MMP1-targeting sirna, and composition thereof and use thereof

Abstract

Provided are an MMP1-targeting siRNA, and a composition thereof and the use thereof. The siRNA can efficiently and specifically inhibit expression of the MMP1 gene, thereby inhibiting the generation of matrix metalloproteinase 1 and reducing the degradation of type I and type III fibrillar collagens, and can be used in skin anti-wrinkle drugs or cosmetic compositions.

Description

siRNAs targeting MMP1, their compositions, and applications Technical Field

[0001] This invention belongs to the field of biotechnology, and specifically relates to an siRNA targeting matrix metalloproteinase 1 (MMP1), its composition, and its uses. Background Technology

[0002] Matrix metalloproteinases (MMPs) are zinc-dependent endopeptidases that specifically degrade almost all extracellular matrix (ECM) components, including collagen, elastin, proteoglycans, and fibronectin. In skin tissue, aberrant activation of MMPs leads to excessive degradation of type I and type III collagen fibers and elastin, disrupting the structural integrity and functional stability of the dermis. The degradation of collagen and elastin not only weakens the skin's support and elasticity but also accelerates wrinkle formation, ultimately leading to skin aging. Based on substrate specificity and structural characteristics, matrix metalloproteinases (MMPs) can be divided into five main subgroups: collagenases (MMP-1, MMP-8, MMP-13); gelatinases (MMP-2, MMP-9); mesenchymal lysins (MMP-3, MMP-10, MMP-11); mesenchymal lysins (MMP-7, MMP-26); and membrane-type matrix metalloproteinases (MMP-14, MMP-15, MMP-16, etc.). Matrix metalloproteinase 1 (MMP1), also known as interstitial collagenase or fibroblast collagenase, is encoded by the MMP1 gene located on chromosome 11q22. MMP1 is a multifunctional enzyme that degrades various matrix substrates, especially type I and type III collagen. Type I and type III collagen are the most abundant structural proteins in the dermis; their degradation disrupts the structural integrity of the dermis, leading to decreased skin elasticity and wrinkle formation. Therefore, downregulating MMP1 expression can effectively inhibit the degradation of normal collagen and elastin fibers, thereby reducing wrinkles and delaying skin aging.

[0003] Oligonucleotide therapies, such as antisense oligonucleotides (ASOs) and double-stranded small interfering RNA (siRNAs), have been used to treat many different types of diseases. RNA interference (RNAi)-based therapies have shown particular advantages in the treatment of liver-related diseases. Compared to traditional small molecule drugs, oligonucleotide drugs have a longer duration of action and higher targeting specificity. Summary of the Invention

[0004] The purpose of this invention is to provide a small interfering RNA (siRNA) for inhibiting matrix metalloproteinase 1 (MMP1), its composition, and its uses. The siRNA of this invention, through chemical modification, optimizes its ribose and phosphate ester structures to exhibit anti-nuclease degradation properties and significantly reduces the negative charge carried by the molecule, enhancing its ability to permeate cell membranes. The siRNA of this invention can specifically downregulate the level of intracellular MMP1 mRNA, thereby inhibiting MMP1 synthesis, reducing the degradation of normal collagen and elastin fibers by MMP1, and thus delaying skin wrinkles and aging. It can be added as an active ingredient to cosmetics or anti-wrinkle skin medications for various skin care applications such as anti-wrinkle, firming, and repair, showing broad market application prospects.

[0005] On the one hand, the present invention provides an siRNA or a salt thereof, comprising a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently modified or unmodified, wherein the sense strand contains nucleotide sequence I, the antisense strand contains nucleotide sequence II, and nucleotide sequence I and nucleotide sequence II are at least partially anticomplementary to form a double-stranded region, wherein nucleotide sequence I and nucleotide sequence II are selected from a set of sequences shown in (1)-(39) below:

[0006] (1) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:5 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:43 by no more than 3 (preferably no more than 1) nucleotides:

[0007] (2) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:6 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:44 by no more than 3 (preferably no more than 1) nucleotides:

[0008] (3) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:7 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:45 by no more than 3 (preferably no more than 1) nucleotides:

[0009] (4) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:8 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:46 by no more than 3 (preferably no more than 1) nucleotides:

[0010] (5) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:9 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:47 by no more than 3 (preferably no more than 1) nucleotides:

[0011] (6) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:10 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:48 by no more than 3 (preferably no more than 1) nucleotides:

[0012] (7) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:11 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:49 by no more than 3 (preferably no more than 1) nucleotides:

[0013] (8) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:12 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:50 by no more than 3 (preferably no more than 1) nucleotides:

[0014] (9) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:13 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:51 by no more than 3 (preferably no more than 1) nucleotides:

[0015] (10) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:14 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:52 by no more than 3 (preferably no more than 1) nucleotides:

[0016] (11) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:15 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:53 by no more than 3 (preferably no more than 1) nucleotides:

[0017] (12) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:16 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:54 by no more than 3 (preferably no more than 1) nucleotides:

[0018] (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:17 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:55 by no more than 3 (preferably no more than 1) nucleotides:

[0019] (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:18 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:56 by no more than 3 (preferably no more than 1) nucleotides:

[0020] (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:19 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:57 by no more than 3 (preferably no more than 1) nucleotides:

[0021] (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:20 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:58 by no more than 3 (preferably no more than 1) nucleotides:

[0022] (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:21 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:59 by no more than 3 (preferably no more than 1) nucleotides:

[0023] (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:22 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:60 by no more than 3 (preferably no more than 1) nucleotides:

[0024] (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:23 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:61 by no more than 3 (preferably no more than 1) nucleotides:

[0025] (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:24 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:62 by no more than 3 (preferably no more than 1) nucleotides:

[0026] (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:25 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:63 by no more than 3 (preferably no more than 1) nucleotides:

[0027] (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:26 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:64 by no more than 3 (preferably no more than 1) nucleotides:

[0028] (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:27 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:65 by no more than 3 (preferably no more than 1) nucleotides:

[0029] (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:28 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:66 by no more than 3 (preferably no more than 1) nucleotides:

[0030] (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:29 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:67 by no more than 3 (preferably no more than 1) nucleotides:

[0031] (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:30 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:68 by no more than 3 (preferably no more than 1) nucleotides:

[0032] (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:31 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:69 by no more than 3 (preferably no more than 1) nucleotides:

[0033] (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:32 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:70 by no more than 3 (preferably no more than 1) nucleotides:

[0034] (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:33 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:71 by no more than 3 (preferably no more than 1) nucleotides:

[0035] (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:34 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:72 by no more than 3 (preferably no more than 1) nucleotides:

[0036] (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:35 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:73 by no more than 3 (preferably no more than 1) nucleotides:

[0037] (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:36 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:74 by no more than 3 (preferably no more than 1) nucleotides:

[0038] (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:37 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:75 by no more than 3 (preferably no more than 1) nucleotides:

[0039] (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:38 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:76 by no more than 3 (preferably no more than 1) nucleotides:

[0040] (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:39 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:77 by no more than 3 (preferably no more than 1) nucleotides:

[0041] (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:40 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:78 by no more than 3 (preferably no more than 1) nucleotides:

[0042] (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:18 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:79 by no more than 3 (preferably no more than 1) nucleotides:

[0043] (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:41 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:80 by no more than 3 (preferably no more than 1) nucleotides:

[0044] (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:42 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:81 by no more than 3 (preferably no more than 1) nucleotides:

[0045] In some embodiments, the siRNA has a combination of sense and antisense strands selected from the following combinations:

[0046] In some embodiments, each nucleotide in the siRNA of the present invention is independently a modified or unmodified nucleotide.

[0047] In some embodiments, the siRNA of the present invention may comprise at least one modified nucleotide and / or at least one interstrand modification.

[0048] In some implementations, all nucleotides on the positive strand are modified nucleotides.

[0049] In some implementations, all nucleotides on the antisense strand are modified nucleotides.

[0050] In some implementations, substantially all nucleotides of the sense and antisense strands are modified nucleotides.

[0051] In some implementations, all nucleotides of the sense strand and all nucleotides of the antisense strand are modified nucleotides.

[0052] The modified nucleotides include, but are not limited to, nucleotides modified with 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP, iB, etc.

[0053] 2'-F, 2'-OME, and 2'-MOE modifications refer to the substitution of the 2' hydroxyl group of the furanyl ring of the nucleotide by fluorine (F), methoxy (OMe), or methoxyethoxy (MOE), respectively. iB refers to the reverse abase-free nucleotide, GNA modification refers to ethylene glycol nucleic acid nucleotide, and UNA modification refers to open-ring ribonucleotide and / or ethylene glycol nucleic acid nucleotide. UNA and GNA are thermally unstable chemical modifications that can improve siRNA off-target effects (MKSchlegel et al., J.Am.Chem.Soc.139,8537-8546(2017)).

[0054] PNA modification refers to peptide nucleic acids, where the glycosyl backbone of RNA is replaced with an amide-containing backbone. It is a type of DNA analog where the glycosyl backbone is replaced by a polypeptide backbone. Literature reports that replacing a single phosphodiester bond at position 2-7 of the seed region of the antisense strand with an amide bond of PNA can effectively inhibit off-target side effects caused by microRNA (M. Richter et al., ACS Chem. Biol. 18, 7-11 (2022)).

[0055] 5'-VP modification refers to the modification of the 5' end of siRNA with vinyl-phosphate.

[0056] The interchain modifications mentioned include, but are not limited to, modifications such as thiophosphate, -OEt, and -OMe. Thiophosphate modification refers to a non-bridging oxygen (=O or -O) in the phosphate backbone. - The hydrogen atom of the hydroxyl group on the phosphate backbone is replaced by a sulfur atom (S). The -OEt modification refers to the hydrogen atom of the hydroxyl group on the phosphate backbone being replaced by an ethyl atom, and the -OMe modification refers to the hydrogen atom of the hydroxyl group on the phosphate backbone being replaced by a methyl atom.

[0057] In some embodiments, the antisense strand of the siRNA of the present invention may contain 0 to 5 (e.g., 1, 2, 3, 4, especially 2) 3' pendant nucleotides, and in some embodiments, the 3' pendant nucleotides are A, T, C, G, or U.

[0058] In some embodiments, the siRNA of the present invention has a structure selected from the following: Note: Uppercase letters A, C, G, and U represent the base composition of nucleotides; lowercase letter m indicates that the nucleotide adjacent to the left of letter m is a nucleotide modified with 2′-methoxy; lowercase letter f indicates that the nucleotide adjacent to the left of letter f is a nucleotide modified with 2′-fluorine; Ps indicates that the connection between two adjacent nucleotides is a phosphate thioester linkage.

[0059] In a preferred embodiment, the double-stranded siRNA is numbered DG013-37.1, with its sense strand being UmPsAmPsAmCmCmUmUfUfGfAmUmGmCmUmAmUmAmAmCm and its antisense strand being GmPsUfPsUmAmUfAfGfCmAmUmCmAmAmAfGmGfUmUmUmAmPsUmPsUm.

[0060] In another aspect, the present invention provides a composition comprising siRNA or a salt thereof provided herein and optionally a carrier acceptable in cosmetics or pharmaceuticals.

[0061] An acceptable carrier in a cosmetic or pharmaceutical product refers to any carrier, diluent, or excipient that is compatible with the siRNA or its salts and other components and is harmless to the user.

[0062] In some embodiments, excipients include, but are not limited to, microcrystalline cellulose, magnesium stearate, calcium stearate, any acceptable sugar (e.g., mannose, xylitol), and oil excipients.

[0063] In some embodiments, the carrier is selected from one or more of hydrocarbon oils, esters, higher fatty acids, and higher fatty alcohols. The hydrocarbon oil refers to an oily substance of hydrocarbon composition, examples of which include, but are not limited to, mineral oil, petrolatum, isoalkanes (such as isohexadecane), and polyisobutylene. The ester refers to an ester compound formed by the condensation of fatty acids and alcohols, examples of which include, but are not limited to, isopropanol palmitate, caprylic / capric triglyceride, isopropyl stearate, caprylic / capric isopropyl ester, and hexadecyl ethylhexanoate. The higher fatty acid refers to fatty acids with a carbon chain length of C12 or longer, examples of which include, but are not limited to, stearic acid, palmitic acid, oleic acid, and linoleic acid. The higher fatty alcohol refers to fatty alcohols with a relatively long carbon chain, examples of which include, but are not limited to, cetyl alcohol, stearyl alcohol, hexadecyl alcohol, and octyldodecyl alcohol.

[0064] In some embodiments, the carrier is a delivery carrier selected from one or more of, for example, ionic liquids, liposomes, carbomers, lipid nanoparticles, hyaluronic acid, etc., so that the siRNA can reach target areas inside or deep within the skin via the delivery carrier.

[0065] In some embodiments, the ionic liquid is a choline-based ionic liquid. The cation of the choline-based ionic liquid comprises a choline cation, and the anion is a carboxylic acid anion, particularly an amino acid or α-hydroxy acid anion. More particularly, the ionic liquid comprises a choline cation and a choline-acid anion. Still particularly, the ionic liquid is a choline-acid ionic liquid.

[0066] The compositions described herein may be provided in any cosmetic and / or dermatologically suitable form (e.g., emulsion, cream, mousse, gel, foam, lotion, mask, ointment, balm, solution, serum, spray, face mask, etc.).

[0067] The siRNA or its salts and compositions thereof of the present invention can inhibit the expression of matrix metalloproteinase 1 (MMP1), thereby inhibiting the synthesis of MMP1, reducing the degradation of normal collagen and elastic fibers by MMP1, and thus delaying skin wrinkles and aging.

[0068] The actual dose level of siRNA or its salt in the composition can be varied to obtain an amount of siRNA or its salt that provides satisfactory results for a particular user without producing toxicity or side effects.

[0069] In another aspect, the present invention provides the use of the above-mentioned siRNA or its salt or the above-mentioned composition in the preparation of pharmaceuticals or cosmetics.

[0070] When the siRNA of the present invention is applied to the skin, it enables the oligonucleotide drug to penetrate the stratum corneum of the skin at a certain rate, delivering the oligonucleotide to the epidermis and dermis, and simultaneously transporting the oligonucleotide into the skin cells, thereby exerting the effect of the oligonucleotide.

[0071] The oligonucleotides described herein can be synthesized using a phosphorus amide solid-phase synthesis method well-known in the art. Nucleoside monomers are sequentially linked in the 3′ to 5′ direction according to the nucleotide types and sequence of the oligonucleotides. The linkage of each nucleoside monomer involves the same cycle, including four steps: deprotection, coupling, capping, and oxidation or sulfidation. The synthesized sense strand and the antisense strand synthesized using the same method are annealed to form a double-stranded siRNA.

[0072] In some specific implementation schemes, the concentration of the nucleoside monomer in acetonitrile solution can be 0.01–0.10 mol / L.

[0073] In the deprotection step, the deprotecting agent can be selected from one or more of trifluoroacetic acid, trichloroacetic acid, dichloroacetic acid, and monochloroacetic acid. In some embodiments, the deprotecting agent is dichloroacetic acid. The deprotecting agent can be dissolved in a suitable organic solvent. A suitable organic solvent is dichloromethane. In some embodiments, deprotection is performed using a dichloromethane solution of the deprotecting agent, and the concentration of the deprotecting agent in the solution can be 1–5% (v / v). Typically, 1–5 deprotection treatments can be performed, with each reaction time being 20–40 seconds.

[0074] In this document, the coupling agent used in the coupling step may be selected from one or more of 1H-tetrazole, 5-ethylthio-1H-tetrazole, and 5-benzylthio-1H-tetrazole. In some embodiments, the coupling agent is 5-ethylthio-1H-tetrazole. The coupling agent may be dissolved in a suitable organic solvent. In some embodiments, the organic solvent is acetonitrile. In some embodiments, coupling is performed using an acetonitrile solution of the coupling agent, and the concentration of the coupling agent in the solution may be 0.1 to 0.5 mol / L. The coupling reaction may be carried out 1 to 5 times, and the reaction time for each reaction may be 1 to 5 minutes. The coupling reaction may be carried out in an organic solvent. Suitable organic solvents include, but are not limited to, one or more of anhydrous acetonitrile, anhydrous DMF, and anhydrous dichloromethane. In some embodiments, the organic solvent is anhydrous acetonitrile.

[0075] In this paper, the capping step can be performed in an acetic anhydride-acetonitrile solution and an N-methylimidazole / pyridine / acetonitrile solution. In the acetic anhydride-acetonitrile solution, the concentration of acetic anhydride can be 10–30% (v / v). In the N-methylimidazole / pyridine / acetonitrile solution, the volume concentration of N-methylimidazole can be 15–25%, the volume concentration of pyridine can be 25–35%, and the volume concentration of acetonitrile can be 45–55%. The capping process can be performed 1–3 times.

[0076] In this paper, the oxidation step can be performed using an aqueous solution of iodine in pyridine (90 / 10, v / v) at a concentration of 0.01–0.10 mol / L, and the thiolation step can be performed using a solution of 5-imino-1,2,4-dithiazolidin-3-thione in pyridine at a concentration of 0.10–0.30 mol / L. The thiolation can be carried out 1–3 times.

[0077] After the last nucleoside is ligated, ammonolysis is performed. Ammonolysis can separate the conjugate from the solid support. In the ammonolysis step, concentrated ammonia (e.g., 25–28%) can be mixed with the reaction product, and the mixture is reacted at 60–80°C for 1–8 hours. The mixture is then filtered to obtain a filtrate containing the conjugate. This filtrate can be concentrated to obtain the crude product.

[0078] If at least one 2′-TBDMS protection is present on the synthesized nucleotide sequence, the 2′-TBDMS protection needs to be removed. The reagent used for removal can be triethylamine hydrofluoric acid. In some embodiments, the filtrate or crude product is contacted with an N-methylimidazole / triethylamine hydrofluoric acid / triethylamine solution and reacted at 60–70°C for 1–4 hours. In the N-methylimidazole / triethylamine hydrofluoric acid / triethylamine solution, the volume percentages of N-methylimidazole, triethylamine hydrofluoric acid, and triethylamine can be 55–65%, 25–35%, and 35–45%, respectively.

[0079] After deprotection, purification and desalting can be performed. Methods well-known in the art can be used for purification and desalting. For example, preparative ion chromatography columns can be used to elute nucleic acids using a gradient of NaBr or NaCl; after product collection and pooling, desalting can be performed using reversed-phase chromatography columns. Fractions with a purity greater than 95% are collected, concentrated, and dried.

[0080] The sense and antisense strands can be prepared separately using the above method, then mixed and annealed to prepare the siRNA or its salt of the present invention. Typically, the sense and antisense strands are dissolved separately in PBS solution, then the two PBS solutions are mixed and annealed. The molar ratio of the sense and antisense strands can be 1–1.2:1. Annealing can be performed at 83–87°C for 3–5 minutes. After annealing, the mixture can be naturally cooled to room temperature and lyophilized if necessary.

[0081] In another aspect, the present invention provides the above-mentioned siRNA or its salt or the above-mentioned composition for use in the preparation of pharmaceuticals or cosmetics, or for inhibiting the expression of MMP1, or for skin anti-wrinkle, firming and repair.

[0082] In another aspect, the present invention provides a method for inhibiting MMP1 expression, or a method for skin anti-wrinkle, firming and repair, the method comprising applying the siRNA or its salt or the above-described composition according to the present invention to an object or skin in need. Attached Figure Description

[0083] Figure 1 shows the results of the inhibition of MMP1 mRNA expression in the HT1080 cell line by the naked siRNA sequence in Table 1.

[0084] Figure 2 shows the results of the inhibition of MMP1 mRNA expression in the HT1080 cell line by the siRNA chemical modification sequences in Table 2.

[0085] Figure 3 shows the effect of DG013-37.1 knockdown of MMP1 on collagen content in primary mouse dermal fibroblasts.

[0086] Figure 4 shows a comparison experiment of the stability of unmodified DG013-37 and chemically modified DG013-37.1 against nucleases. Detailed Implementation

[0087] To enable those skilled in the art to understand the features and effects of the present invention, the terms and expressions used in the specification and claims are explained and defined in general below. Unless otherwise specified, all technical and scientific terms used herein have the ordinary meaning understood by those skilled in the art regarding the present invention, and in case of conflict, the definitions in this specification shall prevail.

[0088] The theories or mechanisms described and disclosed herein, whether right or wrong, should not in any way limit the scope of the invention, that is, the contents of the invention can be implemented without being limited by any particular theory or mechanism.

[0089] In this document, the terms “contains,” “includes,” “containing,” and similar terms encompass the meanings of “basically composed of” and “composed of.” For example, when this document discloses “A contains B and C,” “A is basically composed of B and C” and “A is composed of B and C” should be considered as having been disclosed in this document.

[0090] In this document, all features defined by numerical ranges or percentage ranges, such as numerical values, quantities, contents, and concentrations, are for the sake of brevity and convenience only. Accordingly, descriptions of numerical ranges or percentage ranges should be considered as covering and specifically disclosing all possible sub-ranges and individual numerical values ​​(including integers and fractions) within those ranges.

[0091] In this document, when describing embodiments or examples, it should be understood that it is not intended to limit the invention to those embodiments or examples. Rather, all alternatives, modifications, and equivalents of the methods and materials described herein are covered within the scope defined by the claims.

[0092] For the sake of brevity, not all possible combinations of the technical features in each implementation scheme or embodiment are described herein. Therefore, as long as there is no contradiction in the combination of these technical features, the technical features in each implementation scheme or embodiment can be combined arbitrarily, and all possible combinations should be considered within the scope of this specification.

[0093] the term

[0094] Unless otherwise defined, all technical terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which the subject matter of the claims pertains. Unless otherwise stated, all patents, patent applications, and publications cited in this document are incorporated herein in their entirety through reference.

[0095] It should be understood that the above summary and the following detailed description are exemplary and for illustrative purposes only, and do not limit the subject matter of this disclosure. In this application, unless specifically stated otherwise, the singular is used to include the plural. It must be noted that unless clearly stated otherwise, the singular form used in this specification and claims includes the plural form of the referred to. It should also be noted that unless otherwise stated, the use of “or” or “or” means “and / or”. Furthermore, the use of the term “comprising” and other forms such as “including,” “containing,” and “containing” are not limiting and can be open-ended, semi-closed, or closed. In other words, the term also includes the meaning of “consistently made of” or “made of.”

[0096] Unless specifically defined herein, the terminology used in the relevant descriptions of analytical chemistry, organic synthetic chemistry, and pharmaceutical and medicinal chemistry is known in the art. Standard techniques can be used in chemical synthesis, chemical analysis, drug preparation, formulation and delivery, and in the treatment of patients. For example, reactions and purifications can be carried out using the manufacturer's instructions for use of kits, or in accordance with methods known in the art or the descriptions in this disclosure. The techniques and methods described herein can generally be carried out according to conventional methods well known in the art, based on the descriptions in several summary and more specific documents cited and discussed in this specification. In this specification, groups and their substituents can be selected by those skilled in the art to provide stable structural moieties and compounds.

[0097] The chapter headings used in this document are for organizational purposes only and should not be construed as limiting the subject matter. All references or portions thereof cited in this application, including but not limited to patents, patent applications, articles, books, manuals, and papers, are incorporated herein by reference in their entirety.

[0098] All numerical ranges mentioned in this disclosure refer to the range including its two endpoints, all integers within the range, and subranges formed by these integers.

[0099] In this disclosure, "composition" refers to a formulation of the siRNA of this disclosure, or its salts, in combination with a medium generally accepted in the art for delivering biologically (pharmacologically) active compounds to mammals (e.g., humans). This medium includes carriers or excipients acceptable in cosmetics or pharmaceuticals. The purpose of the composition is to facilitate administration to the organism, thereby promoting the absorption of the active ingredient and the exertion of its biological (pharmacological) activity. Generally, the compositions of this disclosure contain 0.1% to 99.5% by weight of a cosmetic or pharmaceutical active ingredient (i.e., the siRNA of this disclosure, or its salts). In some embodiments, the compositions of this disclosure contain 0.5% to 90% by weight, for example, 1% by weight, 1.5% by weight, 2% by weight, 5% by weight, 10% by weight, 15% by weight, 20% by weight, 25% by weight, 30% by weight, or 50% by weight of the cosmetic or pharmaceutical active ingredient.

[0100] As used herein, the term "acceptable in cosmetics or pharmaceuticals" means a substance (such as a carrier or diluent) that does not affect the biological activity or properties of the siRNA or its salts disclosed herein, and is relatively non-toxic, meaning that the substance can be administered to an individual without causing an adverse biological reaction or interacting adversely with any component contained in the composition.

[0101] In this disclosure, "acceptable carriers in cosmetics or pharmaceuticals" include, but are not limited to, any adjuvants, carriers, excipients, flow aids, sweeteners, diluents, preservatives, dyes / colorants, flavoring agents, surfactants, wetting agents, dispersants, suspending agents, stabilizers, isotonic agents, solvents, or emulsifiers that are permitted by the relevant government regulatory authorities to be acceptable for human or livestock use.

[0102] Example

[0103] Example 1: Synthesis of siRNA reagent

[0104] Using human MMP1 gene (SEQ ID NO:1, SEQ ID NO:2), cynomolgus monkey MMP1 gene (SEQ ID NO:3), and mouse MMP1 gene (SEQ ID NO:4) as target genes, 19 / 21nt siRNAs were designed to meet the general rules of active siRNAs, and siRNAs with homology between human MMP1 siRNA and mouse, rat, or monkey gene sequences were screened as the siRNA set to be screened.

[0105] This invention efficiently screened out 39 pairs of siRNAs targeting MMP1, and their nucleic acid sequences are listed in Table 1.

[0106] Table 1. Sensitive and antisense strand sequences of unmodified MMP1siRNA.

[0107] Table 2. Antisense and sense strand sequences of the chemically modified MMP1siRNA of this invention. Note: Uppercase letters A, C, G, and U represent the base composition of nucleotides; lowercase letter m indicates that the nucleotide adjacent to the left of letter m is a nucleotide modified with 2′-methoxy; lowercase letter f indicates that the nucleotide adjacent to the left of letter f is a nucleotide modified with 2′-fluorine; Ps indicates that the connection between two adjacent nucleotides is a phosphate thioester linkage.

[0108] The MMP1siRNA reagent duplexes shown in Tables 1 and 2 above were synthesized according to the following general method.

[0109] 1. Synthesis of the Justice Chain (SS Chain) and the Antisense Chain (AS Chain)

[0110] The solid-phase phosphoramide synthesis method utilizes blank aminosilanized microporous glass spheres (CPG) as the starting cycle. Nucleoside monomers are sequentially linked from the 3′ to the 5′ direction according to the nucleotide sequence. The linking of each nucleoside monomer involves the same cycle, including four steps: deprotection, coupling, capping, oxidation, or sulfidation.

[0111] The synthesis conditions for oligonucleotides with a synthesis scale of 500 nmol are as follows: the nucleoside monomer is prepared into a 0.04 mol / L acetonitrile solution, and then... The molecular sieve was dried, and the reaction conditions were identical for each step. The deprotection agent was a 3% dichloroacetic acid solution in dichloromethane, deprotected three times, with a reaction time of 30 seconds. The coupling agent was a 0.25 mol / L acetonitrile solution of 5-ethylthio-1H-tetrazole, coupled three times, with a reaction time of 3 minutes. The coupling reaction was carried out in anhydrous acetonitrile. Capping was performed twice using a 20% acetic anhydride-acetonitrile solution and an N-methylimidazolium / pyridine / acetonitrile solution (20 / 30 / 50, v / v / v); oxidation was performed twice using a 0.05 mol / L pyridine / water solution of iodine (90 / 10, v / v); thiolation was performed twice using a 0.20 mol / L 5-imino-1,2,4-dithiazolidin-3-thione / pyridine solution.

[0112] 2. Purification and annealing of oligonucleotides

[0113] 2.1 Ammonolysis

[0114] The CPG carrier that has completed the synthesis step was added to a 5 mL centrifuge tube, and 1 mL of 25%–28% concentrated ammonia solution was added. The mixture was heated in a forced-air oven at 80°C for 2 hours or at 60°C for 6 hours. After filtration, the solid carrier was washed three times with water. The filtrate was concentrated using a concentrator to obtain the crude product for further purification.

[0115] 2.2 Deprotection

[0116] When at least one 2′-TBDMS protection exists on the synthesized nucleotide sequence, the method further includes contacting the crude product after the ammonolysis step with triethylamine hydrofluoric acid to remove the 2′-TBDMS protection. The deprotection reagent uses an N-methylimidazole / triethylamine hydrofluoric acid / triethylamine solution (6 / 3 / 4, v / v / v) and reacts at 65°C for 2.5 hours.

[0117] 2.3 Purification

[0118] Purification and desalting methods are well known to those skilled in the art. For example, nucleic acids can be purified using a preparative ion chromatography column with gradient elution of NaBr or NaCl; after the products are collected and combined, desalting can be performed using a reversed-phase chromatography column. The fraction with a purity greater than 95% is collected, concentrated, dried, and prepared into a 100 μM PBS solution.

[0119] 2.4 Annealing

[0120] In a centrifuge tube, the PBS solution containing the sense strand (SS strand) and the antisense strand (AS strand) was mixed at a molar ratio (SS strand / AS strand = 1.1 / 1), heated to 85°C, held for 3-5 minutes, and then allowed to cool naturally to room temperature. The system was then freeze-dried to obtain the product.

[0121] Example 2: In vitro screening of MMP1 siRNA duplexes

[0122] Human cell line HT1080 (purchased from the Cell Bank of the Chinese Academy of Sciences) was selected for experiments to detect the inhibitory effect of siRNA on MMP1 expression, as shown in Table 1. The experimental steps were as follows: HT1080 cells were trypsinized, adjusted to an appropriate density, and seeded into 48-well cell culture plates. The cells were cultured in DMEM containing 10% FBS overnight at 37°C and 5% CO2. Transfection: siRNA was transfected using RNAiMAX (Invitrogen, 13778) according to the manufacturer's recommendations. The final siRNA transfection concentration was 10 nM, and three copies were prepared. No siRNA was added to the negative control group. After incubation at 37°C and 5% CO2 for 24 hours, cells were harvested, washed with PBS, and then RNA was extracted using Trizol (Invitrogen 15596018). Reverse transcription was performed using a kit (Takara PrimeScript). TM II. 1st Strand cDNA Synthesis Kit; 6210A) was used to reverse transcribe the extracted total RNA into cDNA according to the instructions, followed by quantitative real-time PCR using a TB (TB) kit. Premix Ex Taq TM The MMP1 cDNA was detected using a quantitative real-time PCR method (II, Takara, RR820A). GAPDH cDNA was used as an internal control in this method. PCR was performed as follows: 30 seconds at 95°C, followed by 40 cycles of 10 seconds at 95°C and 30 seconds at 60°C.

[0123] The primer sequences are shown in Table 3.

[0124] Table 3: Sequences of Detection Primers

[0125] Data Analysis:

[0126] In the comparative Ct(ΔΔCt) method, siRNA inhibitory activity was measured using the remaining amount of MMP1 gene expression. -△△Ct The expression is: △△Ct = [(Target gene in Ct experimental group - Internal reference in Ct experimental group) – (Target gene in Ct negative control group - Internal reference in Ct negative control group)]. The mRNA inhibition rate is then calculated using the following formula: mRNA inhibition rate = (1 - Remaining amount of hMMP1 gene expression) × 100%.

[0127] The inhibition of the naked siRNA sequences shown in Table 1 on the expression of MMP1 mRNA in the human cell line HT1080 is shown in Figure 1. The results of the average inhibition rate of the naked sequences shown in Table 1 on MMP1 mRNA in the human cell line HT1080 are shown in Table 4.

[0128] Table 4

[0129] NA: No inhibitory activity was detected.

[0130] The inhibition rate of the modified sequences shown in Table 2 on MMP1 mRNA in the human cell line HT1080 is shown in Figure 2. The results of the average inhibition rate of the modified sequences shown in Table 2 on MMP1 mRNA in the human cell line HT1080 are shown in Table 5.

[0131] Table 5

[0132] It can be seen from Tables 4 and 5 and Figures 1 and 2 that some oligonucleotides of the present invention have a strong inhibitory effect on the target gene MMP1.

[0133] Example 3 Effects of siRNA on the Contents of Collagen 1 and Collagen 3 in Skin Fibroblasts

[0134] Immunofluorescence detection

[0135] Mouse primary skin fibroblasts were selected to conduct an experiment on the collagen deposition effect after MMP1 knockdown, and the effect of MMP1 knockdown on collagen content was detected.

[0136] The experimental steps are as follows: Mouse primary skin fibroblasts (isolated from the skin tissues of C57 / BL6 mice (production license number: SCXK(Shanghai)2024-0007, use license number: SYXK(Shanghai)2023-0005) purchased from Shanghai Model Organisms Center, Inc.) (F. Boraldi et al., Biomedicines 12, 1586 (2024)) were routinely cultured in an incubator (37 °C, 5% CO2). After the cell number reached the experimental requirements, subsequent experiments were carried out. The cells were removed from the culture medium and gently rinsed 1-2 times with D-Hanks, and then the cells were irradiated with UVA (9 J / cm 2A photoaging model was established. After modeling, cells in the model group and the light-protected group were digested with trypsin and seeded in 12-well plates with 2*10^5 cells mixed with 10 nM DG013-37.1 in complete medium containing 2% serum. siRNA was transfected using RNAiMAX (Invitrogen, 13778) and cultured at 37°C and 5% CO2 for three days. After cell collection, cells were washed with PBS, lysed with RIPA lysis buffer containing protease and phosphatase inhibitors, and proteins were extracted. Protein concentration was determined using a BCA protein quantification kit (Beyotime). Protein samples were treated twice with loading buffer, denatured by heating in a 95°C water bath for 10 minutes, centrifuged (12000 rpm, room temperature, 3 minutes), and the supernatant was collected. Electrophoresis was performed on a 7% polyacrylamide gel, with 20 μL loaded per well at 120 V for 1.5 hours. Transfer was then performed at a constant current of 300 mA for 2 hours on ice. The membrane was blocked in 5% skim milk at a constant temperature for 1 hour and washed three times with TBST (10 minutes each time). It was then incubated with collagen I / III primary antibody (Cell Signaling Technology, catalog #54376, 1:1000 dilution, 4°C overnight) and HRP-labeled secondary antibody (Cell Signaling Technology, catalog #91144, 1:1000 dilution, room temperature for 1.5 hours), with three washes with TBST after each incubation. Finally, it was incubated with ECL (Thermo Fisher) for 1-2 minutes, and the expression level of the target protein was detected by chemiluminescence immunoassay. β-actin (1:1500 dilution) was used as the internal control protein. The experimental results are shown in Figure 3. In mouse primary skin fibroblasts, the expression level of matrix metalloproteinase 1 (MMP1) increased after UVA irradiation, and the expression level of MMP1 significantly decreased after treatment with DG013-37.1 siRNA sample. Meanwhile, UVA irradiation significantly reduced the level of intracellular collagen I / III compared to the light-protected group. After treatment with siRNA sample DG013-37.1, collagen I / III showed a significant increase compared to the model group.

[0137] Example 4: Comparison experiment on the stability of unmodified DG013-37 and chemically modified DG013-37.1 against nucleases.

[0138] This embodiment uses an in vitro RNase A degradation system to compare the resistance to nuclease hydrolysis of unmodified DG013-37 and chemically modified DG013-37.1, verifying the effect of chemical modification on improving the stability of siRNA nucleases.

[0139] The experimental procedure is as follows: Unmodified DG013-37 and chemically modified DG013-37.1 were dissolved in PBS buffer to prepare 10 μM siRNA working solutions. Bovine pancreatic RNase A was added to nuclease buffer (50 mM Tris-HCl pH 7.5, 10 mM MgCl2, 1 mM DTT) to prepare an active enzymatic digestion system (final RNase A concentration 0.1 μg / μL). 2 μL of siRNA working solution was added to each 18 μL digestion system according to the group, and the system was quickly placed in a 37°C constant temperature water bath. Timing was started, and an independent reaction tube was set up for each time point. After reaching the preset time point, 2 μL of 20 mM EDTA stop solution was immediately added to the reaction tube, quickly mixed by pipetting, and placed in an ice bath to terminate the nuclease hydrolysis. The samples were analyzed by 1.5% agarose gel electrophoresis. The electrophoresis was performed at a constant voltage of 80V for 25 minutes. The bands were photographed using a gel imaging system to determine the degree of siRNA degradation.

[0140] The experimental results are shown in Figure 4: Unmodified DG013-37 rapidly degraded under the action of RNase A; the carefully designed chemically modified DG013-37.1, after co-incubation with bovine pancreatic RNase for 48 hours, still maintained its structural integrity, and no obvious degradation bands were observed. The chemically modified DG013-37.1 exhibited excellent nuclease resistance, and its anti-enzymatic stability was significantly improved, providing key performance assurance for the development and large-scale application of this small nucleic acid in pharmaceutical formulations and cosmetics.

[0141] SEQ ID NO:1 is human matrix metallopeptidase 1 (MMP1) mRNA [NCBI reference sequence: NM_002421.4]

[0142] SEQ ID NO:2 is human matrix metallopeptidase 1 (MMP1) mRNA [NCBI reference sequence: NM_001145938.2]

[0143] SEQ ID NO:3 is the matrix metallopeptidase 1 (MMP1) mRNA of cynomolgus monkeys [NCBI reference sequence: XM_015115558.2].

[0144] SEQ ID NO:4 is mouse matrix metallopeptidase 1a (MMP1a) mRNA [NCBI reference sequence: NM_032006.3]

[0145] In SEQ ID NO:1 to 4 above, “T” represents “U”.

Claims

1. An siRNA or a salt thereof, comprising a sense strand and an antisense strand, wherein each nucleotide in the siRNA is independently a modified or unmodified nucleotide, wherein, The sense strand contains nucleotide sequence I, and the antisense strand contains nucleotide sequence II, wherein nucleotide sequence I and nucleotide sequence II are at least partially anticomplementary to form a double-stranded region, and nucleotide sequence I and nucleotide sequence II are selected from one of the sequence groups shown in (1)-(39) below: (1) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:5 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:43 by no more than 3 (preferably no more than 1) nucleotides: GAGGAAAACACUGGAAAAAA(SEQ ID NO:5) UUUUUCCAGUGUUUUCCCAG(SEQ ID NO:43); (2) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:6 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:44 by no more than 3 (preferably no more than 1) nucleotides: CGAUCUAUGGAUCCAGGUU(SEQ ID NO:6) AACCUGGAUCCAUAGAUCGUU(SEQ ID NO:44); (3) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:7 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:45 by no more than 3 (preferably no more than 1) nucleotides: GAUCUAUGGAUCCAGGUUA(SEQ ID NO:7) UAACCUGGAUCCAUAGAUCGU(SEQ ID NO:45); (4) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:8 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:46 by no more than 3 (preferably no more than 1) nucleotides: GAUAUAAUUUAGUUCCACA(SEQ ID NO:8) UGUGGAACUAAAUUAUAUCAG (SEQ ID NO:46); (5) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:9 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:47 by no more than 3 (preferably no more than 1) nucleotides: UGUAUCAGUGACUCUAGAG(SEQ ID NO:9) AUAAAUAAGAUUAUAUUCUGU(SEQ ID NO:47); (6) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:10 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:48 by no more than 3 (preferably no more than 1) nucleotides: CUUUCAGACAGAAAGAGA(SEQ ID NO:10) UCUCUUUCUGUCUUGAAAGGA (SEQ ID NO:48); (7) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:11 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:49 by no more than 3 (preferably no more than 1) nucleotides: ACCUCUAGAGUCACUGAUA(SEQ ID NO:11) UAUCAGUGACUCUAGAGGUUA(SEQ ID NO:49); (8) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:12 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:50 by no more than 3 (preferably no more than 1) nucleotides: GACAGAAAGAGACAGGAGA(SEQ ID NO:12) UCUCCUGUCUCUUUCUGUCUU(SEQ ID NO:50); (9) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:13 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:51 by no more than 3 (preferably no more than 1) nucleotides: CAGAAUAUAAUCUUAUUUA(SEQ ID NO:13) UAAAUAAGAUUAUAUUCUGUG (SEQ ID NO:51); (10) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:14 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:52 by no more than 3 (preferably no more than 1) nucleotides: AUGGAACAAGACAAUACAA(SEQ ID NO:14) UUGUAUUGUCUUGUUCCAUGA (SEQ ID NO:52); (11) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:15 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:53 by no more than 3 (preferably no more than 1) nucleotides: GCUUCAGUGACAAACAUAU(SEQ ID NO:15) AUAUGUUUGUCACUGAAGCUG (SEQ ID NO: 53); (12) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:16 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:54 by no more than 3 (preferably no more than 1) nucleotides: CAUGGAACAAGACAAUACA(SEQ ID NO:16) UGUAUUGUCUUGUUCCAUGAA (SEQ ID NO:54); (13) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:17 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:55 by no more than 3 (preferably no more than 1) nucleotides: AACCUUUGAUGCUAUAACU(SEQ ID NO:17) AGUUAUAGCAUCAAAGGUUAG (SEQ ID NO:55); (14) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:18 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:56 by no more than 3 (preferably no more than 1) nucleotides: UAACCUUUGAUGCUAUAAC(SEQ ID NO:18) GUUAUAGCAUCAAAGGUUAGC (SEQ ID NO: 56); (15) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:19 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:57 by no more than 3 (preferably no more than 1) nucleotides: CUAACCUUUGAUGCUAUAA(SEQ ID NO:19) UUAUAGCAUCAAAGGUUAGCU(SEQ ID NO:57); (16) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:20 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:58 by no more than 3 (preferably no more than 1) nucleotides: AUGGUCCAGGUUAUCCCA(SEQ ID NO:20) UGGGAUAACCUGGAUCCAUAG(SEQ ID NO:58); (17) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:21 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:59 by no more than 3 (preferably no more than 1) nucleotides: UAUGGAUCCAGGUUAUCCC(SEQ ID NO:21) GGGAUAACCUGGAUCCAUAGA (SEQ ID NO:59); (18) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:22 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:60 by no more than 3 (preferably no more than 1) nucleotides: CUAUGGAUCCAGGUUAUCC(SEQ ID NO:22) GGAUAACCUGGAUCCAUAGAU(SEQ ID NO:60); (19) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:23 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:61 by no more than 3 (preferably no more than 1) nucleotides: UCUAUGGAUCCAGGUUAUC(SEQ ID NO:23) GAUAACCUGGAUCCAUAGAUC(SEQ ID NO:61); (20) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:24 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:62 by no more than 3 (preferably no more than 1) nucleotides: UUGGGCCUGAAAGUGACUGG(SEQ ID NO:24) CCAGUCACUUUCAGCCCAAUG(SEQ ID NO:62); (21) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:25 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:63 by no more than 3 (preferably no more than 1) nucleotides: UUUGGGCCUGAAAGUGACUG(SEQ ID NO:25) CAGUCACUUUCAGCCCAAAGU(SEQ ID NO:63); (22) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:26 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:64 by no more than 3 (preferably no more than 1) nucleotides: UGCCUGAUGUGGCUCAGUU(SEQ ID NO:26) AACUGAGCCACAUCAGGCACU (SEQ ID NO: 64); (23) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:27 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:65 by no more than 3 (preferably no more than 1) nucleotides: GGCUGAAAGUGACUGGGAA(SEQ ID NO:27) UUCCCAGUCACUUUCAGCCCU(SEQ ID NO:65); (24) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:28 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:66 by no more than 3 (preferably no more than 1) nucleotides: GUCCAGAAUACCUGGAAA(SEQ ID NO:28) UUUCCAGGUAUUUCUGGACUA(SEQ ID NO:66); (25) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:29 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:67 by no more than 3 (preferably no more than 1) nucleotides: CUAUUUCUUUCAUGGAACA(SEQ ID NO:29) UGUUCCAUGAAAGAAAUAGAA (SEQ ID NO: 67); (26) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:30 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:68 by no more than 3 (preferably no more than 1) nucleotides: GGAGGUAUGAUGAAUAUAA(SEQ ID NO:30) UUAUAUUCAUCAUACCUCCAG(SEQ ID NO:68); (27) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:31 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:69 by no more than 3 (preferably no more than 1) nucleotides: AAGUUGAGCUCAAUUUCAU(SEQ ID NO:31) AUGAAAUUGAGCUCAACUUCC (SEQ ID NO: 69); (28) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:32 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:70 by no more than 3 (preferably no more than 1) nucleotides: GAAGUUGAGCUCAAUUUCA(SEQ ID NO:32) UGAAAUUGAGCUCAACUUCCG(SEQ ID NO:70); (29) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:33 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:71 by no more than 3 (preferably no more than 1) nucleotides: CCAGAUGCUGAAACCCUGA(SEQ ID NO:33) UCAGGGUUUCAGCAUCUGGUU(SEQ ID NO:71); (30) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:34 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:72 by no more than 3 (preferably no more than 1) nucleotides: GGUUCAACUGCAGGAAAAA(SEQ ID NO:34) UUUUUCCUGCAGUUGAACCAG(SEQ ID NO:72); (31) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:35 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:73 by no more than 3 (preferably no more than 1) nucleotides: CUGGUUCAACUGCAGGAAA(SEQ ID NO:35) UUUCCUGCAGUUGAACCAGCU(SEQ ID NO:73); (32) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:36 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:74 by no more than 3 (preferably no more than 1) nucleotides: AUAGCUGGUUCAACUGCAG(SEQ ID NO:36) CUGCAGUUGAACCAGCUAUUA (SEQ ID NO:74); (33) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:37 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:75 by no more than 3 (preferably no more than 1) nucleotides: CUAAUAGCUGGUUCAACUG(SEQ ID NO:37) CAGUUGAACCAGCUAUUAGCU(SEQ ID NO:75); (34) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:38 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:76 by no more than 3 (preferably no more than 1) nucleotides: ACUUCUUUGUUGCUAACAA(SEQ ID NO:38) UUGUUAGCAACAAAGAAGUAG (SEQ ID NO:76); (35) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:39 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:77 by no more than 3 (preferably no more than 1) nucleotides: UCCUUUGGCUUCCCUAGAA(SEQ ID NO:39) UUCUAGGGAAGCCAAAGGAGC (SEQ ID NO:77); (36) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:40 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:78 by no more than 3 (preferably no more than 1) nucleotides: AGAUGCUGAAACCCUGAAG(SEQ ID NO:40) CUUCAGGGUUUCAGCAUCUGG(SEQ ID NO:78); (37) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:18 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:79 by no more than 3 (preferably no more than 1) nucleotides: UAACCUUUGAUGCUAUAAC(SEQ ID NO:18) GUUAUAGCAUCAAAGGUUAUU(SEQ ID NO:79); (38) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:41 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:80 by no more than 3 (preferably no more than 1) nucleotides: UACUGGAGGUAUGAUGAAU(SEQ ID NO:41) AUUCAUCAUACCUCCAGUAUU(SEQ ID NO:80); (39) The nucleotide sequence I comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:42 by no more than 3 (preferably no more than 1) nucleotides, and the nucleotide sequence II comprises at least 15 consecutive nucleotides that differ from SEQ ID NO:81 by no more than 3 (preferably no more than 1) nucleotides: UGGGCUGAAAGUGACUGGG(SEQ ID NO:42) CCCAGUCACUUUCAGCCCAAA (SEQ ID NO:81).

2. The siRNA or its salt according to claim 1, wherein, The siRNA has a combination of sense and antisense strands selected from the following combinations:

3. The siRNA or its salt according to claim 1 or 2, wherein: The siRNA contains at least one modified nucleotide and / or at least one interstrand modification, and / or All nucleotides on the positive strand are modified nucleotides, and / or All nucleotides on the antisense strand are modified nucleotides. Preferably, substantially all nucleotides of the sense and antisense strands are modified nucleotides; more preferably, all nucleotides of the sense and antisense strands are modified nucleotides. More preferably, the modified nucleotides include 2'-F, 2'-OME, 2'-MOE, GNA, UNA, PNA, 5'-VP, and iB. More preferably, the antisense chain contains 0 to 5 (e.g., 2) 3'-terminal pendant nucleosides.

4. The siRNA or its salt according to any one of claims 1-3, wherein, The siRNA has a structure selected from the following: In this context, uppercase letters A, C, G, and U represent the base composition of nucleotides; lowercase letter m indicates that the nucleotide adjacent to the left of letter m is a nucleotide modified with 2′-methoxy; lowercase letter f indicates that the nucleotide adjacent to the left of letter f is a nucleotide modified with 2′-fluorine; and Ps indicates that the connection between two adjacent nucleotides is a phosphate thioester linkage.

5. The siRNA or its salt according to claim 4, wherein the double strand is numbered DG013-37.1, the sense strand is UmPsAmPsAmCmCmUmUfUfGfAmUmGmCmUmAmUmAmAmCm, and the antisense strand is GmPsUfPsUmAmUfAfGfCmAmUmCmAmAmAfGmGfUmUmAmPsUmPsUm.

6. An MMP1 synthesis inhibitor comprising one or more siRNAs selected from any one of claims 1-5 and their salts.

7. A composition comprising one or more siRNAs selected from any one of claims 1-5 or their salts, and a carrier acceptable for use in cosmetics or pharmaceuticals.

8. Use of the siRNA or its salt as described in any one of claims 1-5, or the composition as described in claim 7, in the preparation of a pharmaceutical or cosmetic product.

9. The use as described in claim 8, wherein, The drug or cosmetic is used to inhibit the expression of MMP1, or for skin anti-wrinkle, firming and repair.

Images