Adeno-associated virus capsid protein mutant, packaging system, recombinant virus, and medical uses
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-09-29
- Publication Date
- 2026-08-13
Smart Images

Figure CN2025125167_13082026_PF_FP_ABST
Abstract
Description
Adeno-associated virus capsid protein mutants, packaging systems, recombinant viruses and pharmaceutical applications Technical Field
[0001] This invention relates to the field of genetic engineering technology, and in particular to an adeno-associated virus capsid protein mutant, packaging system, recombinant virus, and pharmaceutical applications. Background Technology
[0002] Adeno-associated virus (AAV) is a highly valuable viral vector in gene therapy, cell engineering, vaccine development, and neuroscience. Its core advantage lies in its ability to efficiently deliver target genes into target cells, while also exhibiting low immunogenicity, persistent expression, and high safety. This makes AAV a core tool for treating single-gene genetic diseases such as spinal muscular atrophy, Leber's congenital amaurosis, and hemophilia, and several products have already been approved. AAV applications are flexible: it can be used for direct in vivo injection for gene therapy or editing, such as delivering CRISPR systems for single-base editing to repair β-thalassemia; it can also be used in vitro to modify cells, such as T cells, hematopoietic stem cells, and iPSCs, and then reinfused into patients for applications in CAR-T cancer immunotherapy, genetic disease correction, or tissue regeneration. Especially with the rapid development of gene editing technology, AAV shows great potential in precise gene knock-in and HLA editing.
[0003] However, AAV-mediated therapies, especially in the field of cell therapy, face significant challenges, primarily due to insufficient gene delivery efficiency and the resulting high dose requirements. While different serotypes have been developed to address tissue targeting, their delivery efficiency remains limited. To achieve therapeutic effects, extremely high viral doses are often required; for example, >10⁻⁶ doses are needed for targeting the central nervous system. 13 GC / kg, with a multiplicity of infection (MOI) of up to 10 for primary T cells. 6 GC / cells. This directly leads to enormous costs—for example, a single dose of Zolgensma for treating SMA costs as much as $2.1 million—and significant safety risks—high-dose AAV increases off-target risks, potential genomic integration, and is more likely to elicit a host immune response. In the field of cell therapy, traditionally used gamma retroviruses and lentiviral vectors pose a risk of insertional mutations leading to oncology due to their semi-random integration characteristics. While using CRISPR combined with AAV for targeted integration is a promising alternative, AAV6 infection of T cells still requires extremely high MOI, and its toxicity and cost remain significant issues. Summary of the Invention
[0004] Purpose of the invention: The purpose of this invention is to provide an adeno-associated virus capsid protein mutant that enables efficient infection of human T cells by adeno-associated virus; the second purpose is to provide a packaging system containing the capsid protein mutant, recombinant virus, and its applications.
[0005] Technical solution: The adeno-associated virus capsid protein mutant of the present invention is based on the wild-type adeno-associated virus 6 capsid protein with the amino acid sequence shown in SEQ ID NO: 1, and has an amino acid residue mutation at amino acid residues 454-460 as shown in the XAPRXXX sequence. The specific mutant sequence is as follows:
[0006] Preferably, the mutant has an amino acid sequence as shown in any one of SEQ ID NO: 2-13.
[0007] Preferably, the mutant has an amino acid sequence as shown in SEQ ID NO: 2.
[0008] The recombinant adeno-associated virus capsid of the present invention contains the aforementioned adeno-associated virus capsid protein mutant.
[0009] The nucleotide sequence described in this invention encodes the amino acid sequence of the aforementioned adeno-associated virus capsid protein mutant.
[0010] The plasmid described in this invention contains the aforementioned nucleotide sequence.
[0011] Preferably, the plasmid is an auxiliary plasmid containing the aforementioned nucleotide sequence, which together with the vector plasmid carrying the ITR-flanked exogenous gene expression cassette and the adeno-associated virus auxiliary plasmid pHelper constitutes a three-plasmid system for packaging recombinant adeno-associated virus.
[0012] Preferably, the plasmid is a baculovirus transfer plasmid containing the aforementioned nucleotide sequence, which, after sequentially infecting insect cells with a Rep gene-inserted baculovirus transfer plasmid and an ITR-exogenous gene-inserted baculovirus transfer plasmid, is used for the expression of recombinant adeno-associated virus.
[0013] The recombinant adeno-associated virus of the present invention contains the aforementioned recombinant adeno-associated virus capsid and a functional gene encapsulated by the capsid. The functional gene includes a pair of inverted terminal repeat sequences and the target gene between them that can encode any one or more products of a therapeutic RNA, a therapeutic protein, a gene editing nuclease and a gene editing guide RNA, a transposon system, a chimeric antigen receptor, a T-cell receptor, a monoclonal antibody, a nanobody, or a single-chain antibody variable region.
[0014] The pharmaceutical composition of the present invention comprises the aforementioned recombinant adeno-associated virus as an active ingredient and pharmaceutically acceptable excipients.
[0015] The present invention relates to the application of the recombinant adeno-associated virus or pharmaceutical composition in the preparation of therapeutic drugs for immune-related diseases, including cancer, autoimmune diseases, infectious diseases, and tissue / organ fibrosis.
[0016] Preferably, the application is in the preparation of a drug that targets CD7-positive cells.
[0017] Preferably, the application is the preparation of therapeutic immune cells, wherein the therapeutic immune cells are any one of chimeric antigen receptor T cells, T cell receptor T cells, and chimeric antigen receptor NK cells.
[0018] Beneficial Effects: Compared with the prior art, the present invention has the following significant advantages: 1. By constructing a saturated mutant library of amino acid residues 454-460 of the adeno-associated virus (AAV) capsid protein, a series of capsid proteins with alanine-proline-arginine residue structural mutations at this site were screened; 2. AAV containing this capsid protein has a significant advantage in infecting CD7-positive cells, requiring only 10 nucleotides per cell. 2 -10 3 The efficient preparation of therapeutic immune cells can be achieved by copying viral genes; 3. AAV.APR significantly improves the efficiency of infecting mouse T cells and human NK cells, providing a powerful technical platform for basic research in biomedicine, cell therapy, immunotherapy and gene therapy-related research and clinical applications. Attached Figure Description
[0019] Figure 1 is a flowchart of the mutation and screening process for adeno-associated virus (AAV) capsid proteins;
[0020] Figure 2 shows the trend of AAV dominant serotype changes in T cells infected with donor A and donor B after three rounds of AAV mutant library screening;
[0021] Figure 3 shows the correlation analysis results of AAV6, AAV.APR31 and other mutants infecting T cells derived from donor A and donor B after three rounds of AAV mutant library screening;
[0022] Figure 4 shows the enrichment of AAV6, AAV.APR mutants and non-AAV.APR mutants infecting T cells derived from donor A and donor B after the third round of AAV mutant library screening;
[0023] Figure 5 shows the amino acid sequence distribution of the first 200 mutants infecting T cells derived from donor A and donor B after the third round of AAV mutant library screening;
[0024] Figure 6 shows the infection performance of AAV.APR31 mutant in Jurkat cells, where the left figure is a flow cytometry plot and the right figure is a statistical plot.
[0025] Figure 7 shows the infection performance evaluation of human T cells with AAV.APR mutants. Figure A shows the flow cytometry and statistical plots of AAV6 and AAV.APR31 infecting T cells derived from donor 300F. Figure B shows the flow cytometry results of AAV6, AAV.APR01, AAV.APR30, AAV.APR32, AAV.APR33, AAV.APR34, and AAV.APR36 infecting T cells derived from donor 300F. Figure C shows the flow cytometry and statistical plots of AAV6 and AAV.APR31 infecting T cells derived from donor E. Figure D shows the flow cytometry results of AAV6, AAV.APR01, AAV.APR30, AAV.APR32, AAV.APR33, AAV.APR34, and AAV.APR36 infecting T cells derived from donor E.
[0026] Figure 8 shows the performance of the AAV.APR31 mutant in infecting human T cells from seven different donors.
[0027] Figure 9 shows the murine CD8 mutation of AAV.APR. + T-cell invasion performance assessment;
[0028] Figure 10 shows the performance evaluation of AAV.APR31-mediated TRAC site EGFP integration, where the left figure is a flow cytometry plot and the right figure is a statistical plot;
[0029] Figure 11 shows the performance evaluation of AAV.APR31-mediated TRAC site CD22-CAR integration. Figure A shows the flow cytometry and statistical graphs of integration mediated by AAV6 and AAV.APR31, and Figure B shows the flow cytometry results of integration of AAV6, AAV.APR01, AAV.APR20, AAV.APR21, AAV.APR22, AAV.APR23, AAV.APR24, and AAV.APR30 into donor 300F or donor E-derived T cells.
[0030] Figure 12 shows the performance evaluation of AAV.APR31 in the TRAC site CD22-CAR integration mediated by unactivated T cells. The left figure is a flow cytometry plot, and the right figure is a statistical plot.
[0031] Figure 13 shows the performance evaluation of AAV.APR31-mediated TRBC1 site CD22-CAR integration, where the left figure is a flow cytometry plot and the right figure is a statistical plot;
[0032] Figure 14 shows the performance evaluation of AAV.APR31-mediated PDCD1 site CD22-CAR integration, where the left figure is a flow cytometry plot and the right figure is a statistical plot;
[0033] Figure 15 shows the performance evaluation of BFP integration at the GAPDH site mediated by AAV.APR31, where the left figure is a flow cytometry plot and the right figure is a statistical plot.
[0034] Figure 16 shows the performance evaluation of the AAV.APR31-mediated TRAC and GAPDH dual-site targeted integration reporter gene, where the upper figure is a flow cytometry plot and the lower figure is a statistical graph;
[0035] Figure 17 shows the performance evaluation of AAV.APR31-mediated TRAC and GAPDH dual-site targeted integration CAR gene, where the upper figure is a flow cytometry plot and the lower figure is a statistical graph.
[0036] Figure 18 is a schematic diagram of flow cytometry sorting, in which the cells collected for each cell type include: 18% of cells with low EGFP expression and no EGFP expression on the left side, and 18% of cells with high EGFP expression on the right side.
[0037] Figure 19 shows the enrichment analysis results of key targets of AAV.APR31 infection after CRISPR screening.
[0038] Figure 20 shows the comparison results of some key targets of AAV.APR31 in Jurkat and NALM-6 cells;
[0039] Figure 21 shows the evaluation results of AAV.APR31 infection performance after knocking out the key target CD7 or AAVR. Figure A is a flow cytometry plot of AAV.APR31 invading Jurkat cells after CD7 or AAVR knockout, and Figure B is a statistical plot of flow cytometry results of AAV.APR31 invading Jurkat cells or human T cells after CD7 or AAVR knockout.
[0040] Figure 22 shows the evaluation results of AAV.APR31 infection performance after blocking the key target CD7 with antibody. The left figure is a flow cytometry result of AAV.APR31 infection of Jurkat cells after CD7 blocking, and the right figure is a flow cytometry result of AAV.APR31 infection of human T cells from three different donors after CD7 blocking.
[0041] Figure 23 shows the results of the interaction analysis between AAV.APR31 capsid protein monomers and CD7 protein.
[0042] Figure 24 shows the predicted structures of the VR-IV domain and CD7 extracellular domain of the AAV6 and AAV.APR31 capsid proteins;
[0043] Figure 25 is a schematic diagram of the core spatial domains that interact with the VR-IV domain of the AAV.APR31 capsid protein and the extracellular segment of CD7.
[0044] Figure 26 shows the results of MSLN-CAR T cell preparation mediated by AAV.APR31 based on the CRISPR / Cas9 system. The left figure is a flow cytometry plot, and the right figure is a statistical plot.
[0045] Figure 27 shows the results of GD2-CAR T cell preparation mediated by AAV.APR31 based on the CRISPR / Cas9 system. The left figure is a flow cytometry plot, and the right figure is a statistical plot.
[0046] Figure 28 shows the results of CD19.20-CAR T cell preparation mediated by AAV.APR31 based on the CRISPR / Cas9 system. The left figure is a flow cytometry plot, and the right figure is a statistical plot.
[0047] Figure 29 shows the results of NY-ESO-1-TCR T cell preparation mediated by AAV.APR31 based on the CRISPR / Cas9 system. The left figure is a flow cytometry plot, and the right figure is a statistical plot.
[0048] Figure 30 is a statistical graph of flow cytometry results after the preparation of CAR-NK cells mediated by AAV.APR31 based on the CRISPR / Cas9 system;
[0049] Figure 31 shows the results of EGFP-integrated cell preparation mediated by the Sleeping Beauty transposon system AAV.APR31, where the left figure is a flow cytometry plot and the right figure is a statistical plot;
[0050] Figure 32 shows the evaluation results of the antitumor performance of the therapeutic immune cells prepared in the aforementioned embodiments;
[0051] Figure 33 shows the preparation and anti-tumor performance evaluation results of in vivo CD22-CAR T cells. Figure A shows the in vivo imaging results, and Figure B shows the statistical results of in vivo imaging fluorescence intensity. Detailed Implementation
[0052] The technical solution of the present invention will be further described below.
[0053] Example 1: Mutation and Screening of Adeno-Associated Virus (AAV) Capsid Protein
[0054] The mutation and screening process for adeno-associated virus capsid proteins is shown in Figure 1.
[0055] 1. Construction of the AAV mutant library
[0056] Based on the nucleotide sequence of wild-type adeno-associated virus (AAV) capsid protein 6, the nucleotide sequence corresponding to amino acid residues 454-460 in the VR-IV domain of the wild-type AAV capsid protein was completely replaced with the sequence NNSNNSNNSNNSNNSNNSNNS using the NNS degenerate codon strategy. Primers were randomly synthesized by Qingke Biotechnology Co., Ltd., as shown in Table 1 below:
[0057] Table 1 PCR primers
[0058] Where N is any one of A, T, C, and G, and S is any one of C and G;
[0059] Using the AAV6-VR-IV-Stop plasmid with the sequence shown in SEQ ID NO: 14 as a vector template, the above primers were used to amplify the product by PCR, and PCR#1 and PCR#2 products were obtained. The PCR system is shown in Table 2 and the reaction conditions are shown in Table 3.
[0060] Table 2 PCR reaction system
[0061] Table 3 PCR reaction conditions
[0062] The pLY037a_P5-Rep_deadGFP-Cap plasmid with the sequence shown in SEQ ID NO: 15 was selected as the library cloning backbone. Double digestion was performed using Pfl23II and SdaI enzymes. The digestion products were separated by 0.9% agarose gel electrophoresis, and the approximately 6900bp digested fragment was purified and recovered using a DNA recovery and purification kit (QIAquick Gel ExTRACtion Kit, catalog number 28704).
[0063] The recovered product was mixed with PCR#1 and PCR#2 products in an equimolar ratio, and then... Seamless assembly was performed using HiFi DNA Assembly Master Mix. The assembled product was then purified with anhydrous ethanol and further concentrated.
[0064] The purified and concentrated product was electroporated to Endura. TMElectroporation of competent cells (Lucigen, catalog number 60242-1) was performed. After electroporation, the cells were allowed to recover in the accompanying resuscitation medium for 1 hour, and then inoculated onto 245 mm diameter agar plates using the plate-spreading method. Simultaneously, 10 μL of competent cells were serially diluted 100 or 1000 times with resuscitation medium to assess library capacity. All single colonies on the agar plates were collected, and Rep-Cap mutant library plasmids were prepared using the NucleoBond Xtra Midi EF kit to obtain the AAV mutant library.
[0065] 2. Construction of the AAV mutant virus library
[0066] The day before transfection, 293T cells were loaded at a rate of 2 × 10⁻⁶. 7 Cells were seeded at a density of 100 cells / dish in 150 mm culture dishes and cultured at 37°C and 5% CO2. On the day of transfection, the original culture medium was replaced with 13 mL of preheated serum-free DMEM medium.
[0067] For each culture dish, add 8.75 μg of Rep-Cap mutant library plasmid and 19.25 μg of pAdDeltaF6 helper plasmid to 450 μL of Opti-MEM, then add 130 μL of polyethyleneimine (PEI) at a concentration of 1 mg / mL, mix thoroughly, incubate at room temperature for 15 min, add to the culture dish, and incubate at 37 °C and 5% CO2.
[0068] Six hours after transfection, the culture medium in the culture dish was replaced with 20 mL of preheated fresh DMEM complete medium, and cultured at 37°C and 5% CO2.
[0069] After 72 hours, the supernatant of the culture medium was collected, and then 20 mL of fresh culture medium was added. After culturing for another 24 hours, the transfected cells and supernatant were collected. The cells and supernatant collected in both cases were used for AAV purification. The purification and titration of AAV were performed according to the method described in Ye et al., In vivo CRISPR screening in CD8 T cells with AAV–Sleeping Beauty hybrid vectors identifies membrane targets for improving immunotherapy for glioblastoma. Nature Biotechnology 2019.
[0070] 3. Screening for AAV mutants
[0071] Peripheral blood mononuclear cells (PBMCs) from healthy individuals were purchased from Miaoshun Biotechnology or Heyou Biotechnology.
[0072] PBMCs from two different donors (Donor A and Donor B) were used at a ratio of 1×10 6 Cells were seeded at a density of 10 cells / mL in 6-well plates and cultured at 37°C in a 5% CO2 environment in X-VIVO medium. TM 15 culture medium supplemented with 5% fetal bovine serum, 50 μM 2-mercaptoethanol, 100 U / mL IL-2, 5 ng / mL IL-7 and 5 ng / mL IL-15;
[0073] Add ImmunoCult at a concentration of 25 μL / mL culture medium. TM Human CD3 / CD28 / CD2 T cell activator activated for 48 hours;
[0074] Activated human T cells were incubated with the aforementioned AAV mutant viral library at MOI = 1000 for 6 hours at 37°C and 5% CO2. The T cells were then collected by centrifugation, washed with PBS, and the process was repeated three times. Whole-genome DNA was extracted using the QIAamp DNA Blood Mini Kit. The VR-IV domain of the enriched AAV mutants was amplified by PCR using primers listed in Table 4, with PCR conditions shown in Tables 5 and 6. Second and third rounds of AAV mutant library construction were performed using this method, with MOI = 1000 in the second round and MOI = 500 in the third round.
[0075] Table 4 PCR Primers
[0076] Table 5 PCR reaction system
[0077] Table 6 PCR reaction conditions
[0078] After three rounds of screening, cells were collected, whole-genome DNA was extracted, PCR library was constructed and sequenced, and the final enriched AAV mutants were determined through data analysis.
[0079] The screening results are shown in Figure 2-5. AAV mutants containing the APR motif in the VR-IV domain were enriched in large quantities. As the number of screening rounds increased, the proportion and signal of AAV.APR mutants gradually increased and eventually became dominant.
[0080] Example 2: Evaluation of the cell invasion performance of AAV.APR mutants
[0081] Based on the AAV capsid protein mutants with the amino acid sequences shown in SEQ ID NO: 3 (APR01), 9 (APR30), 2 (APR31), 10 (APR32), 11 (APR33), 12 (APR34), and 13 (APR36), AAV capsid protein mutants AAV.APR01, 30, 31, 32, 33, 34, and 36 were designed and prepared using pRepCap6 (i.e., AAV6) plasmid as the backbone plasmid. These mutant plasmids were co-transfected with pAdDeltaF6 helper plasmid and pscAAV-CAG-GFP plasmid into 293T cells for packaging, resulting in the corresponding serotypes of EGFP virus AAV.APR01, AAV.APR30, AAV.APR31, AAV.APR32, AAV.APR33, AAV.APR34, and AAV.APR36. Wild-type AAV6 was used as a control to evaluate cell infection performance.
[0082] 1. Evaluation of Jurkat cell invasion performance of AAV.APR mutants
[0083] Jurkat cells were loaded at 1×10 6 The cells were seeded at a density of 10 cells / mL in 48-well culture plates and cultured at 37°C and 5% CO2.
[0084] The cells were cultured at 37°C and 5% CO2 with the aforementioned AAV.APR31 or AAV6 cells having MOIs of 50, 100, 250, 500 or 1000, respectively, with cells without AAV added as a negative control.
[0085] After 16 hours, the culture medium was replaced with fresh complete medium. After 48 hours of AAV infection, the EGFP positivity rate was analyzed by flow cytometry.
[0086] As shown in Figure 6, the AAV6 group failed to effectively infect Jurkat under low MOI conditions, with only some cells showing EGFP positivity at MOI=1000. In contrast, the AAV.APR31 group showed some EGFP positivity even at MOI=50, and the infection efficiency increased significantly with increasing MOI. When MOI was greater than or equal to 500, almost all cells showed EGFP positivity. This indicates that AAV.APR31 has excellent infection performance.
[0087] 2. Evaluation of the human T-cell invasion performance of AAV.APR mutants
[0088] Peripheral blood mononuclear cells (PBMCs) from healthy individuals were purchased from Miaoshun Biotechnology or Heyou Biotechnology.
[0089] PBMCs from two different donors (Donor 300F and Donor E) were used at 1×10⁻⁶ ppm. 6 Cells were seeded at a density of [number] cells / mL in 48-well plates and cultured at 37°C under 5% CO2 in X-VIVO2 medium. TM 15 culture medium supplemented with 5% fetal bovine serum, 50 μM 2-mercaptoethanol, 100 U / mL IL-2, 5 ng / mL IL-7 and 5 ng / mL IL-15;
[0090] Add ImmunoCult at a concentration of 25 μL / mL culture medium. TM Human CD3 / CD28 / CD2 T cell activator activated for 48 hours;
[0091] Activated human T cells were supplemented with the aforementioned prepared AAV, APR01, 30, 31, 32, 33, 34, 36 or AAV6 with an MOI of 250, 500, 1000, 2500, 5000 or 10000, while cells without added AAV were used as a negative control, and cultured at 37°C and 5% CO2.
[0092] After 16 hours, the culture medium was replaced with fresh complete medium. After 48 hours of AAV infection, the EGFP positivity rate was analyzed by flow cytometry.
[0093] As shown in Figure 7, AAV6 has very limited ability to infect human T cells, but AAV.APR31 can infect cells very effectively.
[0094] The same experiment was repeated in T cells from 7 different donors (purchased from Miaoshun Bio or Heyousheng Bio). The infection performance was evaluated according to the above method. The results are shown in Figure 8. AAV6 has limited infection ability, while AAV.APR31 can effectively infect PBMCs from different donors and can be widely used for T cells from different donor sources.
[0095] 3. Mouse CD8 mutant of AAV.APR + T-cell invasion performance assessment
[0096] C57BL / 6J mouse-derived CD8 + T cells at 5 × 10 5Cells were seeded at a density of 10 cells / well in 48-well plates pretreated with anti-mouse CD3ε antibody. The medium was RPMI-1640 medium supplemented with 10% fetal bovine serum, 50 μM 2-mercaptoethanol, 0.1% penicillin-streptomycin, 2 ng / mL IL-2, 2.5 ng / mL IL-7, 50 ng / mL IL-15, and 1 μg / mL anti-mouse CD28. The plates were incubated at 37°C and 5% CO2 for 48 h to activate the cells.
[0097] Activated mouse CD8 + T cells were supplemented with the aforementioned prepared AAV.APR31 or AAV6 with an MOI of 100, 1000, 10000, 50000 or 100000, while cells without AAV were used as a negative control, and cultured at 37°C and 5% CO2.
[0098] After 16 hours, the culture medium was replaced with fresh complete medium. After 48 hours of AAV infection, the EGFP positivity rate was analyzed by flow cytometry.
[0099] As shown in Figure 9, AAV.APR31 also exhibits superior infection performance compared to AAV6 in mouse T cells.
[0100] Therefore, it can be seen that AAV capsid proteins with mutations as shown in any of SEQ ID NO: 1-517 at amino acid residues 454-460 of the amino acid sequence shown in SEQ ID NO: 1 can endow AAV with stronger cell invasion performance, and are especially suitable for T cell invasion.
[0101] Example 3: Achieving efficient site-specific integration of AAV.APR31-mediated DNA at different sites in the human T cell genome. Peripheral blood mononuclear cells (PBMCs) from healthy individuals were purchased from Miaoshun Biotechnology or Heyousheng Biotechnology.
[0102] 1. Achieving efficient site-specific integration of AAV.APR31-mediated DNA at the TRAC site.
[0103] Based on the AAV capsid protein mutants with the amino acid sequences shown in SEQ ID NO: 3 (APR01), 4 (APR20), 5 (APR21), 6 (APR22), 7 (APR23), 8 (APR24), and 2 (APR31), AAV capsid protein mutant plasmids AAV.APR01, 20, 21, 22, 23, 24, 30, and 31 were prepared using pRepCap6 (i.e., AAV6) plasmid as the backbone plasmid. Using the sequence pLY154 shown in SEQ ID NO: 26 as the backbone plasmid, the sequence shown in SEQ ID NO: 16 was inserted into the MluI and RsrII restriction sites to prepare a plasmid containing the EGFP expression cassette LHA-EFS-EGFP-PolyA-RHA, and the sequence was inserted into SEQ ID NO: 16. The sequence shown in NO:17 was used to prepare a plasmid containing the CD22-CAR expression cassette LHA-EFS-CD22-CAR-PolyA-RHA. The prepared plasmid was co-transfected with the pAdDeltaF6 helper plasmid into 293T cells for packaging to obtain the corresponding serotypes of EGFP virus AAV.APR31 EGFP and CD22-CAR virus AAV.APR01, 20, 21, 22, 23, 24, 30, 31CD22-CAR. Wild-type AAV6 EGFP and AAV6 CD22-CAR were packaged as controls.
[0104] PBMCs were cultured at 37°C and 5% CO2 in X-VIVO medium. TM 15. Culture medium supplemented with 5% fetal bovine serum, 50 μM 2-mercaptoethanol, 100 U / mL IL-2, 5 ng / mL IL-7, and 5 ng / mL IL-15, with ImmunoCult added at a concentration of 25 μL / mL culture medium. TM Human CD3 / CD28 / CD2 T cell activator activated for 48 hours;
[0105] Electroporation was performed using the ThermoFisher Neon transfection system, with 5×10⁻⁶ cells / mL. 5 One activated T cell was resuspended in 10 μL Neon TM Mix the RNP complex with Buffer R (catalog number MPK1096) that comes with the transfection system kit.
[0106] The RNP was prepared by mixing 1 μg sgRNA with 0.3 μL 61 mM Cas9 protein (IDT, catalog number 1081059) and 0.2 μL Buffer R, and incubating at room temperature for 15 minutes. The sgRNA sequence was TCTTCTCAGCTGGTACACGGC, which was synthesized by Genscript Biotech Co., Ltd.
[0107] 10 μL of cell-RNP mixture was aspirated into the Neon pipette tip, and electroporation was performed with a voltage of 1600 V, a single pulse of 10 ms, and three pulses.
[0108] Immediately after electroporation, the cells were transferred to preheated X-VIVO. TM 15 Complete culture medium was added with the aforementioned prepared AAV.APR31 EGFP or AAV6 EGFP at an MOI of 250, 500, 750 or 1000, and cells without added AAV were used as a negative control. The cells were cultured at 37°C and 5% CO2.
[0109] After 16 hours, the culture medium was replaced with fresh complete medium and cultured for another 5 days. Before flow cytometry analysis, the cells were incubated with APC anti-human CD3 antibody on ice for 30 minutes. After washing with PBS, the EGFP positivity rate was analyzed by flow cytometry.
[0110] As shown in Figure 10, the site-specific integration efficiency of AAV.APR31 in delivering the EGFP expression cassette can reach over 60%, and even at MOI=250, it can reach 40%, far exceeding the 5.3% of the AAV6 group.
[0111] Based on the aforementioned experimental steps, PBMCs from different donor sources (Donor 300F, Donor E) were used in the experiments. After electroporation, the PBMCs were replaced with the aforementioned prepared AAV.APR01, 20, 21, 22, 23, 24, 30, 31CD22-CAR or AAV6CD22-CAR with MOIs of 250, 500, 750 or 1000. The culture medium was replaced with fresh complete medium 16 h after infection and cultured for another 5 days.
[0112] After collecting and washing T cells, they were incubated with CD22-Fc protein on ice for 30 min. After washing with PBS, PE anti-human IgG Fc antibody and APC anti-human CD3 antibody diluted 1:200 were added and incubated on ice for another 30 min. After washing with PBS, the CD22-CAR positivity rate was detected by flow cytometry.
[0113] As shown in Figure 11, the site-specific integration efficiency of AAV.APR31 in delivering the CD22-CAR expression cassette reached 60% at MOI=750, which is much higher than the 10% of AAV6. The site-specific integration efficiency was also close to 20% at MOI=100, while almost no CD22-CAR positive cells were detected in the AAV6 group.
[0114] Based on the aforementioned experimental steps, the experiment was modified to not activate PBMC cells. After electroporation, PBMC cells were supplemented with the aforementioned prepared AAV.APR31 CD22-CAR or AAV6 CD22-CAR with an MOI of 250, 500, 750, or 1000. After 16 hours of infection, the culture medium was replaced with fresh complete medium, and the cells were cultured for another 5 days.
[0115] After collecting and washing the cells, they were incubated with CD22-Fc protein on ice for 30 min. After washing with PBS, PE anti-human IgG Fc antibody and APC anti-human CD3 antibody diluted 1:200 were added and the cells were incubated on ice for another 30 min. After washing with PBS, the CD22-CAR positivity rate was detected by flow cytometry.
[0116] As shown in Figure 12, at MOI=1000, the site-specific integration efficiency of AAV.APR31 delivering the CD22-CAR expression frame reached 35.8%, while the integration efficiency of AAV6 was only 2.9%.
[0117] 2. Achieving efficient site-specific integration of AAV.APR31-mediated DNA at the TRBC1 site.
[0118] Based on the AAV capsid protein mutant with the amino acid sequence shown in SEQ ID NO: 2, an AAV.APR31 mutant plasmid was prepared using pRepCap6 (i.e., AAV6) plasmid as the backbone plasmid. Using the pLY154 plasmid with the sequence shown in SEQ ID NO: 26 as the backbone plasmid, the sequence shown in SEQ ID NO: 18 was inserted into the MluI and RsrII restriction sites to prepare a plasmid containing the CD22-CAR expression cassette LHA-EFS-CD22-CAR-PolyA-RHA. The plasmids prepared above were co-transfected with the pAdDeltaF6 helper plasmid into 293T cells for packaging to obtain the corresponding serotype CD22-CAR virus AAV.APR31 CD22-CAR. At the same time, wild-type AAV6 CD22-CAR was packaged as a control.
[0119] PBMCs were cultured at 37°C and 5% CO2 in X-VIVO medium. TM 15. Culture medium supplemented with 5% fetal bovine serum, 50 μM 2-mercaptoethanol, 100 U / mL IL-2, 5 ng / mL IL-7, and 5 ng / mL IL-15, with ImmunoCult added at a concentration of 25 μL / mL culture medium. TM Human CD3 / CD28 / CD2 T cell activator activated for 48 hours;
[0120] Electroporation was performed using the ThermoFisher Neon transfection system, with 5×10⁻⁶ cells / mL. 5 One activated T cell was resuspended in 10 μL Buffer R and mixed with a pre-prepared RNP complex.
[0121] The RNP was prepared by mixing 1 μg sgRNA with 0.3 μL 61 mM Cas9 protein and 0.2 μL Buffer R, and incubating at room temperature for 15 minutes. The sgRNA sequence was CAAACACAGCGACCTCGGGT, which was synthesized by Genscript Biotech Co., Ltd.
[0122] 10 μL of cell-RNP mixture was aspirated into the Neon pipette tip, and electroporation was performed with a voltage of 1600 V, a single pulse of 10 ms, and three pulses.
[0123] Immediately after electroporation, the cells were transferred to preheated X-VIVO. TM 15 cells were cultured in complete medium with the aforementioned prepared AAV.APR31 CD22-CAR or AAV6 CD22-CAR at MOI of 100, 250, 500, 750 or 1000, and cells without added AAV were used as a negative control. The cells were cultured at 37°C and 5% CO2.
[0124] After 16 hours, the culture medium was replaced with fresh complete medium and cultured for another 5 days. After collecting and washing the T cells, they were incubated with CD22-Fc protein on ice for 30 minutes. After washing with PBS, PE anti-human IgG Fc antibody and APC anti-human CD3 antibody diluted 1:200 were added and incubated on ice for another 30 minutes. After washing with PBS, the CD22-CAR positivity rate was detected by flow cytometry.
[0125] As shown in Figure 13, the knock-in efficiency of AAV.APR31 in exon 1 of TRBC1 can reach 20.1% at MOI=250 and 46.9% at MOI=1000, both of which are significantly higher than that of AAV6.
[0126] 3. Achieve efficient site-specific integration of AAV.APR31-mediated DNA at the PDCD1 site.
[0127] Based on the AAV capsid protein mutant with the amino acid sequence shown in SEQ ID NO: 2, an AAV.APR31 mutant plasmid was prepared using pRepCap6 (i.e., AAV6) plasmid as the backbone plasmid. Using the pLY154 plasmid with the sequence shown in SEQ ID NO: 26 as the backbone plasmid, the sequence shown in SEQ ID NO: 19 was inserted into the MluI and RsrII restriction sites to prepare a plasmid containing the CD22-CAR expression cassette LHA-EFS-CD22-CAR-PolyA-RHA. The plasmids prepared above were co-transfected with the pAdDeltaF6 helper plasmid into 293T cells for packaging to obtain the corresponding serotype CD22-CAR virus AAV.APR31 CD22-CAR. At the same time, wild-type AAV6 CD22-CAR was packaged as a control.
[0128] PBMCs were cultured at 37°C and 5% CO2 in X-VIVO medium. TM 15. Culture medium supplemented with 5% fetal bovine serum, 50 μM 2-mercaptoethanol, 100 U / mL IL-2, 5 ng / mL IL-7, and 5 ng / mL IL-15, with ImmunoCult added at a concentration of 25 μL / mL culture medium. TM Human CD3 / CD28 / CD2 T cell activator activated for 48 hours;
[0129] Electroporation was performed using the ThermoFisher Neon transfection system, with 5×10⁻⁶ cells / mL. 5 One activated T cell was resuspended in 10 μL Buffer R and mixed with a pre-prepared RNP complex.
[0130] The RNP was prepared by mixing 1 μg sgRNA with 0.3 μL 61 mM Cas9 protein and 0.2 μL Buffer R, and incubating at room temperature for 15 minutes. The sgRNA sequence was GGCGCCCTGGCCAGTCGTCT, which was synthesized by Genscript Biotech Co., Ltd.
[0131] 10 μL of cell-RNP mixture was aspirated into the Neon pipette tip, and electroporation was performed with a voltage of 1600 V, a single pulse of 10 ms, and three pulses.
[0132] Immediately after electroporation, the cells were transferred to preheated X-VIVO. TM 15 cells were cultured in complete medium with the aforementioned prepared AAV.APR31 CD22-CAR or AAV6 CD22-CAR at MOI of 100, 250, 500, 750 or 1000, and cells without added AAV were used as a negative control. The cells were cultured at 37°C and 5% CO2.
[0133] After 16 hours, the culture medium was replaced with fresh complete medium and cultured for another 5 days. After collecting and washing the T cells, they were incubated with CD22-Fc protein on ice for 30 minutes. After washing with PBS, PE anti-human IgG Fc antibody and APC anti-human CD3 antibody diluted 1:200 were added and incubated on ice for another 30 minutes. After washing with PBS, the CD22-CAR positivity rate was detected by flow cytometry.
[0134] As shown in Figure 14, the knock-in efficiency of AAV.APR31 in exon 1 of PDCD1 is significantly higher than that of AAV6 at MOI = 250-1000.
[0135] 4. Achieving efficient site-specific integration of AAV.APR31-mediated DNA at the GAPDH site.
[0136] Based on the AAV capsid protein mutant with the amino acid sequence shown in SEQ ID NO: 2, an AAV.APR31 mutant plasmid was prepared using pRepCap6 (i.e., AAV6) plasmid as the backbone plasmid. Using the pLY154 plasmid with the sequence shown in SEQ ID NO: 26 as the backbone plasmid, the sequence shown in SEQ ID NO: 20 was inserted into the MluI and RsrII restriction sites to prepare a plasmid containing the BFP expression frame exon8-exon9-Recoded exon9-P2A-BFP-PolyA-exon9. The plasmids prepared above were co-transfected with the pAdDeltaF6 helper plasmid into 293T cells for packaging to obtain the corresponding serotype of BFP virus AAV.APR31 BFP. At the same time, wild-type AAV6 BFP was packaged as a control.
[0137] PBMCs were cultured at 37°C and 5% CO2 in X-VIVO medium. TM 15. Culture medium supplemented with 5% fetal bovine serum, 50 μM 2-mercaptoethanol, 100 U / mL IL-2, 5 ng / mL IL-7, and 5 ng / mL IL-15, with ImmunoCult added at a concentration of 25 μL / mL culture medium. TM Human CD3 / CD28 / CD2 T cell activator activated for 48 hours;
[0138] Electroporation was performed using the ThermoFisher Neon transfection system, with 5×10⁻⁶ cells / mL. 5 One activated T cell was resuspended in 10 μL Buffer R and mixed with a pre-prepared RNP complex.
[0139] The RNP was prepared by mixing 1 μg sgRNA with 0.3 μL 61 mM Cas9 protein and 0.2 μL Buffer R, and incubating at room temperature for 15 minutes. The sgRNA sequence was TCTAGGTATGACAACGAATT, which was synthesized by Qingke Biotechnology Co., Ltd.
[0140] 10 μL of cell-RNP mixture was aspirated into the Neon pipette tip, and electroporation was performed with a voltage of 1600 V, a single pulse of 10 ms, and three pulses.
[0141] Immediately after electroporation, the cells were transferred to preheated X-VIVO. TM 15 cells were cultured in complete medium with the aforementioned prepared AAV.APR31 CD22-CAR or AAV6 CD22-CAR at MOI of 100, 250, 500, 750 or 1000, and cells without added AAV were used as a negative control. The cells were cultured at 37°C and 5% CO2.
[0142] After 16 hours, the culture medium was replaced with fresh complete medium and cultured for another 5 days. The BFP positivity rate was analyzed by flow cytometry. Before flow cytometry analysis, the cells were incubated with APC anti-human CD3 antibody on ice for 30 minutes. After washing with PBS, the BFP positivity rate was detected by flow cytometry.
[0143] As shown in Figure 15, the knock-in efficiency of AAV.APR31 in exon 9 of GAPDH can reach 54.5% at MOI=250 and 73.9% at MOI=1000, both of which are significantly higher than that of AAV6.
[0144] 5. Achieve efficient site-specific integration of AAV.APR31-mediated DNA at both TRAC and GAPDH sites.
[0145] Based on the AAV capsid protein mutant with the amino acid sequence shown in SEQ ID NO: 2, AAV.APR31 mutant plasmids were prepared using pRepCap6 (i.e., AAV6) plasmid as the backbone plasmid. Using the pLY154 plasmid with the sequence shown in SEQ ID NO: 26 as the backbone plasmid, the sequence shown in SEQ ID NO: 21 was inserted into the MluI and RsrII restriction sites to prepare a plasmid with the MSLN-CAR expression cassette LHA-EFS-MSLN-CAR-PolyA-RHA targeting the TRAC site, and the sequence shown in SEQ ID NO: 22 was inserted to prepare a plasmid with the CD22-CAR expression cassette exon8-exon9-Recoded exon9-P2A-CD22-CAR-PolyA-exon9 targeting the GAPDH site. The prepared plasmids were co-transfected with the pAdDeltaF6 helper plasmid into 293T cells for packaging, yielding the corresponding serotypes of the virus AAV.APR31MSLN-CAR and AAV.APR31. CD22-CAR was packaged with wild-type AAV6 MSLN-CAR and AAV6CD22-CAR as controls.
[0146] PBMCs were cultured at 37°C and 5% CO2 in X-VIVO medium. TM 15. Culture medium supplemented with 5% fetal bovine serum, 50 μM 2-mercaptoethanol, 100 U / mL IL-2, 5 ng / mL IL-7, and 5 ng / mL IL-15, with ImmunoCult added at a concentration of 25 μL / mL culture medium. TM Human CD3 / CD28 / CD2 T cell activator activated for 48 hours;
[0147] Electroporation was performed using the ThermoFisher Neon transfection system, with 5×10⁻⁶ cells / mL. 5 One activated T cell was resuspended in 10 μL Buffer R and simultaneously mixed with the aforementioned pre-prepared TRAC and GAPDH site RNP complex.
[0148] 10 μL of cell-RNP mixture was aspirated into the Neon pipette tip, and electroporation was performed with a voltage of 1600 V, a single pulse of 10 ms, and three pulses.
[0149] Immediately after electroporation, the cells were transferred to preheated X-VIVO. TM 15. Add MOI of 250, 500, 750 or 1000 to the complete culture medium.
[0150] a) AAV.APR31 EGFP targeting the TRAC site and AAV.APR31 BFP targeting the GAPDH site, with a viral load ratio of 1:1; or
[0151] b) The viral load ratio of AAV6 EGFP targeting the TRAC site and AAV6 BFP targeting the GAPDH site is 1:1;
[0152] Meanwhile, cells without added AAV were used as a negative control and cultured at 37°C and 5% CO2.
[0153] After 16 hours, the culture medium was replaced with fresh complete medium, and the cells were cultured for another 5 days. The positive rates of EGFP and BFP were then directly analyzed by flow cytometry.
[0154] As shown in Figure 16, at MOI=250, the double knock-in efficiencies mediated by AAV6 and AAV.APR31 were 0.62% and 26.1%, respectively; at MOI=1000, the double knock-in efficiencies were 15.7% and 50.8%, respectively, with the double knock-in efficiency mediated by AAV.APR31 being significantly higher than that of AAV6.
[0155] Based on the aforementioned experimental steps, the MOI was changed to 250, 500, 750, or 1000 after electroporation.
[0156] c) AAV.APR31 MSLN-CAR targeting the TRAC site and AAV.APR31CD22-CAR targeting the GAPDH site, with a viral load ratio of 1:1; or
[0157] d) The viral load ratio of AAV6 MSLN-CAR targeting the TRAC site and AAV6 CD22-CAR targeting the GAPDH site was 1:1.
[0158] Similarly, after 16 hours of infection, the culture medium was replaced with fresh complete medium and cultured for another 5 days. After collecting and washing the T cells, they were first incubated with CD22-FC protein on ice for 30 minutes. After washing with PBS, anti-human IgG-FC, anti-FLAG, and APC anti-human CD3 antibody were added and incubated on ice for another 30 minutes. After washing with PBS, the positive rates of MSLN-CAR and CD22-CAR were detected by flow cytometry.
[0159] As shown in Figure 17, at MOI=250, the double knock-in efficiencies mediated by AAV6 and AAV.APR31 were 0.5% and 34.4%, respectively; at MOI=1000, the double knock-in efficiencies were 9.65% and 40.3%, respectively, with AAV.APR31 also exhibiting superior double knock-in efficiency.
[0160] Example 4: Screening and identification of key factors for AAV.APR31 invasion of human T cells
[0161] 1. Genome-wide CRISPR knockout screening for key factors in AAV.APR31 invasion of human T cells.
[0162] The lentiCas9-Blast plasmid, pMD2.G plasmid, and psPAX2 plasmid were co-transfected into 293T cells to obtain Cas9-Blasticidin lentivirus. After infecting Jurkat and NALM-6 cells with this lentivirus, the cells were screened with blastomycin at concentrations of 5 or 10 μg / mL to obtain stable Cas9-expressing Jurkat-Cas9 and NALM-6-Cas9 cell lines.
[0163] Brunello lentivirus was obtained by co-transfecting 293T cells with Brunello plasmid (Addgene, catalog number 73178), pMD2.G plasmid, and psPAX2 plasmid.
[0164] Transduction of Brunello whole-genome sgRNA libraries into Jurkat-Cas9 and NALM-6-Cas9 cells was performed by directly adding Brunello lentivirus to the cells at a dose of MOI=0.25, with sgRNA coverage of over 750×.
[0165] Three days later, puromycin at a concentration of 1 μg / mL was used for screening to obtain Jurkat-Cas9 mutant library cells and NALM-6-Cas9 mutant library cells;
[0166] Two days later, Jurkat-Cas9 mutant library cells or NALM-6-Cas9 mutant library cells were infected with AAV.APR31 containing EGFP expression cassette packaged in Example 2. After 16 hours, the medium was replaced with fresh medium and cultured for another 48 hours before flow cytometry sorting was performed.
[0167] Using the BD FACS Aria flow cytometry sorting system, cells with 18% low or no EGFP expression (left side) and 18% high EGFP expression (right side) were collected and sorted, as shown in Figure 18. Genomic DNA was extracted from the sorted cells, and the first round of PCR amplification was performed. Primers are shown in Table 7, PCR system is shown in Table 8, and reaction conditions are shown in Table 9.
[0168] Table 7 PCR Primers
[0169] Table 8 First-round PCR reaction system
[0170] Table 9. Conditions for the first round of PCR reaction
[0171] After the first round of PCR, the PCR products of the same sample are combined into one sample and used as a template for the second round of PCR.
[0172] The primers for the second round of PCR were the same as above. The PCR system is shown in Table 10, and the reaction conditions are shown in Table 11.
[0173] Table 10 Second-round PCR reaction system
[0174] Table 11 Conditions for the second round of PCR reaction
[0175] The amplified products were separated by 2% agarose gel electrophoresis, and the fragments of approximately 150 bp in size were purified and recovered using a DNA recovery and purification kit. The recovered products were sequenced and analyzed using the NovaSeq X Plus platform.
[0176] As shown in Figures 19-20, CD7 is the most critical target affecting AAV.APR31 invasion of T lymphocytes and is also a T lymphocyte-specific target. At the same time, some common targets that have been proven to be key targets for AAV invasion of cells were also identified, including KIAA0319L(AAVR), GPR108, TM9SF2, VPS52, VPS51, VPS41, ATP2C1, TRAPPC1, and SLC35B2.
[0177] 2. Cas9 knockout validates key sites of AAV.APR31 infection in human T cells.
[0178] Cas9 RNP electroporation was performed using the ThermoFisher Neon transfection system to knock out AAVS1 (negative control), AAVR (positive control), and CD7.
[0179] Referring to the aforementioned experimental steps, 5×10 5 One activated T cell or Jurkat cell was resuspended in 10 μL Buffer R and mixed with a pre-prepared site RNP complex.
[0180] The RNP was prepared by mixing 1 μg sgRNA with 0.3 μL 61 mM Cas9 protein and 0.2 μL Buffer R, and incubating at room temperature for 15 minutes.
[0181] The AAVS1 sgRNA sequence is GGGGCCACTAGGGACAGGAT; the AAVR sgRNA sequence is GCTTTTGCTTCAGCGTTCTG; the CD7 sgRNA1 sequence is ATGCTCGGACGCCCCACCAA; the CD7 sgRNA2 sequence is CATCATTTACTACGAGGACG; all of the above sgRNAs were synthesized by Genscript Biotech Co., Ltd.
[0182] 10 μL of cell-RNP mixture was aspirated into the Neon pipette tip, and electroporation was performed with a voltage of 1600 V, a single pulse of 10 ms, and three pulses.
[0183] Five days after knocking out all loci in human primary T cells or Jurkat cells by Cas9 RNP electroporation, cells were infected with AAV.APR31 or AAV6 containing the EGFP expression cassette prepared in Example 2 (MOI = 1000). After 16 hours of infection, the cells were replaced with fresh complete culture medium and cultured for another 48 hours before flow cytometry was used to detect the expression level of EGFP.
[0184] As shown in Figure 21, CD7 knockout significantly reduced the ability of AAV.APR31 to infect Jurkat and human primary T cells, further confirming that it is a key target affecting the infectivity of AAV.APR31.
[0185] 3. Antibody blocking to verify key sites of AAV.APR31 infection in human T cells
[0186] Every 5×10 5 Jurkat or human primary T cells were incubated with anti-human CD7 antibody at final concentrations of 0.4, 1, 2, and 4 μg / mL, respectively, on ice for 30 min to block the CD7 epitope. The cells were then infected with AAV.APR31 or AAV6 containing the EGFP expression cassette prepared in Example 2 at an MOI of 1000.
[0187] After 16 hours of infection, the culture medium was replaced with fresh complete medium, and the cells were cultured for another 48 hours before flow cytometry was used to detect the expression level of EGFP.
[0188] As shown in Figure 22, the infection effect of AAV.APR31 on Jurkat and human primary T cells was significantly reduced, showing an effect similar to knockout, further verifying that it is a key target affecting the infection performance of AAV.APR31.
[0189] 4. Structural prediction of AAV.APR31 monomers and analysis of their interaction with CD7 protein.
[0190] The structures of AAV6 and AAV.APR31 capsid protein monomers and CD7 were predicted using AlphaFold 3, and pairwise interactions between the AAV.APR31 capsid protein monomer and CD7 protein were analyzed using ChimeraX software (v1.8). The results are shown in Figure 23. The AAV.APR31 capsid protein monomer and CD7 can form highly interactive and matched spatial domains. The predicted structures of the VR-IV domain of AAV6 and AAV.APR31 capsid proteins and the extracellular segment of CD7 are shown in Figure 24. The conformation of AAV.APR31 is significantly different from that of wild-type AAV6 capsid protein. The replacement of the AAPRANE motif forms a novel VR-IV domain. The specific interaction prediction between VR-IV and the extracellular segment of CD7 is shown in Figure 25. In the core domain of their interaction, the APR motif of the VR-IV domain and CD7 can form a perfect interaction interface.
[0191] The above results reveal the reason why AAV.APR31 efficiently infects CD7-positive cells at the molecular level.
[0192] Example 5: Highly efficient preparation of therapeutic immune cells mediated by AAV.APR31
[0193] 1. Evaluation of the efficiency of therapeutic immune cell preparation
[0194] 1.1 Preparation of therapeutic immune cells based on the CRISPR / Cas9 system
[0195] Based on the AAV capsid protein mutant with the amino acid sequence shown in SEQ ID NO: 2, AAV.APR31 mutant plasmids were prepared using pRepCap6 (i.e., AAV6) plasmid as the backbone plasmid. Using the pLY154 plasmid with the sequence shown in SEQ ID NO: 26 as the backbone plasmid, the sequences shown in SEQ ID NO: 17 (CD22-CAR), 21 (MSLN-CAR), 23 (GD2-CAR), 24 (CD19.20-CAR), and 25 (NY-ESO-1TCR) were inserted into the MluI and RsrII restriction sites to prepare the target gene plasmids. The prepared plasmids were co-transfected with the pAdDeltaF6 helper plasmid into 293T cells for packaging, yielding the corresponding serotypes of the virus AAV.APR31 CD22-CAR, AAV.APR31 MSLN-CAR, AAV.APR31 GD2-CAR, AAV.APR31 CD19.20-CAR, and AAV.APR31... NY-ESO-1 TCR was used, along with wild-type AAV6 CD22-CAR, AAV6 MSLN-CAR, AAV6 GD2-CAR, AAV6 CD19.20-CAR, and AAV6 NY-ESO-1 TCR as controls.
[0196] PBMCs were cultured at 37°C and 5% CO2 in X-VIVO medium. TM 15. Culture medium supplemented with 5% fetal bovine serum, 50 μM 2-mercaptoethanol, 100 U / mL IL-2, 5 ng / mL IL-7, and 5 ng / mL IL-15, with ImmunoCult added at a concentration of 25 μL / mL culture medium. TM Human CD3 / CD28 / CD2 T cell activator activated for 48 hours;
[0197] NK cells were isolated from PBMCs and cultured at 37°C in a 5% CO2 environment in CTS medium. TM NK-Xpander TM The culture medium was supplemented with 5% fetal bovine serum and 500 U / mL IL-2, and subsequent experiments were conducted after 7 days of culture.
[0198] Electroporation was performed using the ThermoFisher Neon transfection system, with 5×10⁻⁶ cells / mL. 5 One activated T cell or NK cell was resuspended in 10 μL Buffer R and mixed with the TRAC Cas9 complex prepared as described in the previous example.
[0199] 10 μL of cell-RNP mixture was aspirated into the Neon pipette tip, and electroporation was performed with a voltage of 1600 V, a single pulse of 10 ms, and three pulses.
[0200] Immediately after electroporation, the cells were transferred to preheated X-VIVO. TM 15 In complete culture medium (CTS for NK cells) TM NK-Xpander TM The culture medium was supplemented with the aforementioned prepared AAV.APR31 MSLN-CAR, AAV.APR31 GD2-CAR, AAV.APR31 CD19.20-CAR, AAV.APR31 NY-ESO-1 TCR, AAV6 MSLN-CAR, AAV6 GD2-CAR, AAV6 CD19.20-CAR, AAV6 NY-ESO-1 TCR (infecting activated T cells), or AAV.APR31 CD22-CAR, AAV6 CD22-CAR (infecting NK cells), with cells without AAV added as a negative control. The cells were cultured at 37°C and 5% CO2.
[0201] After 16 hours of viral incubation, the culture medium was replaced with fresh complete medium, and the cells were cultured for another 5 days. T cells were then collected and washed before incubation with CD22-FC protein and anti-human IgG FC antibody (for CD22-CAR only) or directly with anti-FLAG antibody (for MSLN-CAR, GD2-CAR, CD19.20-CAR). NY-ESO-1 TCR cells were tagged with EGFP and did not require staining. All cells were co-incubated with APC anti-human CD3 antibody. After staining, the cells were washed with PBS, and the CAR positivity rate was detected by flow cytometry.
[0202] As shown in Figures 26-30, at MOI=1000, the efficiency of AAV.APR31-mediated CAR T cell preparation can reach 50-80%, the efficiency of NY-ESO-1 TCR T cell preparation can reach about 40%, and the efficiency of CD22-CAR NK cell preparation can also reach about 40%, all of which are significantly higher than AAV6.
[0203] 1.2 Preparation of therapeutic immune cells based on the Sleeping Beauty transposon system
[0204] Based on the AAV capsid protein mutant with the amino acid sequence shown in SEQ ID NO: 2, an AAV.APR31 mutant plasmid was prepared using pRepCap6 (i.e., AAV6) plasmid as the backbone plasmid. Using pLY017SB_pAAV-U6sg(BbsI)-EFS-Thy1.1-P2A-SB100X plasmid (Addgene Plasmid#192151) as the backbone plasmid, the original sequence was replaced between the BamHI and EcoRI restriction sites and inserted into the sequence shown in SEQ ID NO: 27 to construct the AAV-SB-EFS-EGFP plasmid. Then, AAV.APR31 and AAV-SB-EFS-EGFP were co-transfected with pAdDeltaF6 helper plasmid into 293T for packaging to obtain the corresponding serotype Sleeping Beauty transposon virus AAV.APR31-SB-EGFP, while wild-type AAV6-SB-EGFP was packaged as a control.
[0205] PBMCs were cultured at 37°C and 5% CO2 in X-VIVO medium. TM 15. Culture medium supplemented with 5% fetal bovine serum, 50 μM 2-mercaptoethanol, 100 U / mL IL-2, 5 ng / mL IL-7, and 5 ng / mL IL-15, with ImmunoCult added at a concentration of 25 μL / mL culture medium. TM Human CD3 / CD28 / CD2 T cell activator activated for 48 hours;
[0206] Electroporation was performed using the ThermoFisher Neon transfection system, with 5×10⁻⁶ cells / mL. 5 One activated T cell was resuspended in 10 μL Buffer R and mixed with 300 ng Sleeping Beauty transposase hsSB mRNA (based on the amino acid sequence shown in SEQ ID NO: 28, synthesized by Shanghai Hexincheng Biotechnology Co., Ltd.);
[0207] 10 μL of cell-RNP mixture was aspirated into the Neon pipette tip, and electroporation was performed with a voltage of 1600 V, a single pulse of 10 ms, and three pulses.
[0208] Immediately after electroporation, the cells were transferred to preheated X-VIVO. TM 15 Complete culture medium was added with the aforementioned prepared AAV.APR31-SB-EGFP or AAV6-SB-EGFP at an MOI of 250, 500 or 1000, and cells without added AAV were used as a negative control. The cells were cultured at 37°C and 5% CO2.
[0209] After 16 hours, the culture medium was replaced with fresh complete medium, and the cells were cultured for another 5 days. The T cells were then collected, washed with PBS, and the EGFP positivity rate was detected directly by flow cytometry.
[0210] As shown in Figure 31, the delivery efficiency of AAV.APR31 can reach more than 50% when MOI=250, while that of AAV6 is less than 2%.
[0211] 2. Evaluation of the antitumor properties of therapeutic immune cells
[0212] The antitumor activity of the aforementioned PDCD1 or TRBC1 site CD22-CAR T cells, TRAC site MSLN-CAR T cells, TRAC site GD2-CAR T cells, TRAC site CD19.20-CAR T cells, and luciferase-expressing NALM6-GL, AsPC-1-PL, and U87 MG-PL cancer cells (all provided by the laboratory of Ye Lupeng, Nanjing University) was evaluated:
[0213] In a 96-well plate, inoculate 1×10⁶ cells per well. 5 For the CD22-CAR T cell treatment group, the ratio of CAR T cells to NALM6-GL cells (E:T) was 1:2, 1:5, or 1:10; for the CD19.20-CAR T cell treatment group, the ratio of CAR T cells to NALM6-GL cells (E:T) was 1:1, 1:2, 1:4, 1:8, or 1:16; each condition was performed in quadruplicate.
[0214] In a 96-well plate, each well is inoculated with 2 × 10⁶ seeds. 4 The ratio of MSLN-CAR T cells to AsPC-1-PL cells (E:T) was 1:2, 1:4, 1:8, 1:16, or 1:32; four replicates were set up for each condition.
[0215] In a 96-well plate, each well is inoculated with 2 × 10⁶ seeds. 4 U87 MG-PL cells were seeded at a ratio of GD2-CAR T cells to U87 MG-PL cells (E:T) of 1:1, 1:2, 1:4, 1:8, or 1:16; four replicates were set up for each condition.
[0216] After co-culturing at 37℃ and 5% CO2 for 24 hours, D-luciferin potassium salt with a final concentration of 150 μg / mL was added to each well, and the luminescence intensity of luciferin was measured using a multimode microplate reader.
[0217] As shown in Figure 32, CAR T cells inserted at PDCD-1, TRBC1, and TRAC sites all exhibited strong tumor-killing capabilities, and there was no significant difference between CAR T cells prepared from AAV.APR31 or AAV6.
[0218] 3. Preparation of in vivo CD22-CAR T cells and evaluation of their anti-tumor effects
[0219] Using pscAAV-CAG-GFP plasmid as the backbone plasmid, a self-complementary AAV CAR expression cassette scAAV-CD22-CAR was inserted to obtain the scAAV-CD22-CAR plasmid with the sequence shown in SEQ ID NO: 29. This prepared plasmid was co-transfected with the pAdDeltaF6 helper plasmid and the aforementioned AAV.APR31 mutant plasmid or pRepCap6 (i.e. AAV6) plasmid into 293T for packaging to obtain scAAV.APR31 CD22-CAR and scAAV6 CD22-CAR viruses.
[0220] Female NOG mice aged 8-12 weeks were purchased from Vital River Pharmaceuticals. Each mouse was injected with 1×10⁻⁶ mmol / L via the tail vein. 5 NALM-6-GL cells (provided by Ye Lupeng's laboratory at Nanjing University) were used to establish a malignant hematologic malignancy model. Three days after modeling, all mice were randomly assigned to a human T cell treatment group (T cell only), a human T cell + AAV6 CD22-CAR treatment group (T cell + AAV6), a human T cell + AAV.APR31 CD22-CAR treatment group (T cell + AAV.APR31), and a control group (PBS), with 4 mice in each group.
[0221] Except for the control group mice, all tumor-burdened mice were injected via tail vein with 8 × 10⁸ mg / L of urea solution. 6 Mice were treated with human T cells, followed by human T cells + AAV6 CD22-CAR treatment group and human T cells + AAV.APR31 CD22-CAR treatment group, with a tail vein injection dose of 5 × 10⁻⁶. 11 The corresponding scAAV.APR31 CD22-CAR or scAAV6 CD22-CAR viruses of vg were injected into the tail vein of control mice with the same volume of PBS. Human T cells were obtained by activating healthy human peripheral blood mononuclear cells (PBMCs) purchased from Heyousheng Biotechnology using the same method as described in the previous examples.
[0222] Each mouse received an intraperitoneal injection of 2.5 μg of human IL-2 on days 0 and 3 following T-cell injection. Starting from day 3 post-tumor cell injection, in vivo imaging was performed every two days using the AniView100 multimodal animal in vivo imaging system to assess tumor progression. Before each imaging session, each mouse received an intraperitoneal injection of 100 μL of 3 mg / mL D-fluorescein potassium salt, and in vivo imaging was performed 10 minutes after injection.
[0223] As shown in Figure 33, mice treated with human T cells alone showed no significant difference in tumor progression compared to the control group. The T cell + AAV6 CD22-CAR treatment group showed some early efficacy, but the overall therapeutic effect was not significantly different from the human T cell treatment group. The human T cell + AAV.APR31 CD22-CAR treatment group showed a very significant therapeutic effect compared to the other three groups, with a significant slowdown in tumor progression. This demonstrates that AAV.APR31 can not only efficiently prepare therapeutic immune cells in vitro, but also prepare CAR-T cells in vivo, exhibiting effective anti-tumor effects, providing a novel in vivo delivery technology platform for cell therapy.
Claims
1. An adeno-associated virus capsid protein mutant, characterized in that, The mutant is based on the wild-type adeno-associated virus 6 capsid protein with the amino acid sequence shown in SEQ ID NO: 1, and has an amino acid residue mutation at amino acid residues 454-460 as shown in the XAPRXXX sequence. The specific mutant sequence is as follows:
2. The adeno-associated virus capsid protein mutant according to claim 1, characterized in that, The mutant has an amino acid sequence as shown in any one of SEQ ID NO: 2-13.
3. A recombinant adeno-associated virus capsid, characterized in that, The capsid contains a mutant of the adeno-associated virus capsid protein as described in any one of claims 1-2.
4. A nucleotide sequence, characterized in that, The nucleotide sequence encodes the amino acid sequence of the adeno-associated virus capsid protein mutant of claim 1.
5. A plasmid, characterized in that, The plasmid contains the nucleotide sequence as described in claim 4.
6. A recombinant adeno-associated virus, characterized in that, The recombinant adeno-associated virus contains the recombinant adeno-associated virus capsid as described in any one of claims 3-4, and a functional gene encapsulated by the capsid.
7. The recombinant adeno-associated virus according to claim 6, characterized in that, The functional gene includes a pair of inverted terminal repeat sequences and the target gene between them that can encode one or more products of a therapeutic RNA, a therapeutic protein, a gene editing nuclease and a gene editing guide RNA, a transposon system, a chimeric antigen receptor, a T-cell receptor, a monoclonal antibody, a nanobody, or a single-chain antibody variable region.
8. A pharmaceutical composition, characterized in that, The pharmaceutical composition comprises the recombinant adeno-associated virus of claim 6 as the active ingredient, and pharmaceutically acceptable excipients.
9. The use of the recombinant adeno-associated virus of claim 6 or the pharmaceutical composition of claim 8 in the preparation of a medicament for treating immune-related diseases.
10. The application according to claim 9, characterized in that, The immune-related diseases include cancer, autoimmune diseases, infectious diseases, and tissue / organ fibrosis.
11. The application according to claim 9, characterized in that, The application is in the preparation of therapeutic immune cells.
12. The application according to claim 11, characterized in that, The therapeutic immune cells are any one of chimeric antigen receptor T cells, T cell receptor T cells, or chimeric antigen receptor NK cells.