An ink formulation

WO2026167048A1PCT designated stage Publication Date: 2026-08-13DUBLIN CITY UNIVERSITY
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-02-04
Publication Date
2026-08-13

Smart Images

  • Figure EP2026052962_13082026_PF_FP_ABST
    Figure EP2026052962_13082026_PF_FP_ABST
Patent Text Reader

Abstract

The invention provides an ink for a screen-printed working electrode, the ink comprising: gold microstructures having a maximum dimension of about 0.05 to about 7.5 microns; conductive carbon particles; at least one solvent having a boiling point of greater than 110°C; and at least one polymer dissolved or dispersed in the at least one solvent. The invention also provides an electrode comprising: a screen-printed working electrode comprising the ink of the first aspect of the invention.
Need to check novelty before this filing date? Find Prior Art

Description

An ink formulationField of the InventionThis invention relates to an ink formulation containing gold microparticles for the development of cost-effective biosensors.Background of the InventionIn the field of biomolecular analysis, electrochemical biosensors have emerged as powerful tools for the sensitive and specific determination of analytes, including, but not limited to, miRNAs, offering several distinct advantages over traditional techniques such as PCR-based assays and microarray methods, including, but not limited to:1. High Sensitivity: Electrochemical biosensors exhibit exceptional sensitivity, enabling the detection of analytes at ultralow concentrations. This attribute is critical when dealing with trace amounts of analytes in complex biological samples.2. Selectivity: These biosensors offer outstanding selectivity, distinguishing between closely related analytes and differentiating them from other interfering species present in the sample. This selectivity is vital for precise analyte profiling.3. Real-time Monitoring: Electrochemical biosensors enable real-time monitoring of analyte levels, providing dynamic insights into changes in analyte levels over time. This feature is particularly valuable for studying dynamic biological processes and disease progression. 4. Cost-effectiveness: Compared to traditional methods like PCR-based assays or microarray techniques, electrochemical biosensors often require fewer reagents and have lower operational costs, making them an economically viable choice for routine analysis.5. Portability: Many electrochemical biosensors are compact and portable, facilitating their use in point-of-care diagnostics and field applications where immediate results are essential.Carbon-based materials, such as glassy carbon electrodes and screen-printed carbon electrodes (SPCEs), provide versatility and affordability in biosensing. Notably, SPCEs offer distinct advantages over traditional platforms for analyte detection. Apart from their cost-effectiveness and biocompatibility, SPCEs are disposable, possess low toxicity, can be tailored to meet end-users' specific requirements, and enable miniaturization. Miniaturization involves downsizing the electrode, reducing sample and reagent volumes in production, and facilitating potential integration into compact or handheld devices. While the conductivity and electron transfer properties of SPCEs may not match those of traditional electrodes, their surfaces remain customizable to address precise analytical needs, and their cost-effectiveness allows for large-scale testing.The present invention describes biocompatible and / or biodegradable, electronically conducting inks and pastes containing metal particles (nano to micron) and / or biomolecules that enable applications requiring a low resistivity, high flexibility, and bioactivity e.g., electrochemical (bio)sensors, medicaltest strips, wearable and implantable biomedical devices sensors, printed electronics, smart fabrics, flexible electronic fabrics and e-textiles.Summary of the InventionAccordingly, in a first aspect, the present invention provides an ink for a screen-printed working electrode, the ink comprising gold microstructures.Optionally, the gold microstructures have a maximum dimension of about 0.05 to about 7.5 microns, optionally about 0.5 to about 6 microns, optionally about 0.5 to about 3 microns, optionally about 0.5 to about 1.5 microns. Further optionally, the gold microstructures have a maximum dimension of about 1 to about 6 microns, optionally about 1 to about 3 microns, optionally about 1 to about 1.5 microns, further optionally about 2 microns.Optionally, the gold microstructures have a maximum dimension of 0.05 to 7.5 microns, optionally 0.5 to 6 microns, optionally 0.5 to 3 microns, optionally 0.5 to 1.5 microns. Further optionally, the gold microstructures have a maximum dimension of 1 to 6 microns, optionally 1 to 3 microns, optionally 1 to 1.5 microns, further optionally 2 microns.Optionally the ink further comprises at least one solvent. Preferably, the at least one solvent has a boiling point greater than 110°C.Optionally, the at least one solvent has a boiling point less than or equal to 240°C. Optionally, the at least one solvent has a boiling point greater than 110°C and less than or equal to 240°C.Optionally, the ink further comprises a polymer. Preferably, the polymer is dissolved or dispersed in the at least one solvent (that is to say, preferably the polymer is dissolved or dispersed in the solvent or combination of solvents).In some embodiments, the present invention provides an ink for a screen-printed working electrode, the ink comprising gold microstructures having a maximum dimension of about 0.05 to about 7.5 microns, optionally about 1 to about 3 microns, further optionally about 2 microns; and a polymer dissolved or dispersed in a solvent or a combination of solvents, the solvent or combination of solvents having a boiling point of greater than 110°C.Preferably, the ink further comprises conductive carbon particles.Optionally, the present invention provides an ink for a screen-printed working electrode, the ink comprising: gold microstructures having a maximum dimension of about 0.05 to about 7.5 microns; conductive carbon particles; at least one solvent having a boiling point of greater than 110°C; and at least one polymer dissolved or dispersed in the at least one solvent.Optionally, the gold microstructures have a maximum dimension of about 0.05 to about 7.5 microns, optionally about 0.5 to about 6 microns, optionally about 0.5 to about 3 microns, optionally about 0.5 to about 1.5 microns. Further optionally, the gold microstructures have a maximum dimension of about 1 to about 6 microns, optionally about 1 to about 3 microns, optionally about 1 to about 1.5 microns, further optionally about 2 microns.Optionally, the gold microstructures have a maximum dimension of 0.05 to 7.5 microns, optionally 0.5 to 6 microns, optionally 0.5 to 3 microns, optionally 0.5 to 1.5 microns. Further optionally, the gold microstructures have a maximum dimension of 1 to 6 microns, optionally 1 to 3 microns, optionally 1 to 1.5 microns, further optionally 2 microns.Optionally, the ink has a viscosity of 15,000 to 44,000 centipoises at 27°C (Anton Paar MCR 92 Modular Compact rheometer, equipped with RheoCompass™ software).Optionally, the ink comprises about 7.5 to about 25% (w / w) gold microstructures; optionally about 10 to about 20% (w / w) gold microstructures; further optionally, about 17.5 to about 22.5 % (w / w) gold microstructures. Optionally, the ink comprises about 10 to about 20% (w / w) gold microstructures.Optionally, the gold microstructures are selected from gold microspheres and gold microflakes. Optionally, the gold microspheres have a diameter of about 0.05 to about 7.5 microns, optionally about 1 to about 3 microns, further optionally about 2 microns; or the gold microflakes have a maximum dimension of about 0.05 to about 7.5 microns, optionally about 1 to about 3 microns, further optionally about 2 microns.Preferably, the ink comprises conductive carbon particles, optionally the conductive carbon particles comprise a material selected from graphite, graphene, carbon black, and carbon nanotubes, or any combination thereof. Preferably, the conductive carbon particles comprise graphite and I or carbon black.Optionally, the conductive carbon particles comprise more than 25% (w / w), optionally more than 27% (w / w), of the ink. That is to say: optionally the ink comprises more than 25% (w / w) conductive carbon particles, optionally the ink comprises more than 27% (w / w) conductive carbon particles.Optionally, the conductive carbon particles comprise about 25% to about 50% (w / w) of the ink. That is to say, optionally the ink comprises about 25% to about 50% (w / w) conductive carbon particles. Optionally, the conductive carbon particles comprise 25% to 50% (w / w) of the ink. That is to say, optionally the ink comprises 25% to 50% (w / w) conductive carbon particles.Optionally, the ink comprises about 10% to about 20% (w / w) gold microstructures and about 25% to about 50% (w / w) conductive carbon particles. Optionally, the ink comprises about 10% to about 20%(w / w) gold microstructures and about 25% to about 50% (w / w) conductive carbon particles comprising graphite and I or carbon black. Optionally, the ink comprises about 10% to about 20% (w / w) gold microstructures and about 25% to about 50% (w / w) conductive carbon particles consisting of graphite and I or carbon black. Optionally, the ink comprises about 10% (w / w) gold microstructures and about 25% to about 50% (w / w) conductive carbon particles. Optionally, the ink comprises about 10% (w / w) gold microstructures and about 25% to about 50% (w / w) conductive carbon particles comprising graphite and I or carbon black. Optionally, the ink comprises about 10% (w / w) gold microstructures and about 25% to about 50% (w / w) conductive carbon particles consisting of graphite and I or carbon black.Optionally, the present invention provides an ink for a screen-printed working electrode, the ink comprising: gold microstructures having a maximum dimension of about 0.05 to about 7.5 microns; conductive carbon particles; at least one solvent having a boiling point of greater than 110°C; and at least one polymer dissolved or dispersed in the at least one solvent.Optionally, the at least one polymer comprises at least one reactive group. Optionally, the at least one reactive group is selected from thiols, disulphides, aldehydes, acrylate, methacrylate, alcohols, carboxylic acids, and amines.Optionally, the ink further comprises at least one polymer comprising one or more reactive groups; the or each reactive group being optionally selected from thiols, disulphides, aldehydes, acrylate, methacrylate, alcohols, carboxylic acids, and amines.Optionally, the at least one polymer comprises about 4 to 15% (w / w), optionally 5 to 12 % (w / w), of the ink. That is to say: optionally the ink comprises about 4 to 15% (w / w) polymer(s), optionally the ink comprises about 5 to 12 % (w / w) polymer(s).Optionally, the at least one polymer is selected from polyethylene terephthalate, polyethyloxazoline, polymethylmethacrylate, poly-L-lactide, cellulose derivatives, ethyl cellulose, cellulose acetate, cellulose acetate propionate, polyacrylates, polyesters, polyamines, polyhydroxyether, polyethers, polymethyl methacrylate, polyvinyl acetate, polyvinyl chloride, polyhydroxyethers, poly(lactide) and associated co-polymers.Optionally, the at least one polymer has a molecular weight between about 5,000 and about 500,000 g mol-1Optionally, the at least one solvent comprises at least one organic solvent. Optionally, the at least one solvent consists of organic solvent(s).Optionally, the at least one solvent is selected from monoterpenoid alcohols, ethers, glycols, glycol ether acetates, acetates, glycol ethers, diols, phthalates, carbonates, sorbitol-derivatives, and dibasic esters.Optionally, the at least one solvent is selected from a-terpineol, dipropylene glycol monomethyl ether [also called di(propylene glycol) monomethyl ether], methyl isobutyl ketone (MIBK), isobutyl acetate, propylene glycol monomethyl ether acetate, diethylene glycol monoethyl ether, Diethylene glycol monoethyl ether acetate, dipropylene glycol monomethyl ether, dibasic ester 9, dihydrolevoglucosenone, and propylene glycol monomethyl ether acetateOptionally, the ink further comprises at least one solvent (that is to say, a solvent or a combination of solvents). Optionally, the at least one solvent comprises at least one organic solvent. Optionally, the at least one solvent consists of organic solvent(s). Optionally, the at least one solvent is selected from monoterpenoid alcohols, ethers, glycols, glycol ether acetates, acetates, glycol ethers, diols, phthalates, carbonates, sorbitol-derivatives, and dibasic esters. Optionally, the at least one solvent is selected from a-terpineol, dipropylene glycol monomethyl ether, methyl isobutyl ketone (MIBK), isobutyl acetate, Propylene glycol monomethyl ether acetate (PGMEA), diethylene glycol monoethyl ether (DEGEE), Diethylene glycol monoethyl ether acetate (DEGEEA), dipropylene glycol monomethyl ether (DPM), dibasic ester 9 (DBE-9), dihydrolevoglucosenone (Cyrene™), di(propylene glycol), methyl ether, and propylene glycol monomethyl ether acetate.Optionally, the at least one solvent comprises 45 to 65% (w / w) of the ink. That is to say: optionally the ink comprises 45 to 65% (w / w) solvent(s).A second aspect of the invention provides an electrode comprising:a screen-printed working electrode comprising the ink according to the first aspect of the invention.Optionally, the electrode further comprises at least one binding ligand for a target analyte, the at least one binding ligand being associated with, optionally covalently attached to, the gold microstructures on the working electrode, optionally selected from thiolation (covalent), hydrogen bonding, ionic or electrostatic(physical) interactions. Optionally, the at least one binding ligand is associated with the gold microstructures on the working electrode by means of wet chemical deposition, cold plasma deposition or soft stamping onto gold microstructures. The binding ligand may be applied by immersion in a solution containing the at least one binding ligand or coating by room temperature plasma. Immersion is preferred for monoplex whilst it is envisaged that plasma is preferred for multiplex.Optionally, the at least one binding ligand is selected from nucleic acids, antibodies, aptamers, polypeptides, and proteins. Aptamers are oligomers of artificial ssDNA, RNA, XNA, or peptides that bind a specific target molecule, or family of target molecules. Optionally, the at least one binding ligand, in use, is capable of binding a target analyte and, in use, is also capable of hybridising to aprobe strand that is functionalized with a label. Optionally, in use, the label comprises an electrochemical or optical label; wherein the electrochemical label is optionally selected from metal particles or wherein the optical label is optionally selected from a fluorophore, luminophore or chromophore. Optionally, wherein the metal particles comprise metal nanostructures that are selected from gold nanorods, platinum nanoparticles, and palladium nanocubes. Preferably, the metal nanostructure is platinum nanoparticles or gold nanorods. Most preferably, the metal nanostructure is gold nanorods.Optionally, the electrode, further comprises a reference electrode; and / or a counter electrode; wherein, optionally, the reference electrode and I or the counter electrode is screen printed. Optionally, the screen-printed reference electrode comprises silver, silver / silver chloride, gold or carbon. Alternatively or additionally, the screen-printed counter electrode comprises platinum, gold, or carbon.A third aspect of the invention provides a method of making the electrode of the second aspect of the invention, comprising:screen-printing a working electrode onto a substrate using an ink according to the first aspect of the invention;providing a reference electrode on the substrate;providing a counter electrode on the substrate.optionally, associating an at least one binding ligand with the working electrode, wherein a response characteristic of the electrode is capable of being operably varied.Optionally, the reference and I or counter electrode is I are screen printed onto the substrate.Alternatively or additionally, the substrate is selected from paper, plastic, metal and ceramic.A fourth aspect of the invention provides a method of detecting the presence or absence of a target analyte in a sample, comprising:contacting the electrode of the second aspect of the invention with a sample;wherein a response characteristic of the electrode is capable of being operably varied, thereby providing an indication of the presence of the analyte within the sample.Optionally, the reference and I or counter electrode is I are screen printed onto the substrate.Alternatively or additionally, the substrate is selected from paper, plastic, metal and ceramic.Optionally, the response characteristic comprises an electrochemical signal or an optical signal which is capable of being operably varied upon capture of the target analyte thereby indicating the presence of the target analyte within the sample.Further optionally, the electrochemical signal comprises a changed electrochemical impedance signal (resistance and capacitance) or a changed amperometric or cyclic voltammetric signal (potential and current); and I or wherein the optical signal comprises a change in the fluorescence, colorimetric or luminescence intensity or lifetime of a bound or free fluorophore, chromophore or luminophore; optionally by a change in the scattering intensity of a bound or free fluorophore, chromophore or luminophore.In electrochemical impedance, the Nyquist plot consists of an imaginary (Z") and real (Z') impedance and can be fitted to decouple changes in the solution phase resistance as well as resistance associated with the target analyte capture. The impedance response is measured in a solution of DPBS with a frequency range from 0.01 Hz to 100 kHz inside a Faraday cage.A chromophore is a molecule which absorbs light at a particular wavelength and reflects color as a result. A luminophore (sometimes shortened to lumophore) is an atom or functional group in a chemical compound that is responsible for its luminescent properties.Optionally, the ink formulation may be created by using naturally occurring materials repurposed from perfumes, cosmetics, food additives and implantable medical devices. All such materials are FDA approved as food additives (PART 172) or indirect food additives (PART 175 and 177). The uniqueness of the formulation relies on its capability of integrating several functionalities, e.g., biocompatibility, low curing temperature, flexibility, and controllable available active sites for biomolecules thiolation by incorporating gold particles, that are relevant for industrial applications from electronic circuits to on-body sensing devices.The metal particle size plays an important role in the ink formulation, e.g., electrocatalytic properties of gold nanoparticles can negatively affect the signal to noise ratio in a biosensor platform context. To avoid this type of issues, gold micron particles were incorporated in the ink formulation.Gold nanoparticles (NPs) are often superior electrocatalysts compared to gold microparticles due to their unique size-dependent properties, large surface area-to-volume ratio, and high surface energy. This increased surface area provides more active sites for catalytic reactions to occur, enhancing the catalytic activity per unit mass promoting faster electron transfer kinetics and facilitates the activation of various electrochemical reactions. However, gold nanoparticles tend to present a higher signal to noise ratio.The incorporation of gold microparticles instead of gold nanoparticles to the sensor interface improves the signal-to-noise ratio (SNR), reduces the background noise, enhances stability, and improves signal amplification.Existing electrodes containing carbon / gold particles are usually constituted of gold nanoparticles instead of microparticles. Gold nanoparticles (NPs) are superior electrocatalysts compared to gold microparticles due to their unique size-dependent properties, large surface area-to-volume ratio, andhigh surface energy. This increased surface area provides more active sites for catalytic reactions to occur increasing the signal to noise ratio. The incorporation of gold microparticles instead of gold nanoparticles to the sensor interface can potentially improve the signal-to-noise ratio (SNR), reduce the background noise, enhance stability, and improve signal amplification. In addition, gold microparticles facilitate the immobilisation of biomolecules through thiolation due to their larger size and greater accessibility of binding sites.This strategy can enable ultralow concentration (fM) of biomarkers to be detected.The ink of the present invention differs fundamentally from any prior ink for a screen-printed working electrode in several aspects. First, our ink contains both gold microstructures and conductive carbon particles (of materials such as graphite). Second, many prior inks employ a significantly higher percentage of gold (Au) than is present in our ink, leading to a different balance of cost, conductivity, and processing characteristics. Third, the curing temperature required for many prior inks is substantially higher, in contrast to our formulation, which cures effectively at lower temperatures and thus supports compatibility with a wider range of substrates. Fourth, certain prior inks include silver as a constituent element, while silver is entirely absent and not relevant in our ink composition. Furthermore, the particle size in many prior inks is not well defined, whereas our material employs a controlled and well-characterised particle size distribution that ensures reproducibility and performance reliability; for example our material employs a controlled and well-characterised particle size distribution of gold microstructures and conductive carbon particles. While the cited composition relies on triple roll milling, our ink is manufactured using an alternative process that achieves superior dispersion and consistency, without the limitations inherent in roll milling.The ink of the present invention comprises gold microstructures. The inventors have surprisingly found that the ink comprising gold microstructures within a maximum dimension range of about 0.05 to about 7.5 microns is advantageous. The gold microstructures maximum dimension range of about 0.05 to about 7.5 microns ensures optimal printability, stability, and electrochemical performance in screen-printed sensor systems. Gold particles having a maximum dimension below approximately 0.05 pm begin to behave as nanostructures, which are significantly more electrocatalytic and would therefore undesirably increase background current and noise in electrochemical measurements. Such elevated baseline activity would compromise the sensitivity and reproducibility of the printed sensor. Conversely, gold particles having a maximum dimension above about 7.5 pm reduce formulation stability and screen-printing performance, including poor dispersion, clogging of the mesh, and reduced feature resolution. The upper size limit of the gold microstructures (i.e. an upper maximum dimension of about 7.5 microns) therefore ensures consistent ink rheology, smooth film formation, and reliable screen-printing without sedimentation or screen mesh blockages. See also Figure 7 and Figure 8.The present invention preferably incorporates a solvent system that enables effective dispersion, stability, and film-forming characteristics during the screen printing process. A key factor in achievingthese properties is controlling the solvent evaporation rate during formulation and subsequent application. Solvents having boiling points greater than 110 °C provide a slower evaporation profile, which is preferable for (a) Maintaining viscosity and printability throughout the printing operation; (b) Preventing screen clogging and premature drying on the mesh; (c) Allowing uniform transfer and levelling of the printed layer prior to drying or curing; (d) Ensuring consistent feature definition and edge quality during printing; and (e) Maintaining dispersion stability and avoiding phase separation or agglomeration before the film is formed. Therefore, the solvent or combination of solvents preferably have a boiling point of greater than 110°C.Another advantage of the solvent or combination of solvents having a boiling point of greater than 110°C is that the formulation remains more processable and more stable during screen printing, where rapid solvent loss would otherwise lead to mesh blockage, film defects, loss of feature fidelity, and inconsistent film morphology.Boiling point is a useful parameter for selecting solvents in formulations requiring controlled evaporation and many solvents having a boiling point greater than 110°C share the necessary evaporation and solvating characteristics.The solvent(s) (optionally organic solvent(s)) in a screen-printing ink formulation dictate(s) the drying behaviour, film formation, and ultimately functional performance through its / their volatility, which is directly linked to boiling point and vapour pressure. Solvents with a higher boiling point exhibit lower vapour pressure at ambient conditions and therefore evaporate more slowly from the printed surface. This slower evaporation prolongs the time the ink film remains liquid and mobile after deposition, strongly influencing levelling, microstructure development, and defect formation.If solvent evaporation is too rapid (as with lower boiling-point solvents), the surface of the printed layer can dry prematurely, forming a “skin” that traps solvent beneath. This often leads to defects such as pinholes, blistering, mesh marking, and non-uniform thickness, as well as poor levelling due to a rapid increase in viscosity. Therefore, the solvent or combination of solvents preferably have a boiling point of greater than 110°C. See Figure 9.In contrast, if the solvent system is dominated by high-boiling components (for example if the at least one solvent has a boiling point greater than 240°C), evaporation might be excessively slow, leaving the film wet for extended periods. This can cause smudging, blocking, dust contamination, reduced process throughput, and, critically, residual solvent retention in the final layer.For functional and electrochemical screen-printed films, retained solvent (such as organic solvent) has a direct and detrimental impact on performance. Most solvents (such as organic solvents) are electrically insulating and weakly ion-conductive, so solvent remaining within the film increases the effective bulk resistance of the layer. Residual solvent can occupy free volume between conductive particles or within the polymer binder, disrupting conductive percolation pathways and raising thefilm’s ohmic resistance. In electrochemical terms, this manifests as increased solution / film resistance and higher charge-transfer resistance, leading to lower measured currents, slower electron-transfer kinetics, and a reduced overall electrochemical response. Additionally, solvent-rich surface regions can block electrolyte access, reduce the electrochemically active surface area, and further suppress faradaic processes. See also Figure 6.These competing effects explain why using a solvent or mixture of solvents is preferable in screenprinting ink formulations. A blended solvent system enables a controlled, staged evaporation profile: a more volatile solvent evaporates early to help the film set and prevent excessive spreading, while a less volatile, higher-boiling solvent remains temporarily to promote flow, levelling, and uniform particle or polymer rearrangement. At the same time, the overall solvent blend can be tailored to ensure complete removal under the chosen drying or curing conditions, minimizing residual solvent content and the associated increase in electrical resistance.Ethyl cellulose is an exemplary polymer for use in the ink of the present invention, but other polymers fulfilling the same solubility / dispersion and binder function could also be used e.g., cellulose derivatives, acrylic binders, or polyvinyl-based polymers, would also be suitable. The invention relies on well-established formulation practice where binder polymers are selected based on their solubility and performance in high-boiling solvent systems to ensure proper viscosity, printability, and film formation. See also Figure 10.The products of the invention can be incorporated in wearable devices, biosensors (medical application), electronic circuits, electronic devices and textile garments.The inks of the present invention can be applied in printed electronics and circuit boards for a variety of applications:• Flexible and Printed Electronics: widely used in the fabrication of flexible and printed electronic circuits on flexible substrates, such as polyimide or PET films.• Prototyping and Rapid Iteration: used for rapid prototyping and iteration of electronic circuits on substrates, such as paper, plastic, or glass.• RFID Tags and Antennas: Carbon ink is used to print conductive traces and antennas on RFID (Radio Frequency Identification) tags and NFC (Near Field Communication) devices.• Flexible Interconnects: used to create flexible interconnects and connectors for electronic devices, especially in applications where traditional rigid PCBs (Printed Circuit Boards) are not suitable due to space constraints, mechanical flexibility requirements, or environmental factors.The inks of the present invention can be also used in smart fabrics, flexible electronic fabrics and e-textiles:• Wearable Technology: coated onto textiles to create flexible and stretchable electronic circuits, sensors, and electrodes. These wearable electronic textiles (etextiles) enable the integration ofelectronic functionalities into clothing, allowing for applications such as health monitoring, gesture recognition, and interactive garments.• Heating Elements: applications in heated clothing, heated car seats, medical devices, and other products requiring localized or distributed heating.• Electrostatic Discharge (ESD) Protection: applied to textiles to impart electrostatic discharge (ESD) protection properties. ESD-safe textiles are used in industries where static electricity can damage sensitive electronic components, such as semiconductor manufacturing and electronics assembly.• Smart Fabrics: capable of sensing various stimuli, such as touch, pressure, temperature, or humidity. These smart fabrics have applications in healthcare, sports monitoring, automotive interiors, and consumer electronics.Due to the low percentages of gold microparticles in the ink formulation, with most of the conductive particles being carbon-based, the cost is much lower than commercial gold sensors.The invention enables high analytical performance, and wearable devices to be developed. It would also provide advancements in the electronic circuits, electronic devices, and textile garments field.Other aspects and advantages of the invention will become apparent from the following detailed description, taken in conjunction with the accompanying drawings, illustrating by way of example the principles of the invention.Brief Description of the DrawingsEmbodiments of the invention will now be described, by way of example only, with reference to the accompanying drawings, in which:Figure 1. Cyclic voltammograms of screen-printed electrodes (working electrode), SPE carbon (counter electrode) and SPE Ag / AgCI (reference electrode) in 0.1 M sulfuric acid. Scan rate: 100 mV s-1. The C / G (Au) 1 SPE shows the higher electrochemical response compared to C / G (Au) 2 SPE.Figure 2. Amperometric i-t curves for a bare screen-printed carbon electrode (dash line; bottom line with the smallest step at about 120 sec on each of Figures 2A and 2B), and (A) C / G (Au) 1 (B) C / G (Au) 2 screen-printed electrodes functionalised with capture, 1pM target and probe DNA labelled with platinum nanoparticles (full sandwich assay, (A) thin and thick black lines (B) black and dashpoint lines).Figure 3. Nyquist plots of the blank SPE electrode before modification ((b) in Fig. 3A and (c) in Fig.3B) and after anti-E. coli modification ((a) in Fig. 3A and (a), (b) in Fig. 3B) are shown. Electrochemical impedance spectroscopy (EIS) measurements were carried out in 1 mM DPBS over a frequency range of 1 Hz to 1 x 106Hz, using an AC amplitude of 25 mV, with the DC potential set at the open-circuit potential.Figure 3.1 illustrates an ink formulation comprising SPE Au 1 comprising 10% Au as Au microparticles (Gold powder, spherical, APS 0.1 micron).Figure 3.2 illustrates an ink formulation comprising SPE Au 2 (with carboxy binder) - at 10% Au as Au microparticles (Gold powder, spherical, APS 0.1 micron).Figure 3.3 (of the invention) illustrates an ink formulation comprising 10% Au as Au microparticles (Gold powder, spherical, APS 1.5 - 3.0 micron). This figure shows SEM images of 10% AuF SPCE surface made with magnification and accelerating voltage used of (C)1.3 K, 1 kV using secondary electrons and (D) 1.3 k, 5 kV using SE (LA100).Figure 3.4 (of the invention) illustrates an ink formulation comprising 20% Au as Au microparticles (Gold powder, spherical, APS 1-1.5 micron).Figure 4.1. Cyclic voltammograms of (A) a conventional gold disk electrode, (C) 10% AuF SPCE and (E) 10% AuS SPCE in 0.01 M PBS with 1mM FcMeOH at scan rates from 0.005 V / s to 0.5 V / s. Graphs of peak current vs. square root of scan rate are depicted in Figures (B), (D) and (F). Error bars were estimated as triple of the standard deviation.Figure 4.2. SEM images of a 10% AuF SPCE surface made with secondary electrons. Magnification and accelerating voltage used was (A) 25 k, 1 kV (B), 25 k, 5 kV and (C) 22 k, 20 kV.Figure 4.3. SEM image of a 10% AuS SPCE surface generated by secondary electrons. Magnification and accelerating voltage used was 60 k, 1 kV. The gold particle were highlighted for clarity.Figure 4.4. SEM images of 10% AuS SPCE surface made with magnification and accelerating voltage of 5 k and 10 kV using (A) secondary electrons (B) secondary electrons (LA1000). SEM images of 10% AuF SPCE surface made with magnification and accelerating voltage using (C)1.3 K, 1 kV using secondary electrons and (D) 1.3 k, 5 kV using SE (LA100).Figure 4.5. Amperometric i-t curves for 10% AuF and AuS SPCEs functionalised with (A) 10 pM miRNA capture-probe strands, 1 pM of miRNA target stands, and 1 pM miRNA reporter-probe strands labelled with palladium nanocubes at an applied potential of -0.375 V in 0.01 M PBS and (B) 10 pM miRNA capture-probe strands, 100 nM of miRNA target strands and 4.6 pM miRNA reporterprobe strands labelled with AuNRDs at an applied potential of -0.250 V in 0.01 M PBS. The difference in current before and after the addition of 400 pM hydrogen peroxide is displayed in the graphs. Measurements were conducted in triplicate. The greatest response, in Figure 4.5A is about -16.5 for 10% AuS (spheres); the greatest response, in Figure 4.5B, is about -1.9 for 10% AuS (spheres). On each Figure, the lines (a) and (c) are bare electrodes using 10% Au (whether S(sphere) or F(flakes)).Figure 4.6. Representative amperometric i-t curves for 10% AuS and 20% AuS SPCEs functionalised with (A) 10 pM miRNA capture-probe strands, 1 pM of miRNA target strands, and 1 pM miRNA re porter- pro be strands labelled with PdNCBs at -0.375 V in 1 mM PBS and (B) 10 pM miRNA capture-probe strands, 100 nM of miRNA target strands and 4.6 pM miRNA reporter-probe strands labelled with gold nanorods at -0.25 V in 0.01 M PBS. The difference in current before and after the addition of 400 pM hydrogen peroxide is displayed. Measurements were conducted in triplicate. The greatest response, in both figures, is using 20% AuS with Pd or AU NRDS (nanorods) as labels. A lessor response can be observes, in both figures, for using 10% AuS with Pd or AU NRDS (nanorods) as labels.Figure 4.7. Cyclic voltammograms of a 20% AuS SPCE without any modification over the surface (line (a)). Cyclic voltammograms of a 20% AuS SPCE with 2 pL of (in Fig. 4.7A) palladium nanocubes, (in Fig. 4.7B) gold nanorods and (in Fig. 4.7C) platinum nanoparticles drop-casted on its surface. Electrolyte: 0.01 M of PBS with 400 pM of hydrogen peroxide. Scan rate: 0.05 V / s. Measurements were conducted in triplicate. In Figures 4.7A and 4.7C, there is an increase in the reduction peak (between -0.5 and -0.6) in the presence of hydrogen peroxide.Figure 4.8. Amperometric i-t curves of 20% AuS SPCEs functionalised with (A) 10 pM miRNA capture-probe strands, 1 pM of miRNA target stands and 1 pM miRNA reporter-probe strands labelled with PdNCBs; (B) 10 pM miRNA capture-probe strands, 100 nM of miRNA target strands, and 4.6 pM miRNA reporter-probe strands labelled with AuNRDs and (C) 10 pM miRNA captureprobe strands, 1 pM of miRNA target stands and 1 pM miRNA reporter-probe strands labelled with PtNPs (n=3). The studied potential window ranged from -0.1 to -0.5 V in 0.01 M PBS. The difference in current before and after the addition of 400 pM hydrogen peroxide is displayed in the graphs.Figure 4.9. TEM image of AuNRDs in citrate. Magnification and accelerating voltage used was 700k and 20kV, respectively.Figure 4.10. SEM image made with secondary electrons. Magnification of 90 k was used. Accelerating voltage of 25 kV.Figure 4.11. XRD pattern of Pd nanocubes with average size of 48.9 nm.Figure 4.12. SEM images of (A) 20% AuS SPCE without modification of the surface and (B) 20% AuS SPCE functionalised with full miRNA assay and PdNCBs labels. Magnification and accelerating voltage used is described in the respective images.Figure 5.1 presents a schematic diagram of the assembly of the labelled miRNA biosensor.Figure 5.2. Amperometric i-t curves for 20% AuS SPEs functionalized with 10 pM miRNA captureprobe strands following hybridisation with the indicated concentration of the target. The concentration of the reporter-probe labelled nanoparticles is 1 pM. The reporter-probe labelled nanoparticles are (A) gold nanorods, (B) palladium nanocubes, and (C) platinum nanoparticles (NPs). The applied potentials were (A) - 0.25V, (B) - 0.375V, and (C) - 0.5 V. The electrolyte was 0.01 M PBS and hydrogen peroxide was added at 300 s to give a final concentration of 400 pM. Measurements were conducted in triplicate,Figure 5.3. Calibration curves of the functionalized fully sandwich assay based on the amperometric variation of current and log concentration of the (A) miRNA-206, (B) miRNA-135a and (C) let-7b. Error bars were estimated as triple of the standard deviation (n = 3).Figure 5.4. Chronoamperometric curves show the current difference between a fully complementary strand at nM and pM (line (b) and line (d), respectively) and a 1-base mismatch strand (line (c) and line (e)) at the same concentrations. The fully complementary assay was labelled with gold nanorods. Potential applied is -0.25 V in 0.01 M PBS. The difference in current before and after the addition of 400 pM H2O2 is displayed. Measurements were performed in triplicate.Figure 5.5. Chronoamperometric curves show the current difference between a fully complementary strand at 1 nM and 1 pM (line (b) and line (d), respectively) and a 4-base mismatch strand (line (c) and line (e)) at the same concentrations. The fully complementary assay was labelled with gold nanorods. Potential applied is -0.25 V in 0.01 M PBS. The difference in current before and after the addition of 400 pM H2O2 is displayed. Measurements were performed in triplicate.Figure 5.6. Representative chronoamperometric curves of the current difference between a fully complementary strand at nM and pM and (A) 1-base mismatches strand and (B) 2-base mismatches at the same concentrations (n=3), for Let7b vs Let7g. The fully complementary assay was labelled with platinum nanoparticles. Potential applied is -0.50 V in 0.01 M PBS. The difference in current before and after the addition of 400 pM hydrogen peroxide is displayed.Figure 5.7. Chronoamperometric curves show the current difference between a fully complementary strand at nM and pM (line (b) and line (d)) and a 1-base mismatch strand (line (c) and line (e)) at the same concentrations (n=3). The fully complementary assay was labelled with palladium nanocubes. Potential applied is -0.375 V in 0.01 M PBS.The difference in current before and after the addition of 400 pM H2O2 is displayed. The red line is the lowest.Figure 5.8. Calibration curves of functionalized assays at a range of concentrations (from 1 pM to aM) of (A) miRNA-206; (B) miRNA-135a; (C) let-7b and 1 pM of miRNA reporter-probe without any interfering assay (squares) and in an environment where BSA is present (circles). The error bars were indicated on the curve (n = 3). Potential applied is (A) -0.25V; (B) -0.375 V; (C) -0.5V in 0.01 M PBS.Figure 5.9. Time dependence of the amperometric current response of the biosensor to two different concentrations (1 nM and 1 pM) of (A) miRNA-206; (B) miRNA-135a; (C) let-7b after storage at 4 °C for 21 days. The number next to each data point represents the average percent of response compared to the freshly prepared biosensors. Errors bars estimated as triple of the standard deviations (n=3).Figure 6. Cyclic voltammograms showing representative electrochemical responses of screen-printed electrodes fabricated using inks formulated with different organic solvents (1 isobutyl acetate, 2 propylene glycol monomethyl ether acetate, 3 diethylene glycol monoethyl ether acetate, 4 dihydrolevoglucosenone (Cyrene™)) and curing in low temperature. Variations in solvent boiling point alter evaporation rate and residual solvent content within the printed layer, which in turn affect film resistance and charge-transfer behaviour. Electrodes printed with higher-boiling point solvents exhibit suppressed electrochemical currents due to increased resistance associated with residual organic solvent. Measurements were performed in 1 mM ferrocene methanol in phosphate-buffered saline (PBS).Figure 7. Optical image of screen-printed electrode tracks showing mesh blockage caused by ink containing gold microstructures having dimension in the range of 7.8 to 9.5 pm. Particle agglomeration obstructs ink transfer through the screen, resulting in incomplete deposition and darkened tracks (such as those shown here); properly clean tracks should appear white.Figure 8. Cyclic voltammograms showing a comparison between screen-printed electrodes containing gold microstructures with maximum dimension in the ranges of 0.5-1.5 pm and 6.5-8.5 pm.Figure 9. Electrodes were printed using an ink formulation containing an 80:20 (v / v) ethyl acetate:isobutanol solvent blend (boiling points =77 °C and 108 °C, respectively). Following a 2-minute screen / mesh open time, rapid solvent evaporation led to surface drying of the ink on the screen / mesh, which hindered ink transfer and print uniformity. This behavior indicates that solvent systems dominated by lower boiling point components are unsuitable for maintaining adequate open time under these printing conditions.Figure 10. Optical images of screen-printable ink formulations developed using different polymer binders, together with their corresponding viscosities, illustrating variations in printed ink thickness or viscosity. Differences in binder chemistry and rheological behaviour influence ink transfer, wet film formation, and final dried layer thickness.Detailed Description of Exemplary EmbodimentsThe detailed description set forth below in connection with the appended drawings is intended as a description of presently preferred embodiments of the invention, and is not intended to represent the only forms in which the present invention may be practiced. It is to be understood that the same or equivalent functions may be accomplished by different embodiments that are intended to be encompassed within the scope of the invention.For example, the examples exemplify the sensitive and specific determination of certain miRNAs. However, the invention is not limited to the determination of miRNAs.The term "electrically conductive" as used herein refers to being capable of allowing the flow of electrical charges in one or more directions.The term "about" as used herein refers to both numbers in a range of numerals and is also used to indicate that a value includes the standard deviation of error for the device or method being employed to determine the value. The term "about" as used herein can allow for a degree of variability in a value or range, for example, within 10%, within 5%, or within 1 % of a stated value or of a stated limit of a range.Comparative ExampleFour inks were formulated based on a vinyl chloride co- and terpolymers resin. The ink base comprises carbon and graphite that define the bare working electrode and the counter electrode. The addition of gold nanoparticles to the ink formulation allows the immobilisation of antibodies and nucleic acids. Vinnol® resins were chosen as the binder due to their mechanical properties, ability to bind carbon, graphite and gold to a plastic substrate across a wide range of loadings as well as its dielectric properties. Di(propylene glycol) methyl ether and diethylene glycol monoethyl ether acetate are hydrophilic solvents that have 100% water solubility. They also have a relatively higher flash point making them easier to handle and store. Their mixture also effectively prevents particle coagulation and it has an intermediate evaporation rate. DBE-9 is a mix of refined dimethyl esters of adipic, glutaric, and succinic acids. Dimethyl esters of succinic, glutaric and adipic acids were determined to be "inherently biodegradable", however BOD data suggests that these materials are "readily biodegradable". The solvents used in the ink formulation, when discarded, are not a hazardous waste. A plasticiser was used as an additive to improve the flexibility / plasticity of the ink on the substrate.First, Vinnol® (E15 / 45 and H15 / 45M) resin was dissolved in di(propylene glycol) methyl ether (DPGME) I diethylene glycol monoethyl ether acetate (DEGEEA) and DBE-9, forming a viscous liquid. Then, the powder materials (carbon black and graphite) were mixed into the viscous liquid.Table 1 shows the weight % for each component for the four ink formulations.Table 1 :1. Viscosity MeasurementsUnderstanding the links between ink composition, rheology, surface wetting, printability, print quality, surface topography and electrochemical performance is important for the formulation of inks. For screen-printing inks in general, viscosity, i.e., the resistance to flow, is the most important rheological characteristic since it influences parameters such as the printing pressure, the stability of the ink under extended storage and the sharpness of the prints. The viscosity results are listed in the following table.Table 2. Viscosity measurements of the four ink formulations of Table 1 :2. Resistivity MeasurementsThe resistance of the screen-printed electrode dictates the reliability of the electrical signal. It is an important factor for the correct operation of the (bio)sensor. Table 3 presents the resistance values for the screen-printed electrodes using the ink formulations of Table 1. Typically, a lower resistance is favourable and generates a more stable potential and leads to a shorter sensor response time.Table 3. Resistance measurements of the SPEs.3. Cyclic VoltammetryFigure 1 shows the cyclic voltammogram of electrodes screen printed using the four ink formulations of Table 1 - C / G SPE, C / G CB SPE, C / G (Au) 1 SPE and C / G CB (Au) 2 SPE. A well-defined peak (electrochemical parameters listed in Table 4) can be observed, corresponding to the Au nanoparticles in the screen-printed electrode surface. The bare electrodes (C / G SPE and C / G CB SPE overlapped) did not show peaks with a low background current.Table 4. Electrochemical Parameters obtained from the cyclic voltammograms presented in Figure 1.AEp = | Epa- EPc| **E°= (Epa+ EPc) / 22.1 Electrocatalytic detection DNA assay of E. coll in clean buffer.The base sequences were as follows:Capture: SH - C3- 3’ CCGGTTCCTAA- 5’Target: 5’ - GGCCAAGGATTAGCTGTACAT - 3’Probe: 3’ - TGGACATGTA - 5’ - C3- SHDNA Probe Immobilization and Hybridization.Step 1: Monolayer of Capture Strand DNA. A monolayer of capture strand DNA was prepared on a freshly screen-printed electrode “C / G (Au) 1 and C / G (Au) 2 SPEs” by immersing these electrodes in 10 pM solution of the capture strand DNA dissolved in hybridization buffer. After 1 h at 30°C, the electrode was rinsed with deionized water for 10 s to remove loosely bound oligo.Step 2: Hybridization of Target Oligo to the Capture Surface. Hybridization of the target at concentration 1 pM to the immobilized capture strand was performed at 30°C in hybridization buffer for 1 h. Following hybridization, the modified electrode was rinsed thoroughly with deionized water.Step 3: Probe Hybridization. The nanoparticle labelled probe DNA was then hybridized to the complementary section of the target not used for binding to the capture strand for 1 h at 30 °C in hybridization Buffer. Finally, before quantitation, it was thoroughly washed with deionized water.Electrochemical Detection of E. coli DNA Target: Following assembly of the capture-target-nanoparticle labelled probe DNA sequence, the modified electrode was placed in an aqueous solution of 0.1 M H2SO4 and the current measured at -0.250 V after equilibration for 2 min. Then, sufficient hydrogen peroxide was added to give a final concentration of 200 pM and the reduction current associated with peroxide reduction at the bound PtNPs was measured at -0.250 V after 3 min. The analytical response was taken as the difference in current, Ai, measured before and after peroxide addition.Figure 2 shows the amperometric i-t curves for a bare screen-printed carbon electrode (blue line), and (A) C / G (Au) 1 (B) C / G (Au) 2 screen-printed electrodes functionalised with capture, 1pM target and probe DNA labelled with platinum nanoparticles (full sandwich assay, (A) black and green lines (B) purple and black lines). Potential applied is -0.250 V in 0.1 M H2SO4. The difference in current before and after the addition of H2O2 is displayed. In both Figures 2A & B, a response can be observed for C / G (Au) SPE A and B.2.2 Immobilisation of E. coli

[1011] on the SPE platform.The anti-E. coli antibody was attached by incubating the screen-printed carbon based electrodes containing a carboxy type of binder (Figure 3A) and gold nanoparticles (Figure 3B) with a 10 pL droplet of 0.1 mg / mL anti-E. coli antibody solution for 15 min at room temperature.EIS measurements were carried out at the open circuit potential, in 1 mM Dulbecco's phosphate-buffered saline (DPBS) in the frequency range of 1-1 e+6Hz, with a 25 mV amplitude using a three-electrode cell (all electrodes involved in the measurement were screen-printed) placed inside a Faraday cage.Nyquist plots (Figure 3) were used to study the change in charge transfer resistance (Ret) before (bare electrode) and after anti-E. coli immobilisation. The formation of a new semicircle (flat peak) in the experiments involving a screen-printed carbon based electrode without gold nanoparticles functionalisation can be observed (Figure 3A, black line). An increase in resistance for the screen-printed carbon based electrode with gold nanoparticles functionalisation can be observed (B. black and blue lines).Figure 3.1 illustrates SPE Au 1 - 10% Au - Au microparticles (Gold powder, spherical, APS 0.1 micron). Figure 3.2 illustrates SPE Au 2 (carboxy binder) - 10% Au - Au microparticles (Gold powder, spherical, APS 0.1 micron). Figures 3.3 and 3.4 illustrate, in contrast, ink formulations of the present invention.Comparative Example 1 demonstrates that the incorporation of gold nanoparticles to the sensor interface disimproves the signal-to-noise ratio (SNR), increases the background noise, and disimproves signal amplification.Example 1 - Development of labelled amperometric biosensors based on screen printed electrodes that contain different gold microstructures within the carbon ink.1 INTRODUCTIONNeurological diseases are debilitating conditions that affect the central and peripheral nervous systems, leading to severe disability and reduced quality of life. Early detection of these diseases is critical for a higher possibility in management of the disease, as well as, to improve the patient outcomes to treatment. The need for early detection of these diseases has driven the development of novel detection methods that are highly sensitive, rapid, and specific.MicroRNAs (miRNAs) are small non-coding RNA molecules that regulate gene expression and play a critical role in various biological processes, including neuronal development and function. Aberrant expression of miRNAs has been linked to several neurological disorders, including Alzheimer's disease and epilepsy. Therefore, the early detection of miRNAs associated with neurological diseases has significant clinical implications.Electrochemical techniques have become widely used in the detection of miRNAs due to their ease of operation, portability, low cost, and rapid results. Screen-printed electrodes (SPEs) have emerged as a popular platform for electrochemical sensing, e.g., for glucose monitoring in diabetic patients, due to their low cost, disposability, and ease of fabrication. Traditional SPEs are based on carbon containing inks but this example aims to improve the biosensor's performance by incorporating gold microstructures directly into the ink used for screen printing the working electrodes. This approach allows for easy modification, e.g., using thiol chemistry, of the SPE with functional biomolecules without additional surface modification steps. The integration of gold nanostructures directly into the ink could also lead to an increase in the electrochemical signal and sensitivity of the biosensor.In the present work, the electrochemical behaviour and the analytical performance of the in-house developed screen-printed electrodes with different compositions of gold particles mixed into a carbon-based ink was evaluated. The goal was to compare different screen-printed electrodes and nanoparticle labels to create an optimal miRNA biosensor platform for detecting biomarkers of neurological disease, such as miRNA-206. The response of the sensor was obtained through amperometry, and by analysing the reduction of hydrogen peroxide by the nanoparticles confined to the gold surface via complementary hybridization between the functionalized reporter-probe and the capture-probe -target.The electrocatalytic properties of metal nanoparticles for the reduction of hydrogen peroxide are highly dependent on their size and shape. AuNRDs have shown improved electrocatalytic activity due to their high aspect ratio, which results in a larger surface area capable to facilitate the reduction of hydrogen peroxide [1 ; Vigderman et al]. The optimal size for metal nanoparticles in electrocatalytic reduction of hydrogen peroxide is around 50 nm [2; Kleijn et al]. Therefore, by controlling the size and shape of metal nanoparticles one can optimize their electrocatalytic activity for hydrogen peroxide reduction, which is vital for various applications, including biosensors and fuel cells.The use of screen-printed carbon electrodes with integrated gold particles for the detection of miRNAs associated with neurological diseases could offer an excellent platform for early detection of neurological disorders. Moreover, they could simplify the fabrication process, by reducing the overall fabrication time, improve the reproducibility and scalability of the biosensor manufacturing process, and offer a greater potential for tailoring the incorporated gold structures to specific sizes and shapes optimized for the detection of various biomolecules and different applications.1.1 Experimental Procedures1.1.1 Materials and ChemicalsFerrocenemethanol (FcMcOH), phosphate buffer (PBS, pH 7.4), ethyl cellulose, dipropylene glycol monomethyl ether, alpha-terpineol, sulfuric acid (H2SO4, 95-98%), tris[2-carboxyethyl]phosphine (TCEP), hydrogen peroxide solution (H2O2, 3%), a solution (5%) of a a perfluorosulfonic acid polymer comprising a polytetrafluoroethylene backbone and perfluoroether side chains terminated with sulfonic acid groups, namely a copolymer of tetrafluoroethylene and perfluoro(3,6-dioxa-4-methyl-7-octenesulfonyl fluoride) in its hydrolyzed form (commercially available as Nation® 117), palladium (II) chloride (PdCh), hydrochloric acid (HCI), cetyltrimethylammonium bromide (CTAB) and ascorbic acid (AA) were purchased from Sigma Aldrich and used as received.Conductive Carbon Black (Ensaco®) and Graphite (Timrex®) were purchased from Imerys Graphite & Carbon (Bironico, Switzerland). Au microparticles (Gold powder, spherical or flakes, APS 1.5 - 3.0 micron) were obtained by Alfa Aesar (Lancashire, UK). For the Au microparticle flakes, the APS dimension refers to their maximum length.Nanoparticles used as labels in this study were obtained from nanoComposix. Specifically, gold nanorods measuring 50 nm x 15 nm in size with a zeta potential of -52 mV and a particle concentration of 4.30 x 1011parts / mL, as well as platinum nanoparticles measuring 50 nm ± 4 nm in size with a zeta potential of -40 mV and a particle concentration of 9.6 x 1011particles / mL, were used. All nanoparticles were citrate-stabilized and suspended in water. A third and final label used in this work was palladium nanocubes which were fabricated in-house. These nanocubes had an edge length of 50 nm and zeta potential of 38.6 ± 5.0 mV.All the aqueous solutions described herein, if it was not stated otherwise, were prepared using Milli-Q® water (Millipore® Core, 18 MO cm'1).The oligonucleotides (purity > 98%), RNase free water and TE buffer (10 mM Tris and 1 mM EDTA) used to prepare immobilization and hybridization solutions were purchased from IDT. The base sequences used were:Capture-probe (miRNA-206): 5’- / 5 HSMC6-D / C-CAC- ACA-CUU- 3’; (SEQ ID NO: 1)Target (Fully complementary): 3’- G-GUG-UGU-GAA-GGA-AUG-UAA-GGU- 5’; (SEQ ID NO: 2) Reporter-probe: 5’-CCU-UAC-AUU-CCA / 3ThioMC3-D / - 3’; (SEQ ID NO: 3)1.1.2 Synthesis of PdNCBs (50 nm in size)The synthesis of palladium nanocubes was based on the approach described by Niu et al. [3] and was initiated by preparing a solution of 10 mM H2PdCk. For this purpose, 0.1775 g of PdCh was added to a 10 mL volumetric flask that had been filled with 0.2 M HCI. Subsequently, the resulting solution was diluted to 100 mL of distilled water to achieve a final concentration of 10 mM.In the next step, 200 mL of 12.5 mM CTAB was prepared, and 12.5 mL of 10 mM H2PdCk solution was added. This was heated to 95 °C and kept under constant stirring. After a duration of 14 minutes, 2.5 mL of freshly prepared 100 mM ascorbic acid solution was introduced. The reaction was allowed to proceed for an additional 30 minutes.To separate the desired palladium nanocubes, the solution was subjected to centrifugation at 6000 rpm for 1 hour. The supernatant was carefully removed, leaving the solid residue, which was subsequently washed with DI water. This centrifugation and washing procedure was repeated two more times.1.1.3 Labelling of miRNA reporter-probes with PdNCBs and PtNPsTo prepare the PdNCBs and PtNPs for functionalization with miRNA reporter-probes, 1 mL of the specific nanomaterial was centrifuged with 1 mL of nuclease-free water at 6000 rpm for 10 minutes. After centrifugation, the excess water was carefully removed, leaving the nanoparticles as an aggregate in the Eppendorf tube.To achieve an optimal* nucleic acid density on the platinum spherical surface, 3140 pL of 1 pM miRNA reporter-probe (complementary to the target let-7b) was combined with 88 pL of 1.59 nM platinum nanoparticles. Similarly, for optimal nucleic acid coverage of the palladium cubic surface, 2409 pL of 1 pM miRNA reporter-probe (complementary to the target miRNA-135a) was mixed with150 pL of palladium nanocubes (4.72 nM). The immobilization of the labels to the specific miRNA reporter-probe was carried out at 37°C for 3 hours.Following the described procedure, 150 pL of the functionalized miRNA reporter-probe was added to an Eppendorf for subsequently hybridization with the complementary sandwich assay developed at screen-printed electrode (20% AuS SPCE). Detailed information regarding the development of the assay will be outlined in the subsequent section.*The volumes needed to functionalize about 40% of surface of the nanoparticles and nanocubes surfaces were calculated in accordance with their shape and size.1.1.4 Labelling of miRNA reporter-probe with AuNRDsPrior to functionalizing AuNRDs with miRNA reporter-probes, 15 mL of the specific nanomaterial was concentrated 10 times, by centrifugation at 6000 rpm for 10 minutes. The supernatant (approximately 14.85 mL) was removed from the solution leaving the nanoparticles as a precipitate in the Eppendorf. Subsequently, 150pL of 4.6 pM of miRNA reporter-probe was added to 150 pL of (7.14 nmol / L) of gold nanorods to form a ratio of [miRNAreporter-probe]i I [AuNRDs] = 640:1. After 1h of incubation, the gold nanorods functionalized miRNA reporter-probe required a salt aging step* to improve the adsorption capability of the conjugate miRNA reporter-probe to AuNRDs. Therefore, 1M NaCI was added dropwise to the solution to reach a final concentration of 50 mM. The solution was allowed to stabilize for 1h. The process was repeated until the salt concentration achieved 300 mM, over a 6-hr period. A vortex was used to fully mix the solutions following each addition.Following the described procedure, the hybridization of the miRNA reporter-probe with the complementary sandwich assay on a screen-printed carbon electrode (SPCE) occurred. The specific details of the assay development are outlined in the subsequent section.*lt is important to note that the salt aging process utilized in this work follows the methodology described by [2; Kleijn et al] The optimum molar ratio of the initial concentration of miRNA reporterprobe to AuNRDs ([miRNAreporter-Probe]i I [AuNRDs]) had been investigated (data not shown) because the optimal molar ratio between miRNA and total thiols co-absorbed on the gold electrode is important. This not only relates to regulating surface density but also to enhancing the efficacy of hybridization. This efficacy is, to some extent, influenced by the orientation of miRNA relative to the gold surface. Achieving maximal miRNA hybridization involves positioning the miRNA capture-probe at an approximate 90-degree angle from the surface, connected primarily through its thiol groups.Considering this, the impact of altering the [miRNA capture-probe]:[total thiol] ratio gains significance. Such modifications could induce changes in the local microenvironment within which hybridization takes place. At lower ratios, the capture-probe strands are more likely to be encompassed by MCH(mercaptohexanol). This introduces a distinct charge distribution and dielectric constant compared to higher ratios, where the capture-probe strands would be more densely packed and the interactions altered.In terms of orientation, it is expected that, in high molar miRNA fraction (e.g. 1 : 2 miRNA / total thiol), there will not be enough MCH to compete effectively with non-specific miRNA interactions and, although the miRNA coverage is high, the poor oligonucleotide orientation to the gold surface will result in low rates of hybridization. However, as the concentration of MCH increases (decreasing the molar fraction of miRNA), MCH competes with non-specific interactions of oligonucleotides (electrostatic interaction between the chemisorb capture-probe strand and the gold surface) more effectively and the orientation of the miRNA on the surface is improved. Eventually, MCH begins to dominate the surface and the miRNA coverage decreases. It is this balance between the ratios (i.e. coverage) and the molecular environment (e.g., orientation of the miRNA) that allows the maximum amount of hybridization of the target.Using a Varian Cary 50 UV-Vis spectrometer with a pathlength of 1 cm and a spectral range spanning from 200-1000 nm, the samples containing miRNA reporter-probe functionalized with AuNRDs at different molar ratios (i.e., 640:1, 960:1, 1280:1, and 6400:1 [miRNA reporter-probe]i I [AuNRDs] were recorded.The optimization of the miRNA reporter-probe to AuNRDs molar ratio was crucial for achieving successful and ultrasensitive miRNA detection in the biosensor. The use of a molar ratio of 960 :1 (~1 ,5x theoretical capacity) effectively prevented AuNRDs aggregation and led to high amperometric current responses. The salt aging procedure and careful control of the initial miRNA reporter-probe concentration were essential in stabilizing the conjugates, optimizing oligonucleotide loading, and preventing AuNRDs aggregation. Various molar ratios were tested, including 640 : 1, 960 : 1, 1280 : 1 , and 6400 : 1 , with 960 : 1 showing the best results. The deposition time for these experiments was standardized to 7 hours.1.1.5 Development of miRNA assay at screen printed electrodesIn this investigation, the setup incorporated the working electrode (WE), reference electrode (RE), and counter electrode (CE) printed together as a single unit. However, to prevent the unintended binding of miRNAs at the CE and RE during the immobilization and subsequent hybridization phases, the CE and RE electrodes were physically separated.To commence the development of the miRNA assay, we initially applied a monolayer of miRNA capture-probe onto the screen-printed electrode, which featured diverse combinations* of gold microstructures within the carbon ink. This process involved immersing the surface of the working electrode in an Eppendorf tube containing a 10 pM solution of the 5'-thiolated oligo. The sealedEppendorf tube was then incubated in an oven at 37°C for 80 minutes. Afterward, the electrode was thoroughly rinsed with nuclease-free water to eliminate any loosely attached or physiosorbed strands.Subsequently, the capture-probe-modified screen-printed electrode was exposed to different concentrations of the miRNA target (1 M when the electrode was functionalized with PdNCBs or PtNPs and 100 nM when functionalized with AuNRDs). This step facilitated the hybridization of the miRNA target's 3' end with the capture-probe strand, a process carried out for 20 minutes in an oven at 37°C. Once again, the electrode underwent a thorough washing with nuclease-free water.Finally, the free 5' end of the miRNA target was allowed to hybridize with its complementary sequence found in the miRNA reporter-probe functionalized with metal nanoparticles. This hybridization of the labeled miRNA reporter-probe to its complementary sequence transpired over a 5-hour duration at 37°C.Two crucial aspects require careful attention for the successful development of the miRNA assay. Firstly, the preparation of the working solution necessitates thorough consideration. To circumvent the adverse effects of freeze / thaw cycles, we drew multiple aliquots from stock solutions of oligonucleotides (100 pM) and stored them in the refrigerator until needed. Additionally, to obtain less concentrated standards, precise dilution in the TE buffer (comprising 10 mM Tris and 1 mM EDTA) was meticulously carried out.Secondly, the preparation of the immobilization buffer (miRNA capture-probe and reporter-probe) entails specific steps. We introduced TCEP (Tris [2-carboxyethyl] phosphine) in a 100-fold excess and allowed it to react for 2 hours. This crucial step ensures the reduction and liberation of thiol bonds from the capture-probe and reporter-probe oligos, thereby facilitating efficient immobilization on the metallic surfaces.*ln this study, various compositions of gold microstructures were blended with the screen-printed carbon ink of the SPCE to create electroactive adsorption sites, which were pivotal for the development of the fully complementary assay mentioned earlier. These compositions included 10% (w / w) and 20% (w / w) gold microspheres (2 pm) mixed with the screen-printed carbon ink, as well as 10% (w / w) and 20% (w / w) gold microflakes (maximum dimension of 2 pm).1.1.6 Drop-casting of metal nanoparticlesIn order to get an insight into the electrocatalytic properties of the nanoparticles developed to act as labels, they were drop cast onto the electrode surface. The PdNCBs, AuNRDs and PtNPs were drop cast on a screen-printed electrode that contained 20% (w / w) of gold microspheres mixed to the carbon ink (referred as 20% AuS SPCE) following a washing step. Hence, 1 mL of the nanoparticles were centrifuged with 1 mL of nuclease free water at 6000 rpm for 10 minutes. The excess waterwas removed from the solution leaving the nanomaterials in the bottom of the Eppendorf. Then, the Eppendorfwas oven dried at 80°C for 15 minutes. Finally, 50 pL of Nation® 117 solution (5%), a 5% (w / v) solution of the hydrolyzed form of a tetrafluoroethylene-perfluoro(3,6-dioxa-4-methyl-7-octenesulfonyl fluoride) copolymer was added to the nanoparticles and 5 pL of this solution was drop-casted on to the 20% AuS SPCE surface. Electrochemical measurements were carried out after complete evaporation of the solvent present at the SPCE.1.1.7 Electrochemical Analysis1.1.7.1 Voltametric AnalysisScan rate studies of a conventional gold electrode and SPCEs with different gold nanoparticles shapes within the carbon ink such as, 10% (w / w) gold microspheres (referred as 10% AuS SPCE) and 10% (w / w) microflakes (referred as 10% AuF SPCE), were performed. Cyclic voltammetry (CV) curves were obtained between -0.5 to +0.9 V over a range of scan rates, from 0.05 to 0.50 V s-1. The electrodes were placed in a three-electrode cell filled with 0.01 M of PBS solution and 1 mM of ferrocene methanol (FcMeOH). All electrochemical measurements were performed in triplicate. The solutions were vigorously deoxygenated with nitrogen to remove oxygen prior to analysis.1.1.7.2 Amperometric detection of miRNA-206After functionalizing the screen printed carbon electrode surface with the capture-probe — target — labelled reporter-probe assay, the working electrode, reference electrode, and counter electrode were assembled together and immersed in a small cell filled with 7.2 mL of 0.01 M PBS solution. Amperometry was employed as the detection method to identify the presence of the metal nanoparticles and hence the target concentration.Initially, the current was measured at the identified specific potentials for each type of nanoparticle: -0.375V for PdNCBs, -0.25V for AuNRDs, and -0.5V for PtNPs. The current was allowed to stabilize for 5 min. Following that, 3.27 pL of hydrogen peroxide (3% w / v) was introduced into the PBS solution to achieve a final concentration of 400 pM. Stirring was employed for 1 min, upon addition of hydrogen peroxide.Subsequently, the current associated with the reduction of hydrogen peroxide by the nanoparticles was measured after 20 minutes. The analytical response was determined by calculating the difference in current (Ai) observed before and after the addition of hydrogen peroxide.1.1.8 InstrumentationElectrochemical measurements were carried out using a CHI760D electrochemistry workstation at room temperature (22+2 °C). For the measurements using a conventional gold disc working electrode(diameter, <t> = 2 mm) a three-electrode cell was used. The silver / silver chloride electrode (Ag / AgCI in 3 M KCI) and a platinum wire acted as a reference and counter electrode, respectively.A screen-printed carbon / graphite / gold nanoparticles* working electrodes (diameter, <t> = 3 mm) were fabricated in-house with appropriate stencil designs using a DEK Horizon APiX screen-printing machine (Maxem, IE) by Dr Loanda Cumba, DCU. For the electrochemical measurements applying SPCEs, a screen-printed Ag / AgCI was used as a pseudo-reference and carbon / graphite as a counter electrode.‘Specifically, the composition of the 10% Au SPCE was ethyl cellulose (5.85%), dipropylene glycol monomethyl ether (30.60%), alpha-terpineol (26.10%), carbon black (8.55%), graphite (18.90%) and gold microparticles (spheres or flakes, 10%).The 20% AuS SPCE contained: ethyl cellulose (5.20%), dipropylene glycol monomethyl ether (27.20%); alpha-terpineol (23.20%), carbon black (7.60%), graphite (16.80%) and Au microspheres (AuS; spheres, 20%).1.1.9 Microscopic measurements1.1.9.1 TEM and SEMThe formation and shapes of AuNRDs was observed by high-resolution transmission electron microscopy (HRTEM, JEM-2200FS, JEOL, Japan). Scanning electron microscopy (SEM) was performed using a Hitachi S-3400N scanning electron microscope. It was used to evaluate the structure of SPCE with different gold microparticles mixed to the carbon ink, as well as the formation of synthesized palladium nanocubes.1.1.10 Spectroscopic measurements1.1.10.1 DLS and Zeta potentialDynamic Light Scattering (DLS) and zeta potential was performed at 25=C on a Nanosizer NanoZS (Malvern Instruments, Malvern U.K.) using a detection angle of 90 degrees.1.1.11 Estimation of the heterogeneous electron transfer (ko) and the diffusion coefficient (D) from CV:In this work, the determination of the standard heterogeneous electron transfer rate constant, ko, was experimentally obtained using cyclic voltammetry. The method, improved by Nicholson [4], involves investigating the peak-to-peak separation (AE) of a redox couple in solution as a function of scan rate.To simplify Nicholson's method, Lavagnini et al. [5] introduced the dimensionless parameter qi (psi), calculated using Equation 4.1. This parameter was subsequently correlated with Equation 4.2, which describes the relationship between ko andBy manipulating these equations mathematically, thevalue of kO can be directly obtained from the slope of theversus f graph.Equation 4.1Equation 4.1 can also be represented as qi = (-0.6288+0.0021 AEp) / (1-0.017 AEp)Equation 4.2Equation 4.2 can also be represented as qi = kosqrt[(RT) / (jrnFD)] v1 / 2It is important to note that this method specifically applies to reversible or quasi-reversible systems. The diffusion coefficient (£>) was determined using the Randles-Sevcik equation, described below.Equation 4.3Equation 4.3 can also be represented as iP= 2.687 x105n3 / 2ACDV2v1 / 2Where, D is the diffusion coefficient of electroactive species (cm2s-1), n is the number of electrons transferred in the reaction, F is the Faraday constant (C mol-1), R is the molar gas constant (JK-1mol_1), Tis the absolute temperature (K), C is the concentration of the redox species in solution (mol cur3) and A is the area of the working electrode (cm2). As a result, the constant has units of C mol-1V-1.1.2 Results and Discussion1.2.1 Evaluation of the Electrochemical Behaviour of SPCE with different gold structures mixed to the carbon inkTwo distinct screen printed carbon electrodes (SPCE) were fabricated, each incorporating different gold particle structures within the carbon ink. Both electrodes comprised 10% (w / w) gold microstructures (2 pm) blended into the carbon-based ink. SPCEi utilized gold microspheres (AuS) alongside graphite as a conductive pathway (denoted 10% AuS SPCE). On the other hand, SPCE2 deviated from SPCEi by incorporating gold microflakes, in place of gold microspheres, within the screen-printed carbon ink (10% AuF SPCE). Despite this difference, both SPCEi and SPCE2 shared a common feature — a precisely formulated ink with an optimized composition, maintaining an identical proportion of base materials (carbon / graphite).Metallic functionalization of the transducer platform was used with the purpose of creating an electroactive surface area available for capture-probe strand immobilisation. If the sensing phase have more sites available to bind with the full miRNA assay, higher is it sensitivity, leading to an overall improvement of the analytical performance of the sensor.Additional features as enhancement of electron transfer properties and decreasing of the resistance of the surface, provided by the gold particles, was assessed through scan rate studies of the 10% AuS SPCE and 10% AuF SPCE platform. Each electrode was immersed in a solution of 1 mM ferrocene methanol in 0.01 M PBS. The electrochemical behaviour of the benchmark redox species was recorded by cyclic voltammetry applying scans from -0.5 V to +0.9 V at rates from 0.005 V / s to 0.5 V / s.Figure 4.1 compares the scan rate studies of (A) a conventional gold electrode, (C) 10% AuF SPCE and (E) 10% AuS SPCE. Table 4.1 presents the analysis of the cyclic voltammograms in regards of peak-to peak potential (AEP). The peak current densities of the oxidation and reduction processes and the diffusion behaviour of the redox species was also evaluated through its corresponding graphs of peak current vs. square root of scan rates.Table 4.1. Average of the peak-to-peak potentials obtained from scan rate studies of conventional gold electrode, 10% AuF SPCE and 10% AuS SPCE in FcMeOH and 0.01 M PBS.A conventional gold electrode was selected as an exemplary representation of ideal electron transfer properties sought after in the sensing phase. Consequently, when ferrocene methanol was introduced to this system, a quasi-reversible reaction was observed. It is important to discuss the factors that contribute to the lack of full reversibility in this context. In a truly reversible system, the AEp (peak separation) would ideally remain constant or display minimal variation with increasing scan rate. However, in this case, the AEp exhibited an increase from 82 mV to 190 mV (AEP> 57 / n (mV)) as the scan rate escalated from 0.005 V / s to 0.5 V / s. The quasi-reversible nature of the reaction can be attributed to a combination of factors such as surface heterogeneity, kinetic limitations, or other influences that hinder the complete reversibility of the electrochemical process. Additionally, the plot demonstrating the linear relationship between ip (peak current) versus v1 / 2(square root of the scan rate) signifies that the transport of ions to and from the electrode is predominantly governed by diffusion, as expected in a quasi-reversible system.Each of the in-house developed SPCEs exhibited distinct electron transfer properties when exposed to ferrocene methanol, with the SPCE containing 10% AuS SPCE demonstrating the most reversible behaviour. The greater reversibility and reduced AEp (98 mV to 245 mV for 10% AuF SPCE versus 96 mV to 218 mV for 10% AuS SPCE) suggest that the platform incorporating 10% (w / w) gold microspheres possesses higher electronic transfer kinetics.It is important to consider the role of the iR drop in this context. The iR drop, which accounts for the resistance associated with the electrode-electrolyte interface, can influence the observed electrochemical behaviour. A larger AEp indicates a higher iR drop, which can impede the electron transfer process and result in slower kinetics. Consequently, the SPCE with 10% (w / w) gold microflakes experienced a higher AEp, suggesting a larger iR drop and consequently slower electron transfer kinetics compared to the 10% AuS SPCE.Moreover, the 10% AuS SPCE demonstrated the highest iPvalues (peak current) and the lowest overvoltage among the in-house electrodes. These characteristics further support the superior electronic transfer properties of the 10% AuS SPCE, indicating its enhanced ability to facilitate efficient electron transfer with minimal overpotential.The heterogeneous electron transfer (ko) values were calculated as described above and are given in Table 4.2. Differently from ordinary Nernstian one electron reaction, AEp for SPCEs are expected to be greater than 57 mV and koto be lower than conventional gold electrodes

[0015] , 10% AuS SPCE and 10% AuF SPCE presented values 220-fold and 300-fold lower than the obtained for conventional gold, respectively. The decrease in reactivity of the surfaces is due the composition of the ink being only partially made of conductive carbon particle and smaller percentage of gold.Table 4.2. Average heterogeneous electrons transfer rate (ko) for conventional gold electrode, 10% AuS SPCE and 10% AuF SPCE. Average values and standard deviations were calculated from triplicate measurements (n=3).Considering that the resistance to charge transfer (Ret) is inversely proportional to the heterogeneous electron transfer rate (ko), it can be inferred that the 10% AuS SPCE exhibits lower resistance compared to the 10% AuS SPCE. This disparity in resistance can be attributed to a specific effect observed during the electrode drying process. It is proposed that the ink used in the 10% AuF SPCE partially floods and covers the flat gold microflakes, which in turn hinders their electrochemical activity. Conversely, this phenomenon does not significantly affect the SPEs with gold microspheres. This is thought to be because the gold microspheres are partially embedded within the ink while remaining exposed on the SPCE surface, resulting in a distinct distribution. Consequently, the 10% AuS SPEs exhibit a larger electrochemical surface area compared to the 10% AuF SPEs. This expanded surface area enables increased interaction with the analyte and promotes more efficient electron transfer during electrochemical reactions.The validity of this theory is supported by the SEM image presented in Figure 4.3, which clearly demonstrates that gold particles with a flake structure possess a reduced extent of exposure fortheir electroactive surface area. The presence of a discernible "halo" in Figure 4.3 B, where SEM secondary electrons are emitted at a higher voltage, penetrating deeper into the surface, provides evidence that the carbon from the ink partially covers the flat gold microflakes. This phenomenon may contribute to variations in the electroactive surface area, potentially affecting the electron transfer process.In contrast, such a phenomenon is not observed with the 10% AuS SPCE, as depicted in Figure 4.4.In this case, the distribution of the gold microspheres is characterized by approximately half of each sphere being embedded within the ink, while the remaining half is exposed on the SPCE surface. When comparing the different SPCE platforms, the superior reversibility of the redox probe, enhanced electron transfer, and higher current density observed in the 10% AuS SPCE can be attributed to the lower resistance encountered in its conducting path.SEM images were also utilized to assess the size and dispersion of particles on the surfaces of both 10% AuS SPCE and 10% AuF SPCE (Figure 4.4A and C, respectively). These images revealed a homogeneous distribution of gold nanoparticles on both surfaces, indicating a uniform arrangement. It is important to avoid agglomeration of microparticles since it leads to their transformation intolarger particles, resulting in a reduction of the available surface area. Consequently, maintaining a good dispersion of the metal microparticles becomes essential.In this regard, the proper dispersion of gold microparticles plays a significant role in enhancing the overall chemical activity and responsiveness of the gold sphere substrate. Specifically, when considering electrochemical reactions occurring at the surface of the gold microspheres, such as electron transfer processes or interactions with analytes, achieving a good dispersion becomes crucial. This ensures the efficient utilization of the entire surface area of the gold microspheres, promoting increased contact and interaction with reactants or species involved in the electrochemical reactions. As a result, this improved dispersion contributes to enhancing the efficiency and effectiveness of the electrochemical processes taking place on the gold sphere substrate.1.2.2 Analytical Performance of the 10% AuS SPCE and 10% AuF SPCEThe analytical performance of the SPCEs with different shapes of gold nanostructures within its carbon ink were investigated to elucidate how the different nanostructured platforms affect the sensitivity of the biosensor.The magnitude of the signal difference (Ai) between bare SPCEs and SPCEs functionalized with a fully complementary miRNA assay, utilizing either palladium nanocubes (PdNCBs) or gold nanorods (AuNRDs) as labels, was rigorously assessed. This evaluation involved measuring the reduction behaviour of the platforms before and after the addition of 400 pM hydrogen peroxide in a 0.01 M PBS solution. For the electrodes labelled with PdNCBs, a potential of -0.375 V was applied, while a potential of -0.250 V was applied to the electrodes with AuNRDs labels.The metallic labels were used to amplify the signal of the target miRNAs. As the concentration of miRNA target increases, the number of nanoparticle functionalised miRNA reporter-probe increases and a proportional increase of the reduction current of hydrogen peroxide is expected to occur.Figure 4.5 shows the comparison of the current responses (Ai) of 10% AuS SPCE and 10% AuF SPCE functionalized electrode where the reporter-probe label is (A) palladium nanocubes and (B) gold nanorods. A fixed potential was used for the specific particles and the final analytical signal was evaluated after hydrogen peroxide injections.Table 4.3. Changes in the current before and after the injection of 400 pM hydrogen peroxide in 10% AuS SPCE and 10% AuF SPCE functionalised with a full sandwich assay and PdNCBs. Average values and standard deviations were calculated from triplicate measurements (n=3).Table 4.4. Changes in the current before and after the injection of 400 pM hydrogen peroxide in 10% AuS SPCE and 10% AuF SPCE functionalised with a full sandwich assay and AuNRDs. Average values and standard deviations were calculated from triplicate measurements (n=3).The electrocatalytic properties of nanoparticles can be finely tuned by the changes in surface atoms and / or surface structures. Hence, the different type and shapes of the labels were also explored at this work to enhance the performance of the sensor. It was observed that the analytical signal of 10% AuS SPCE platform hybridised with full miRNA assay labelled with PdNCBs was 10-fold higher than that found the same platform where the label was AuNRD. For 10% AuF SPCE, the full assay labelled with PdNCBs presented an enhancement of signal of approximately! 4-fold when compared to the same platform labelled with AuNRDs. Overall, 10% AuS SPCE platform presented the highest sensitivity in terms of current density while 10% AuF SPCE exhibited the lowest values. The 10% AuS also showed a greater signal to noise (S / N) ratio. This result correlates with the voltammetric behaviour.It is expected that palladium nanocubes would be more electrocatalytic than gold nanorods as they have major (1 00) exposed facets which can make them more reactive. This phenomenon occurs as a result of the high index surface structure. So, in summary, the excellent response of the 10% AuS SPCE platforms functionalised with PdNCBs is attributed to the synergetic effects of increased surface area for biomolecules adsorption (effect generated by particles onto the platform) and enhancement of metal catalytic activity.Regarding the background signal of 10% AuS SPCE and 10% AuF SPCE, the current intensities are around 8 X 10-8A which is not a significant value in comparison with the analytical signals obtained. Thus, the optimised ink recipe forms a surface capable of distinguishing between the signal of miRNA target and bare gold SPCE electrodes.1.2.3 Enhancement of the analytical performance of AuS SPCEsThe in-house 10% AuS SPCE developed has the best charge transfer properties towards ferrocene methanol when compared with 10% AuF SPCE platform. However, its behaviours (i.e., ko, Ret) are far from the ideal. Two parameters can be optimised in order to enhance this exchange of electrons, the conducting path and the carbon composition. As graphite has already excellent conductivity properties, a higher percentage of gold microspheres (20% in weight / weight) mixed to the WE ink was studied.In chronoamperometry, the electric potential of the working electrode is stepped and the resulting current from faradaic processes occurring at the electrode (caused by the potential step) is monitored as a function of time. The functional relationship between current response and time is measured after applying single or double potential step to the working electrode of the electrochemical system.Figure 4.6 shows the comparison of the chronoamperometric response of 10% AuS SPCEs and 20% AuS SPCEs functionalised with full miRNA assay labelled with (A) PdNCBs and (B) AuNRDs before and after the addition of 400 pM hydrogen peroxide. Tables 4.5 and 4.6 shows the difference in current density data obtained from Figure 4.6.Table 4.5. Changes in the current before and after the injection of hydrogen peroxide of 10% AuS SPCE and 20% AuS SPCE with full sandwich assay functionalised with PdNCBs. Average values and standard deviations were calculated from triplicate measurements.Table 4.6. Changes in the current before and after the injection of hydrogen peroxide of 10% AuS SPCE and 20% AuS SPCE with full sandwich assay functionalised with AuNRDs. Average values and standard deviations were calculated from triplicate measurements.The response of the biosensor was produced by the reduction of hydrogen peroxide by the nanoparticles confined in the electrode surface via hybridization process with miRNA target. The measurements conducted on 10% AuS SPCEs resulted in a delta current density (Ai) of -0.144 ± 0.015 pA when labelled with AuNRDs, whereas it was -1.50 x ± 0.18 pA when labelled with PdNCBs. For 20% AuS SPCEs labelled with AuNRDs, the delta current density (Ai) was found to be -8.08 ± 0.21 pA, whereas it was -18 ± 0.03 pA when the platform was functionalized with PdNCBs.As expected, the 20% AuS SPCE platform outperformed the 10% AuS SPCE, providing significant signal amplification with a 56-fold enhancement for the full assay when AuNRDs labels are used and a 12-fold enhancement for the sandwich assay using PdNCBs. The remarkable difference in sensitivity can be attributed to the substantial electrocatalytic surface-to-volume ratio achieved by incorporating gold nanoparticles onto the SPCE surface, summed to the catalytic effects of the different nanoparticles. This successful combination led to a satisfactory signal enhancement when an extra 10% of material was added to the SPE matrix.To ensure the reliability of the findings, all experiments were repeated in triplicate, and the obtained reduction currents (specific to each system) consistently displayed minimal deviations, within < 5%. These results demonstrate the high reproducibility of the platforms, instilling confidence in their potential for practical use in biosensing applications.Considering that the ultimate goal is to create a point-of-care, close to the patient device, it becomes essential to strike a balance between development costs and sensitivity. These results show promise that a multiplexed electrochemical biosensor for detecting miRNAs associated with neurological diseases could be successfully fabricated using 20% AuS SPCE.1.2.4 Optimisation of the studied conditions1.2.4.1 Studies of the optimal potential for hydrogen peroxide reductionTo create point of care biosensors with a greater degree of accuracy, it is imperative to design a platform capable of detecting multi-analytes. As specified in the previous sections, the amplification of miRNA target signal occurs through the reduction of hydrogen peroxide by the different nanoparticles. Considering that each nanoparticle label is linked to a miRNA target, the differentiation between biomarkers relies on the ability of the nanoparticle to electrocatalyse the reduction of hydrogen peroxide at distinct potentials if the multianalyte assay was to be implemented on a single sensor surface, i.e., the different capture-probe miRNA deposited on a single sensor. The need for different reduction potentials for peroxide would not be needed if the sensors for each miRNA type were physically separated within a microfluidic device.An optimum potential for hydrogen peroxide reduction was investigated using two techniques, cyclic voltammetry and amperometry. The surface of 20% AuS SPCEs was saturated with either PdNCBs, AuNRDs or PtNPs through drop-casting, as detailed above in this Example. CVs were obtained before and after the injection of 400 pM hydrogen peroxide in 0.01 M degassed PBS solution.Through evaluation of the label’s redox peak shapes in a blank PBS solution, one can see a well-developed cathodic voltammetric peak, suggesting that the mechanism of the hydrogen peroxide reduction reaction process (HPRR) is likely initiated through the reduction of oxygen traces adsorbed on the surface of the nanoparticles. Specifically, the assessment of the PdNCBs peaks at the SPCE surface (Figure 4.7A), presented a composition of two overlapping peaks positioned at about -0.200 V and -0.375 V. Overlapping of two distinct peaks also occurs when AuNRDs and PtNPs were analysed, suggesting that the reduction of oxygen at the nanoparticles’ surface may proceed as a two-step process of adsorbed species. The proposed mechanism begins with adsorbed oxygen (O2 (ads)) and a subsequent electrochemical formation of adsorbed hydrogen peroxide which will be reduced to adsorbed hydroxide ions.While these observations provide valuable evidence for the proposed reaction mechanism, it is important to acknowledge that electrochemical reactions can be complex, and other factors may also influence the observed behaviour. To gain a more comprehensive understanding of the adsorbed species and their involvement in the reduction process, it is strongly advised to conduct further investigations using complementary techniques, such as in situ spectroscopy or surface analysis. These advanced techniques can offer deeper insights into the interactions occurring at the nanoparticles' surface and shed light on any intermediate species involved in the reaction. Moreover, exploring different experimental conditions, such as varying pH levels or electrolyte compositions, will be instrumental in unravelling the intricacies of the reaction. By systematically varying these parameters, we can uncover how the reaction kinetics, electron transfer rates, and adsorptionprocesses are influenced, ultimately contributing to a more comprehensive understanding of the overall mechanism.Figure 4.8 shows the reduction of hydrogen peroxide by the three studied labels. The reduction of the hydrogen peroxide by the PdNCBs started at -0.12V and achieved a maximum value at -0.5V. The reduction of hydrogen peroxide by AuNRDs started at -0.25V and presented a maximum current at an EPvalue of -0.45 V. Finally, the reduction of the hydrogen peroxide by PtNPs presented a starting point at -0.15 V and a maximum reduction current at -0.57 V.Numerous definitions for what is considered the onset of a reduction potential can be found in the literature. Some authors indicate that the reduction occurs when the current density is bigger than 10 pA / cm2, others indicate that the current itself should be 10 pA. However, the applied experimental conditions will produce variations to this value. To analyse the window of potentials previously defined by CVs, i.e. from -0.1 to -0.5, SPCEs functionalised with the full miRNA assay and the nanoparticle labels were placed in a 3-electrode cell. Measurements using a technique with greater sensitivity, as amperometric i-t curves, was produced before and after addition of 400hydrogen peroxide in 0.01 M PBS.Table 4.7. Summary of the changes in the current before and after the injection of hydrogen peroxide in a blank 20% AuS SPCE and in 20% AuS SPCE functionalised with a full sandwich assay and PdNCBs; AuNRDs or PtNPs at different applied potentials. Average and standard deviations were calculated from triplicate measurements.Figure 4.8 shows that the efficiency of the electrocatalytic current increases as the applied potential is made more negative (shifted in the anodic direction) with a slightly decrease after achieving a maximum, specific potential (EP). Hence, the EPwhen AuNRDs, PdNCBs and PtNPs was used as labels was -0.25 V, -0.375V and -0.5V, respectively.It is valid to note that, in this measurement (i.e. amperometric i-t curves), nanoparticles are brought to the SPCE surface via miRNA reporter-probe functionalization instead of being deposited onto SPCE surface (i.e. CV measurements). Direct deposition might lead to a different distribution and packing of the nanoparticles on the electrode surface compared to the functionalization process used in the assay. The specific arrangement of the labels can influence the electrochemical reaction kinetics which may result in slight shift in the observed onset potential between the two techniques.1.2.5 Characterization of Metal nanomaterialsThe electrocatalytic activity of noble nanoparticles towards the reduction of hydrogen peroxide can be enhanced through the modulation of their specific sizes and shapes. According to the literature, gold nanoparticles with approximately 50 nm in length and rod shapes acts not only as a satisfactory electrocatalyst agent for peroxides but also have optical properties that can be explored throughout other techniques, such as ECL [6; Mayer et al]. The optical properties, tuneable surface chemistry, and compatibility with biomolecules (DNA, miRNA) give greater designs possibilities for the development of multiplexed sensing technologies.It is worth mentioning that the gold nanoparticles (AuNRDs) were procured from nanoComposix. The morphological validation of the nanoparticles was thoroughly investigated using various characterization techniques, including Transmission Electron Microscopy (TEM), Dynamic Light Scattering (DLS), and zeta potential measurements. These rigorous assessments ensured that the nanoparticles possessed the desired size, shape, and stability required for their successful implementation in the electrochemical sensing platform.1.2.5.1 Morphology of AuNRDs: Correlation between TEM, DLS and zeta potentialFigure 4.9 displays a Bright-field Scanning Transmission Electron Microscopy (TEM) image of the gold nanorod labels. This TEM image reveals clear lattice fringes, confirming the single crystalline nature of the nanorods. In the Bright-field TEM mode, the image formation relies on transmitted electrons, which interact differently with regions of varying electron densities in the crystal lattice, resulting in distinguishable brighter or darker areas. Consequently, this mode allowed for the identification of distinct lattice fringes in the gold nanorods. The presence of regular and repeating atomic arrangements (lattice fringes) in the image is a characteristic feature of crystalline materials. Therefore, as anticipated, the analysed nanoparticles displayed a uniform rod-like shape, with an average size of approximately 50 nm, corroborating their single crystalline nature.The population analysis for the nanorods, i.e., DLS measurements was also performed. A single, monodisperse population of 46.6 ± 2.6 nm was observed, confirming TEM size analyses and indicating no significant aggregation. The charge of the particles was also measured by zeta potential and presented a value of -55.5 ± 3.0 mV. All parameters were in agreement with the certificate of analysis provide by nanoComposix.1.2.6 Fabrication and Characterization of Pd Nanocubes labelsThe methodology used to synthetise palladium nanocubes is similar to the one reported by Niu et al.[3], As detailed above in this example, through one step reduction, 22 nm palladium nanocubes were formed. Cetyltrimethylammonium bromide (CTAB), dihydrogentetrachloropalladate(ll) (H2PdCk), and ascorbic acid (AA) was further used as growth solutions. However, the biggest difference encountered at this procedure relies in the usage of a higher reaction temperature (95 °C) and a different growing time. Variations in these parameters are expected to generate an optimum (electrocatalytic) size for palladium particles, such as 50 nm, besides the specific cubic shapes. Size distribution is another parameter tuned by the modulation of these reaction conditions.1.2.6.1 SEM of PdNCBsThe morphology of the as-synthesized PdNCBs were assessed through scanning electron microscopy (SEM). Figure 4.10 demonstrates the successful formation of cubic palladium nanocrystals. Through the secondary electron emissions, the structure of the surface could be easily evaluated. The PdNCBs presented approximately 50 nm in size and a uniform surface distribution with no signs of aggregation. In addition, the particles presented sharp edges and corners and well-defined and smooth faces.The edge length of the PdNCBs was confirmed using a Malvern Zetasizer Nano Zs and the DLS response received was 44.0 ± 4.0 nm. The charge of the particles was also measured with zeta potential given a value of 38.6 ± 5.0 mV.The observed results align with the Ostwald ripening theory [7; Ostwald] and previous experimental investigations [8; Voorhees], [9; Ganesan et al]. By controlling the reaction time and increasing the reaction temperature, it was expected that the particle size would increase while leading to a narrower size distribution. The obtained SEM and DLS data provided substantial evidence supporting this theory, confirming the successful control of particle size and distribution.1.2.6.2 XRD of Palladium nanocubesThe structure of the as-obtained Pd nanocubes was also characterized by X-ray diffraction (XRD).Figure 4.11 illustrates the XRD pattern for the 50 nm Pd nanocubes. The diffraction peaks can be observed at angles of 40.0, 46.5, and 67.9 assigned to the (111), (200) and (220) planes of Pd, respectively. In accordance with the JCPDS card (File No. 46-1043) these peaks represent a face-centred cubic structure (fee) of bulk Pd. An average diameter was calculated from the line broadening of (111) reflection and the Sherrer’s formula. Nanoparticle size of approximately 48.9 nm was obtained, which is consistent with the SEM and DLS results.The intensity ratio of (111) to (200) peak was evaluated and compared to the standard value calculated from JCPDS data. A negligible decrease from 2.38 to 2.05 was achieved, which indicates that reflection of (100) planes dominate in Pd nanocubes.The formation of palladium nanostructures with (100) facets is justified by the usage of CTAB as surfactant in the synthesis. Previous reports demonstrate that bromide anions (Br) acts as an effective etchant, adsorbing on the surface of the palladium seeds, controlling the growth of Pd nanocubes and altering the order of surface free energies to y(110) < y(111) < y(100). Therefore, the anisotropic growth of Pd nanocrystals leads to the formation of thermodynamically favoured (100) facets.Others synthesis conditions as the usage of high temperature (95 °C) and relatively high ascorbic acid (AA) concentrations are also responsible to promote preferential reduction of palladium salts to palladium atoms on the (111) facets. The disappearance of (111) facets lead to the formation of cubic nanocrystals enclosed completely by the (100) facets

[0011] ,1.2.7 Characterisation of PdNCBs — reporter probe conjugates on 20% AuS SPCEFigure 4.13 presented the SEM of a (A) 20% AuS SPCE surface before (bare) and (B) after its functionalisation with a full miRNA assay and palladium nanocubes as labels. miRNA target and reporter-probe concentration used was 1 pM. The images are highly sensitive to differences in the atomic number. The higher the atomic number, the brighter the material appears in the image. A higher energy electron is obtained from the higher contrast material. Hence, the bright spots clearly represent gold particles on the surface.Through the analysis of the bare gold surface one can see that by enhancing in 10% the number of gold microspheres mixed to the ink, there is a substantial increase in the density of gold microspheres present on the surface (Figure 4.5 (A) vs. Figure 4.13 (A)). A uniform, homogeneous distributed gold particles was also observed in the SEM analysis and validated by DLS experiments (DLS data not shown).The discernible differences in the morphology of the SPEs observed in Figure 4.13 (B) indicate the successful binding between the miRNA sandwich assay and labels confined in the gold surface. The size of PdNCBs presented as approximately 43-47 nm. As expected, the as-synthetised palladium nanocubes retained their size and shape throughout the hybridisation process.1.2.8 Characterisation of 20% AuS SPCE1.2.8.1 Thickness of the electrode surfaceStudies of the thickness of the 20% AuS SPCEs (i.e. the printed layer thickness) was performed using a Bruker DektaKXT Stylus profilometer. The electrode presented a value of 50 ± 5 pm. An Ossila Four-Point Probe instrument was also used to assess additional physical and electrochemical parameters of the sensor surface. The results are displayed in Table 4.8.The small standard deviation generated by the good reproducibility between electrodes can be associated to the consistency of the viscosity of the inks used to produce the SPEs. If the viscosity of the inks differed, after a single print, the physical and electrochemical properties would also differs, causing undesirable variations in the surface’s electron transfer properties, i.e., changes in charge transfer effects.Table 4.8. Four-point probe analysis results of bare 20% AuS SPCE. Average values and standard deviations were calculated from triplicate measurements.1.3 ConclusionAt this work, three studies were performed to evaluate the electrochemical behaviour and the analytical performance of the in-house developed screen-printed carbon electrodes (SPCEs) with different compositions of gold microparticles within its carbon-based ink. Hence, the first study evaluated SPCEs with 10% (w / w) gold microspheres (referred as 10% AuS SPCE) and SPCE with 10% (w / w) microflakes particles (referred as 10% AuF SPCE) mixed to the carbon ink. The results showed that the 10% AuS SPCE generated the most reversible behaviour, highest lPvalues, and lowest overvoltage of the in-house electrodes, suggesting that this platform has higher electronic transfer kinetics. The 10% AuS SPCE also presented the lowest resistance due to the geometry of the gold particles, resulting in its homogeneous distribution over the surface, which enhances the reactivity of the substrate. These findings indicate that the use of gold microspheres mixed to the ink could significantly improve the analytical performance of the sensor, making it a promising approach for developing new electrochemical sensors.The second study investigates how the different nanostructured gold SPCE (10% AuS SPCE and 10% AuF SPCE) affect the sensitivity of a biosensor functionalised to a fully complementary miRNAsandwich assay. The performance of the platforms were compared using two different labels (PdNCBs and AuNRDs). The analytical signal of 10% AuS SPCE with PdNCBs was 10 times better than that obtained with AuNRDs, while 10% AuF SPCE with PdNCBs showed a 5-fold increase in signal. Additionally, the 10% AuS SPCE platform had the highest sensitivity and signal-to-noise ratio compared to the 10% AuF platform. The excellent response of this platform was attributed to the synergetic effects of increased surface area for biomolecules adsorption and enhancement of metal catalytic activity. The optimised ink recipe resulted in a surface capable of perfectly distinguishing between the signal of miRNA target and bare gold SPCE electrodes.The third study presented an optimization of the conducting path of the SPCE to enhance the number of electroactive adsorption sites. The study then evaluated the performance of 10% (w / w) and 20% (w / w) AuS SPCEs functionalized with miRNA assay labelled with PdNCBs and AuNRDs. The 20% AuS SPCEs showed the greatest performance with a 56-fold signal amplification when the full assay was labelled with AuNRDs. Other optimisations, such as the study of potentials for enhancing the electrocatalysis of nanoparticles for the reduction of hydrogen peroxide was also performed. The morphology of gold nanorods, and palladium nanocubes was confirmed through TEM or SEM, DLS, and zeta potential. The results suggest that the efficiency of electroreduction reaction of hydrogen peroxide can be enhanced through the modulation of the metal nanoparticles' favourable characteristics associated with specific sizes and shapes. These findings have implications for the development of multiplexer sensing technologies with greater design possibilities and accuracy in point-of-care biosensors.Overall, this study provides useful insights into designing and optimising SPCE for improved analytical performance. The newly developed platforms were found to be effective and reproducible, indicating high potential for use in biosensing. The studies suggest that a multiplexed electrochemical biosensor for the detection of miRNAs associated with neurological diseases could be fabricated using the 20% AuS SPCE.References[1] Vigderman, L., Khanal, B. P., & Zubarev, E. R. (2012). Functional Gold Nanorods: Synthesis, Self-Assembly, and Sensing Applications. Advanced Materials, 24(36), 4811-4841. https: / / doi.org / 10.1002 / adma.201201690[2] Kleijn, S. E. F., Lai, S. C. S., Koper, M. T. M., & Unwin, P. R. (2014). Electrochemistry of Nanoparticles. Angewandte Chemie International Edition, 53(12), 3558-3586. https: / / doi.Org / 10.1002 / anie.201306828[3] Niu, W., Zhang, L., Xu, G. (2010). Shape-Controlled Synthesis of Single-Crystalline Palladium Nanocrystals. ACS Nano, 4 (4),1987-1996. https: / / doi.org / 10.1021 / nn100093y.[4] Nicholson, R. S., & Shain, Irving. (1964). Theory of stationary electrode polarography. Single scan and cyclic methods applied to reversible, irreversible, and kinetic systems. Analytical Chemistry, 36(4), 706-723. https: / / doi.Org / 10.1021 / ac60210a007[5] Lavagnini, I., Antiochia, R., & Magno, F. (2004). An extended method for the practical evaluation of the standard rate constant from cyclic voltammetric data. Electroanalysis, 16(6), 505-506. https: / / doi.Org / 10.1002 / elan.200302851[6] Mayer, K. M., Lee, S., Liao, H., Rostro, B. C., Fuentes, A., Scully, P. T., Nehl, C. L., & Hafner, J. H. (2008). A label-free immunoassay based upon localized surface plasmon resonance of gold nanorods.ACS nano, 2(4), 687-692. https: / / doi.org / 10.1021 / nn7003734[7] Ostwald, W. (1901). Blocking of Ostwald Ripening Allowing Long-Term Stabilization. Physikalische Chemie, 37, 385.[8] Voorhees, P. W. (1985). The theory of Ostwald ripening. Journal of Statistical Physics , 38, 231-252 . https: / / doi.org / 10.1007 / BF01017860[9] Ganesan, M., Freemantle, R. G., & Obare, S. O. (2007). Monodisperse Thioether-Stabilized Palladium Nanoparticles: Synthesis, Characterization, and Reactivity. Chemistry of Materials, 79(14), 3464-3471. https: / / doi.org / 10.1021 / cm062655gExample 2: A sandwich electrochemical biosensor for miRNA-206, miRNA-135a and let-7b detection based on metal nanoparticles labelled SPEs.IntroductionNeurological diseases pose significant challenges in terms of accurate diagnosis and monitoring due to their complex nature and diverse manifestations. The absence of definitive diagnostic tests, the overlap between different disorders, and the variability in disease progression further complicate the diagnostic process. However, microRNAs (miRNAs) hold promise as biomarkers for addressing these challenges. miRNAs, small non-coding RNA molecules, have been found to be associated with various neurological disorders and play a crucial role in gene regulation. Detecting miRNAs could enable early diagnosis, accurate monitoring, and effective treatment of neurological diseases.The development of point-of-care devices for miRNA detection in neurological diseases is of paramount importance in healthcare. These devices could enable early and accurate diagnosis, facilitating timely interventions and personalized treatment plans. Key features of such devices include portability, user-friendliness, high sensitivity and specificity, quick results, and costeffectiveness. Point-of-care devices incorporating these features can revolutionize patient care through the promotion of prognosis, improving outcomes, and enhanced quality of life.In recent years, screen-printed carbon electrochemical biosensors (SPCEs) have gained attention in clinical settings due to their low cost, ease of use, low volume requirements, possibility to mass produce and portability. Although the conductivity and electron transfer properties may be lower than traditional electrodes, their surfaces can still be tailored to meet specific analytical needs and their low cost enables testing at scale. The incorporation of nanomaterials, such as gold microspheres (AuS), into SPCEs can increase the surface area, act as catalytic sites and improve biocompatibility. Nanomaterials offer advantages such as signal amplification, improved sensitivity, and versatile sensing platforms [1; Rasheed et al]. Ever since the initial reports of an electrochemical miRNA biosensor in 2006, extensive endeavours have been dedicated to improving the detection sensitivity. In part, this has been accomplished by harnessing the distinctive chemical and physical characteristics of nanostructures [2; Xia et al].This work presents a proof-of-concept study on an innovative electrochemical platform that utilizes screen-printed working electrodes. These electrodes consist of 20% (w / w) gold microspheres with a diameter of 2 pm mixed with carbon ink, referred to as 20% AuS SPCE. By limiting the theoretical fraction of gold surface to about 20% of the SPCE, interference from products formed at the counter electrode that could react at the gold surface is minimized, resulting in improved reproducibility.Furthermore, the optimized percentage of gold-to-carbon enhances the performance of the electrode (in comparison to conventional SPCE) by increasing its electroactive binding area. This, in turn, boosts the efficiency of miRNA capture-probe binding at the electrode surface and facilitates the attachment of a higher number of nanoparticle labels in a complementary sandwich miRNA assay. Various shaped nanoparticles, including gold nanorods (AuNRDs), platinum nanoparticles (PtNPs), and palladium nanocubes (PdNCBs), have been employed as labels to amplify the signal of the miRNA target and enhance charge collection. These nanoparticles act as catalysts, promoting the reduction of hydrogen peroxide and thereby increasing the detection efficiency.SPCEs that incorporate metal nanoparticles provides advantages over traditional approaches. With their high conductivity and tailored structure, these SPCEs can improve analytical sensitivity and expand the range of applications for biosensors [3; Mistry et al]. The sensitive, selective, and fast detection of targets make them suitable for point-of-care devices in healthcare, enabling quick and accurate diagnosis of diseases. The miniaturization potential of electrochemical biosensors based on SPCEs further opens up opportunities for the development of compact and efficient lab-on-a-chip systems, capable of real-time monitoring of biomarkers and even environmental contaminants.These advancements hold the promise of revolutionizing real-time detection, enhancing efficiency and accuracy in healthcare and environmental monitoring scenarios.The biosensor platform developed in this work utilizes an enhanced transducer component (i.e., 20% (w / w) gold microspheres mixed in the carbon ink). These microparticles act as anchor points for the thiolated capture-probe strands that bind the target. Once the target binds to an electrocatalytic nanoparticle labelled reporter-probe strand, there is a conversion of miRNA binding events into detectable signals. The detection process involves amperometry, where the current generated by the electrocatalytic reduction of hydrogen peroxide by differently shaped nanoparticles in a fully complementary sandwich assay, is measured. The sensor can detect a variety of miRNA targets at different potentials without significant cross-reactivity giving the possibility that it can be developed as a multiplexed sensor system.The novel AuS screen-printed carbon electrode (20% w / w AuS SPCE) used as the platform for a sandwich assay, utilizing metal nanoparticles as labels, exhibits selectivity towards base mismatches, low non-specific binding of BSA, and sensitive detection at distinct potentials for miRNA-206, miRNA-135a, and let-7b. Thus, this platform has the potential to improve the accuracy of neurological disease diagnosis and monitoring.1.4 Experimental Procedures1.4.1 Materials and ChemicalsEthyl cellulose, dipropylene glycol monomethyl ether, alpha-terpineol, potassium ferricyanide (K3Fe(CN)6 ; K4Fe(CN)e), potassium chloride (KCI), phosphate buffer (PBS, pH 7.4), tris[2-carboxyethyl]phosphine (TCEP), hydrogen peroxide solution (H2O2, 3%), BSA (Bovine Serum Albumin), palladium (II) chloride (PdCb), hydrochloric acid (HCI), cetyltrimethylammonium bromide (CTAB) and ascorbic acid (AA) were purchased from Sigma Aldrich and used as received.Conductive Carbon Black (Ensaco®) and Graphite (Timrex®) were purchased from Imerys Graphite & Carbon (Bironico, Switzerland). Au microparticles (Gold powder, spherical or flakes, APS 1.5-3.0 micron) were obtained by Alfa Aesar (Lancashire, UK).Nanoparticles used as labels in this study were obtained from nanoComposix. Specifically, gold nanorods measuring 50 nm long with a diameter of 15 nm were used. Their zeta potential was -52 mV and had a particle concentration of 4.30 x 1011parts / mL. A second label, platinum nanoparticles with a diameter of 50 nm ± 4 nm, a zeta potential of -40 mV and a particle concentration of 9.6 x 1011particles / mL, were used. All nanoparticles were citrate-stabilized and suspended in water. A third and final label used in this work was palladium nanocubes which was fabricated in-house. These nanocubes had an edge length of 50 nm and zeta potential of 38.6 ± 5.0 mV.All the aqueous solutions described in this work, if it was not stated otherwise, were prepared using Milli-Q® water (Millipore® Core, 18 MO cm).The oligonucleotides (purity >98%), RNase free water and TE buffer (10mM Tris and 1mM EDTA) used to prepare immobilization and hybridization solutions were purchased from IDT. The base sequences used was:miRNA-206Capture-probe: SH-C6- 5'-CCA CAC ACU U-3’; SEQ ID NO: 4Target (miRNA-206): 3’- GGU GUG UGA A GGA-AUG-UAA-GGU- 5’; SEQ ID NO: 5Target (miRNA-1- 4 bases mismatches): 3'-UAU GUA UGA A GAA AUG UAA GGU-5'; SEQ ID NO: 6Target (miRNA-206’ -1 base mismatch): 3’- UGU GUG UGA A GGA AUG UAA GGU- 5’; SEQ ID NO: 7Reporter-probe: 5’-CCU-UAC-AUU-CCA / 3ThioMC3-D / - 3’; SEQ ID NO: 8Let-7bCapture-probe: SH-C6- 5'-AACC AGA CAA-3’; SEQ ID NO: 9Target (Let-7b): 3’-UUGG UCU GUU GGA UGA UGG AGU-5'; SEQ ID NO: 10Target (Let- 7f- 2 base mismatches) : 3’-UUGA UUU GUU GGA UGA UGG AGU-5'; SEQ ID NO: 11 Target (Let-7g - 1 base mismatch: 3’-UUGG UUU GUU GGA UGA UGG AGU-5'; SEQ ID NO: 12 Reporter-probe: 5’-CCU-ACU ACC UCA / 3ThioMC3-D / - 3’; SEQ ID NO: 13miRNA-135aCapture-probe: SH-C6- 5’-UCACA UAG GA-3’; SEQ ID NO: 14Target (miRNA-135a): 3’-AGUGU AUC CUU AUU UUU CGG UAU-5’; SEQ ID NO: 15Target (miRNA-135b- 1 base mismatch): 3’-AGUGU AUC CUA ACU UUU CGG UAU-5’; SEQ ID NO: 16Reporter-probe: 5’-UAA AAA GCC AUA / 3ThioMC3-D / - 3’; SEQ ID NO: 171.4.2 Development of functionalized miRNA assay at 20% (w / w) AuS SPCEIn this study, the working electrode (WE), reference electrode (RE), and counter electrode (CE) were printed together as part of the experimental setup. However, to prevent the binding of miRNAs at the CE and RE during the immobilization and subsequent hybridization steps, it was necessary to physically separate the CE and RE electrodes.To initiate the development of the miRNA assay, the 5'-thiolated miRNA capture-probe was deposited onto gold microspheres (2 pm) that were incorporated within the carbon ink of the screen printed electrode (denoted as 20% AuS SCPE). For this, the surface of the working electrode was incubated in an Eppendorf tube containing a 10 pM solution of the 5'-thiolated oligo. The Eppendorf tube was sealed with parafilm and placed in an oven at 37°C for 80 minutes. The electrode was rinsed with nuclease-free water to remove any loosely bound strands.Subsequently, the capture-probe modified screen printed electrode was incubated with different concentrations of the miRNA target ranging from 1 aM to 1pM. This step led to the hybridization of the miRNA target's 3' end to the capture-probe strand. The hybridization time between the miRNA target and surface immobilized capture-probe strands was 20 minutes in an oven at 37°C. The electrode was then washed with nuclease free water.Finally, the free 5' end of the miRNA target was hybridized with its complementary sequence present in the miRNA reporter-probe functionalized with metal nanoparticles*. The hybridization of the labelled miRNA reporter-probe to its complementary sequence occurred over a 5-hour period at 37°C.The preparation of the immobilization buffer (miRNA capture-probe and reporter-probe) requires specific steps. TCEP (Tris [2-carboxyethyl] phosphine) was added in 100-fold excess and allowed to react for 2 hours. This step ensures the activation of the thiols bonds from the capture-probe and reporter-probe oligo, facilitating efficient immobilization with the metallic surfaces.*The functionalization of palladium nanocubes (PdNCBs), platinum nanoparticles (PtNPs) and gold nanorods (AuNRDs) with miRNA reporter-probes occurred as described in Example 1 above.Figure 5.1 illustrates assembly of the labelled miRNA Biosensor: Schematic Diagram and Specific Parameters. For the functionalization of the electrode to AuNRDs, 4.6 pM reporter-probe solution were utilized. Alternatively, when functionalized with PtNPs and PdNCBs, a 1 pM miRNA reporterprobe solution were employed.1.4.3 Electrochemical Analysis1.4.3.1 Amperometric detection of miRNAs targetAfter the miRNA sandwich assay is completed, the working electrode, reference electrode, and counter electrode were assembled together. These electrodes were then immersed in a small cell filled with 7.2 mL of 0.01 M PBS solution. Amperometry was employed as the detection method to identify the presence of the metal nanoparticles and hence the target concentration.Initially, the current was measured at a potential that is specific for each type of nanoparticle: -0.375V for PdNCBs, -0.25V for AuNRDs, and -0.5V for PtNPs. The current was allowed to stabilize for 5 min. Following that, 3.27 pL of hydrogen peroxide (3% w / v) was introduced into the PBS solution to achieve a final concentration of 400 pM. Stirring was employed for 1 min, upon addition of H2O2.Subsequently, the current associated with the reduction of hydrogen peroxide by the nanoparticles was measured after 20 minutes. The analytical response was determined by calculating the difference in current (Ai) observed before and after the addition of hydrogen peroxide.1.4.4 InstrumentationThe electrochemical measurements were conducted at room temperature (22 ± 2 °C) using a CHI760D electrochemistry workstation. Dr. Loanda Cumba from DCU fabricated the working electrodes in-house by employing a DEK Horizon APiX screen-printing machine (Maxem, IE) and using appropriate stencil designs.The working electrodes (<t> = 3 mm) were made of 20% AuS SPCE (i.e., ethyl cellulose (5.20%), dipropylene glycol monomethyl ether (27.20%); alpha-terpineol (23.20%), carbon black (7.60%), graphite (16.80%) and Au microspheres (20%). For all the electrochemical measurements, a screen-printed Ag / AgCI was utilized as pseudo-reference electrode, while a carbon / graphite screen-printed electrode served as the counter electrode.1.5 Results and Discussion1.5.1 Principle of the proposed electrochemical biosensorIn a proof-of-concept study, three independent screen-printed working electrodes with a 20% (w / w) mixture of gold microspheres in the carbon ink (referred to as 20% AuS SPCE), designed and optimized in Example 1 , was used to develop labelled biosensors for the detection of biomarkers of neurological diseases such as miRNA-206, miRNA-135a and let-7b. Labels in the form of gold nanorods (AuNRDs), platinum nanoparticles (PtNPs), and palladium nanocubes (PdNCBs) were selected due to their distinct reduction potential.The direct incorporation of gold microspheres into the carbon ink of the SPE provided several advantages over traditional SPCE platforms. Firstly, it defines the region where the capture-probe strands bind and the microsphere loading can be changed to control their separation, e.g., to achieve local radial diffusion, and improve kinetic reactions across the surface, including heterogeneous electron transfer. Secondly, it increases the rate of miRNA capture-probe strand adsorption on the electrode surface. If the sensing phase have more active sites available to bind with the labelled fullycomplementary miRNA assay, higher number of nanoparticles is brought to the electrode surface leading to an overall improvement of the analytical performance of the sensor.Through fine-tuning the size and shape of the labelled nanoparticles, there was a notable enhancement in the charge collection capability of the platform. This improvement is facilitated by the faster electron transfer during the reduction reaction of H2O2. In other words, the nanoparticles acted as catalysts, promoting the reduction of H2O2 and thereby improving the signal, while minimising the background noise (the kinetics of peroxide reduction at the carbon matrix of the SPE are very slow) during the detection phase.As a consequence of this enhanced charge collection, the signal from the targeted miRNA was amplified. Additionally, the binding event between the labelled miRNA reporter-probe and the target miRNA resulted in each biomarker possessing a distinct reduction potential. This distinct potential generated independent current signals, further contributing to the sensitivity and specificity of the biosensing system.1.5.2 Analytical performance of the biosensorTo validate the degree of signal amplification achieved by each nanoparticle label and the feasibility of the platform for the detection of biomarkers present in blood at ultralow concentrations, a calibration curve was developed. Standard miRNA targets was diluted to generate a sequential range of concentrations from 1 pM to 1 aM. Subsequently, on independent 20% AuS SPCE platforms, sandwich assays were constructed using capture-probe - target - reporter-probe labelled nanoparticles (AuNRDs, PtNPs, or PdNCBs) with specific targets (miR-206, let-7b, and miR-135a, respectively). These assays utilized the previously prepared target concentrations ranging from 1 pM to 1 aM. The gold nanorods were subjected to a potential of -0.25V, while the detection potentials for palladium nanocubes and platinum nanoparticles were -0.375V and -0.5V, respectively. The baseline current was measured after 5 minutes. After that, hydrogen peroxide was added to the system to give a final concentration of 400 pM and the current measured after 20 minutes. The signal was taken as the difference in the current before and after (Ai) the addition of the hydrogen peroxide.Figure 5.2 depicts representative amperometric i-t curves for the fully complementary miRNA assay for the detection of (A) miRNA-206, (B) miRNA-135a, (C) let-7b. In each case, the concentration of the reporter-probe labelled nanoparticles was high, to ensure that all capture-probe - target hybrids are labelled. Using a high concentration is important, since the reporter-probe coverage may vary as the identity of the metal in the nanoparticle label is changed which will alter the binding kinetics and perhaps the association constant.The background current for all the functionalized fully complementary assay at 20% AuS SPCEs remains stable and close to zero after applying the particle specific potential for 5 minutes. When 400 pM of hydrogen peroxide is introduced to the system, the sensor quickly responds, resulting in ahigh current and the subsequent formation of a plateau. The time frame needed to transition between temporary current to plateau, was between 300 to 1500 seconds depending on the concentration of the miRNA target.The shift from a transient current to a plateau relies on the radial diffusion of H2O2 towards nanoparticles, such as AuNRDs, PtNPS, and PdNCBs. This diffusion phenomenon follows Fick's second law of diffusion, where it is directly proportional by factors such as the availability of surface area for diffusion, diffusion coefficient, and concentration, while being inversely proportional by the distance of diffusion [12; Cai, et al]. As hydrogen peroxide is reduced at the surface of the nanoparticles, it forms a depleted peroxide layer, which reduces the concentration gradient and slows down the diffusion of hydrogen peroxide from the bulk solution to the nanoparticle surface. Since the diffusion rate between the bulk hydrogen peroxide solution and the nanoparticles is slow (approximately 10-5cm2 / s), the current becomes limited, thereby contributing to the observed transient behaviour. This restricted diffusion rate explains the noticeable difference in current before and after the addition of peroxidase, making it easy to distinguish the two states.It is worth noting that the diffusion limitations cause the transient (i.e., the change in current over time) to level off. While the Cottrell equation can describe the initial part of the transient, where the current decreases with the square root of time in a diffusion-controlled process, it does not account for the plateau observed which arise due to radial diffusion of peroxide to the nanoparticle labels.The concentration of the miRNA target directly affects the magnitude of the current signal (Ai) as depicted in Figure 5.2. A higher density of miRNA targets on the surface increases the likelihood of binding to the labelled reporter-probe. This binding allows for a greater number of active sites present on the nanoparticle surface to be accessible for the reduction of hydrogen peroxide, resulting in an increased current. Essentially, the current is proportional to the loading of the functionalized reporter-probe, which is determined by the concentration of the miRNA target.Higher concentrations of the miRNA target require more time to reach equilibrium due to two interconnected factors. Firstly, an increased quantity of nanoparticles becomes bonded through miRNA target — reporter-probe hybridization. Secondly, the presence of a high number of miRNA probes creates a physical barrier for the reduction of hydrogen peroxide on the nanoparticle surface. As a result, not only is the diffusion of hydrogen peroxide difficult / limited at elevated miRNA target concentrations, but the likelihood of cluster formation also increases due to the abundance of nanoparticles on the electrode surface. Consequently, the nanoparticles exhibit behaviour similar to that of microelectrodes in terms of their size, leading to the close proximity of labelled miRNA probes. This proximity causes the diffusion zones of the nanoparticles to overlap, reducing the surface-to-volume ratio and hindering the efficient diffusion of hydrogen peroxide. Consequently, the electrocatalytic efficiency of the nanoparticles is diminished [5; Gao et al].The magnitude of the current signal is also dependent on the electrocatalytic activity of the metal nanoparticles towards the reduction of hydrogen peroxide. This activity varies based on the nanoparticles' intrinsic properties, shape, and size. Among the used nanoparticles, platinum nanoparticles exhibited the highest electrocatalytic activity, followed by palladium nanocubes and gold nanorods (PtNPs > PdNCBs > AuNRDs). This difference was observed through consistently higher currents for a given target concentration of miRNA-206, miRNA-135a, and let-7b labelled with these nanoparticles. Signal to noise ratios for the highest target concentration of miRNA-206, miRNA-135a and let-7b labelled with AuNRDs, PdNCBs and PtNPs were found to be 88; 164 and 177, respectively.The superior electrocatalytic activity of platinum nanoparticles can be ascribed to their heightened capacity to bind with peroxide, coupled with their electronic characteristics that induce polarization in H-O-O-H bonds [6; Morais et al]. This polarization facilitates the easier cleavage of hydrogen peroxide into water and oxygen during the electrocatalytic process. By fostering an increased number of interactions between hydrogen peroxide molecules and the platinum nanoparticles, a greater potential for effective collisions emerges, thereby amplifying the catalytic performance.Similarly to platinum nanoparticles, palladium nanocubes have an irregular shape, which contributes to their enhanced electrocatalytic activity. Irregular shaped particles have a more complex surface structure with more exposed surface atoms [7; Ulusoy et al]. Hence, a higher surface-to-volume ratio is formed, generating more active sites, and reducing the energy required for the reaction to occur.Although gold nanorods have a high aspect ratio and a large surface area, their elongated surface structure is relatively uniform and less complex compared to palladium nanocubes or platinum nanoparticles. The arrangement of surface atoms in regular-shaped particles is more ordered and symmetrical, leading to a reduction in the number of exposed surface atoms [7; Ulusoy et al] available for catalytic reactions. Additionally, gold nanorods are more prone to aggregation due to their higher Hamaker constant [8; Bishop et al]. Aggregation reduces the effective surface area available for catalytic reactions because the active sites on the surfaces of the individual nanorods become less accessible. This decreased surface area limits the interaction between the catalyst (AuNRDs) and the reactant (H2O2), resulting in a reduction in electrocatalytic activity.The selection of which nanoparticle would be bonded to the miRNA reporter-probe was determined based on the absolute concentration of its complementary target. In the context of studying miRNA-135a and let-7b expression levels in the brain of epileptic subjects, miRNA-135a-5p is significantly increased in children with temporal lobe epilepsy (TLE) and in animal models. Similarly, let-7b has shown deregulation during epileptogenesis, being upregulated in TLE. However, when it comes to measuring the concentrations of these miRNAs in circulating blood, reported values can vary due to differences in study design, patient population, and measurement techniques.For instance, miRNA-135a was detected at a concentration of 2.2 x 10-4± 0.03 ng / mL (~3.14 x 10-14mol / L) for healthy controls and 3.40 x 10-2± 0.04 ng / mL (~4.86 x 10-12mol / L) for patients with epilepsy. Let-7b was found at a concentration of 1.6 x 10-4± 0.02 ng / mL (~2.67 x 10-14mol / L) for healthy controls and 2.4 x 10-2± 0.03 ng / mL (~4.0 x 10-12mol / L) in patients with epilepsy. Since miRNAs are theoretically present in the femtomolar (fM) range, it is essential to take account of this clinically relevant range. Therefore, the decision was made to functionalize these sequences with the nanoparticles that presented greater catalytic properties, i.e., PtNPs and PdNCBs.The reason behind this sequential choice of nanoparticles is to address the issue of different absolute concentrations in a multi-analyte device. When the sensitivity of detection varies greatly among targets, it can pose a significant challenge. In this particular case, gold nanorods were used with miRNA-206 because its sensitivity is much higher (pM to nM range) compared to miRNA-135a and let-7b. Therefore, by using different types of nanoparticles, such as platinum and palladium, it becomes possible to shift the measured signal so that all three miRNAs exhibit similar current magnitudes over their different clinically relevant concentration ranges.By doing so, even if let-7b has a lower concentration than miRNA-206, the choice of nanoparticles allows their analytical sensitivities to be adjusted thus achieving comparable detection levels. This approach minimises sample preparation, e.g., dilution with buffer, and helps mitigate the problem caused by varying absolute concentrations, enabling a more accurate and reliable analysis of the miRNAs of interest.Figure 5.3 presents the calibration curves of the current response (Ai), i.e., the difference in current before and after addition of hydrogen peroxide, obtained from the biosensors after exposure to a range of concentrations of (A) miRNA-206, (B) miRNA-135a and (C) let-7b. As the concentration of the miRNA target rises, the absolute current signal increases. The calibration curves indicated a good linear relationship between current and logarithm of the analyte’s concentration, which ranges from 108M to 1014M for miRNA-206 and 106M to 1015M for miRNA-135a and let-7b. The best-fit least-squares regression line equation determined for miRNA-206, miRNA-135a and let-7b were I = -0.91 x 106log [miRNA-206] - 14.01 x 106; I = - 1.72 x 106log [miRNA- 135a] - 26.53 x 106and l= -1.77 x 10-6log [let-7b] - 29.68 x 10-6, with a regression coefficient of 0.99.The limit of detection (LOD) was calculated from the limit of blank (LOB), as described in the experimental section in this example. Hence, the lowest concentration of the miRNA-206, miRNA-135a and let 7b that proved to be reliably distinguished from the background noise level were 0.6 fM, 0.42 fM, 1.17 fM, respectively.The proposed biosensors were compared to relevant published studies on miRNA detection based in SPCEs. Table 5.1 provides an overview of several electrochemical biosensors known for their sensitivity in detecting miRNAs. The results showed a wider linear dynamic range, lower detection limit, and a higher sensitivity. The biosensor also presents the possibility to detect simultaneously upto three miRNAs. The multi-targeting ability of the sensor is desirable as it would improve accuracy of the detection. Further discussion about how to implement a multiplex platform at the developed platform is discussed after Example 2.Table 5.1. Performances of the proposed electrochemical biosensor for miRNA detection compared with those of previous studies.*Of the present inventionFootnote to Table: GSPE, gold screen-printed electrode; screen-printed carbon electrode (SPCE); SWV: square wave voltammetry; M0S2, molybdenum disulfide; OMCNTs, oxidized multi-walled carbon nanotube; P2ABA, poly(2-amino-benzylamine); rGO, reduced graphene oxide; PEG, polyethylene glycol.The reproducibility of the biosensor was assessed by analysing the relative standard deviation (RSD) of the current response (Ai) from three independent fully complementary assays. These assays wereprepared simultaneously using the same procedure. The biosensor's response was evaluated across a concentration range from 1 pM to aM. Table 5.2 shows the correlation of RSD values at different concentrations.Table 5.2. Average variation of the current response before and after the injection of H2O2 (Ai) on functionalized fully complementary miRNA assays. These data were obtained from the calibration curves depicted in Figure 5.3 A-C. Average values and standard deviations were calculated based in the measurements performed in triplicate.Across the entire concentration range, the RSD ranged from 1.95% to 3.95% for miRNA-206, 1.01% to 5.42% for miRNA-135a, and 1.07% to 5.80% for let-7b. These values fall within the acceptable limit of reliable measurements. These results classify the platform as suitable for sensitive and reproducible detection of the target molecules.Poor reproducibility of biosensors is a recurring issue in the literature and can be associated with the instability of the reference and counter electrodes. In the case of multiplex platforms, the significant difference in size between the multiple working electrodes and the counter electrode also poses challenges. In this study, the sensor's good reproducibility is achieved through studies confirming the stability of the counter and reference electrodes, as well as the novel structure of the screen-printed carbon electrode (SPCE) working electrode.To evaluate the stability of the counter and reference electrodes, cyclic voltammetry measurements were conducted on the designed 20% AuS SPEs, which included the counter and reference electrodes. These measurements involved 50 cycles in a solution containing 5 mM [Fe(CN)6]3 / 4‘ and 0.1 M KCI (data not shown). The counter and reference electrodes on the SPEs demonstrated good stability, which can have a significant impact on the current response and contribute to the sensor's reproducibility.Furthermore, unlike other studies that deposited thick, complete layers of gold on the working electrode surface, these systems utilized only a 20% coverage of gold on the SPE surface (checked by acid voltammetry). This limited gold coverage ensures that the substantially larger surface area of the platinum counter, relative to the working electrode, prevents any interference in the current response.1.5.3 Selectivity of the biosensormiRNA-206To evaluate the selectivity of the developed biosensor for miRNA-206, the response of the functionalized fully complementary assay was compared to assays with one-base mismatch 3’-UGU GUG UGA AGA AAU GUA AGG U-5’) and four-base mismatches (3-UAU GUA UGA AGA AAU GUA AGG U-5') in the miRNA target. The mismatched bases (U, A) in red (enlarged and underlined) do not complement the miRNA reporter-probe. This comparison of current (Ai) was conducted at two specific concentrations of targets, nM and pM, which not only lie in the middle of the calibration curve but also represent the range in which the target is detected in healthy control (pM) and Alzheimer's disease (AD) samples (nM).Figure 5.4 illustrates the contrast in amperometric i-t curves between the fully complementary assay and assays containing one-base mismatch. Table 5.3 presents the average current values obtained from these assays, with n=3 measurements considered for each.Table 5.3. Comparison between the current of a fully complementary nucleic acid strand and 1-base mismatch. Average values and standard deviations were calculated by measurements performed in triplicate.The fully complementary assays exhibited a higher current signal (Ai) at both target concentrations compared to the one-base mismatch assays within the same concentration range. The current magnitude observed in the presence of a one-base mismatch was approximately 50% of the current generated by the fully complementary electrode (at the specified concentrations). The theoretical association constant (Ka) calculated for the fully complementary assay is 4.2 x 109while for the one-base mismatch, it is 2.1 x 109. Consequently, a 50% decrease in assay response is reasonable for both nM and pM concentrations. Correspondingly, the biosensor response in the presence of the mismatch was approximately 45% for pM. These results indicate that the assay could differentiate between a fully complementary miRNA strand and one that has a single mismatched base if their concentrations are equal. However, real clinical samples are not likely to contain such closely related miRNAs.Figure 5.5 depicts a comparison between the functionalized fully complementary assay to an assay that presents 4 base mismatches at miRNA target. Table 5.4 displays the average biosensor response at nM and pM scales for both scenarios. Based on the calculated Kavalues (1 .05 x108for 4 base mismatches and 4.2 x109for fully complementary assay), a decrease in sensitivity of approximately 97% was expected. However, when the assay was bonded to the mismatches, a decrease of only 63% for nM and 57% for pM concentrations were observed.Table 5.4. Comparison between the currents observed for a fully complementary nucleic acid strand and 4-bases mismatches. Average values and standard deviations were calculated by measurements performed in triplicate (n=3).A possible explanation for the magnitude of the current signal being smaller than theoretically predicted is related to the position of the base mismatches in the miRNA sequence. It is important to note that the seed region, which is identical in both miRNA-1 and miRNA-206, plays a crucial role in determining miRNA-target specificity. This region typically contains the "seed match" for the target mRNA, ensuring selective binding to intended targets rather than non-target mRNAs with partially complementary sequences. Despite the lower current signal than anticipated, it is still sufficient to prevent false positive responses and distinguish between targets with the similar structure.Let- 7bThe biosensor's ability to distinguish between different members of the let-7 miRNA family was assessed by examining three representative members: let-7b (fully complementary: 3’-UUGG UGU GUU GGA UGA UGG AGU-5’), let-7g (one-base mismatch : 3’-UUGG UUU GUU GGA UGA UGG AGU-5’), and let-7f (two-base mismatch: 3’-UUGA UUU GUU GGA UGA UGG AGU-5’).Figure 5.5 displays the typical current signal responses of the functionalized fully complementary assay at the nM and pM scales, contrasted with the current signal response of the functionalized assay with (A) one-base mismatch and (B) two-base mismatches within the same concentration range. Table 5.5 shows the average current signals and the extent of signal decrease.Table 5.5. Comparison between the current of a fully complementary let-7b assay and 1-base and 2 base mismatches. Average values and standard deviations were calculated by measurements performed in triplicate.Based on the theoretical calculation of association constants and in comparison with a fully complementary assay (Ka= 2.82 x 109), it is expected that a one base mismatch (Ka= 2.53 x109) will result in an approximately 8% decrease in current signal, while two-base mismatches (2.05 x 109) should lead to a 24% decrease in current signal. Consistent with these predictions, the amperometric i-t curves demonstrate a signal reduction of approximately 20% for both pM and nM concentrationsfor two base mismatches, and from approximately 10% for pM and nM concentrations of the one base mismatch.The lower decrease in the current response despite the presence of base mismatches can be attributed to three main factors. Firstly, the shared seed region between the mismatches and the fully complementary assay, along with the specific characteristics of the mismatches, play a significant role. Additionally, the presence of G:U wobble pairs within the mismatches and the mismatches being located at the end of the sequence contribute to this phenomenon.The seed region, spanning positions 2 to 7 from the 5' end of the miRNA molecule, acts as a guide for target recognition and binding. When a mismatch occurs in the seed region, it disrupts the complementarity between the miRNA and the target mRNA sequence. This disruption leads to a less stable binding complex and a decrease in the number of bonds formed between the miRNA and the complementary sequence on the target mRNA. However, since the fully complementary assay and mismatches have an identical seed region, the binding process tends to proceed along the entire sequence in a similar way to the fully complementary target. Consequently, mismatches outside the seed region would be more challenging to detect as they have a moderate impact on the overall binding affinity.In this case, the mismatches present as G:U wobble pairs. This type of mismatch occurs when a G nucleotide in the miRNA sequence pairs with a U nucleotide in the target mRNA sequence, despite the mismatch. The G:U wobble pair is partially tolerated within the sequence extension due to the formation of some hydrogen bonds, although fewer than the canonical Watson-Crick base pairs (G:C and A:U). As a result, the G:U wobble pair retains a certain level of interaction between the miRNA and the target mRNA, contributing to a lower decrease in binding strength.Furthermore, when two base mismatches occur, with one being a wobble pair and the other located at the end of the sequence, the disruptive impact on pairing (i.e. binding efficiency) is diminished. Mismatches at the end of the sequence have a lower impact on the overall miRNA-target binding, further contributing to the observed lower decrease in the current response.These factors collectively influence the binding affinity and stability of miRNA-target interactions, highlighting the crucial role of seed region complementarity in efficient miRNA-mediated gene regulation. It is essential to note that the assay is run under kinetic control conditions. The equilibrium constant determines the binding strength between the biosensor and the miRNA targets. In the case of mismatches, the changing equilibrium constant affects the stability of the binding complex, resulting in the observed variations in the current signal. Therefore, the equilibrium constant plays a crucial role in determining the impact of mismatches on the current response.It is important to note that distinguishing between highly similar miRNA family members can be challenging, and a combination of multiple approaches, such as PCR, bioinformatics tools, and high-throughput sequencing technologies, is often employed for accurate identification. The fact that the developed biosensor exhibits current variations within the range predicted by theoretical calculations demonstrates the selectivity of the screen carbon printed electrodes (SPCE) platform. Therefore, it not only can differentiate between false positives, but it can also accurately detect current values without the need for additional techniques.miRNA-135aThe selectivity of the biosensor towards different members of the miRNA-135 family was evaluated using two representative members: miRNA-135a (3’-AGUGU AUC CUU AUU UUU CGG UAU-5'), which is fully complementary to the functionalized assay, and miRNA-135b, which contains a one-base mismatch (3’-AGUGU AUC CUA ACU UUU CGG UAU-5’)Figure 5.7 presents the standard current signal responses of the functionalized fully complementary assay at both the nM and pM scales, comparing them to the current signal response of the functionalized assay with a one-base mismatch within the identical concentration range. Table 5.6 provides the average current signals and the magnitude of the signal decrease.Table 5.6. Comparison between the current of a fully complementary nucleic acid strand and 1-base mismatch. Average values and standard deviations were calculated by measurements performed in triplicate.The variation in current signal (Ai) follows the anticipated pattern, with a higher variation observed when the miRNA target is fully complementary to the functionalized assay at both the nM and pM ranges. Conversely, a sequence containing a one-base mismatch results in a lower variation. The theoretical calculation of the association constants predicts that miRNA-135a has a Kavalue of 2.74 x 109, while miRNA-135b has a value of 1.59 x 109. Thus, the binding of the functionalized assay to the mismatched sequence is expected to generate a reduction in current signal of 42%. The experimental results closely align with these predictions, showing a reduction from 43 to 44% at the high and low concentration ranges.Considering the difference between the expected decrease in current and the obtained value is within 5%, the platform can be deemed highly specific for the detection of miRNA-135a, demonstrating sufficient sensitivity to differentiate between a fully complementary miRNA strand and one that contains a single mismatched base.1.5.4 Non-specific binding of BSAThe sensor's performance regarding non-specific binding of proteins was evaluated using bovine serum albumin (BSA) as a surrogate for human serum albumin (HSA), which is naturally present in human plasma samples. Since the ultimate goal of this project is to employ the biosensor for miRNA detection in circulating blood, it is crucial to ensure its specificity against high-affinity molecules. If BSA binds non-specifically to the miRNA capture-probe or other assay components, it competes with the specific binding of the miRNA target, thereby reducing signal generated the miRNA-target interaction. This interference can result in several complications, including false-negative signals, reduced sensitivity, increased background noise, and compromised assay performance. These issues can introduce variability and inconsistencies in the results, making it challenging to derive meaningful conclusions from the assay data.To obtain more realistic data on the impact caused by this protein, BSA was tested at a concentration that is close to the physiological concentration of HAS in blood, approximately 1 mM.Figures 5.8 A-C illustrates the assessment of interference at various concentrations (ranging from 1 pM to 1 aM) of the target miRNA of interest (miRNA-206, miRNA-135a, let-7b). The obtained results were then compared to samples containing miRNA in the absence of BSA. Tables 5.7; 5.8; and 5.9 provide a summary of the data obtained from these experiments.Table 5.7. Comparison between the current of a functionalized fully complementary miRNA-206 assay with and without an environment of BSA. Average values and standard deviations were calculated by measurements performed in triplicate.Table 5.8. Comparison between the current of a functionalized fully complementary miRNA-135a assay with and without an environment of BSA. Average values and standard deviations were calculated by measurements performed in triplicate.Table 5.9. Comparison between the current of a functionalized fully complementary let-7b assay with and without an environment of BSA. Average values and standard deviations were calculated by measurements performed in triplicate.The amperometric response of the functionalized assays, specifically miRNA-206, miRNA-135a, and let-7b, demonstrated linearity across a wide concentration range from 1 pM to 1 aM. The decrease in current response observed in assays with non-specific binding compared to fully complementary assays was limited, with maximum reductions of 5.70% for miRNA-206, 6.20% for miRNA-135a, and 6.50% for let-7b.These findings emphasize the strong resistance of the sensor to non-specific binding of BSA at different target concentrations. The change in current response (Ai) directly reflects the electrocatalytic reduction of hydrogen peroxide facilitated by the nanoparticles. This reduction occurs when the target miRNAs hybridize with the miRNA re porter- pro be, forming a specific double helix structure. In cases where the miRNA reporter-probe fails to fully bind to the target miRNA sequence, a decrease in Ai values occurs. This decrease signifies a differentiation process by the system, allowing it to distinguish between different target miRNAs based on the extent of binding between the reporter-probe and the target sequence.Importantly, despite the high BSA content in the samples, the sensor does not experience significant interference in miRNA detection. This result suggests that there is a low propensity for the biosensor to become fouled by non-specific adsorption of proteins that could disrupt its functionality. The sensor's ability to resist non-specific binding contributes to its reliability and suitability for accurate miRNA detection applications.Additionally, the proposed biosensor offers significant advantages for routine miRNA analysis. Unlike existing miRNA assays that require highly purified RNA samples, this biosensor eliminates the need for chemical / biological ligation and PCR amplification. Consequently, it enables direct profiling of miRNAs with minimal or no sample pre-treatment, streamlining the analysis process.1.5.5 Stability of the biosensorTo investigate the stability of the developed biosensor, independent electrodes containing the sensing phase and miRNA capture-probes were prepared. These electrodes were stored in an immobilization buffer at 4 °C for 21 days. The study involved testing 9 fully complementary assays, with triplicate samples for each assay. The samples were functionalized with either AuNRDs, PdNCBs, or PtNPs and hybridized to miRNA-206, miRNA-135a, and let-7b, respectively. Amperometric analysis was conducted to study the behaviour of the platform at specific miRNA targets at nanomolar (nM) and picomolar (pM) scales, with measurements taken at 4-5 day intervals.Figure 5.9 presents the variation in current response (Ai) of the 20% AuS SPCE platform hybridized with (A) miRNA-206, (B) miRNA-135a, and (C) let-7b during different storage times of the sensing phase.To assess the stability of the biosensor, the response after 21 days of storage was compared to the signal of freshly prepared biosensors. For the assay with 1 nM of miRNA-206, the biosensor's response after 21 days of storage was approximately 88% of its original signal. For the assay with 1 pM of miRNA-206 under the same storage conditions, the biosensor's response is approximately 86% of the original signal.For the sensing phase stored for 21 days and hybridized to miRNA-135a, the current signal maintained from 90.13% (pM) to 90.38% (nM) of its original magnitude. Similarly, when the sensing phase was stored for 21 days and hybridized with let-7b, the current signal remained at 92.94% (pM) to 95.07% (nM) of its original value.Based on these results, it is suggested that the monolayer formed by the miRNA capture-probe at the 20% AuS SPCE remains stable for several days. The biosensor retains good activity for hybridization, indicating that the immobilized sensing phase retains its functionality over the storage period.The decrease in current signal throughout the analysed period is likely caused by exogenous ribonucleases (RNAse) that decompose the capture-probe strands on the electrode surface. The varying stability of the nanoparticles immobilized to the miRNA-reporter reporter-probe also contributes to the decrease in current signal over time. This can be attributed to the fact that the binding reaction between the nanoparticles and the miRNA reporter-probe occurred on "day zero" inan Eppendorf and subsequent storage took place at 4 degrees Celsius in the fridge. For subsequent analyses, the previously prepared functionalized reporter-probe was utilized to complete the assay.These results not only demonstrate the formation of a stable sensing platform but also highlight its significance in reducing analysis time and enabling the storage of biosensors for future use. This is particularly important in the context of point-of-care sensors, as they are required to have a satisfactory shelf-life. By establishing a stable sensing phase, the biosensors can be stored for extended periods and utilized whenever needed. This capability is crucial for point-of-care applications where immediate testing may not always be feasible, allowing healthcare professionals to rely on the biosensors even after a certain period of time has elapsed. Therefore, the development of a highly stable sensing platform addresses the need for both prolonged shelf-life and the convenience of utilizing biosensors at the point of care.1.6 ConclusionIn conclusion, this presents a proof-of-concept investigation of an innovative electrochemical platform designed for detecting biomarkers associated with neurological diseases. The development of a screen-printed carbon electrode incorporating 20% (w / w) gold microspheres in the carbon ink significantly advances the field of electrochemical biosensors. The inclusion of a small percentage of gold microspheres has notably increased the active surface area of the SPCE, surpassing that of conventional SPCE surfaces, resulting in improved miRNA capture-probe binding efficiency. Additionally, the incorporation of different-shaped metal nanoparticle labels, such as gold nanorods, platinum nanoparticles, and palladium nanocubes, enhances the biosensor's performance by amplifying the signal from the miRNA targets and generating distinguishable current signals. This approach allows for sensitivity adjustment based on the selection of different nanoparticles, catering to the specific requirements of different miRNAs.The biosensor exhibits a wide dynamic range, as indicated by the calibration curves. These curves display a linear relationship between the current and the logarithm of the analyte concentration across a broad range spanning 6 orders of magnitude for miR-206 and 9 orders of magnitude for miR-135a and let-7b. It demonstrates high sensitivity for detecting ultralow concentrations of the biomarkers, with LOD values of 0.6 fM for miRNA-206, 0.42 fM for miRNA-135a, and 1.17 fM for let-7b. When compared to other relevant electrochemical biosensors for miRNA detection, the proposed biosensor outperforms in terms of linear dynamic range, detection limit, and sensitivity.The biosensor also demonstrates selectivity for the target miRNAs, as evidenced by higher current signals for the fully complementary assays compared to assays with one-base and four-base mismatches. Additionally, the biosensor's reproducibility falls within acceptable limits, with RSD values ranging from 1.95% to 3.95% for miRNA-206, 1.01% to 5.42% for miRNA-135a, and 1.07% to 5.80% for let-7b. The good reproducibility is attributed to the stability of the counter and reference electrodes, as well as the limited gold coverage on the working electrode surface.The biosensor exhibits strong resistance to non-specific binding of BSA, with limited decreases in current response observed (about 6%) when compared to fully complementary assays. This resistance indicates the biosensor's reliability and suitability for accurate miRNA detection application. Additionally, the biosensor offers advantages for routine miRNA analysis by eliminating the need for extensive sample pre-treatment thus streamlining the analysis process.Furthermore, the developed biosensor exhibits good stability and functionality even after being stored for 21 days. Comparisons with freshly prepared biosensors reveal that it retains a significant portion of its original signal. The formation of a stable monolayer by the miRNA capture-probe on the 20% AuS screen-printed carbon electrode (SPCE) indicates the longevity and efficiency of the immobilized sensing phase. These findings highlight the practical significance of the highly stable sensing platform, reducing analysis time and enabling extended storage. The stability is particularly valuable in point-of-care applications, ensuring a satisfactory shelf-life and enabling healthcare professionals to rely on the biosensors even after an extended duration.Overall, the developed platform shows promising potential for multiplex detection. Its sensitive and selective detection of multiple miRNAs, exemplified by the successful detection of miRNA-206, miRNA-135a, and let-7b, positions it as a good platform for simultaneous detection of multiple miRNA targets. This capability significantly improves the accuracy of neurological disease detection, as miRNAs' multi-targeting ability correlates with disease diagnosis accuracy. Simultaneous detection of multiple targets is crucial for enhancing diagnostic precision. Additional design improvements could further enhance its potential application as a point-of-care device in clinical diagnostics.References[1] Rasheed, P. A., & Sandhyarani, N. (2017). Electrochemical DNA sensors based on the use of gold nanoparticles: a review on recent developments. Microchimica Acta, 184, 981-1000. https: / / doi.Org / 10.1007 / S00604-017-2143-1.[2] Xia, N., & Zhang, L. (2014). Nanomaterials-Based Sensing Strategies for Electrochemical Detection of MicroRNAs. Materials (Basel, Switzerland), 7(7), 5366-5384. https: / / doi.org / 10.3390 / ma7075366[3] Mistry, K. K., Layek, K., Mahapatra, A., RoyChaudhuri, C., & Saha, H. (2014). A review on amperometric-type immunosensors based on screen-printed electrodes. The Analyst, 739(10), 2289-2311. https: / / doi.org / 10.1039 / c3an02050a[4] Cai, X., , Tanner, E. E. L., , Lin, C., , Ngamchuea, K., , Foord, J. S., , & Compton, R. G., (2018). The mechanism of electrochemical reduction of hydrogen peroxide on silver nanoparticles. Physical chemistry chemical physics, 20(3), 1608-1614. https: / / doi.org / 10.1039 / c7cp07492a[5] Gao, Z., & Yang, Z. (2006). Detection of microRNAs using electrocatalytic nanoparticle tags. Analytical Chemistry, 78(5), 1470-1477. https: / / doi.org / 10.1021 / ac051726m[6] Morais, A., Rijo, P., Batanero, B., & Nicolai, M. (2022). Low Platinum-Content Electrocatalysts for Highly Sensitive Detection of Endogenously Released H2O2. Biosensors, 12 (9), 672. https: / / doi.org / 10.3390 / bios12090672[7] Ulusoy, U. (2023). A Review of Particle Shape Effects on Material Properties for Various Engineering Applications: From Macro to Nanoscale. Minerals, 13(1), 91. http: / / dx.d0i.0rg / l 0.3390 / min13010091[8] Bishop, K. J., Wilmer, C. E., Soh, S., & Grzybowski, B. A. (2009). Nanoscale forces and their uses in self-assembly. Small (Weinheim an der Bergstrasse, Germany), 5(14), 1600-1630. https: / / doi.Org / 10.1002 / smll.200900358Conclusions from Examples 1 and 2; and Future DirectionIn conclusion, Examples 1 and 2 focused on the development of biosensors for the detection of microRNAs (miRNAs) associated with neurological diseases, such as Alzheimer's disease and epilepsy. The current diagnostic techniques for these diseases lack specificity (e.g. clinical tests < 70% (true negative rate)), reliability (e.g. proteins measurement in CSF), sensitivity, and costefficiency (e.g. MRI, PET), making it necessary to explore alternative methods. Electrochemical sensors that can detect specific sequences of gene regulators, such as miRNAs, offer a revolutionary approach with high relevance in the prognosis, diagnosis, and treatment of neurological diseases. This approach is possible because of the biomarker stability in biofluids, miRNA functionality and the chemical and physical properties inherent of these type of system of detection. Hence, the high selectivity, ability to address low volume samples, high compatibility with microfabrication technology, portability and accessibility to cost-efficient material for the development of electrochemical platforms make it a promising technique for point-of-care devices.To address non-specific adsorption issues, the transducer platform employed an optimal molar ratio of miRNA capture-probe to mercaptohexanol (MCH) of 1 : 4, effectively inhibiting non-specific interactions and ensuring a balanced modulation of charge transfer resistance (Ret) upon target binding while maximizing hybridization efficiency.Through meticulous optimization of the capture-probe strand coverage over the gold electrode surface intertwined with the optimum molar ratio of miRNA capture-probe strands to MCH, the biosensor achieves a remarkable sub-attomolar limit of detection (LOD = 0.15 aM). The strategic use of 1 : 4 ratio of miRNA capture-probe strands to MCH, particularly at 37 °C, modified the microenvironment of the biosensor surface, promoting optimal orientation of oligonucleotides and facilitating target hybridization. Hence, at this ratio, there is a modulation of the dielectric constant of the modified interface, resulting in a lower association constant between the capture-probe and target. This alteration extends the upper limit of the dynamic range giving a linear range of more than nine orders of magnitude. Notably, this specific ratio also minimizes protein adsorption onto the sensor surface, further enhancing the biosensor's overall performance.The biosensor demonstrated excellent analytical performance and high sensitivity against 4-base mismatches (miRNA-1). The stability of the biosensor was confirmed by maintaining upto 90% of its original signal for 14 days when stored in immobilization buffer at 4 °C. These results make the biosensor highly attractive for the development of a point-of-care diagnostic device.The biosensor was also validated using real plasma samples, including healthy and Alzheimer's disease (AD) positive and negative samples. The calibration curve constructed using diluted plasma samples showed accurate quantification of miRNA-206. The biosensor demonstrated good recovery rates in AD positive and negative samples, with values ranging from 95.4% to 110% for AD positive samples and 96.8% to 107% for AD negative samples and a high degree of correlation with results obtained using qPCR. Additionally, gender was not found to be a confounding factor.The development of this platform brings several advantages to the field of biosensing. Firstly, the biosensor operates based on impedance measurements at an optimized, controlled and well-structured platform, allowing low cost label-free and real-time detection. This eliminates the need for complex and time-consuming labelling processes e.g., ferrocyanide could be impregnated within the test strip of a lateral flow device so that it dissolves into the sample when the plasma sample is applied and the need for a second hybridization step is avoided.Secondly, the use of an engineered transducer platform effectively addresses non-specific adsorption issues, improving the selectivity of the assay. The study on the effect of the of the ratio of miRNA capture-probe to MCH, the addition of an optimal temperature used in the hybridization and immobilization reactions to enhance saturation of the surface, not only reduced steric limitation by controlling the separation / dispersion of the capture-probes, but also contribute to maximising the change in Ret when the fully complementary target binds. Lastly, the biosensor achieves high sensitivity and stability, making it suitable for point-of-care diagnostics.Future directions could include (1) Miniaturization into a lateral-flow device (2) the integration of the biosensor with a microfluidic platform, (3) Additional clinical validation studies. Exploring the possibility of miniaturizing the biosensor into a lateral-flow device format would enable rapid and user-friendly testing in resource-limited settings. However, this new approach have challenges to address, which include optimizing sample loading and flow rate to ensure accurate detection, stabilizing reagents in a dried format, while maintaining sensitivity and selectivity in a simplified design.Enhancing the biosensor by also integrating it with a microfluidic system could enable automated sample handling and analysis. Developing a setup where sample handling, fluid mixing, and reactions are performed within a microfluidic cartridge would allow for more precise control and higher throughput. By implementing this less labour-intensive work system, the efficiency and speed of the overall process can be significantly increased compared to manual operation.Additionally, conducting further validation studies using a larger cohort of patient samples is recommended to establish the clinical utility of the biosensor. Evaluating its performance in different stages of the disease and comparing it with existing diagnostic methods would provide valuable insights for its integration into clinical practice. By pursuing these future directions, the biosensor's potential can be further realized, expanding its applicability, diagnostic capabilities, and accessibility in various healthcare settings.A labelled chronoamperometric biosensor for the detection of miRNA-206 was developed. Gold nanorods were used as labels to investigate the potential of specific size and shape of gold nanostructures to enhance electrocatalytic activity and analytical performance of the biosensor. A well-structured mixed monolayer was used in this work (i.e. 1 [miRNA capture-probe] : 4[MCH]), and parameters such as, the molar ratios of miRNA reporter-probe to gold nanorods, optimum time for saturation of hybridization / immobilization steps, and hydrogen peroxide concentration for electrocatalysis, were optimised.The optimization of the miRNA reporter-probe to AuNRDs molar ratio was crucial for achieving successful and ultrasensitive miRNA detection in the biosensor. The use of a molar ratio of 960 :1 (~1 ,5x theoretical capacity) effectively prevented AuNRDs aggregation and led to high amperometric current responses.The optimal hybridization time between the miRNA reporter-probe and target was determined to be 5 hours. This time frame was identified as optimum based on a comprehensive analysis of the current response of the biosensor at different hybridization times, ranging from 30 minutes to 17 hours. At 5h all potential binding sites for the miRNA target have been occupied by reporter-probe strands generating ta maximum current response allied to reproducible results.The electrocatalytic reduction of H2O2 in the functionalized miRNA assay was proved to be influenced by the radial diffusion of peroxide to the gold nanorods, resulting in a slow amperometric process that is diffusion controlled and concentration dependent on hydrogen peroxide. Through analysis of a range of hydrogen peroxide concentrations (200 pM to 10 mM), an optimum concentration hydrogen peroxide was defined as 400 pM allowing for maximum readout response (ii) while maintaining a low background current.The biosensor platform was tested against mismatches, including a four base mismatches (miRNA-1) and a one base mismatch. It exhibited a significant decrease in current signal of 95% and 64% compared to a fully complementary miRNA target, respectively. This indicates that the biosensor is capable of selectively detecting miRNA-206. The biosensor demonstrated a limit of detection of 0.46 fM and a wide dynamic range covering nine orders of magnitude.Furthermore, the biosensor showed promising results in terms of providing accurate results, which are essential for point-of-care devices. The amperometric response of the biosensor was found to beproportional to the log miRNA target concentration, with a steady-state current achieved within a time frame of 300 to 1500 seconds, depending on the miRNA target concentration.This platform uses gold nanorods, which possess both optical properties and improved catalytic activity based on their size and shape. Unlike previous studies that primarily focused on using gold nanorods in optical biosensors, this work pioneers the use of gold nanorods in chronoamperometric sensors. By systematically adjusting the miRNA reporter-probe to AuNRDs ratio, hybridization time, and hydrogen peroxide concentration, reliable and efficient biosensor without unnecessary complexity (i.e. simplistic design) was achieved. This straightforward approach facilitated the fine-tuning of the biosensor's sensitivity, specificity, and stability, ultimately making significant strides towards the development of point-of-care biosensors for neurological disease detection.Moving forward, future directions could involve exploring the application of surface-enhanced Raman scattering (SERS) of gold nanorods as a detection method for the biosensor. This entails optimizing SERS conditions and investigating the correlation between SERS signals and miRNA concentration. Challenges in this direction include achieving sufficient enhancement of Raman signals, reducing background noise, and ensuring the stability of SERS-active nanoparticles on the biosensor surface. By further exploring SERS, the biosensor can potentially gain additional sensitivity and expand its detection capabilities.In Example 1, in-house screen printed carbon electrodes (SPCEs) with different structures of gold nanoparticles mixed to the carbon ink was developed. Amperometry was used as a detection system and labels, such as gold nanorods (AuNRDs) and palladium nanocubes (PdNCBs) were used to evaluate the sensitivity of the miRNA assays at different composition of SPCEs.Example 1 reports the results of three studies. The first study investigated the electrochemical behaviour of SPCEs with 10% (w / w) of gold microspheres within the carbon based ink (referred as 10% AuS SPCE) and SPCEs with 10% (w / w) of flake microparticles mixed into the ink (referred as 10% AuF SPCE). The 10% AuS SPCE exhibited the most reversible behaviour, highest current values (lP), and lowest overvoltage among the in-house electrodes, indicating higher electronic transfer kinetics and better reactivity of the substrate. The 10% AuS SPCE also showed the lowest resistance to the charge transfer due to the uniform distribution of gold particles on the surface. In the second study, the different micro-structured gold SPCEs (10% AuS SPCE and 10% AuF SPCE) were assessed for their impact on the sensitivity of a biosensor functionalised to a fully complementary miRNA sandwich assay. The performance of the platforms was compared using two different labels, PdNCBs and AuNRDs. The 10% AuS SPCE with PdNCBs demonstrated a 10-fold increase in analytical signal (Ai) compared to AuNRDs, while the 10% AuF SPCE with PdNCBs showed a 5-fold increase. The 10% AuS platform exhibited the highest sensitivity and signal-to-noise ratio, attributed to increased surface area for biomolecule adsorption and enhanced metal catalytic activity. The third study focused on optimizing the conducting path of the SPCE platform to enhance the number of active sites over the surface. The performance of 10% (w / w) and 20% (w / w) goldmicrospheres (AuS) SCPEs functionalized with miRNA assay labelled with PdNCBs and AuNRDs was evaluated. The 20% (w / w) AuS SPCEs showed the greatest performance with 56-fold increase in current when the full assay is labelled with AuNRDs and 12-fold increase in current when the sandwich assay is functionalized with PdNCBs. The study also investigated the optimum potential capable to enhance the electrocatalysis of nanoparticles for the reduction of H2O2. The results indicate that the electrocatalytic reduction of H2O2 can be tuned by modulating the favourable characteristics of metal nanoparticles, such as their sizes and shapes. Optimum potentials was defined as -0.25V, -0.375V and -0.5V for AuNRDs, PdNCBs and PtNPS, respectively.Overall, the developed screen-printed platforms exhibited promising results and reproducibility, indicating their potential for use in biosensing applications. The studies suggest that the 20% (w / w) AuS SPCE could be utilized for fabricating a multiplexed electrochemical biosensor to detect miRNAs associated with neurological diseases. The optimizations performed on the SPCE have successfully enhanced the surface characteristics and analytical performance of the assay, including parameters such as heterogeneous electron transfer (ko), number of electroactive sites, LCD, and dynamic range. These achievements offer valuable insights into development of point-of-care biosensors with improved capabilities.Future directions for this research include conducting a comprehensive comparison of the developed screen-printed electrode with other commercially available platforms in terms of sensitivity and costeffectiveness. This comparison would provide important knowledge into the performance and competitiveness of the developed platform.In Example 2, the innovative electrochemical platform developed in Example 1 (referred as 20% AuS SPCE) was used to demonstrate its feasibility as a highly sensitive platform to detect multiple miRNA targets. The incorporation of 20% (w / w) gold microspheres into the carbon ink of a screen-printed electrode has increased the biosensor's active adsorption surface area, surpassing that of conventional SPCE surfaces, resulting in improved miRNA capture-probe binding. In addition, the strategic integration of different-shaped metal nanoparticle labels, such as gold nanorods, platinum nanoparticles, and palladium nanocubes, further augmented the biosensor's performance by amplifying the signal from the different miRNA targets studied (let-7b, miRNA-206 and miRNA-135a) at distinct potentials. The SPCE designs allows for sensitivity adjustment based on the selection of different nanoparticles, catering to the specific requirements of different miRNAs.The biosensor demonstrates a wide dynamic range, with calibration curves showing a linear relationship between current and the logarithm of the analyte concentration. It also exhibits high sensitivity, with low LCD values for various miRNAs (i.e. 0.6 fM for miRNA-206, 0.42 fM for miRNA-135a, and 1.17 fM for let-7b). When compared to other electrochemical SPCE for miRNA detection, the proposed biosensor outperforms in terms of linear dynamic range, detection limit, and sensitivity.Furthermore, the biosensor shows selectivity for the target miRNAs, as evidenced by higher current signals observed for fully complementary assays compared to assays with 1-base mismatches and 4-base mismatches. Reproducibility falls within acceptable limits (< 5%), and limited non-specific binding of BSA is observed (-6% of the original signal)), ensuring the reliability and accuracy of miRNA detection.The biosensor exhibits stability even after 21 days of storage, retaining a 90% of its original signal. The formation of a stable monolayer by the miRNA capture-probe on the SPCE indicates the longevity and efficiency of the immobilized sensing phase. This stability reduces analysis time and enables extended storage, making the biosensor suitable for point-of-care applications.The developed biosensors offer several advantages, including easy-to-use operation, cost-efficiency, real-time detection, and potential for point-of-care devices. They have the potential to revolutionize the detection, diagnosis, and treatment of neurological diseases.Future directions for this research include, (1) simultaneous detection of the multi-analyte at the developed platform and (2) conducting clinical validation studies. In terms of design of the experiments, the developed platform could be used with a multichannel apparatus. Through this simplistic modification, the signals associated with the reduction of hydrogen peroxide by each nanoparticle labelled to a specific fully complementary miRNA target assay is measured at a different channel. This approach allows the efficiency and throughput of the diagnostic process.Simultaneous detection of multiple miRNAs provides a more comprehensive and holistic view of the disease state, leading to improved diagnostic accuracy and personalized treatment strategies. In addition, by detecting miRNAs from real plasma samples at the designed platform, clinicians and researchers can gain valuable insights into the molecular signatures associated with neurological diseases.A successful simultaneous and multiplex detection is the first step into the future where integration of these biosensors into periodic monitoring systems, such as annual medical exams, would provide continuous and real-time monitoring of disease progression. Further advancements in multiplexed sensing technologies and design possibilities can enhance the accuracy and efficiency of point-of-care biosensors.However, there are a few challenges that may be encountered in simultaneous detection analysis and real plasma sample analysis. One such challenge involves the possibility of cross-reactivity or interference between different miRNA targets during multiplex detection. To overcome this, it is crucial to carefully design the assay to ensure the biosensor's specificity and selectivity towards each target miRNA.Another hurdle lies is the complexity of plasma samples, which contain a variety of proteins and nucleic acids. This complexity can potentially make sample preparation challenging and interfere with the biosensor's performance. While the multiplex platform has been tested for non-specific absorption of BSA and showed no significant interference, even at physiological relevant levels, it is still necessary to establish robust and reliable sample preparation protocols. These protocols are essential for minimizing interferences and guaranteeing the accurate detection of miRNAs in plasma samples.To produce the biosensor in large numbers, other challenges may include optimizing the fabrication process, ensuring reproducibility between baths, and validating the performance with a broader range of analytes and complex samples. By addressing these challenges and conducting thorough evaluations, the developed screen-printed electrode platform can advance toward practical applications in biosensing.In conclusion, the developed biosensors for miRNA detection associated with neurological diseases hold significant promise for improving diagnostics, prognosis, and treatment outcomes. Continued research and development in this field will contribute to the advancement of personalized medicine and patient care in the context of neurological diseases.The invention is not limited to the embodiment(s) described herein but can be amended or modified without departing from the scope of the present invention. While preferred embodiments of the invention have been described, it will be clear that the invention is not limited to the described embodiments only. Numerous modifications, changes, variations, substitutions and equivalents will be apparent to those skilled in the art without departing from the scope of the invention as described in the claims.Further, unless the context clearly requires otherwise, throughout the description and the claims, the words "comprise", "comprising" and the like are to be construed in an inclusive as opposed to an exclusive or exhaustive sense; that is to say, in the sense of "including, but not limited to".

Claims

72CLAIMS:

1. An ink for a screen-printed working electrode, the ink comprising: gold microstructures having a maximum dimension of about 0.05 to about 7.5 microns; conductive carbon particles; at least one solvent having a boiling point of greater than 110°C; and at least one polymer dissolved or dispersed in the at least one solvent.

2. The ink according to Claim 1, wherein the gold microstructures have a maximum dimension of about 1 to about 3 microns, optionally about 2 microns.

3. The ink according to Claim 1 or 2, wherein the ink comprises about 10 to about 20% (w / w) gold microstructures.

4. The ink according to Claim 1 , 2 or 3, wherein the gold microstructures are selected from gold microspheres and gold microflakes.

5. The ink according to any one of Claims 1 to 4, wherein the conductive carbon particles comprise a material selected from graphite, graphene, carbon black, and carbon nanotubes, or any combination thereof.

6. The ink according to any one of Claims 1 to 5, wherein the conductive carbon particles comprise more than 25% (w / w), optionally more than 27% (w / w), of the ink.

7. The ink according to any one of Claims 1 to 6, wherein the at least one polymer comprises at least one reactive group.

8. The ink according to Claim 7, wherein the at least one reactive group is selected from thiols, disulphides, aldehydes, acrylate, methacrylate, alcohols, carboxylic acids, and amines.

9. The ink according to any preceding claim, wherein the at least one polymer comprises about 4 to 15% (w / w), optionally 5 to 12 % (w / w), of the ink.

10. The ink according to any preceding claim,wherein the at least one polymer is selected from polyethylene terephthalate, polyethyloxazoline, polymethylmethacrylate, poly-L-lactide, cellulose derivatives, ethyl cellulose, cellulose acetate, cellulose acetate propionate, polyacrylates, polyesters, polyamines, polyhydroxyether, polyethers, polymethyl methacrylate, polyvinyl acetate, polyvinyl chloride, polyhydroxyethers, poly(lactide) and associated co-polymers.

11. The ink according to any preceding claim, wherein the at least one polymer has a molecular weight between about 5,000 and about 500,000 g mol-1.7312. The ink according to any preceding claim, wherein the at least one solvent is selected from monoterpenoid alcohols, ethers, glycols, glycol ether acetates, acetates, glycol ethers, diols, phthalates, carbonates, sorbitol-derivatives, and dibasic esters.

13. The ink according to any preceding claim, whereinthe at least one solvent is selected from a-terpineol, dipropylene glycol monomethyl ether, methyl isobutyl ketone (MIBK), isobutyl acetate, propylene glycol monomethyl ether acetate, diethylene glycol monoethyl ether, Diethylene glycol monoethyl ether acetate, dipropylene glycol monomethyl ether, dibasic ester 9, dihydrolevoglucosenone, and propylene glycol monomethyl ether acetate.

14. The ink according to any preceding claim, whereinthe at least one solvent comprises 45 to 65% (w / w) of the ink.

15. An electrode comprising:a screen-printed working electrode comprising the ink according to any preceding claim.

16. The electrode according to Claim 15, further comprising at least one binding ligand for a target analyte, the at least one binding ligand being associated with, optionally covalently attached to, the gold microstructures on the working electrode.

17. The electrode according to Claim 15 or 16, whereinat least one binding ligand is associated with the gold microstructures on the working electrode by means of wet chemical deposition, cold plasma deposition or soft stamping onto gold microstructures.

18. The electrode according to Claim 16 or 17, wherein the at least one binding ligand is selected from nucleic acids, antibodies, aptamers, polypeptides, and proteins.

19. The electrode according to Claim 18, wherein the at least one binding ligand, in use, is capable of binding a target analyte and, in use, is also capable of hybridising to a probe strand that is functionalized with a label.

20. The electrode according to Claim 19 wherein,in use, the label comprises an electrochemical or optical label; wherein the electrochemical label is optionally selected from metal particles or wherein the optical label is optionally selected from a fluorophore, luminophore or chromophore.

21. The electrode according to Claim 20, wherein the metal particles comprise metal nanostructures that are selected from gold nanorods, platinum nanoparticles, and palladium nanocubes.7422. The electrode according to any one of Claims 15 to 21, further comprising a reference electrode; and / or a counter electrode.

23. The electrode according to Claim 22, wherein the reference electrode and / or the counter electrode is screen printed.

24. The electrode according to Claim 23, whereinthe screen-printed reference electrode comprises silver, silver / silver chloride, gold, platinum or carbon.

25. The electrode according to Claim 23, whereinthe screen-printed counter electrode comprises platinum, gold, or carbon.

26. A method of making the electrode according to any one of Claims 15 to 25, comprising: screen-printing a working electrode onto a substrate using an ink according to any one of Claims 1 to 14;providing a reference electrode on the substrate; andproviding a counter electrode on the substrate.

27. The method according to Claim 26, further comprising:associating an at least one binding ligand with the working electrode, wherein a response characteristic of the electrode is capable of being operably varied.

28. A method of detecting the presence or absence of a target analyte in a sample, comprising: contacting the electrode of any one of Claims 15 to 25 with a sample;wherein a response characteristic of the electrode is capable of being operably varied, thereby providing an indication of the presence of the analyte within the sample.

29. The method of any one of Claims 26 to 28, wherein the reference and I or counter electrode is I are screen printed onto the substrate.

30. The method of any one of Claims 26 to 29, wherein the substrate is selected from paper, plastic, metal and ceramic.

31. A method according to Claim 27 or 28, wherein the response characteristic comprises an electrochemical signal or an optical signal which is capable of being operably varied upon capture of the target analyte thereby indicating the presence of the target analyte within the sample.7532. A method according to Claim 31, wherein the electrochemical signal comprises a changed electrochemical impedance signal (resistance and capacitance) or a changed amperometric or cyclic voltammetric signal (potential and current).

33. A method according to Claim 31, wherein the optical signal comprises a change in the fluorescence, colorimetric or luminescence intensity or lifetime of a bound or free fluorophore, chromophore or luminophore.

34. A method according to Claim 33, wherein the optical signal comprises a change in the fluorescence, colorimetric or luminescence intensity or lifetime of a bound or free fluorophore, chromophore or luminophore; by a change in the scattering intensity of the bound or free fluorophore, chromophore or luminophore.