Novel RNA interference agents targeting raptor expression and uses thereof

WO2026165665A1PCT designated stage Publication Date: 2026-08-13UNIVERSITE LAVAL
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-02-09
Publication Date
2026-08-13

Smart Images

  • Figure CA2026050194_13082026_PF_FP_ABST
    Figure CA2026050194_13082026_PF_FP_ABST
Patent Text Reader

Abstract

The mTOR signaling pathway is crucial for regulating cellular growth, proliferation, and metabolism, integrating signals from various sources to manage anabolic and catabolic processes. Central to this pathway is mTORC1, whose dysregulation, especially through hyperactivation, is linked to diseases like cancer, neurological and metabolic disorders. Inhibiting mTORC1 is a potential strategy for treating these conditions. However, existing treatments like rapamycin can also affect mTORC2, leading to side effects like insulin resistance. Thus, more targeted approaches are needed. The present application discloses novel RNAi agents that inhibit the expression of RAPTOR, a constitutive protein of mTORC1 that is involved in mTORC1 activity. These RNAi agents may be useful for the treatment of diseases and disorders associated with mTORC1 hyperactivation such as cancers, metabolic diseases, neurological disorders, cystic diseases, multisystem disorders and cardiovascular diseases.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] NOVEL RNA INTERFERENCE AGENTS TARGETING RAPTOR EXPRESSION AND USES THEREOF

[0002] CROSS REFERENCE TO RELATED APPLICATIONS

[0003] This application claims the priority benefit of U.S. Provisional Application 63 / 756,451, filed February 10, 2025. The contents of the referenced application are incorporated into the present application by reference.

[0004] SEQUENCE LISTING

[0005] A sequence listing is submitted herewith as an XML file named G11229-00488_Seq Listing.xml, created on February 4, 2026, and having a size of ~ 58,186 bytes. The content of the aforementioned file is hereby incorporated by reference in its entirety.

[0006] TECHNICAL FIELD

[0007] The present invention generally relates to the treatment of diseases and conditions associated with mTOR complex 1 (mTORCI) hyperactivation or defective regulation, such as cancer, metabolic disorders and neurodevelopmental disorders.

[0008] BACKGROUND ART

[0009] The mammalian target of rapamycin (mTOR) signaling pathway is an important regulator of cellular growth, proliferation, and metabolism. It acts as a central hub, integrating signals downstream of growth factors receptor activation, intracellular nutrient-regulated signaling pathways, and intracellular energy status to orchestrate anabolic and catabolic processes!1] PL p] At the heart of this pathway lies the mTOR complex 1 (mTORCI), a protein complex comprising mTOR, Raptor, mLST8, PRAS40 and DEPTOR, whose activity is tightly regulated to maintain cellular homeostasis. Dysregulation of the mTOR pathway, particularly mTORCI hyperactivation, is implicated in a wide range of diseases, including cancer, epilepsy, and metabolic disorders!1] [4], [5]_

[0010] mTORCI hyperactivation can arise from various genetic mutations affecting its upstream regulators. For instance, mutations in the GATOR1 complex, a negative regulator of mTORCI, can lead to constitutive activation of the pathway. Similarly, mutations in the Tuberous Sclerosis Complex (TSC), another negative regulator, can result in uncontrolled mTORCI signaling and the disease named after the genetic defects causing it, Tuberous Sclerosis Complex. Ultimately, the aberrant activation of mTORCI drives uncontrolled cellular growth and metabolic reprogramming, a hallmark of many cancers!1]- PL M

[0011] Given its role in disease, restricting mTORCI activity has emerged as a promising therapeutic strategy for several diseases and disorders including!4):• Cancer: Inhibiting RAPTOR-mediated mTORCI signaling could help suppress the uncontrolled growth and proliferation of cancer cells, particularly in cancers driven by mutations in upstream regulators like GATOR1 orTSC, or loss of function mutations in PTEN.

[0012] • Metabolic disorders: Modulating mTORCI activity through restricting RAPTOR expression could help restore metabolic balance in disorders characterized by changes in glucose and lipid utilization, such as type 2 diabetes.

[0013] • Neurodevelopmental disorders: Emerging evidence suggests a role for mTORCI hyperactivity in certain neurodevelopmental disorders such as epilepsy and autism spectrum disorders (ASD), and targeting RAPTOR could offer therapeutic benefits in these conditions.

[0014] • Neurodegenerative disorders: Impaired autophagic processes, which reduce defective or toxic protein and organelle accumulation are associated with neurodegeneration, could be therapeutically enhanced by restricting RAPTOR expression and decreasing mTORCI function in conditions including: Amyotrophic Lateral Sclerosis, Alzheimer’s disease and Parkinson’s disease.

[0015] Rapamycin and its analogs (rapalogs), which directly bind and allosterically inhibit mTORCI, have shown efficacy in treating certain cancers. However, directly targeting mTORCI with small molecule inhibitors can have unintended consequences due to its central role in numerous cellular processes. While rapamycin primarily inhibits mTORCI, chronic or prolonged exposure to rapamycin can also impact mTOR complex 2 (mTORC2), albeit indirectly. Unlike mTORCI, mTORC2 is not directly inhibited by the rapamycin-FKBP12 complex in most cells; however, prolonged rapamycin treatment has been shown to gradually disrupt mTORC2 assembly and function in certain cell types. One of the primary side effects linked to mTORC2 inhibition is insulin resistance, as mTORC2 is involved in the phosphorylation and activation of Akt (also termed protein kinase B) in insulin-sensitive tissues. Chronic rapamycin treatment has been associated with impaired glucose tolerance and hyperglycemia, leading to increased risk of type 2 diabetes. Additionally, mTORC2 inhibition can disrupt lipid metabolism, contributing to dyslipidemia, where abnormal lipid levels elevate the risk of cardiovascular diseases and other pathologies.

[0016] There is thus a need for alternative and more specific approaches for the inhibition of mTORCI, which may be useful for the treatment of diseases associated with mTORCI hyperactivation.

[0017] The present description refers to a number of documents, the content of which is herein incorporated by reference in their entirety.

[0018] SUMMARY OF THE INVENTION

[0019] In various aspects and embodiments, the present disclosure provides the following items 1 to 48:1. An RNA interfering agent specific for a transcript encoding Regulatory-associated protein of mTOR (Raptor), the RNAi agent binding within a domain defined by the sequence ttaaggctggaggttctcgag (SEQ ID NO:1) or gctctggaaaccatcggtgc (SEQ ID NO:2) of said transcript.

[0020] 2. The RNA interfering agent according to item 1, wherein the agent binds to a domain defined by the sequence gctctggaaaccatcggtgc (SEQ ID NO:2) of said transcript.

[0021] 3. The RNA interfering agent according to item 2, wherein the agent binds within a domain defined by the sequence aaggctggaggttctcg (SEQ ID NO:3), ttaaggctggaggttct (SEQ ID NO:4), or ggctggaggttctcgag (SEQ ID NO:5), preferably aaggctggaggttctcg (SEQ ID NO:3), of said transcript.

[0022] 4. The RNA interfering agent according to any one of items 1 to 3, wherein the agent is a microRNA (miRNA), a short hairpin RNA (shRNA), a small interfering RNA (siRNA) or an antisense oligonucleotide (ASO).

[0023] 5. The RNA interfering agent according to item 4, wherein the agent is an ASO.

[0024] 6. The RNA interfering agent according to item 5, wherein the ASO comprises the sequence CGAGAACCTCCAGCCTT (SEQ ID NO:6), AGAACCTCCAGCCTTAA (SEQ ID NO:7), CTCGAGAACCTCCAGCC (SEQ ID NO:8), or GCACCGATGGTTTCCAGAGC (SEQ ID NO:9).

[0025] 7. The RNA interfering agent according to item 6, wherein the ASO comprises the sequence CGAGAACCTCCAGCCTT (SEQ ID NO:6).

[0026] 8. The RNA interfering agent according to item 6 or 7, wherein the ASO comprises one or more modifications that increases its stability and / or reduce its immunogenicity.

[0027] 9. The RNA interfering agent according to item 8, wherein said one or more modifications comprises one or more backbone (inter-nucleotide linkage) modifications.

[0028] 10. The RNA interfering agent according to item 10, wherein said one or more backbone modifications are phosphorothioate (PS) modifications, phosphodiester modifications, and / or methoxypropylphosphonate (MOP) modifications.

[0029] 11. The RNA interfering agent according to item 10, wherein said one or more backbone modifications are phosphorothioate (PS) modifications.

[0030] 12. The RNA interfering agent according to any one of items 8 to 11 , wherein said one or more modifications comprises one or more 2' ribose modifications.

[0031] 13. The RNA interfering agent according to item 12, wherein one or more 2' ribose modifications are methyl (Me), methoxyethyl (MOE), constrained ethyl (cEt), locked nucleic acid (LNA) and / or fluoro modifications.

[0032] 14. The RNA interfering agent according to item 13, wherein one or more 2' ribose modifications are MOE modifications.

[0033] 15. The RNA interfering agent according to any one of items 5 to 14, wherein the ASO comprises an all-phosphothionate (PS) backbone.16. The RNA interfering agent according to any one of items 5 to 15, wherein the ASO comprises the sequence C*G*A*G*A*ACCTCCAG*C*C*T*T* (SEQ ID NO: 10) or G*C*A*C*C*GATGGTTTCCA*G*A*G*C* (SEQ ID NO:11), wherein * is a methoxyethyl (MOE) 2' ribose modification.

[0034] 17. The RNA interfering agent according to item 16, wherein the ASO comprises the sequence C*G*A*G*A*ACCTCCAG*C*C*T*T* (SEQ ID NO:10).

[0035] 18. A composition (e.g., a pharmaceutical composition) comprising the RNA interfering agent of any one of items 1 to 17.

[0036] 19. A method of treating a disease or disorder associated with mTORCI hyperactivation in a subject in need thereof comprising administering to the subject the RNA interfering agent of any one of items 1 to 17 or the pharmaceutical composition of item 18.

[0037] 20. The method of item 19, wherein the disease or disorder associated with mTORCI hyperactivation is caused by a defect in GAP activity toward Rags 1 (GATOR1) and / or Tuberous Sclerosis Complex (TSC).

[0038] 21. The method of item 19 or 20, wherein the disease associated with mTORCI hyperactivation is cancer, a metabolic disease, a neurological disorder, a cystic disease, an inflammatory / autoimmune disease, or a multisystem disorder.

[0039] 22. The method of item 21, wherein the cancer is brain cancer (e.g., glioblastoma, medulloblastoma), lung cancer (e.g., non-small cell lung cancer, squamous cell lung carcinoma), head and neck cancer (e.g., head and neck squamous cell carcinoma), breast cancer, renal cancer (e.g., renal cell carcinoma), liver cancer (e.g., hepatic cell carcinoma), gastric cancer, colorectal cancer, neuroendocrine cancer (e.g., large-cell neuroendocrine carcinoma), prostate cancer, lymphoma, urinary bladder cancer, or gynecologic cancer (e.g., ovarian cancer).

[0040] 23. The method of item 21 , wherein the neurological disorder is a neurodegenerative disorder, a neurocutaneous disease, or a neurodevelopmental disorder.

[0041] 24. The method of item 21 or 23, wherein the neurodegenerative is Alzheimer’s disease or Parkinson’s disease.

[0042] 25. The method of item 21 or 23, wherein the neurological disorder is epilepsy, focal cortical dysplasia, or an autism spectrum disorder.

[0043] 26. The method of item 21 , wherein the cystic disease is polycystic kidney disease (PKD) or lymphangioleiomyomatosis (LAM).

[0044] 27. The method of item 21 , wherein the multisystem disorder is tuberous sclerosis.

[0045] 28. The method of item 21 , wherein the metabolic disease is diabetes.

[0046] 29. The RNA interfering agent of any one of items 1 to 17 or the pharmaceutical composition of item 18 for use in treating a disease or disorder associated with mTORCI hyperactivation in a subject.30. The RNA interfering agent or composition for use according to item 29, wherein the disease or disorder associated with mTORCI hyperactivation is caused by a defect in GAP activity toward Rags 1 (GATOR1) and / or Tuberous Sclerosis Complex (TSC).

[0047] 31. The RNA interfering agent or composition for use according to item 29 or 30, wherein the disease associated with mTORCI hyperactivation is cancer, a metabolic disease, a neurological disorder, a cystic disease, an inflammatory / autoimmune disease, or a multisystem disorder. 32. The RNA interfering agent or composition for use according to item 31 , wherein the cancer is brain cancer (e.g., glioblastoma, medulloblastoma), lung cancer (e.g., non-small cell lung cancer, squamous cell lung carcinoma), head and neck cancer (e.g., head and neck squamous cell carcinoma), breast cancer, renal cancer (e.g., renal cell carcinoma), liver cancer (e.g., hepatic cell carcinoma), gastric cancer, colorectal cancer, neuroendocrine cancer (e.g., large-cell neuroendocrine carcinoma), prostate cancer, lymphoma, urinary bladder cancer, or gynecologic cancer (e.g., ovarian cancer).

[0048] 33. The RNA interfering agent or composition for use according to item 31, wherein the neurological disorder is a neurodegenerative disorder, a neurocutaneous disease, or a neurodevelopmental disorder.

[0049] 34. The RNA interfering agent or composition for use according to item 31 or 33, wherein the neurodegenerative is Alzheimer’s disease or Parkinson’s disease.

[0050] 35. The RNA interfering agent or composition for use according to item 31 or 33, wherein the neurological disorder is epilepsy, focal cortical dysplasia, or an autism spectrum disorder.

[0051] 36. The RNA interfering agent or composition for use according to item 31 , wherein the cystic disease is polycystic kidney disease (PKD) or lymphangioleiomyomatosis (LAM).

[0052] 37. The RNA interfering agent or composition for use according to item 31, wherein the multisystem disorder is tuberous sclerosis.

[0053] 38. The RNA interfering agent or composition for use according to item 31, wherein the metabolic disease is diabetes.

[0054] 39. Use of the RNA interfering agent of any one of items 1 to 17 or the pharmaceutical composition of item 18 for the manufacture of a medicament for treating a disease or disorder associated with mTORCI hyperactivation in a subject.

[0055] 40. The use according to item 39, wherein the disease or disorder associated with mTORCI hyperactivation is caused by a defect in GAP activity toward Rags 1 (GATOR1) and / or Tuberous Sclerosis Complex (TSC).

[0056] 41. The use according to item 39 or 40, wherein the disease associated with mTORCI hyperactivation is cancer, a metabolic disease, a neurological disorder, a cystic disease, an inflammatory / autoimmune disease, or a multisystem disorder.

[0057] 42. The use according to item 41, wherein the cancer is brain cancer (e.g., glioblastoma, medulloblastoma), lung cancer (e.g., non-small cell lung cancer, squamous cell lung carcinoma),head and neck cancer (e.g., head and neck squamous cell carcinoma), breast cancer, renal cancer (e.g., renal cell carcinoma), liver cancer (e.g., hepatic cell carcinoma), gastric cancer, colorectal cancer, neuroendocrine cancer (e.g., large-cell neuroendocrine carcinoma), prostate cancer, lymphoma, urinary bladder cancer, or gynecologic cancer (e.g., ovarian cancer).

[0058] 43. The use according to item 41, wherein the neurological disorder is a neurodegenerative disorder, a neurocutaneous disease, or a neurodevelopmental disorder.

[0059] 44. The use according to item 41 or 43, wherein the neurodegenerative is Alzheimer’s disease or Parkinson’s disease.

[0060] 45. The use according to item 41 or 43, wherein the neurological disorder is epilepsy, focal cortical dysplasia, or an autism spectrum disorder.

[0061] 46. The use according to item 41, wherein the cystic disease is polycystic kidney disease (PKD) or lymphangioleiomyomatosis (LAM).

[0062] 47. The use according to item 41 , wherein the multisystem disorder is tuberous sclerosis. 48. The use according to item 41 , wherein the metabolic disease is diabetes.

[0063] Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.

[0064] BRIEF DESCRIPTION OF DRAWINGS

[0065] In the appended drawings:

[0066] FIGs. 1A-D show the results of a Raptor-targeted ASO screen and functional studies in various cell-lines. FIG. 1A: Mouse embryonic fibroblasts (MEF cells) that do not express the requisite subunit of GATOR1 called NPRL2 (NPRL2 KO cells) were treated with 5 pM of each ASO (resuspended in water) or a positive control lentivirus that expresses shRNA to knockdown Raptor expression (Addgene plasmid # 21339). Western blotting was used to determine the change in Raptor (mTORCI specific subunit), Rictor (mTORC2 specific subunit), and p-actin (internal loading control) protein levels after 48 hours of treatment. ASO#2 and ASO#3 both show strong repression of Raptor expression. FIG. 1B: Wild-type (WT) and TSC2 KO HEK293 cells (human) were treated with ASO#2 for 48 hours and western blots were performed. FIG. 1C:

[0067] Various genetic models of MEF cells expressing disease-linked GATOR1 mutations (previously described in Muller, M., et al., International Journal of Molecular Sciences 25, 2068) were treated with ASO#2, as above. FIG. 1D: results of a Raptor-targeted ASO screen and functional study in C8-D1A (astrocyte type I clone) cells. Cells were treated with 5pM of either ASO1-10 for 72 hours. Western blotting was used to determine changes in Raptor (mTORCI specific subunit) and |3-actin (internal loading control).

[0068] FIG. 2 shows the testing of RAPTOR targeted ASO variants. ASO#2 variants were designed by shifting the targeting sequence +2 or -2 nucleotides on the Raptor mRNA (seeTables 1A-1B), which covers a conserved nucleotide sequence in both mouse and human genes, and the effects of these variants on RAPTOR expression was tested MEF or HEK293 cells. A mutated version of ASO#2, called mutantASO#2, which has the same nucleotide composition as ASO#2 except 2-nucleotides are switched that result in a change at four nucleotide positions (see Tables 1A-1B), was also tested. An NCBI blast search was made for this control ASO and its closest target is 88% homology to anything in the transcriptome. Cells were treated for 48 hrs with 5pM of each ASO.

[0069] FIG. 3 shows a dose-response of RAPTOR expression following ASO treatment in MEF cells. MEF cells were treated with the indicated concentrations of either mutantASO#2 or ASO#2 for 48 hours. ASO#2, but not mutantASO#2, showed a dose-dependent ability to repress RAPTOR within the tested range. This graphed data represents 3-independent experiments, a. p<0.05;

[0070] FIG.4 shows the effects of ASO treatments on RAPTOR mRNA expression in MEF cells. MEF and HEK293 cells were treated with either mutantASO#2 or ASO#2 (5pM) for 72 hours. Quantitative reverse transcription-PCR was used to measure the expression of Raptor mRNA using primers toward Raptor and U36B4 internal control (see Table 2). Data represents the result of an experiment performed in triplicate.

[0071] FIG. 5 shows the effect of ASO#2 on GATOR1 -defective Primary Neuron Cultures. Primary cortical neuron cultures from NPRL2™ animals were generated (following the protocol described in Hui, J. B et al. eNeuro 9, 10.1523 / ENEURO.0317-21.2022) and transduced with control or Cre-recombinase expressing lentivirus (right= control virus; left=Cre virus) at day-in-vitro (DIV) 2 on 24-well multi-well electrode array plates from Axion Biosystems (16-electrodes per well). Neuronal activity, or spike events, from 3-independent wells per condition were measured at DIV 7 to DIV 22 (5 minutes per recording). Cells were treated with either shRaptor expressing virus or 0.5 pM ASO#2 at DIV3, which normalizes spike events in cultures expressing Cre (i.e., NPRL2 knock-out cells). Data is representative of one experiment that was replicated at least 3-times.

[0072] FIG. 6 shows the effect of ASO#2 treatment of control or Nprl2i,xpVgluT2-ires-Cre mice (=NPRL2 nKO). Control and NPRL2 nKO littermates were treated using free-hand intracerebroventricular (ICV) injection of 50 pg ASO#2 / side (PBS vehicle). Mice were monitored 24-hours / day using video recordings. ‘Untreated NPRL2 nKO death curve is taken from a published report (Hui, J. B et al. eNeuro 9, 10.1523 / ENEURO.0317-21.2022), and used to show the life extending (longevity) effect of ASO#2 treatment.

[0073] FIG. 7 shows that ASO#2 reduces cellular reactive oxygen species (ROS) in GATOR1-defective cells. NPRL3 knockout C8-D1A cell lines were created using a Crispr-mediated knockout strategy as described previously (Muller et al., Int. J. Mol. Sci. 2024, 25(4), 2068). Loss of NPRL3 significantly increases Mitosox staining of reactive oxygen species in astrocytes,relative to control. Cells were treated for 72 hours with either 1 pM mutantASO#2 or ASO#2 before Mitosox staining and analysis.

[0074] FIG. 8 shows that the loss of GATOR1 function in astrocytes show defective electron transport chain activity that is ameliorated by ASO#2 treatment. NPRL3 KO astrocytes show reduced mitochondrial electron transport activity relative to control cells, using high-resolution respirometry (Oroboros Instruments). T reatment of NPRL3 KO cells with 1 pM ASO#2 for 72 hours rescues mitochondrial function, similar to control levels. N=4 per condition.

[0075] FIG. 9 shows that deletion of NPRL2 in astrocytes in vivo causes reactive astrocytosis that can be ameliorated by ASO#2 treatment. Nprl2loxP / loxP' GFAP-ires-Cre (NPRL2 astroKO) (Jackson Laboratory, catalog #02498) and littermate controls were harvested at 5-months. Immunohistochemistry was performed toward GFAP (astrocyte marker) and P-S6 (downstream marker of mTORCI activity) in the hippocampus. Loss of NPRL2 in astrocytes causes reactive astrocytosis. Adult mice were treated by stereotactic hippocampal injection with 100 pg ASO2 / hemisphere (PBS vehicle) 30 days prior to harvest. Scale bar = 40 pm.

[0076] FIGs. 10A-C depict the nucleotide sequence of the mRNA encoding human RAPTOR (NCBI Reference Sequence: NM_020761.3, SEQ ID NO:12). The regions targeted by ASO#2 and ASO#3 described herein are underlined.

[0077] FIGs. 10D-F depict the nucleotide sequence of the mRNA encoding mouse RAPTOR (NCBI Reference Sequence: NM_028898.3, SEQ ID NO: 13). The regions targeted by ASO#2 and ASO#3 described herein are underlined.

[0078] FIG. 11A depicts representative GATOR 1 -related pathologies (from Loissell-Baltazar, Y.A.; Dokudovskaya, SEA and GATOR 10 Years Later. Cells 2021, 10, 2689).

[0079] FIG. 11B depicts representative tuberous sclerosis complex (TSC)-related pathologies (from Henske, E., Jozwiak, S., Kingswood, J. et al. Tuberous sclerosis complex. Nat Rev Dis Primers 2, 16035 (2016).

[0080] FIG. 12 shows the results of a Raptor-targeted ASO screen in various cell-lines. Wildtype (WT) and NPRL2 KO MEF cells were treated with 5 pM of either mutantASO#2 (scrASO2) or ASO#2 for 72 hours. Cells were maintained in either regular cell growth media or switched to starvation media (Earle’s Buffered Saline Solution; EBSS) for 1 hour prior to harvest. Protein extracts were collected and western blot analysis was performed against RAPTOR, P-S6K (T389), total S6K, P-AKT (S473), total AKT, P-S6(S240 / 244), total S6 and -actin. Band intensities were quantified by densitometry using identical regions of interest across lanes. Protein expression levels were calculated as the ratio of phospho-protein to total protein and normalized to p-actin within the same lane, and expressed as relative density. Average RD-values represent the average of two-independent replicate experiments.

[0081] FIGs. 13A-B show the effects of intracerebral administration of RAPTOR-targeted ASO#2 on blood glucose levels and Pepck expression. FIG. 13A: 4 month-old control and NPRL2astrocyte KO mice (NPRL2fl / fl; GFAP-Cre) were treated with a sham injection, or 100 pg / side of either mutantASO#2 (scrASO2) or ASO#2. 6-hour fasted blood glucose was assessed, 1-week after treatment via tail vein sampling using an automated glucometer. FIG. 13B: Wild-type or NPRL2 astrocyte KO mice (NPRL2fl / fl; GFAP-Cre) mice (n=3 individual mice per genotype) were injected by ICV with either 100 pg of ASO#2 (PBS vehicle) per side, or sham injection control. After 1 month, liver was collected, snap frozen in liquid nitrogen, and stored at -80 °C until RNA extraction and processing. Quantitative reverse transcription-PCR analysis was used to measure the gene expression of Pepck (rate limiting enzyme of gluconeogenesis), Rptor, and U36b4 (internal control gene).

[0082] FIG. 14 shows the effect of ASO#2 treatment on the expression of RAPTOR in vivo across examined brain tissues. Wild-type mice were injected by stereotactic ICV with 100 pg of ASO#2 (PBS vehicle) per side or sham control. After 2-weeks, tissues were collected for immunohistochemistry and confocal microscopy to determine RAPTOR expression in the tissue. Top slides: Sham treatment (n=3 individual mice). Bottom slides: ASO#2 treatment (n=3 individual mice).

[0083] FIG. 15 shows the effect of ASO#2 treatment on the longevity of NPRL2fl / fl; GFAP-Cre (=NPRL2 astroKO; Jackson Labs, #02498) mice. Mice were either untreated or treated with 100pg ASO#2 in 4pL bilaterally into the hippocampus (one injection per side) with ASO#2 in PBS at 4-months of age.

[0084] FIG. 16 shows that ASO#2 treatment reduces human astrocyte invasion using Boyden chambers. NHA human astrocytes were treated with 0.5 pM RAPTOR-targeting ASO#2 or mutantASO#2 (scrASO2) for 48 h or 72 h, then transferred to collagen-coated Boyden chambers for 6 h. Cells on the lower membrane surface were fixed in paraformaldehyde and imaged at 20x; invading cells were quantified from stitched 8x8 field composites per insert. For each experiment, invasion was normalized to the matched scrambled control ASO to yield a relative invasion ratio (n=3 per condition). Data shown as mean ± SD.

[0085] DISCLOSURE OF INVENTION

[0086] The use of the terms "a" and "an" and "the" and similar referents in the context of describing the technology (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0087] The terms "comprising", "having", "including", and "containing" are to be construed as open-ended terms (i.e., meaning "including, but not limited to") unless otherwise noted.

[0088] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context.The use of any and all examples, or exemplary language (“e.g.”, "such as") provided herein, is intended merely to better illustrate embodiments of the claimed technology and does not pose a limitation on the scope unless otherwise claimed.

[0089] No language in the specification should be construed as indicating any non-claimed element as essential to the practice of embodiments of the claimed technology.

[0090] Herein, the term "about" has its ordinary meaning. The term “about” is used to indicate that a value includes an inherent variation of error for the device or the method being employed to determine the value, or encompass values close to the recited values, for example within 10% of the recited values (or range of values).

[0091] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, and each separate value is incorporated into the specification as if it were individually recited herein. All subsets of values within the ranges are also incorporated into the specification as if they were individually recited herein.

[0092] Where features or aspects of the disclosure are described in terms of Markush groups or list of alternatives, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member, or subgroup of members, of the Markush group or list of alternatives.

[0093] Unless specifically defined otherwise, all technical and scientific terms used herein shall be taken to have the same meaning as commonly understood by one of ordinary skill in the art (e.g., in stem cell biology, cell culture, molecular genetics, immunology, immunohistochemistry, protein chemistry, and biochemistry).

[0094] Unless otherwise indicated, the molecular biology, cell culture, and immunological techniques utilized in the present disclosure are standard procedures, well known to those skilled in the art. Such techniques are described and explained throughout the literature in sources such as, J. Perbal, A Practical Guide to Molecular Cloning, John Wiley and Sons (1984), J. Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbour Laboratory Press (1989), T. A. Brown (editor), Essential Molecular Biology: A Practical Approach, Volumes 1 and 2, IRL Press (1991), D. M. Glover and B. D. Hames (editors), DNA Cloning: A Practical Approach, Volumes 1-4, IRL Press (1995 and 1996), and F. M. Ausubel et al. (editors), Current Protocols in Molecular Biology, Greene Pub. Associates and Wiley-lnterscience (1988, including all updates until present), Ed Harlow and David Lane (editors) Antibodies: A Laboratory Manual, Cold Spring Harbour Laboratory, (1988), and J. E. Coligan et al. (editors) Current Protocols in Immunology, John Wiley & Sons (including all updates until present).

[0095] The term “RNA interfering agent” as used herein refers to a molecule that permits the enzyme-dependent degradation of targeted mRNA to regulate gene expression. RNA interference is a biological process in which nucleic acid (e.g., RNA, RNA-like, DNA) moleculesinhibit gene expression or translation by neutralizing targeted messenger RNA (mRNA) molecules. Examples of RNAi agent include single-stranded antisense oligonucleotides (ASOs), microRNAs (miRNAs) (non-coding RNA), siRNAs, and shRNAs. While the present disclosure is not limited by any particular mechanism of action, in some embodiments, the RNAi agent according to the present disclosure enters a cell and causes the degradation, blocks the translation, blocks the interaction with another factor or affects the splicing of a Raptor transcript.

[0096] In a first aspect, the present disclosure provides an RNA interfering agent specific for a transcript encoding Regulatory-associated protein of mTOR (RAPTOR), the RNA interfering agent binding within a domain defined by the sequence ttaaggctggaggttctcgag (SEQ ID NO:1) or gctctggaaaccatcggtgc (SEQ ID NO:2) of said transcript.

[0097] In an embodiment, the domain comprises at least 15 contiguous nucleotides. In another embodiment, the domain comprises at least 16 contiguous nucleotides. In another embodiment, the domain comprises at least 17 contiguous nucleotides.

[0098] The results presented below show that targeting the above-noted sequences of the Raptor mRNA impairs the expression / level of RAPTOR in cells.

[0099] The sequence ttaaggctggaggttctcgag (SEQ ID NO:1) corresponds to nucleotides 733-753 in the human Raptor mRNA (FIGs. 10A-C, SEQ ID NO: 12) and nucleotides 848-864 in the mouse Raptor mRNA (FIGs. 10D-F, SEQ ID NO:13), and the sequence gctctggaaaccatcggtga (SEQ ID NO:2) corresponds to nucleotides 1082-1105 in the human Raptor mRNA, and nucleotides 1197-1216 in the mouse Raptor mRNA.

[0100] In an embodiment, the RNA interfering agent binds within a domain defined by the sequence ttaaggctggaggttctcgag (SEQ ID NO:1). In a further embodiment, the RNA interfering agent binds within a domain defined by the sequence aaggctggaggttctcg (SEQ ID NO:3). In another embodiment, the RNA interfering agent binds within a domain defined by the sequence gctctggaaaccatcggtgc (SEQ ID NO:2).

[0101] In an embodiment, the RNA interfering agent is an antisense oligonucleotide (ASO) specific for Raptor mRNA (e.g., human and / or mouse). ASOs are synthetic single stranded strings of nucleic acids (natural or modified (e.g., Locked Nucleic Acid (LNA), phosphorothioate, 2’0-Methyl, 2’0-Methoxy, phosphoramidite, etc.)), between 8 and 50 nucleotides in length, preferably between 10 and 35, between 15 and 25, or 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 in length. In some embodiments, the ASO is about 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 single-stranded nucleotides in length. The present disclosure thus encompasses in addition to the specifically exemplified antisense oligonucleotide sequences described herein additional antisense oligonucleotides that hybridize to the RAPTOR mRNA within the same target regions as the validated sequences (as described above), or overlapping sub-regions thereof, through Watson-Crick base pairing under physiological conditions. Such antisense oligonucleotides may include mismatches, substitutions, or staggered alignments, provided they retain sufficient contiguouscomplementarity to form stable RNA-DNA (or RNA-RNA) hybrids and mediate a functional reduction of RAPTOR expression. The scope of the present disclosure encompasses antisense oligonucleotides targeting defined RAPTOR mRNA regions demonstrated herein to be susceptible to antisense-mediated knockdown, including sequence variants that would be considered by a person skilled in the art to be functionally equivalent.

[0102] In an embodiment, the ASO comprises or consists of the sequence CGAGAACCTCCAGCCTT (SEQ ID NO:6), AGAACCTCCAGCCTTAA (SEQ ID NO:7), or CTCGAGAACCTCCAGCC (SEQ ID NO:8). In another embodiment, the ASO comprises or consists of the sequence GCACCGATGGTTTCCAGAGC (SEQ ID NO:9).

[0103] In certain embodiments, the above-mentioned RNA interfering agents targeting Raptor (e.g., Raptor ASOs, siRNAs, or miRNA mimics) are chemically modified to improve at least one property such as solubility, permeability, loading capacity, stability, plasma half-life or for targeting the RNA interfering agent of a specific site. In embodiments, the RNA interfering agent is modified to increase their stability and / or help them evade immune response (i.e., reduce immunogenicity). Such modifications include backbone (inter-nucleotide linkage) modifications as well as 2' ribose modifications. Examples of 2' ribose modifications include 2’-fluoro, 2’-O-methyl (i.e., 2’-methoxy), 2'-O-alkyl, or 2’-0-methoxyethyl (2’-O-MOE).

[0104] The first nucleotide from the 5’ end of the RNA interfering agent may be a modified nucleotide that has a phosphate analog, i.e., a chemical moiety that mimics the electrostatic and / or steric properties of a phosphate group. A 5’ phosphate analog can include a phosphatase-resistant linkage. Examples of phosphate analogs include 5’ methylene phosphonate (5’-MP) and 5’-(E)-vinylphosphonate (5’-VP). In some embodiments, the phosphate analog is 5 ’-VP.

[0105] In an embodiment, the RNA interfering agent include one or more of the following modifications: phosphorothioate (PS) (e.g., increases stability), 2’0-Methyl (2’OMe) (e.g., increases stability and reduces immune response), 2’0-Methoxy (2’MOE) e.g., (increases stability and reduces immune response), phosphoramidite (NP) (e.g., increases stability), locked nucleic acid (LNA) or phosphoramidate morpholino (PMO), and / or peptide nucleic acid (PNA) groups. Such modifications may also assist in loading in the RISC complex and in excluding the passenger strand, and / or facilitate cleavage by RNase H. In an embodiment, the RNA interfering agent (e.g., ASO) comprises one or more phosphorothioate (PS) modifications, in a further embodiment all inter-nucleotide linkages of the RNAi agent (e.g., ASO) are PS linkages. In an embodiment, the RNA interfering agent (e.g., ASO) comprises one or more 2’MOE modifications.

[0106] In an embodiment, the first nucleotide from the 5’ end of the RNA interfering agent comprises a 2’MOE modification. In an embodiment, the first two nucleotides from the 5’ end of the RNA interfering agent comprises a 2’MOE modification. In an embodiment, the first three nucleotides from the 5’ end of the RNA interfering agent comprises a 2’MOE modification. In an embodiment, the first four nucleotides from the 5’ end of the RNA interfering agent comprises a2’MOE modification. In an embodiment, the first five nucleotides from the 5’ end of the RNA interfering agent comprises a 2’MOE modification.

[0107] In an embodiment, the first nucleotide from the 3’ end of the RNA interfering agent comprises a 2’MOE modification. In an embodiment, the first two nucleotides from the 3’ end of the RNA interfering agent comprises a 2’MOE modification. In an embodiment, the first three nucleotides from the 3’ end of the RNA interfering agent comprises a 2’MOE modification. In an embodiment, the first four nucleotides from the 3’ end of the RNA interfering agent comprises a 2’MOE modification. In an embodiment, the first five nucleotides from the 3’ end of the RNA interfering agent comprises a 2’MOE modification.

[0108] In an embodiment, the ASO comprises or consists of the sequence *C*G*A*G*AACCTCCAG*C*C*T*T* (SEQ ID NO: 10), *A*G*A*A*CCTCCAGCC*T*T*A*A* (SEQ ID NO:14), or *C*T*C*G*AGAACCTCC*A*G*C*C* (SEQ ID NO:15), wherein * is a methoxyethyl (MOE) 2' ribose modification and wherein all inter-nucleotide linkages are PS linkages. In another embodiment, the ASO comprises or consists of the sequence G*C*A*C*C*GATGGTTTCCA*G*A*G*C* (SEQ ID NO:11), wherein * is a methoxyethyl (MOE) 2' ribose modification and wherein all inter-nucleotide linkages are PS linkages.

[0109] In some embodiments, the RNA interfering agent comprises a delivery moiety conjugated thereto, e.g., at the 3’ end. The delivery moiety can facilitate the entry of RNA interfering agent into the cells. Examples of delivery moiety include lipids, cholesterol, vitamin E, carbohydrates, amino sugars, or polypeptides. In an embodiment, the delivery moiety is a hydrophobic moiety, for example a sterol, a ganglioside, a lipid, a vitamin, or a fatty acid, such as a-tocopherol, cholesterol or palmitic acid. The delivery moiety may be conjugated to a nucleotide of the RNA interfering agent. In that case, the delivery moiety is a modified nucleotide located in the RNA interfering agent. Examples of such modified nucleotides include 2’-O-hexadecyl uridine, 2’-O-hexadecyl cytidine, 2’-O-hexadecyl guanine, or 2’-O-hexadecyl adenosine. The delivery moiety may be conjugated to the RNA interfering agent through a linker, such as a tetraethylene glycol (Teg) linker or piperidinol-PEG linker. In some embodiments, the delivery moiety is a known delivery moiety for delivering RNA interfering agent into a cell. Placement of a delivery moiety on the RNA interfering agent needs to overcome potential inefficient loading of AG02 (Argonaute-2) or other hindrance of the RNA-induced silencing complex (RISC) complex activity, or interference with RNAse H activity. The delivery moiety may also allow or enhance the loading of the RNA interfering agent into a carrier entity such as extracellular vesicles (EVs), lipid nanoparticles, or liposomes.

[0110] In another aspect, the present disclosure provides a pharmaceutical composition comprising the RNA interfering agent described herein and a pharmaceutically acceptable excipient. As used herein, "pharmaceutically acceptable excipient" includes any and all solvents, diluents, dispersion media, coatings, thickeners, lubricants, antibacterial and antifungal agents,isotonic and absorption delaying agents, pH modifiers, surfactants, emulsifiers, adjuvants, surfactants, preservatives, chelating agents and the like that are physiologically compatible. The excipient should be suitable for the desired route of administration, e.g., intravenous, intramuscular, subcutaneous, intranasal, parenteral, intrathecal, spinal or epidermal administration (e.g., by injection or infusion).

[0111] Pharmaceutical compositions provided herein, in some embodiments, include a pharmaceutically acceptable antioxidant. Examples of pharmaceutically acceptable antioxidants include: water soluble antioxidants, such as ascorbic acid, cysteine hydrochloride, sodium bisulfate, sodium metabisulfite, sodium sulfite and the like; oil-soluble antioxidants, such as ascorbyl palmitate, butylated hydroxyanisole (BHA), butylated hydroxytoluene (BHT), lecithin, propyl gallate, alpha-tocopherol, and the like; and metal chelating agents, such as citric acid, ethylenediamine tetraacetic acid (EDTA), sorbitol, tartaric acid, phosphoric acid, and the like.

[0112] Examples of suitable aqueous and non-aqueous carriers that are employed in the pharmaceutical compositions of provided herein include, but are not limited to, water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), DMSO, and suitable mixtures thereof, vegetable oils, such as olive oil, and injectable organic esters, such as ethyl oleate. Proper fluidity is maintained, for example, by the use of coating materials, such as lecithin, by the maintenance of the required particle size in the case of dispersions, and by the use of surfactants.

[0113] In some embodiments, compositions herein contain adjuvants such as preservatives, wetting agents, emulsifying agents, and dispersing agents. Prevention of presence of microorganisms is ensured, in some embodiments, both by sterilization procedures, supra, and by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol sorbic acid, and the like. In some embodiments, it is desirable to include isotonic agents, such as sugars, sodium chloride, and the like into the compositions. In addition, prolonged absorption of the injectable pharmaceutical form, in some embodiments, is brought about by the inclusion of agents which delay absorption such as, aluminum monostearate and gelatin.

[0114] Pharmaceutically acceptable excipients include sterile aqueous solutions or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion. The use of such media and agents for pharmaceutically active substances is known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the pharmaceutical compositions provided herein is contemplated. In some embodiments, supplementary active compounds are incorporated into the compositions.

[0115] The RNA interfering agents described herein may also be formulated in polymer- or lipid-based nanoparticles or liposomes.In another aspect, the present disclosure provides a method of treating a disease or disorder associated with mTORCI hyperactivation in a subject in need thereof comprising administering to the subject an effective amount of the RNA interfering agent or pharmaceutical composition defined herein. The present disclosure also provides the use of the RNA interfering agent or pharmaceutical composition defined herein for treating a disease or disorder associated with mTORCI hyperactivation in a subject. The present disclosure also provides the use of the RNA interfering agent or pharmaceutical composition defined herein for the manufacture of a medicament for treating a disease or disorder associated with mTORCI hyperactivation in a subject. The present disclosure also provides the RNA interfering agent or pharmaceutical composition defined herein for use in treating a disease or disorder associated with mTORCI hyperactivation in a subject.

[0116] mTORCI hyperactivation has been shown to be associated or involved in several diseases and disorders, including:

[0117] • Cancer: mTORCI hyperactivation is frequently observed in various cancers, as it promotes cell growth and metabolic alterations that permit it. Aberrant mTORCI signaling can result from mutations in upstream regulators, such as PTEN, GATOR1 (a complex of three subunits comprising NPRL2 (TUSC4), NPRL3 and DEPDC5 proteins), or TSC1 / TSC2, which normally act to inhibit mTORCI activity. Thus, in an embodiment, the disease or disorder associated with mTORCI hyperactivation is cancer, for example a cancerwith a mutation in one or more upstream regulators of mTORCI , such as PTEN, GATOR1, and / or TSC1 / TSC2. In some embodiments, the cancer is brain cancer (e.g., glioblastoma, medulloblastoma), lung cancer (e.g., non-small cell lung cancer, squamous cell lung carcinoma), head and neck cancer (e.g., head and neck squamous cell carcinoma), breast cancer, renal cancer (e.g., renal cell carcinoma), liver cancer (e.g., hepatic cell carcinoma), gastric cancer, colorectal cancer, neuroendocrine cancer (e.g., large-cell neuroendocrine carcinoma), prostate cancer, lymphoma, urinary bladder cancer, or gynecologic cancer (e.g., ovarian cancer). In an embodiment, the RNA interfering agent or pharmaceutical composition defined herein is used in combination with another anticancer therapy (e.g., surgery, radiotherapy, chemotherapy, immunotherapy, cell therapy (e.g., CAR T / NK), checkpoint inhibitor therapy), i.e. as an adjuvant therapy.

[0118] • Tuberous Sclerosis: This is a genetic disorder caused by mutations in the TSC1 or TSC2 genes, which lead to uncontrolled mTORCI activity. It is characterized by the development of benign tumors in multiple organs, including the brain, skin, kidneys, and heart. TSC1 and TSC2 mutations are also associated with neurodevelopmental defects and seizures. Thus, in an embodiment, the disease or disorder associated with mTORCI hyperactivation is TSC.• Cystic diseases: mTORCI hyperactivation has been shown to be associated with the formation of cysts in various organs or tissues. For example, lymphangioleiomyomatosis (LAM), which is often associated with TSC, is a rare lung disease affecting mostly women, characterized by the proliferation of abnormal smooth muscle-like cells in the lungs, leading to cyst formation and respiratory issues. Also, mTORCI hyperactivation is observed in cystic kidney diseases such as autosomal dominant polycystic kidney disease (ADPKD). Thus, in an embodiment, the disease or disorder associated with mTORCI hyperactivation is a cystic disease.

[0119] • Neurodegenerative Diseases: Abnormal mTORCI signaling has been implicated in neurodegenerative disorders such as cognitive impairment, Alzheimer's disease and Parkinson's disease. mTORCI hyperactivation restricts autophagy and alters protein homeostasis, contributing to the pathogenesis of these conditions. Thus, in an embodiment, the disease or disorder associated with mTORCI hyperactivation is a neurodegenerative disorder.

[0120] • Neurodevelopmental disorders: Emerging evidence suggests a role for mTORCI hyperactivity in certain neurodevelopmental disorders such as epilepsy and autism spectrum disorders (ASD). Thus, in an embodiment, the disease or disorder associated with mTORCI hyperactivation is a neurodevelopmental disorder.

[0121] • Neurodegenerative disorders: Impaired autophagic processes, which reduce defective or toxic protein and organelle accumulation are associated with neurodegeneration, could be therapeutically enhanced by restricting RAPTOR expression and decreasing mTORCI function in conditions including: Amyotrophic Lateral Sclerosis, Alzheimer’s disease and Parkinson’s disease. Thus, in an embodiment, the disease or disorder associated with mTORCI hyperactivation is a neurodegenerative disorder.

[0122] • Metabolic conditions: mTORCI plays a homeostatic role in metabolic regulation, and its dysregulation has been linked to insulin resistance, a hallmark of type 2 diabetes. Additionally, mTORCI hyperactivation may contribute to obesity by affecting appetite and energy balance. Thus, in an embodiment, the disease or disorder associated with mTORCI hyperactivation is a metabolic disorder.

[0123] • Inflammatory and autoimmune diseases: Activation of mTOR has been implicated in a number of chronic inflammatory diseases, especially rheumatic diseases, such as systemic lupus erythematosus (SLE), rheumatoid arthritis (RA), systemic sclerosis (SSc), Sjogren syndrome (SS) and seronegative spondyloarthropathy (SpA). Thus, in an embodiment, the disease or disorder associated with mTORCI hyperactivation is an inflammatory or autoimmune disease.The RNA interfering agent or composition described herein may be used for the management or treatment of any disease or condition treatable by mTOR inhibitors such as rapamycin and rapamycin analogs (e.g., Everolimus), for example sarcopenia; skin atrophy; cherry angiomas; seborrheic keratoses; brain atrophy; atherosclerosis; arteriosclerosis; pulmonary emphysema; osteoporosis; osteoarthritis; high blood pressure; erectile dysfunction; cataracts; macular degeneration, glaucoma, stroke, cerebrovascular disease (strokes), chronic kidney disease, diabetes-associated kidney disease, impaired hepatic function, liver fibrosis, autoimmune hepatitis, endometrial hyperplasia, metabolic dysfunction, renovascular disease, hearing loss, mobility disability, cognitive decline, tendon stiffness, heart dysfunction such as cardiac hypertrophy and / or systolic and / or diastolic dysfunction and / or hypertension, heart dysfunction which results in a decline in ejection fraction, immune senescence, Parkinson's disease, Alzheimer's disease, cancer, immune-senescence leading to cancer due to a decrease in immune-surveillance, infections due to an decline in immune-function, chronic obstructive pulmonary disease (COPD), obesity, loss of taste, loss of olfaction, arthritis, epilepsy, cancer, and type II diabetes

[0124] In an embodiment, the disease or disorder is a mTORopathy. mTORopathiesare a group of rare neurological disorders caused by mutations in the mechanistic target of rapamycin (mTOR) pathway. In an embodiment, the mTORopathy is tuberous sclerosis, focal cortical dysplasia type II (FCDII), hemimegaloencephaly (HME), polyhydramnios, megalocephaly, or symptomatic epilepsy (PMSE) syndrome.

[0125] In an embodiment, the disease or disorder is one of the diseases or disorders depicted in FIG. 11Aor11B.

[0126] As used herein, “treatment” or “treating” refers to an approach for obtaining beneficial or desired results with respect to a disease, disorder, or medical condition including, but not limited to, a therapeutic benefit and / or a prophylactic benefit. In certain embodiments, treatment or treating involves administering a compound or composition disclosed herein to a subject. A therapeutic benefit may include the eradication or amelioration of the underlying disorder being treated. Also, a therapeutic benefit may be achieved with the eradication or amelioration of one or more of the physiological symptoms associated with the underlying disorder, such as observing an improvement in the subject, notwithstanding that the subject may still be afflicted with the underlying disorder. In certain embodiments, for prophylactic benefit, the compositions are administered to a subject at risk of developing a particular disease, or to a subject reporting one or more of the physiological symptoms of a disease, even though a diagnosis of this disease may not have been made. Treating can include, for example, reducing, delaying or alleviating the severity of one or more symptoms of the disease or condition, or it can include reducing the frequency with which symptoms of a disease, defect, disorder, or adverse condition, and the like, are experienced by a patient. Treating can be used herein to refer to a method that results insome level of treatment or amelioration of the disease or condition, and can contemplate a range of results directed to that end, including but not restricted to prevention of the condition entirely.

[0127] In an embodiment, the above-mentioned treatment comprises the use / administration of more than one ( / .e. a combination of) active / therapeutic agent, one of which being the above- mentioned RNAi agent or composition. The combination of agents and / or compositions of the present disclosure may be administered or co-administered (e.g., consecutively, simultaneously, at different times) in any conventional dosage form. Co-administration in the context of the present disclosure refers to the administration of more than one therapeutic in the course of a coordinated treatment to achieve an improved clinical outcome. Such co-administration may also be coextensive, that is, occurring during overlapping periods of time. For example, a first agent may be administered to a patient before, concomitantly, before and after, or after a second active agent is administered. The agents may in an embodiment be combined / formulated in a single composition and thus administered at the same time. In an embodiment, the one or more active agent(s) is used / administered in combination with one or more agent(s) currently used to prevent or treat the disorder in question.

[0128] MODE(S) FOR CARRYING OUT THE INVENTION

[0129] The present invention is illustrated in further details by the following non-limiting examples.

[0130] Example 1: Design of ASOs specific for RAPTOR transcript A biological screen was designed to test ASO molecules that have: 1) complementary sequences to the human and mouse RAPTOR mRNA, and 2) target similar secondary structures (“hairpin” structures) in both human and mouse RAPTOR mRNA. After calculating the respective thermodynamic binding properties (Tm), of each ASO, 10 ASOs (ASO1-10) that conformed to the design strategy were selected. Variants of ASO#2 were also designed. The characteristics of these ASOs are depicted in Tables 1A-B.

[0131] Table 1A: Characteristics of the designed ASOs

[0132]

[0133]

[0134] Table 1B: Characteristics of the designed ASOs (continued)

[0135]

[0136] The ability of the different ASOs to inhibit RAPTOR expression was tested in mouse embryonic fibroblasts (MEF cells) that do not express the requisite subunit of GATOR1 called NPRL2 (NPRL2 KO cells). As shown in FIG. 1A, ASO#2 and ASO#3 both show strong repression of RAPTOR expression in MEF cells. ASO#2 was also shown to reduce RAPTOR expression in WT and TSC2 KO HEK293 cells (FIG. 1 B), as well as in various genetic models of MEF cells expressing disease-linked GATOR1 mutations or the parental WT lineage MEF cell (FIG. 1C). ASO#2 and ASO#3 were also shown to induce repression of RAPTOR expression in C8-D1A cells (astrocyte type I clone) (FIG. 1D).

[0137] Variants of ASO#2 were created by shifting the targeting sequence by +2 or -2 nucleotides on the RAPTOR mRNA, which covers the conserved nucleotide sequence in both mouse and human genes (Tables 1A-B). As shown in FIG. 2, ASO#2 showed the strongest repression of Raptor expression, whereas ASO#2+2 and ASO#2-2 had a moderate effect on RAPTOR downregulation in MEF or HEK293 cells. A mutated version of ASO#2, calledmutantASO#2, which has four nucleotides substituted (shown in bold and underlined in Table 1A), had insubstantial effect on RAPTOR expression at the highest concentration tested in both cell types.

[0138] The results depicted in FIG. 3 demonstrate that ASO#2, but not mutantASO#2, exhibits a dose-dependent ability to repress RAPTOR in MEF cells.

[0139] It was next tested whether ASO#2 was able to reduce Raptor mRNA expression. Quantitative reverse transcription-PCR (QPCR) was used to measure the expression of Raptor mRNA using primers toward Raptor and U36B4 internal control (see Table 2).

[0140] Table 2: Primers used for QPCR experiments

[0141]

[0142] As shown in FIG. 4, strong repression of Raptor mRNA expression was observed in MEF and HEK293 cells treated with ASO#2, relative to mutantASO#2, consistent with the “RNAse H-hallmark” of mRNA degradation that is associated with this type of ASO targeting.

[0143] Example 2: Effect of ASO#2 on GATOR1 -defective Primary Neuron Cultures The effect of RAPTOR inhibition by ASO#2 on primary cortical neuron defective in Nitrogen permease regulator-like 2 (NPRL2), which is part of the GAP activity toward Rags 1 (GATOR1) complex, was tested. Disruption of the GATOR1 complex causes mTORCI hyperactivation. The results depicted in FIG. 5 show that the loss of NPRL2 expression in primary neuron cultures causes the cells to become hyperactive and massively increase neuronal firing events, which is similar to what can happen with epileptic neuron activity during a seizure. Such hyperactivity of the primary cortical neurons was prevented by treatment with ASO#2 or with a lentiviral-mediated shRNA targeting Raptor mRNA.

[0144] Example 3: Effect of ASO#2 on survival of NPRL2-defective mice It has been previously reported that loss of NPRL2 increases mTORCI signal transduction, significantly alters amino acid homeostasis in the brain, and causes suddenunexpected death of epileptics (SUDEP) (Hui, J. B etal., eNeuro 9, 10.1523 / ENEUR0.0317-21.2022). The data reported in FIG.6 demonstrates that administration of ASO#2 can prevent sudden and early death of NPRL2-defective mice.

[0145] Example 4: Effect of ASO#2 on GATOR1 -defective astrocytes mTORCI hyperactivation has been shown to be associated with elevated cellular ROS (see, e.g., Reho et al., Journal of the American Heart Association, Volume 8, Number 9). As shown in FIG. 7, astrocytes defective in Nitrogen permease regulator-like 3 (NPRL3), which is also a protein subunit of the GATOR1 complex, show increased levels of ROS relative to wild-type astrocytes. Treatment of the NPRL3-defective astrocytes with ASO#2, but not with mutantASO#2, led to a reduction in ROS levels. NPRL3-defective astrocytes were also shown to exhibit defective mitochondrial electron transport chain activity, which was corrected by treatment with ASO#2 (FIG. 8).

[0146] The effect of ASO#2 was next tested in mice with deletion of NPRL2 in astrocytes. As shown in FIG. 9, loss of NPRL2 in astrocytes causes reactive astrocytosis (also known as astrogliosis), comprising the abnormal presence, morphology, and protein marker expression consistent with reactive astrocytes, which was prevented by administration of ASO#2.

[0147] Example 5: Effect of ASO#2 on mTORCI signaling in wild-type (WT) and NPRL2 KO MEF cells

[0148] ASO#2-mediated knockdown of RAPTOR selectively decreased mTORCI signaling (P-S6K:S6K; P-S6:S6) in GATOR1 defective cells during starvation relative to wild-type cells, where WT cells should naturally permit GATORI-dependent inhibition mTORCI signaling. ASO#2 reduced P-S6K:S6K and P-S6:S6 ratios, while slightly increasing P-AKT (Ser473) in starvation conditions, relative to scrASO2 treatment (FIG. 12).

[0149] Example 6: Effect of ASO#2 on blood glucose levels and gluconeogenic markers in wild-type (WT) and NPRL2 astrocyte KO mice

[0150] Rapamycin is associated with induction of hepatic gluconeogenic markers and insulin resistance. It was thus tested whether a similar effect was observed following ASO2-mediated knockdown of RAPTOR. As shown in FIG. 13A, intracerebral administration of RAPTOR-targeted ASO#2 does not induce hyperglycemia, indicating no detectable systemic glycemic dysregulation under the test conditions. Treatment with ASO#2 reduced Pepck mRNA (rate limiting enzyme of gluconeogenesis) in both control and NPRL2 astrocyte KO mice, indicating that ASO#2 does not simulate hepatic gluconeogenesis under the testconditions (FIG. 13B). Thus, in contrast to rapamycin, treatment with the disclosed RAPTOR-targeting ASOs did not induce hyperglycemia and hepatic gluconeogenic markers under the tested conditions.

[0151] Example 7: Effect of ASO#2 on the expression of RAPTOR in vivo across brain tissues

[0152] The results depicted in FIG. 14 show that ASO#2 treatment reduces the expression of RAPTOR in vivo across examined brain tissues.

[0153] Example 8: Effect of ASO#2 on the survival of NPRL2 KO mice The results depicted in FIG. 15 show that ASO#2 treatment delayed the first death by 19 days, with mean survival gain (50% alive) increased by approximately 32 days. No NPRL2fl / fl; GFAP-Cre mice live beyond day 258, whereas 44.4% of ASO2 treated mice survive at that point, and more than 10% were still alive after 320 days.

[0154] Example 9: Effect of ASO#2 on human astrocyte invasion The results depicted in FIG. 16 demonstrate that ASO#2 treatment reduces normal human astrocytes (NHA) invasion using Boyden chambers.

[0155] Although the present invention has been described hereinabove by way of specific embodiments thereof, it can be modified, without departing from the spirit and nature of the subject invention as defined in the appended claims. In the claims, the word "comprising" is used as an open-ended term, substantially equivalent to the phrase "including, but not limited to". The singular forms "a", "an" and "the" include corresponding plural references unless the context clearly dictates otherwise.REFERENCES

[0156] 1. N. X. Y. Ling et al., « mTORCI directly inhibits AMPK to promote cell proliferation under nutrient stress », Nat Meta b, vol. 2, no 1, p. 41-49, janv. 2020, doi: 10.1038 / s42255-019-0157-1.

[0157] 2. L. Vadlakonda, M. Pasupuleti, et R. Pallu, « Role of PI3K-AKT-mTOR and Wnt Signaling Pathways in Transition of G1-S Phase of Cell Cycle in Cancer Cells », Front Oncol, vol. 3, p. 85, 2013, doi: 10.3389 / fonc.2013.00085.

[0158] 3. M. Martini, M. C. De Santis, L. Braccini, F. Gulluni, et E. Hirsch, « PI3K / AKT signaling pathway and cancer: an updated review », Ann Med, vol. 46, no 6, p. 372-383, sept. 2014, doi: 10.3109 / 07853890.2014.912836.

[0159] 4. V. Karalis, F. Caval-Holme, et H. S. Bateup, « Raptor downregulation rescues neuronal phenotypes in mouse models of Tuberous Sclerosis Complex », Nat Commun, vol.

[0160] 13, no 1, p. 4665, aout2022, doi: 10.1038 / s41467-022-31961 -6.

[0161] 5. Jeremy B. Hui, Jose Cesar Hernandez Silva, Mari Carmen Pelaez, Myriam Sevigny, Janani Priya Venkatasubramani, Quentin Plumereau, Mohamed Chahine, Christophe D. Proulx, Chantelle F. Sephton and Paul A. Dutchak. NPRL2 Inhibition of mTORCI Controls Sodium Channel Expression and Brain Amino Acid Homeostasis. eNeuro 14 February 2022, 9 (2) ENEURO.0317- 21.2022; https: / / doi.org / 10.1523 / ENEURO.0317-21.2022.

Claims

1. WHAT IS CLAIMED IS:

1. An RNA interfering agent specific for a transcript encoding Regulatory-associated protein of mTOR (Raptor), the RNAi agent binding within a domain defined by the sequence ttaaggctggaggttctcgag (SEQ ID NO:1) or gctctggaaaccatcggtgc (SEQ ID NO:2) of said transcript.

2. The RNA interfering agent according to claim 1 , wherein the agent binds to a domain defined by the sequence gctctggaaaccatcggtgc (SEQ ID NO:2) of said transcript.

3. The RNA interfering agent according to claim 2, wherein the agent binds within a domain defined by the sequence aaggctggaggttctcg (SEQ ID NO:3), ttaaggctggaggttct (SEQ ID NO:4), or ggctggaggttctcgag (SEQ ID NO:5), preferably aaggctggaggttctcg (SEQ ID NO:3), of said transcript.

4. The RNA interfering agent according to any one of claims 1 to 3, wherein the agent is a microRNA (miRNA), a short hairpin RNA (shRNA), a small interfering RNA (siRNA) or an antisense oligonucleotide (ASO).

5. The RNA interfering agent according to claim 4, wherein the agent is an ASO.

6. The RNA interfering agent according to claim 5, wherein the ASO comprises the sequence CGAGAACCTCCAGCCTT (SEQ ID NO:6), AGAACCTCCAGCCTTAA (SEQ ID NO:7), CTCGAGAACCTCCAGCC (SEQ ID NO:8), or GCACCGATGGTTTCCAGAGC (SEQ ID NO:9).

7. The RNA interfering agent according to claim 6, wherein the ASO comprises the sequence CGAGAACCTCCAGCCTT (SEQ ID NO:6).

8. The RNA interfering agent according to claim 6 or 7, wherein the ASO comprises one or more modifications that increases its stability and / or reduce its immunogenicity.

9. The RNA interfering agent according to claim 8, wherein said one or more modifications comprises one or more backbone (inter-nucleotide linkage) modifications.

10. The RNA interfering agent according to claim 10, wherein said one or more backbone modifications are phosphorothioate (PS) modifications, phosphodiester modifications, and / or methoxypropylphosphonate (MOP) modifications.

11. The RNA interfering agent according to claim 10, wherein said one or more backbone modifications are phosphorothioate (PS) modifications.

12. The RNA interfering agent according to any one of claims 8 to 11, wherein said one or more modifications comprises one or more 2' ribose modifications.

13. The RNA interfering agent according to claim 12, wherein one or more 2' ribose modifications are methyl (Me), methoxyethyl (MOE), constrained ethyl (cEt), locked nucleic acid (LNA) and / or fluoro modifications.

14. The RNA interfering agent according to claim 13, wherein one or more 2' ribose modifications are MOE modifications.

15. The RNA interfering agent according to any one of claims 5 to 14, wherein the ASO comprises an all-phosphothionate (PS) backbone.

16. The RNA interfering agent according to any one of claims 5 to 15, wherein the ASO comprises the sequence C*G*A*G*A*ACCTCCAG*C*C*T*T* (SEQ ID NO: 10) or G*C*A*C*C*GATGGTTTCCA*G*A*G*C* (SEQ ID NO:11), wherein * is a methoxyethyl (MOE) 2' ribose modification.

17. The RNA interfering agent according to claim 16, wherein the ASO comprises the sequence C*G*A*G*A*ACCTCCAG*C*C*T*T* (SEQ ID NO:10).

18. A pharmaceutical composition comprising the RNA interfering agent of any one of claims 1 to 17.

19. A method of treating a disease or disorder associated with mTORCI hyperactivation in a subject in need thereof comprising administering to the subject the RNA interfering agent of any one of claims 1 to 17 or the pharmaceutical composition of claim 18.

20. The method of claim 19, wherein the disease or disorder associated with mTORCI hyperactivation is caused by a defect in GAP activity toward Rags 1 (GATOR1) and / or Tuberous Sclerosis Complex (TSC).

21. The method of claim 19 or 20, wherein the disease associated with mTORCI hyperactivation is cancer, a metabolic disease, a neurological disorder, a cystic disease, an inflammatory / autoimmune disease, or a multisystem disorder.

22. The method of claim 21, wherein the cancer is brain cancer (e.g., glioblastoma, medulloblastoma), lung cancer (e.g., non-small cell lung cancer, squamous cell lung carcinoma), head and neck cancer (e.g., head and neck squamous cell carcinoma), breast cancer, renal cancer (e.g., renal cell carcinoma), liver cancer (e.g., hepatic cell carcinoma), gastric cancer, colorectal cancer, neuroendocrine cancer (e.g., large-cell neuroendocrine carcinoma), prostate cancer, lymphoma, urinary bladder cancer, or gynecologic cancer (e.g., ovarian cancer).

23. The method of claim 21, wherein the neurological disorder is a neurodegenerative disorder, a neurocutaneous disease, or a neurodevelopmental disorder.

24. The method of claim 21 or 23, wherein the neurodegenerative is Alzheimer’s disease or Parkinson’s disease.

25. The method of claim 21 or 23, wherein the neurological disorder is epilepsy, focal cortical dysplasia, or an autism spectrum disorder.

26. The method of claim 21 , wherein the cystic disease is polycystic kidney disease (PKD) or lymphangioleiomyomatosis (LAM).

27. The method of claim 21 , wherein the multisystem disorder is tuberous sclerosis.

28. The method of claim 21 , wherein the metabolic disease is diabetes.

29. The RNA interfering agent of any one of claims 1 to 17 or the pharmaceutical composition of claim 18 for use in treating a disease or disorder associated with mTORCI hyperactivation in a subject.

30. The RNA interfering agent or composition for use according to claim 29, wherein the disease or disorder associated with mTORCI hyperactivation is caused by a defect in GAP activity toward Rags 1 (GATOR1) and / or Tuberous Sclerosis Complex (TSC).

31. The RNA interfering agent or composition for use according to claim 29 or 30, wherein the disease associated with mTORCI hyperactivation is cancer, a metabolic disease, a neurological disorder, a cystic disease, an inflammatory / autoimmune disease, or a multisystem disorder.

32. The RNA interfering agent or composition for use according to claim 31, wherein the cancer is brain cancer (e.g., glioblastoma, medulloblastoma), lung cancer (e.g., non-smallcell lung cancer, squamous cell lung carcinoma), head and neck cancer (e.g., head and neck squamous cell carcinoma), breast cancer, renal cancer (e.g., renal cell carcinoma), liver cancer (e.g., hepatic cell carcinoma), gastric cancer, colorectal cancer, neuroendocrine cancer (e.g., large-cell neuroendocrine carcinoma), prostate cancer, lymphoma, urinary bladder cancer, or gynecologic cancer (e.g., ovarian cancer).

33. The RNA interfering agent or composition for use according to claim 31, wherein the neurological disorder is a neurodegenerative disorder, a neurocutaneous disease, or a neurodevelopmental disorder.

34. The RNA interfering agent or composition for use according to claim 31 or 33, wherein the neurodegenerative is Alzheimer’s disease or Parkinson’s disease.

35. The RNA interfering agent or composition for use according to claim 31 or 33, wherein the neurological disorder is epilepsy, focal cortical dysplasia, or an autism spectrum disorder.

36. The RNA interfering agent or composition for use according to claim 31, wherein the cystic disease is polycystic kidney disease (PKD) or lymphangioleiomyomatosis (LAM).

37. The RNA interfering agent or composition for use according to claim 31, wherein the multisystem disorder is tuberous sclerosis.

38. The RNA interfering agent or composition for use according to claim 31, wherein the metabolic disease is diabetes.

39. Use of the RNA interfering agent of any one of claims 1 to 17 or the pharmaceutical composition of claim 18 for the manufacture of a medicament for treating a disease or disorder associated with mTORCI hyperactivation in a subject.

40. The use according to claim 39, wherein the disease or disorder associated with mTORCI hyperactivation is caused by a defect in GAP activity toward Rags 1 (GATOR1) and / or Tuberous Sclerosis Complex (TSC).

41. The use according to claim 39 or 40, wherein the disease associated with mTORCI hyperactivation is cancer, a metabolic disease, a neurological disorder, a cystic disease, an inflammatory / autoimmune disease, or a multisystem disorder.

42. The use according to claim 41 , wherein the cancer is brain cancer (e.g. , glioblastoma, medulloblastoma), lung cancer (e.g., non-small cell lung cancer, squamous cell lungcarcinoma), head and neck cancer (e.g., head and neck squamous cell carcinoma), breast cancer, renal cancer (e.g., renal cell carcinoma), liver cancer (e.g., hepatic cell carcinoma), gastric cancer, colorectal cancer, neuroendocrine cancer (e.g., large-cell neuroendocrine carcinoma), prostate cancer, lymphoma, urinary bladder cancer, or gynecologic cancer (e.g., ovarian cancer).

43. The use according to claim 41, wherein the neurological disorder is a neurodegenerative disorder, a neurocutaneous disease, ora neurodevelopmental disorder.

44. The use according to claim 41 or 43, wherein the neurodegenerative is Alzheimer’s disease or Parkinson’s disease.

45. The use according to claim 41 or 43, wherein the neurological disorder is epilepsy, focal cortical dysplasia, or an autism spectrum disorder.

46. The use according to claim 41 , wherein the cystic disease is polycystic kidney disease (PKD) or lymphangioleiomyomatosis (LAM).

47. The use according to claim 41 , wherein the multisystem disorder is tuberous sclerosis.

48. The use according to claim 41 , wherein the metabolic disease is diabetes.