethyl acetate (2x 50 mL). Organic layer was separated and dried over sodium sulphate and evaporated under reduced pressure. The crude compound was purified by column chromatography 0-40% ethyl acetate / heptane, and14381859815v2773158: SA9-886PC / / PAT25019-WO-PCTafforded two peaks. The first peak, which corresponds to the (R, R) or (S, S) compound was collected as a colourless liquid (0.6 g, yield 24.8%).Results:ELSD analysis: Purity 99.89 %, Calculated: C27H31NO3= 417.23, Observed = 418.25 (m / z, M+H+).2,6-bis((benzyloxy)methyl)morpholine [INT 9b], OBnI 1HN^A^OBnTo a stirred solution of 4-benzyl-2,6-bis[(benzyloxy)methyl]morpholine [INT 8b](2 g, 4.79 mmol) in methanol (66.7 mL, 1.65 mol), was added palladium on carbon (10% w / w, 50 % moisture) (0.7 g, 1.4 eq., 6.58 mmol) at ambient temperature under H2 atmosphere stirred for 8 h. Progress of reaction was monitored by LCMS / ELSD / TLC. Reaction was filtered through celite pad and concentrated under reduced pressure to get the crude of 2,6-bis [(benzyloxy )methyl] morpholine [INT 9b] (0.9 g, yield 57%) as a colourless liquid.Results:ELSD analysis: Purity 99.71%, Calculated C20H25NO3= 327.18, Observed = 328.20 (m / z, M+H+).tert-butyl 2, 6-bis( (benzyloxy)methyl)morpholin e-4-carboxylate [INT 10b]JDBnI?A., OBnBocTo a stirred solution of 2,6-bis[(benzyloxy)methyl]morpholine [INT 9b] (0.9 g, 2.75 mmol) in dichloromethane (8.31 mL, 130 mmol), was added triethylamine (1.16 mL, 3 eq., 8.25 mmol), followed by di-tert-butyl dicarbonate (695 pL, 1.1 eq., 3.02 mmol). Reaction was stirred at ambient temperature for 16 h. Progress of reaction was monitored by ELSD and TLC. Reaction mixture was diluted with water (50 mL) and extracted with (2x 40 mL) DCM. Organic layer was dried over sodium sulphate and concentrated under reduced pressure. The crude was purified over silica using 0-50% EtOAC / Heptane to give product tert-butyl 2,6-bis[(benzyloxy)methyl]morpholine-4-carboxylate [INT 10b] (0.7 g, yield 59%) as a colourless liquid.14481859815v2773158: SA9-886PC / / PAT25019-WO-PCTResults:ELSD analysis: Purity 99.80 %, Calculated: C25H33NO5= 427.24, Observed = 450.20 (m / z, M+Na+).tert-butyl 2,6-bis(hydroxymethyl)morpholine-4-carboxylate [INT 11b] / OH[ °„ zNv / OHBocTo a stirred solution of tert-butyl 2,6-bis[(benzyloxy)methyl]morpholine-4-carboxylate [INT 10b] (0.7 g, 1.64 mmol) in ethanol (13.1 mL, 225 mmol), tetrahydrofuran (13.1 mL, 161 mmol), w-as added palladium on carbon (10% w / w, 50% moisture) (350 mg, 2 eq., 3.29 mmol) at ambient temperature and allowed to stir under H2 atmosphere for 16 h. Progress of reaction was monitored by ELSD / TLC. Reaction was filtered through celite pad and concentrated under reduced pressure to get tert-buty l 2,6-bis(hydroxymethyl)morpholine-4-carboxylate [INT 11b] (350 mg, yield 86%) as a colourless liquid.Results:ELSD analysis: Purity 97.92%, Calculated C11H21NO5= 247.14, Observed = 192.30 (m / z, M+H+-56).(4-(tert-butoxycarbonyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 12b]OTBDMS OTBDMSBocTo a stirred solution of starting material 4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoic acid [INT 4] (1.98 g, 2 eq., 2.83 mmol) in dichloromethane (37 mL, 578 mmol), were added EDC. HC1 (651 mg, 2.4 eq., 3.4 mmol) and DMAP (837 mg, 4.8 eq., 6.79 mmol). After 15 min of string at room temperature tert-butyl 2,6-bis(hydroxymethyl)morpholine-4-carboxylate [INT lib] (350 mg, 1.42 mmol) was also added at RT under inert atmosphere and resultant reaction mass was allowed to stir at RT for 16h. Reaction progress was monitor by ELSD. SM was consumed completely. Reaction mass was evaporated under reduced pressure. The crude was purified by column chromatography using 3-5% EtOAc in Heptane. The fraction was evaporated under reduced pressure to get (4- 14581859815v2773158: SA9-886PC / / PAT25019-WO-PCT(tert-butoxycarbonyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert- butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 12b] (1.7g, yield 71.7%) as light yellow liquid.Results:ELSD analysis: Purity 99.88 %, Calculated C91H187N3O11Si4=1610.32, Observed = 1610.85 (m / z, M+H+).morpholine-2,6-diylbis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) (Compound 1, (R, R) or (S, S) form)To a stirred solution of starting material (4-(tert-butoxycarbonyl)morpholine-2,6- diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 12b] (0.6 g, 372 pmol) in dichloromethane (30 mL, 469 mmol), was added hydrogen chloride in Et2O(lM, 2 mL) at 0°C. Reaction mixture was allowed to keep at room temperature for 16h. Reaction was monitored by checking TLC / ELSD. Reaction progress was monitored by checking TLC / ELSD. Reaction mixture was evaporated under reduced pressure, then basified with aq. NaHCO3solution (50 mL) and extracted with DCM (3x 25 mL). Organic layer was separated and dried over sodium sulphate and concentrated under reduced pressure. The crude compound was purified over silica 0-10% MeOH / DCM fraction was evaporated to get the morpholine-2,6-diylbis(methylene) bis(4-(bis(2- hydroxydodecyl)amino)butanoate) [Compound 1, (R, R) or (S, S) form] (176 mg, yield=44%) as a colourless liquid.Results:1H-NMR (400MHz, CDCl3)- δ4.38-4.22 (m, 2H), 4.17-4.05 (m, 2H), 4.04-3.90 (m, 2H), 3.94-3.68-3.55 (m, 4H), 2.97-2.94 (m, 2H), 2.75-2.69 (m, 2H), 2.67-2.52 (m, 5H), 2.50-2.28 (m, 12H), 1.85-1.75 (m, 4H), 1.48-1.35 (m, 12H), 1.34-1.20 (m, 66H), 0.87 (t, J=6.4 Hz, 12H).ELSD analysis: Purity 83% + 16% = 99 %, Calculated: C63H125N3O9= 1053.93, Observed = 1054.60 (m / z).14681859815v2773158: SA9-886PC / / PAT25019-WO-PCTExample 3: Synthesis of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) (Compound 2, meso form)I[INT 16] is produced as a mix of diastereomers that can be separated via column chromatograph. The meso form of the compound (i.e., the (R, S) form) can be isolated and is referred to as [INT 16a], Subsequent intermediates having (R, S) (or (S. R))) stereochemistry on the morpholine ring are also identified with a lower case “a.” Similarly, a mixture of the (R, R) and (S,S) enantiomers of [INT 16] can be isolated and is referred to as [INT 16b] Subsequent intermediates having (R, R) and / or (S, S) stereochemistry on the morpholine ring are also identified with a lower case “b ”3,3'-(methylazanediyl)bis(l-(benzyloxy)propan-2-ol) [INT 15]14781859815v2773158: SA9-886PC / / PAT25019-WO-PCT.. OBnHOjf OH^N^X^OBn2-[(benzyloxy)methyl]oxirane [INT 13] (10.6 g, 64.4 mmol) was taken in methylamine [INT 14] (1 g, 32.2 mmol) in THF Solution. The reaction was heated to 60 °C for 16 h in seal tube (because of Methylamine low boiling point). Progress of the reaction was monitored by ELSD and TLC, which shows reaction completion. Reaction was cooled to RT then evaporated under reduced pressure to get the crude compound. The crude was purified over silica 2-5% MeOH in DCM to give 3,3'-(methylazanediyl)bis(l-(benzyloxy)propan-2-ol) [INT 15] (7.8 g, yield 67%) as a colourless liquid.Results:ELSD analysis: Purity 99.84%, Calculated: C21H29NO4= 359.21, Observed = 360.20 (m / z, M+H+).2,6-bis((benzyloxy)methyl)-4-methylmorpholine [INT 16a], OBnI iTo a stirred solution of sodium hydride (1.91 g, 47.7 mmol) in tetrahydrofuran (110 mL), was added 3,3'-(methylazanediyl)bis(1-(benzyloxy)propan-2-ol) [INT 15] (7.8 g, 21.7 mmol) at 0 °C temperature then stirred for 30 minutes at ambient temperature. After that 4-methylbenzene-1 -sulfonyl chloride (4.14 g, 21.7 mmol) was added to the resulting reaction mixture and stirred for 16 h. Reaction was monitored by TLC and ELSD, which shows new spots along with SM. Reaction was quenched with ice cold water (50 mL) and extracted with ethyl acetate (2x 30 mL), dried over sodium sulphate, and evaporated under reduced pressure. The crude compound was purified by column chromatography 2-4% MeOH in DCM and afforded two peaks. The second peak, which corresponds to the meso compound, was collected as a colorless liquid (1.1 g, yield 15%).Results:ELSD analysis: Purity 99.21%, Calculated: C21H27NO3= 341.20, Observed = 342.25 (m / z, M+H+).(4-methylmorpholine-2,6-diyl)ditnethanol [INT 17a]14881859815v2773158: SA9-886PC / / PAT25019-WO-PCTOH\0To the stirred solution of 2,6-bis((benzyloxy)methyl)-4-methylmorpholine [INT 16a] (0.6 g.2.39 mmol) in methanol (10 mL), was added palladium on carbon (10% w / w, 50% moisture) (0.3 g) under nitrogen. Then reaction was allowed to stir at RT under H2 pressure (lOOpsi) for 16h. The reaction progress was monitored by TLC, which shows reaction completion. The reaction mass was filtered through celite and washed with methanol (20 mL). The filtrate was evaporated to get (4-methylmorphohne-2,6-diyl)dimethanol [INT 17a] (0.15 g, 53%) as yellowish liquid.Results:ELSD analysis: Purity 80.90%, Calculated: C7H15NO3= 161.11, Observed = 162.35 (m / z, M+H+).(4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 18a]To a stirred solution of starting material 4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoic acid [INT 4] (869 mg. 1.24 mmol) in dichloromethane (15 mL), were added EDC. HC1 (285 mg, 1.49 mmol) and DMAP (367 mg, 2.98 mmol) followed by the addition of (4-methylmorpholine-2,6-diyl)dimethanol [INT 17a] (0.1 g, 0.62 mmol) at RT under inert atmosphere. The resultant reaction mass was allowed to stir at RT. After 16h reaction progress was monitor by ELSD & TLC. Which shows SM was consumed completely. Reaction mass was evaporated under reduced pressure to afford crude compound. The crude was purified by column chromatography using 7-9% EtOAc in Heptane. The fraction was evaporated under reduced pressure to get (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 18a] (0.6 g, yield 63%) as colorless liquid.Results:14981859815v2773158: SA9-886PC / / PAT25019-WO-PCTLCMS analysis: Purity 99.92 %, Calculated: C87H181N3O9Si4= 1524.29, Observed = 1525.85 (m / z, M+H+).(4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hy droxy dodecyl) amino)butanoate) (Compound 2, meso form)To the stirred solution of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 18a] (0.6 g, 0.393 mmol) in tetrahydrofuran (15 mL) was added hydrogen fluoride — pyridine (1 / 1) (2.5 mL) at 0°C temperature. After 16h, reaction was completed by TLC and ELSD. Reaction mixture was diluted with diethyl ether (30 mL) and washed with cold water (2x 50 mL). Now organic layer was washed with aq. NaHCO3solution (2x 25 mL) and fresh water (30 mL). Collected organic layer was dried over sodium sulphate and concentrated under reduced pressure. The crude was purified over silica using 0-5% MeOH in DCM to give (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) [Compound 2, meso form] (0.130 g, yield 31%) as yellowish oil.Results:1H-NMR (400MHz, CDCl3)- δ4.19-4.02 (m, 4H), 3.87-3.78 (m, 2H), 3.75-3.58 (m, 4H), 2.75-2.70 (m, 2H), 2.69-2.57 (m, 4H), 2.55-2.35 (m, 11H), 2.30 (s, 3H), 1.88-1.75 (m, 6H), 1.55-1.10 (m, 73H), 0.87 (t, J=6.4 Hz, 12H).ELSD analysis: Purity 99.5%, Calculated: C63H125N3O9= 1067.94, Observed = 1068.60 (m / z, M+H+).Example 4: Synthesis of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hvdroxydodecyl)amino)butanoate) (Compound 2, (R, R) or (S,S) form)15081859815v2773158: SA9-886PC / / PAT25019-WO-PCTThe (R, R) or (S, S) form of Compound 2 was prepared using the same synthetic protocol as for the meso form of Compound 2 in Example 3, with the exception that the (R, R) or (S. S ) form of [INT 16] was used in subsequent steps.2>6-bis((benzyloxy)methyl)-4-methylmorpholine [INT 16b]4DBnzNI\ / 1^0BnTo a stirred solution of sodium hydride (1.91 g, 47.7 mmol) in tetrahydrofuran (110 mL), was added 3,3'-(methylazanediyl)bis(1-(benzyloxy)propan-2-ol) [INT 15] (7.8 g, 21.7 mmol) at 0 °C temperature then stirred for 30 minutes at ambient temperature. After that 4-methylbenzene-1 -sulfonyl chloride (4.14 g, 21.7 mmol) was added to the resulting reaction mixture and stirred for 16 h. Reaction was monitored by TLC and ELSD. which shows new spots along with SM. Reaction was quenched with ice cold water (50 mL) and extracted with ethyl acetate (2x 30 mL), dried over sodium sulphate and evaporated under reduced pressure. The crude compound was purified by column chromatography 2-4% MeOH in DCM and afforded two peaks. The first peak, which corresponds to the (R, R) or (S, S) form of the compound, was collected as a colourless liquid (1.1 g, yield 15%).Results:ELSD analysis: Purity 99.90 %, Calculated: C21H27NO3= 341.20, Observed = 342.25 (m / z, M+H+).(4-methylmorpholine-2,6-diy I) dimethanol [INT 17b], OHI 1To the stirred solution of 2,6-bis((benzyloxy)methyl)-4-methylmorpholine [INT 16b] (440 mg, 1.29 mmol) in methanol (10 mL, 247 mmol) was added palladium on carbon (10% w / w, 50% moisture) (223 mg) under nitrogen. Then reaction was degassed and allowed to stir at RT under H2 pressure (lOOpsi) for 16h. The reaction progress was monitored by TLC which shows reaction completion. The reaction mass was filtered through celite and washed with methanol (20 mL). The filtrate was evaporated to get (4-methylmorpholine-2,6-diyl)dimethanol [INT 17b] (150 mg, yield 72%) as yellowish liquid.15181859815v2773158: SA9-886PC / / PAT25019-WO-PCTResults:ELSD analysis: Purity 97.49 %, Calculated: C7H15NO3= 161.11, Observed = 162.30 (m / z. M+H+).(4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 18b]To a stirred solution of starting material 4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoic acid [INT 4] (869 mg. 2 eq., 1.24 mmol) in dichloromethane (16.2 mL, 253 mmol), were added EDC. HC1 (285 mg, 2.4 eq., 1.49 mmol) and DMAP (367 mg, 4.8 eq., 2.98 mmol), After 15 min (4-methylmorpholine-2,6-diyl)dimethanol [INT 17b] (0.1 g, 620 pmol) was also added at RT under inert atmosphere and resultant reaction mass was allowed to stirred at RT for 16h. Reaction progress was monitor by ELSD & TLC. Reaction mass was evaporated under reduced pressure and the crude was purified by column chromatography using 7-9% EtOAc in Heptane. The fraction was eveporated under reduced pressure to get (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 18b] (520 mg, yield 55%) as colourless liquid.Results:LCMS analysis: Purity 99.98 %, Calculated: C87H181N3O9Si4= 1524.29, Observed = 1525.05 (m / z, M+H+).(4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) (Compound 2, (R, R) or (S, S) form)To a solution of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 18b] (0.3 g. 197 pmol) in15281859815v2773158: SA9-886PC / / PAT25019-WO-PCTtetrahydrofuran (5 mL, 61.4 mmol), was added pyridine hydrofluoride (2.5 mL, 786 pmol) drop wise at 0°C, then stirred at room temperature for 16h. Reaction monitor by ELSD analysis, after completion of reaction, reaction mixture was diluted with Et2O (20 mL), washed with cold water (2x 20 mL) and brine solution (20 mL). The organic layer was aq, NaHCCh solution (50 mL) followed by water (50 mL), dried over sodium sulphate and was evaporated to dryness. Crude compound was column purified at 3% MeOH-DCM to get (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate)[Compound 2, (R, R) or (S, S) form] (180 mg, yield 86%) as light yellow liquid.Results:1H-NMR (400MHz, CDCh)- 54.50-4.34 (m, 2H), 4.12-4.00 (m, 4H), 3.82-3.58 (m, 4H), 2.60-2.55 (m, 2H). 2.50-2.40 (m, 8H). 2.27-2.20 (m, 6H). 1.90-1.80 (m, 4H). 1.55-1.35 (m, 12H), 1.35-1.15 (m, 67H), 0.87 (t, J=6.4 Hz, 12H).ELSD analysis: Purity 99.79 %, Calculated: C63H125N3O9= 1067.94, Observed = 1068.65 (m / z, M+H+).Example 5: Synthesis of (4-(2-hvdroxyethyl)morpholine-2.6-diyl)bis(methylene) bis(4- (bis(2-hvdroxydodecyl)amino)butanoate) (Compound 3, meso form)15381859815v2773158: SA9-886PC / / PAT25019-WO-PCTSynthetic Protocoltert-butyl(2-iodoethoxy)dimethylsilane [INT 20]|Xxx^OTBDMSTo a stirred solution of 2-iodoethan-l-ol [INT 19] (10 g, 58.2 mmol) in dichloromethane (0.1 L, 1.56 mol), were added IH-imidazole (7.92 g, 2 eq., 116 mmol) and tert- butyl(chloro)dimethylsilane (17.5 g, 2 eq., 116 mmol) at RT then allowed to stir at room temperature for 48 h. After completion the reaction, the mixture was washed with saturated brine solution (2x 30 mL). The organic layer was dried over anhy. sodium sulphate and concentrated under reduced pressure. The crude was purified by flash column chromatography (SiO20-2 % Ethyl acetate in hexane) to obtain tert-buty 1(2- iodoethoxy)dimethylsilane [INT 20] (12 g, yield 72 %) as colourless liquid.Results:1H-NMR (400MHz, CDCh)- 53.81 (t, J=7.2Hz, 2H), 3.19 (t, J=7.2Hz, 2H), 0.91 (s, 9H), 0.06 (s, 6H).morpholine-2, 6-diylbis(methylene) bis(4-(bis(2-((tert- butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 21a]15481859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo a stirred solution of (4-(tert-butoxycarbonyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) (9 g, 5.58 mmol) [INT 12a] in dichloromethane (169 mL, 2.64 mol), was added trifluoroacetic acid (18 mL) at 0°C. Reaction mixture was allowed to stir at room temperature for 16 h. Reaction progress was monitored by TLC / ELSD. Reaction mixture was evaporated under reduced pressure, then basified with aq. NaHCCh solution (300 mL) and extracted with DCM (3x 50 mL), organic layer was separated and dried over sodium sulphate and concentrated under reduced pressure. The crude compound was purified over silica 0-40% EtOAC / Heptane fraction was evaporated to get the morpholine-2,6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 21a] (8 g, yield 93.8%) as a pale yellow liquid.Results:ELSD analysis: Purity 98.52 %, Calculated C86H179N3O9Si4= 1510.27, Observed = 1511.85 (m / z, M+H+).(4-(2-((tert-butyldimethylsilyl)oxy)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2- ( (tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 22a]OTBDMS OTBDMSOTBDMSTo a stirred solution of morpholine-2,6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) (8 g, 5.29 mmol) [INT 21a] in acetonitrile (60 mL, 1.15 mol), tetrahydrofuran (60 mL, 737 mmol) were added dipotassium carbonate (3.66 g, 5 eq., 26.5 mmol) and tert-butyl(2-iodoethoxy)dimethylsilane [INT 20] (2.27 g, 1.5 eq.. 7.94 mmol) and allowed to stir at 90°C temperature for 16 h. Reaction was monitored by checking TLC / ELSD. Solid dipotassium carbonate was removed by filtration and concentrated. Residue was diluted with water (100 mL) and extracted with ethyl acetate (2x15581859815v2773158: SA9-886PC / / PAT25019-WO-PCT50 mL), dried over sodium sulphate and concentrated under reduced pressure. The crude was purified by silica gel column chromatography using 3-5% EtOAc in Heptane to get (4-(2-((tert-butyldimethylsilyl)oxy)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 22a] (4.5 g, yield 50%) as a colourless liquid.Results:ELSD analysis: Purity 99.89 %, Calculated C94H197N3O10Si5= 1668.38, Observed = 1669.65 (m / z, M+H+).(4-(2-hydroxyethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) (Compound 3, meso form)To a stirred solution of (4-(2-((tert-butyldimethylsilyl)oxy)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 22a] (4.5 g, 2.69 mmol) in tetrahydrofuran (90 mL, 1.11 mol), was added hydrogen fluoride — pyridine (1 / 1) (1.07 g. 4 eq., 10.8 mmol) at 0°C. Reaction mixture was allowed to keep at room temperature for 16h. Reaction progress was monitored by checking TLC / ELSD. Reaction mixture was diluted with diethyl ether (50 mL) and washed with cold water (2x 50 mL). Now organic layer was washed with aq. NaHCO3solution (2x 25 mL) and fresh water (50 mL). Collected organic layer was dried over sodium sulphate and concentrated under reduced pressure. The crude compound was purified over silica 0-10% MeOH / DCM to get (4-(2-hydroxyethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) [Compound 3, meso form] (2.5 g, yield 84%) as a colourless liquid.Results:1H-NMR (400MHz, CDCh)- 54.25-4.15 (m, 2H), 4.15-4.10 (m, 2H), 4.09-3.84 (m, 2H), 3.82-3.75 (m, 2H), 3.20-2.70 (m, 18H), 2.57-2.45 (m, 4H), 2.43-2.25 (m, 2H), 2.70-1.92 (m, 4H), 1.50-1.35 (m, 12H), 1.32-1.22 (m, 62H), 0.87 (t, J=6.4 Hz, 12H).ELSD analysis: Purity 99.11 %, Calculated C64H127N3O10= 1097.95, Observed = 1098.55 (m / z, M+H+).15681859815v2773158: SA9-886PC / / PAT25019-WO-PCTExample 6: Synthesis of (4-(2-hvdroxyethyl)morpholine-2,6-diyl)bis(methylene) bis(4- (bis(2-hvdroxydodecyl)amino)butanoate) (Compound 3, (R, R) or (S,S) form)Synthetic ProtocolThe (R, R) or (S, S) form of Compound 3 was prepared using the same synthetic protocol as for the meso form of Compound 3 in Example 5, with the exception that the (R, R) or (S, S) form of [INT 12] was used.morpholine-2, 6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 21b]To a stirred solution of starting material (4-(tert-butoxycarbonyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate)[INT 12b] (0.9 g, 558 pmol) in dichloromethane (16.9 mL, 264 mmol) was added trifluoroacetic acid (2 mL) at 0°C. Reaction mixture was allowed to keep at room temperature for 16 h. Reaction was monitored by checking TLC / ELSD. Reaction mixture was evaporated under reduced pressure, then basified with aq. NaHCO3solution and extracted with DCM (3x25 mL). Organic layer was separated and dried over sodium sulphate and concentrated under reduced pressure. The crude compound was purified over silica 0-40% EtOAC / Heptane to get morpholine-2.6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 21b] (0.8 g, yield 93.8 %) as a pale yellow liquid.Results:ELSD analysis: Purity 96.38%, Calculated C86H179N3O9Si4= 1510.27, Observed = 1511.35 (m / z, M+H+).15781859815v2773158: SA9-886PC / / PAT25019-WO-PCT(4-(2-((tert-butyldimethylsilyl)oxy)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2- ( (tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 22b]OTBDMS OTBDMS O O N O. N0 oOTBDMS N TBDMSO'OTBDMSTo a stirred solution of starting material morpholine-2,6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 21b] (820 mg, 542 pmol) in acetonitrile (6.15 mL, 118 mmol), tetrahydrofuran (6.15 mL, 75.6 mmol) were added dipotassium carbonate (375 mg, 5 eq., 2.71 mmol) and tert-butyl(2-iodoethoxy)dimethylsilane [INT 20] (233 mg, 1.5 eq., 814 pmol). Reaction mixture was allowed to keep at 90°C temperature for 16 h. Reaction was monitored by checking TLC / ELSD. Reaction mixture was diluted with water (100 mL)) and extracted with ethyl acetate (3x 50 mL). Organic layer was separated, dried over sodium sulphate, and concentrated under reduced pressure. The crude was purified by flash chromatography by using 0-20% EA / hexane gradient to afford (4-(2-((tert-butyldimethylsilyl)oxy)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 22b] (410 mg, yield 44.8 %) as a colourless liquid.Results:ELSD analysis: Purity 99.92 %, Calculated C94H197N3O10Si5= 1668.38, Observed = 1669.40 (m / z, M+H+).(4-(2-hydroxyethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hy droxy dodecyl) amino)butanoate) (Compound 3, (R, R) or (S, S) form)OH OHOHTo a stirred solution of starting material (4-(2-((tert-butyldimethylsilyl)oxy)ethyl)morpholine-2,6-diyl)bis(rnethylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 22b] (0.4 g, 240 pmol) in dichloromethane (10 mL, 156 mmol) was added hydrogen chloride (1M in Et2O, 4 mL) at 15881859815v2773158: SA9-886PC / / PAT25019-WO-PCT0°C. Reaction mixture was allowed to keep at room temperature for 16h. Reaction progress was monitored by checking TLC / ELSD. Reaction mixture was evaporated under reduced pressure. Residue was basified with aq. NaHCO3solution (40 rnL) and extracted with DCM (2x 30 mL). Organic layer was separated, washed with fresh water (30 mL), dried over sodium sulphate and concentrated under reduced pressure. The crude compound was purified over silica gel column using 0-10% MeOH / DCM to get the (4-(2-hydroxyethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) [Compound 3, (R, R) or (S, S) form] (115 mg, yield 43.7%) as a colourless liquid.Results:1H-NMR (400MHz, CDCh)- 54.77-4.29 (m, 2H), 4.22-4.11 (m, 2H), 4.10-4.03 (m, 2H), 3.70-3.56 (m, 6H). 2.70-2.25 (m, 24H), 1.85-1.74 (m. 4H), 1.50-1.20 (m. 76H), 0.87 (t, J=6.4 Hz, 12H).ELSD analysis: Purity 99.84 %, Calculated C64H127N3O10= 1097.95, Observed = 1098.85 (m / z, M+H+).Example 7: Synthesis of (4-(2-(dimethylamino)ethyl)morpholine-2.6-diyl)bis(methylene) bis(4-(bis(2-hvdroxydodecyl)amino)butanoate) (Compound 4, meso form)Synthetic Protocol15981859815v2773158: SA9-886PC / / PAT25019-WO-PCT(4-(2-(dimethylamino)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 24a]OTBDMS OTBDMSTo a stirred solution of starting material morpholine-2,6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 21a] (1.2 g, 794 pmol) in acetonitrile (9 mL, 172 mmol), tetrahydrofuran (9 mL, 111 mmol), were added dipotassium carbonate (549 mg, 5 eq., 3.97 mmol) and (2-bromoethyl)dimethylamine [INT 23] (181 mg, 1.5 eq., 1.19 mmol). Reaction mixture was allowed to keep at 90°C temperature for 16 h.Reaction was monitored by checking TLC / ELSD. Reaction mixture was diluted with water and extracted with ethyl acetate, both layer was separated. Organic layer was dried over sodium sulphate and concentrated under reduced pressure to get the crude compound. The crude compound was purified over silica 0-20% EtOAC / Heptane to get the (4-(2-(dimethylamino)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-16081859815v2773158: SA9-886PC / / PAT25019-WO-PCTbutyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 24a] (350 mg, yield=27,58%) as a colourless liquid.Results:ELSD analysis: Purity 99.34 %, Calculated: C9oHi8sN4C>9Si4 = 1581.35, Observed = 1581.95 (m / z, M+H+).(4-(2-(dimethylamino)ethyl)morphotine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) (Compound 4, meso form)OH OHTo a stirred solution of starting material (4-(2-(dimethylamino)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 24a] (350 mg, 221 pmol) in dichloromethane (5 mL, 78.1 mmol), was added hydrogen chloride in Et20 (IM, 1 mL) at 0 °C. Reaction mixture was allowed to keep at room temperature for 16h. Reaction progress was monitored by checking TLC / ELSD. Reaction mixture was evaporated under reduced pressure, then basified with aq. NaHCO3solution (30 mL) and extracted with DCM (2x 25 mL). Organic layer was separated and dried over sodium sulphate and concentrated under reduced pressure. The crude compound was purified over silica 0-10% MeOH / DCM, fraction was evaporated to get the (4-(2-(dimethylamino)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) [Compound 4, meso form] (120 mg, yield 48.2%) as a colourless liquid.Results:1H-NMR (400MHz, CDCl3)- δ4.20-4.12 (m, 4H), 3.90-3.80 (m, 2H), 3.71-3.60 (m, 4H), 3.00-2.38 (m, 32H), 2.00-2.78 (m, 4H), 1.50-1.20 (m, 74H), 0.87 (t, J=6.4 Hz, 12H).EELSD analysis'. Purity 99.43 %, Calculated: C66Hi32N4C>9= 1125.00, Observed = 1125.70 (m / z, M+H+).Example 8; Synthesis of (4-(2-(dimethylamino)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) (Compound 4, (R, R) or (S, S) form)16181859815v2773158: SA9-886PC / / PAT25019-WO-PCTSynthetic ProtocolThe (R, R) or (S, S) form of Compound 4 was prepared using the same synthetic protocol as for the meso form of Compound 4 in Example 7, with the exception that the (R, R) or (S, S) form of [INT 21] was used.morpholine-2, 6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 24b]To a stirred solution of starting material morpholine-2, 6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 21b] (750 mg, 496 pmol) in acetonitrile (5.62 mL, 108 mmol), tetrahydrofuran (5.62 mL, 69.1 mmol), were added dipotassium carbonate (343 mg, 5 eq., 2.48 mmol) and N, N-dimethyl(2-bromoethyl)amine — hydrogen bromide (1 / 1) [INT 23] (173 mg, 1.5 eq., 744 pmol) at room temperature. Reaction mixture was allowed to keep at 90°C temperature for 16 h. Reaction mixture was allowed to keep at 90°C temperature for 16 h. Reaction was monitored by checking TLC / ELSD.Reaction mixture was diluted with water and extracted with ethyl acetate; each layer was separated. Organic layer was dried over sodium sulphate and concentrated under reduced pressure. The crude compound was purified over silica 0-20% EtOAC / Heptane to get the morpholine-2,6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 24b] (280 mg, yield 36%) as a pale y ellow oil liquid.Results:EELSD analysis'. Purity 99.36 %, Calculated: C90H188N4O9Si4= 1581.35, Observed = 1582.45 (m / z, M+H+).16281859815v2773158: SA9-886PC / / PAT25019-WO-PCT(4-(2-(dimethylamino)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) (Compound 4, (R, R) or (S, S) form)OH OHTo a stirred solution of starting material morpholine-2,6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 24b] (0.4 g, 253 pmol) in di chloromethane (5 mL, 78.1 mmol), was added hydrogen chloride in Et20 (IM. 1 mL) at 0 °C. Reaction mixture was allowed to keep at room temperature for 16h. Reaction progress was monitored by checking TLC / ELSD. Reaction mixture was evaporated under reduced pressure, then basified with aq. NaHCO3solution (30 mL) and extracted with DCM (2x 25 mL). Organic layer was separated and dried over sodium sulphate and concentrated under reduced pressure. The crude compound was purified over silica 0-10% MeOH / DCM, fraction was evaporated to get (4-(2-(dimethylamino)ethyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) [Compound 4, (R, R) or (S, S) form] (90 mg, yield 32%) as a colourless liquid.Results:1H-NMR (400MHz, CDCl3)- δ4.40-4.30 (m, 2H), 4.20-4.02 (m, 4H), 3.70-3.60 (m, 4H), 3.45-2.90 (m, 6H), 2.90-2.70 (m, 2H), 2.68-2.54 (m, 6H), 2.53-2.25 (m, 18H), 1.86-1.75 (m, 4H), 1.55-1.00 (m, 74H), 0.87 (t, J=6.4 Hz, 12H).EELSD analysis'. Purity 99.94 %, Calculated: C66H132N4O9= 1125.00, Observed = 1125.95 (m / z, M+H+).Example 9; Synthesis of tetra((Z)-non-2-en-l-yl) 8,8,,8”,8'"-(((((4-methylmorpholine- 2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetraoctanoate (Compound 5, meso form)o16381859815v2773158: SA9-886PC / / PAT25019-WO-PCTSynthetic Protocol25-(((benzyloxy)carbonyl)amino)pentanoic acid [INT 26]To a solution of 5 -aminopentanoic acid [INT 25] (20 g. 171 mmol) in 40 ml water was added sodium hydroxide (17 g + 80 mL water) slowly at 0°C followed by the addition of benzyl chloroformate 30% solution in toluene (59.3 mL, 341 mmol) to the reaction mixture. The reaction was stirred with continuous cooling for 90 min then warmed to RT for an additional 90 min. The TLC was monitored, and the starting was completely consumed. Diethyl ether (100ml) and water (100ml) were added, and both the phases were separated. The compound goes to water (reddish Liquid) and the impurities were extracted in diethyl ether. Further aqueous layer was acidified by 2M HC1 (50 ml), the resulting mixture is extracted with diethyl ether (100 ml) and the combined extracts (from acidic phase) were dried and concentrated to afford 5-(((benzyloxy)carbonyl)amino)pentanoic acid [INT 26] (41 g, yield 95%) as white solid.Results:16481859815v2773158: SA9-886PC / / PAT25019-WO-PCTEELSD analysis'. Purity 99.99 %, Calculated C13H17NO4= 251.12, Observed = 252.20 (m / z, M+H+).tert-butyl 5-(((benzyloxy)carbonyl)amino)pentanoate [INT 27]N O'HTo a stirred solution of starting material 5-(((benzyloxy)carbonyl)amino)pentanoic acid [INT 26] (41 g, 163 mmol) in dichloromethane (400 mL) were added TFAA (54.5 mL, 392 mmol) and 2-methylpropan-2-ol (54.8 mL, 578 mmol) at 0°C in inert atmosphere. The resultant reaction mixture was allowed to stir at RT. After 16 h reaction progress was monitor by TLC. SM was consumed completely. Reaction mixture was diluted with DCM (150 ml) and washed with distilled water (150 ml). Organic layer was dried over anhy. sodium sulphate and concentrated under reduced pressure. The crude compound w as purified by silica gel column chromatography in 20% EtOAc in heptane to afford tert-buty l 5-(((benzyloxy)carbonyl)amino)pentanoate [INT 27] (17.4 g, yield 34%) as a light red liquid product.Results:EELSD analysis'. Purity 99.87 %, Calculated- C17H25NO4= 307.18, Observed = 252.15 (m / z, M-56).tert-butyl 5-aminopentanoate [INT 28]To a stirred solution of tert-butyl 5-(((benzyloxy)carbonyl)amino)pentanoate [INT 27] (5 g, 16.4 mmol) in methanol (50 mL), was added palladium on carbon (10% w / w; with 50 % moisture) (2.3 g, 21.6 mmol) under nitrogen. Reaction mixture w as degassed and allowed to stir for 16 h in hydrogen atmosphere. The starting was consumed by TLC and RM was filtered through celite bed. The solvent was distilled under vacuum to afford tert-butyl 5-aminopentanoate [INT 28] (2.71 g, yield 95%) as pale yellow liquid compound.Results:EELSD analysis'. Purity 94.5%, Calculated C9H19NO2= 173.14, Observed = 174.30 (m / z, M+H+).16581859815v2773158: SA9-886PC / / PAT25019-WO-PCT(Z)-non-2-en-l-yl 8-bromooctanoate [INT 31]OTo a stirred solution of 8-bromooctanoic acid [INT 30] (20 g, 89.6 mmol) in di chloromethane (128 mL, 1.99 mol), were added 4-(dimethylamino)pyridin-l-ium (2.21 g, 0.2 eq., 17.9 mmol) and {3-[cyano(ethyl)amino]propyl}dimethylazanium chloride (20.6 g, 1.2 eq., 108 mmol) at room temperature. After this (2Z)-non-2-en-l-ol [INT 29] (6.38 g, 44.8 mmol) was added in reaction mixture, allow to stir for 16 h. The reaction was monitored by TLC, after completion the reaction, reaction mixture was concentrated under reduced pressure. The crude was purified by flash column chromatography on silica gel using 10-20 % to afforded (Z)-non-2-en-l-yl 8-bromooctanoate [INT 31] (27 g, yield 86.37%) as pale-yellow liquid. Results:1H-NMR (400MHz, CDCl3)- δ5.67-5.61 (m, 1H), 5.54-5.48 (m, 1H), 4.62-4.60 (d, J= 6.8 Hz, 2H), 3.39 (t, J= 6.8 Hz, 2H), 2.30 (t, J= 7.2 Hz, 2H), 2.12-2.06 (m, 2H), 1.88-1.76 (m, 2H), 1.64-1.59 (m, 2H), 1.42-1.27 (m, 14H), 0.80 (m, 3H).di((Z)-non-2-en-l-yl) 8,8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)dioctanoate [INT 32]ONTo a stirred solution of starting material tert-butyl 5-aminopentanoate [INT 28] (1.5 g, 8.66 mmol) and dipotassium carbonate (5.98 g, 5 eq., 43.3 mmol) in dimethylformamide (75 mL, 969 mmol), was added (Z)-non-2-en-l-yl 8-bromooctanoate [INT 31] (6.31 g, 2.1 eq., 18.2 mmol) in inert atmosphere. The resultant reaction mixture was allowed to stir for 16 h at 75° C. Reaction mixture was filtered through celite, filtrate was diluted with water (100.0 mL) and extracted with EtOAc (2x 50.0 mL), dried over anhy. Na2SO4, filtered and concentrated. Crude was purified by flash chromatography using 10-30 % gradient of ethyl acetate in heptane to afford di((Z)-non-2-en-l-yl) 8,8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)dioctanoate [INT 32] (2 g, yield = 33 %) as colourless thick oil.EELSD analysis'. Purity 99.96%, Calculated Formula: C43H79NO6= 705.59, Observed = 706.45 (m / z, M+H+).5-(bis(8-(((Z)-non-2-en-l-yl)oxy)-8-oxooctyl)amino)pentanoic acid [INT 33]16681859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo the stirred solution of di((Z)-non-2-en-l-yl) 8,8'-((5-(tert-butoxy)-5- oxopentyl)azanediyl)dioctanoate [INT 32] (1.7 g, 2.41 mmol) in dichloromethane (38.8 mL.606 mmol), was added trifluoroacetic acid (3.6 mL) at 0°C dropwise. The reaction was allowed to stir at RT for 16h. TLC shows SM was consumed and formed new spots. The solvent was evaporated at 40°C and residue was basified using saturated NaHCO3aq. solution (50 mL). The compound was extracted with diethyl ether (2 x 30 mL). The combined organic layer was dried with Na2SO4 and evaporated to get crude. The crude compound was purified by column chromatography to afford 5-(bis(8-(((Z)-non-2-en-l-yl)oxy)-8-oxooctyl)amino)pentanoic acid [INT 33] (1.3 g, Yield 83%) as pale yellow liquid compound.1H-NMR (400MHz, CDCl3)- δ5.67-5.60 (m, 2H), 5.54-5.29 (m, 2H), 4.62-4.60 (d, J= 6.8 Hz, 4H), 2.95-2.74 (m, 6H), 2.40-2.28 (m, 6H), 2.30-2.04 (m, 4H), 1.70-1.59 (m, 12H), 1.37- 1.21 (m, 28H), 0.87 (t, J = 6.4 Hz, 6H).tetra((Z)-non-2-en-l-yl) 8,8',8",8"'-(((((4-methylmorpholine-2,6- diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetraoctanoate (Compound 5, meso form)oo To a stirred solution of starting material 5-(bis(8-(((Z)-non-2-en-l-yl)oxy)-8- oxooctyl)amino)pentanoic acid [INT 33] (565 mg, 2 eq., 868 pmol) in dichloromethane (14 mL, 219 mmol), were added 4-(dimethylamino)pyridin-l-ium (257 mg, 4.8 eq., 2.08 mmol) and EDC. HCL (0.2 g, 2.4 eq., 1.04 mmol) at RT. After 10 min (4-methylmorpholine-2,6- diyl)dimethanol [INT 17a] (70 mg, 434 pmol) was added under inert atmosphere and resultant reaction mass was allowed to stir at RT. After 16 h reaction progress was monitor by ELSD & TLC, SM was consumed completely. Reaction mass was evaporated under reduced pressure. The crude compound was purified by column chromatography. Product obtained was taken in ACN (10 ml) and extract with pentane (2x 10 ml). Pentane layer was 16781859815v2773158: SA9-886PC / / PAT25019-WO-PCTevaporated under reduced pressure to get tetra((Z)-non-2-en-l-yl) 8,8',8",8"'-(((((4- methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5.1- diyl))bis(azanetriyl))tetraoctanoate [Compound 5, meso form] (227 mg, yield 36.68%) as colourless liquid.1H-NMR (400MHz, CDCl3)- δ5.67-5.60 (m, 4H), 5.54-5.48 (m, 4H), 4.62-4.60 (d, J= 6.8 Hz, 8H), 4.15-4.11 (dd, Ji = 6.0 Hz, J2= 5.6 Hz, 2H), 4.07-4.03 (dd. Ji = 6.0 Hz, J2= 5.6 Hz, 2H), 3.83-3.79 (m. 2H), 2.90-2.56 (m. 18H), 2.29 (t, J = 7.2 Hz, 12H), 2.11-2.06 (qrt, J = 7.2 Hz, 8H), 1.82 (t, J= 11.2 Hz, 2H), 1.63-1.59 (m, 14H), 1.37-1.26 (m, 65H), 0.87 (t, J= 6.4 Hz, 12H).EELSD analysis'. Purity 99.92 %, Calculated Formula: C85H153N3O13=1424.14, Observed = 1424.75 (m / z, M+H+).Example 10: Synthesis of tetra((Z)-non-2-en-l-yl) 8,8,,8,,,8”,-(((((4-methylmorpholine- 2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l- diyl))bis(azanetriyl))tetraoctanoate (Compound 5, (R, R) or (S, S) form)Synthetic ProtocolThe (R, R) or (S, S) form of Compound 5 was prepared using the same synthetic protocol as for the meso form of Compound 5 in Example 9, with the exception that the (R, R) or (S, S) form of [INT 17] was used.tetra((Z)-non-2-en-l-yl) 8,8',8",8"'-(((((4-methylmorpholine-2,6- diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetraoctanoate (Compound 5, (R, R) or (S, S) form)O'o o o -0>\' oo..To a stirred solution of starting material 5-(bis(8-(((Z)-non-2-en-l-yl)oxy)-8- oxooctyl)amino)pentanoic acid [INT 33] (565 mg, 2 eq., 868 pmol) in dichloromethane (1416881859815v2773158: SA9-886PC / / PAT25019-WO-PCTmL, 219 mmol), were added 4-(dimethylamino)pyridin-l-ium (257 mg, 4.8 eq., 2.08 mmol) and {3-[cyano(ethyl)amino]propyl}dimethylazanium chloride (0.2 g, 2.4 eq.. 1.04 mmol) at RT under inert atmosphere. After 15 min, (4-methylmorpholine-2,6-diyl)dimethanol (70 mg, 434 pmol) [INT 17b] was added to the resulting reaction mixture and allowed to stirred at RT for 16h. Reaction progress was monitor by ELSD & TLC. SM was consumed completely. Reaction mass was evaporated under reduced pressure. The crude compound was purified by column chromatography. Product obtained was taken in ACN (10 ml) and extract with pentane (2x 10 ml). Pentane layer w as evaporated under reduced pressure to get tetra((Z)-non-2-en-l-yl) 8,8',8",8"'-(((((4-methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetraoctanoate [Compound 5, (R, R) or (S, S) form] (137 mg. yield 22.14 %) as colourless liquid.Results:1H-NMR (400 MHz, CDCl3)- δ5.67-5.60 (m, 4H), 5.54-5.48 (m, 4H), 4.62-4.60 (d, J= 6.8 Hz, 8H), 4.33 (m, 2H), 4.12-4.02 (m, 4H), 2.62-2.36 (m, 16H), 2.29 (t, J= 7.2 Hz, 12H), 2.22 (s, 3H). 2.11- 2.06 (qrt, J = 6.8 Hz, 8H), 1.63-1.59 (m, 14H), 1.44-1.43 (m, 6H), 1.37-1.26 (m, 60H), 0.87 (t, J= 6.4 Hz, 12H).EELSD analysis'. Purity 99.96 %, Calculated Formula: C85H153N3O13= 1424.14, Observed = 1424.70 (m / z, M+H+).Example 11: Synthesis of tetra((Z)-non-2-en-l-yl) 8,8',8",8"'-(((((4-methylmorpholine- 2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7-hydroxyoctanoate) (Compound 6, meso form)HO > -NN Y OH L OH HO'JSynthetic Protocol16981859815v2773158: SA9-886PC / / PAT25019-WO-PCToct- 7-enoic acid [INT 34]OA stirred solution of potassium 2-methylpropan-2-olate (226 g, 4.5 eq., 2.02 mol) in tetrahydrofuran (3.33 L, 41 mol) was stirred at 90 °C, and added 8-bromooctanoic acid [INT 30] (100 g, 448 mmol). The reaction mixture was stirred at 90 °C for 24 h. TLC shows SM consumed and formed new spot. The reaction was diluted with cold water (1000 mL). The aq. layer was acidified using HC1 up to 2-3 pH and compound was extracted in EtOAc (2 x 500 mL). The organic layer was washed with cold water, dried over Na2SO4. filtered and evaporated to get oct-7-enoic acid [INT 34] (76 g, crude yield 100%) crude as yellowish liquid, which was used as such for next step.Results:1H-NMR (400MHz, CDCl3)- δ5.82-5.75 (m, 1H), 5.02-4.92 (m, 2H), 2.19 (t, J= 7.6 Hz, 2 H), 2.03-1.98 (m, 2H), 1.53-1.47 (m, 2H), 1.38-1.24 (m, 4H).17081859815v2773158: SA9-886PC / / PAT25019-WO-PCTbenzyl oct-7-enoate [INT 36]OTo the stirred solution of oct-7-enoic acid [INT 34] (10 g, 70.3 mmol) in dimethylformamide (0.1 L, 1.29 mol) was added dipotassium carbonate (38.9 g, 4 eq., 281 mmol) followed by the addition of (bromomethyl)benzene [INT 35] (10 mL, 1.2 eq., 84.4 mmol) at RT, then allowed to stir for 16 h. Progress of reaction was monitored by TLC. The RM was diluted with water (350 mL) and extracted with Diethyl ether (2 x 200 mL). The combined organic layer was washed with cold brine solution (2 x 200 mL), dried over anhy. Na2SO4, filtered and evaporated under reduced pressure. The crude compound was purified by manual silica gel column and eluted in 10-13% EtOAc in heptane. The solvent was evaporated to get benzyl oct-7-enoate [INT 36] (12 g. yield 73.45 %) as light greenish liquid.Results:1H-NMR (400MHz, CDCl3)- 57.35 (m, 5H), 5.84-5.73 (m, 1H), 5.11 (s, 2H), 5.01-4.96 (m, 1H), 4.96-4.92 (m, 1H), 2.37-2.33 (t, J=7.6Hz. 2H), 2.06-2.01 (m, 2H), 1.70-1.60 (m, 2H), 1.44-1.20 (m, 4H).benzyl 6-(oxiran-2-yl)hexanoate [INT 37]To the stirred solution of benzyl oct-7-enoate [INT 36] (16 g. 68.9 mmol) and dichloromethane (192 mL, 3 mol) was added 3-chlorobenzene-l-carboperoxoic acid (23.8 g, 1.5 eq., 103 mmol) at 0°C. The reaction was allowed to stir at RT for 16h. TLC showed starting material was consumed and formed a polar spot. The reaction was quenched with saturated NaHCO3aq. solution (200 mL) and stirred for 5 minutes. The organic layer was separated and again compound was extracted with DCM (300 mL). The combined organic layer was dried with Na2SO4 and evaporated. The crude compound was purified through silica gel using EtOAc: heptane. The compound was eluted in 5-6% EtOAc in heptane, then solvent was evaporated on rota evaporator to afford benzyl 6-(oxiran-2-yl)hexanoate [INT 37] (9.5 g, yield 55.55 %) as light greenish gel.Results:17181859815v2773158: SA9-886PC / / PAT25019-WO-PCT1H-NMR (400MHz, CDCh)- 87.38-7.29 (m, 5H), 5.11 (s, 2H), 2.86 (s, 1H), 2.73 (t, J = 4.8 Hz. 1H), 2.45 (t, J= 2.8 Hz, 1H), 2.36 (t, J= 7.6 Hz, 2H), 1.70-1.62 (m, 2H), 1.60-1.42 (m, 4H), 1.39-1.24 (m, 2H).dibenzyl 8, 8 '-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis( 7-hydroxyoctanoate) [INT 38]To the stirred solution of tert-butyl 5-aminopentanoate [INT 28] (3 g, 17.3 mmol) in isopropanol (50 mL, 654 mmol), were added ethylbis(propan-2-yl)amine (6.22 mL, 2 eq., 34.6 mmol) and benzyl 6-(oxiran-2-yl)hexanoate [INT 37] (8.6 g, 2 eq., 34.6 mmol) at RT. The reaction was allowed to stir at 90 °C for 16h. The reaction progress was monitored by ELSD & TLC. The solvent was evaporated under reduced pressure. Reaction mixture was diluted with water (100 mL) and extracted with DCM (2x 50 mL). Organic layer was dried over anhy. Sodium sulphate, filtered and concentrated under reduced pressure. The crude compound was purified over silica using 0-60% EtOAc in heptane to give dibenzyl 8, 8'-((5 -(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-hydroxyoctanoate) [INT 38] (4.72 g, yield 40.69%) as yellow oil.Results:EELSD analysis'. Purity 99.47 %, Calculated- C39H59NOs= 669.42, Observed = 670.30 (m / z, M+H+).dibenzyl 8, 8 ’-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-( (tert-butyldimethylsilyl)oxy)octanoate) [INT 39]To a stirred solution of starting material benzyl di benzyl 8,8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-hydroxyoctanoate) [INT 38] (4.72 g, 7.05 mmol) in dichloromethane (96.3 mL, 1.5 mol) were added IH-imidazole (9.59 g, 20 eq., 141 mmol)17281859815v2773158: SA9-886PC / / PAT25019-WO-PCTand tert-butyl(chloro)dimethylsilane (10.6 g, 10 eq.. 70.5 mmol) at 0 °C under inert atmosphere. The resultant reaction mass was allowed to stirred RT for 16h. Reaction progress was monitor with TLC. SM was consumed completely. The reaction was diluted water and extracted with DCM (2 x 50 ml). Combined organic layer was washed wdth brine and dried over sodium sulphate. Evaporated under reduced pressure. Crude compound was purified by column chromatography using silica gel. The compound was eluted in 7% EtOAc in heptane. The solvent was evaporated to get dibenzyl 8,8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-((tert-butyldimethylsilyl)oxy)octanoate) [INT 39] (6 g, yield 95 %) as colourless liquid.Results:EELSD analysis'. Purity 99.58 %, Calculated- CsiH87NOsSi2 = 897.60, Observed = 898.35 (m / z, M+H+).8,8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-((tert-butyldimethylsilyl)oxy)octanoic acid) [INT 40]OH TBDMSOJf OTBDMS OTo the stirred solution of dibenzyl 8,8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-((tertbutyldimethylsilyl)oxy)octanoate) [INT 39] (6 g, 6.68 mmol) in methanol (57.1 mL, 1.41 mol) & tetrahydrofuran (28.6 mL, 351 mmol) was added Palladium on carbon (10% w / w, 50% wet) (2.5 g, 23.5 mmol) under inert atmosphere. Reaction mass was degassed by vacuum, then EE gas balloon w as inserted into the RM. The reaction was stirred for 16h. TLC shows SM were consumed and formed new spot. Pd / C was filtered through celite carefully and washed with methanol (50 mL). The filtrate was evaporated and dried to get 8.8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-((tert-butyldimethylsilyl)oxy)octanoic acid) [INT 40] (4.2 g, yield 87.5%) as yellowish liquid.Results:EELSD analysis'. Purity 98.28 %, Calculated- C37H75NOsSi2 = 717.50, Observed = 718.30 (m / z, M+H+).17381859815v2773158: SA9-886PC / / PAT25019-WO-PCTdi((Z)-non-2-en-l-yl) 8,8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-((tert-To the stirred solution of 8,8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-((tert-butyldimethylsilyl)oxy)octanoic acid) [INT 40] (4.2 g, 5.85 mmol) in dichloromethane (0.1 L, 1.56 mol) were added 4-(dimethylamino)pyridin-l-ium (4.32 g, 6 eq., 35.1 mmol) and EDC. HC1 (3.36 g, 3 eq., 17.5 mmol) at room temperature. After 15 min, (2Z)-non-2-en-l-ol [INT 29] (1.66 g, 2 eq., 11.7 mmol) was added to the RM and reaction was allowed to stir for 16h. TLC shows SM was consumed and formed new non polar spot. The solvent was evaporated, and crude was purified by column chromatography using silica gel. The compound was eluted in 8% EtOAc in heptane. The solvent was evaporated to get di((Z)-non-2-en-l-yl) 8,8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-((tert-butyldimethylsilyl)oxy)octanoate) [INT 41] (5.2 g, yield 92%) as yellowish gel.Results:1H-NMR (400MHz, CDCh)- 85.66-5.60 (m, 2H), 5.54 -5.48 (m, 2H), 4.62-4.60 (d, J= 6.8 Hz, 4H), 3.59 (brs, 2H), 2.42-2.35 (m, 10H), 2.19 (t, J =7.6 Hz, 2H), 2.17-2.06 (m, 4H), 1.62 (m, 6H), 1.51 (s, 9H), 1.43-1.30 (m, 8H), 1.27-1.24 (m, 22H). 0.87 (t, J= 2.8 Hz, 24H), 0.02 (m. 12H).5-(bis(2-((tert-butyldimethylsilyl)oxy)-8-(((Z)-non-2-en-l-yl)oxy)-8-oxooctyl)amino)pentanoic acid [INT 42]To the stirred solution of di((Z)-non-2-en-l-yl) 8,8'-((5-(tert-butoxy)-5-oxopentyl)azanediyl)bis(7-((tert-butyldimethylsilyl)oxy)octanoate) [INT 41] (5.2 g, 5.38 mmol) in dichloromethane (86.7 mL, 1.35 mol), trifluoroacetic acid (3 mL) was added at 0°C dropwise. The reaction was allowed to stir at RT for 16h. TLC shows SM was consumed and17481859815v2773158: SA9-886PC / / PAT25019-WO-PCTformed new spots. The solvent was evaporated at 40°C and residue was basified using saturated NaHCO3 aq. solution (50 mL). The compound was extracted with diethyl ether (2 x 30 mL). The combined organic layer was dried with Na2SO4 and evaporated to get crude. The crude compound was purified by column chromatography using 0-3% methanol in DCM to afford 5-(bis(2-((tert-butyldimethylsilyl)oxy)-8-(((Z)-non-2-en-l-yl)oxy)-8-oxooctyl)amino)pentanoic acid [INT 42] (4.2 g. yield 86 %) as pale yellow liquid compound.Results:EELSD analysis'. Purity 89.15%, Calculated- C5iH99NOsSi2 = 909.69, Observed = 911.25 (m / z, M+H+).tetra((Z)-non-2-en-l-yl) 8,8',8",8"'-((( ((4-methylmorpholine-2, 6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7-((tert-butyldimethylsilyl)oxy)octanoate) [INT 43a]o To a stirred solution of starting material 5-(bis(2-((tert-butyldimethylsilyl)oxy)-8-(((Z)-non-2-en-l-yl)oxy)-8-oxooctyl)amino)pentanoic acid [INT 42] (904 mg, 2 eq., 993 pmol) in dichloromethane (8 mL, 125 mmol), were added N, N-dimethyl-4-pyridylamine (291 mg, 4.8 eq.. 2.38 mmol) and 2-methyl-2.6.8-triaza-6,7-decadiene — hydrogen chloride (1 / 1) (228 mg.2.4 eq., 1.19 mmol) at 0 °C, after 15 min (4-methylmorphohne-2,6-diyl)dimethanol [INT 17a] (80 mg, 496 pmol) was also added at RT under inert atmosphere and resultant reaction mass was allowed to stirred at RT for 16h. Reaction progress was monitor by ELSD. SM was consumed completely. Reaction mass was evaporated under reduced pressure to afford crude which was purified by column chromatography using 3-5% EtOAc in Heptane. The solvent was evaporated to get tetra((Z)-non-2-en- 1 -yl) 8,8',8",8"'-(((((4-methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7-((tert-butyldimethylsilyl)oxy)octanoate) [INT 43a] (730 mg, yield 75.5 %) as yellowish liquid. Results:EELSD analysis'. Purity 99.50 %, Calculated- C109H209N3O17S14 = 1944.47, Observed = 1945.90 (m / z, M+H+).17581859815v2773158: SA9-886PC / / PAT25019-WO-PCTtetra((Z)-non-2-en-l-yl) 8,8',8",8'"-((( ((4-methylmorpholine-2, 6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7-hydroxyoctanoate) (Compound 6, meso form)oo To a solution of tetra((Z)-non-2-en-l-yl) 8,8'.8",8'"-(((((4-methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7-((tert-butyldimethylsilyl)oxy)octanoate) [INT 43a] (0.4 g, 206 umol) in tetrahydrofuran (10 mL, 123 mmol), was added hydrogen fluoride — pyridine (1 / 1) (2.5 mL) drop wise at 0°C, then stirred at room temperature for 16h. Reaction monitor by ELSD analysis, after completion of reaction, reaction mixture was diluted with Et20 (20 mL), washed with cold water and brine solution. The organic layer was basified with aq. NaHCO3(pH=8-9) and again washed with water. Organic layer was dried over sodium sulphate and was evaporated to dryness. Crude compound was purified on silica gel column using 3% MeOH-DCM to get tetra((Z)-non-2-en-l-yl) 8,8,.8",8'"-(((((4-methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7-hydroxyoctanoate) [Compound 6, meso form] (208 mg, yield 68 %) as light yellow liquid.Results:1H-NMR (400MHz, CDCh)- 65.67-5.60 (m, 4H), 5.54-5.47 (m, 4H), 4.62-4.60 (d, J= 6.8 Hz, 8H), 4.15 - 3.97 (m, 10 H), 3.10-2.76 (m, 14H), 2.43-2.37 (m, 6H), 2.30 (1, J= 7.2 Hz, 8H), 2.11-2.06 (dd, J= 7.2 Hz, 8H), 1.92-1.58 (m, 19H), 1.51-1.26 (m, 60H), 0.87 (t, J= 7.2 Hz, 12H).ELSD analysis: Purity 99.35 %, Calculated- C85H153N3O17 = 1488.12, Observed = 1488.70 (m / z. M+H+).Example 12: Synthesis of tetra((Z)-non-2-en-l-yl) 8,8,,8",8,”-(((((4-methylmorpholine- 2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7-hydroxyoctanoate) (Compound 6, (R, R) or (S, S) form)17681859815v2773158: SA9-886PC / / PAT25019-WO-PCTSynthetic ProtocolThe (R, R) or (S, S) form of Compound 6 w as prepared using the same synthetic protocol as for the meso form of Compound 6 in Example 11. with the exception that the (R,R) or (S, S) form of [INT 17] was used.tetra((Z)-non-2-en-l-yl) 8,8',8",8'"-((( ((4-methylmorpholine-2, 6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7-((tert-butyldimethylsilyl)oxy)octanoate) [INT 43b]To a stirred solution of starting material 5-(bis(2-((tert-butyldimethylsilyl)oxy)-8-(((Z)-non-2-en-l-yl)oxy)-8-oxooctyl)amino)pentanoic acid [INT 42] (1.02 g, 2 eq., 1.12 mmol) in dichloromethane (9 mL, 141 mmol) were added N, N-dimethyl-4-pyridylamine (327 mg, 4.8 eq., 2.68 mmol) and 2-methyl-2,6,8-triaza-6,7-decadiene — hydrogen chloride (1 / 1) (257 mg, 2.4 eq.. 1.34 mmol) were added, to which (4-methylmorpholine-2,6-diyl)dimethanol [INT 17b] (90 mg, 558 pmol) was also added at RT under inert atmosphere and resultant reaction mass was allowed to stirred at RT for 16h. After 16h reaction progress was monitor by ELSD. SM was consumed completely. Reaction mass was evaporated under reduced pressure to afford crude which was purified by column chromatography using 3-5% EtOAc in Heptane. The solvent was evaporated to get tetra((Z)-non-2-en-l-yl) 8,8',8",8"’-(((((4-methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7-((tert-butyldimethylsilyl)oxy)octanoate) [INT 43b] (760 mg, 391 pmol) as yellowish liquid.EELSD analysis'. Purity 99.69 %, Calculated- CiosTLogNsOnSii = 1944.47, Observed = 1944.90 (m / z, M+H+).17781859815v2773158: SA9-886PC / / PAT25019-WO-PCTtetra((Z)-non-2-en-l-yl) 8,8',8",8'"-((( ((4-methylmorpholine-2, 6- diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7- hydroxyoctanoate) (Compound 6, (R, R) or (S, S) form)HO q,', N " N y OH L OHHoqTo a solution of tetra((Z)-non-2-en-l-yl) 8,8'.8",8'"-(((((4-methylmorpholine-2,6- diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetrakis(7-((tert- butyldimethylsilyl)oxy)octanoate) [INT 43b] (0.4 g, 206 pmol) in tetrahydrofuran (10 mL, 123 mmol), add hydrogen fluoride — pyridine (1 / 1) (2.5 mL) drop wise at 0°C, stirred at room temperature for 16h. After completion of reaction, reaction mixture was diluted with Et20 (20 mL), washed with cold water and brine solution. The organic layer was basified with TEA up to 8-9 pH and again washed with cold brine solution Organic layer was dried over sodium sulphate and was evaporated to dryness. Crude compound was column purified at 3% MeOH- DCM to get tetra((Z)-non-2-en-l-yl) 8,8',8",8'"-(((((4-methylmorpholine-2,6- diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5.1-diyl))bis(azanetriyl))tetrakis(7- hydroxy octanoate) [Compound 6, (R, R) or (S, S) form] (210 mg, 141 pmol) as light yellow liquid.1H-NMR (400MHz, CDCh)- 55.66-5.60 (m, 4H), 5.54-5.47 (m, 4H), 4.62-4.60 (d, J= 6.8 Hz. 8H), 4.48-4.43 (m. 2H), 4.05-4.02 (m. 8H), 3.08-2.70 (m. 12H), 2.47 -2.40 (m. 6H), 2.30 (t, J= 7.2 Hz, 8H), 2.23 (s, 6H), 2.11-2.06 (dd, J= 7.2 Hz, 8H), 1.88-1.86 (m, 4H), 1.71-1.58 (m, 8H), 1.51-1.26 (m, 60H), 0.87 (t, J= 7.2 Hz, 12H).EELSD analysis'. Purity 99.26 %, Calculated- C85H153N3O17 = 1488.12, Observed = 1488.65 (m / z, M+H+).Example 13: Synthesis of tetra((Z)-non-2-en-l-yl) 8,8,,8,,,8,,,-(((((4-methylmorpholine- 2,6-divDbis(methylene))bis(oxy))bis(5-oxopentane-5,l- diyl))bis(azanetriyl))tetraoctanoate (Compound 7, (R, S) or (S, R) form)Synthetic Protocol17881859815v2773158: SA9-886PC / / PAT25019-WO-PCTheptadecan-9-yl 8-bromooctanoate [INT 46]To a stirred solution of 8-bromooctanoic acid [INT 44] (15 g. 67.2 mmol) in DCM (0.2 L) were added 4-(dimethylamino)pyridin-l-ium (2.07 g, 16.8 mmol) & EDC. HC1 (16.2 g, 84.7 mmol) portion wise at 0°C and stirred for 15 min then heptadecan-9-ol [INT 45] (17.2 g, 67.2 mmol) was added at 0°C. The reaction mixture was allowed to stir at rt for 16h. The progress of reaction was monitored by TLC. After completion of reaction, mixture was quenched with water (200.0 mL) & extracted by DCM (2x 200.0 mL). The organic layer dried anhydrous sodium sulphate and concentrated under reduced pressure. The crude was purified by flash column chromatography (0 to 10 % Ethyl acetate: Heptane) to afford heptadecan-9-yl 8- bromooctanoate [INT 46] (21 g, yield 67%) as a colourless liquid.Results:17981859815v2773158: SA9-886PC / / PAT25019-WO-PCT1H-NMR (400MHz, CDCh)- 84.89-4.83 (m, 1H), 3.41-3.38 (t, J=7.2Hz, 2H), 2.29-2.26 (t, J=7.2Hz. 2H), 1.88-1.81 (m. 2H), 1.68-1.56 (m. 2H), 1.56-1.45(m, 4H), 1.44-1.39 (m, 2H), 1.38-1.31 (m, 4H), 1.32-1.20 (m, 24H), 0.87 (t, J=6.4 Hz, 6H).undecyl 6-bromohexanoate [INT 49]OTo a stirred solution of 6-bromohexanoic acid [INT 47] (20 g, 103 mmol) in DCM (250 mL), were added 4-(dimethylamino)pyridin-l-ium (3.16 g, 25.6 mmol) and ({[3-(dimethylamino)propyl]imino}methylidene)(ethyl)amine (20.1 g, 129 mmol) portion wise at 0°C and stirred for 15 min then undecan-l-ol [INT 48] (17.7 g. 103 mmol) was added at 0°C under nitrogen atmosphere. The reaction mixture was stirred rt for 16h. The progress of reaction was monitored by TLC. After completion, reaction mixture was quenched with water (200.0 mL) & extracted by DCM (2x 200.0 mL). The organic layer dried anhydrous sodium sulphate and concentrated under reduced pressure. The crude was purified by flash column chromatography (0 to 10 % EA: Heptane) to afford undecyl 6-bromohexanoate [INT 49] (27 g, yield 75%) as a colourless liquid.Results:ELSD analysis: Purity 99.8 %, Calculated- Ci7H3? BrO2= 348.17, Observed = 349.15 & 351.15 (m / z, M+H+) with bromo-pattem.undecyl 6-((4-(tert-butoxy)-4-oxobutyl)amino)hexanoate [INT 51]To a stirred solution of tert-butyl 4-aminobutanoate hydrochloride [INT 50] (2 g, 10.2 mmol) and K2CO3 (4.24 g, 30.7 mmol) in dimethylformamide (20 mL), was added undecyl 6-bromohexanoate [INT 49] (3.57 g, 10.2 mmol). The reaction mixture was stirred at RT and 16h. The progress of reaction was monitored by TLC. After completion of reaction mixture quenched water (50.0 mL) & extracted by ethyl acetate (2x 50.0 mL). The organic layer was dried over anhydrous sodium sulphate and concentrated under reduced pressure. The crude was purified by flash silica gel column chromatography (0 to 10 % MeOH DCM) to afford undecyl 6-((4-(tert-butoxy)-4-oxobutyl)amino)hexanoate [INT 51] (1.8 g, yield 41%) as pale yellow liquid.Results:18081859815v2773158: SA9-886PC / / PAT25019-WO-PCTELSD analysis: Purity 64 %, Calculated- C2sH49NO4= 427.37, Observed = 428.40 (m / z, M+H+)heptadecan-9-yl 8-((4-(tert-butoxy)-4-oxobutyl)(6-oxo-6- (undecyloxy)hexyl)anuno)octanoate [INT 52]OTo a stirred solution of undecyl 6-((4-(tert-butoxy)-4-oxobutyl)amino)hexanoate [INT 51] (1.2 g, 2.81 mmol) in dimethylformamide (18.8 mL), K2CO3 (1.94 g, 14 mmol), and heptadecan-9-yl 8-bromooctanoate [INT 46] (1.55 g, 3.37 mmol) were added at room temperature. The reaction mixture was heated at 60°C for 16h. The progress of reaction was monitored by TLC & ELSD. After completion, the reaction mixture was filtered through celite & washed by ethyl acetate (50.0 mL). The filtrate was concentrate under vacuum. The crude was purified by column chromatography (10-40% ethylacetate-Hexane) to afford heptadecan-9-yl 8-((4-(tert-butoxy)-4-oxobutyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate [INT 52] (1.3 g, yield 57%) as colourless liquid.Results:LCMS analysis: Purity 84.9 %, Calculated- C50H97NO6= 807.73, Observed = 808.55 (m / z, M+H+).4-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)butanoic acid [INT 53]OTo the stirred solution of heptadecan-9-yl 8-((4-(tert-butoxy)-4-oxobutyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate [INT 52] (2.5 g. 3.04 mmol) in DCM (30 mL) was added trifluoroacetic acid (5 mL) at 0°C dropwise. The reaction was allowed to stir at RT for 16h. TLC shows SM was consumed and formed new spots. The solvent was evaporated from reaction mass at 40°C and residue was basified using saturated aq. NaHCO3solution (50 mL). The compound was extracted with diethyl ether (2 x 30 mL). The combined organic 18181859815v2773158: SA9-886PC / / PAT25019-WO-PCTlayer was dried with Na2SO4 and evaporated under reduced pressure. The crude compound was purified by silica gel column chromatography to afford 4-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)butanoic acid [INT 53] (2.06 g, yield 88%) as pale yellow liquid compound.Results:LCMS analysis Purity 99.8 %, Calculated Formula: C46H89NO6 = 751.67, Observed = 752.70 (m / z, M+H+).undecyl 6-((5-(tert-butoxy)-5-oxopentyl)amino)hexanoate [INT 54]HNTo a stirred solution of tert-butyl 5-aminopentanoate [INT 28] (4 g, 23.1 mmol) in acetonitrile (100 mL) and K2CO3 (9.57 g, 69.3 mmol), was added on RT and then undecyl 6-bromohexanoate [INT 49] (8.07 g, 23.1 mmol). The reaction mixture was stirred at RT and 16h. The progress of reaction was monitored by TLC. After completion, reaction mixture was quenched with water (100.0 mL) & extracted by ethyl acetate (2x 100.0 mL). The organic layer dried over anhydrous sodium sulphate and concentrated under reduced vacuum. The crude was purified by flash silica gel column chromatography (0 to 10 % MeOH DCM) to afford undecyl 6-((5-(tert-butoxy)-5-oxopentyl)amino)hexanoate [INT 54] (3.0 g, yield 29%) as pale yellow liquid.Results:LCMS analysis: Purity 98.85%, Calculated- C26H51NO4= 441.38, Observed = 442.30 (m / z. M+H+).heptadecan-9-yl 8-((5-(tert-butoxy)-5-oxopentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate [INT 55]NTo the solution of heptadecan-9-yl 8-bromooctanoate [INT 46] (3.39 g, 7.34 mmol) and undecyl 6-((5-(tert-butoxy)-5-oxopentyl)amino)hexanoate [INT 54] (2.7 g, 6.11 mmol) in18281859815v2773158: SA9-886PC / / PAT25019-WO-PCTdimethylformamide (30 mL) was added dipotassium carbonate (4.22 g, 30.6 mmol) at room temperature then allowed to stir at 90 °C for 16 h. Progress of reaction was monitored by TLC. Reaction mixture was filtered through celite bed to remove solid K.2CO3. Filtrate was diluted with cold water (100.0 mL) and extracted with EtOAc (3x 100.0 mL). Combined organic layer was washed with fresh water twice, dried over anhy. sodium sulphate, filtered and concentrated. Crude was purified by flash chromatography on silica gel column using 0-1 % gradient of MeOH in DCM to afford heptadecan-9-yl 8-((5-(tert-butoxy)-5-oxopentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate [INT 55] (2.5 g, yield=50%) as pale yellow liquid.Results:LCMS analysis: Purity 99.9 %, Calculated- C51H99NO6 = 821.75. Observed = 822.55 (m / z, M+H+).5-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)pentanoic acid [INT 56]To the stirred solution of heptadecan-9-yl 8-((5-(tert-butoxy)-5-oxopentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate [INT 55] (2.5 g, 3.04 mmol) in DCM (30 mL) was added trifluoroacetic acid (5 mL) at 0°C dropwise. The reaction was allowed to stir at RT for 16h. TLC shows SM was consumed and formed new spots. The solvent was evaporated at 40°C and residue was basified using saturated NaHCO3aq solution (50 mL). The compound was extracted with diethyl ether (2 x 30 mL). The combined organic layer was dried with Na2SO4 and evaporated to get crude. The crude compound was purified by column chromatography to afford 5-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)pentanoic acid [INT 56] (2.06 g, yield=88%) as pale yellow liquid compound.Results:LCMS analysis: Purity 99.9 %, Calculated- C47H91NO6 = 765.68, Observed = 766.50 (m / z, M+H+).18381859815v2773158: SA9-886PC / / PAT25019-WO-PCTheptadecan-9-yl 8-((5-((6-(hydroxymethyl)-4-methylmorpholin-2-yl)methoxy)-5- oxopentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate [INT 57a]ooTo a stirred solution of starting material 5-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6- (undecyloxy)hexyl)amino)pentanoic acid [INT 56] (951 mg, 1.24 mmol) in DCM (10 ml), were added DMAP (97.5 mg, 2.4 eq., 0.792 mmol) and EDC.HCl (75.9 mg, 0.396 mmol), to which (4-methylmorpholine-2,6-diyl)dimethanol [INT 17a] (0.2 g, 1.24 mmol) was also added at RT under inert atmosphere and was allowed to stir at RT for 16h. After 16h reaction progress was monitored by ELSD & TLC, which showed SM was consumed. The crude was purified over silica 2-5% MeOH in DCM to give heptadecan-9-yl 8-((5-((6-(hydroxymethyl)- 4-methylmorpholin-2-yl)methoxy)-5-oxopentyl)(6-oxo-6- (undecyloxy)hexyl)amino)octanoate [INT 57a] (0.3 g, yield 26%) as yellow oil.Results:LCMS analysis: Purity 99.16 %, Calculated- C54H104N2O8 = 908.78, Observed = 909.55 (m / z, M+H+).heptadecan-9-yl 8-((5-((6-(((4-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6- (undecyloxy)hexyl)amino)butanoyl)oxy)methyl)-4-methylmorpholin-2-yl)methoxy)-5- oxopentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate (Compound 7, (R, S) or (S, R) form)To a stirred solution of 4-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6- (undecyloxy)hexyl)amino)butanoic acid [INT 53] (248 mg, 0.330 mmol) in dichloromethane (10 mL), were added DMAP (97.5 mg, 0.792 mmol) and EDC.HCl (75.9 mg, 0.396 mmol) at room temperature. After 10 min heptadecan-9-yl 8-((5-((6-(hydroxymethyl)-4- methylmorpholin-2-yl)methoxy)-5-oxopentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate [INT 57a] (0.3 g, 0.330 mmol) was also added at RT under inert atmosphere and was allowed to stir at RT for 16h. After 16h reaction progress was monitored by ELSD & TLC,18481859815v2773158: SA9-886PC / / PAT25019-WO-PCTwhich showed SM was consumed. Reaction mass was evaporated under reduced pressure to afford crude. Reaction mass was extracted with pentane (20 mL) and washed with ACN (2 x 3 mL). Pentane layer was evaporated under reduced pressure to give desired product heptadecan-9-yl 8-((5-((6-(((4-((8-(heptadecan-9-yloxy)-8-oxooctyl)(6-oxo-6-(undecyloxy)hexyl)amino)butanoyl)oxy)methyl)-4-methylmorpholin-2-yl)methoxy)-5-oxopentyl)(6-oxo-6-(undecyloxy)hexyl)amino)octanoate [Compound 7, (R, S) or (S, R) form] (137 mg, yield 25%) as yellowish oil.Results:1H-NMR (400MHz, CDCl3)- δ4.87-4.84 (m, 2H), 4.16-4.12 (m, 2H), 4.06-4.03 (m, 6H), 3.83-3.79 (m, 2H), 2.74-2.72 (m, 2H), 2.45-2.30 (m, 14H), 2.29-2.25 (m, 9H), 1.85-1.79 (t, J=11Hz, 2H), 1.76-1.71 (m, 2H), 1.69-1.55 (m, 22H). 1.54-1.43 (m, 8H). 1.42-1.35 (m, 8H). 1.34-1.20 (m, 94H), 0.87 (t, J=6.4 Hz, 18H).ELSD analysis: Purity 99.34 %, Calculated C100H191N3O13 = 1642.44, Observed = 1642.90 (m / z, M+H+).Example 14: Synthesis of tetra((Z)-non-2-en-l-yl) 8,8',8'',8'''-(((((4-methylmorpholine- 2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetraoctanoate (Compound 8, (R, S) or (S, R) form). OH OHOH HO Synthetic Protocol18581859815v2773158: SA9-886PC / / PAT25019-WO-PCToct- 7-enoic acid [INT 59]To a suspension of 8-bromooctanoic acid [INT 58] (120 g, 538 mmol) in tetrahydrofuran (2.4 L), was added (tert-butoxy)potassium (241 g, 2.15 mol) and stir at 90 °C for 16 h. The progress of reaction was monitor by TLC (SM was consumed completely). Reaction mass18681859815v2773158: SA9-886PC / / PAT25019-WO-PCTwas diluted with EtOAc (2 L), make pH 3-4 of reaction mass with IN HC1 and extracted. The organic layer was combined, dried over sodium sulphate, and concentrated under reduce pressure to obtained crude product, which was purified by flash column chromatography silica (0-20 % EtOAc in hexane) to afford oct-7-enoic acid [INT 59] (70 g, 91.53% yield) as pale-yellow liquid.Result:¹H NMR (400 MHz, CDCl3): δ5.85-5.75 (m, 1H), 5.02-4.93 (m, 2H), 2.37-2.33 (t, J = 7.6 Hz, 2H), 2.10-2.03 (m, 2H), 1.68-1.60 (m, 2H), 1.47-1.33 (m, 4H) ppm.heptadecan-9-yl oct-7-enoate [INT 61]To a stirred solution of oct-7-enoic acid [INT 59] (50 g, 352 mmol), in dichloromethane (IL), added EDC.HCl (84.3 g, 440 mmol), and 4-(dimethylamino)pyridin-1-ium (10.8 g, 87.9 mmol) at room temperature. After this heptadecan-9-ol [INT 60] (81.2 g, 316 mmol) was added in reaction mixture, allow to stir for 16 h. The reaction was monitored by TLC, after completion the reaction, reaction mixture was diluted with DCM and washed wi th brine solution. The organic layers were combined, dried over sodium sulphate, concentrated under reduced pressure to get crude and crude used for column chromatography silica (0-10 % EtOAc in hexane) to afford heptadecan-9-yl oct-7-enoate [INT 61] (100 g, 74.71% yield) as a colourless liquid.Result:¹H NMR (400 MHz, CDCl3): δ5.85-5.74 (m, 1H), 5.01-4.83 (m, 3H), 2.30-2.26 (t, J= 7.6 Hz, 2H), 2.07-2.02 (q, J = 6.8, 2H), 1.67-1.58 (m, 2H), 1.51-1.49 (m, 4H), 1.42-1.25 (m, 28H), 0.89-0.86 (t, J= 6.8 Hz, 6H) ppm.heptadecan-9-yl 6-(oxiran-2-yl)hexanoate [INT 62]To a stirred solution of heptadecan-9-yl oct-7-enoate [INT 61] (100 g, 263 mmol) in di chloromethane (1 L), was added 3-chlorobenzene-l-carboperoxoic acid (90.7 g, 525 mmol) at room temperature for 16 h. The progress of reaction was monitored by TLC. Reaction mass was filtered through sintered funnel, followed by washing with pentane (3 - 4 times).18781859815v2773158: SA9-886PC / / PAT25019-WO-PCTThe heptane layer was distilled and then treated with saturated aqueous solution of sodium bicarbonate (500 mL) and extracted with dichloromethane (2x1 L). Combined organic layer was dried over anhydrous sodium sulphate, filtered and concentrated under reduced pressure to get crude. The crude was purified by flash column chromatography (0-10% ethyl acetate in hexane) to offered heptadecan-9-yl 6-(oxiran-2-yl)hexanoate [INT 62] (80 g, 76.77 Yield) as a colourless liquid.Result:¹H NMR (400 MHz, CDCl3): δ4.90-4.83 (m, 1H), 2.92-2.88 (m, 1H), 2.75-2.73 (t, J = 4.4, 1H), 2.47-2.45 (m, 1H), 2.31-2.27 (t, J = 7.6 Hz, 2H), 1.68-1.60 (m, 2H), 1.53-1.45 (m, 6H), 1.43-1.34 (m, 2H), 1.29-1.26 (m, 24H), 0.89-0.86 (t, J= 6.8 Hz, 6H) ppm.undecyl hex-5-enoate [INT 65]OTo a stirred solution of hex-5-enoic acid [INT 63] (5 g, 43.8 mmol), in di chloromethane (100 mL), added EDC.HCl (10.5 g, 54.8 mmol), and 4-(dimethylamino)pyridin-1-ium (1.35 g, 11 mmol) at room temperature. After this undecan- l-ol [INT 64] (7.55 g, 43.8 mmol) was added in reaction mixture, allow to stir for 16 h. The reaction was monitored by TLC, after completion the reaction, reaction mixture was diluted with DCM and washed with brine solution. The organic layers were combined, dried over sodium sulphate, concentrated under reduced pressure to get crude and crude used for column chromatography silica (0-10 % EtOAc in hexane) to afford undecyl hex-5-enoate [INT 65] (100 g, 74.71 % Yield) as a colourless liquid.Result:¹H NMR (400 MHz, CDCl3): δ5.81-5.75 (m, 1H), 5.05-4.97 (m, 2H), 4.07-4.04 (t, J = 6.4 Hz, 2H), 2.33-2.29 (t, J= 7.6 Hz, 2H), 2.11-2.06 (m, 2H), 1.76-1.71 (m, 2H), 1.63-1.58 (m, 4H), 1.34-1.26 (m, 14H), 0.89-0.86 (t, J= 6.8 Hz, 3H) ppm.undecyl 4-(oxiran-2-yl)butanoate [INT 66]To a stirred solution of undecyl hex-5-enoate [INT 65] (11.5 g, 42.8 mmol) in dichloromethane (120 mL), was added 3 -chlorobenzene- 1 -carboperoxoic acid (11.1 g, 64.3 mmol) at room temperature for 16 h. The progress of reaction was monitored by TLC.18881859815v2773158: SA9-886PC / / PAT25019-WO-PCTReaction mass was filtered through sintered funnel, followed by washing with pentane (3 - 4 times). The heptane layer was distilled and then treated with saturated aqueous solution of sodium bicarbonate (100 rnL) and extracted with di chloromethane (2x300 mL). Combined organic layer was dried over anhydrous sodium sulphate, filtered, and concentrated under reduced pressure to get crude. The crude was purified by flash column chromatography (0- 10% Ethyl acetate in Hexane) to offered undecyl 4-(oxiran-2-yl)butanoate [INT 66] (8 g, 65.65 yield) as a colourless liquid.Result:¹H NMR (400 MHz, CDCl3): δ4.08-4.05 (t, J= 6.4 Hz, 2H), 2.92 (m, 1H), 2.76-2.74 (t, J = 4.4, 1H), 2.48-2.46 (m, 1H), 2.39-2.35 (m, 2H), 1.82-1.78 (m, 2H), 1.65-1.56 (m, 4H), 1.30-1.26 (m, 18H), 0.89-0.86 (t, J= 6.8 Hz, 3H) ppm.undecyl 6-((4-(tert-butoxy)-4-oxobutyl)amino)-5-hydroxyhexanoate [INT 67]O OHHOTo a stirred solution of tert-butyl 4-aminobutanoate [INT 50] (7.5 g, 47.1 mmol) and undecyl 4-(oxiran-2-yl)butanoate [INT 66] (13.4 g, 47.1 mmol) in IPA (200 mL) at room temperature. The ethylbis(propan-2-yl)amine (25.2 mL, 141 mmol) was added dropwise. The reaction mixture was stirred at RT for 48 h. The progress of reaction was monitored by TLC / ELSD, after completion of reaction, mixture was concentrated under reduced pressure, the crude was purified by flash column chromatography (0-6% MeOH: DCM) to afford undecyl 6-((4-(tert-butoxy)-4-oxobutyl)amino)-5-hydroxyhexanoate [INT 67] (5 g, 24 % yield) as a light yellow liquid.Result:ELSD analysis: Purity 99.64 %, Calculated C25H49NO5 = 443.36, Observed = 444.55 (m / z, M+H+).heptadecan-9-yl 8-((4-(tert-butoxy)-4-oxobutyl)(2-hydroxy-6-oxo-6- (undecyloxy)hexyl)amino)-7-hydroxyoctanoate [INT 68]18981859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo a stirred solution of undecyl 6-((4-(tert-butoxy)-4-oxobutyl)amino)-5-hydroxyhexanoate [INT 67] (16.8 g, 37.9 mmol) and heptadecan-9-yl 6-(oxiran-2-yl)hexanoate [INT 62] (15 g, 37.9 mmol) in IPA (200 mL). The reaction mixture was heated at 90 °C for 16 h, the progress of reaction was monitored by TLC / ELSD, after completion of reaction mixture concentrated under reduced pressure to get crude. The crude was purified by flash column chromatography (0-5% MeOH:DCM) to offered heptadecan-9-yl 8-((4-(tert-butoxy)-4-oxobutyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)-7-hydroxyoctanoate [INT 68] (10 g, 31.4 % yield) as a light yellow liquid.Result:ELSD analysis: Purity 99.89%, Calculated C50H97NO8= 839.72, Observed = 840.55 (m / z, M+H+).heptadecan-9-yl 8-((4-(tert-butoxy)-4-oxobutyl)(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)anuno)- 7-((tert-butyldimethylsilyl)oxy)octanoate [INT 69]To a stirred solution of heptad ecan-9-yl 8-((4-(tert-butoxy)-4-oxobutyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)-7-hydroxyoctanoate [INT 68] (10 g, 11.9 mmol) in DCM (200 mL). The 1H-imidazole (16.2 g, 238 mmol) and tert-butyl(chloro)dimethylsilane (17.9 g, 119 mmol) were added portion wise. The reaction mixture was stirred rt for 16h. The progress of reaction was monitored by TLC / ELSD. After completion of reaction, mixture was quenched by water and extracted by DCM, the organic layer was collected, dried over anhydrous sodium sulphate, concentrated under reduced pressure to get. The crude was purified by flash column chromatography (0-10% Ethyl acetate: Hexane) to offered heptadecan-9-yl 8-((4-(tert-butoxy)-4-oxobutyl)(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)amino)-7-((tert-butyldimethylsilyl)oxy)octanoate [INT 69] (11g, 86.48 % yield) as a colourless liquid.Result:ELSD analysis: Purity 99.86 %, Calculated C62H125NO8Si2= 1067.89, Observed = 1069.90 (m / z. M+H+).19081859815v2773158: SA9-886PC / / PAT25019-WO-PCT4-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)butanoic acid [INT 70]To a stirred solution of heptadecan-9-yl 8-((4-(tert-butoxy)-4-oxobutyl)(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)amino)-7-((tert-butyldimethylsilyl)oxy)octanoate [INT 70] (7 g, 6.55 mmol) in dichloromethane (100 mL.1.56 mol) trifluoroacetic acid (7.47 g, 65.5 mmol) was added dropwise at 0°C. The reaction mixture was stirred rt for 5 h. The progress of reaction was monitored by TLC / ELSD, after completion of reaction mixture quenched by saturated aq. solution of sodium bicarbonate and extracted by DCM. the organic layer dried over anhydrous sodium sulphate, concentrated under reduced pressure to get crude. The crude of 4-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)butanoic acid [INT 70] (6.5 g, crude) as a light yellow liquid was used for next step.Result:ELSD analysis: Purity 99.54%, Calculated C58H117NO8Si2=1011.83, Observed = 1013.00 (m / z, M+H+).heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert-butyldimethylsilyl)o^)-6-oxo- 6-(undecyloxy)hexyl)(4-((6-(hydroxymethyl)-4-methylmorpholin-2-yl)methoxy)-4-To a stirred solution of starting material 4-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)butanoic acid [INT 70] (0.8 g, 794 pmol) in dichloromethane (12.8 mL, 0.2 mol), DMAP (233 mg, 2.4 eq., 1.91 mmol) and EDC. HC1 (0.183 g, 1.2 eq., 953 pmol) was added, to which (4-methylmorpholine-2,6-diyl)dimethanol [INT 17a] (128 mg, 794 pmol) was also added at RT under inert atmosphere and was allowed to stir at RT. After 16h 19181859815v2773158: SA9-886PC / / PAT25019-WO-PCTreaction progress was monitored by ELSD & TLC, which showed SM was consumed.Reaction mass was evaporated under reduced pressure to afford crude. Crude was purified with silica gel flash chromatography using 2-5% MeOH in dichloromethane as gradient elute to afford desired product heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert- butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy )hexyl)(4-((6-(hydroxymethyl)-4- methylmorpholin-2-yl)methoxy)-4-oxobutyl)amino)octanoate [INT 71a] (0.29 g, 31.9 % yield ).Result:ELSD analysis: Purity 99.60 %, Calculated: C65H130N2O10Si2= 1154.93, Observed = 1155.90 (m / z, M+H+).undecyl 6-((5-(tert-butoxy)-5-oxopentyl)amino)-5-hydroxyhexanoate [INT 72]To the stirred solution of undecyl 4-(oxiran-2-yl)butanoate [INT 66] (7.9 g, 27.7 mmol) in isopropanol (100 mL, 951 mmol), tert-butyl 5-aminopentanoate [INT 28] (4.8 g, 27.7 mmol) was added at RT. The reaction mixture was stirred for 72 h, at RT. Progress of reaction was monitor by TLC. Then solvent was evaporated to get crude compound. The crude compound was purified by column chromatography using silica gel and 0-5 % MeOH in DCM as eluent to afford undecyl 6-((5-(tert-butoxy)-5-oxopentyl)amino)-5-hydroxyhexanoate [INT 72] (8.7g, 69.04% yield) as yellowish viscous oil.Results:ELSD analysis: Purity 94.21 %, Calculated C26H51NO5 = 457.38, Observed = 458.30 (m / z, M+H+).heptadecan-9-yl 8-((5-(tert-butoxy)-5-oxopentyl)(2-hydroxy-6-oxo-6- (undecyloxy)hexyl)amino)-7-hydroxyoctanoate [INT 73]19281859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo the stirred solution of undecyl 6-((5-(tert-butoxy)-5-oxopentyl)amino)-5-hydroxyhexanoate [INT 72] (6.0 g, 13.1 mmol) in isopropanol (60 mL. 438 mmol) was added heptadecan-9-yl 6-(oxiran-2-yl)hexanoate [INT 62] (5.7 g, 13.1 mmol) at RT. The reaction mixture was stirred for 16 h 90 °C. Progress of reaction was monitor by TLC. Then solvent w as evaporated to get crude compound. The crude compound w as purified by column chromatography using silica gel and 0-40 % ethyl acetate in heptane as eluent to afford heptadecan-9-yl 8-((5-(tert-butoxy)-5-oxopentyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)-7-hydroxyoctanoate [INT 73] (6.0 g, 53.57 % yield) as yellowish viscous oil.Result:ELSD analysis: Purity 95.94 %, Calculated C51H99NO8= 853.74, Observed = 855.0 (m / z, M+H+).heptadecan-9-yl 8-((5-(tert-butoxy)-5-oxopentyl)(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)amino)- 7-((tert-butyldimethylsilyl)oxy)octanoate [INT 74]OTBDMSNOTBDMS OTo a stir solution of heptadecan-9-yl 8-((5-(tert-butoxy)-5-oxopentyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)-7-hydroxyoctanoate [INT 73] (4.0 g, 46.7 mmol) in dichloromethane (40 mL, 63.2 mol). 1H-imidazole (3.19 g, 46.7 mmol) and tert-butyl(chloro)dimethylsilane (6.18 g. 235.5 mmol) were added under inert atmosphere. The reaction mixture was stirred at RT for 16h. Progress of reaction was monitor by TLC.Reaction mixture was diluted with DCM (500.0 mL) and washed with cold water (2x 100 mL). Organic layer was dried over sodium sulphate, filtered and evaporated under reduced pressure to gives crude reaction mass. Crude was purified over silica gel flash column chromatography (30% EtOAc in Hexane) to afford heptadecan-9-yl 8-((5-(tert-butoxy)-5-oxopentyl)(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)amino)-7-((tert-butyldimethylsilyl)oxy)octanoate [INT 74] (4.0 g, 78.9 % yield) as colourless liquid.Result:ELSD analysis: Purity 99.66 %, Calculated C63H127NO8Si2= 1081.91, Observed = 1082.65 (m / z, M+H+).19381859815v2773158: SA9-886PC / / PAT25019-WO-PCT5-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)pentanoic acid [INT 75]OTBDMS 0 To a stirred solution of heptadecan-9-yl 8-((5-(tert-butoxy)-5-oxopentyl)(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)amino)-7-((tert-butyldimethylsilyl)oxy)octanoate [INT 75] (3 g, 2.77 mmol) in dichloromethane (30 mL), was added trifluoroacetic acid (2.1 mL, 27.7 mmol) dropwise wise under inert atmosphere. Reaction mixture was stirred at room temperature for 4 h. After, completion of reaction, reaction mixture was diluted with di chloromethane (2x50 mL), washed by saturated sodium bicarbonate solution (50mL). Organic part was evaporated to dryness under reduce pressure to get 5-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)pentanoic acid [INT 75] (2.0 g, 70.31 % yield) as colourless liquid.Result:ELSD analysis: Purity 98.35%, Calculated C59H119NO8Si2= 1025.85, Observed = 1026.55 (m / z, M+H+).heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert-butyldimethylsilyl)oxy)-6-()xo- 6-(undecyloxy)hexyl)(4-((6-(8-(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)- 10-(6-(heptadecan-9-yloxy)-6-oxohexyl)-12,12,13,13-tetramethyl-3-oxo-2,ll-dioxa-8-aza- 12-silatetradecyl)-4-methylmorpholin-2-yl)methoxy)-4-oxobutyl)amino)octanoate [INT 76a]To a stirred solution of starting material heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert-butyl dimethylsilyl )oxy)-6-oxo-6-(undecyloxy)hexyl)(4-((6-(hydroxymethyl)-4-methylmorpholin-2-yl)methoxy)-4-oxobutyl)amino)octanoate [INT 71a] (285 mg, 246 pmol)19481859815v2773158: SA9-886PC / / PAT25019-WO-PCTin dichloromethane (13.5 mL, 211 mmol), N, N-dimethyl-4-pyridylamine (72.2 mg, 2.4 eq., 591 pmol) and 2-methyl-2,6,8-triaza-6,7-decadiene — hydrogen chloride (1 / 1) (56.6 mg, 1.2 eq., 295 pmol) was added, to which 5-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)pentanoic acid [INT 75] (253 mg, 246 pmol) was also added at RT under inert atmosphere and was allowed to stir at RT. After 16h, reaction progress was monitored by ELSD & TLC, which showed SM was consumed. Reaction mass was evaporated under reduced pressure to afford crude. Crude was purified with silica gel flash chromatography using 2-5% MeOH in di chloromethane as gradient elute to afford desired product heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(4-((6-(8-(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)- 10-(6-(heptadecan-9-yloxy )-6-oxohexyl)- 12, 12, 13, 13-tetramethyl-3-oxo-2, 11 -dioxa-8-aza- 12-silatetradecyl)-4-methylmorpholin-2-yl)methoxy)-4-oxobutyl)amino)octanoate [INT 76a] (250 mg, 46.9 % yield) as colourless liquid.Result:EELSD analysis'. Purity 99.12 %, Calculated: C124H247N3O17Si4= 2162.76, Observed = 1083.05 (m / z, M+H+ / 2).heptadecan-9-yl 8-((5-((6-(((4-((8-(heptadecan-9-yloxy)-2-hydroxy-8-oxooctyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)butanoyl)oxy)methyl)-4-methylmorpholin-2-yl)methoxy)-5-oxopentyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)-7-hydroxyoctanoate (Compound 8, (R, S) or (S, R) form)To a solution of heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert- butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(4-((6-(8-(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)-10-(6-(heptadecan-9-yloxy)-6-oxohexyl)-12,12,13,13-tetramethyl-3-oxo-2,ll-dioxa-8-aza-12-silatetradecyl)-4-methylmorpholin-2-yl)methoxy)-4-oxobutyl)amino)octanoate [INT 76a] (245 mg, 113 pmol) in tetrahydrofuran (15 mL. 184 mmol) was added hydrogen fluoride — pyridine (1 / 1) (2 mL) drop wise at 0°C, stirred at room temperature for 16h. Reaction monitor by ELSD analysis. After completion of reaction, reaction mixture was diluted with Et20 (20 mL), washed with19581859815v2773158: SA9-886PC / / PAT25019-WO-PCTcold water and brine solution. The organic layer was washed with aq. NaHCO3and cold brine solution. Organic layer was dried over sodium sulphate and was evaporated to dryness.Compound was purified by column chromatography using 2-5% MeOH in DCM. The solvent was evaporated to get heptadecan-9-yl 8-((5-((6-(((4-((8-(heptadecan-9-yloxy)-2-hydroxy-8-oxooctyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)butanoyl)oxy)methyl)-4-methylmorpholin-2-yl)methoxy)-5-oxopentyl)(2-hydroxy-6-oxo-6- (undecyloxy)hexyl)amino)-7-hydroxyoctanoate [Compound 8, (R, S) or (S, R) form] (88 mg, 45.5% yield) as yellow oil.Results:1H-NMR (400MHz, CDCh)- 54.88-4.82 (m, 2H), 4.18-4.02 (m, 8H), 3.85-3.78 (m, 2H), 3.77-3.62 (m, 4H). 2.78-2.64 (m, 6H). 2.50-2.39 (m, 22H), 1.90-1.78 (m. 6H), 1.74-1.57 (m. 14H), 1.55-1.45 (m, 10H), 1.44-1.20 (m, 96H), 0.87 (t, J=6.4 Hz, 18H).EELSD analysis'. Purity 98.96 %, Calculated: C100H191N3O17 = 1706.42, Observed = 1707.25 (m / z, M+H+).Example 15: Synthesis of tetra((Z)-non-2-en-l-yl) 8.8’.8,,.8,,,-(((((4-methylmorpholine- 2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis(azanetriyl))tetraoctanoate (Compound 8, (R, R) or (S, S) form)Synthetic ProtocolThe (R, R) or (S, S) form of Compound 8 was prepared using the same synthetic protocol as for the (R, S) or (S, R) form of Compound 8 in Example 14, with the exception that the (R, R) or (S,S) form of [INT 17] was usedheptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(4-((6-(hydroxymethyl)-4-methylmorpholin-2-yl)methoxy)-4-19681859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo the stirred solution of 4-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)butanoic acid [INT 70] (534 mg, 527 pmol) in di chloromethane (8.5 mL, 133 mmol), were added DMAP (155 mg, 2.4 eq., 1.27 mmol) and EDC. HC1 (121 mg, 1.2 eq., 633 pmol) at room temperature. After 15 min, (4-methylmorpholine-2,6-diyl)dimethanol [INT 17b] (85 mg, 527 pmol) was also added in reaction mass at rt. under inert atmosphere and was allowed to stir at RT for 16h. After 16h reaction progress was monitored by ELSD & TLC. Reaction mass was evaporated under reduced pressure to afford crude. Crude was purified with silica gel flash chromatography using 2-5% MeOH in dichloromethane as gradient elute to afford desired product heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(4-((6-(hydroxymethyl)-4-methylmorpholin-2-yl)methoxy)-4-oxobutyl)amino)octanoate [INT 71b] (320 mg, 52.5% yield) as a pale yellow liquid.Result:ELSD analysis: Purity 95.07 %, Calculated: C65H130N2O10Si2= 1154.93, Observed = 1155.60 (m / z, M+H+).heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert-butyldimethylsilyl)oxy)-6-oxo- 6-(undecyloxy)hexyl)(4-((6-(8-(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)-10-(6-(heptadecan-9-yloxy)-6-oxohexyl)-12,12,13,13-tetramethyl-3-oxo-2,11-dioxa-8-aza-12-silatetradecyl)-4-methylmorpholin-2-yl)methoxy)-4-oxobutyl)amino)octanoate [INT 76b]To a stirred solution of starting material heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(4-((6-(hydroxymethyl)-4-methylmorpholin-2-yl)methoxy)-4-oxobutyl)amino)octanoate [INT 71b] (317 mg, 274 pmol) in dichloromethane (15 mL, 234 mmol), were added N, N-dimethyl-4-pyridylamine (80.2 mg, 2.4 eq., 656 pmol) and 2-methyl-2,6,8-triaza-6,7-decadiene — hydrogen chloride (1 / 1) (62.9 mg, 1.2 eq., 328 pmol) at room temperature. After 15 min, 5-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)pentanoic acid [INT 75] (281 mg, 274 pmol) was19781859815v2773158: SA9-886PC / / PAT25019-WO-PCTalso added at RT under inert atmosphere and was allowed to stir at RT. After 16h reaction progress was monitored by ELSD & TLC. Reaction mass was evaporated under reduced pressure. Crude was purified with silica gel flash chromatography using 2-5% MeOH in di chloromethane as gradient elute to afford desired product heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(4-((6-(8-(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)-10-(6-(heptadecan-9-yloxy )-6-oxohexyl)- 12, 12, 13, 13-tetramethyl-3-oxo-2, 11 -dioxa-8-aza- 12-silatetradecyl)-4-methylmorpholin-2-yl)methoxy)-4-oxobutyl)amino)octanoate [INT 76b] (0.3 g, 50.6% yield) as colourless liquid.Result:EELSD analysis'. Purity 98.87 %, Calculated: C124H247N3O17Si4= 2162.76, Observed = 1082.7 (m / z, M+H+ / 2).heptadecan-9-yl 8-((5-((6-(((4-((8-(heptadecan-9-yloxy)-2-hydroxy-8-oxooctyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)butanoyl)oxy)methyl)-4-methylmorpholin-2-yl)methoxy)-5-oxopentyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)-7-hydroxyoctanoate (Compound 8, (R, R) or (S, S) form). OH OHOH HO' To a solution of heptadecan-9-yl 7-((tert-butyldimethylsilyl)oxy)-8-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(4-((6-(8-(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)-10-(6-(heptadecan-9-yloxy)-6-oxohexyl)-12,12,13,13-tetramethyl-3-oxo-2,11-dioxa-8-aza-12-silatetradecyl)-4-methylmorpholin-2-yl)methoxy)-4-oxobutyl)amino)octanoate [INT 76b] (270 mg, 125 pmol) in tetrahydrofuran (13.5 mL, 166 mmol)was added hydrogen fluoride — pyridine (1 / 1) (2.5 mL) drop wise at 0°C and allowed to stir at room temperature for 16h. Reaction monitor by ELSD analysis. After completion of reaction, reaction mixture was diluted with Et20 (20 mL), washed with cold water and brine solution. The organic layer was washed with aq. NaHCO3and cold brine solution. Organic layer was dried over sodium sulfate and was evaporated to dry ness. Crude compound was column purified at 3% MeOH-DCM to get heptadecan-9-yl 8-((5-((6-(((4-((8-(heptadecan-9-yloxy)-2-hydroxy-8-oxooctyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)butanoyl)oxy)methyl)-4-methylmorpholin-2-yl)methoxy)-19881859815v2773158: SA9-886PC / / PAT25019-WO-PCT5-oxopentyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)-7-hydroxyoctanoate [Compound 8, (R, R) or (S, S) form] (94 mg, 44% yield) as light yellow liquid.Results:1H-NMR (400MHz, CDCl3)- 54.88-4.82 (m, 2H), 4.49-4.34 (m, 2H), 4.12-4.02 (m, 8H), 3.94-3.58 (m, 4H), 3.10-2.55 (m, 10H), 2.50-2.39 (m, 8H), 2.38-2.32 (t,.7=7, 2Hz. 4H), 2.29-2.26 (t, J=7.6Hz. 4H), 2.22 (s, 4H), 1.90-1.78 (m, 4H), 1.77-1.67 (m, 4H), 1.65-1.58 (m, 8H), 1.55-1.40 (m, 18H), 1.39-1.20 (m. 90H), 0.87 (t, J=6.4 Hz, 18H).ELSD analysis: Purity 99.31 %, Calculated: C100H191N3O17= 1706.42, Observed = 1707.40 (m / z, M+H+).Example 16: Synthesis of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydecyl)amino)butanoate) (Compound 9, meso form)Synthetic Protocol4-(bis(2-hydroxydecyl)amino)butanoic acid [INT 78]19981859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo the solution of 4-aminobutyric acid [INT 1] (5 g, 48.5 mmol) in methanol (0.1 L, 2.47 mol), were added ethylbis(propan-2-yl)amine (25.3 mL, 3 eq., 145 mmol) and 2-octyloxirane [INT 77] (15.2 g, 2 eq., 97 mmol) at RT. The resultant reaction mass was allowed to heated at 90°C for 16 h. After 16 h reaction progress was monitor by TLC. SM was consumed completely. Reaction mass was cool to RT. tetrahydrofuran (90 mL, 1.11 mol), water (62.4 mL, 3.46 mol) and lithium(1+) hydroxide (2.32 g, 2 eq., 97 mmol) were added. After 4 h reaction progress monitored by TLC. Adjust the pH 2.0 using 2N hydrochloric acid and extracted with Ethyl acetate (2x 100 mL). Organic layer was dried over sodium sulfate and concentrated under reduced pressure. Crude was purified with column chromatography using 2.5-5.0 % methanol in DCM to afford 4-(bis(2-hydroxydecyl)amino)butanoic acid [INT 78] (15 g, yield 75%) as a colourless liquid.Result:ELSD analysis: Purity 99.30 %, Calculated: C24H49NO4= 415.37, Observed = 416.40 (m / z, M+H+).4-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)butanoic acid [INT 79]To a stirred solution of 4-(bis(2-hydroxydecyl)amino)butanoic acid [INT 78] (13 g, 31.3 mmol) in DCM (130 mL), were added 1H-imidazole (34.1 g, 16 eq., 0.5 mol) & tert-butyl(chloro)dimethylsilane (37.7 g, 8 eq., 250 mmol) portion wise. The reaction mixture was stirred at rt for 16h. The progress of reaction was monitored by TLC & ELSD, after completion of reaction mixture was diluted with water (1.0 Lit) & extracted by DCM (3x 250 mL). The combined organic layer was dried anhydrous sodium sulfate & reduced under vacuum. The crude was purified by flash column chromatography by using 30-60 % EtOAc in heptane to afford 4-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)butanoic acid [INT 79] (12 g, yield 59.6 %) as a colourless liquid.Result:20081859815v2773158: SA9-886PC / / PAT25019-WO-PCTEELSD analysis'. Purity 99.37 %, Calculated: C36H77NO4Si2= 643.54, Observed = 644.55 (m / z, M+H+).(4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)butanoate) [INT 80a]To a stirred solution of 4-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)butanoic acid [INT 79] (559 mg, 2 eq.. 868 pmol), in dichloromethane (15 mL, 234 mmol), N, N-dimethyl-4-pyridylamine (255 mg, 4.8 eq., 2.08 mmol) and 2-methyl-2,6,8-triaza-6,7-decadiene — hydrogen chloride (1 / 1) (0.2 g, 2.4 eq., 1.04 mmol) were added portion wise at 0°C and stirred for 15 min then (4-methylmorpholine-2,6-diyl)dimethanol [INT 17a] (70 mg, 434 pmol) was added at 0°C under nitrogen atmosphere. The reaction mixture was stirred rt for 16h. The progress of reaction was monitored by TLC. After completion of reaction mixture quenched water (100 mL) & extracted by DCM (2x lOOmL). The organic layer dried anhydrous sodium sulfate and reduced under vacuum. The crude was purified by flash column chromatography (0 to 10 % EA: Heptane) to afford (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)butanoate) [INT 80a] (310 mg, yield 51%) as a colourless liquid.(4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydecyl)amino)butanoate) (Compound 9, meso form)To the stirred solution of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)butanoate) [INT 80a] (310 mg, 219 pmol) in tetrahydrofuran (15 mL, 184 mmol) was added hydrogen fluoride — pyridine (1 / 1) (3 mL) at 0°C temperature. After completion of reaction, reaction mixture was diluted with Et20 (20 mL), washed with cold water and brine solution. The organic layer was basified with aq.20181859815v2773158: SA9-886PC / / PAT25019-WO-PCTNaHCO3 up to 8-9 pH and again washed with cold water. Organic layer was dried over sodium sulfate and was evaporated to dryness. Crude compound was column purified at 3% MeOH-DCM to get (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydecyl)amino)butanoate) — methane (1 / 1) [Compound 9, meso form] (114 mg, Yield 53.45%) as pale yellow liquid.Results:1H-NMR (400MHz. CDCh)- 54.13-4.00 (m. 4H), 3.80-3.78 (m. 2H), 3.68-3.54 (m. 4H), 2.75-2.67 (m, 2H), 2.69-2.52 (m, 6H), 2.50-2.30 (m, 12H), 2.28 (s, 3H), 1.88-1.70 (m, 6H), 1.52-1.15 (m, 58H), 0.87 (t, 7=6.4 Hz. 12H).EELSD analysis'. Purity 99.5 %, Calculated: C55H109N3O9 = 955.82, Observed = 956.65 (m / z, M+H+).Example 17: Synthesis of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxytetradecyl)amino)butanoate) (Compound 10, meso form)4-(bis(2-hydroxytetradecyl)amino)butanoic acid [INT 82]20281859815v2773158: SA9-886PC / / PAT25019-WO-PCTA solution of 4-aminobutanoic acid [INT 1] (2 g, 19.4 mmol), 2-octyloxirane [INT 81] (9.09 g, 3 eq., 58.2 mmol) and ethylbis(propan-2-yl)amine (3.21 mL, 19.4 mmol) in methanol (20 mL, 494 mmol) was heated to reflux overnight. After completion of reaction, solvent was evaporated to dryness. Crude compound was dissolved in DCM, washed by water. Organic part was dried over sodium sulfate and was evaporated to dryness to get 4-(bis(2-hydroxytetradecyl)amino)butanoic acid [INT 82] (5.5 g, 53.7%) as white solid.Results:EELSD analysis'. Purity 99.76%, Calculated: C32H65NO4 = 527.49, Observed = 528.40 (m / z, M+H+).4-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)butanoic acid [INT 83]To a solution of 4-(bis(2-hydroxytetradecyl)amino)butanoic acid [INT 82] (1.5 g, 2.84 mmol) in dichloromethane (30 mL, 469 mmol), were added IH-imidazole (2.9 g, 15 eq., 42.6 mmol) portion wise, followed by addition of tert-butyl(chloro)dimethylsilane (4.28 g, 10 eq., 28.4 mmol). Reaction mixture was allowed to stir at room temperature for 16h. After completion of reaction, reaction mixture was diluted with DCM (100 mL), washed by water (2x 100 mL). Organic part was dried over sodium sulfate and was evaporated to dryness, crude compound was column purified at 17% ethylacetate-hexane to get 4-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)butanoic acid [INT 83] (2 g, yield 93%).Results:EELSD analysis'. Purity 99.69 %, Calculated: C44H93NO4Si2 = 755.66, Observed = 756.45 (m / z, M+H+).(4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)butanoate) [INT 84a]20381859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo a stirred solution of 4-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)butanoic acid [INT 83] (657 mg, 2 eq., 868 pmol), N, N-dimethyl-4-pyridylamine (255 mg, 4.8 eq., 2.08 mmol) and 2-methyl-2,6,8-triaza-6,7-decadiene — hydrogen chloride (1 / 1) (0.2 g. 2.4 eq.. 1.04 mmol) were added portion wise at 0°C and stirred for 15 min then (4-methylmorpholine-2,6-diyl)dimethanol [INT 17a] (70 mg, 434 pmol) was added at 0°C under nitrogen atmosphere. The reaction mixture was stirred rt for 16h. The progress of reaction was monitored by TLC. After completion of reaction mixture quenched water (100 mL) & extracted by DCM (2x lOOmL). The organic layer dried anhydrous sodium sulfate and reduced under vacuum. The crude was purified by flash column chromatography (0 to 10 % EA: Heptane) to afford (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)butanoate) [INT 84a] (525 mg, yield 74%) as a colourless liquid.Results:EELSD analysis'. Purity 99.78 %, Calculated: C95H197N3O9Si4 = 1636.41, Observed = 1637.00 (m / z, M+H+).(4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxytetradecyl)amino)butanoate) (Compound 10, meso form)To the stirred solution of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)butanoate) [INT 84a] (525 mg, 321 pmol), in tetrahydrofuran (15 mL, 184 mmol), hydrogen fluoride — pyridine (1 / 1) (3 mL) was added at 0°C temperature. The progress was monitored by ELSD. After completion of reaction, reaction mixture was diluted with Et20 (20 mL), washed with cold water and brine solution. The organic layer was basified with aq. sodium bibarbonate upto 8-9 pH and again washed with cold water. Organic layer was dried over sodium sulfate and was evaporated to dryness. Crude compound was column purified at 3% MeOH-DCM to get (4-methylmorpholine-2,6- 20481859815v2773158: SA9-886PC / / PAT25019-WO-PCTdiyl)bis(methylene) bis(4-(bis(2-hydroxytetradecyl)amino)butanoate) [Compound 10, meso form] (275 mg, yield 72%) as pale yellow liquid.Results:1H-NMR (400MHz, CDCl3)- δ4.16-4.12 (m, 2H), 4.08-4.04 (m, 2H), 3.83-3.81 (m, 2H), 3.78-3.62 (m, 4H), 2.78-2.35 (m, 19H), 2.30 (s, 3H), 1.90-1.75 (m, 6H), 1.48-1.22 (m, 90H), 0.87 (t,.7=6,4 Hz. 12H).ELSD analysis'. Purity 99.40 %, Calculated: C71H141N3O9 = 1180.07, Observed = 1180.85 (m / z, M+H+).Example 18: Synthesis of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-hvdroxydecyl)amino)pentanoate) (Compound 11, meso form)5-(bis(2-hydroxydecyl)amino)pentanoic acid [INT 85]20581859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo the stirred solution of 5-aminovaleric acid [INT 25] (10 g, 85.4 mmol) and N-ethylbis(isopropyl)amine (44.1 mL, 3 eq., 256 mmol) in methanol (0.1 L. 2.47 mol) was added 2-octyloxirane [INT 81] (29.3 g, 2.2 eq., 188 mmol) at RT. After the complete addition the reaction mixture was reflux for 16h at 60°C. Progress of reaction was monitored by TLC / ELSD. Reaction mixture was evaporated under reduced pressure. The crude was purified by using 60-120 silica on combi flash by elute in 2%methanol in DCM to afford 5-(bis(2-hydroxydecyl)amino)pentanoic acid [INT 85] (9.7 g. yield 26%) as colourless liquid.Results:EELSD analysis'. Purity 87.99%, Calculated: C25H51NO4 = 429.38, Observed = 430.45 (m / z, M+H+).5-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)pentanoic acid [INT 86]OTBDMSNTo the stirred solution of 5-(bis(2-hydroxydecyl)amino)pentanoic acid [INT 85] (30 g, 69.8 mmol) in dichloromethane (0.3 L, 4.69 mol), were added imidazole (2.5 g, 6 eq., 419 mmol) and (tert-butyl)(chloro)bis(methyl)silane (42.1 g, 4 eq., 279 mmol) portion wise at 0°C. After the complete addition, the reaction mixture was stirred at RT for 16h. Progress of reaction was monitored with TLC analytical data. After completion of reaction, reaction mixture was diluted with DCM (300 mL)), washed with water (2x 400 mL). Organic part was dried over sodium sulfate and was evaporated to dryness to afford 5-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)pentanoic acid [INT 86] (15.2 g, yield 33%) as yellow viscous oil.Results:EELSD analysis'. Purity 99.73%, Calculated: C37H79NO4Si2 = 657.55, Observed = 658.60 (m / z, M+H+).20681859815v2773158: SA9-886PC / / PAT25019-WO-PCT(4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)pentanoate) ]INT 87a]To a stirred solution of 5-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)pentanoic acid [INT 86] (572 mg, 2 eq., 868 pmol) in dichloromethane (15 mL, 234 mmol), were added N, N-dimethyl-4-pyridylamine (255 mg, 4.8 eq., 2.08 mmol) and 2-methyl-2,6,8-triaza-6,7-decadiene — hydrogen chloride (1 / 1) (0.2 g, 2.4 eq., 1.04 mmol) portion wise at 0°C and stirred for 15 min then (4-methylmorpholine-2,6-diyl)dimethanol [INT 17a] (70 mg. 434 pmol) was added at 0°C under nitrogen atmosphere. The reaction mixture was stirred rt for 16h. The progress of reaction was monitored by TLC. After completion of reaction mixture quenched water (200.0 mL) and extracted by DCM (2x 200.0 mL). The organic layer dried anhydrous sodium sulfate and reduced under vacuum. The crude was purified by flash column chromatography (0 to 10 % EA: Heptane) to afford (4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)pentanoate) [INT 87] (420 mg, yield=67%) as a colourless liquid.Results:EELSD analysis'. Purity 99.96 %, Calculated: C81H169N3O9Si4 = 1440.19, Observed = 1441.00 (m / z, M+H+).(4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)pentanoate) (Compound 11, meso form)OH OHTo the stirred solution of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)pentanoate) [INT 87a] (420 mg, 291 pmol) in tetrahydrofuran (15 mL, 184 mmol) was added hydrogen fluoride — pyridine (1 / 1) (3 mL) at 0°C temperature. The progress was monitored by ELSD. After completion of reaction, reaction mixture was diluted with Et20 (20 mL), washed with cold water and brine solution. The organic layer was basified with aq. NaHCO3upto 8-9 pH and again washed with cold water. Organic layer was dried over sodium sulfate and was evaporated to dryness. Crude 20781859815v2773158: SA9-886PC / / PAT25019-WO-PCTcompound was column purified at 3% MeOH-DCM to get (4-methylmorpholine-2,6- diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)decyl)amino)pentanoate)[Compound 11, meso form] (175 mg, yield 61%) as pale yellow liquid.Results:1H-NMR (400MHz, CDCl3)- 54.13-4.09 (m, 2H), 4.05-4.01 (m, 2H), 3.83-3.74 (m, 2H), 3.68-3.54 (m, 4H), 2.75-2.68 (m, 2H), 2.64-2.50 (m, 6H), 2.49-2.30 (m, 12H), 2.99-2.25 (m, 3H), 1.88-1.78 (m. 2H), 1.70-1.32 (m. 20H), 1.30-1.19 (m, 42H). 0.85 (t. J=6.4 Hz, 12H).EELSD analysis'. Purity 99.54%, Calculated: C57H113N3O9 = 983.85, Observed = 984.70 (m / z, M+H+).Example 19: Synthesis of (4-methylmorpholine-2.6-diyl)bis(methylene) bis(5-(bis(2- hvdroxydodecyl)amino)pentanoate) (Compound 12, meso form)5-(bis(2-hydroxydodecyl)amino)pentanoic acid [INT 88]20881859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo a stirred solution of 5-aminovaleric acid (15 g, 128 mmol) [INT 25] in methanol (150 mL) was added 2-decyloxirane (51.9 g, 2.2 eq., 282 mmol) [INT 2] followed by addition of ethylbis(propan-2-yl)amine (55.2 mL, 2.5 eq., 320 mmol). Reaction mass was heated to 90°C for 16h. Progress of reaction mixture was monitored by TLC / ELSD. Starting material was consumed. Reaction mass was cooled to RT. Added water (70 mL, 5.55 mol) and tetrahydrofuran (50 mL, 614 mmol) then lithium hydroxide (3.07 g, 128 mmol). Reaction mixture was stirred for 4 h. Progress of reaction mixture was monitored by TLC / ELSD. Reaction mass was acidified with IN HC1 up to pH-3 and extracted with ethyl acetate (3x 100 mL), dried over anhy. Na2SO4and removed solvent under reduced pressure. Crude was purified by column chromatography using 0-65% ethyl acetate and then 0-10% MeOH in DCM to afford 5-(bis(2-hydroxydodecyl)amino)pentanoic acid (60 g. 124 mmol) [INT 88] as colourless liquid.Results:EELSD analysis'. Purity 92.31%, Calculated C29H59NO4 = 485.44, Observed = 486.30 (m / z, M+H+).5-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)pentanoic acid [INT 89 JTo the stirred solution 5-(bis(2-hydroxydodecyl)amino)pentanoic acid [INT 88] (20 g, 41.2 mmol) in dichloromethane (0.3 L, 4.69 mol), was added imidazole (44.8 g, 16 eq., 659 mmol) and (tert-butyl)(chloro)bis(methyl)silane (49.6 g, 8 eq., 329 mmol) successively at 0°C, then allowed to stir reaction mixture at RT for 16 h. After the complete consumption of starting material on TLC. Filter the reaction mixture through sintered funnel. Filtrate was evaporated over rota vapour under reduced pressure. Crude was purified by silica gel column chromatography by using 7% ethyl acetate in heptane to afford 5-(bis(2-((tert-20981859815v2773158: SA9-886PC / / PAT25019-WO-PCTbutyldimethylsilyl)oxy)dodecyl)amino)pentanoic acid (12 g, yield 41%) [INT 89] as colourless liquid.Results:LCMS analysis: Purity 99.90%, Calculated: C41H87NO4Si2 = 713.62, Observed = 715.35 (m / z, M+H+).(4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)pentanoate) [INT 90a]To a stirred solution of 5-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)pentanoic acid [INT 89] (620 mg, 2 eq., 868 pmol), in dichloromethane (15 mL, 234 mmol), N, N-dimethyl-4-pyridylamine (255 mg, 4.8 eq., 2.08 mmol) and 2-methyl-2,6,8-triaza-6,7-decadiene — hydrogen chloride (1 / 1) (0.2 g, 2.4 eq., 1.04 mmol) were added portion wise at 0°C and stirred for 15 min then (4-methylmorpholine-2,6-diyl)dimethanol [INT 17a] (70 mg. 434 pmol) was added at 0°C under nitrogen atmosphere. The reaction mixture was stirred rt for 16h. The progress of reaction was monitored by TLC. After completion of reaction mixture quenched water (200.0 mL) & extracted by DCM (2x 200.0 mL). The organic layer dried anhydrous sodium sulphate and reduced under vacuum. The crude was purified by flash column chromatography (0 to 10 % EA: Heptane) to afford (4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)pentanoate) [INT 90a] (560 mg, yield 83%) as a light yellow liquid.(4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-hydroxydodecyl)amino)pentanoate) (Compound 12, meso form)To the stirred solution of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)pentanoate) [INT 90] (560 mg, 360 pmol) in tetrahydrofuran (15 mL), was added hydrogen fluoride — pyridine (1 / 1) (3 mL) at 0°C21081859815v2773158: SA9-886PC / / PAT25019-WO-PCTtemperature. The progress was monitored by ELSD. After completion of reaction, reaction mixture was diluted with Et2O (20 mL), washed with cold water and brine solution. The organic layer was basified with aq. NaHCO₃ up to 8-9 pH and again washed with cold water. Organic layer was dried over sodium sulfate and was evaporated to dryness. Crude compound was column purified at 3% MeOH-DCM to get (4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-hydroxydodecyl)amino)pentanoate) [Compound 12, meso form] (269 mg, yield 68.05%) as pale yellow liquid.Results:1H-NMR (400MHz, CDCl3)- δ4.16-4.12 (m, 2H), 4.08-4.04 (m, 2H), 3.85-3.78 (m, 2H), 3.78-3.65 (m, 4H), 2.75-2.62 (m, 7H), 2.60-2.42 (m, 8H), 2.38 (t, J=6.8Hz, 4H), 2.30 (s, 3H), 1.86 (t. J=11.2Hz, 2H), 1.74-1.52 (m, 9H), 1.50-1.25 (m, 70H). 0.87 (t.7=6.4 Hz. 12H).ELSD analysis: Purity 99.80 %, Calculated: C65H129N3O9= 1095.97, Observed = 1096.85 (m / z, M+H+).Example 20: Synthesis of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-hvdroxytetradecyl)amino)pentanoate) (Compound 13, meso form)21181859815v2773158: SA9-886PC / / PAT25019-WO-PCT5-(bis(2-hydroxytetradecyl)amino)pentanoic acid [INT 92]To a stirred solution of 5-aminovaleric acid [INT 25] (15 g, 128 mmol) and ethylbis(propan-2-yl)amine (69 mL, 3 eq., 384 mmol) in methanol (0.3 L), was added 2-dodecyloxirane [INT 91] (59.8 g, 2.2 eq., 282 mmol). The resultant reaction mass was allowed to heated at 90°C for 16 h. After 16 h reaction progress was monitor by TLC / ELSD. SM was consumed completely. Reaction mass was cool to RT. tetrahydrofuran (264 mL, 3.24 mol), water (264 mL, 14.7 mol) and lithium(l+) hydrate hydroxide (5.37 g, 128 mmol) were added. After 4 h reaction progress monitored by TLC. Reaction mixture was concentrated under reduced pressure to remove MeOH. Residue was diluted with water (350 mL) and adjust the pH 2.0 using 2N hydrochloric acid. Product was extracted with EtOAc (3x 250 mL). dried over sodium sulphate, distil out under reduced pressure get crude as a 5-(bis(2-hydroxytetradecyl)amino)pentanoic acid (70 g, crude) [INT 92] yellowish liquid. Crude was used as such for next step.Results:21281859815v2773158: SA9-886PC / / PAT25019-WO-PCTELSD analysis: Purity 76.18 %, Calculated: C33H67NO4= 541.51, Observed = 542.40 (m / z, M+H+).5-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)pentanoic acid [INT 93]To a stirred solution of 5-(bis(2-hydroxytetradecyl)amino)pentanoic acid [INT 92] (69.2 g, 128 mmol) in dichloromethane (0.6 L. 9.38 mol), were added IH-imidazole (69.5 g, 8 eq., 1.02 mol) and tert-butyl(chloro)dimethylsilane (77 g, 4 eq., 511 mmol) portionwise successively at 0°C. The resultant reaction mass was allowed to stirred RT for 16 h. The progress of reaction was monitor with TLC. SM was consumed completely. Reaction diluted with ice cold water (1000 mL) and extracted by DCM (2 x 250 mL). Combined organic layers was dried over Na2SO4, concentrated under reduced pressure. The crude material was purified by flash column chromatography (SiO20-30% Ethyl acetate in n-heptane) to afford 5-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)pentanoic acid [INT 93] (40 g, 51.9 mmol) as colourless liquid.Results:ELSD analysis: Purity 76.61%, Calculated: C45H95NO4Si2= 769.68, Observed = 770.40 (m / z, M+H+).(4-inethylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)pentanoate) [INT 94a]To a stirred solution of 5-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)pentanoic acid [INT 93] (669 mg, 2 eq., 868 pmol) in dichloromethane (15 mL, 234 mmol), DMAP (255 mg, 4.8 eq., 2.08 mmol) and EDC. HC1 (0.2 g, 2.4 eq., 1.04 mmol) were added portion wise at 0°C and stirred for 15 min then (4-methylmorpholine-2.6-diyl)dimethanol [INT 17a] (70 mg, 434 pmol) was added at 0°C under nitrogen atmosphere. The reaction mixture was stirred rt for 16h. The progress of reaction was monitored by TLC. After completion of21381859815v2773158: SA9-886PC / / PAT25019-WO-PCTreaction mixture quenched water (200.0 mL) & extracted by DCM (2x 200.0 mL). The organic layer dried anhydrous sodium sulfate and reduced under vacuum. The crude was purified by flash column chromatography (0 to 10 % EA:hexane) to afford (4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)pentanoate) [INT 94a] (490 mg, yield 67.63%) as a colourless liquid.ELSD analysis: Purity 99.82%, Calculated: C97H201N3O9Si4= 1664.44, Observed = 1665.25 (m / z, M+H+).(4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-hydroxytetradecyl)amino)pentanoate) (Compound 13, meso form)OH OHTo the stirred solution of (4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-((tert-butyldimethylsilyl)oxy)tetradecyl)amino)pentanoate) [INT 94a] (490 mg, 294 pmol) in tetrahydrofuran (15 mL, 184 mmol) hydrogen fluoride — pyridine (1 / 1) (3 mL) was added at 0°C temperature. The progress was monitored by ELSD. After completion of reaction, reaction mixture was diluted with Et20 (20 mL), washed with cold water and brine solution. The organic layer was basified with Aq. NaHCO3up to 8-9 pH and again washed with cold water. Organic layer was dried over sodium sulphate and was evaporated to dryness. Crude compound was column purified at 3% MeOH-DCM to get (4-methylmorpholine-2,6-diyl)bis(methylene) bis(5-(bis(2-hydroxytetradecyl)amino)pentanoate) [Compound 13, meso form] (250 mg, 207 pmol) as pale yellow liquid, (yield 70.31%).Results:1H-NMR (400MHz, CDCl3)- δ4.16-4.12 (m, 2H), 4.08-4.04 (m, 2H), 3.82-3.80 (m, 2H), 3.78-3.65 (m, 4H), 2.74-2.62 (m, 7H), 2.60-2.42 (m, 7H), 2.38 (t, J=6.8Hz, 4H), 2.30 (s, 3H), 1.84 (t. J=10.8Hz, 2H), 1.74-1.52 (m, 8H), 1.50-1.38 (m, 10H). 1.37-1.22 (m, 80H), 0.87 (t, J=6.4 Hz, 12H).ELSD analysis: Purity 98.93 %, Calculated: C73H145N3O9= 1208.10, Observed = 1209.95 (m / z, M+H+).21481859815v2773158: SA9-886PC / / PAT25019-WO-PCTExample 21: (((((4-methylmorpholine-2.6-diyl)bis(methylene))bis(oxy))bis(5- oxopentane-5.1-diyl))bis((6-oxo-6-(undecyloxy)hexyl)azanediyl))bis(heptane-7,l-diyl) bis(2-octyldecanoate) (Compound 14, meso form)Synthetic Protocoldiethyl 2,2-dioctylmalonate [INT 96]In a dry RBF, weighing of sodium hydride 50%w / w (3.75 g, 1.3 eq., 78 mmol) was done under nitrogen atmosphere, then dimethylformamide (150 mL, 1.94 mol) was added at 0 °C, under nitrogen, followed by diethyl malonate [INT 95] (10 g, 62.4 mmol). Resulting reaction21581859815v2773158: SA9-886PC / / PAT25019-WO-PCTmixture was allowed to stir at RT for Ih, then slow addition of 1-iodooctane (37.5 g, 2.5 eq., 156 mmol) was done and stir reaction mixture for 18h at room temperature. Progress of reaction was monitored by TLC. Reaction mixture was cool to 0°C and quenched with cold water (500 mL) with dropping funnel and extracted with EtOAc (2x 250 mL). Organic layer was dried over anhy. sodium sulphate, filtered and concentrated. Crude was purified by flash chromatography using 0-20 % gradient of EtOAc in heptane to give diethyl 2,2-dioctylmalonate [INT 96] (11 g. Yield 45.81% 28.6 mmol) as yellow liquid.Result:ELSD analysis: Purity 91.80 %, Calculated: C23H44O4= 384.32, Observed = 385.30 (m / z, M+H+).2-octyl decanoic acid [INT 97]OIn a dry RBF, potassium hydroxide (7.73 g, 2 eq., 138 mmol) was added to the solution of diethyl 2.2-dioctylmalonate [INT 96] (26.5 g, 68.9 mmol) in ethanol (345 mL, 5.91 mol) and allowed to stir at 90 °C for 18 h. Progress of reaction was monitored by TLC. Reaction mixture was concentrated under reduced pressure. Residue was taken in pyridine (230 mL) and allowed to stir at 100 °C. After 18 h reaction mixture was cool to RT and concentrated under reduced pressure to give crude. Crude was taken in IN aq. HC1 (100 mL) and extracted with EtOAc (2x 100 mL). Combined organic layer dried over anhydrous sodium sulphate, filtered and concentrated. Crude was purified over silica gel using 0-2% MeOH in DCM to give 2-octyldecanoic acid [INT 97] (10 g, yield 51%) as light yellow oil.Result:1H-NMR (400MHz, CDCl3)- δ 12.00 (s, 1H), 2.30-2.00 (m, 1H), 1.51-1.40 (m, 2H), 1.39-1.30 (m, 2H), 1.29-1.10 (m, 21H), 0.85 (br, 6H).7-bromoheptyl 2-octyldecanoate [INT 99]OTo a stirred solution of 2-octyldecanoic acid [INT 97] (11 g, 38.7 mmol) in dichloromethane (137 mL, 2.15 mol ), were added N, N-dimethyl-4-pyridylamine (1.23 g, 0.26 eq., 10.1 mmol)81859815v2773158: SA9-886PC / / PAT25019-WO-PCTand EDC. HC1 (9.27 g, 1.3 eq., 48.3 mmol) portion wise at 0°C and stirred for 15 min then 7-bromo-1 -heptanol [INT 98] (6.79 g. 0.9 eq.. 34.8 mmol) was added at 0°C under nitrogen atmosphere. The reaction mixture was stirred at rt for 16h. The progress of reaction was monitored by TLC. After completion of reaction mixture quenched water (50.0 mL) and extracted by DCM (2x 40.0 mL). The organic layer dried over anhydrous sodium sulphate and reduced under vacuum. The crude was purified by flash column chromatography (0 to 10 % EA: hexanes) to afford 7-bromoheptyl 2-octyldecanoate [INT 99] (10 g, yield 56%) as a colourless liquid.Results:1H-NMR (400MHz, CDCl3)- δ4.08 (t, J=6.4Hz, 2H), 3.42 (t, J=6.8Hz, 2H), 2.40-2.29 (m, 1H), 1.92-1.84 (m, 2H), 1.70-1.55 (m, 4H), 1.51-1.34 (m, 8H), 1.32-1.23 (m, 24H), 0.87 (t, J=6.4 Hz, 6H).7-((5-(tert-butoxy)-5-oxopentyl)(6-oxo-6-(undecyloxy)hexyl)amino)heptyl 2-octyldecanoate [INT 100]0In a dry RBF, undecyl 6-((5-(tert-butoxy)-5-oxopentyl)amino)hexanoate [INT 54] (5 g, 11.3 mmol) was added to the solution of dipotassium carbonate (4.69 g, 3 eq., 34 mmol) and 7-bromoheptyl 2-octyldecanoate [INT 99] (6.27 g, 1.2 eq., 13.6 mmol) in dimethylformamide (55.6 mL, 718 mmol) at room temperature then allowed to stirred for 16 h. Progress of reaction was monitored by TLC. Reaction mixture was filtered through celite bed to remove solid K2CO3. Filtrate was diluted with cold water (100.0 mL) and extracted with EtOAc (3x 100.0 mL). Combined organic layer was washed with fresh water twice, dried over anhy. sodium sulphate, filtered and concentrated. Crude was purified by flash chromatography on silica gel column using 0-1 % gradient of MeOH in DCM to afford 7-((5-(tert-butoxy)-5-oxopentyl)(6-oxo-6-(undecyloxy)hexyl)amino)heptyl 2-octyldecanoate [INT 100] (5 g, yield 53.7%) as pale yellow liquid.Results:ELSD analysis: Purity 93.55%, Calculated: C51H99NO6= 821.75, Observed = 822.80 (m / z, M+H+).21781859815v2773158: SA9-886PC / / PAT25019-WO-PCT5-((7-((2-octyldecanoyl)oxy)heptyl)(6-oxo-6-(undecyloxy)hexyl)amino)pentanoic acid [INT 101]To the stirred solution of 7-((5-(tert-butoxy)-5-oxopentyl)(6-oxo-6-(undecyloxy)hexyl)amino)heptyl 2-octyldecanoate [INT 100] (1.8 g, 2.19 mmol) in dichloromethane (35.3 mL, 551 mmol), trifluoroacetic acid (3 mL) was added dropwise at 0°C. The reaction was allowed to stir at RT for 16h. TLC shows SM was consumed and formed new spots. The solvent was evaporated at 40°C and residue was basified using saturated aq. NaHCCh solution (50 mL). The compound was extracted with diethyl ether (2 x 30 mL). The combined organic layer was dried with Na2SO4and evaporated under reduced pressure. The crude was purified by column chromatography using 0-3% methanol in DCM to afford 5-((7-((2-octyldecanoyl)oxy)heptyl)(6-oxo-6-(undecyloxy)hexyl)amino)pentanoic acid [INT 101] (1.3g, yield 77.5%) as pale yellow liquid compound.Results:ELSD analysis: Purity 98.21%, Calculated: C47H91NO6= 765.68, Observed = 766.65 (m / z, M+H+).(((((4-methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis((6-oxo-6-(undecyloxy)hexyl)azanediyl))bis(heptane-7,l-diyl) bis(2-octyldecanoate) (Compound 14, meso form)To a stirred solution of starting material 5-((7-((2-octyldecanoyl)oxy)heptyl)(6-oxo-6-(undecyloxy)hexyl)amino)pentanoic acid [INT 101] (665 mg, 2 eq., 868 pmol) in dichloromethane (5 mL, 78.1 mmol), were added N, N-dimethyl-4-pyridylamine (255 mg, 4.8 eq.. 2.08 mmol) and 2-methyl-2.6.8-triaza-6,7-decadiene hydrogen chloride (1 / 1) (0.2 g, 2.4 eq., 1.04 mmol). After 15 min (4-methylmorpholine-2,6-diyl)dimethanol [INT 17a] (70 mg, 434 pmol) was also added at RT under inert atmosphere and was allowed to stir for 16h. The21881859815v2773158: SA9-886PC / / PAT25019-WO-PCTprogress of reaction was monitored by TLC. After completion of reaction mixture quenched water (50 mL) & extracted by DCM (2x 25 mL). The organic layer dried anhydrous sodium sulphate and reduced under vacuum. The crude was purified by flash column chromatography (0 to 10 % EA: Heptane) to afford (((((4-methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis((6-oxo-6- (undecyloxy)hexyl)azanediyl))bis(heptane-7,l-diyl) bis(2-octyldecanoate) [Compound 14, meso form] (104 mg, Yield 14%) as pale yellow liquid.Results:1H-NMR (400MHz, CDCl3)- δ4.15-4.12 (m, 2H), 4.07-4.03 (m, 10H), 3.83-3.76 (m, 2H), 2.75-2.70 (m, 2H), 2.69-2.41 (m, 7H), 2.40-2.32 (m, 4H), 2.32-2.27 (m, 8H), 1.98-1.78 (m, 8H), 1.70-1.50 (m, 28H), 1.48-1.39 (m, 6H), 1.36-1.18 (m, 98H), 0.85 (t, J=6.4 Hz, 18H).ELSD analysis: Purity 98.29 %, Calculated: C101H193N3O13= 1656.45, Observed = 1656.75 (m / z, M+H+).Example 22: Synthesis of (((((4-methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5.1-diyl))bis((2-hvdroxy-6-oxo-6-(undecyloxy)hexyl)azanediyl))bis(6-hydroxyheptane-7,l-diyl) bis(2-octyldecanoate) (Compound 15, meso form)OH. OHHO'OH Synthetic Protocol21981859815v2773158: SA9-886PC / / PAT25019-WO-PCThept-6-en-l-ol [INT 103]To the stir solution of 7-bromo-l -heptanol [INT 102] (60 g, 309 mmol) in tetrahydrofuran (0.6 L) was added potassium tertiary butoxide (72.6 g, 2.1 eq., 645 mmol). The reaction mixture was stirred at 90 °C for 16 h. Progress of reaction was monitored by TLC. The reaction mixture was dilute with cold water (1.5 L) and acidified by using 2N aq. HC1 up to 2-3 pH then extract with EtOAc (2x IL). The organic layer was dried over anhydrous NazSCL, filtered and evaporated to give hept-6-en-l-ol [INT 103] (23.0 g, crude) as pale yellow oil. Crude used as such for the next step.Results:22081859815v2773158: SA9-886PC / / PAT25019-WO-PCT¹H-NMR (400 MHz, CDCl₃)- δ(ppm): 5.84-5.75 (m, 1H), 5.02-4.92 (m, 2H), 3.65-3.61 (m, 2H), 3.40-3.36 (t, J= 6.6 Hz, 1H). 2.08-2.02 (m, 2H). 1.60-1.55 (m, 2H). 1.46-1.30 (m, 4H).2-octyldecanoic acid [INT 106]To a stirred solution of decanoic acid [INT 104] (75 g, 435 mmol) in tetrahydrofuran (1.5 L, 18.42 mol) was added sodium hydride (25.08 g, 1.2 eq., 522 mmol) at 0°C. Stirred for 15 minute, Followed by dropwise addition of lithium bis(isopropyl)azanide (56.1 g, 1.2 eq., 522 mmol) at 0°C and stirred for 30 minute at 25°C. After this 1-iodooctane [INT 105] (125.4 g.1.2 eq., 522mmol) was added dropwise and reaction was heated to 45°C for next 06 h.Progress of reaction mass was monitored by ELSD and TLC. Starting material was consumed. Added IN HC1 - 500 ml into reaction mass and adjusted pH acidic. Reaction mass extracted with ethyl acetate- 1 L. Organic layer was dried over sodium sulphate and then removed solvent. Crude purified over silica using 3% ethyl acetate in n-hexane. Obtained 2-octyldecanoic acid [INT 106] (58.0 g, 47 % yield) as white solid.Results:¹HNMR (CDCl₃, 400 MHz): δ(ppm) 2.37-2.30 (m, 1H), 1.64-1.57 (m, 2H), 1.49-1.42 (m, 2H), 1.25 (s, 24H). 0.87 (t, J= 6.8 Hz, 6H).hept-6-en-l-yl 2-octyldecanoate [INT 107]To a stirred solution of 2-octyldecanoic acid [INT 106] (31 g, 109 mmol) and hept-6-en-l-ol [INT 103] (12.4 g, 109 mmol) in dichloromethane (0.5 L, 7.81 mol),2-methyl-2,6,8-triaza-6,7-decadiene — hydrogen chloride (1 / 1) (27.2 g, 1.3 eq., 142 mmol) was added followed by addition of N, N-dimethyl-4-pyridylamine (6.66 g, 0.5 eq., 54.5 mmol) at room temperature. Reaction mass was stirred for 16 h at room temperature. Progress of reaction was monitored by ELSD / TLC (SM was consumed). Water (500ml) was added to the reaction mixture. Stirred well and separated organic layer, aqueous layer was extracted with DCM (3x100 ml). The separated organic layer was dried over Na₂SO₄ and concentrated under reduce pressure22181859815v2773158: SA9-886PC / / PAT25019-WO-PCTto obtained crude product. Resulting crude (49.0 g, crude) was forwarded to next step without further purification.Results:EELSD analysis'. Purity 64.9 %, Calculated C25H48O2 = 380.37, Observed = 381.30 (m / z, M+H+).5-(oxiran-2-yl)pentyl 2-octyldecanoate [INT 108]o0To a stirred solution of hept-6-en-l-yl 2-octyldecanoate [INT 107] (49 g, 129 mmol) in dichloromethane (0.5 L, 7.81 mol) was cooled to 0°C. m-chlorobenzeneperoxycarboxylic acid (44.4 g, 1.5 eq., 193 mmol) was added as lot wise. Reaction mass was stirred for 16 h at room temperature. Progress of reaction was monitored by ELSD / TLC (SM was consumed). Water (500ml) was added to the reaction mixture. Stirred well and separated organic layer, aqueous layer was extracted with DCM (3x100 ml). The separated organic layer was dried over Na₂SO₄ and concentrated under reduce pressure to obtained crude product. Resulting crude was purified over silica using 5% ethyl acetate in n-hexane to obtained pure product 5-(oxiran-2-yl)pentyl 2-octyldecanoate [INT 108] (31 g, 78.2 mmol) as yellow liquid mass. Results:¹H-NMR (400 MHz, CDCl₃)- δ(ppm): 4.08-4.05 (t, J=6.6 Hz, 2H), 2.89-2.88 (br, 1H), 2.75-2.73 (m, 1H), 2.47-2.45 (m, 1H), 2.32-2.26 (m, 1H), 1.67-1.35 (m, 12H), 1.34-1.15 (m, 24H), 0.89-0.85 (t, J= 6.8 Hz, 6H).7-((5-(tert-butoxy)-5-oxopentyl)amino)-6-hydroxyheptyl 2-octyldecanoate [INT 109]OHTo the stirred solution of tert-butyl 5-aminopentanoate [INT 28] (9 g, 51.9 mmol) in IPA (270 mL) at RT were added 5-(oxiran-2-yl)pentyl 2-octyldecanoate [INT 108] (20.6 g, 51.9 mmol) and N-ethylbis(isopropyl)amine (26.9 mL, 3 eq., 156 mmol) at RT after the completion of addition, reflux the reaction mixture for 20h at 65°C. after the complete consumption of starting material Concentrate the reaction mixture directly under reduced pressure, and purified by using 2-4% methanol in DCM To afforded 7-((5-(tert-butoxy)-5-22281859815v2773158: SA9-886PC / / PAT25019-WO-PCToxopentyl)amino)-6-hydroxyheptyl 2-octyldecanoate [INT 109] (10 g, 17.5 mmol) as greenish liquid.Results:EELSD analysis'. Purity 98.88 %, Calculated C34H67NO5= 569.50, Observed = 570.50 (m / z, M+H+).7-((5-(tert-butoxy)-5-oxopentyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)-6-hydroxyheptyl 2-octyldecanoate [INT 110]To the stirred solution of 7-((5-(tert-butoxy)-5-oxopentyl)amino)-6-hydroxyheptyl 2-octyldecanoate [INT 109] (10 g. 17.5 mmol) in IPA (98.1 mL). were added undecyl 4-(oxiran-2-yl)butanoate [INT 66] (5.99 g, 1.2 eq., 21.1 mmol) and N-ethylbis(isopropyl)amine (9.08 mL, 3 eq., 52.6 mmol) at RT. After completion of addition, reflux the reaction mixture for 24h at 95°C. Progress of reaction was monitored by TLC / ELSD. Concentrate the reaction mixture directly under reduced pressure and the crude was purified by using 8-15% Ethyl acetate in heptane to afford 7-((5-(tert-butoxy)-5-oxopentyl)(2-hydroxy-6-oxo-6-(undecyloxy)hexyl)amino)-6-hydroxyheptyl 2-octyldecanoate [INT 110] (10 g, 66.7% yield) as yellowish liquid.Results:EELSD analysis'. Purity 99.49 %, Calculated C51H99NO8= 853.74, Observed = 854.45 (m / z, M+H+).7-((5-(tert-butoxy)-5-oxopentyl)(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)amino)-6-((tert-butyldimethylsilyl)oxy)heptyl 2-octyldecanoate [INTTo a stirred solution of 7-((5-(tert-butoxy)-5-oxopentyl)(2 -hydroxy -6-oxo-6-(undecyloxy)hexyl)amino)-6-hydroxyheptyl 2-octyldecanoate [INT 110] (10 g, 11.7 mmol)22381859815v2773158: SA9-886PC / / PAT25019-WO-PCTin dichloromethane (80 mL, 1.45 mol) were added imidazole (9.5 g, 12 eq., 140 mmol) and (tert-butyl)(chloro)bis(methyl)silane (10.6 g, 6 eq., 70.33 mmol) in inert atmosphere. The resultant reaction mass was allowed to stir at RT for 16 h. The progress of reaction was monitor by TLC and analytical data. SM was consumed completely. Reaction quenched with (100 ml) water and, the extraction was done by distilled DCM (2x 100 mL), the organic layers were collected, combined, dried over Na₂SO₄, concentrated under reduced pressure, the crude material was purified by flash column chromatography (SiO2: 5-15% Ethyl acetate in Hexane), to afford 7-((5-(tert-butoxy)-5-oxopentyl)(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)amino)-6-((tert-butyldimethylsilyl)oxy)heptyl 2-octyldecanoate [INT 111] (10 g, 78 % yield) as colorless liquid.Results:EELSD analysis'. Purity 99.88 %, Calculated C₆₃H₁₂₇NO₈Si₂ = 1081.91, Observed = 1082.60 (m / z, M+H+).5-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)pentanoic acid [INT 112]A solution of 7-((5-(tert-butoxy)-5-oxopentyl)(2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)amino)-6-((tert-butyldimethylsilyl)oxy)heptyl 2-octyldecanoate [INT 111] (10 g, 9.22 mmol) in dichloromethane (0.1 L, 1.55 mol) was cooled to 0°C. to the resulting solution, trifluoroacetic acid (20 mL, 28 eq., 525mmol) was added and allowed to stirred at room temperature for 16 h. Progress of reaction was monitored by ELSD / TLC (SM was consumed). Reaction mixture was quenched with water (50 mL) and pH = 5 was adjusted using NaHCCh. Separated organic layer and aqueous layer was extracted twice with DCM (2x 100 ml). Combined organic layer was dried over Na₂SO₄ and concentrated under reduce pressure to obtained crude product. Resulting crude was purified over silica using 10-15% ethyl acetate in heptane to obtained 5-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)pentanoic acid [INT 112] (8.3 g, 88 % yield) as Light brown liquid.Results:22481859815v2773158: SA9-886PC / / PAT25019-WO-PCTELSD analysis: Purity 99.40%, Calculated C59H119NO8Si2= 1025.85, Observed = 1026.40 (m / z, M+H+).((4-methylmorpholine-2,6-diyl)bis(12,12,13,13-tetramethyl-3-oxo-10-(4-oxo-4-(undecyloxy)butyl)-2',11'-dioxa-8'-aza-12'-silatetradecane-1,8-diyl))bis(6-((tert-butyldimethylsilyl)oxy)heptane-7,1-diyl) bis(2-octyldecanoate) [INT 113a]To a stirred solution of 5-((2-((tert-butyldimethylsilyl)oxy)-6-oxo-6-(undecyloxy)hexyl)(2-((tert-butyldimethylsilyl)oxy)-8-(heptadecan-9-yloxy)-8-oxooctyl)amino)pentanoic acid [INT 112] (3.5 g, 2 eq., 3.41 mmol) in dichloromethane (17.6 mL), were added N, N-dimethyl-4-pyridylamine (1 g, 4.8 eq., 8.19 mmol) and EDC. HC1 (785 mg, 2.4 eq., 4.09 mmol) portion wise at 0°C and stirred for 15 min then (4-methylmorpholine-2.6-diyl)dimethanol [INT 17a] (275 mg, 1.71 mmol) was added at 0°C under nitrogen atmosphere. The reaction mixture was stirred RT for 16 h. The progress of reaction was monitored by TLC. After completion, reaction mixture was quenched with water (200.0 mL) & extracted by DCM (2x 200.0 mL). The organic layer dried over anhydrous sodium sulphate and reduced under vacuum. The crude was purified by silica gel flash column chromatography (0 to 10 % EA:hexane) to afford ((4-methylmorpholine-2,6-diyl)bis( 12, 12, 13, 13-tetramethyl-3-oxo- 10-(4-oxo-4-(undecyloxy)butyl)-2', H'-dioxa-8'-aza-12'-silatetradecane-l,8-diyl))bis(6-((tert-butyldimethylsilyl)oxy)heptane-7,l-diyl) bis(2-octyldecanoate) [INT 113a] (1.8g, yield 48.4%) as a colourless liquid.Results:CAD analysis: Purity 91.79%, Calculated C₁₂₅H₂₄₉N₃O₁₇Si₄ = 2176.78, Observed = 1090.3 (m / z, M+H+ / 2).(((((4-methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis((2-hydroxy-6-oxo-6-(undecyloxy)hexyl)azanediyl))bis(6-hydroxyheptane-7,l-diyl) bis(2-octyldecanoate) (Compound 15, meso form)22581859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo the stirred solution of ((4-methylmorpholine-2,6-diyl)bis(12,12,13,13-tetramethyl-3-oxo-10-(4-oxo-4-(undecyloxy)butyl)-2',11'-dioxa-8'-aza-12'-silatetradecane-1,8-diyl))bis(6-((tert-butyldimethylsilyl)oxy)heptane-7,1-diyl) bis(2-octyldecanoate) [INT 113a] (1.8 g, 826 pmol) in tetrahydrofuran (30 mL), was added hydrogen fluoride-pyridine (4 mL) at 0°C temperature. The progress of reaction was monitored by ELSD. Reaction mixture was diluted with Et2O (50 mL), washed with cold water and brine solution. The organic layer was washed with with aq, NaHCO3(50 mL) followed by cold brine solution. Organic layer was dried over sodium sulphate and was evaporated to dryness. Crude compound was column purified at 3% MeOH-DCM to get (((((4-methylmorpholine-2,6-diyl)bis(methylene))bis(oxy))bis(5-oxopentane-5,l-diyl))bis((2-hydroxy-6-oxo-6-(undecyloxy)hexyl)azanediyl))bis(6-hydroxyheptane-7.1-diyl) bis(2-octyldecanoate) [Compound 15, meso form] (795 mg, yield 55.89%) as yellow oil.Results:¹H NMR (400 MHz, CDCl₃)- δ(ppm): 5.20-4.50 (m, 2H), 4.30-3.80 (m, 16H), 3.40-2.60 (m, 14H), 2.55-2.20 (m, 10H), 1.90-1.50 (m, 34H), 1.45-1.20 (m, 96H), 0.89-0.85 (t, J=6.4Hz,18H).ELSD analysis: Purity 99.9%, Calculated C₁₀₁H₁₉₃N₃O₁₇= 1720.43, Observed = 1721.70 (m / z, M+H+).CAD analysis: Purity 98.22 %, C₁₀₁H₁₉₃N₃O₁₇= 1720.43, Observed = 1721.44 (m / z, M+H+).Example 23: (4-(3-hydroxypropyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) (Compound 16, meso form)22681859815v2773158: SA9-886PC / / PAT25019-WO-PCTtert-butyl(3-iodopropoxy)dimethylsilane [INT 115]I^^^OTBDMS To a stirred solution of 3-iodo-l -propanol [INT 114] (5 g, 26.9 mmol) in di chloromethane (46.2 mL, 722 mmol), were added IH-imidazole (3.66 g, 2 eq., 53.8 mmol), and tert- butyl(chloro)dimethylsilane (8.1 g, 2 eq., 53.8 mmol) at RT, allowed to stir at rt for 48 h.After completion the reaction, the mixture was washed with saturated brine solution (2x 30 mL). The organic layer was dried over sodium sulphate and concentrated under reduced pressure. The crude was purified by flash column chromatography (S1O20-2 % ethyl acetate in hexane) to obtain tert-butyl(3-iodopropoxy)dimethylsilane [INT 115] (6.5g, yield 79.7%) as colourless liquid.Results:Results: 1H-NMR (400MHz, CDCl₃)- δ 3.66 (t, J=6.0Hz, 2H), 3.28 (t, J=6.8Hz, 2H), 2.06-1.97 (m, 2H), 0.89 (s, 9H), 0.07 (s, 6H).(4-(3-((tert-butyldimethylsilyl)oxy)propyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2- ((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 116a]22781859815v2773158: SA9-886PC / / PAT25019-WO-PCTTo a stirred solution of starting material morpholine-2,6-diylbis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 21a] (1 g, 661 pmol) in acetonitrile (7.5 mL, 144 mmol), tetrahydrofuran (7.5 mL, 92.2 mmol) were added dipotassium carbonate (457 mg, 5 eq., 3.31 mmol) and tert-butyl(3-iodopropoxy)dimethylsilane [INT 115] (298 mg, 1.5 eq., 992 pmol). Reaction mixture was allowed to keep at 90°C temperature for 16 h. Reaction was monitored by checking TLC / ELSD. Solid dipotassium carbonate was removed by filtration and concentrated. Residue was diluted with water (30 mL) and extracted with ethyl acetate (2x 25 mL), dried over sodium sulphate and concentrated under reduced pressure. The crude was purified by column chromatography using 0-10% EtOAc in heptane to afford (4-(3-((tert-butyldimethylsilyl)oxy)propyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 116a] (0.5 g, yield 44.4%) as colourless liquid.Results:EELSD analysis'. Purity 98.76%, Calculated: C₉₅H₁₉₉N₃O₁₀Si₅ = 1682.40, Observed = 1683.15 (m / z, M+H+).(4-(3-hydroxypropyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) (Compound 16, meso form)To a stirred solution of starting material (4-(3-((tert-butyldimethylsilyl)oxy)propyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-((tert-butyldimethylsilyl)oxy)dodecyl)amino)butanoate) [INT 116a] (550 mg, 327 pmol) in tetrahydrofuran (10.9 mL, 134 mmol), was added hydrogen fluoride — pyridine (1 / 1) (12922881859815v2773158: SA9-886PC / / PAT25019-WO-PCTmg, 4 eq., 1.31 mmol) at 0°C. Reaction mixture was allowed to keep at room temperature for 16h. Reaction progress was monitored by checking TLC / ELSD. Reaction mixture was diluted with diethyl ether (20 mL) and washed with cold water (2x 20 mL). Now organic layer was washed with aq. NaHCO3solution (2x 25 mL) and fresh water (25 mL). Collected organic layer was dried over sodium sulphate and concentrated under reduced pressure. The crude compound was purified over silica 0-10% MeOH / DCM fraction was evaporated to get the (4-(3-hydroxypropyl)morpholine-2,6-diyl)bis(methylene) bis(4-(bis(2-hydroxydodecyl)amino)butanoate) [Compound 16, meso form] (180 mg, yield 49.5%) as a colourless liquid.Results:1H-NMR (400MHz, CDCl₃)- δ 5.20-4.70 (m, 2H), 4.45-4.00 (m, 10H), 3.79 (s, 2H), 3.50-3.00 (m, 17H), 2.70-2.50 (m, 5H), 2.19 (br, 4H), 1.99 (br, 2H), 1.52-1.10 (m, 71H), 0.87 (t, J=6.4 Hz, 12H)ELSD analysis: Purity 99.83 %, Calculated C₆₅H₁₂₉N₃O₁₀ = 1111.97, Observed = 1112.85 (m / z, M+H+).Example 24: Synthesis of (4-(4-hvdroxybutyl)niorpholine-2,6-diyDbis(methylene) bis(4- (bis(2-hydroxydodecyl)amino)butanoate) (Compound 17, meso form)22981859815v2773158: SA9-886PC / / PAT25019-WO-PCTtert-butyl(4-bromobutoxy)dimethylsilane [INT 118]„ / \ / \. OTBDMSBrTo a stirred solution of 4-bromo-l -butanol [INT 117] (5 g, 32.7 mmol) in dichloromethane (56.2 mL, 878 mmol), were added IH-imidazole (4.45 g, 2 eq., 65.4 mm...

Claims

773158: SA9-886PC / / PAT25019-WO-PCTCLAIMS1. A compound having a structure according to Formula (I):(I),or a pharmaceutically acceptable salt thereof, wherein:each X is independently for each occurrence -C(1-8)alkylene-;-;each Y is independently for each occurrence -C(1-8)alkylene-;R1independently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selectedfrom the group consisting of -OH,R2independently for each occurrence is -C<4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted w ith one or two substituents independently selectedfrom the group consisting of -OH,R3is H, -C(1-8)alkyl, or -C(O)-C(1-8)alkyl, wherein the C(1-8)alkyl and -C(O)-C(1-8)alkyl are optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl;RAindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl;30481859815v2773158: SA9-886PC / / PAT25019-WO-PCTRBindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C<4- 30)alkynyl;RNindependently for each occurrence is H or -C(i-3)alkyl; andn is 1-10.

2. A compound having a structure according to Formula (I):R< AC XX AY, R2R1L ) R1NIR3(I),or a pharmaceutically acceptable salt thereof, wherein:each X is independently for each occurrence -C(1-8)alkylene-;-;each Y is independently for each occurrence -C(1-8)alkylene-;R1independently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected^A0 / RAYfrom the group consisting of -OH,u, and °;R2independently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected0 / RAYfrom the group consisting of -OH,u, and0;R3is H, -C(1-8)alkyl, or -C(O)-C(1-8)alkyl, wherein the C(1-8)alkyl and -C(O)-C(1-8)alkyl are optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5- to 10-membered heteroaryl;RAindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl;30581859815v2773158: SA9-886PC / / PAT25019-WO-PCTRBindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl;RNindependently for each occurrence is H or -C(1-3)alkyl; andn is 1-10.

3. The compound of claim 1 or claim 2, or a pharmaceutically acceptable salt thereof, wherein each X is -CH2-.

4. The compound of any one of claims 1-3, or a pharmaceutically acceptable saltthereof, wherein L independently for each occurrence is5. The compound of any one of claims 1-4, having a structure according to Formula Ic:or a pharmaceutically acceptable salt thereof.

6. The compound of any one of claims 1-5, or a pharmaceutically acceptable salt thereof, wherein each Y is -C(2-4)alkylene-.

7. The compound of any one of claims 1-6, or a pharmaceutically acceptable salt thereof, wherein Y independently for each occurrence is -CH2CH2CH2- or -CH2CH2CH2CH2-8. The compound of any one of claims 1-7, having a structure according to Formula Ic-i:R130681859815v2773158: SA9-886PC / / PAT25019-WO-PCT(Ic-i),or a pharmaceutically acceptable salt thereof.

9. The compound of any one of claims 1-7, having a structure according to Formula Ic-n:or a pharmaceutically acceptable salt thereof.

10. The compound of any one of claims 1-7, having a structure according to Formula Ic-iii:or a pharmaceutically acceptable salt thereof.

11. The compound of any one of claims 1-10, or a pharmaceutically acceptable salt thereof, wherein R1independently for each occurrence is -C(4-30)alkyl or -C(4-30)alkenyl, each of which is optionally substituted with one or two substituents selected from the groupconsisting of -OH,12. The compound of any one of claims 1-11, or a pharmaceutically acceptable salt thereof, wherein R1independently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl, each of which is optionally substituted with one or two substituents selected from the groupconsisting of -OH,30781859815v2773158: SA9-886PC / / PAT25019-WO-PCT13. The compound of any one of claims 1-12, or a pharmaceutically acceptable salt thereof, wherein R1independently for each occurrence is -C(8-20)alkenyl that is optionally substituted with a -OH group.

14. The compound of any one of claims 1-12, or a pharmaceutically acceptable salt thereof, wherein R1independently for each occurrence is -C(4-20)alkyl that is optionally substituted with one or two substituents selected from the group consisting of -OH,15. The compound of any one of claims 1-12 and 14, or a pharmaceutically acceptable salt thereof, wherein R1independently for each occurrence is -C(8-20)alkyl that is optionally substituted with a -OH group.

16. The compound of any one of claims 1-12 and 14, or a pharmaceutically acceptable salt thereof, wherein R1independently for each occurrence is -C(4-io)alkyl, wherein the -C<4-lojalkyl is substituted with one substituent selected fromand wherein the -C(4-10)alkyl is optionally further substituted with one -OH group.

17. The compound of any one of claims 1 and 3-10, or a pharmaceutically acceptable salt thereof, wherein R1independently for each occurrence is -C(4-20)alkyl that is optionally substituted with one or two substituents independently selected from the group consisting of -18. The compound of any one of claims 1-17, or a pharmaceutically acceptable salt thereof, wherein R2independently for each occurrence is -C(4-30)alkyl or -C(4-30)alkenyl, each30881859815v2773158: SA9-886PC / / PAT25019-WO-PCTof which is optionally substituted with one or two substituents selected from the group O \ o RBconsisting of -OH, Yux, and Y019. The compound of any one of claims 1-18, or a pharmaceutically acceptable salt thereof, wherein R2independently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl, each of which is optionally substituted with one or two substituents selected from the groupconsisting of -OH,u, and020. The compound of any one of claims 1-19, or a pharmaceutically acceptable salt thereof, wherein R2independently for each occurrence is -C<8-20)alkenyl that is optionally substituted with a -OH group.

21. The compound of any one of claims 1-19, or a pharmaceutically acceptable salt thereof, wherein R2independently for each occurrence is -C(4-20)alkyl that is optionally substituted with one or two substituents selected from the group consisting of -OH,22. The compound of any one of claims 1-19 and 21, or a pharmaceutically acceptable salt thereof, wherein R2independently for each occurrence is -C(8-20)alkyl that is optionally substituted with a -OH group.

23. The compound of any one of claims 1-19 and 21, or a pharmaceutically acceptable salt thereof, wherein R2independently for each occurrence is -C(4-10)alkyl, wherein the -C<4-io)alkyl is substituted with one substituent selected fromu, and O, and wherein the -C(4-10)alkyl is optionally further substituted with one -OH group.

24. The compound of any one of claims 1-17, or a pharmaceutically acceptable salt thereof, wherein R2independently for each occurrence is -C(4-20)alkyl that is optionally81859815v2773158: SA9-886PC / / PAT25019-WO-PCTsubstituted with one or two substituents independently selected from the group consisting of -25. The compound of any one of claims 1-12, 14, 16-19, 21, 23, and 24, or a pharmaceutically acceptable salt thereof, wherein RAindependently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl.

26. The compound of any one of claims 1-12, 14, 16-19, 21, and 23-25, or a pharmaceutically acceptable salt thereof, wherein each RAis -C(4-20)alkyl.

27. The compound of any one of claims 1-12, 14, 16-19, 21, and 23-25, or a pharmaceutically acceptable salt thereof, wherein each RAis -C(4-20)alkenyl.

28. The compound of any one of claims 1-12, 14, 16-19, 21, and 23-27, or a pharmaceutically acceptable salt thereof, wherein RBindependently for each occurrence is -C(4-20)alkyl or -C(4-20)alkenyl.

29. The compound of any one of claims 1-12, 14, 16-19, 21, and 23-28, or a pharmaceutically acceptable salt thereof, wherein each RBis -C(4-20)alkyl.

30. The compound of any one of claims 1-12, 14, 16-19, 21, and 23-28, or a pharmaceutically acceptable salt thereof, wherein each RBis -C(4-20)alkenyl.

31. The compound of any one of claims 1-10, or a pharmaceutically acceptable salt thereof, wherein R1and R2are independently for each occurrence selected from the group consisting of:OH31081859815v2773158: SA9-886PC / / PAT25019-WO-PCTOH 0OOOO32. The compound of any one of claims 1-10, or a pharmaceutically acceptable salt thereof, wherein R1and R2are independently for each occurrence selected from the group consisting of:OHOO31181859815v2773158: SA9-886PC / / PAT25019-WO-PCT33. The compound of any one of claims 1-32, or a pharmaceutically acceptable salt thereof, wherein R3is H.

34. The compound of any one of claims 1-33, or a pharmaceutically acceptable salt thereof, wherein R3is -C(1-6)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(RN)2, -(OCH2CH2)n-OH, -(OCH2CH2)n-OCH3, and 5-to 6-membered heteroaryl.

35. The compound of any one of claims 1-32 and 34, or a pharmaceutically acceptable salt thereof, wherein R3is -C(1-6)alkyl that is optionally substituted with a substituent selected from the group consisting of -OH, -N(CH3)2, -(OCH2CH2)2-OH, and imidazolyl.

36. The compound of any one of claims 1-32, 34, and 35, or a pharmaceutically acceptable salt thereof, wherein R3is selected from the group consisting of -CH3,.0., and37. The compound of any one of claims 1-32 and 34-36, or a pharmaceutically acceptable salt thereof, wherein R3is -CH3 or38. The compound of any one of claims 1-32, or a pharmaceutically acceptable salt thereof, wherein R3is -C(O)-C(1-6)alkyl that is optionally substituted with -N(RN)2.31281859815v2773158: SA9-886PC / / PAT25019-WO-PCT39. The compound of any one of claims 1-32 and 38, or a pharmaceutically acceptablesalt thereof, wherein R3is / / / I I 7\ \ \ \ / / ° ° — - O OZZ— ^ '40. A compound selected from the group consisting of:1J J11) ) o — \— o o1 / O z—.o z— / A / Z / \'L2 o o oO izT Tr\ / r° O\ \ \ \ ° ° ' — ' —3 OH OH0 0. N. r JL,< o y y o o > / O - / — / / zrOH45 00 S?TJ. ¥031381859815v2773158: SA9-886PC / / PAT25019-WO-PCT6 0A 0 00H<y > Il IlII1Xx XX X xx.0^ xx X XX / X / X XX XX XX Zk X=X XX XX XxxXx_^xX^\=x^0Ax^xx'\xAXxN° | J O / X / X / N 1 n \- / \X'\x"OH L J L OH / / T 0\ oz / / X \ \ / T ° - ozx \ / ° - 07O n | A 0 || 0 II X '\xx x"'\ \x X^~X \x A^oA^ 'XX x'" X \x X^~X \X x"\ x' A 1 x A z\ \X / Ox Y ^ AW / \ / \N1 J J r A OT ^A o o k / \ A xx x\ x"x x"x / - x^X x^X / X / 01 ° To8 xx,^^ OH O A\ / "x^x' o o z Z——T O O xL x^ x^x x^x A x-x x-x x-x x' 0 A || || < ^x^ ^x^ ^x^O"xX \x N 1 ^ X / XX 'XXx^ o x Ox XX xx X xx^ xx 1Z-— T T 0 \-x \xN- x^x^x^^Ox / X^z^A 1 J > ° o o O OH ’i'HOX^ / ''~X\3'X / XXX / XXX / o 91A r\? *\ \ ° — ' r\ A * T\ \ ° ' — T / O - OH OH 10XXxXXXXXXXXX^ Q Q ^XXxXxxXXXXXX / N xX. Az, X / OxXx„ Ax^N\ r o Y Y °XXXXXXX-XXXXYHkhTHQXxXxXxXxXxzxx 1OH OH 11Xx-XXXXXX^ O 0 ^X^XxXxXXXXxXXXxxXXXx^0HNH00'xXXXXXXX 121331481859815v2773158: SA9-886PC / / PAT25019-WO-PCT31581859815v2773158: SA9-886PC / / PAT25019-WO-PCT 20 OH OH^- / ^XX / X / X / ^ Q0< / x JU o x YA Y. o > x / XX\XxxAOH Ho''A / / Tx / ''x'''^^\ \ / ° - O<°) ) O —— \^' O ■Z—. o^ roOH21 AO ) —7\ / A * °Zo< / —^1oz17or\ P *\ \ ° ' —22 OH OHJN ^X\AO^X / O-XXQ A / X o 'z~\X' - N)1) o —— / / I\<'N'> / OH2324 OH OHJAx\ / Ox / -x / N.< o Y |0X^X^X^^^X^^QI-I ^hY nQ / x^ / x^ / v / or a pharmaceutically acceptable salt thereof.31681859815v2773158: SA9-886PC / / PAT25019-WO-PCT31781859815v2773158: SA9-886PC / / PAT25019-WO-PCTor a pharmaceutically acceptable salt thereof.

43. A compound having a structure according to Formula (II):or a pharmaceutically acceptable salt thereof, wherein:X is -C(1-8)alkylene-;R1is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected from the group consisting of -R2is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl, each of which is optionally substituted with one or two substituents independently selected from the group consisting of -RAindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl; andRBindependently for each occurrence is -C(4-30)alkyl, -C(4-30)alkenyl, or -C(4-30)alkynyl.

44. The compound of claim 43, or a pharmaceutically acceptable salt thereof, wherein X is -C(1-4)alkylene-.

45. The compound of claim 43 or claim 44, or a pharmaceutically acceptable salt thereof, wherein R1is -C(4-io)alkyl, wherein the -C(4-10)alkyl is substituted with one substituent31881859815v2773158: SA9-886PC / / PAT25019-WO-PCTselected fromand wherein the -C(4-10)alkyl is optionally further substituted with one -OH group.

46. The compound of any one of claims claim 43-45, or a pharmaceutically acceptable salt thereof, wherein R2is -C(4-10)alkyl, wherein the -C(4-10)alkyl is substituted with onesubstituent selected fromand wherein the -C(4-10)alkyl is optionally further substituted with one -OH group.

47. The compound of any one of claims 43-46, or a pharmaceutically acceptable salt thereof, wherein each RAis -C(4-20)alkyl.

48. The compound of any one of claims 43-47, or a pharmaceutically acceptable salt thereof, wherein each RBis -C(4-20)alkyl.

50. A composition comprising:(1) one or more compound of any one of claims 1-49, or a pharmaceutically acceptable salt thereof,(2) one or more helper lipids,31981859815v2773158: SA9-886PC / / PAT25019-WO-PCT(3) one or more structural lipids, and(4) one or more stealth lipids.

51. The composition of claim 50, wherein the one or more helper lipids is selected from the group consisting of l,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE); 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC); l,2-dioleoyl-sn-glycero-3-phospho-L-serine (DOPS); l,2-dielaidoyl-sn-glycero-3-phosphoethanolamme (DEPE); and 1,2-dioleoyl-sn-glycero-3-phosphocholine (DPOC), dipalmitoylphosphatidylcholine (DPPC), 1,2-dilauroyl-sn-glycero-3-phosphocholine (DLPC), 1,2-Distearoylphosphatidylethanolamine (DSPE), or l,2-dilauroyl-sn-glycero-3 -phosphoethanolamine (DLPE), for example 1,2-dioleoyl-SN-glycero-3-phosphoethanolamine (DOPE).

52. The composition of claim 50 or claim 51, wherein the one or more structural lipids is a sterol-based lipid, for example a cholesterol-based lipid, for example cholesterol.

53. The composition of any one of claims 50-52, wherein the one or more stealth lipids is a PEG-modified lipid.

54. The composition of any one of claims 50-53, wherein the composition is a lipid nanoparticle, optionally a liposome.

55. The composition of claim 54, wherein the one or more compound of any one of claims 1-44 constitute(s) about 20 mol% to about 60 mol% of the lipid nanoparticle.

56. The composition of claim 54 or claim 55, wherein the one or more helper lipids constitute(s) about 10 mol% to about 50 mol% of the lipid nanoparticle.

57. The composition of any one of claims 54-56, wherein the one or more stealth lipid(s) constitute(s) about 1 mol% to about 4 mol% of the lipid nanoparticle.

58. The composition of any one of claims 43-46, wherein the one or more structural lipids constitute(s) about 10 mol% to about 50 mol% of the lipid nanoparticle.32081859815v2773158: SA9-886PC / / PAT25019-WO-PCT59. The composition of any one of claims 54-58, wherein the lipid nanoparticle encapsulates a nucleic acid.

60. The composition of claim 59, wherein the nucleic acid is an mRNA encoding a peptide or protein.

61. The composition of claim 60, wherein the lipid nanoparticles have an encapsulation percentage for mRNA of:(i) at least 50%;(ii) at least 55%;(iii) at least 60%;(iv) at least 65%;(v) at least 70%;(vi) at least 75%;(vii) at least 80%;(viii) at least 85%;(ix) at least 90%; or(x) at least 95%.

62. The composition of claim 61, wherein the lipid nanoparticles have an encapsulation percentage for mRNA of:(i) at least 85%;(ii) at least 90%; or(iii) at least 95%.

63. A vaccine comprising the composition of any one of claims 60-62.

64. The composition of any one of claims 60-62 for use in therapy.

65. The composition of any one of claims 60-62 for use in a method of treating or preventing a disease amenable to treatment or prevention by the peptide or protein encoded by the mRNA, optionally wherein the mRNA encodes an antigen and / or the disease is (a) a protein deficiency, optionally wherein the protein deficiency affects the liver, lung, brain or muscle, (b) an autoimmune disease, (c) an infectious disease, or (d) cancer.32181859815v2773158: SA9-886PC / / PAT25019-WO-PCT66. The composition for use according to claim 64 or claim 65, wherein the composition is administered intravenously, intrathecally, or intramuscularly, or by pulmonary delivery, optionally through nebulization.

67. The composition for use according to claim 66, wherein the composition is administered intramuscularly.

68. The composition for use according to claim 66, wherein the composition is administered intravenously.

69. A method for treating or preventing a disease wherein said method comprises administering to a subject in need thereof the composition of any one of claims 60-62 and wherein the disease is amenable to treatment or prevention by the peptide or protein encoded by the mRNA, optionally wherein the mRNA encodes an antigen and / or the disease is (a) a protein deficiency, optionally wherein the protein deficiency affects the liver, lung, brain or muscle, (b) an autoimmune disease, (c) an infectious disease, or (d) cancer.

70. The method of claim 69, wherein the composition is administered intravenously, intrathecally. or intramuscularly, or by pulmonary delivery, optionally through nebulization.

71. The method of claim 70, wherein the composition is administered intramuscularly.

72. The method of claim 70, wherein the composition is administered intravenously.32281859815v2

Images