Gene therapy for the treatment of neuromuscular pathologies of genetic origin

WO2026167077A1PCT designated stage Publication Date: 2026-08-13ASSOCIATION FRANCAISE CONTRE LES MYOPATHIES (AFM) +3
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-02-05
Publication Date
2026-08-13

Smart Images

  • Figure EP2026053012_13082026_PF_FP_ABST
    Figure EP2026053012_13082026_PF_FP_ABST
Patent Text Reader

Abstract

The invention relates to a composition comprising at least one vector encoding a CRISPR-Cas system directed to a messenger RNA (mRNA) linked to a neuromuscular pathology of genetic origin for use in the treatment or prevention of the pathology. The invention is characterised in that the at least one vector comprises: (a) at least one sequence encoding a guide RNA (gRNA) that hybridises to the mRNA linked to the pathology in the patient; and (b) a second sequence encoding a Cas nuclease.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Gene therapy for the treatment of neuromuscular disorders of genetic origin

[0002] TECHNICAL FIELD

[0003] The present invention relates to a composition comprising at least one vector encoding a CRISPR-Cas system directed to a messenger RNA (mRNA) linked to a neuromuscular pathology of genetic origin for use in the treatment or prevention of said pathology.

[0004] PREVIOUS TECHNIQUE

[0005] Neuromuscular diseases or neuromuscular pathologies manifest as transient or permanent muscle damage that can appear at any age of life and worsen more or less rapidly.

[0006] Neuromuscular diseases are diseases of the muscle or its nerve control, in which the muscle contracts poorly, or not at all.

[0007] There are several hundred known neuromuscular diseases that differ both in the extent and severity of muscle involvement and its consequences on the body (orthopedic, respiratory, cardiac, digestive) and in their causes, the majority being of genetic origin, some being autoimmune and inflammatory.

[0008] Neuromuscular diseases are primarily due to damage to the motor unit, a physiological structure consisting of the muscle, the nerve / muscle junction and the motor neuron, which connects the central nervous system to the muscle.

[0009] Most neuromuscular diseases are therefore diseases of genetic origin. The genetic abnormality more specifically prevents the production of a constituent or an enzyme essential for the proper functioning of the muscle cell (muscular dystrophies, congenital myopathies, metabolic myopathies, muscular channelopathies), of the neuromuscular junction (congenital myasthenic syndromes) or even of the motor nerve cell (spinal amyotrophies, Charcot-Marie-Tooth disease).

[0010] The discovery of genes involved in the genetic forms of these diseases and a better understanding of the mechanisms involved have made it possible to explore innovative therapeutic avenues, some of which are being tested in humans.

[0011] Most neuromuscular disorders of genetic origin do not have specific treatments available. However, when an inflammatory mechanism is involved, treatment can be implemented.

[0012] In most cases, treatments are limited to relieving patients' symptoms, or even delaying the progression of the disease.

[0013] Current medical care primarily aims to prevent complications, whether orthopedic, cardiac, or respiratory. It improves the comfort and lifespan of people with neuromuscular diseases. Therefore, it should begin as early as possible, even if a precise diagnosis of the specific form of neuromuscular disease has not yet been made.

[0014] Regular monitoring from a muscular, orthopedic, respiratory, cardiac, nutritional, ENT, and oral perspective allows, as far as possible, for the implementation at the right time, according to the evolution of each person, of the management techniques necessary for the prevention and limitation of the consequences of muscular damage.

[0015] Orthopedic treatment (physiotherapy, orthotics, surgery) should be early, regular, and tailored to each individual situation. It helps maintain joint flexibility.

[0016] Assistive devices (hands-free phone, cane, arm support, long-handled grabber, etc.) can help, when necessary, to perform everyday tasks that muscle weakness makes difficult or impossible. In some cases, a wheelchair is necessary to restore independence in mobility.

[0017] Respiratory care must be started very early in order to preserve the growth of the thorax and promote optimal development of lung capacity.

[0018] Regular and precise cardiological monitoring thus makes it possible to start appropriate treatment in the event that cardiac signs are detected by medical examinations.

[0019] Pain management varies depending on the causes (adaptations to the rehabilitation program or equipment as needed, pain medication, relaxation).

[0020] When it comes to a hereditary genetic disease, genetic counseling helps to inform and support a person, or a family, facing the risk of developing or transmitting this disease.

[0021] In parallel, research into neuromuscular diseases has developed considerably since the 1990s, enabling the development of more targeted therapies, such as gene therapies.

[0022] Conventional gene therapy has largely focused on gene replacement in target cells. RNA-based strategies offer a range of novel therapeutic applications, including modifying the processing of the target pre-mRNA transcript, reprogramming genetic defects by mRNA repair, delivering functional components, and targeted silencing of allele- or isoform-specific gene transcripts.

[0023] Thus, several avenues for gene therapies have been developed.

[0024] Golodirsen is an antisense oligonucleotide used to treat Duchenne muscular dystrophy by exon-skipping the mutated exon 53 of the DMD gene. This is a messenger RNA (mRNA) editing approach that involves excluding a defective exon from the mRNA. Anti-antibody therapies (AAVs) containing DMD-specific guide RNAs have also been developed for the treatment of Duchenne disease, with demonstrated therapeutic effects in mice (GUOLING U ET AL, THE JOURNAL OF CLINICAL INVESTIGATION, 2022 vol. 133, no. 3; CE NELSON ET AL, SCIENCE ADVANCES, 2015 vol. 351, no. 6271).

[0025] Nusinersen is an antisense oligonucleotide that acts on the defective pre-messenger RNA (pre-mRNA) of the SMN2 gene responsible for spinal muscular atrophy (SMA). The drug modifies the splicing of the SMN2 pre-mRNA to increase the production of the functional SMN protein.

[0026] RNA interference is also a promising avenue. It makes it possible to reduce the expression of a gene responsible for a given pathology.

[0027] The technique of RNA editing by the CRISPR-Cas system for the restoration of functional mRNA sequences is another particularly promising avenue.

[0028] Although CRISPR-Cas has shown enormous potential in basic and laboratory research, its use in treating genetically inherited neuromuscular disorders in humans is still only in the experimental phase. To date, there are no CRISPR-Cas treatments approved for routine clinical use for neuromuscular disorders.

[0029] In particular, the use of the CRISPR-Cas system presents several challenges.

[0030] One of the major challenges in using CRISPR for neuromuscular diseases is the efficient delivery of the CRISPR-Cas system to target muscle or nerve cells. Skeletal muscles, in particular, are difficult to reach with commonly used viral vectors.

[0031] Another challenge is to specifically target the affected muscle or nerve cells while avoiding damage to non-target cells.

[0032] Adult muscle cells, particularly those of skeletal and cardiac muscle, have a limited capacity for regeneration. This makes gene therapy treatments, including CRISPR, less effective in adults, especially for conditions affecting already damaged muscles.

[0033] More specifically, centronuclear myopathies constitute a family encompassing certain neuromuscular diseases of genetic origin.

[0034] Centronuclear myopathies (CNM) are a group of congenital neuromuscular myopathies. Three main forms of CNM have been characterized:

[0035] - X-linked CNM (XLCNM also called myotubular myopathy, OMIM 310400) due to mutations in the phosphoinositide phosphatase myotubularin (MTM1) (Laporte, J. et al., Nature Genetics, 1996. 13(2): p. 175-82),

[0036] - autosomal recessive CNM (ARCNM, OMIM 255200) caused by mutations in the membrane remodeling protein amphiphysin 2 (BIN1) (Nicot, AS et al., Nature Genetics, 2007. 39(9): p. 1134-9), and

[0037] - autosomal dominant CNM (ADCNM, OMIM 160150) due to mutations in dynamin 2 (DNM2) (Bitoun, M. et al., Nature Genetics, 2005. 37(11): p.

[0038] 1207-9).

[0039] Other genes have been associated with CNM-type myopathy such as RYR1 encoding the ryanodine receptor, TTN encoding titin, CCDC78 (OMIM 614807) and the phosphoinositide phosphatase MTMR14 (called hJUMPY; OMIM 160150).

[0040] The genetic relationship between the genes involved in these diseases is generally unknown, and there are few, if any, effective therapeutic approaches.

[0041] Centronuclear myopathies thus include certain serious diseases involving in particular the DNM2 gene and requiring a real need for effective treatment; there are also forms of Charcot-Marie-Tooth disease caused by mutations of the DNM2 gene.

[0042] For example, patent application WO2013 / 0065558 describes miR-133a as playing a modulatory role in DNM2 expression. Since DNM2 is mutated in centronuclear myopathy (CNM), it is suggested that an agonist of a member of the miR-133 family could be beneficial for treating this condition. However, miR-133 has multiple targets and could therefore have deleterious effects. Furthermore, no improvement in CNM has been reported with the administration of miR133a.

[0043] Specific guide RNAs targeting DNM2 have also been developed for their ability to inactivate DNM2R465W mutants, exhibiting relatively low efficacy (RABAI AYMEN ET AL, MOLECULAR THERAPY-NUCLEIC ACIDS, 2019 vol. 16 pages 246-256).

[0044] Although they exist, therapeutic approaches for the treatment of neuromuscular pathologies of genetic origin are rarely applied to the field of human health.

[0045] Therefore, there is still a need for new treatments for these diseases, especially since the care currently provided to patients focuses more on limiting the consequences of muscle damage than on actually treating the pathology itself.

[0046] TECHNICAL PROBLEM

[0047] Considering the foregoing, one problem that the invention aims to solve is the development of a composition for use in the treatment or prevention of neuromuscular diseases of genetic origin, and more particularly centronuclear myopathies, by gene editing using the CRISPR-Cas system. The composition is advantageously adapted to target muscle cells and aims to overcome the limitations of the CRISPR-Cas system established above, in particular:

[0048] - the difficulty of targeted delivery to muscle cells;

[0049] - the specificity of targeting muscle cells; and

[0050] - the difficulty in modifying muscle cells in adult tissues.

[0051] TECHNICAL SOLUTION

[0052] The invention therefore relates to a composition comprising at least one vector encoding a CRISPR-Cas system directed towards a messenger RNA (mRNA) linked to a neuromuscular disease of genetic origin for use in the treatment or prevention of said disease, wherein said at least one vector comprises:

[0053] (a) at least one sequence encoding a guide RNA (gRNA) that hybridizes to the mRNA associated with said pathology in the patient; and

[0054] (b) a second sequence encoding a Cas nuclease.

[0055] BENEFITS PROVIDED

[0056] The composition for use in the treatment or prevention of neuromuscular diseases of genetic origin has the particular advantage of targeting DNM2 at the mRNA level, allowing the DNA not to be modified, and making the therapy reversible.

[0057] The composition has an effective and specific action on the RNAs of pathological muscle cells.

[0058] Regulating DNM2 expression allows for the treatment of a wide range of neuromuscular pathologies of genetic origin, including diseases whose genetic origin is not linked to DNM2.

[0059] BRIEF DESCRIPTION OF THE DRAWINGS

[0060] The invention and its advantages will be better understood upon reading the following description and non-limiting embodiments, with reference to the accompanying drawings in which:

[0061] Figure 1 represents the relative abundance of DNM2 mRNA in DNM2R465W / + myoblasts treated with Casl3X.l, Casl3X.l + RNAgl41 or Casl3X.l + RNAgl41 + RNAg8.16. One-way ANOVA with Tukey's test: *P<0.05; **P<0.01; ***P<0.001.

[0062] Figure 2 represents the relative abundance of DNM2 protein in DNM2R465W / + myoblasts treated with Casl3X.l, Casl3X.l + RNAgl41 or Casl3X.l + RNAgl41 + RNAg8.16. One-way ANOVA with Tukey's test: *P<0.05; **P<0.01.

[0063] Figure 3 shows the GTPase activity of DNM2R465W / + myoblasts treated with Casl3X.l, Casl3X.l + RNAgl41 or Casl3X.l + RNAgl41 + RNAg8.16. One-way ANOVA with Tukey's test: p = 0.053. Figure 4 shows the relative abundance of DNM2 mRNA in myocytes from untreated DNM2R465W / + dogs; dogs treated with Casl3X.l + RNAgl41 or Casl3X.l + RNAgl41 + RNAg8.16, 1 month and 2 months after treatment injection.

[0064] Figure 5 represents the relative abundance of DNM2 protein in untreated or Casl3X.l + RNAgl41 + RNAg8.16 DNM2+ / + and DNM2R465W / + dog myocytes.

[0065] Figure 6 represents the relative abundance of p62 protein in myocytes from DNM2+ / + and DNM2R465W / + dogs, untreated or treated with Casl3X.l + RNAgl41 + RNAg8.16.

[0066] Figure 7 represents the relative abundance of cytochrome-C protein in myocytes of DNM2+ / + and DNM2R465W / + dogs untreated or treated with Casl3X.l + RNAgl41 + RNAg8.16.

[0067] Figure 8 represents the relative abundance of DNM2 mRNA in untreated human Hek293T cells; cells treated with humanized 8.16gRNA (hgRNA8.16); cells treated with humanized 41gRNA (hgRNA41); cells treated with humanized 25gRNA (hgRNA25); cells treated with canine 8.16gRNA (cgRNA8.16); cells treated with canine 41gRNA (cgRNA41); cells treated with canine 25gRNA (cgRNA25); cells treated with humanized 207gRNA (hgRNA207); cells treated with humanized 33gRNA (hgRNA33) or humanized 1gRNA (hgRNA).

[0068] DESCRIPTION OF IMPLEMENTATION METHODS

[0069] In this description, unless otherwise specified, it is understood that, when an interval is given, it includes the upper and lower bounds of said interval.

[0070] The invention relates to a composition for use in the treatment or prevention of neuromuscular diseases of genetic origin.

[0071] The terms "treat" or "treatment" refer to any action intended to improve the health status of patients, such as therapy, prevention, prophylaxis, and the slowing of disease or disease symptoms. It encompasses both curative and / or prophylactic treatment of a disease. Curative treatment is defined as treatment that results in a cure or that alleviates, improves, and / or eliminates, reduces, and / or stabilizes a disease or the symptoms of a disease, or the suffering it causes directly or indirectly. Prophylactic treatment includes both treatment that prevents a disease and treatment that reduces and / or delays the progression and / or incidence of a disease or the risk of its occurrence. In some cases, this term refers to the improvement or eradication of a disease, disorder, infection, or associated symptoms.The treatments according to the present invention do not necessarily imply 100% or complete treatment. On the contrary, there are varying degrees of treatment which, to those with ordinary skill in the art, are recognized as having a potential benefit or therapeutic effect. The terms "pathology" and "disease" are considered strict synonyms and are interchangeable.

[0072] The terms "pathology" or "disease" refer to an organ, part, structure, or system of the body that is not functioning properly and that results from the effects of genetic or developmental errors, infections, poisons, nutritional deficiencies or imbalances, toxicity, or adverse environmental factors. Preferably, these terms refer to a health disorder or disease, for example, a disease that disrupts normal physical or mental functions.

[0073] The term "patient" refers to animal subjects, preferably a mammal, and even more preferably a human being, including an adult and a child. However, the term "patient" also encompasses non-human animals, particularly mammals such as dogs, cats, horses, cows, pigs, sheep, and non-human primates, among others.

[0074] From an anatomoclinical point of view, "neuromuscular pathology" refers to disorders of the muscle (muscular dystrophies, congenital myopathies, metabolic myopathies), of the neuromuscular junction (myasthenia gravis and myasthenic syndromes), of the motor neuron (infantile spinal muscular atrophies) and / or of the peripheral nerve (including, among others, familial amyloid neuropathies, rare dysimmune neuropathies, and forms of Charcot-Marie-Tooth disease caused by mutations in the DNM2 gene).

[0075] In France, in 2019, there were between 40,000 and 50,000 people suffering from a neuromuscular disease.

[0076] Neuromuscular disorders can be of genetic or non-genetic origin.

[0077] By "neuromuscular pathology of genetic origin", we mean neuromuscular pathologies for which a gene codes for a protein involved in the process of nerve or muscle alteration.

[0078] Each neuromuscular disorder of genetic origin corresponds to one or more genetic abnormalities. Therefore, a single gene can be responsible for different neuromuscular disorders of genetic origin. A gene can have different mutations that give rise to different neuromuscular diseases. Furthermore, the same protein can play a key role in different disorders, as is the case with the DNM2 protein in neuromuscular disorders.

[0079] The severity of neuromuscular disorders of genetic origin varies greatly. Some threaten the patient's life or independence, while others are compatible with a relatively normal life.

[0080] Preferably, the neuromuscular diseases of genetic origin according to the invention are centronuclear myopathies. Centronuclear myopathies include several forms, among which we can mention X-linked myotubular myopathy (XLMTM), autosomal dominant centronuclear myopathy (ADCNM), autosomal recessive centronuclear myopathy due to BIN1 mutations, RYR1-linked centronuclear myopathy, TTN-linked centronuclear myopathy, SPEG-linked centronuclear myopathy, as well as rare forms associated with mutations in the MTMR2, MTM1, GAGNAI S, MYH2 and RHO genes.

[0081] Essentially, the composition used according to the invention in the treatment or prevention of a neuromuscular disease of genetic origin comprises at least one vector encoding a CRISPR-Cas system directed towards a messenger RNA (mRNA) linked to said neuromuscular disease of genetic origin, composition in which said at least one vector comprises:

[0082] (a) at least one sequence encoding a guide RNA (gRNA) that hybridizes to the mRNA associated with said pathology in the patient; and

[0083] (b) a second sequence encoding a Cas nuclease.

[0084] The CRISPR-Cas system is a tool for modifying the genome, or its expression. When the genome is modified, this is referred to as "genome editing" or simply "editing".

[0085] Genome editing is generally performed at the DNA level. It allows for permanent modifications to DNA and potentially cures for certain genetic diseases. However, this technique presents risks, particularly because the consequences of an editing error can be serious. This is known as collateral editing, which refers to an unintentional modification of DNA at a site other than the one initially targeted.

[0086] RNA modification, on the other hand, is less risky because the DNA remains intact and is not edited. This technique is considered safer than DNA editing, although the therapeutic benefits are not permanent. It is a reversible therapy. Generally, the CRISPR-Cas system does not edit RNA sequences but rather regulates the expression of associated genes.

[0087] Indeed, the targeting of RNA by the CRISPR-Cas system generally aims at the destruction of said RNA.

[0088] Gene therapy based on the CRISPR-Cas system requires at least two elements:

[0089] a guide RNA (gRNA); and

[0090] a Cas nuclease.

[0091] γRNA is capable of specifically hybridizing to a nucleotide sequence, such as a messenger RNA (mRNA) strand, through base complementarity. This allows it to specifically target a sequence of interest. The Cas protein recognizes γRNA and acts as molecular scissors at the mRNA sequence where γRNA is hybridized.

[0092] Following the cleavage of the mRNA, it is naturally degraded by the cell. By targeting certain specific sequences of interest, it is possible to regulate the expression of certain genes by acting on the mRNAs. In the context of this invention, the mRNAs of interest are advantageously responsible for neuromuscular pathologies of genetic origin.

[0093] Neuromuscular pathology of genetic origin is preferentially chosen from among centronuclear myopathies.

[0094] Centronuclear myopathies constitute a specific subgroup of neuromuscular pathologies of genetic origin, characterized by an abnormality in the structure of muscle fibers in which the nucleus of the muscle fibers is abnormally located in the center of the cell, instead of being in the periphery, as is the case in healthy muscles.

[0095] Surprisingly, six families of RNAs have been advantageously identified as relevant and of interest in the treatment or prevention of neuromuscular diseases of genetic origin, and more particularly of centronuclear myopathies, namely RNAg141 (SEQ ID NO: 1-2), RNAg8.16 (SEQ ID NO: 3-4), RNAg25N (SEQ ID NO: 5-6), RNAgl (SEQ ID NO: 12-13), RNAg33 (SEQ ID NO: 14-15) and RNAg207 (SEQ ID NO: 16-17).

[0096] Preferably, the composition used according to the invention comprises at least one coding sequence for an RNAg having at least 85% identity with one of the sequences SEQ ID NO: 1 to SEQ ID NO: 6 or SEQ ID NO: 12 to SEQ ID NO: 17.

[0097] More preferably, the composition used according to the invention comprises at least one coding sequence for an RNA gene, which is chosen from the group consisting of the following sequences:

[0098] - GTGCCX1TCX2TCCATCAGGTCX3AGCTTGG dans laquelle Xi = T ou G, X2= A ou G et X3= G ou A (SEQ ID NO : 9) ;

[0099] - TGATGACACCGATGGTCCGYi AY2GCCTT and laquelle Yi = T or G and Y2= A or G (SEQ ID NO : 10);

[0100] - CZ1AGZ2TGGGGGTCCATGGAGAAGGTGTT dans laquelle Zi = T ou G et Z2= G ou T (SEQ ID NO : 11) ;

[0101] - TAATGGCATAGCTGATCTCP1CGP2CGTAAP3T and laquelle Pi = G ou A, P2= T ou G and P3= G ou A (SEQ ID NO: 18);

[0102] CCCACQi GGQ2ACQ3GGAATCAGQ4GGGGGCCCQ5 and then Qi = G ou T, Q2 = A ou G, Q3 = A ou G, Q4 = G ou A and Qs = T ou G (SEQ ID NO : 1) ; ou

[0103] - GCGGTTCACCACGCCAATGTAGCCTCTTCT (SEQ ID NO : 16),

[0104] taken alone or in combination. Even more preferably, the composition used according to the invention comprises at least one coding sequence for an RNAg which is chosen from the sequences consisting of SEQ ID NO: 1 to SEQ ID NO: 6 or SEQ ID NO: 12 to SEQ ID NO: 17, taken alone or in combination.

[0105] To act at the sites of interest, in particular the mRNAs in pathological muscle cells within the framework of the invention, the RNA and Cas protein sequences are advantageously integrated into vectors.

[0106] The term "vector" refers to an entity used to transfer genetic material. The vectors used in the context of the invention may be of viral or non-viral origin.

[0107] A viral vector is a virus that has been genetically modified to transport and deliver genes or genetic material into the cells of an organism without causing disease. Viral vectors are very efficient at gene transfer and allow transfer to a wide range of different cell types.

[0108] A non-viral vector is a chemical or physical tool used to transfer genetic material into the cells of an organism without using a virus. Unlike viral vectors, non-viral vectors are an alternative that does not rely on viral mechanisms to infect cells. Non-viral vectors are generally safer than viral vectors, particularly because they do not induce an immune response, and they are a good choice for large-scale production due to their ease of manufacture.

[0109] Preferably, the composition used according to the invention comprises at least one vector which is selected from an adeno-associated viral (AAV) vector, a lentiviral vector, a retroviral vector, and a non-viral vector selected from nanoparticles.

[0110] More preferably, at least one vector is a recombinant adeno-associated viral (AAV) vector chosen from an AAV8, AAV9 and MYO-AAV vector.

[0111] The composition used according to the invention may advantageously comprise several vectors, identical or different.

[0112] According to a first embodiment, the composition used according to the invention comprises a vector, comprising at least one sequence encoding an RNAg taken alone or in combination, and a second sequence encoding a Cas nuclease.

[0113] According to another embodiment, the composition used comprises two vectors, a first vector comprising at least one sequence encoding an RNAg taken alone or in combination, and a second vector comprising a second sequence encoding a Cas nuclease.

[0114] According to another embodiment, the composition used comprises at least two vectors, a first vector comprising at least one coding sequence for an RNAg taken alone or in combination and a second Cas nuclease sequence, and a second vector comprising at least one other coding sequence for an RNAg taken alone or in combination.

[0115] According to another embodiment, the composition comprises at least four vectors, a first vector comprising a sequence encoding an RNAg taken alone, a second vector comprising another sequence encoding an RNAg taken alone, a third vector comprising yet another sequence encoding an RNAg taken alone and a fourth vector comprising a Cas nuclease sequence.

[0116] Preferably, the second Cas nuclease-encoding sequence is under the control of a promoter that regulates the expression of said second Cas nuclease-encoding sequence, more preferably a ubiquitous promoter, and even more preferably a ubiquitous CMV or EFLa promoter. Furthermore, specific promoters such as CK8, ACTA1, and desmin can be used to allow for specific expression in muscle.

[0117] Preferably, at least one RNA-coding sequence is under the control of a promoter that regulates the expression of at least one RNA-coding sequence, more preferentially an hU6 or hHl promoter, even more preferentially an hU6 promoter.

[0118] A gene promoter is a segment of DNA that controls gene expression. The promoter binds to an enzyme, RNA polymerase, which reads the DNA sequence and synthesizes the corresponding RNA molecule.

[0119] The promoter thus defines whether a gene should be transcribed and at what rate.

[0120] Promoters are generally tissue-specific, allowing for variation in gene expression depending on the tissue.

[0121] A ubiquitous promoter, on the other hand, refers to a promoter that controls the expression of a gene in almost all cells of an organism, regardless of their specialization.

[0122] The hU6 and hHl promoters are advantageously used in viral or non-viral vectors to ensure the expression of the gene of interest in the form of RNA, usually guide RNA or interfering RNA.

[0123] The hU6 promoter is more preferentially used for controlling the expression of at least one coding RNAg sequence according to the invention.

[0124] The RNAs used for the treatment or prevention of neuromuscular diseases of genetic origin are preferentially chosen from among RNAgl41, RNAg8.16, RNAg25N, RNAgl, RNAg33 and RNAg207, for their strong capacity to hybridize to dynamin 2 (DNM2).

[0125] Dynamin 2 is a cytoplasmic protein involved in vesicle formation during endocytosis. It is present in many different cell types, including muscle cells, particularly skeletal and cardiac striated muscle cells, neurons, and liver and kidney cells. DNM2 is involved in numerous protein networks, including but not limited to: clathrin, EPS15, adaptin 2, synaptotagmin, endophilin, caveolin, ARF6, RHOA, CDC42, synapsin, synaptophysin, VPS4, TSG101, aniline, septin, TRKB, EGFR, amphiphysin 2, and myotubularin 1. Some of these proteins are known to be involved in neuromuscular disorders of genetic origin, including centronuclear myopathies.

[0126] The BIN 1 gene, encoding amphiphysin 2, is known to be involved in several neuromuscular pathologies, such as autosomal recessive centronuclear myopathy, autosomal dominant centronuclear myopathy, BIN 1-related cardiomyopathy, congenital centronuclear myopathy with respiratory involvement, and T-tubule dysfunction syndrome.

[0127] The MTM1 gene, encoding myotubularin 1, is also known to be involved in neuromuscular pathologies such as X-linked myotubular myopathy.

[0128] The regulation of DNM2 expression thus allows, through numerous interactions with other proteins and signaling pathways, the treatment or prevention of neuromuscular pathologies whose genetic origin is not linked to the DNM2 gene.

[0129] Preferably, in the composition used according to the invention, the mRNA linked to the neuromuscular pathology of genetic origin is a DNM2 mRNA and has at least 95% identity with the SEQ ID NO: 20 sequence.

[0130] Preferably, the DNM2 mRNA is mutated, and it more preferentially has at least 99% identity with the SEQ ID NO sequence: 20.

[0131] Even more preferentially, the mutated DNM2 mRNA has the sequence SEQ ID NO: 21.

[0132] The canine nucleotide sequences SEQ ID NO: 20 and SEQ ID NO: 21 code respectively for the canine protein sequences SEQ ID NO: 22 and SEQ ID NO: 23.

[0133] "Identity" refers to a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences. "Identity" also refers to the degree of relatedness between polypeptide or polynucleotide sequences, as the case may be, determined by the correspondence between the chains of these sequences. The "identity" can be easily calculated by known methods, including, but not limited to, those described in the following references (Computational Molecular Biology, Lesk AM, ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith DW, ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin AM and Griffin HG, eds, Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heinje G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov M. and Devereux J.eds, M Stockton Press, New York, 1991; and Carillo H., and Lipman D., SIAM J. Applied Math, 48:1073 (1998)). Identity determination methods are designed to give the greatest possible match between the tested sequences. In addition, identity determination methods are coded in publicly available computer programs. Computer methods for determining the identity between two sequences include, but are not limited to, the GCG software package (Devereux J. et al., Nucleic Acids Research 12(1): 387 (1984)), BLASTP, BLASTN, and PASTA (Altschul SF et al., J. Molec. Biol.

[0134] 215: 403-410 (1990)). The BLAST X program is available from NCBI and other sources (BLAST Manual, Altschul S. et al., NCBI NLM NUH Bethesda, MD 20894; Altschul S. et al., J. Mol Biol. 215: 403-410 (1990)).

[0135] By "mutated RNA" we mean an RNA that has at least one mutation compared to standard human RNA.

[0136] By "mutation" we mean a change in the nucleotide sequence, namely an insertion, deletion or substitution of a nucleotide.

[0137] The standard canine mRNA for DNM2 has the sequence SEQ ID NO: 20. The mutated canine mRNA for DNM2 has the sequence SEQ ID NO: 21.

[0138] The most common DNM2 mutation in humans and dogs is called DNM2R465W and corresponds to the substitution of arginine at position 465 of DNM2 by tryptophan. It is associated with centronuclear myopathy.

[0139] The human and canine protein sequences of non-mutated DNM2 correspond to SEQ ID NO: 7 and SEQ ID NO: 22 respectively. The human and canine protein sequences of mutated DNM2 (DNM2R465W mutation) correspond to SEQ ID NO: 8 and SEQ ID NO: 23 respectively.

[0140] Preferably, at least one vector used in the composition according to the invention is suitable for intramuscular or systemic administration.

[0141] By "intramuscular administration" we mean the administration directly into the body of a muscle, preferably a skeletal or cardiac striated muscle.

[0142] By "systemic administration" we mean administration into the bloodstream.

[0143] Preferably, the second sequence codes for a Casl3 nuclease, more preferentially a Casl3X.l nuclease.

[0144] The Casl3 nuclease is specific to RNA, thanks to its structure adapted for the recognition and binding of RNA molecules, and to its catalytic domains possessing ribonuclease activity.

[0145] The Casl3X.l nuclease belongs to the Casl3 nuclease family. Its small size facilitates its use in systems requiring viral vectors or nanoparticles. It also exhibits very good cleavage efficiency and specificity.

[0146] A dose between 3.5 and 10 10 and 3.5.10 13 vg, preferably between 3.5.10" and 3.5.10 12 vg is advantageously administered intramuscularly, more preferably at a dose of 3.5 x 10 12 vg.

[0147] A dose between 10" and 10 ,6 vg / kg is advantageously administered in the case of systemic administration, preferably a dose of 10 14 vg / kg.

[0148] Advantageously, the composition is suitable for use in an animal, preferably in a mammal, and even more preferably in a human.

[0149] The present invention will now be illustrated by means of the following examples.

[0150] EXAMPLES

[0151] Example 1: CRISPR / Casl3 expression method and experimental conditions implemented

[0152] The treatment of neuromuscular diseases of genetic origin by gene therapy is being studied.

[0153] The neuromuscular pathology of genetic origin studied is a centronuclear myopathy characterized by a mutation of the DNM2 protein, and more specifically by the substitution of arginine at position 465 by a tryptophan (DNM2R465W).

[0154] "Healthy" individuals are referenced as DNM2+ / + and "ill" individuals are referenced as DNM2R465W / +.

[0155] Different experimental conditions are thus tested.

[0156] The first condition corresponds to the cloning of the sequence encoding the Casl3X.l protein, under the control of an EF1 a promoter.

[0157] The second condition corresponds to the cloning of the sequence encoding the Casl3X.l protein, under the control of an EFla promoter, and the cloning of the RNAgl 41 sequence, under the control of an hU6 promoter.

[0158] The third condition corresponds to the cloning of the sequence encoding the Casl3X.l protein, under the control of an EFla promoter; the cloning of the RNAgl41 sequence, under the control of an hU6 promoter and the cloning of the RNAg8.16 sequence, under the control of an hU6 promoter.

[0159] Example 2: Recovery of the cellular phenotype by reducing DNM2 expression via CRISPR / Casl3 in vitro

[0160] For each of the three experimental conditions defined in Example 1, the sequences are cloned into separate mCherry plasmids, and these plasmids are transfected (2.5 µg) into separate DNM2R465W / + myoblasts using lipofectamine. 48 hours after transfection of the DNM2R465W / + cells with the plasmids, the cells are sorted according to mCherry (reporter gene) expression. Since the transfection efficiency is not 100%, the sorting allows for the exclusive analysis of transfected cells that have integrated the plasmid.

[0161] RT-qPCR is performed using 100 ng of RNA extracted from myoblasts.

[0162] The results are presented in Figure 1.

[0163] According to the results obtained, the use of RNAgl41 with Casl3X.l results in a 35% reduction in DNM2 mRNA levels, and the use of the combination of RNAgl41 and RNAg8.16 with Casl3X.l causes a 55% reduction in DNM2 mRNA levels.

[0164] In addition, a western blot of the DNM2 protein is performed on the myoblasts.

[0165] The results are presented in Figure 2.

[0166] The use of RNAgl41 with Casl3X.l results in a 25% reduction in DNM2 protein levels, and the use of the combination of RNAgl41 and RNAg8.16 with Casl3X.l causes a 28% reduction in DNM2 protein levels.

[0167] The use of gene therapy based on the CRISPR / Casl3X system restores the cellular phenotype by reducing the expression of DNM2, both at the mRNA and protein levels.

[0168] Since DNM2 is a GTPase, the GTPase activity of myoblasts is also studied.

[0169] The results are presented in Figure 3.

[0170] The use of RNAgl41 with Casl3X.1 results in a 15% reduction in GTPase activity, and the use of the combination of RNAgl41 and RNAg8.16 with Casl 3X.1 causes a 20% reduction in GTPase activity.

[0171] The use of gene therapy based on the CRISPR / Casl3X system makes it possible to reduce the expression of DNM2, but also to regulate its activity.

[0172] The treatment efficacy is advantageously better when using two gRNAs in combination (gRNA41 + gRNA8.16) compared with a single gRNA (gRNA41).

[0173] Example 3: In vivo proof of principle and treatment duration

[0174] For each of the three experimental conditions defined in Example 1, the sequences are cloned into distinct AAV9 vectors.

[0175] Three DNM2R465W / + dogs were selected. Under general anesthesia, a muscle bundle was defined using non-absorbable sutures and 3.5.10 12 AAV9 vg are injected. The injection is performed on muscle bundles as proof of concept for the efficacy of CRISPR / Casl 3 in reducing DNM2 transcripts.

[0176] Biopsies are performed 1 and 2 months after injection from pre-identified bundles for complete analysis. RT-qPCR is performed from 100 ng of RNA extracted from the muscle bundles.

[0177] The results are presented in Figure 4.

[0178] Based on the results obtained, after 1 month post-treatment, the use of 141gRNA with Casl3X.l resulted in a 40% reduction in DNM2 mRNA levels, and the use of the combination of 141gRNA and 8.16gRNA with Casl3X.l caused a 50% reduction in DNM2 mRNA levels. After 2 months post-treatment, the use of 141gRNA with Casl3X.l resulted in a 50% reduction in DNM2 mRNA levels, and the use of the combination of 141gRNA and 8.16gRNA with Casl3X.l caused a 55% reduction in DNM2 mRNA levels.

[0179] The treatment efficacy is advantageously better when using two gRNAs in combination (gRNA41 + gRNA8.16) compared with a single gRNA (gRNA41).

[0180] After 2 months post-treatment, the results are essentially the same (with less variability) as at 1 month post-treatment.

[0181] Example 4: In vivo proof of concept and administered doses

[0182] For each of the three experimental conditions defined in Example 1, the sequences are cloned into distinct AAV9 vectors.

[0183] A DNM2R465W / + dog was selected. Under general anesthesia, a muscle bundle was defined using non-absorbable sutures, and AAV9 was injected. The injection was performed on muscle bundles as proof of concept for the efficacy of CRISPR / Casl3 in reducing DNM2 transcripts. Three doses were tested: 3, 5, and 10 12 vg, 3.5.10"vg and 3.5.10 ,0 vg.

[0184] Biopsies are performed 2 months after injection from pre-identified bundles for complete analysis.

[0185] The most effective results were obtained in dogs receiving the highest doses, namely 3.5 x 10 ,2 vg.

[0186] In the population of dogs that received 3.5.10 12 vg, western blots of DNM2, p62 and cytochrome-C proteins, obtained from muscle bundles, are performed.

[0187] The results are presented in Figures 5, 6 and 7 respectively.

[0188] According to the results obtained, for the three proteins DNM2, p62 and cytochrome-C, an increase in protein expression is observed in "sick" dogs compared to "healthy" dogs.

[0189] A reversal of the levels of these proteins is observed in dogs receiving injections at a dose of 3.5 x 10 12 vg, but with inter-individual variability.

[0190] The use of gene therapy based on the CRISPR / Casl3 system allows for the restoration of expression levels of these proteins in order to restore the phenotype of "sick" dogs. Example 5: Impact of CRISPR / Casl3 treatment on muscle histology

[0191] Biopsies from the three injected dogs in Example 3 were also used for histological analyses.

[0192] The type of fibers (type I and type II fibers) was studied by ATPase labeling in dogs treated with the combination of RNAgl41 and RNAg8.16.

[0193] The histology of the biceps femoris (BF) muscle of DNM2R465W / + dogs showed a slight increase in the number of type I fibers compared to "healthy" muscles which mostly have type II fibers.

[0194] In the BF muscle, a slight difference between pre- and post-processed samples is observed, indicating a slight change in muscle fiber type.

[0195] According to the results obtained, the number of type I fibers decreases to a level equal to or lower than the number of type II fibers. This is an intermediate level between untreated and healthy levels.

[0196] Although this does not apply to intramuscular injection, a biochemical analysis is performed before and after the injections to monitor the dogs' health. No changes are observed in liver parameters.

[0197] Example 6: In vitro validation of humanized guide RNAs and novel CRISPR / Casl3 guide RNAs targeting DNM2

[0198] In order to evaluate the transposability of the CRISPR / Casl3X.l system developed in dogs to the human species, in vitro experiments were carried out on human HEK293T cells expressing the human DNM2 gene.

[0199] This study aims to compare the efficacy of previously validated guide RNAs in dogs, their humanized versions, and new guide RNAs specifically designed to target the human DNM2 sequence.

[0200] Transient transfections were performed using plasmids expressing the Casl3X.l protein and various guide RNAs, said plasmids including an mCherry reporter gene.

[0201] Forty-eight hours after transfection, the cells were sorted based on mCherry expression to select only the transfected cells. Total RNA was then extracted from the sorted cells.

[0202] Five independent experiments were conducted.

[0203] For each of these, RT-qPCR was performed using 100 ng of total RNA. Each experimental condition was analyzed using a triplicate qPCR technique, with each experimental point corresponding to an independent experiment (Figure 8).

[0204] The expression of the human DNM2 gene was quantified relative to the expression of the human TBP housekeeping gene.

[0205] The guide RNAs tested include, on the one hand, the guide RNAs initially used in dogs (cg8.16, cgl41 and cg25), on the other hand their corresponding humanized sequences (hg8.16, hg 141 and hg25), as well as three new guide RNAs specifically designed for the human sequence of DNM2, namely hgl, hg33 and hg207.

[0206] The results obtained, presented in Figure 8, show that several guide RNAs significantly reduce human DNM2 mRNA levels compared to the control condition without guide RNA. Notably, the humanized guide RNA hgl41 and the novel guide RNA hg207, specifically designed for the human DNM2 sequence, exhibit an effective capacity to reduce human DNM2 transcripts, comparable to that observed with guide RNAs initially developed in dogs.

[0207] Thus, this example establishes an in vitro proof of concept of the effectiveness of the CRISPR / Casl3X.l system for modulating the expression of human DNM2, and demonstrates that the adaptation or design of guide RNAs specific to the human sequence makes it possible to preserve the desired technical effect.

Claims

DEMANDS 1. Composition comprising at least one vector encoding a CRISPR-Cas system directed to a messenger RNA (mRNA) linked to a neuromuscular disease of genetic origin for use in the treatment or prevention of said disease, wherein said at least one vector comprises: (a) at least one sequence encoding a guide RNA (gRNA) that hybridizes to the mRNA associated with said pathology in the patient; and (b) a second sequence encoding a Cas nuclease.

2. Composition for use according to claim 1, characterized in that the neuromuscular pathology of genetic origin is selected from among centronuclear myopathies.

3. Composition for use according to claim 1 or 2, characterized in that said at least one coding RNAg sequence has at least 85% identity with one of the sequences SEC ID NO: 1 to SEO ID NO: 6 or SEO ID NO: 12 to SEC ID NO:

17.

4. Composition for use according to claim 3, characterized in that said at least one coding RNAg sequence is selected from the group consisting of the following sequences: - GTGCCX1TCX2TCCATCAGGTCX3AGCTTGG in which Xi = T or G, X2= A or G and X3= G or A (SEC ID NO: 9); - TGATGACACCGATGGTCCGY1AY2GCCTT in which Yi = T or C and Y2= A or G (SEC ID NO: 10); - CZ1AGZ2TGGGGGTCCATGGAGAAGGTGTT in which Zi = T or 0 and Z2 = 0 or T (SEQ ID NO: 11); - TAATGGCATAGCTGATCTCP1CGP2CGTAAP3T in which Pi = 0 or A, P2 = T or 0 and P3 = G or A (SEQ ID NO: 18); - CCCACQ1GGQ2ACQ3GGAATCAGQ4GGGGGCCCQ5 in which Qi = G or T, Q2 = A or C, Q3 = A or G, Q4 = G or A and Qs = T or C (SEQ ID NO: 1); or - GCGGTTCACCACGCCAATGTAGCCTCTTCT (SEQ ID NO: 16), taken alone or in combination.

5. Composition for use according to claim 4, characterized in that said at least one coding RNAg sequence is selected from the sequences consisting of SEC ID NO: 1 to SEC ID NO: 6 or SEQ ID NO: 12 to SEQ ID NO: 17, taken alone or in combination.

6. Composition for use according to any one of the preceding claims, characterized in that said at least one vector is a viral vector selected from an adeno-associated viral (AAV) vector, a lentiviral vector, a retroviral vector, and a non-viral vector selected from nanoparticles.

7. Composition for use according to claim 6, characterized in that said at least one vector is a recombinant adeno-associated viral (AAV) vector selected from an AAV8, AAV9 and MYO-AAV vector.

8. Composition for use according to any one of the preceding claims, characterized in that said composition comprises a vector, comprising said at least one coding sequence for an RNAg taken alone or in combination, and said second coding sequence for a Cas nuclease.

9. Composition for use according to any one of claims 1 to 7, characterized in that said composition comprises at least two vectors, a first vector comprising said at least one coding sequence for an RNAg taken alone or in combination, and a second vector comprising said second coding sequence for a Cas nuclease.

10. Composition for use according to any one of the preceding claims, characterized in that the second Cas nuclease-coding sequence is under the control of a promoter which regulates the expression of said second Cas nuclease-coding sequence, preferably a ubiquitous promoter, even more preferably a ubiquitous CMV or EFLa promoter.

11. Composition for use according to any one of the preceding claims, characterized in that said at least one RNA-coding sequence is under the control of a promoter which regulates the expression of said at least one RNA-coding sequence, preferably an hU6 or hHl promoter, even more preferably an hU6 promoter.

12. Composition for use according to any one of the preceding claims, characterized in that the neuromuscular pathology-related mRNA of genetic origin is a DNM2 mRNA and has at least 95% identity with the SEQ ID NO sequence:

20.

13. Composition for use according to claim 12, characterized in that the DNM2 mRNA is mutated, preferably in that the mutated DNM2 mRNA has at least 99% identity with the SEQ ID NO sequence:

20.

14. Composition for use according to claim 13, characterized in that the mutated DNM2 mRNA has the sequence SEQ ID NO:

21.

15. Composition for use according to any one of the preceding claims, characterized in that said at least one vector is suitable for intramuscular or systemic administration.

16. Composition for use according to any one of the preceding claims, characterized in that said second sequence encodes a Casl3 nuclease, preferably a Casl3X.l nuclease.

17. Composition for use according to any one of the preceding claims, characterized in that the composition is suitable for use in an animal, preferably in a mammal, even more preferably in a human.