Hypoimmunogenic human cell compositions and methods of making and use thereof

WO2026165387A1PCT designated stage Publication Date: 2026-08-06MASSACHUSETTS EYE & EAR INFARY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
MASSACHUSETTS EYE & EAR INFARY
Filing Date
2026-01-30
Publication Date
2026-08-06

Smart Images

  • Figure US2026013313_06082026_PF_FP_ABST
    Figure US2026013313_06082026_PF_FP_ABST
Patent Text Reader

Abstract

Disclosed herein are cells lacking ERAP1 or with an inactive ERAP1, which results in increased HLA-I immunocompatability (and reduced alloimmunity) relative to unmodified cells. These cells can be stem cells, such as iPSCs, or other cell types, including cell types differentiated from stem cells. Also disclosed herein are methods of using these ERAP1 inactivated cells for the treatment of various diseases and disorders.
Need to check novelty before this filing date? Find Prior Art

Description

HYPOIMMUNOGENIC HUMAN CELL COMPOSITIONS AND METHODS OF MAKING AND USE THEREOFRELATED APPLICATIONS

[0001] This application claims the benefit of U.S. Provisional Application No.63 / 751,786, filed January 30, 2025, the disclosure of which is incorporated herein by reference in its entirety.FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under Grant Number EY036033 and EY024602, awarded by the National Institutes of Health. The Government has certain rights in the invention.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0003] The contents of the electronic sequence listing (M105370061WO00-SEQ-RE.xml; Size: 4,474 bytes; and Date of Creation: January 30, 2026) is herein incorporated by reference in its entirety.BACKGROUND

[0004] Allogeneic cell-based therapies hold promise for treating a wide range of diseases and disorders. Unlike autologous cell therapies, which require significant effort in isolating, modifying, and expanding cells from the patient, allogeneic cell-based therapies offer a more scalable approach where therapeutic compositions can be prepared from healthy donors ahead of time. However, a persistent challenge in the field is immunogenicity posed by human leukocyte antigen (HLA) mismatches between donor and recipient cells. When transplanted cells express HLA molecules that differ from those of the recipient, the recipient’s immune system may recognize these cells as foreign and mount an alloimmune response, leading to graft rejection.

[0005] Current approaches to mitigate HLA-mediated alloimmunity include HLA matching between donors and recipients, which is time consuming and limited, and systemic immunosuppression, which poses significant complications. There is a need for alternative ways to overcome alloimmunity.SUMMARY

[0006] This summary is provided to introduce a selection of concepts in a simplified form that are further described below in the detailed description. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used as an aid in determining the scope of the claimed subject matter.

[0007] The present disclosure relates to modified cells lacking endoplasmic reticulum aminopeptidase 1 (ERAP) protein or comprising an ERAP1 protein that is inactive, resulting in the cells having increased HLA-I immunocompatability. Also provided herein are compositions comprising such cells, methods of producing such cells, and methods of treating conditions using such cells. In some embodiments, the modified cells are stem cells, which can be differentiated into various cell types. These modified cells, including modified stem cells and modified differentiated cells, can be used for allogeneic cell-based therapies with reduced risk of immune rejection.

[0008] Provided herein in some embodiments are modified cells lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified cell comprises increased human leukocyte antigen class-I (HLA-I) immunocompatibility relative to an unmodified cell.

[0009] In some embodiments, the modified cell lacks ERAP1 protein and / or the ERAP1 protein is inactive due to an inactivating mutation in an endogenous ERAP1 gene of the modified cell. In some embodiments, the inactivating mutation comprises a deletion, substitution, or insertion of one or more nucleotides in a genomic sequence of the endogenous ERAP1 gene. In some embodiments, the inactivating mutation is introduced by a Cas protein and a gRNA targeting the endogenous ERAP1 gene.

[0010] In some embodiments, the modified cell lacks ERAP1 protein and / or the ERAP1 protein is inactive due to RNA interference or an ASO. In some embodiments, RNAi molecule or ASO comprises a region of complementarity to an ERAP1 sequence.

[0011] In some embodiments, the modified cell expresses a peptide-free HLA-I molecule.

[0012] In some embodiments, the modified cell expresses an HLA-I molecule comprising a low-affinity peptide.

[0013] In some embodiments, the modified cell is a stem cell. In some embodiments, the modified cell is an induced pluripotent stem cell (iPSC).

[0014] In some embodiments, the modified cell is a limbal epithelial stem cell (LSC).

[0015] In some embodiments, the modified cell is a Retinal Pigment Epithelium (RPE) cell.

[0016] In some embodiments, the modified cell is a Corneal Endothelial Cell (CEnC).

[0017] In some embodiments, the modified cell is a fibroblast.

[0018] In some embodiments, the modified cell is a cardiomyocyte.

[0019] In some embodiments, the modified cell is further a pancreatic P cell.

[0020] In some embodiments, the modified cell is a hepatocyte.

[0021] In some embodiments, the modified cell is mammalian.

[0022] In some embodiments, the modified cell is human.

[0023] In some embodiments, the increased HLA-I immunocompatibility comprises reduced CD8+ T cell-mediated cytotoxicity and / or non-increased or reduced natural killer (NK) cell-mediated cytotoxicity.

[0024] Also provided herein are compositions comprising any of the modified cells or other cells disclosed herein. In some embodiments, the compositions further comprise a pharmaceutically acceptable carrier or diluent.

[0025] Also provided herein are methods of producing modified cells for allogeneic cell-based therapies. In some embodiments, the methods comprise obtaining unmodified cells, and introducing an inactivating mutation in an endogenous ERAP1 gene to the unmodified stem cells, or introducing an RNAi molecule or ASO targeting ERAP1 to the unmodified cells to generate modified stem cells. In some embodiments, the RNAi molecule or ASO comprises a region of complementarity to an ERAP1 sequence. In some embodiments, the unmodified cells are stem cells. In some embodiments, the unmodified cells are iPSCs. In some embodiments, if the modified cells are modified stem cells, the methods further comprise a step of differentiating the modified stem cells into ectodermal, mesodermal, endodermal, and / or neural crest cells and / or cell lineages. In some embodiments, the inactivating mutation is introduced by a Cas protein and a gRNA targeting the endogenous ERAP1 gene.

[0026] In some embodiments, the modified stem cells are differentiated into ectodermal lineage cells. In some embodiments, the modified stem cells are differentiated into limbal stem cells (LSCs), neuronal cells, or skin epithelial cells.

[0027] In some embodiments, the modified stem cells are differentiated into mesodermal lineage cells. In some embodiments, the modified stem cells are differentiated into fibroblasts, cardiomyocytes, myocytes, osteocytes, or nephrons.

[0028] In some embodiments, the modified stem cells are differentiated into endodermal lineage cells. In some embodiments, the modified stem cells are differentiated into pancreatic p cells or hepatocytes.

[0029] In some embodiments, the modified stem cells are differentiated into neural crest lineage cells. In some embodiments, the modified stem cells are differentiated into CEnC or RPE cells.

[0030] Also provided herein are methods of treating a condition in need of cell transplantation. In some embodiments, the methods comprise administering to the subject an effective amount of any of the modified cells disclosed herein or any of the compositions disclosed herein.

[0031] Also provided herein are methods of treating an ocular condition in a subject in need thereof. In some embodiments, the methods comprise administering to the subject an effective amount of a population of LSCs, RPE cells, and / or CEnC, where the LSCs, RPE cells, and / or CEnC lack ERAP1 protein or comprise an inactive ERAP1 protein . In some embodiments, the LSCs are any of the LSCs disclosed herein. In some embodiments, the RPE cells are any of the RPE cells disclosed herein. In some embodiments, the CEnC are any of the CEnC disclosed herein.

[0032] In some embodiments, the ocular condition is selected from age-related macular degeneration (AMD), retinitis pigmentosa (RP), Stargardt disease, glaucoma, corneal disorders like limbal stem cell deficiency, diabetic retinopathy, inherited retinal degeneration, comeal dystrophies, post-infection ocular scarring, ocular surface failure after trauma and / or chemical injury.

[0033] Also provided herein are methods of treating diabetes in a subject in need thereof. In some embodiments, the method comprises administering to the subject an effective amount of a population of pancreatic P cells that lack ERAP1 protein or comprise an inactive ERAP1 protein. In some embodiments, the pancreatic P cells are any of the pancreatic P cells disclosed herein.

[0034] The foregoing general description of the illustrative embodiments and the following detailed description thereof are merely exemplary aspects of the teachings of this disclosure and are not restrictive.BRIEF DESCRIPTION OF FIGURES

[0035] Non-limiting and non-exhaustive examples are described with reference to the following figures.

[0036] FIG. 1A depicts an evaluation of immune escape by wild-type (WT) and ERAP1 knockout (KO) induced pluripotent stem cells (iPSCs) using a pluripotent cell-derivedgraft formation assay in immunodeficient (NSG) mice and mice with a humanized immune system (HIS).

[0037] FIG. IB depicts a quantification of weights of pluripotent cell-derived grafts generated from WT and ERAP1 KO iPSCs in immunodeficient (NSG) mice and in mice with a humanized immune system (HIS). Individual data points represent grafts from individual mice; bars indicate mean ± SD. Graft weight is shown in grams (g).

[0038] FIG.2A depicts a plot of surface expression of HLA class I in WT and ERAP1 KO iPSCs.

[0039] FIG.2B depicts a plot of surface expression of HLA class II in WT and ERAP1 KO iPSCs.

[0040] FIG. 3A depicts an exemplary workflow for isolation and mass spectrometric analysis of HLA class I-associated peptides.

[0041] FIG. 3B depicts a graph showing the total number of HLA class I-associated peptides identified in WT and ERAP1 KO iPSCs.

[0042] FIG.3C depicts a graph showing length distribution of HLA class I-associated peptides in WT and ERAP1 KO iPSCs.

[0043] FIG. 4A depicts differentiation of WT and ERAP1 KO iPSCs into corneal limbal stem cells (LSCs). Scale bar: 100 pm.

[0044] FIG. 4B depicts differentiation of WT and ERAP1 KO iPSCs into retinal pigment epithelial (RPE) cells. Scale bar: 50 pm.

[0045] FIG. 4C depicts differentiation of WT and ERAP1 KO iPSCs into corneal endothelial cells (CEnCs). Scale bar: 100 pm.

[0046] FIG. 4D depicts differentiation of WT and ERAP1 KO iPSCs into fibroblastlike cells.

[0047] FIG. 4E depicts immuno staining of WT and ERAP1 KO-derived fibroblastlike cells. Scale bar: 100 pm.

[0048] FIG. 5A depicts Calcein-AM stained images showing that ERAP1 deletion reduces allogenic PBMC-mediated cytotoxicity in iPSC-derived limbal stem cells (iLSCs). Dotted lines indicate areas of cell loss or damage resulting from PBMC-mediated cytotoxicity.

[0049] FIG. 5B depicts a lactate dehydrogenase (LDH) assay graph showing that ERAP1 deletion reduces allogenic PBMC-mediated cytotoxicity in iPSC-derived limbal stem cells (iLSCs). Data are presented as mean ± SD from four independent experiments (n = 4). ****p < 0.0001.

[0050] FIGs. 5C-5D depict flow cytometry plots showing that ERAP1 deletion in iPSC-derived limbal stem cells (iLSCs) reduces CD8+T cell degranulation without affecting NK cell responses. FIG. 5C depicts dot plots of CD107a expression on CD8+cytotoxic T lymphocytes. FIG. 5D depicts dot plots of CD107a expression on CD56+NK cells.

[0051] FIG.6 depicts an exemplary experimental design for assessment of alloimmune responses to WT and ERAP1 KO iPSC-derived limbal stem cells (iLSCs) in mice with a humanized immune system.

[0052] FIGs. 7A-7B depict flow cytometry plots showing induction of alloimmunity to WT and ERAP1 KO iPSC-derived limbal stem cells (iLSCs) in humanized mice. FIG. 7A depicts dot plots of IFN-y expression in total T cells. FIG. 7B depicts dot plots of CD 107a expression on NK cells.

[0053] FIG. 7C depicts histochemical images showing reduced infiltration of inflammatory cells at the injection site in ERAP1 KO iPSC-derived limbal stem cells (iLSCs) compared with WT iLSCs. Dashed boxes indicate regions shown at higher magnification in adjacent panels, and dotted outlines highlight iLSC colonies.

[0054] FIG. 7D depicts an immunohistochemical analysis showing reduced CD45+immune cell infiltration at injection sites of ERAP1 KO iPSC-derived limbal stem cells (iLSCs) compared with WT iLSCs.

[0055] FIG.7E depicts an immunohistochemical analysis showing survival of ERAP 1 KO iPSC-derived limbal stem cells (iLSCs) in vivo.

[0056] FIG. 8 depicts an exemplary schematic of the six-stage differentiation protocol for hiPSC-derived pancreatic P cells.

[0057] FIGs. 9A-9B depict images showing that ERAP1 deletion does not affect differentiation of iPSCs into pancreatic P-cell clusters. FIG. 9A depicts representative bright-field images of WT and ERAP1 KO iPSCs during stepwise differentiation from stage 1 through stage 4, showing stage-specific morphological changes characteristic of pancreatic lineage commitment. FIG. 9B depicts representative images of the differentiation process following stage 5, where differentiated cells were transferred to static microwell plates to promote three-dimensional (organoid-like) cell clusters. Representative images show the morphology and size of the clusters as they mature into pancreatic P-cell aggregates, with similar cluster formation observed for both WT and ERAP1 KO iPSCs.

[0058] FIG. 9C depicts graphs showing downregulation of pluripotency markers during early differentiation of WT and ERAP1 KO iPSCs as measured by qRT-PCR. Data are presented as mean ± SD.

[0059] FIG. 9D depicts graphs showing that ERAP1 deletion does not affect differentiation of iPSCs toward pancreatic progenitor and P-cell lineages as measured by qRT-PCR. Data are presented as mean ± SD.

[0060] FIG. 9E depicts graphs showing that ERAP1 deletion does not affect further maturation of iPSC-derived pancreatic [3-cells as measured by qRT-PCR. Data are presented as mean ± SD.

[0061] FIG. 9F depicts images and graphs showing that ERAP1 deletion reduces allogenic human PBMC-mediated cytotoxicity of iPSC-derived pancreatic P-cell clusters. Bar graphs represent mean ± SD; ****p < 0.0001.

[0062] FIGs. 9G-9I depict flow cytometry plots of alloantigen-primed peripheral blood mononuclear cells (PBMCs) following coculture with WT or ERAP1 KO pancreatic P-cell clusters. Representative dot plots show IFN-y expression (FIG. 9G) and CD107a (FIG.9H) surface expression on CD8+cytotoxic T lymphocytes (CTLs), and CD107a expression on CD56+natural killer (NK) cells (FIG.91). Isotype controls and PBMC-only controls are shown for reference.DETAILED DESCRIPTION

[0063] The following description sets forth exemplary aspects of the present disclosure. It should be recognized, however, that such description is not intended as a limitation on the scope of the present disclosure. Rather, the description also encompasses combinations and modifications to those exemplary aspects described herein.

[0064] The present disclosure, in some embodiments, relates to hypoimmunogenic cell compositions and methods for generating such compositions. Allogeneic cell-based therapies involve transplanting cells from a donor into a recipient who is genetically distinct from the donor. A challenge associated with allogeneic cell-based therapies is immune rejection of the transplanted cells by the recipient's immune system. The recipient's immune system may recognize the transplanted cells as foreign and mount an immune response against the transplanted cells, leading to destruction of the transplanted cells and failure of the therapy.

[0065] Human leukocyte antigen class I (HLA-I) molecules play a role in the immune recognition of transplanted cells. HLA-I molecules are expressed on the surface of nucleated cells and present peptide antigens to CD8+ T cells. When a CD8+ T cell recognizes a foreign peptide presented by an HLA-I molecule, the CD8+ T cell can become activated and kill the cell presenting the foreign peptide. In the context of allogeneic cell-based therapies, differencesin HLA-I molecules between the donor and recipient can lead to recognition of the transplanted cells as foreign by the recipient's CD8+ T cells.

[0066] Endoplasmic reticulum aminopeptidase 1 (ERAP1) is an enzyme that trims peptides to appropriate lengths in the endoplasmic reticulum before the peptides are loaded onto MHC class I molecules (HLA-1 molecules in humans) and presented at the cell surface. As disclosed herein, inactivation of ERAP 1 alters the repertoire of peptides presented by HLA-I molecules. In the absence of functional ERAP1, peptide precursors are not trimmed to the appropriate length for stable binding to HLA-I molecules. As a result, HLA-I molecules are presented on the cell surface in a peptide-free form or loaded with low-affinity peptides that do not bind stably to the HLA-I molecules. Cells expressing peptide-free HLA-I molecules or HLA-I molecules loaded with low-affinity peptides exhibit reduced recognition by CD8+ T cells.

[0067] As provided herein, cells are modified to inactivate ERAP1. These modified cells exhibit hypoimmunogenicity. When the modified cells are stem cells, such as iPSCs, they can also be differentiated into various cell types and lineages that also have inactivated ERAP1 and exhibit hypoimmunogenicity. These stem cells and differentiated cells can be used in allogeneic cell-based therapies for the treatment of various diseases and disorders.

[0068] As used herein, the term "stem cell" refers to a cell that has the capacity for selfrenewal and the ability to differentiate into one or more specialized cell types. In some embodiments, stem cells include embryonic stem cells, adult stem cells, and induced pluripotent stem cells. In some embodiments, the stem cells are mammalian. In some embodiments, the stem cells are human.

[0069] As used herein, the term "induced pluripotent stem cell" or "iPSC" refers to a pluripotent stem cell generated by reprogramming a somatic cell to a pluripotent state. Reprogramming can be achieved by introducing reprogramming factors to a somatic cell. iPSCs have the capacity to differentiate into cell types derived from all three germ layers (ectoderm, mesoderm, and endoderm) as well as neural crest cells.

[0070] As used herein, the term "ERAP1" or "endoplasmic reticulum aminopeptidase 1" refers to an aminopeptidase enzyme localized in the endoplasmic reticulum that trims peptide precursors to generate peptides of appropriate length for loading onto MHC class I molecules. ERAP1 may also be referred to as ARTS-1 (aminopeptidase regulator of TNFR1 shedding) or PILS-AP (puromycin-insensitive leucyl-specific aminopeptidase). An exemplary ERAP1 gene sequence is accessible under NCBI Gene ID 51752. Exemplary ERAP1 transcript sequences are provided under NCBI Accession Nos. NM_001040458.3, NM_001349244.2,NM_016442.5, NM.001198541.3, XM_005272015.6, XM_005272016.5, XM_011543484.3, XM_011543485.3, XM_0 17009581.2, XM.047417305.1, XM.047417306.1, XM_047417307.1, XM.047417308.1, XM.047417309.1, XM 047417310.1, XM_011543486.4, XM_017009583.3, XM_047417311.1, XM_047417312.1.

[0071] Additional information regarding ERAP1 may be found in Peaper & Cresswell. Regulation of MHC Class Assembly and Peptide Binding, Annu. Rev. Cell Dev. Biol. (2008);24:343-68 and Chang et al. The ER aminopeptidase, ERAP1, trims precursors to lengths of MHC class I peptides by a “molecular ruler” mechanism. PNAS (2005); 102(47): 17107-17112, each of which is hereby expressly incorporated by reference in its entirety.

[0072] As used herein, the term "lacking ERAP1 protein" refers to a cell in which ERAP1 protein is not expressed or is not detectable. In some embodiments, a cell lacking ERAP1 protein comprises an inactivating mutation in the endogenous ERAP1 gene that prevents production of ERAP1 protein, such as, but not limited to, a frameshift mutation, a premature stop codon, or a deletion of all or a portion of the ERAP1 gene. In some embodiments, a cell lacking ERAP1 protein comprises reduced or absent ERAP1 mRNA expression, such as due to transcriptional silencing, RNA interference, or antisense oligonucleotide-mediated knockdown. In some embodiments, a cell lacking ERAP1 protein comprises targeted degradation of ERAP1 protein. In some embodiments, ERAP1 protein expression, or lack thereof, is assessed by Western blotting, immunofluorescence, flow cytometry, enzyme-linked immunosorbent assay (ELISA), or mass spectrometry, or any combination thereof.

[0073] As used herein, the term "comprising an ERAP1 protein that is inactive" or "comprising an inactive ERAP1 protein" refers to a cell that expresses an ERAP1 protein with reduced or absent aminopeptidase activity compared to a wild-type ERAP1 protein. In some embodiments, an inactive ERAP1 protein is due to a mis sense mutation that alters one or more amino acid residues in the ERAP1 protein, such as the active site or substrate-binding domain of the ERAP1 protein. In some embodiments, an inactive ERAP1 protein is due to a truncating mutation that removes a portion of the ERAP1 protein required for enzymatic activity. In some embodiments, an inactive ERAP1 protein is due to a mutation that disrupts proper folding or localization of the ERAP1 protein. In some embodiments, an inactive ERAP1 protein is expressed at levels comparable to wild-type ERAP1 protein but lacks the ability to trim peptide precursors to the appropriate length for loading onto HLA-I molecules. In some embodiments, ERAP1 activity is assessed by analysis of the peptide repertoire presented by HLA-I molecules, or any combination thereof.

[0074] As used herein, the term "inactivating mutation" refers to a genetic alteration that reduces or eliminates the function of a gene or the protein encoded by the gene. In some embodiments, an inactivating mutation comprises a deletion, substitution, or insertion of one or more nucleotides in a genomic sequence. In some embodiments, an inactivating mutation comprises a frameshift, nonsense mutations, promoter or start codon disruptions, premature stop codon, or disruption of a splice site. In some embodiments, an inactivating mutation results in production of a non-functional protein or may prevent production of the protein. In some embodiments, the inactivating mutation can be introducing using gene editing approaches such as RNA-guided DNA endonucleases (such as CRISPR), zinc finger nucleases, TALENs, or meganucleases.

[0075] As used herein, the term "RNA interference" or "RNAi" refers to a cellular mechanism in which small RNA molecules inhibit gene expression by targeting messenger RNA (mRNA) molecules for degradation or translational repression. RNAi can be mediated by small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), or artificial microRNA (amiRNA). In some embodiments, RNAi is used for the transient reduction of gene expression. In some embodiments, RNAi is used for the stable and heritable reduction of gene expression when the RNAi-inducing molecule is expressed from an integrated DNA construct.

[0076] As used herein, the term "antisense oligonucleotide" or "ASO" refers to a singlestranded oligonucleotide that is complementary to a target mRNA sequence and inhibits expression of the gene encoding the target mRNA. In some embodiments, an ASO inhibits gene expression by promoting RNase H-mediated degradation of the target mRNA. In some embodiments, an ASO inhibits gene expression by steric blockade of translation. In some embodiments, an ASO inhibits gene expression by modulating pre-mRNA splicing. In some embodiments, ASOs can comprise chemical modifications to enhance stability, binding affinity, and / or cellular uptake.

[0077] As used herein, the term "region of complementarity" refers to a portion of a nucleic acid molecule, such as a siRNA, shRNA, miRNA, ASO, or gRNA, that is complementary to a target nucleic acid sequence. In some embodiments, the region of complementarity is fully complementary to the target sequence, meaning that each nucleotide in the region of complementarity forms a Watson-Crick base pair with a corresponding nucleotide in the target sequence. In some embodiments, the region of complementarity is partially complementary to the target sequence, meaning that one or more mismatches, insertions, or deletions are present between the region of complementarity and the targetsequence. In some embodiments, the region of complementarity is at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, or at least 30 nucleotides in length. In some embodiments, the region of complementarity is about 15 to about 30 nucleotides in length, about 17 to about 25 nucleotides in length, or about 19 to about 23 nucleotides in length. In some embodiments, the region of complementarity is at least 80%, at least 85%, at least 90%, at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99%, or 100% complementary to the target sequence.

[0078] As used herein, the term "HLA-I" or "human leukocyte antigen class I" refers to a class of major histocompatibility complex (MHC) molecules expressed on the surface of nucleated cells. HLA-I molecules present peptide antigens to CD8+ T cells. HLA-I molecules include HLA-A, HLA-B, and HLA-C molecules.

[0079] As used herein, the term "immunocompatibility" refers to the degree to which cells or tissues are tolerated by the immune system of a recipient without eliciting an immune response. Increased HLA-I immunocompatibility refer to reduced recognition and / or reduced destruction of cells by immune effector cells such as CD8+ T cells and / or NK cells.

[0080] As used herein, the term "hypoimmunogenicity" or "hypoimmunogenic" refers to a reduced capacity of a cell or tissue to provoke an immune response when introduced into an allogeneic recipient.

[0081] As used herein, the phrase "peptide-free HLA-I molecule" refers to an HLA-I molecule that is present on the cell surface without a peptide bound in the peptide-binding groove of the HLA-I molecule. In unmodified cells with functional ERAP1, peptide precursors are trimmed by ERAP1 in the endoplasmic reticulum to generate peptides of appropriate length (typically 8-10 amino acids) for stable binding to HLA-I molecules. The trimmed peptides bind to HLA-I molecules in the endoplasmic reticulum, and the peptide-HLA-I complexes are transported to the cell surface. In cells comprising an inactivating mutation in the endogenous ERAP1 gene, peptide precursors may not be trimmed to the appropriate length for stable binding to HLA-I molecules. As a result, HLA-I molecules can be transported to the cell surface without bound peptides. Peptide-free HLA-I molecules do not effectively engage T cell receptors on allogeneic CD8+ T cells, thereby reducing CD8+ T cell-mediated cytotoxicity.

[0082] As used herein, the phrase "HLA-I molecule comprising a low-affinity peptide" refers to an HLA-I molecule that is loaded with a peptide that binds with reduced binding affinity compared to peptides generated by ERAP1 trimming in unmodified cells. In cells comprising an inactivating mutation in the endogenous ERAP1 gene, peptide precursors thatare not trimmed by ERAP1 may still be loaded onto HLA-I molecules. However, these untrimmed or improperly trimmed peptides can have suboptimal length or sequence characteristics for stable binding to HLA-I molecules. The resulting peptide-HLA-I complexes have reduced stability and reduced half-life on the cell surface compared to peptide-HLA-I complexes formed with properly trimmed peptides. In some embodiments, low-affinity peptides can dissociate from the HLA-I molecules before the peptide-HLA-I complexes can be recognized by T cell receptors on allogeneic CD8+ T cells. In some embodiments, the peptide-HLA-I complexes comprising low-affinity peptides do not adopt a conformation that is optimal for T cell receptor engagement, thereby reducing CD8+ T cell activation and cytotoxicity.

[0083] As used herein, the phrase “increased HLA-I immunocompatability” refers to a reduction in immune recognition or immune activation elicited by the modified cell compared to an unmodified cell expressing ERAP1. In some embodiments, this is evidenced by one or more of the following: altered HLA-I peptide repertoire resulting in reduced presentation of immunogenic peptides (while HLA-I expression is not affected), reduced activation, proliferation, and / or cytotoxicity of allogeneic CD8+T cells and non-increased or reduced NK cell activity, reduced interferon-y or cytotoxic effector molecule release in mixed lymphocyte or co-culture assays, and / or increased survival or persistence of the modified cell following allogeneic or xenogeneic transplantation.

[0084] As used herein, the terms "ectoderm" or "ectodermal lineage" refer to cells derived from the outermost of the three primary germ layers formed during embryonic development. Ectodermal cells give rise to the epidermis and its appendages, the nervous system, and sensory organs. Ectodermal cells include, among others, limbal stem cells (LSCs), neuronal cells, glial cells, keratinocytes, and skin epithelial cells.

[0085] As used herein, the terms "mesoderm" or "mesodermal lineage" refer to cells derived from the middle of the three primary germ layers formed during embryonic development. Mesodermal cells give rise to connective tissues, muscle, bone, cartilage, the circulatory system, and the urogenital system. Mesodermal cells include, among others, fibroblasts, cardiomyocytes, skeletal myocytes, smooth muscle cells, osteocytes, chondrocytes, endothelial cells, hematopoietic cells, and nephron cells.

[0086] As used herein, the terms "endoderm" or "endodermal lineage" refer to cells derived from the innermost of the three primary germ layers formed during embryonic development. Endodermal cells give rise to the epithelial lining of the gastrointestinal tract, respiratory tract, and associated organs including the liver, pancreas, thyroid, and bladder.Endodermal cells include, among others, pancreatic P cells, hepatocytes, lung epithelial cells, intestinal epithelial cells, and thyroid cells.

[0087] As used herein, the terms "neural crest" or "neural crest lineage" refer to a transient, multipotent cell population that arises from the dorsal neural tube during embryonic development. Neural crest cells undergo epithelial-to-mesenchymal transition and migrate throughout the embryo to give rise to diverse cell types. Neural crest cells include, among others, comeal endothelial cells (CEnCs), retinal pigment epithelium (RPE) cells, melanocytes, peripheral neurons, Schwann cells, and craniofacial cartilage and bone cells.

[0088] As used herein, the term "limbal stem cell" or "LSC" refers to a stem cell located in the basal epithelial layer of the corneal limbus. LSCs serve as progenitor cells for comeal epithelial cells and are involved in maintaining and regenerating the corneal epithelium, from which cells are naturally shed in tears. Damage to the limbus and / or loss of limbal stem cells results in disruption of the epithelium and complications such as conjunctivitis, comeal scarring, and inflammation.

[0089] As used herein, the term "retinal pigment epithelium cell" or "RPE cell" refers to the pigmented cell of the retinal pigment epithelium, which is a monolayer of cells located between the photoreceptors and the choroid in the eye. RPE cells perform functions such as absorption of light, transport of nutrients, maintenance of the immune privileged nature of the eye, and phagocytosis of photoreceptor outer segments damaged by photo-oxidative stress.

[0090] As used herein, the term "corneal endothelial cell" or "CEnC" refers to a cell of the corneal endothelium, which is a monolayer of cells lining the inner surface of the cornea. CEnCs regulate fluid and solute transport between the aqueous humor and the corneal stroma.

[0091] As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable diluent" refers to a substance that may be used to formulate a composition for administration to a subject without causing unacceptable adverse effects. Pharmaceutically acceptable carriers and diluents may include solvents, dispersion media, coatings, antibacterial agents, antifungal agents, isotonic agents, absorption delaying agents, and other substances compatible with pharmaceutical administration. In some cases, a pharmaceutically acceptable carrier may comprise saline, buffered saline, dextrose, water, glycerol, or combinations thereof.ERAP1 disruption or inactivation

[0092] Disclosed herein are modified cells lacking endoplasmic reticulum aminopeptidase 1 (ERAP1) protein or comprising an ERAP1 protein that is inactive. In someembodiments, these modified cells exhibit increased HLA-I immunocompatability and hypoimmunogenicity relative to unmodified cells. In some embodiments, the increased HLA-I immunocompatability caused by the disruption of the ERAP1 gene results in reduced CD8+ T cell-mediated cytotoxicity against the modified cells. In some embodiments, the modified cells also exhibit non-increased or reduced NK cell-mediated cytotoxicity. As disclosed herein, these modified cells can be used in allogeneic cell-based therapies with reduced risk of immune rejection.

[0093] In some embodiments, the ERAP1 disruption or inactivation does not affect or substantially affect HLA-I expression in the modified cell. However, in the modified cells, presentation of HLA-I associated peptide antigens is reduced in diversity and abundance, resulting in resistance to alloimmune cell-mediated cytotoxicity. In some embodiments, HLA-I expression in the modified cell is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of HLA-I expression of an unmodified cell without the ERAP1 disruption or inactivation.

[0094] In some embodiments, the modified cell lacks ERAP1 protein and / or the ERAP1 protein is inactive due to an inactivating mutation in an endogenous ERAP1 gene of the modified cell. In some embodiments, the inactivating mutation in the endogenous ERAP1 gene comprises a deletion of one or more nucleotides in a genomic sequence of the ERAP1 gene. In some embodiments, the deletion removes a portion of one or more coding exons of the ERAP1 gene. In some embodiments, the deletion removes one or more splice sites of the ERAP1 gene. In some embodiments, the deletion results in a frameshift in the reading frame of the ERAP1 gene, resulting in production of a truncated or non-functional ERAP1 protein.

[0095] In some embodiments, the inactivating mutation in the endogenous ERAP1 gene comprises an insertion of one or more nucleotides in a genomic sequence of the endogenous ERAP1 gene. In some embodiments, the insertion disrupts one or more coding exons of the ERAP1 gene. In some embodiments, the insertion results in a frameshift in the reading frame of the ERAP1 gene. In some embodiments, the insertion introduces one or more premature stop codons in the coding sequence of the ERAP1 gene.

[0096] In some embodiments, the inactivating mutation in the endogenous ERAP1 gene comprises a substitution of one or more nucleotides in a genomic sequence of the ERAP1 gene. In some embodiments, the substitution introduces one or more premature stop codons in the coding sequence of the ERAP1 gene. In some embodiments, the substitution alters one or more splice sites of the ERAP1 gene, resulting in aberrant splicing of ERAP1 messenger RNA.In some embodiments, the substitution alters one or more amino acid residues in the ERAP1 protein, resulting in loss of enzymatic activity.

[0097] In some embodiments, the inactivating mutation is introduced using gene editing approaches. In some embodiments, the inactivating mutation is introduced using zinc finger nucleases, TALENs, meganucleases, or other site-specific nucleases. In some embodiments, the inactivating mutation is introduced using homologous recombination with a donor template comprising a disrupted ERAP1 sequence.

[0098] In some embodiments, the inactivating mutation is introduced using an RNA-guided DNA endonuclease system. In some embodiments, the inactivating mutation is introduced using CRISPR, which involves the use of a Cas protein and associated guide RNA (gRNA) that targets the ERAP1 locus. In some cases, the Cas protein may be a Cas9, Cas 12a, or any other known Cas or CRISPR-related protein. The inactivating mutation may be induced through non-homologous end joining or homology-directed repair. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or both.

[0099] In some embodiments, the target sequence within the ERAP1 gene is located in an exon of the ERAP1 gene. In some embodiments, the target sequence is located in an early exon of the ERAP1 gene to maximize the likelihood of generating a non-functional ERAP1 protein. In some embodiments, the target sequence is located in a region encoding the active site of the ERAP1 protein. In some embodiments, the target sequence is selected to minimize off-target cleavage at other genomic loci.

[0100] In some embodiments, cells comprising an inactivating mutation in an endogenous ERAP1 gene express peptide-free HLA-I molecules or HLA-I molecules comprising low-affinity peptides that do not bind stably to the HLA-I molecules.

[0101] In some embodiments, the modified cell lacks ERAP1 protein and / or the ERAP1 protein is inactive due to RNA interference (RNAi) or with an antisense oligonucleotide (ASO). In some embodiments, ERAP1 activity in the modified cell is reduced or eliminated by an RNAi molecule or ASO targeting ERAP1. In some embodiments, the RNAi molecule or ASO comprises a region of complementarity to an ERAP1 sequence. In some embodiments, cells in which ERAP1 expression is reduced or eliminated by RNAi or ASOs exhibit increased HLA-I immunocompatibility relative to cells with intact ERAP1 expression.

[0102] In some embodiments, ERAP1 expression and / or activity is reduced by small interfering RNA (siRNA). In some embodiments, siRNA molecules targeting ERAP1 mRNA are introduced into cells by transfection, electroporation, or lipid-mediated delivery. In some embodiments, siRNA-mediated knockdown of ERAP1 results in transient reduction of ERAP1expression and / or activity. In some embodiments, repeated administration of siRNA is used to maintain reduced ERAP1 expression and / or activity over extended periods.

[0103] In some embodiments, ERAP1 expression and / or activity is reduced by short hairpin RNA (shRNA). In some embodiments, shRNA molecules targeting ERAP1 mRNA are expressed from a DNA construct introduced into cells. In some embodiments, the DNA construct is a plasmid vector or a viral vector, such as a lentiviral vector, retroviral vector, or adeno-associated virus (AAV) vector. In some embodiments, the DNA construct integrates into the genome of the cell, resulting in stable and heritable reduction of ERAP1 expression and / or activity.

[0104] In some embodiments, ERAP1 expression and / or activity is reduced by miRNA or amiRNA.

[0105] In some embodiments, ERAP1 expression and / or activity is reduced by antisense ASOs. In some embodiments, ASOs inhibit ERAP1 expression and / or activity by promoting degradation of ERAP1 mRNA, by blocking translation of ERAP1 mRNA, or by modulating splicing of ERAP1 pre-mRNA. In some embodiments, ASOs targeting ERAP1 mRNA is introduced into cells by transfection, electroporation, or lipid-mediated delivery.

[0106] In some embodiments, the siRNA, shRNA, miRNA, or ASO targeting ERAP1 comprise a sequence complementary to a portion of the ERAP1 mRNA. In some embodiments, the target sequence can be located in the coding region, the 5' untranslated region (5' UTR), or the 3' untranslated region (3' UTR) of the ERAP1 mRNA. In some embodiments, multiple siRNA, shRNA, miRNA, or ASO molecules targeting different regions of the ERAP1 mRNA can be used in combination.

[0107] In some embodiments, RNAi- or ASO-mediated reduction of ERAP1 expression results in reduced ERAP1 protein levels. In some embodiments, ERAP1 protein levels are reduced by at least about 50%, at least about 70%, at least about 80%, at least about 90%, or at least about 95% compared to cells without RNAi- or ASO-mediated knockdown.

[0108] In some embodiments, cells with RNAi- or ASO-mediated reduction of ERAP1 expression exhibit similar immunological properties to cells comprising an inactivating mutation in the endogenous ERAP1 gene. In some embodiments, cells with RNAi- or ASO-mediated reduction of ERAP 1 expression express peptide-free HLA-I molecules and / or HLA-I molecules comprising low-affinity peptides. In some embodiments, cells with RNAi- or ASO-mediated reduction of ERAP1 expression exhibit reduced CD8+ T cell-mediated cytotoxicity and non-increased or reduced allogeneic NK cell-mediated cytotoxicity.Modified cells and stem cells with disrupted or inactivated ERAP1

[0109] Provided herein are modified cells lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified cell comprises increased HLA-I immunocompatability relative to an unmodified cell. In some embodiments, the modified cell lacks ERAP1 protein and / or the ERAP1 protein is inactive due to an inactivating mutation in an endogenous ERAP1 gene of the modified cell. In some embodiments, the inactivating mutation comprises a deletion, substitution, or insertion of one or more nucleotides in a genomic sequence of the endogenous ERAP1 gene. In some embodiments, the inactivating mutation is introduced according to any approach disclosed herein. In some embodiments, the inactivating mutation comprises a deletion, substitution, or insertion of one or more nucleotides in a genome sequence of the endogenous ERAP1 gene. In some embodiments, the inactivating mutation is introduced by a Cas protein and a gRNA targeting the endogenous ERAP1 gene. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or both. In some embodiments, the modified cell lacks ERAP1 protein and / or the ERAP1 protein is inactive due to RNA interference or with an antisense oligonucleotide. In some embodiments, the RNA interference or antisense oligonucleotide is designed and introduced according to any approach disclosed herein. In some embodiments, the modified cell expresses a peptide-free HLA-I molecule. In some embodiments, the modified cell expresses an HLA-I molecule comprising a low-affinity peptide. In some embodiments, the modified cell is mammalian. In some embodiments, the modified cell is human.

[0110] In some embodiments, the ERAP1 disruption or inactivation does not affect or substantially affect HLA-I expression in the modified cell. However, in the modified cells, presentation of HLA-I associated peptide antigens is reduced in diversity and abundance, resulting in resistance to alloimmune cell-mediated cytotoxicity. In some embodiments, HLA-I expression in the modified cell is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of HLA-I expression of an unmodified cell without the ERAP1 disruption or inactivation.

[0111] In some embodiments, the cells provided herein are stem cells. In some embodiments are provided modified stem cells lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified stem cell comprises increased HLA-I immunocompatability relative to an unmodified stem cell. In some embodiments, the modified cell lacks ERAP1 protein and / or the ERAP1 protein is inactive due to an inactivating mutation in an endogenous ERAP1 gene of the modified cell. In some embodiments, the modified stem cells comprising the inactivating mutation expressespluripotency markers at levels comparable to stem cells that do not comprise the inactivating mutation. In some embodiments, the inactivating mutation is introduced according to any approach disclosed herein. In some embodiments, the modified cell lacks ERAP1 protein and / or the ERAP1 protein is inactive due to RNA interference or with an antisense oligonucleotide. In some embodiments, the RNA interference molecule or antisense oligonucleotide is designed and introduced according to any approach disclosed herein. In some embodiments, the RNAi molecule or ASO comprises a region of complementarity to an ERAP1 sequence. In some embodiments, the modified stem cells comprising the RNAi or antisense oligonucleotide expresses pluripotency markers at levels comparable to stem cells that do not comprise the inactivating mutation. In some embodiments, the modified stem cell expresses a peptide-free HLA-I molecule. In some embodiments, the modified stem cell expresses an HLA-I molecule comprising a low-affinity peptide. In some embodiments, the modified cell is mammalian. In some embodiments, the modified cell is human.

[0112] In some embodiments, the ERAP1 disruption or inactivation does not affect or substantially affect HLA-I expression in the modified stem cell. However, in the modified stem cells, presentation of HLA-I associated peptide antigens is reduced in diversity and abundance, resulting in resistance to alloimmune cell-mediated cytotoxicity. In some embodiments, HLA-I expression in the modified stem cell is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% of HLA-I expression of an unmodified stem cell without the ERAP1 disruption or inactivation.

[0113] In some embodiments, the modified stem cell is an iPSC. In some embodiments, the modified stem cell is a mammalian iPSC. In some embodiments, the modified stem cell is a human iPSC. In some embodiments, the iPSC is reprogrammed from a somatic cell, such as a somatic cell derived from a subject or donor. In some embodiments, the iPSC is reprogrammed according to generally known approaches. In some embodiments, the inactivating mutation in the endogenous ERAP1 gene is introduced into the iPSC after the iPSC is reprogrammed from the somatic cell. In some embodiments, the inactivating mutation is introduced into the somatic cell prior to reprogramming, and the somatic cell comprising the inactivating mutation can then be reprogrammed to generate an iPSC comprising the inactivating mutation. In some embodiments, the RNAi or ASO is introduced to the iPSC after the iPSC is reprogrammed from the somatic cell. In some embodiments, the RNAi or ASO is introduced into the somatic cell prior to reprogramming, and the somatic cell comprising the RNAi or ASO can then be reprogrammed to generate an iPSC comprising RNAi or ASO.

[0114] In some embodiments, as disclosed herein, the iPSC comprising the inactivating mutation in the endogenous ERAP1 gene maintains pluripotency following introduction of the inactivating mutation. In some embodiments, as disclosed herein, the iPSC comprising the RNAi or ASO maintains pluripotency following introduction of the RNAi or ASO. Pluripotency can be assessed by expression of pluripotency markers (such as Oct4, Sox2, and Nanog), or by the ability to form embryoid bodies. In some embodiments, the iPSC comprising the inactivating mutation expresses pluripotency markers at levels comparable to iPSCs that do not comprise the inactivating mutation. In some embodiments, the iPSC comprising the RNAi or ASO expresses pluripotency markers at levels comparable to iPSCs that do not comprise the RNAi or ASO. In some embodiments, the iPSCs have the capacity to differentiate into cell types derived from all three germ layers (ectoderm, mesoderm, and endoderm) as well as neural crest cells.

[0115] In some embodiments, the modified stem cell is further differentiated into different cell types and lineages.

[0116] In some embodiments, the modified stem cell is further differentiated into an LSC. In some embodiments, differentiation of the modified stem cell into an LSC is achieved by culturing the modified stem cell under conditions that promote differentiation toward the ectodermal lineage and subsequently toward a comeal epithelial lineage. In some embodiments, LSCs differentiated from the modified stem cell are characterized by expression of LSC markers such as ANp63a and ABCB5. In some embodiments, LSCs differentiated from the modified stem cell are characterized by the absence or low expression of non-limbal stem cell comeal epithelial markers. In some embodiments, the LSCs differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to LSCs differentiated from unmodified stem cells. In some embodiments, the LSCs differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to LSCs differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the LSCs reduces the risk of immune rejection when the LSCs are transplanted into an allogeneic recipient.

[0117] In some embodiments, the modified stem cell is further differentiated into an RPE cell. In some embodiments, differentiation of the modified stem cell into an RPE cell is achieved by culturing the modified stem cell under conditions that promote differentiation toward the neuroectodermal lineage and subsequently toward a retinal lineage. In some embodiments, RPE cells differentiated from the modified stem cell are characterized by thepresence of melanin pigmentation, a polarized epithelial morphology, and / or the ability to phagocytose photoreceptor outer segments. In some embodiments, RPE cells differentiated from the modified stem cell are characterized by expression of RPE markers such as RPE65, BEST1 (bestrophin-1), CRALBP (cellular retinaldehyde-binding protein), MITF (microphthalmia-associated transcription factor), PMEL17, and ZO-1 (zonula occludens-1). In some embodiments, the RPE cells differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to RPE cells differentiated from unmodified stem cells. In some embodiments, the RPE cells differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to RPE cells differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the RPE cells reduces the risk of immune rejection when the RPE cells are transplanted into an allogeneic recipient.

[0118] In some embodiments, the modified stem cell is further differentiated into a CEnC. In some embodiments, differentiation of the modified stem cell into a CEnC is achieved by culturing the modified stem cell under conditions that promote differentiation toward the neural crest lineage and subsequently toward a corneal endothelial lineage. In some embodiments, CEnC differentiated from the modified stem cell are characterized by a hexagonal cell morphology and / or the ability to form a monolayer with barrier function. In some embodiments, CEnC differentiated from the modified stem cell are characterized by expression of CEnC markers such as Na+ / K+-ATPase, ZO-1, N-cadherin, SLC4A11, CD166, and aquaporin 1 (AQP1). In some embodiments, the CEnC differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to CEnC differentiated from unmodified stem cells. In some embodiments, the CEnC differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to CEnC differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the CEnC reduces the risk of immune rejection when the CEnC are transplanted into an allogeneic recipient.

[0119] In some embodiments, the modified stem cell is further differentiated into a fibroblast. In some embodiments, differentiation of the modified stem cell into a fibroblast is achieved by culturing the modified stem cell under conditions that promote differentiation toward the mesodermal lineage and subsequently toward a fibroblast lineage. In some embodiments, fibroblasts differentiated from the modified stem cell are characterized by aspindle-shaped morphology and / or the ability to produce extracellular matrix components. In some embodiments, fibroblasts differentiated from the modified stem cell are characterized by expression of fibroblast markers such as vimentin, fibroblast- specific protein 1 (FSP1, also known as S100A4), collagen type I, collagen type III, and fibronectin. In some embodiments, the fibroblasts differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to fibroblasts differentiated from unmodified stem cells. In some embodiments, the fibroblasts differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to fibroblasts differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the fibroblasts reduces the risk of immune rejection when the fibroblasts are transplanted into an allogeneic recipient.

[0120] In some embodiments, the modified stem cell is further differentiated into a cardiomyocyte. In some embodiments, differentiation of the modified stem cell into a cardiomyocyte is achieved by culturing the modified stem cell under conditions that promote differentiation toward the mesodermal lineage and subsequently toward a cardiac lineage. In some embodiments, cardiomyocytes differentiated from the modified stem cell are characterized by a presence of sarcomeric structures and / or ability to respond to electrical stimulation. In some embodiments, cardiomyocytes differentiated from the modified stem cell are characterized by expression of cardiomyocyte markers such as cardiac troponin T (cTnT), cardiac troponin I (cTnl), a-actinin, myosin heavy chain (MHC), SIRPa (CD 172a), and connexin 43. In some embodiments, the cardiomyocytes differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to cardiomyocytes differentiated from unmodified stem cells. In some embodiments, the cardiomyocytes differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to cardiomyocytes differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the cardiomyocytes reduces the risk of immune rejection when the cardiomyocytes are transplanted into an allogeneic recipient.

[0121] In some embodiments, the modified stem cell is further differentiated into a pancreatic P cell. In some embodiments, differentiation of the modified stem cell into a pancreatic P cell is achieved by culturing the modified stem cell under conditions that promote differentiation toward the endodermal lineage and subsequently toward a pancreatic endocrine lineage. In some embodiments, pancreatic P cells differentiated from the modified stem cell arecharacterized by the ability to secrete insulin in response to glucose stimulation. In some embodiments, pancreatic P cells differentiated from the modified stem cell are characterized by expression of pancreatic P cells markers such as insulin (INS), C-peptide, PDX1, NKX6.1, MAFA, and glucokinase (GCK). In some embodiments, the pancreatic P cells differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to pancreatic P cells differentiated from unmodified stem cells. In some embodiments, the pancreatic P cells differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to pancreatic P cells differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the pancreatic P cells reduces the risk of immune rejection when the pancreatic P cells are transplanted into an allogeneic recipient, such as for treatment of diabetes.

[0122] In some embodiments, the modified stem cell is further differentiated into a hepatocyte. In some embodiments, differentiation of the modified stem cell into a hepatocyte is achieved by culturing the modified stem cell under conditions that promote differentiation toward the endodermal lineage and subsequently toward a hepatic lineage. In some embodiments, hepatocytes differentiated from the modified stem cell are characterized by albumin secretion, a polygonal morphology and / or the presence of binucleated cells. In some embodiments, hepatocytes differentiated from the modified stem cell are characterized by expression of hepatocytes markers such as albumin, HNF4A, alpha- 1 antitrypsin, cytochrome P450 enzymes, asialoglycoprotein receptor 1, and apolipoprotein B. In some embodiments, the hepatocytes differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to hepatocytes differentiated from unmodified stem cells. In some embodiments, the hepatocytes differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to hepatocytes differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the hepatocytes reduces the risk of immune rejection when the hepatocytes are transplanted into an allogeneic recipient.

[0123] In some embodiments, the modified stem cell is further differentiated into a neuronal cell. In some embodiments, differentiation of the modified stem cell into a neuronal cell is achieved by culturing the modified stem cell under conditions that promote differentiation toward the ectodermal lineage and subsequently toward a neural lineage. In some embodiments, neuronal cells differentiated from the modified stem cell are characterizedby a presence of neurites, axons, dendrites, and / or ability to generate action potentials. In some embodiments, neuronal cells differentiated from the modified stem cell are characterized by expression of neuronal markers such as [3-III tubulin (TUJ1), microtubule-associated protein 2 (MAP2), neurofilament, NeuN, and synapsin. In some embodiments, the neuronal cells differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to neuronal cells differentiated from unmodified stem cells. In some embodiments, the neuronal cells differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to neuronal cells differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the neuronal cells reduces the risk of immune rejection when the neuronal cells are transplanted into an allogeneic recipient.

[0124] In some embodiments, the modified stem cell is further differentiated into a skin epithelial cell. In some embodiments, differentiation of the modified stem cell into a skin epithelial cell is achieved by culturing the modified stem cell under conditions that promote differentiation toward the ectodermal lineage and subsequently toward an epidermal lineage. In some embodiments, skin epithelial cells differentiated from the modified stem cell are characterized by a stratified morphology and / or ability to form a barrier function. In some embodiments, skin epithelial cells differentiated from the modified stem cell are characterized by expression of skin epithelial markers such as cytokeratin 14 (CK14), cytokeratin 10 (CK10), cytokeratin 1 (CK1), involucrin, and loricrin. In some embodiments, the skin epithelial cells differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to skin epithelial cells differentiated from unmodified stem cells. In some embodiments, the skin epithelial cells differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to skin epithelial cells differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the skin epithelial cells reduces the risk of immune rejection when the skin epithelial cells are transplanted into an allogeneic recipient.

[0125] In some embodiments, the modified stem cell is further differentiated into a myocyte. In some embodiments, differentiation of the modified stem cell into a myocyte is achieved by culturing the modified stem cell under conditions that promote differentiation toward the mesodermal lineage and subsequently toward a skeletal muscle lineage. In some embodiments, myocytes differentiated from the modified stem cell are characterized by anelongated, multinucleated morphology and / or ability to contract in response to stimulation. In some embodiments, myocytes differentiated from the modified stem cell are characterized by expression of myocyte markers such as myosin heavy chain (MHC), myogenin, MyoD, desmin, and dystrophin. In some embodiments, the myocytes differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to myocytes differentiated from unmodified stem cells. In some embodiments, the myocytes differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to myocytes differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the myocytes reduces the risk of immune rejection when the myocytes are transplanted into an allogeneic recipient.

[0126] In some embodiments, the modified stem cell is further differentiated into an osteocyte. In some embodiments, differentiation of the modified stem cell into an osteocyte is achieved by culturing the modified stem cell under conditions that promote differentiation toward the mesodermal lineage and subsequently toward an osteogenic lineage. In some embodiments, osteocytes differentiated from the modified stem cell are characterized by a stellate morphology with dendritic processes and / or ability to mineralize extracellular matrix. In some embodiments, osteocytes differentiated from the modified stem cell are characterized by expression of osteocyte markers such as sclerostin (SOST), dentin matrix protein 1 (DMP1), podoplanin (El 1), osteocalcin, and PHEX. In some embodiments, the osteocytes differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to osteocytes differentiated from unmodified stem cells. In some embodiments, the osteocytes differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to osteocytes differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the osteocytes reduces the risk of immune rejection when the osteocytes are transplanted into an allogeneic recipient.

[0127] In some embodiments, the modified stem cell is further differentiated into a nephron cell. In some embodiments, differentiation of the modified stem cell into a nephron cell is achieved by culturing the modified stem cell under conditions that promote differentiation toward the mesodermal lineage and subsequently toward a renal lineage. In some embodiments, nephron cells differentiated from the modified stem cell are characterized by a polarized epithelial morphology and / or ability to perform filtration, reabsorption, or secretion functions. In some embodiments, nephron cells differentiated from the modified stemcell are characterized by expression of nephron markers such as nephrin, podocin, aquaporin 1 (AQP1), aquaporin 2 (AQP2), uromodulin, and paired box gene 2 (PAX2). In some embodiments, the nephron cells differentiated from the modified stem cell retain the inactivating mutation in the endogenous ERAP1 gene and exhibit increased HLA-I immunocompatibility relative to nephron cells differentiated from unmodified stem cells. In some embodiments, the nephron cells differentiated from the modified stem cell retain the RNAi or ASO and exhibit increased HLA-I immunocompatibility relative to nephron cells differentiated from stem cells without the RNAi or ASO. In some embodiments, the increased HLA-I immunocompatibility of the nephron cells reduces the risk of immune rejection when the nephron cells are transplanted into an allogeneic recipient.

[0128] In some embodiments, the increased HLA-I immunocompatability comprises reduced CD8+ T cell-mediated cytotoxicity. In some embodiments, the increased HLA-I immunocompatability comprises non-increased or reduced NK cell-mediated cytotoxicity. In some embodiments, the increased HLA-I immunocompatibility comprises both reduced CD8+ T cell-mediated cytotoxicity and non-increased or reduced allogeneic NK cell-mediated cytotoxicity.Somatic cells with disrupted or inactivated ERAP1

[0129] Also disclosed herein are various modified somatic cells lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, ERAP1 can be inactivated or depleted in these cells using any of the approaches disclosed herein. In some embodiments, the cells are differentiated from stem cells, such as iPSCs. In some embodiments, the cells are differentiated from any of the modified stem cells disclosed herein. In some embodiments, the cells are differentiated from ERAP1 inactivated stem cells (z.e., the cells already have ERAP1 inactivated prior to differentiation). In some embodiments, the ERAP1 is inactivated or depleted after the cells are differentiation from a stem cell and / or inactivated or depleted during the differentiated state. In some embodiments, the cells are isolated from a subject or donor. In some embodiments, the modified somatic cells are mammalian. In some embodiments, the modified somatic cells are human.

[0130] In some embodiments are modified LSCs lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified LSCs are differentiated from a stem cell. In some embodiments, the modified LSCs are derived from a subject or donor. In some embodiments, the modified LSCs are characterized by expression of LSC markers such as ANp63a and ABCB5. In some embodiments, the modified LSCs are characterized bythe absence or low expression of non-limbal stem cell corneal epithelial markers. In some embodiments, the modified LSCs exhibit increased HLA-I immunocompatibility relative to unmodified LSCs with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified LSCs reduces the risk of immune rejection when the LSCs are transplanted into an allogeneic recipient.

[0131] In some embodiments are modified RPE cells lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified RPE cells are differentiated from a stem cell. In some embodiments, the modified RPE cells are derived from a subject or donor. In some embodiments, the modified RPE cells are characterized by the presence of melanin pigmentation, a polarized epithelial morphology, and / or the ability to phagocytose photoreceptor outer segments. In some embodiments, the modified RPE cells are characterized by expression of RPE markers such as RPE65, BEST1, CRALBP, MITF, PMEL17, and ZO-1. In some embodiments, the modified RPE cells exhibit increased HLA-I immunocompatibility relative to unmodified RPE cells with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified RPE cells reduces the risk of immune rejection when the RPE cells are transplanted into an allogeneic recipient.

[0132] In some embodiments are modified CEnC lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified CEnC are differentiated from a stem cell. In some embodiments, the modified CEnC are derived from a subject or donor. In some embodiments, the modified CEnC are characterized by a hexagonal cell morphology and / or the ability to form a monolayer with barrier function. In some embodiments, the modified CEnC are characterized by expression of CEnC markers such as Na+ / K+-ATPase, ZO-1, N-cadherin, SLC4A11, CD166, and aquaporin 1. In some embodiments, the modified CEnC exhibit increased HLA-I immunocompatibility relative to unmodified CEnC with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified CEnC reduces the risk of immune rejection when the CEnC are transplanted into an allogeneic recipient.

[0133] In some embodiments are modified fibroblasts lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified fibroblasts are differentiated from a stem cell. In some embodiments, the modified fibroblasts are derived from a subject or donor. In some embodiments, the modified fibroblasts are characterized by a spindle-shaped morphology and / or the ability to produce extracellular matrix components. In some embodiments, the modified fibroblasts are characterized by expression of fibroblast markers such as vimentin, fibroblast- specific protein 1, collagen type I, collagen type III, andfibronectin. In some embodiments, the modified fibroblasts exhibit increased HLA-I immunocompatibility relative to unmodified fibroblasts with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified fibroblasts reduces the risk of immune rejection when the fibroblasts are transplanted into an allogeneic recipient.

[0134] In some embodiments are modified cardiomyocytes lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified cardiomyocytes are differentiated from a stem cell. In some embodiments, the modified cardiomyocytes are derived from a subject or donor. In some embodiments, the modified cardiomyocytes are characterized by a presence of sarcomeric structures and / or ability to respond to electrical stimulation. In some embodiments, the modified cardiomyocytes are characterized by expression of cardiomyocyte markers such as cardiac troponin T, cardiac troponin I, a-actinin, myosin heavy chain, SIRPa (CD 172a), and connexin 43. In some embodiments, the modified cardiomyocytes exhibit increased HLA-I immunocompatibility relative to unmodified cardiomyocytes with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified cardiomyocytes reduces the risk of immune rejection when the cardiomyocytes are transplanted into an allogeneic recipient.

[0135] In some embodiments are modified pancreatic P cell lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified pancreatic P cells are differentiated from a stem cell. In some embodiments, the modified pancreatic P cells are derived from a subject or donor. In some embodiments, the modified pancreatic P cells are characterized by the ability to secrete insulin in response to glucose stimulation. In some embodiments, the modified pancreatic P cells are characterized by expression of pancreatic P cells markers such as insulin, C-peptide, PDX1, NKX6.1, MAFA, and glucokinase. In some embodiments, the modified pancreatic P cells exhibit increased HLA-I immunocompatibility relative to unmodified pancreatic P cells with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified pancreatic P cells reduces the risk of immune rejection when the pancreatic P cells are transplanted into an allogeneic recipient, such as for treatment of diabetes.

[0136] In some embodiments are modified hepatocytes lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified hepatocytes are differentiated from a stem cell. In some embodiments, the modified hepatocytes are derived from a subject or donor. In some embodiments, the modified hepatocytes are characterized by albumin secretion, a polygonal morphology and / or the presence of binucleated cells. In some embodiments, the modified hepatocytes are characterized by expression of hepatocytesmarkers such as albumin, HNF4A, alpha- 1 antitrypsin, cytochrome P450 enzymes, asialoglycoprotein receptor 1, and apolipoprotein B. In some embodiments, the modified hepatocytes exhibit increased HLA-I immunocompatibility relative to unmodified hepatocytes with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified hepatocytes reduces the risk of immune rejection when the hepatocytes are transplanted into an allogeneic recipient.

[0137] In some embodiments are modified neuronal cells lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified neuronal cells are differentiated from a stem cell. In some embodiments, the modified neuronal cells are derived from a subject or donor. In some embodiments, the modified neuronal cells are characterized by a presence of neurites, axons, dendrites, and / or ability to generate action potentials. In some embodiments, the modified neuronal cells are characterized by expression of neuronal markers such as [3-III tubulin, microtubule- associated protein 2, neurofilament, NeuN, and synapsin. In some embodiments, the modified neuronal cells exhibit increased HLA-I immunocompatibility relative to unmodified neuronal cells with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified neuronal cells reduces the risk of immune rejection when the neuronal cells are transplanted into an allogeneic recipient.

[0138] In some embodiments are modified skin epithelial cells lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified skin epithelial cells are differentiated from a stem cell. In some embodiments, the modified skin epithelial cells are derived from a subject or donor. In some embodiments, the modified skin epithelial cells are characterized by a stratified morphology and / or ability to form a barrier function. In some embodiments, the modified skin epithelial cells are characterized by expression of skin epithelial markers such as cytokeratin 14, cytokeratin 10, cytokeratin 1, involucrin, and loricrin. In some embodiments, the modified skin epithelial cells exhibit increased HLA-I immunocompatibility relative to unmodified skin epithelial cells with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified skin epithelial cells reduces the risk of immune rejection when the skin epithelial cells are transplanted into an allogeneic recipient.

[0139] In some embodiments are modified myocytes lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified myocytes are differentiated from a stem cell. In some embodiments, the modified myocytes are derived from a subject or donor. In some embodiments, the modified myocytes are characterized by anelongated, multinucleated morphology and / or ability to contract in response to stimulation. In some embodiments, the modified myocytes are characterized by expression of myocyte markers such as myosin heavy chain (MHC), myogenin, MyoD, desmin, and dystrophin. In some embodiments, the modified myocytes exhibit increased HLA-I immunocompatibility relative to unmodified myocytes with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified myocytes reduces the risk of immune rejection when the myocytes are transplanted into an allogeneic recipient.

[0140] In some embodiments are modified osteocytes lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified osteocytes are differentiated from a stem cell. In some embodiments, the modified osteocytes are derived from a subject or donor. In some embodiments, the modified osteocytes are characterized by a stellate morphology with dendritic processes and / or ability to mineralize extracellular matrix. In some embodiments, the modified osteocytes are characterized by expression of osteocyte markers such as sclerostin, dentin matrix protein 1, podoplanin, osteocalcin, and PHEX. In some embodiments, the modified osteocytes exhibit increased HLA-I immunocompatibility relative to unmodified osteocytes with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified osteocytes reduces the risk of immune rejection when the osteocytes are transplanted into an allogeneic recipient.

[0141] In some embodiments are modified nephron cells lacking ERAP1 protein or comprising an ERAP1 protein that is inactive. In some embodiments, the modified nephron cells are differentiated from a stem cell. In some embodiments, the modified nephron cells are derived from a subject or donor. In some embodiments, the modified nephron cells are characterized by a polarized epithelial morphology and / or ability to perform filtration, reabsorption, or secretion functions. In some embodiments, the modified nephron cells are characterized by expression of nephron markers such as nephrin, podocin, aquaporin 1, aquaporin 2, uromodulin, and paired box gene 2 (PAX2). In some embodiments, the modified nephron cells exhibit increased HLA-I immunocompatibility relative to unmodified nephron cells with intact ERAP1. In some embodiments, the increased HLA-I immunocompatibility of the modified nephron cells reduces the risk of immune rejection when the nephron cells are transplanted into an allogeneic recipient.Pharmaceutical compositions

[0142] Also provided herein are pharmaceutical compositions comprising any of the modified cells, stem cells, iPSCs, LSCs, RPE cells, CEnCs, fibroblasts, cardiomyocytes,pancreatic P cells, hepatocytes, neuronal cells, skin epithelial cells, myocytes, osteocytes, or nephron cells disclosed herein and a pharmaceutically acceptable carrier or diluent.

[0143] In some embodiments, the pharmaceutically acceptable carrier comprises an aqueous solution. In some embodiments, the aqueous solution is an isotonic solution that maintains osmotic balance with the cells. In some embodiments, the aqueous solution comprises saline, such as 0.9% (w / v) sodium chloride. In some embodiments, the aqueous solution comprises buffered saline, such as a solution that is buffered to maintain a physiological pH. In some embodiments, the buffered saline is phosphate-buffered saline, Hanks' balanced salt solution, or Dulbecco's phosphate-buffered saline.

[0144] In some embodiments, the pharmaceutically acceptable carrier comprises a cryopreservation medium. In some embodiments, the cryopreservation medium is formulated to protect the cells during freezing and thawing. In some embodiments, the cryopreservation medium comprises a cryoprotectant. In some embodiments, the cryoprotectant is at a concentration of about 5%, about 6%, about 7%, about 8%, about 9%, or about 10% (v / v) or any value with a range defined by any of the aforementioned concentrations. In some embodiments, the cryoprotectant comprises DMSO. In some embodiments, the cryoprotectant comprises glycerol. In some embodiments, the cryopreservation medium comprises a combination of cryoprotectants. In some embodiments, the cryopreservation medium comprises comprise serum or a serum replacement. In some embodiments, the cryopreservation medium is a commercially available cryopreservation medium formulated for specific cell types.

[0145] In some embodiments, the composition comprises a hydrogel. In some embodiments, the hydrogel is an alginate hydrogel, a hyaluronic acid hydrogel, a collagen hydrogel, a fibrin hydrogel, or a synthetic hydrogel such as a polyethylene glycol (PEG) hydrogel. In some embodiments, the hydrogel is injectable and gels in situ following administration.

[0146] In some embodiments, the composition comprises an extracellular matrix component. In some embodiments, the extracellular matrix component comprises collagen, laminin, fibronectin, or a combination thereof. In some embodiments, the extracellular matrix component is a basement membrane extract, such as Matrigel. In some embodiments, the extracellular matrix component is a decellularized tissue matrix.

[0147] In some embodiments, the composition is formulated for a specific route of administration. In some embodiments, the composition is formulated for injection. In some embodiments, the injection is intravenous, intramuscular, subcutaneous, intradermal, or localinjection at a site of treatment. In some embodiments, the composition is formulated for implantation. In some embodiments, the composition is formulated for topical application. In some embodiments, the composition is formulated for ocular administration, such as subretinal injection, intravitreal injection, or application to the ocular surface.

[0148] In some embodiments, the compositions disclosed herein can be formulated according to generally accepted compositions and methods for pharmaceutical preparation.Methods of making and use

[0149] Provided herein are methods of producing modified cells for allogeneic cellbased therapies. In some embodiments, the methods comprise obtaining unmodified cells, and introducing an inactivating mutation in an endogenous ERAP1 gene to the unmodified cells, or introducing an RNAi or ASO molecule targeting ERAP1 to the unmodified cells to generate modified cells. In some embodiments, the inactivating mutation is introduced by a Cas protein and a gRNA targeting the endogenous ERAP1 gene. In some embodiments, the gRNA comprises the sequence of SEQ ID NO: 1, SEQ ID NO: 2, or both. In some embodiments, the RNAi or ASO molecule comprises a region of complementary to an ERAP1 sequence. In some embodiments, the methods produce modified cells that exhibit increased HLA-I immunocompatibility relative to unmodified cells, thereby reducing the risk of immune rejection when the modified cells, or cells differentiated therefrom, are transplanted into an allogeneic recipient. In some embodiments, the modified cells are mammalian. In some embodiments, the modified cells are human.

[0150] In some embodiments of the methods of producing provided herein, the unmodified cells and / or modified cells are stem cells. In some embodiments, the stem cells are iPSCs. In some embodiments, if the modified cells are modified stem cells, the methods further comprise a step of differentiating the modified stem cells. In some embodiments, the modified stem cells are differentiated into ectodermal, mesodermal, endodermal, and / or neural crest lineage cells. In some embodiments, the modified stem cells are any of the modified stem cells disclosed herein.

[0151] In some embodiments of the methods of producing provided herein, the modified stem cells are differentiated into ectodermal lineage cells. In some embodiments, the modified stem cells are differentiated into LSCs, neuronal cells, or skin epithelial cells.

[0152] In some embodiments of the methods of producing provided herein, the modified stem cells are differentiated into mesodermal lineage cells. In some embodiments,the modified stem cells are differentiated into fibroblasts, cardiomyocytes, myocytes, osteocytes, or nephrons.

[0153] In some embodiments of the methods of producing provided herein, the modified stem cells are differentiated into endodermal lineage cells. In some embodiments, the modified stem cells are differentiated into pancreatic P cells or hepatocytes.

[0154] In some embodiments of the methods of producing provided herein, the modified stem cells are differentiated into neural crest lineage cells. In some embodiments, the modified stem cells are differentiated into CEnC or RPE cells.

[0155] In some embodiments, the methods further comprise initially obtaining unmodified stem cells. In some embodiments, the unmodified stem cells are iPSCs. In some embodiments, the unmodified stem cells are embryonic stem cells. In some embodiments, the unmodified stem cells are adult stem cells. In some embodiments, the unmodified stem cells are mesenchymal stem cells. In some embodiments, the unmodified stem cells are obtained from a cell bank, from a commercial source, or are reprogrammed from somatic cells.

[0156] Also provided herein are methods of administering any of the modified cells or compositions disclosed herein to a subject. In some embodiments, the subject is mammalian. In some embodiments, the subject is human.

[0157] Also provided herein are methods of treating a condition in a subject in need of cell transplantation. In some embodiments, the methods comprise administering to the subject an effective amount of any of the modified cells or compositions disclosed herein. In some embodiments, the subject is mammalian. In some embodiments, the subject is human.

[0158] Also provided herein are methods of treating an ocular condition in a subject in need thereof. In some embodiments, the methods comprise administering to the subject an effective amount of a population of LSCs, RPE cells, and / or CEnC that lack ERAP1 protein or comprise an inactive ERAP1 protein, or a composition thereof. In some embodiments, the LSCs are any of the LSCs disclosed herein. In some embodiments, the RPE cells are any of the RPE cells disclosed herein. In some embodiments, the CEnC are any of the CEnC disclosed herein. In some embodiments, the ocular condition is selected from age-related macular degeneration (AMD), retinitis pigmentosa (RP), Stargardt disease, glaucoma, corneal disorders like limbal stem cell deficiency, and diabetic retinopathy, inherited retinal degeneration, comeal dystrophies, post-infection ocular scarring, ocular surface failure after trauma and / or chemical injury. In some embodiments, the subject is mammalian. In some embodiments, the subject is human. In some embodiments, the population of LSCs, RPE cells, and / or CEnC aremammalian. In some embodiments, the population of LSCs, RPE cells, and / or CEnC are human.

[0159] Also provided herein are methods of treating diabetes in a subject in need thereof. In some embodiments, the methods comprise administering to the subject an effective amount of a population of pancreatic P cells that lack ERAP1 protein or comprise an inactive ERAP1 protein, or a composition thereof. In some embodiments, the pancreatic P cells are any of the pancreatic P cells disclosed herein. In some embodiments, the subject is mammalian. In some embodiments, the subject is human. In some embodiments, the population of pancreatic P cells are mammalian. In some embodiments, the population of pancreatic P cells are human.

[0160] In some embodiments of the methods of administration or treatment provided herein, the subject in need of cell transplantation is a mammal. In some embodiments, the subject is a human. In some embodiments, the subject has a condition that can treated by transplantation of cells, transplantation of stem cells, or transplantation of cells differentiated from stem cells. In some embodiments, the condition is a degenerative disease, an injury, a genetic disorder, or a condition resulting from loss or dysfunction of a specific cell type. In some embodiments, the condition is an ocular condition, a cardiac condition, a metabolic condition, a hepatic condition, or a condition affecting connective tissue.

[0161] In some embodiments of the methods of administration or treatment provided herein, the effective amount of the modified cell or composition is an amount sufficient to provide a therapeutic benefit to the subject. In some embodiments, the effective amount is an amount sufficient to replace lost or dysfunctional cells in the subject. In some embodiments, the effective amount is an amount sufficient to restore function to a tissue or organ in the subject. In some embodiments, the effective amount is an amount sufficient to ameliorate one or more symptoms of the condition in the subject. In some embodiments, the effective amount varies depending on the condition being treated, the cell type being administered, the route of administration, and characteristics of the subject such as age, weight, and overall health status. In some embodiments, the effective amount of the modified cell is in a range of about 104to about IO10cells. In some embodiments, the effective amount is in a range of about 105to about 109cells. In some embodiments, the effective amount is in a range of about 106to about 108cells. In some embodiments, the effective amount is determined based on preclinical studies, dose-escalation studies, and / or clinical trials.

[0162] In some embodiments of the methods of administration or treatment provided herein, the modified cells are administered by various routes of administration. In some embodiments, the route of administration is selected based on the condition being treated andthe target site for cell delivery. In some embodiments, the modified cells are administered parenterally, intravenously, intramuscularly, subcutaneously, intradermally, intracardially, intramyocardially, intracoronary, intrahepatically, intraportally, intrapancreatically, ocularly, subretinally, intravitreally, to the ocular surface, or by implantation.

[0163] In some embodiments of the methods of administration or treatment provided herein, the modified cells are administered by one or more administrations. In some embodiments, the modified stem cells engrafts at the site of administration and can persist for an extended period following a single administration.EXAMPLESExample 1. Materials and Methods

[0164] Deletion of ERAP 1 in cells: The ERAP1 gene sequence was retrieved from the NCBI database (Gene ID: 51752). Two gRNA oligos were designed for the ERAP1 gene near the start codon ATG.

[0165] 2 pL of 100 pM crRNA guide 1 (GGTTGCAAGGGACCATTTGA (SEQ ID NO: 1)) and 2 pL of 100 pM crRNA guide 2 (GGTGTCCCATCACTACGTTT (SEQ ID NO: 2)) were combined with 4 pL of 100 pM tracrRNA.

[0166] The crRNA: tracrRNA mixture was heated at 95°C for 5 minutes, then cooled to room temperature for 15 minutes. Next, 5 pL of the crRNA: tracrRNA complex was combined with 5 pL of 36 pM S.P Cas9 Nuclease V3 (IDT) and incubated at room temperature for 20 minutes to form the ribonucleoprotein (RNP) complex. One million iPSCs were resuspended in 90 pL of Buffer R (Thermo Fisher Scientific) and mixed with 10 pL of the RNP complex and 20 pL of 10.8 pM electroporation enhancer (IDT). The sample was gently mixed, loaded into a Neon 100 pL tip, and electroporated using the Neon Transfection System (Thermo Fisher Scientific) at 1700 V, 20 ms, and 1 pulse. After electroporation, the cells were seeded at a very low density in a 100-mm Matrigel-coated dish with MTeSRl medium containing 10 pM ROCK inhibitor. The next day, single cells were identified under a microscope and marked on the back of the dish. Once individual cells expanded and formed visible colonies, each colony was picked and split into two parts: one half was replated onto a Matrigel-coated 48-well plate, and the other half was suspended in lysis buffer for genomic DNA isolation.

[0167] To identify ERAP1 KO clones, genomic DNA was extracted from each clone, and PCR was performed using ERAP 1 -specific primers (ERAP1 forward primer: TTTGCTTTTGTACATTTGTGCC (SEQ ID NO: 3); ERAP1 reverse primer: AGGTTTGCATGGATCAAGAGAT (SEQ ID NO: 4)). PCR products were resolved on anethidium bromide-stained agarose gel to distinguish ERAP1 KO clones from WT clones based on band size (WT: 256 bp; KO: 155 bp).

[0168] Mouse transplantation protocol (in vivo immune escape): Humanized NOG-EXL mice engrafted with human CD34+hematopoietic stem cells (HSCs) were used to evaluate immune recognition and in vivo survival of transplanted cells. These mice develop a multilineage human immune system with functional T- and NK cell-dependent immune responses and lack xenogeneic immune reactivity against the host. Animals were randomly assigned to experimental groups. Human immune reconstitution was assessed in peripheral blood by flow cytometry prior to cell transplantation. The percentage of human CD3+T cells within the human CD45+population was determined for each animal, and mice with >70% human CD45+cells were considered sufficiently humanized and included in the study. Immunodeficient NSG mice were used as non-immune controls.

[0169] For the iPSC-derived tissue survival and expansion study, WT and ERAP1 KO iPSCs were resuspended at a density of 2 x 106cells in 50 pL Matrigel and injected intramuscularly into the right gastrocnemius muscle of huNOG-EXL and NSG mice. Tissue survival and expansion were monitored weekly. Mice were euthanized 6 weeks post-injection, and iPSC-derived tissues were excised for downstream analyses.

[0170] To assess survival and immune escape of differentiated cells, WT and ERAP1 KO iPSC-derived limbal stem cells (LSCs) were similarly resuspended in 50 L Matrigel and injected intramuscularly into the right gastrocnemius muscle of huNOG-EXL mice. One week post-injection, mice were euthanized, and both the injection site and spleen were harvested for immunological and histological analyses.

[0171] Flow cytometry: Surface staining of single-cell suspensions was performed using fluorochrome-conjugated monoclonal antibodies and corresponding isotype controls to assess the expression of HLA class I (HLA-ABC) and HLA class II (HLA-DR) on iPSCs. For immune phenotyping, allo-primed cocultured PBMCs and splenocytes were stained for surface expression of CD3, CD8, CD56, and the degranulation marker CD107a.

[0172] For intracellular cytokine staining, interferon-y (IFN-y) production was assessed by adding Brefeldin A (0.1 pF per 100 pL culture medium) to the cultures 4 h prior to cell harvest to inhibit cytokine secretion. Following surface staining, cells were fixed and permeabilized using standard fixation / permeabilization buffers, and intracellular IFN-y staining was performed according to the manufacturer’s instructions.

[0173] Data were acquired on an ESR II flow cytometer and analyzed using FlowJo software.

[0174] Peptide expression analysis:

[0175] Immunoprecipitation of MHC class I complexes iPSC samples were lysed in ice-cold lysis buffer containing 50 mM Tris-HCl (pH 8.0), 150 mM NaCl, 0.25% sodium deoxycholate, 1% NP-40, 20 mM iodoacetamide, and lx protease inhibitor cocktail. Lysates were sonicated on ice and clarified by sequential centrifugation at 2,000 x g followed by 20,000 x g at 4 °C. Clarified lysates were pre-cleared using Protein A Sepharose beads and subsequently passed through an anti-MHC class I antibody-coupled immunoaffinity column. The column was washed with detergent-free lysis buffer followed by Tris-based wash buffers of increasing ionic strength. Bound MHC class I-peptide complexes were eluted using 10% (v / v) acetic acid, and eluates were pooled.

[0176] Purification of peptides from MHC class I complexes by RP-LC: Eluted samples were acidified to a final concentration of 1% trifluoroacetic acid (TFA) and separated by reverse-phase liquid chromatography (RP-LC) at a flow rate of 0.3 mL / min. Peptide-containing fractions were collected and concentrated using a SpeedVac concentrator.

[0177] Nano LC-MS / MS analysis: Purified peptides (1 pg) were separated using a trapping column (PepMap C18, 100 A, 100 pm x 2 cm, 5 pm) and an analytical column (PepMap C18, 100 A, 75 pm x 50 cm, 2 pm). Data were acquired on a Q Exactive HF mass spectrometer. Raw data were processed using PEAKS Studio v8.5 and searched against the human reference protein database with no enzyme specificity.

[0178] Immunofluorescence: a-Smooth muscle actin (a-SMA) expression was analyzed by immunofluorescence staining. iPSC-derived fibroblast-like cells were cultured on Matrigel-coated glass coverslips. Upon reaching 60-70% confluence, cells were fixed with 4% paraformaldehyde for 15 min at room temperature (RT) and washed three times with lx PBS.

[0179] Cells were then permeabilized with 0.5% Triton X-100 in PBS for 10 min at RT, followed by three washes with lx PBS. To reduce nonspecific antibody binding, coverslips were incubated in blocking buffer (2% bovine serum albumin in PBS) for 1 h at RT.

[0180] The anti-a-SMA primary antibody was diluted in blocking buffer (1:500) and incubated with the coverslips for 1 h at RT. Following primary antibody incubation, cells were washed three times with lx PBS. Primary antibody binding was detected using an Alexa Fluor 594-conjugated secondary antibody, diluted in blocking buffer and incubated for 45 min at RT in the dark.

[0181] Coverslips were then washed three times with lx PBS and mounted onto glass slides using a DAPLcontaining mounting medium. Fluorescence images were captured using a fluorescence microscope.

[0182] Immunohistochemistry: Muscle tissues harvested from humanized mice were fixed in 4% paraformaldehyde, processed, and embedded in paraffin. Paraffin blocks were sectioned at 4 pm thickness. Deparaffinization was performed by heating slides in a hot-air oven at 70 °C, followed by three washes in xylene to completely remove paraffin.

[0183] Sections were then rehydrated through a graded ethanol series (100%, 90%, and 80%; 3 min each) and rinsed in lx PBS. Antigen retrieval was subsequently performed (method not specified). Sections were permeabilized with 0.5% Triton X-100 for 20 min at RT.

[0184] To prevent nonspecific antibody binding, sections were incubated in blocking buffer for 1 h at RT. Primary antibodies against CD45 and PAX6 were diluted in blocking buffer and incubated with the sections overnight at 4 °C, followed by three washes with lx PBS.

[0185] Sections were then incubated with Alexa Fluor 488- or Alexa Fluor 594-conjugated secondary antibodies for 45 min at RT in the dark, followed by three washes with lx PBS. Finally, sections were mounted using a DAPI-containing mounting medium. Images were acquired using a confocal microscope.

[0186] Differentiation of iPSCs into limbal stem cells (LSCs): Human iPSCs (hiPSCs) were differentiated into limbal stem cells (LSCs) using previously published protocols (Vattulainen et al. Comeal epithelial differentiation of human pluripotent stem cells generates ABCB5+and ANp63a+cells with limbal cell characteristics and high wound healing capacity. Stem Cell Res Ther. (2021);12(l):609; Mikhailova et al. Small-Molecule Induction Promotes Comeal Epithelial Cell Differentiation from Human Induced Pluripotent Stem Cells. Stem Cell Reports. (2014);2(2):219-231), each of which is hereby expressly incorporated by reference in their entirety). Briefly, hiPSCs were maintained in Essential 8 Medium on plates coated with 0.55 pg / cm2laminin-521 (LN-521). Upon reaching -80% confluence, cells were dissociated using ReLeSR to generate embryoid bodies (EBs).

[0187] EBs were cultured in non-adherent dishes containing basal induction medium composed of KnockOut™ DMEM, 15% KnockOut™ Semm Replacement, 2 mM L-glutamine, 0.1 mM P-mercaptoethanol, 1% non-essential amino acids (NEAA), and 50 U / mL penicillin-streptomycin, supplemented with 5 pM Blebbistatin.

[0188] On day 1, EBs were directed toward the surface ectoderm lineage by culturing in basal induction medium supplemented with 10 pM transforming growth factor-P (TGF-P) inhibitor and 50 ng / mL human basic fibroblast growth factor (bFGF). On days 3 and 4, differentiation was further guided by the addition of 25 ng / mL bone morphogenetic protein-4 (BMP-4).

[0189] On day 5, to promote differentiation of surface ectoderm into LSCs, EBs were plated onto dishes coated with 5 pg / cm2collagen IV and 0.5 pg / cm2LN-521, and the culture medium was replaced with CnT-30 comeal differentiation medium, refreshed three times per week.

[0190] After day 18, iPSC-derived LSCs were phenotypically characterized and used for subsequent in vitro and in vivo experiments.

[0191] Differentiation of iPSCs into retinal pigment epithelium (RPE): Human iPSCs (hiPSCs) were differentiated into retinal pigment epithelium (RPE) by adapting a previously published protocol (Mahato et al. Generation of Retinal Organoids from Healthy and Retinal Disease- Specific Human-Induced Pluripotent Stem Cells. J Vis Exp. (2022); 190, which is hereby expressly incorporated by reference in its entirety). Briefly, hiPSC cultures were harvested and replated in non-adherent dishes to generate embryoid bodies (EBs) in mTeSRl medium supplemented with 10 pM Y-27632 for 24 h. On day 1, the medium was replaced with differentiation induction medium (DIM) consisting of DMEM / F12, 10% KnockOut™ Serum Replacement (KOSR), lx non-essential amino acids (NEAA), 2 mM GlutaMAX, 100 U / mL penicillin-streptomycin, 200 pM L-ascorbic acid, and 1% N2 supplement, supplemented with 1 ng / mL basic fibroblast growth factor (bFGF) and 10 ng / mL Noggin.

[0192] On day 2, DIM was supplemented with 10 ng / mL Noggin alone. On day 3, EBs were collected into a 15 mL conical tube, allowed to settle by gravity, and plated onto Matrigel-coated culture dishes.

[0193] Cultures were maintained in retinal differentiation medium (RDM) composed of DMEM / F12, 10% KOSR, lx NEAA, 2 mM GlutaMAX, 100 U / mL penicillin-streptomycin, 200 pM L-ascorbic acid, and 2% B27 supplement with vitamin A for approximately 40 days, until the appearance of lightly pigmented RPE patches.

[0194] Pigmented regions were manually isolated and transferred to new culture dishes for enrichment in RDM supplemented with lx THT and hydrocortisone. Mature RPE cells were maintained as a polarized monolayer and exhibited the characteristic cobblestone morphology.

[0195] Differentiation of iPSCs into corneal endothelial cells: Human iPSCs (hiPSCs) were differentiated into corneal endothelial cells (CEnCs) using a protocol adapted from Ali et al. Pluripotent stem cell-derived comeal endothelial cells as an alternative to donor corneal endothelium in keratoplasty. Stem Cell Reports (2021);16(9):2320-2335, which is hereby expressly incorporated by reference in its entirety. Briefly, hiPSCs were maintained on laminin-coated culture dishes in mTeSRl medium. Upon reaching -80% confluence, cellswere dissociated using ReLeSR and replated at a 1:7 split ratio. Cells were maintained in mTeSRl for 4 days with daily medium changes.

[0196] From day 5 to day 10, cultures were transitioned to neural crest differentiation medium supplemented with 500 ng / mL Noggin and 10 pM SB431542 in a basal medium composed of 80% DMEM / F12, 20% KnockOut™ Serum Replacement (KOSR), 1% non-essential amino acids (NEAA), 1 mM L-glutamine, 0.1 mM P-mercaptoethanol, and 8 ng / mL basic fibroblast growth factor (bFGF), with daily medium changes.

[0197] On day 11, the medium was replaced with comeal endothelial differentiation medium containing 10 ng / mL platelet-derived growth factor-BB (PDGF-BB), 10 ng / mL Dickkopf-2 (DKK-2), and 0.13x B27 supplement.

[0198] On day 12, differentiating cells were replated onto freshly laminin-coated plates and maintained in the same medium for an additional 6 days, with medium changes every other day.

[0199] By day 19, iPSC-derived CEnCs were phenotypically characterized using comeal endothelial- specific markers and used for subsequent experiments.

[0200] Differentiation of iPSCs into fibroblast-like cells: Human iPSCs (hiPSCs) were differentiated into fibroblast- like cells following a protocol adapted from Itoh et al. Generation of 3D skin equivalents fully reconstituted from human induced pluripotent stem cells (iPSCs). PLoS One (2013);8(10):e77673, which is hereby expressly incorporated by reference in its entirety. Embryoid bodies (EBs) were generated by culturing hiPSCs in suspension in iPSC medium lacking bFGF, supplemented with 0.3 mM ascorbic acid, 10 ng / mL transforming growth factor-beta 2 (TGF-[32), and ITS- A supplement in non-adherent dishes. After 48 h, EBs were plated onto gelatin-coated culture dishes and maintained in high-glucose DMEM containing ascorbic acid and 20% fetal bovine serum (FBS) for 10 days. Cells migrating from the EBs were subsequently passaged and cultured weekly, yielding typical spindle-shaped fibroblast- like cells.

[0201] Differentiation of iPSCs into pancreatic beta cells: Human iPSCs (hiPSCs) were differentiated into pancreatic beta cells using a stepwise protocol adapted from Hogrebe et al. Generation of insulin-producing pancreatic P cells from multiple human stem cell lines. Nat Protoc. (2021);16(9):4109-4143. Prior to differentiation, hiPSCs were cultured on Matrigel-coated dishes. At -80% confluence, cells were dissociated into single cells using TrypLE for 5 min, pelleted, and replated at a density of 0.8-1 x 106cells / mL in mTeSRl medium supplemented with 10 pM ROCK inhibitor (Y-27632 dihydrochloride). During days 1-35, differentiation proceeded in six sequential stages, with daily medium changes according to thestage: Stage 1: Days 1-4; Stage 2: Days 5-6; Stage 3: Days 7-8; Stage 4: Days 9-12; Stage 5: Days 13-20; Stage 6: Days 21-35 (endocrine induction). At each stage, cells were collected to assess stage- specific pancreatic endocrine and beta-cell markers. On day 7 of Stage 6, for beta cell maturation, cells were dissociated into single cells using TrypLE, pelleted, and resuspended in static micro well plates at 1 x 106cells / mL to allow formation of beta cell aggregates. These aggregates were further used for characterization and subsequent experiments.

[0202] Basal media compositions:

[0203] Basal E MCDB131 (I L), 10 mL / L GlutaMAX, 1.174 g / L NaHCOs, 1 g / LBSA, 0.16 g / L glucose.

[0204] Basal2: MCDB131 (1 L), 10 mL / L GlutaMAX, 1.174 g / L NaHCOs, 1 g / LBSA, 0.8 g / L glucose.

[0205] Basal 3: MCDB131 (1 L), 10 mL / L GlutaMAX, 1.754 g / L NaHCOs, 20 g BSA, 0.44 g / L glucose, 5 mL / L ITS-X, 44 mg / L Vitamin C.

[0206] Basal 4: MCDB131 (1 L), 10 mL / L GlutaMAX, 1.754 g / L NaHCOs, 20 g BSA, 7.2 g / L glucose, 5 mL / L ITS-X, 44 mg / L Vitamin C, 10 mg / mL Heparin, lx Penicillin-Streptomycin.

[0207] Stage-specific media compositions

[0208] Stage 1: Basal 1 + 100 ng / mL Activin A + 5 pM CHIR-99021.

[0209] Day 1: Basal 1 + 100 ng / mL Activin A + 5 pM CHIR-99021.

[0210] Days 2-4: Basal 1 + 100 ng / mL Activin A.

[0211] Stage 2: Basal 2 + 50 ng / mL KGF.

[0212] Stage 3: Basal 3 + 50 ng / mL KGF, 0.25 pM SANT-1, 1 pM retinoic acid, 100 nM LDN-193189, 200 nM TPB.

[0213] Stage 4: Basal 3 + 50 ng / mL KGF, 0.25 pM SANT-1, 0.1 pM retinoic acid, 100 nM LDN-193189, 200 nM TPB.

[0214] Stage 5: Basal 4 + 10 pM ALK5 inhibitor II, 1 pM XXI, 1 pM retinoic acid, 1 pM T3, 0.25 pM SANT-1, 1 pM latrunculin A (first 24 h only).

[0215] Stage 6: MCDB131 + 10 mL / L GlutaMAX, 1.754 g / L NaHCOs, 20 g BSA, 0.46 g / L glucose, 5 mL / L ITS-X, 44 mg / L Vitamin C, lx MEM NEAA, 10 mg / mL Heparin, lx Penicillin-Streptomycin, lx Trace Elements A, lx Trace Elements B, ZnSO4-7H2O (1 mM stock).

[0216] Calcein-AM staining: To assess the integrity and viability of iPSC-derived LSC monolayers and pancreatic beta cell clusters following co-culture with PBMCs, target cellswere first washed once with lx PBS. Cells were then incubated with Calcein-AM (cytoplasmic viability dye) at a final concentration of 2 pM for 30 min in a 37 °C, 5% CO2 incubator. After staining, cells were washed three times with lx PBS to remove excess dye.

[0217] Primed PBMCs were subsequently added directly onto the iLSC monolayer or beta cell clusters and co-cultured for 9 h. At the end of the co-culture period, cell viability and monolayer / cluster integrity were evaluated by imaging Calcein fluorescence using a fluorescence microscope equipped with a FITC filter.

[0218] Lactate dehydrogenase (LDH) assay: Cytotoxicity was quantified using a lactate dehydrogenase (LDH) release assay (Cytotoxicity Detection Kit) according to the manufacturer’s instructions. iPSCs or iPSC-derived limbal stem cells (LSCs) were cocultured with primed PBMCs. After 9 h of co-culture, 100 pL of culture supernatant was collected from each well and transferred to a fresh 96- well plate. Next, 100 pL of LDH reaction mixture was added to each well, and plates were incubated for 30 min at room temperature in the dark. The reaction was stopped by adding 50 pL of stop solution, and absorbance was measured at 490 nm using a microplate reader. Spontaneous LDH release was determined from wells containing target cells alone and primed PBMCs alone. Maximum LDH release was determined by lysing cells at the experimental endpoint using the lysis buffer provided in the kit. Percent cytotoxicity was calculated according to the manufacturer’s formula.

[0219] RNA isolation and quantitative RT-PCR (qRT-PCR): Total RNA was extracted from samples using the RNeasy Micro Kit according to the manufacturer’s instructions. RNA concentration and purity were assessed using a NanoDrop spectrophotometer. 500-1000 ng of total RNA from each sample was reverse-transcribed into cDNA using SuperScript III Reverse Transcriptase following the manufacturer’s protocol. Quantitative RT-PCR was performed using TaqMan Universal PCR Master Mix and predesigned TaqMan primers for the following genes: ACTB (Hs99999903_ml) - internal control; OCT4 (Hs00999632_gl); NANOG (Hs02387400_gl); NEURODI (Hs01922995_sl); NKX2-2 (Hs00159616_ml); INSULIN (Hs00355773_ml); Chromogranin A (CHGA); NK6-1 (Hs00232355_ml). qRT-PCR reactions were run for 45 cycles using the following thermal program: 95 °C for 10 min (initial denaturation); 95 °C for 15 s (denaturation); 60 °C for 1 min (annealing / extension with fluorescence acquisition using FAM-labeled probe with minor groove binder). Data analysis was performed using the comparative Ct (AACt) method, with ACTB as the internal control, and results were expressed as copy numbers per 106copies of ACTB.Example 2: ERAP1 knockout iPSCs escape alloimmunity in humanized immunocompetent mice

[0220] A pluripotent cell-derived graft formation assay was performed in immunodeficient (NSG) and humanized immune system (HIS) mice to evaluate in vivo immune escape by ERAP1 knockout iPSCs (FIG.1A). Representative excised grafts show that both WT and ERAP1 KO iPSCs formed comparable cell-derived masses in NSG mice, indicating preserved pluripotency and growth capacity in the absence of immune pressure. In contrast, WT iPSCs injected into HIS mice were rejected, resulting in markedly reduced tissue growth. ERAP1 KO iPSCs, however, escaped immune rejection in HIS mice and formed substantially larger tissue growth.

[0221] A quantification of weights of these grafts is provided in FIG. IB. WT and ERAP1 KO iPSCs formed grafts of comparable weight in NSG mice. In contrast, WT iPSCs injected into HIS mice produced significantly smaller grafts, consistent with immune-mediated rejection, whereas ERAP1 KO iPSCs generated substantially larger grafts.

[0222] Human leukocyte antigen (HLA) expression was assessed between WT and ERAP1-KO iPSCs. Flow cytometric analysis showed that ERAP1 KO iPSCs exhibit HLA class I surface expression comparable to WT iPSCs, indicating that ERAP1 deletion does not alter HLA class I expression (FIG.2A). No HLA class II surface expression was detected on either WT or ERAP1 KO iPSCs (FIG. 2B).

[0223] HLA class I peptides exhibited by WT and ERAP1 KO iPSCs was assessed by immunoprecipitation and mass spectrometric analysis (FIG. 3A). Cell pellets were lysed in buffer containing protease inhibitors, and lysates were pre-cleared using Protein A Sepharose. HLA class I-peptide complexes were immunoprecipitated using an antibody cross-linked to Protein A Sepharose. Bound peptides were eluted, purified by reverse-phase liquid chromatography (RP-LC), and analyzed by nano-LC-MS / MS. Raw mass spectrometry data were processed using PEAKS Studio 8.5 for peptide identification against the human protein database.

[0224] FIG. 3B shows the total number of peptides identified by nano-LC-MS / MS following purification of HLA class I-associated peptides from WT and ERAP1 KO iPSCs. ERAP1 KO iPSCs exhibited a substantial reduction, with 1,134 fewer HLA class I-associated peptides identified compared with WT iPSCs. FIG. 3C shows the distribution of peptide lengths (amino acids) among HLA class I-associated peptides identified by nano-LC-MS / MS in WT and ERAP1 KO iPSCs. ERAP1 KO iPSCs exhibited an approximately 90% reduction in 8-, 9-, and 10-mer peptides compared with WT iPSCs, consistent with defective peptidetrimming resulting from loss of ERAP1 function. HLA class I molecules preferentially present peptides of 8-10 amino acids in length for optimal loading to the HLA class I groove and subsequent CD8+T cell recognition.Example 3. ERAP1 knockout does not affect differentiation of iPSCs into different cell types

[0225] ERAP1 deletion does not affect iPSC pluripotency and results in similar differentiation into limbal stem cells (LSCs) compared with WT iPSCs. Representative phasecontrast images illustrate LSC differentiation from WT and ERAP1 KO iPSCs (FIG. 4A). At day 0, iPSCs formed tightly packed colonies with smooth, well-defined edges. Embryoid bodies (EBs) were generated from undifferentiated iPSCs in suspension culture during the first 24 hours. From days 1-4, EBs were treated with small molecules to induce surface ectoderm differentiation. On day 5, EBs were plated onto laminin- and collagen IV-coated dishes to initiate adherent differentiation. By day 9, epithelial-like cells migrated outward from the plated EBs. By day 18, cells exhibited characteristic LSC-like morphology, with comparable differentiation patterns observed in both WT and ERAP1 KO cultures.

[0226] ERAP1 deletion also results in similar differentiation into retinal pigment epithelium (RPE) cells compared with WT iPSCs. Representative images show confluent iPSC cultures grown on Matrigel-coated dishes and differentiated toward retinal lineages (FIG.4B).From days 0-3, WT and ERAP1 KO embryoid bodies (EBs) were cultured in differentiation induction medium (DIM) to promote neuroectodermal specification. On day 4, DIM was replaced with retinal differentiation medium (RDM) to drive retinal lineage differentiation, and cultures were maintained until day 55, when pigmented RPE patches became evident. Pigmented regions were manually isolated and replated for enrichment. Mature WT- and ERAP1 KO-derived RPE cells formed confluent monolayers with a characteristic cobblestone morphology.

[0227] ERAP1 deletion also results in similar differentiation into corneal endothelial cells (CEnCs) compared with WT iPSCs. Representative bright-field images show morphological changes during stepwise differentiation of WT and ERAP1 KO iPSCs (FIG.4C). Undifferentiated iPSCs at day 0 were induced to form neural crest cells (NCCs) using neural crest differentiation medium (NDM). By day 10, NCCs exhibited an elongated, spindle-shaped, migratory morphology. Subsequent differentiation in corneal endothelial cell differentiation medium (CDM) produced cells with characteristic polygonal, cobblestone-like CEnC morphology by day 18.

[0228] ERAP1 deletion also results in similar differentiation into fibroblast-like cells compared with WT iPSCs. Representative bright-field images show the morphology of WT and ERAP1 KO iPSCs following differentiation (FIG. 4D). Both WT- and ERAP1 KO-derived cells exhibited an elongated, spindle-shaped morphology characteristic of fibroblastlike cells. Immunofluorescence images show alpha smooth muscle actin (aSMA, red) expression in WT and ERAP1 KO fibroblast-like cells (FIG.4E). Nuclei are stained with DAPI (blue). Merged images demonstrate a uniform aSMA distribution, indicating comparable myofibroblastic features in both WT and ERAP1 KO cells.Example 4. ERAP1 KO iPSC-derived LSCs exhibit reduced allo-immunogenicity

[0229] ERAP1 KO iPSC-derived LSCs showed reduced cytotoxicity in response to alloprimed PBMCs compared to WT. WT and ERAP1 KO iLSCs cultured without human peripheral blood mononuclear cells (Control, No PBMCs) showed intact monolayers with no cytotoxicity when stained with Calcein AM. However, in the presence of alloantigen-primed PBMCs, WT iLSCs exhibited increased cytotoxicity compared with ERAP1 KO iLSCs (FIG.5A). This cytotoxicity was quantified using an LDH assay. WT iLSCs exhibited significantly higher cytotoxicity, as indicated by increased LDH release, compared with ERAP1 KO iLSCs (FIG. 5B).

[0230] Flow cytometric analysis of degranulation responses in alloantigen-primed peripheral blood mononuclear cells (PBMCs) following coculture with WT or ERAP1 KO iLSCs was performed. Representative dot plots show surface expression of the degranulation marker CD107a on CD8+cytotoxic T lymphocytes (CTLs) and CD56+natural killer (NK) cells. Increased CD107a expression was observed in CD8+CTLs cocultured with WT iLSCs compared with ERAP1 KO iLSCs (FIG. 5C). In contrast, CD107a expression on CD56+NK cells remained comparable between WT and ERAP1 KO cocultures, indicating no evidence of missing-self response (FIG. 5D).

[0231] Alloimmune responses to WT and ERAP1 KO iPSC-derived LSCs were assessed in humanized immune system (HIS) mice (FIG. 6). Humanized mice were engrafted and, 18 weeks post-engraftment, received intramuscular injections into the gastrocnemius muscle of either WT iLSCs (2 x 106cells), ERAP1 KO iLSCs (2 x 106cells) suspended in Matrigel, or Matrigel alone as a no-cell control. Mice were monitored for one week following injection and euthanized at one week post-injection. Spleens were harvested for flow cytometric analysis to assess systemic alloimmune activation, while injected muscle tissueswere collected for histological and immunohistochemical analyses to evaluate iLSC survival and local immune cell infiltration.

[0232] IFN-y expression was assessed in spleen-derived total T cells (FIG. 7A), and CD107a expression was measured on spleen-derived NK cells (FIG. 7B). Comparable frequencies of IFN-y-producing T cells were observed in mice injected with WT or ERAP1 KO iLSCs, indicating no significant difference in systemic alloimmune activation between the two groups. Control mice injected with Matrigel alone showed minimal IFN-y expression. Similarly, CD 107a expression on NK cells did not differ significantly between WT and ERAP1 KO iLSC-injected mice.

[0233] Representative hematoxylin and eosin-stained sections from humanized mice injected with WT iLSCs, ERAP1 KO iLSCs, or Matrigel alone were prepared. Muscle sections from Matrigel-only controls showed normal architecture with no immune cell infiltration, similar to ERAP1 KO iLSC-injected muscles, where discrete iLSC colonies were observed with minimal infiltration (FIG. 7C). In contrast, WT iLSC-injected muscles exhibited prominent immune cell infiltration at the injection site. Additionally, immunohistochemical staining of muscle sections from humanized mice one week after intramuscular injection revealed that WT iLSC-injected muscles exhibited increased CD45+immune cell infiltration, whereas ERAP1 KO iLSC- and Matrigel-injected muscles showed minimal CD45+immune cell infiltration (FIG. 7D). PAX6+limbal stem cells were detected exclusively in muscle injected with ERAP1 KO iLSCs, indicating survival of the transplanted cells (FIG. 7E). No PAX6 expression was observed in muscles injected with WT iLSCs or Matrigel alone.Example 5. Pancreatic 0 (beta) cells can be differentiated from ERAP1 KO iPSCs and exhibit reduced allo-immunogenicity

[0234] FIG. 8 shows an exemplary process of differentiating iPSCs to pancreatic 0 cells. Human iPSCs were initially seeded on Matrigel-coated dishes. Over 35 days, cells were sequentially differentiated toward a pancreatic 0 cell fate through six stages, using the protocol disclosed herein to generate intermediate progenitor populations and mature 0-like cells.

[0235] ERAP1 deletion did not affect iPSC pluripotency or differentiation efficiency, with comparable morphological progression observed in WT and ERAP1 KO cultures (FIG.9A, showing images up to stage 4 resulting in pancreatic progenitor cells). After endocrine induction, differentiated cells were transferred to microwell plates to promote formation of three dimensional pancreatic 0 cell clusters.

[0236] qRT-PCR analysis of pluripotency markers OCT4 and NANOG shows high expression in both WT and ERAP1 KO iPSCs at day 0, followed by a significant decrease after stage 1 differentiation, indicating successful exit from pluripotency (FIG. 9C). ERAP1 deletion does not impair downregulation of pluripotency markers or early differentiation.

[0237] Expression of endocrine induction markers NEURODI, NKX2-2, and INSULIN increased at stage 5 compared with day 0 in both WT and ERAP1 KO cultures as measured by qRT-PCR, indicating successful differentiation toward pancreatic endocrine and P-cell lineages (FIG. 9D). ERAP1 deletion does not affect differentiation to pancreatic progenitor and P-cell lineages.

[0238] Expression of the pancreatic endocrine and P-cell markers chromogranin A (a neuroendocrine marker), NKX6.1 (a key P-cell transcription factor), and INSULIN increased at stage 6 of differentiation in both WT and ERAP1 KO cells as measured by qRT-PCR (FIG.9E). Notably, INSULIN expression increased relative to stage 5, indicating further maturation of P-like cells.

[0239] WT and ERAP1 KO pancreatic P-cell clusters were cocultured with alloantigen-primed PBMCs at two effector cell doses (1 x 105and 2 x 105PBMCs for 9 hours) and imaged with Calcein-AM fluorescence (FIG. 9F). Control P-cell clusters (cultured without PBMCs) maintained intact three-dimensional architecture with no cytotoxicity. Upon coculture with allo-primed PBMCs, WT P-cell clusters showed structural disruption and loss of cell clusters, with significantly increased cytotoxicity as quantified by LDH release by cell death. In contrast, ERAP1 KO P-cell clusters maintained preserved 3D architecture and exhibited significantly reduced cytotoxicity and LDH release compared with WT at both PBMC doses.

[0240] Flow cytometric analysis of the cocultured alloantigen-primed PBMCs showed that coculture with WT p cells resulted in increased frequencies of IFN-y+and CD107a+CD8+CTLs compared with ERAP1 KO P cells (FIGs. 9G-9H). In contrast, CD107a expression on CD56+NK cells was comparable between WT and ERAP1 KO co-cultures, indicating no evidence of a missing-self NK cell response (FIG. 91).Example 6: Pancreatic beta cell alloimmune cytotoxicity assays in mice

[0241] The immuno-cyto toxicity escape studies described herein, in which WT and ERAP1-KO beta cells were cocultured with alloprimed human PBMCs, demonstrated reduced cytotoxicity of ERAP1-KO cells upon exposure to effector immune cells. To further evaluate immune escape and functional engraftment in vivo, WT and ERAP1-KO iPSCs are differentiated into insulin-producing pancreatic beta-cell islet clusters and transplanted intostreptozotocin-induced diabetic humanized mice (with human immune system). Islet grafts are injected into the gastrocnemius muscle of the right thigh of the diabetic humanized mice. Graft survival is monitored at multiple time points by assessing human immune activation markers in peripheral blood. Metabolic function is evaluated through weekly blood glucose measurements. At the end of the study, the injection site is harvested for histological analysis to assess graft survival, beta-cell identity, viability, and immune cell infiltration.

[0242] WT beta cell clusters undergo immune-mediated rejection in diabetic humanized mice, characterized by T cell activation, graft loss, and persistent hyperglycemia. In contrast, ERAP 1 -KO beta cell clusters are expected to escape immune recognition, survive as functional grafts, and continue insulin secretion, resulting in reduced blood glucose levels and improved glucose tolerance. At the end of the study, histological analysis should reveal preserved graft architecture, absence of immune cell infiltration, and confirmation of beta-cell identity and viability, indicating successful engraftment and immune escape of ERAP 1 -KO beta cell clusters in a humanized immune environment.EQUIVALENTS AND SCOPE

[0243] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents of the embodiments described herein. The scope of the present disclosure is not intended to be limited to the above description, but rather is as set forth in the appended claims.

[0244] Articles such as “a,” “an,” and “the” may mean one or more than one unless indicated to the contrary or otherwise evident from the context. Claims or descriptions that include “or” between two or more members of a group are considered satisfied if one, more than one, or all of the group members are present, unless indicated to the contrary or otherwise evident from the context. The disclosure of a group that includes “or” between two or more group members provides embodiments in which exactly one member of the group is present, embodiments in which more than one members of the group are present, and embodiments in which all of the group members are present. For purposes of brevity those embodiments have not been individually spelled out herein, but it will be understood that each of these embodiments is provided herein and may be specifically claimed or disclaimed.

[0245] It is to be understood that the disclosure encompasses all variations, combinations, and permutations in which one or more limitation, element, clause, or descriptive term, from one or more of the claims or from one or more relevant portion of the description, is introduced into another claim. For example, a claim that is dependent on anotherclaim can be modified to include one or more of the limitations found in any other claim that is dependent on the same base claim. Furthermore, where the claims recite a composition, it is to be understood that methods of making or using the composition according to any of the methods of making or using disclosed herein or according to methods known in the art, if any, are included, unless otherwise indicated or unless it would be evident to one of ordinary skill in the art that a contradiction or inconsistency would arise.

[0246] Where elements are presented as lists, e.g., in Markush group format, it is to be understood that every possible subgroup of the elements is also disclosed, and that any element or subgroup of elements can be removed from the group. It is also noted that the term “comprising” is intended to be open and permits the inclusion of additional elements or steps. It should be understood that, in general, where an embodiment, product, or method is referred to as comprising particular elements, features, or steps, embodiments, products, or methods that consist, or consist essentially of, such elements, features, or steps, are provided as well. For purposes of brevity those embodiments have not been individually spelled out herein, but it will be understood that each of these embodiments is provided herein and may be specifically claimed or disclaimed.

[0247] Where ranges are given, endpoints are included. Furthermore, it is to be understood that unless otherwise indicated or otherwise evident from the context and / or the understanding of one of ordinary skill in the art, values that are expressed as ranges can assume any specific value within the stated ranges in some embodiments, to the tenth of the unit of the lower limit of the range, unless the context clearly dictates otherwise. For purposes of brevity, the values in each range have not been individually spelled out herein, but it will be understood that each of these values is provided herein and may be specifically claimed or disclaimed. It is also to be understood that unless otherwise indicated or otherwise evident from the context and / or the understanding of one of ordinary skill in the art, values expressed as ranges can assume any subrange within the given range, wherein the endpoints of the subrange are expressed to the same degree of accuracy as the tenth of the unit of the lower limit of the range.

[0248] In addition, it is to be understood that any particular embodiment of the present disclosure may be explicitly excluded from any one or more of the claims. Where ranges are given, any value within the range may explicitly be excluded from any one or more of the claims. Any embodiment, element, feature, application, or aspect of the compositions and / or methods of the disclosure, can be excluded from any one or more claims. For purposes of brevity, all of the embodiments in which one or more elements, features, purposes, or aspects is excluded are not set forth explicitly herein.

Claims

CLAIMSWhat is claimed is:

1. A modified cell lacking endoplasmic reticulum aminopeptidase 1 (ERAP1) protein or comprising an ERAP1 protein that is inactive.

2. The modified cell of claim 1, wherein the modified cell lacks ERAP1 protein and / or the ERAP1 protein is inactive due to an inactivating mutation in an endogenous ERAP1 gene of the modified cell.

3. The modified cell of claim 2, wherein the inactivating mutation comprises a deletion, substitution, or insertion of one or more nucleotides in a genomic sequence of the endogenous ERAP1 gene, optionally wherein the inactivating mutation is introduced by a Cas protein and a gRNA targeting the endogenous ERAP1 gene.

4. The modified cell of claim 1, wherein the modified cell lacks ERAP1 protein and / or the ERAP1 protein is inactive due to RNA interference or with an antisense oligonucleotide.

5. The modified cell of any one of claims 1-4, wherein the modified cell expresses a peptide-free HLA-I molecule.

6. The modified cell of any one of claims 1-5, wherein the modified cell expresses an HLA-I molecule comprising a low-affinity peptide.

7. The modified cell of any one of claims 1-6, wherein the modified cell is a stem cell, optionally an induced pluripotent stem cell (iPSC).

8. The modified cell of any one of claims 1-6, wherein the modified cell is a limbal epithelial stem cell (LSC).

9. The modified cell of any one of claims 1-6, wherein the modified cell is a retinal pigment epithelium (RPE) cell.

10. The modified cell of any one of claims 1-6, wherein the modified cell is a comeal endothelial cell (CEnC).

11. The modified cell of any one of claims 1-6, wherein the modified cell is a fibroblast.

12. The modified cell of any one of claims 1-6, wherein the modified cell is a cardiomyocyte.

13. The modified cell of any one of claims 1-6, wherein the modified cell is a pancreatic P cell.

14. The modified cell of any one of claims 1-6, wherein the modified cell is a hepatocyte.

15. The modified cell of any one of claims 1-14, wherein the modified cell is mammalian.

16. The modified cell of any one of claims 1-15, wherein the modified cell is human.

17. The modified cell of any one of claims 1-16, wherein the increased HLA-I immunocompatibility comprises reduced CD8+ T cell-mediated cytotoxicity and / or nonincreased or reduced natural killer (NK) cell-mediated cytotoxicity.

18. A composition comprising the modified cell of any one of claims 1-17, optionally further comprising a pharmaceutically acceptable carrier or diluent.

19. A method of producing modified cells for allogeneic cell-based therapies, the method comprising:i) obtaining unmodified cells, optionally wherein the unmodified cells are stem cells, optionally induced pluripotent stem cells (iPSCs),ii) introducing an inactivating mutation in an endogenous ERAP1 gene to the unmodified cells, or introducing an RNAi or ASO molecule targeting ERAP1 to the unmodified cells to generate modified cells, optionally wherein the inactivating mutation is introduced by a Cas protein and a gRNA targeting the endogenous ERAP1 gene, andiii) optionally, if the modified cells are modified stem cells, differentiating the modified stem cells into ectodermal, mesodermal, endodermal, and / or neural crest lineage cells.

20. The method of claim 19, wherein the modified stem cells are differentiated into ectodermal lineage cells, optionally limbal stem cells (LSCs), neuronal cells, or skin epithelial cells.

21. The method of claim 19, wherein the modified stem cells are differentiated into mesodermal lineage cells, optionally fibroblasts, cardiomyocytes, myocytes, osteocytes, or nephron cells.

22. The method of claim 19, wherein the modified stem cells are differentiated into endodermal lineage cells, optionally pancreatic p cells or hepatocytes.

23. The method of claim 19, wherein the modified stem cells are differentiated into neural crest lineage cells, optionally CEnC or RPE cells.

24. A method of treating a condition in a subject in need of cell transplantation, the method comprising administering to the subject an effective amount of the modified cell of any one of claims 1-17 or the composition of claim 18.

25. A method of treating an ocular condition in a subject in need thereof, the method comprising administering to the subject an effective amount of a population of LSCs, RPE cells, and / or CEnC, wherein the LSCs, RPE cells, and / or CEnC lack ERAP1 protein or comprise an inactive ERAP1 protein, optionally wherein the LSCs are the LSCs of claim 8, the RPE cells are the RPE cells of claim 9, and / or the CEnC are the CEnC of claim 10.

26. The method of claim 25, wherein the ocular condition is selected from age-related macular degeneration (AMD), retinitis pigmentosa (RP), Stargardt disease, glaucoma, comeal disorders like limbal stem cell deficiency, diabetic retinopathy, inherited retinal degeneration, comeal dystrophies, post-infection ocular scarring, ocular surface failure after trauma and / or chemical injury.

27. A method of treating diabetes in a subject in need thereof, the method comprising administering to the subject an effective amount of a population of pancreatic P cells that lack ERAP1 protein or comprise an inactive ERAP1 protein, optionally wherein the pancreatic P cells are the pancreatic p cells of claim 13.