Antibody which binds to human SRRM2 present on the cell surface of a target cell for use in the treatment of a solid tumor

WO2026167106A1PCT designated stage Publication Date: 2026-08-13ZENO THERAPEUTICS PTE LTD +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-02-05
Publication Date
2026-08-13

Smart Images

  • Figure IMGF000115_0001
    Figure IMGF000115_0001
  • Figure IMGF000078_0001_TABLE
    Figure IMGF000078_0001_TABLE
  • Figure IMGF000079_0001_TABLE
    Figure IMGF000079_0001_TABLE
Patent Text Reader

Abstract

The present invention provides an antibody that binds to human serine / arginine repetitive matrix protein 2 (SRRM2) present on the cell surface of a target cell, for use in a method for the treatment of a solid tumor in a human patient. The solid tumor may be a solid adenocarcoinoma.
Need to check novelty before this filing date? Find Prior Art

Description

New International Patent Application claiming priority to international Patent application no. PCT / CN2025 / 075803Applicants: Zeno Therapeutics (Shenzhen) Co. Ltd., Eximmium Pte. Ltd., Eximmium Biotechnologies GmbH Our ref: EXI18427PCT-2ANTIBODY WHICH BINDS TO HUMAN SRRM2 PRESENT ON THE CELL SURFACE OF A TARGET CELL FOR USE IN THE TREATMENT OF A SOLID TUMORCROSS-REFERENCE TO RELATED APPLICATION

[0001] The present application claims the benefit of priority of International Patent application no. PCT / CN2025 / 075803 filed 5 February 2025, the content of which is hereby incorporated by reference in its entirety for all purposes.TECHNICAL FIELD OF THE INVENTION

[0002] The present invention provides an antibody that binds to human serine / arginine repetitive matrix protein 2 (SRRM2; aka SRm300; UniProt Q9UQ35) present on the cell surface of a target cell, for use in a method for the treatment of a solid tumor in a human patient. The said solid cancer may be a solid adenocarcinoma.BACKGROUND OF THE INVENTION

[0003] In 2015, about 90.5 million people had cancer. As of 2019, about 18 million new cases occur annually, and about 8.8 million people died from the disease (15.7% of overall deaths). The most prevalent types of cancer in males are lung cancer, prostate cancer, colorectal cancer, and stomach cancer. In females, the most prevalent types are breast cancer, colorectal cancer, lung cancer, and cervical cancer. If skin cancer other than melanoma were included in total new cancer cases each year, it would account for around 40% of cases. In 2012, about 165,000 children under 15 years of age were diagnosed with cancer, with, acute lymphoblastic leukemia (ALL) and brain tumors being most common entities, except for Africa, where nonHodgkin lymphoma is more prevalent. The risk of cancer increases significantly with age, and many cancers occur more commonly in developed countries. The financial costs of cancer were estimated at 1.16 trillion USD per year as of 2010.

[0004] Aberrant translocation of normally intracellular proteins to the surface of cancer cells is a well-known yet poorly understood and emphasized phenomenon (Weidle et al., 2011). One prominent example is BiP / Grp78 / HSPA5, a member of the heat shock protein (hsp)70 family of chaperones. While in normal cells BiP is endoplasmic reticulum-resident, it is also exposed on the surface of many types of cancers, where it probably exerts a disparate function that contributes to tumor progression (Gonzalez-Gronow et al., 2021; Tsai et al., 2018). Other examples for mislocated proteins in cancer cells constitute the phosphatase PRL3 (Chia et al., 2023), hsp90 (Sidera et al., 2008), nucleolin (Joo et al., 2005), and alpha-enolase ENO1 (Perconti et al., 2017), among others. Overall, there is an ever-increasing interest in the identification of such multifunctional proteins which translocate to the outer surface of cancer cells. As this mechanism seems very tumor specific, the identified proteins are considered promising and attractive new target molecules for the development of novel specific cancer therapies.

[0005] SRRM2 (aka SRm300; UniProt Q9LIQ35) is a large, mostly unstructured serine / arginine-rich protein which is a component of spliceosomal complexes (Blencowe etal., 2000) and one of the core scaffold proteins required for the proper formation of nuclear speckles (llik et al., 2020), which are membrane-less nuclear organelles, where mRNA maturation and splicing take place but whose exact function remains elusive. SR proteins also play a role in affecting alternative splice sites in vitro and in vivo (Wang et al., 1995; Zahler et al., 1993), and SRRM2 is also known to play a central role in mRNA splicing (Blencowe etal., 2000; Eldridge etal., 1999).

[0006] It is known from WO 2023 / 174897 A1 and Kellner et al., 2024 that SRRM2, typically localized to the nucleus, is expressed on the surface of cancer cells, but not on healthy, noncancer cells. Thus, surface SRRM2 on the cells obtained from a patient is a biomarker for cancer.

[0007] The present invention provides technical advancements to the treatment in solid tumors, especially in solid adenocarcinoma. The underlying technical problem is thus to address these aspects.SUMMARY OF THE INVENTION

[0008] The technical problem is solved by the subject-matter as defined in the claims, described in the claims, demonstrated in the examples, and illustrated in the figures. In thepresent invention the inventors demonstrated successfully treating cancer in six patients using SRRM2 present on the cancer cells as a target structure of a cancer-specific therapy. Further, treatment of pancreatic cancer patients with SRRM2 specific CAR-T cells led to an improvement of symptoms of the disease (cf. Example 6). Moreover, surface expressed SRRM2 was also found to be significantly elevated on solid cancer cells, when compared to the expression on normal cells or tumor adjacent tissues (cf. Example 2). Moreover, SRRM2 specific CAR-T cells showed potent killing activity against ovarian cancer cell lines in vitro (cf. Example 5). Further, a reduction of tumor volume and significantly prolonged survival could be observed in vivo in tumor-bearing mice using antibody-drug conjugates based on anti-SRRM2 antibodies of the invention (cf. Example 4). In sum, the data show that SRRM2 present on the surface of cancer cells is an optimal and promising target for immunotherapy in solid tumor patients, particularly solid adenocarcinoma patients.

[0009] Accordingly, the present invention provides an antibody that binds to human serine / arginine repetitive matrix protein 2 (SRRM2) present on the cell surface of a target cell, for use in a method for the treatment of a solid tumor in a human patient.

[0010] In one embodiment of the antibody for use of the present invention, said solid tumor may be characterized by target cells, wherein SRRM2 is present on the cell surface of said target cells.

[0011] In one embodiment of the antibody for use of the present invention, the SRRM2 present on the cell surface of said target cell may be externalized.

[0012] In one embodiment of the antibody for use of the present invention, said target cell may be a non-permeabilized target cell.

[0013] In one embodiment of the antibody for use of the present invention, said target cell may be a living target cell.

[0014] In one embodiment of the antibody for use of the present invention, said antibody may bind to SRRM2 which is externalized on the cell surface of a target cell.

[0015] In one embodiment of the antibody for use of the present invention, wherein said antibody may bind to SRRM2 on a non-permeabilized target cell.

[0016] In one embodiment of the antibody for use of the present invention, said antibody may bind to SRRM2 on a living target cell.

[0017] In one embodiment of the antibody for use of the present invention, the antibody may be not an intracellular antibody.

[0018] In one embodiment of the antibody for use of the present invention, said solid tumor may be a solid adenocarcinoma.

[0019] In one embodiment of the antibody for use of the present invention, said solid adenocarcinoma may be pancreatic adenocarcinoma, lung adenocarcinoma, breast adenocarcinoma, colorectal adenocarcinoma, rectum adenocarcinoma, prostatic adenocarcinoma, esophageal adenocarcinoma, gastric adenocarcinoma, adrenal adenocarcinoma, vaginal adenocarcinoma, vulvar adenocarcinoma, bile duct adenocarcinoma, gall bladder adenocarcinoma, salivary gland adenocarcinoma, thyroid adenocarcinoma, duodenal adenocarcinoma, renal adenocarcinoma, urinary bladder adenocarcinoma, ovary adenocarcinoma or endocervical adenocarcinoma.

[0020] In one embodiment of the antibody for use of the present invention, the human patient to be treated may have a weight of between 16 and 150 kg, preferably 18 to 140kg, more preferably 20 to 130kg, still more preferably 22 to 120kg.

[0021] In one embodiment of the antibody for use of the present invention, the patient to be treated may have a body height between 70 and 220cm, preferably between 80 and 200cm, more preferably between 90 and 200cm.

[0022] In one embodiment of the antibody for use of the present invention, which the patient to be treated may be at least 1 year old, preferably 2 years, more preferably between 2 and 80 years old.

[0023] In one embodiment of the antibody for use of the present invention, said antibody may have cytotoxic activity, preferably antigen-dependent cellular cytotoxicity (ADCC) and / or complement-dependent cytotoxicity (CDC).

[0024] In one embodiment of the antibody for use of the present invention, wherein said antibody may have conjugated with a cytotoxic substance.

[0025] In one embodiment of the antibody for use of the present invention, said antibody may be conjugated with monomethyl auristatin E or exatecan or a derivative or an analog thereof.

[0026] In one embodiment of the antibody for use of the present invention, said antibody may be a bispecific antibody.

[0027] In one embodiment of the antibody for use of the present invention, said bispecific antibody may be a T-cell engaging antibody or a NK-cell engaging antibody.

[0028] In one embodiment of the antibody for use of the present invention, said antibody may be(a) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 2;(b) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 4;(c) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 6;(d) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 7; or(e) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 9; or(f) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 11; or(g) an antibody which binds to the same epitope as that in the human SRRM2 protein to which the antibody of (a), (b), (c), (d), (e) or (f) binds.

[0029] In one embodiment of the antibody for use of the present invention, said antibody may be an antibody comprising(a) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 13, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 14, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 15, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 16, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 17, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 18;(b) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 19, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 20, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 21, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 22, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 23, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 24;(c) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 28, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 29, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 30;(d) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 31 , light chain CDR2 having the amino acid sequence as set forth inSEQ ID NO: 32, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 33;(e) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 34, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 35, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 36, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 37, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 38, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 39;(f) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 40, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 41 , and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 42, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 43, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 44, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 45; or(g) an antibody which binds to the same epitope as that in the human SRRM2 protein to which the antibody of (a), (b), (c), (d), (e) or (f) binds.

[0030] In one embodiment of the antibody for use of the present invention, said antibody may be part of a chimeric antigen receptor (CAR).

[0031] In one embodiment of the antibody for use of the present invention, said CAR may comprise the heavy chain variable region and the light chain variable region according to any one of the alternatives (a) to (f) as recited in paragraph

[0027] , preferably with a VH to VL orientation.

[0032] In one embodiment of the antibody for use of the present invention, said CAR may comprise the heavy chain variable region and the light chain variable region according to any one of the alternatives (a) to (f) mentioned above, preferably with a VH to VL orientation.

[0033] In one embodiment of the antibody for use of the present invention, said CAR may be expressed by a T cell, NK cell, NK-T cell or macrophage.

[0034] In one embodiment of the antibody for use of the present invention, said antibody may be expressed by an autologous cell population.

[0035] In one embodiment of the antibody for use of the present invention, said antibody may be expressed by an allogeneic cell population.

[0036] In one embodiment of the antibody for use of the present invention, the route of antibody administration may be parenteral, including, but not limited to, intravenous, intradermal, intramuscular, or intraperitoneal administration.

[0037] In one embodiment of the antibody for use of the present invention, the method for the treatment of a solid tumor in a human patient may comprise, prior to the treatment of the solid tumor, determining whether the target cell of the human patient has SRRM2 protein present on the cell surface.BRIEF DESCRIPTION OF THE DRAWINGS

[0038] The invention will be better understood with reference to the detailed description when considered in conjunction with the non-limiting examples and the drawings, in which:

[0039] Figure 1 shows that the antibodies 13F11, 23A7 and 18A4 precipitate SRRM2. Cyanogen bromide beads were coupled with any of the three antibodies or with an isotype control antibody were incubated overnight with lysates from OVCAR-3 or LIWB1.289 ovarian cancer cells. After precipitation of the beads and incubation in Laemmli buffer, eluates were analyzed by mass spectrometry, which revealed a clear enrichment of SRRM2 with either antibody as compared to the isotype control antibody.

[0040] Figure 2 shows an immunoblot on which 23A7 detects a protein of approx. 300 kDa corresponding to the calculated size of SRRM2 in of the cancer cell lines Capan-1, SkBr-3, HeLa, SKOV-3, T-47D, and UWB1.289. In some cell lines, it also detects a protein at approx.200 kDa, possibly a SRRM2 isoform.

[0041] Figures 3A and 3B shows the surface expression of SRRM2 on various cancer cell lines. Cell lines were incubated with13F11 (solid lines in Fig. 3A and Fig. 3B) or an isotype control antibody (dotted line in Fig. 3A, tinted histogram in Fig. 3B). Cells were then washedand incubated with an Alexa647 labeled anti-rat IgG antibody. Fluorescence was then measured by flow cytometry with a FACS Canto.

[0042] Figure 3C shows the surface expression of SRRM2 on various cancer cell lines. Cell lines T-47D, Capan-1 , HeLa, SkBr3, UWB 1.289, and SKOV-3 were incubated with 23A7 (solid lines in Fig. 3C) or an isotype control antibody (tinted histogram in Fig. 3C). Cells were then washed and incubated with an Alexa647 labeled anti-rat IgG antibody. Fluorescence was then measured by flow cytometry with a FACS Canto.

[0043] Figure 3D shows that normal cells do not express SRRM2 on their cell surface. Primary hepatocytes and PBMCs were stained with 23A7 and an anti-rat IgG / Alexa 647 secondary antibody (solid line) and analyzed as above. Dotted line = isotype control antibody

[0044] Figure 4 shows that 13F11, 18A4 and 23A7 are SRRM2-specific. Figure 4A shows A549 cells transfected with a ribonucleoprotein complex consisting of SRRM2-specific gRNAs and Cas9. Seven days later, binding of the antibodies to knockout and wildtype cells was measured by flow cytometry. For this, A549 Wildtype (bold line) and the A549 SRRM2 knockout line #25 (tinted histogram) were incubated with any of the three antibodies 13F11, 18A4 and 23A7. Cells were washed and then incubated with an Alexa647 labeled anti-rat secondary antibody. Fluorescence was then measured by flow cytometry with a FACS Canto. An isotype control antibody was included as a negative control (dotted line). Figure 4B shows SKOV-3 cells transfected with a ribonucleoprotein complex consisting of SRRM2-specific gRNAs and Cas9. Seven days later, binding of the antibodies to knockout and wildtype cells was measured by flow cytometry. For this, SKOV-3 Wildtype (right) and a SKOV-3 SRRM2 knockout clone (left) were incubated with the antibody 23A7. Cells were washed and then incubated with an Alexa647 labeled anti-rat secondary antibody. Fluorescence was then measured with a FACS Canto. Black line = 23A7; grey tinted histogram = isotype control antibody. Figure 4C shows the binding of the SRRM2-specific antibodies 13F11, 18A4, 23A7, 14B6, or 24A6 as measured by flow cytometry to SKOV-3 wildtype cells (bold line) and SKOV-3 knockout cells (dotted line) which had been generated by transfecting the cells with a ribonucleoprotein complex consisting of SRRM2-specific gRNAs and Cas9, followed by singlecell cloning. Cells were washed, incubated with 13F11, 18A4, 23A7, 14B6, or 24A6, washed, incubated with an Alexa647 labeled anti-rat secondary antibody, and finally measured FACS Canto cytometer. An isotype control antibody was included as a negative control (tinted histogram).

[0045] Figure 5 shows that the SRRM2 specific antibodies of the invention and not commercially available SRRM2 specific antibodies bind to SRRM2 on the cell surface as shown on cells of cancer cell lines using confocal microscopy. Figure 5A shows that 18A4 colocalizes with the surface molecule CD47. A549 or LIWB1.289 cells were grown on a cover slip, washed and incubated with the antibodies 18A4 (SRRM2) and 18F10 (CD47). Cells were fixed with 4% paraformaldehyde and analyzed by confocal fluorescence microscopy. Nuclei were counterstained with DAPI. Figure 5B shows that antibody 23A7 binds to surface SRRM2 using confocal microscopy with (A) vital and (B) fixed and permeabilized Capan-1 and HeLa cells. EX-02 = antibody 23A7, Abeam, clone #122719 and Biozol, (MBS9609206) were used as SRRM2 antibodies, an EpCAM or IGF-a3 antibody were used to stain an established surface protein. Nuclei were counterstained with DAPI.

[0046] Figure 6 shows that the SRRM2 specific antibodies of the invention and not commercially available SRRM2 specific antibodies bind to SRRM2 on the cell surface as shown on living cells of cancer cell lines using flow cytometry. Figure 6A shows the result using HeLa cells. HeLa cells were incubated with EX-02 (=23A7) or commercial SRRM2 antibodies, washed, and then incubated with suitable Alexa647-labeled secondary antibodies. Binding was measured by flow cytometry. SRRM2 = black line; isotype control = tinted grey histogram. Figure 6B shows that commercial antibodies fail to bind to cell-surface SRRM2 on living cells, whilst the SRRM2-specific antibody 13F11 of the present invention binds to cellsurface SRRM2 on living cells. Antibody application = black lines; isotype control = gray lines.

[0047] Figure 7 shows that the SRRM2 specific antibodies of the inventions bind specifically to human tumor tissue. For the results shown in Figures 7A to 7G formalin-fixed paraffin embedded (FFPE) tumor tissues and adjacent normal tissues were stained with antibody 18A4, followed by incubation with a rat-specific secondary antibody coupled with HRP. Tissues were inspected by a trained pathologist and staining intensity was scored from 0 (negative) to 3+ (strong expression on the majority of cells). Figure 7A shows that the majority of tumor samples derived from different locations (bile duct, ovary, pancreas, stomach, lung) reveal SRRM2 membrane staining, while adjacent tissues are mostly negative. Representative immunohistochemistry (IHC) images of the cancer (left) and cancer-adjacent tissues (right) were shown from ovarian (Figure 7B), bile duct (Figure 7C), pancreatic (Figure 7D), gastric (Figure 7E), non small cell lung cancers (NSCLC) samples. Among the NSCLC samples, 3 samples were from squamous cell carcinoma of the cancer (Figure 7F), showing 2 moderate and 1 strong cell surface expression; while the other 12 strong expression were all lung adenocarcinoma (Figure 7G).

[0048] In a second experiment, FFPE cancer tissues and cancer adjacent normal tissues from breast cancer, nasopharyngeal carcinoma (NPC), non-small cell lung cancer (lung adenocarcinoma, NSCLC), small cell lung cancer (SCLC), cervical cancer were stained with antibody 23A7, followed by incubation with a rat-specific secondary antibody coupled with HRP. Tissues were inspected by a trained pathologist and staining intensity was scored from 0 (negative) to 3+ (strong expression on the majority of cells). Figure 7H shows that the majority of tumor samples derived from different locations reveal SRRM2 membrane staining. Representative IHC images of the cancer (left) and cancer-adjacent tissues (right) were shown in, breast cancer (Figure 71), NPC (Figure 7 J) , NSCLC (Figure 7K), SCLC (Figure 7L, cancer tissue only), cervical cancer (Figure 7M).

[0049] Figure 8 shows that normal tissues from Cynomolgus monkeys either stain negative for SRRM2 or show cytoplasmic / nuclear staining as revealed by immunohistochemistry. No membrane staining was observed. Mem = membrane; Cyto = cytoplasmic; Nucl = nuclear. FFPE tissues from cynomolgus monkey were incubated with 18A4 antibody, followed by incubation with a goat anti-rat IgG antibody coupled with HRP (ImmPRESS HRP Peroxidase detection kit; https: / / vectorlabs.com / products / enzyme-polymer / immpress-hrp-goat-anti-rat-iggkit).

[0050] Figure 9 shows that the SRRM2-specific antibodies 13F11, 18A4-2 and 23A7 bind to fragment tr04. A 96-well cell cluster plate was coated with purified SRRM2-trO4-HIS or, as a control, MISP-HIS protein (each at 50 pg / ml) overnight and then blocked with non-fat milk powder in TBST. Then, antibodies 13F11, 18A4-2, 23A7 or an anti-MISP antibody were added at room temperature for 2 hours. After washing, the plate was incubated with a secondary antirat IgG antibody coupled to HRP and developed with TMB. After stopping the reaction with H2SO4, the absorbance was measured at 450 nm.

[0051] Figure 10 shows that the antibody 13F11 is internalized upon binding to SRRM2. SKOV-3 ovarian cancer cells were incubated with 13F11 for 10 min at room temperature and then washed to remove free antibody. Cell samples were then incubated at 37 °C for one to five hours or kept on ice (= 0 hour). Cells were then stained with an Alexa647-coupled secondary anti-rat IgG antibody and fluorescence was measured by flow cytometry. The decrease in fluorescence over time is indicative for the internalization of the SRRM2-13F11 complex. The fluorescence measured after 0 hours at 37 °C was set to 100%.

[0052] Figure 11 shows the reduction of tumor volume in tumor-bearing mice using 23A7 (EX02)-drug conjugates. Balb / c nude mice having a tumor originating from BxPC-3 human pancreatic cancer cells injected subcutaneously into the right lateral abdominal wall with a tumor volume of about 200 mm3were divided in 6 treatment groups, with 5 to 6 animals each. The treatment groups were: Treatment group 1 received intravenous (i.v.) injection of PBS serving as negative control (PBS); Treatment group 2 received i.v. injection of 8.29 mg / kg of Deruxtecan linked to an isotype antibody serving as a further negative control (ISO-DXd 8.29 mg / kg), Treatment group 3 received i.v. injection of 1 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE 1 mg / kg), Treatment group 4 received i.v. injection of 10 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE 10 mg / kg), Treatment group 5 received i.v. injection of 1 mg / kg 23A7 antibody linked to Deruxtecan (EX02-DXd 1 mg / kg), Treatment group 6 received i.v. injection of 10 mg / kg 23A7 antibody linked to Deruxtecan (EX02-DXd 10 mg / kg). The study duration was 30 days counting after the first drug injection. The drug or control substances were i.v. injected at day 0, 8 and 15. Mice were assessed 2-3 times per week for living conditions, body weight and the tumor size was measured. Figure 11A shows a dosedependent reduction of the volume compared to the PBS control. In this experiment especially, both drug conjugates, 23A7 antibody linked to Deruxtecan (EX02-DXd) and 23A7 antibody linked to VcMMAE (EX02-MMAE), given at a dose of 10 mg / kg resulted in a stable tumor volume for EX02-DXd 10 mg / kg, and in the case of EX02-MMAE 10 mg / kg in a shrinkage of the tumor. Figure 11B shows the data for the treatment groups 1 , 2, 5, and 6 (PBS, ISO-DXd, EX02-DXd 1 mg / kg and EX02-DXd 10 mg / kg). EX02-DXd 10 mg / kg was able to hold the tumor volume stable over the whole study (30 days). Figure 11C shows the data for the treatment groups 1, 2, 5, and 6 (PBS, ISO-DXd, EX02-MMAE 1 mg / kg and EX02-MMAE 10 mg / kg). 1 mg / kg of the 23A7-MMAE conjugate (treatment group 3) resulted in delayed tumor growth as compared to controls. 10 mg / kg of the 23A7-MMAE conjugate (treatment group 4) resulted in significant shrinkage. Figure 11 D shows the explanted tumors after the end of the experiment. It is clearly visible that the tumors after treatment with 10 mg / kg of both 23A7-drug conjugates were much smaller than the tumors of all other treatment groups. Furthermore, the tumors in the treatment group using 10 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE) were smaller than tumors of every other treatment group. Figure 11E shows the body weight of the tumor-bearing mice during the experiment. No body weight reduction due to toxicity of the injected substances were visible in all treatment groups.

[0053] Figure 12 shows the reduction of tumor volume in tumor-bearing mice using 23A7 (EX02) monomethyl auristatin E (MMAE) -drug conjugates. Balb / c nude mice having a tumor originating from BxPC-3 pancreatic cancer cells injected subcutaneously into the right lateralabdominal wall with a tumor volume of about 100 mm3 were divided in 6 treatment groups. Treatment groups with 5 to 6 animals each were: Treatment group 1 received intravenous (i.v.) injection of PBS serving as negative control (PBS); Treatment group 2 received i.v. injection of 10 mg / kg of MMAE linked to an isotype antibody serving as a further negative control (ISO-MMAE), Treatment group 3 received i.v. injection of 0.346 mg / kg MMAE (MMAE 0.346 mg / kg), which equals 10 mg / kg of ADC conjugated MMAE, serving as a further negative control, Treatment group 4 received i.v. injection of 2.5 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE 2.5 mg / kg), Treatment group 5 received i.v. injection of 5 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE 5 mg / kg), Treatment group 6 received i.v. injection of 10 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE 10 mg / kg). The study duration was 28 days counting after the first drug injection. The drug or control substances were i.v. injected at day 0 and 15. Mice were observed 2~3 times per week for living conditions, body weight and measuring the tumor size to monitor the changes of tumors. Figure 12A shows the influence of the different injected substances on the tumor volume. In all treatment groups receiving the 23A7-MMAE conjugate (EX02-MMAE) the tumor volumes were smaller than in the controls. Especially MMAE alone or MMAE linked to an isotype control antibody had no effect on tumor volume. The treatment groups which received 5 mg / kg or 10 mg / kg 23A7-MMAE conjugate the tumor volumes were reduced and the tumor mass shrank. Figure 12B shows the explanted tumors after the end of the experiment. It is clearly visible that the tumors after treatment with 5 mg / kg or 10 mg / kg of 23A7-MMAE conjugate were much smaller than the tumors of all other treatment groups. Furthermore, the tumors in the treatment group using 10 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE) were smaller than tumors of every other treatment group. Figure 12C shows the body weight of the tumor-bearing mice during the experiment. No body weight reduction due to toxicity of the injected substances are visible in all treatment groups. Figure 12D shows the organ coefficient (organ weight / body weight) of heart, liver, spleen, and kidney. The organ coefficients of the tested organs show no significant differences across treatment groups.

[0054] Figure 13A shows that surface-SRRM2-positive SKOV-3 cells activate SRRM2-specific 13F11 CAR-T-cells. Primary T-cells from two donors (1 and 2) were transduced with a retroviral vector encoding a CAR construct with a single-chain construct derived from antibody 13F11. Expression of the CAR was tested by flow cytometry with a goat-anti rat IgG antibody (not shown). SKOV-3 cells were incubated with 13F11 CAR-T cells (columns 3-4 of the blots) of non-transduced control T cells (column 1-2 of the blots) at the ratios indicated on the X-axis for 24 h. Then, interferon-gamma in the supernatants, as a marker for T-cell activation, was quantified with a commercial ELISA assay.

[0055] Figure 13B shows that SRRM2-specific CAR-T cells kill SRRM2-positive HO-8910 target cells. Primary T-cells from one donor were transduced with a retroviral vector encoding a CAR construct with a single-chain construct derived from antibody 13F11. Expression of the CAR was tested by flow cytometry with a goat-anti rat IgG antibody (not shown). HO-8910 cells (probably a HeLa derivative) were incubated with 13F11 CAR-T cells of non-transduced control T cells (Mock-T) at the ratios indicated on the X-axis for 24 h. Then, killing was measured with a commercial lactate dehydrogenase (LDH) assay.

[0056] Figure 14 shows the killing of Hep G2, HuCC-T1 and PCI-1 cells by 13F11 or 23A7 (EX02) CAR T cells. Figure 14A shows that 13F11 CAR-T cells kill target cells in vitro. Hep G2 cells were incubated with 13F11 CAR-T cells at different E:T ratios. Targeted cell killing was analyzed in a xCELLigence system with Mock-T cells used as a negative control. Figure 14B shows 13F11 CAR-T induced cytotoxicity on Hep G2 cells after 24 hours of coculture.Figure 14C shows cytotoxicity on HuCC-T1 cells by 13F11 CAR-T. The cell damage was monitored by LDH levels measurement. Figure 14D shows the secretion of IFN-y from the killing of PCI-1 cells by 23A7 (EX02) CAR T cells. T-cells from 4 donors were transduced with a retroviral vector encoding a CAR construct with a single-chain construct derived from antibody 23A7. After coculture of 23A7 (EX02) CAR-T cells or mock-T cells with surface SRRM2 positive PCI-1 head and neck cancer cells at different ratios for 48 h, secretion of IFN-Y into the supernatant was quantified with a commercial sandwich ELISA.

[0057] Figure 15 shows the killing of SKOV-3, UWB1.289, and PANC-1 cells by 13F11 CAR T cells and the resulting IL2- and IFN-y levels. 13F11 CAR-T cells (effectors, E) were cocultured with target cancer cells (T) at different E:T ratios (10:1, 5:1 and 2:1) in a 96-well plate for real-time cell analysis (RTCA). Cancer cells alone (= without T cells) were set as negative control. Mock T cells (without CAR expression) was another control for RTCA CAR-T cell killing assay. Figure 15A shows the results using SKOV-3 ovarian cancer cells as targets, Figure 15B shows the results using UWB1.289 ovarian cancer cells as targets, and Figure 15C shows the results using PANC1 pancreatic cancer cells as targets. To measure IL2- and IFN-y levels, 13F11 CAR-T cells and target cells (SKOV-3, UWB1.289 ovarian cancer cells and PANC1 pancreatic cancer) cells were cocultured as described above for 24 h. After 24 hours of co-culture, the cell culture media (each 200pl) were collected and analyzed with a commercial ELISA assay (Figure 15D (IL-2) and Figure 15E (IFN- y).

[0058] Figure 16 shows that 23A7 (EX-02) CAR-T cells inhibit tumor growth in a human cell xenograft model. Figure 16A shows bioluminescence imaging of xenografted BxPC-3 pancreatic cancer cells in mice treated with 23A7 (EX-02) CAR-T cells, mock-T cells, or with PBS at different time points after T-cell injection. Figure 16B shows the average tumor burden overtime in mice treated with 23A7 (EX-02) CAR-T cells, mock-T cells, or PBS measured as total flux using the bioluminescence measurements. Figure 16C shows the ratios of CD8+ / CD4+ cells and CD45+ / CD8+ cells in 23A7 (EX-02) CAR-T and mock-T cell treated animals.

[0059] Figure 17 shows that 23A7 (EX-02) CAR-T cells inhibit tumor growth in a human xenograft model. Figure 17A shows bioluminescence imaging of xenografted SKOV-3 ovarian cancer cells in mice treated with 23A7 (EX-02) CAR-T cells, mock-T cells, or with PBS at different time points after T-cell injection. Figure 17B shows the average tumor burden over time in mice treated with 23A7 (EX-02) CAR-T cells, mock-T cells, or PBS measured as total flux using the bioluminescence measurements. Figure 17C shows the levels of IL-5, IFNy, CD3+ T cells, CAR-T cells, and ratio of human CD8+ / CD4+ in 23A7 (EX-02) CAR-T and mock-T cell treated animals.

[0060] Figure 18 shows that (A) 23A7 CAR T cells expanded, and (B) that in patients having pancreatic cancer and enrolled in the preliminary clinical trial the proportion of CD8+ cells in the T-cell population consistently increased over a period of 60 days after EX-02 CAR-T cell infusion.DETAILED DESCRIPTION OF THE INVENTION

[0061] WO 2023 / 174897 A1 and Kellner et al., 2024 show that SRRM2 is exposed on the surface of cancer cells. In contrast, in prior art SRRM2 is widely described as being a protein localized to the nucleus, in particular in nuclear speckles. Serine / arginine repetitive matrix protein 2 (SRRM2; UniProt Q9UQ35) plays an important role in pre-mRNA splicing and is a major component of the spliceosome. As such, it is not present on the cell surface of healthy cells. However, within the context of cancer, SRRM2 can be seen to become “externalized”, i.e. it is no longer only present in the nucleus, but also present on the cell surface of a cancer cell. Antibodies binding intracellular SRRM2 have been described in the art. However, these commercially available antibodies are not able to bind SRRM2 exposed on the surface of living cells (see Example 2b and Figures 5B, 6A, and 6B). Thus, contrary to the antibody used in the context of the present invention, these prior art antibodies have different binding propertiesand cannot be used in treating solid tumors characterized by cells having a significantly increased amount of cell surface-expressed, i.e. externalized, SRRM2 (cf. Example 3). However, now it is known that SRRM2 is present on the cell surface of solid tumor cells. Hence, it is also possible to provide further antibodies against SRRM2 present on the cell surface of solid tumor cells. Thus, prior to WO 2023 / 174897 A1 and Kellner et al., 2024, SRRM2 was not considered an accessible target molecule on living or non-permeabilized cells for e.g. antibodies or CAR-T cells due to its assumed localization in the nucleus. However, using the SRRM2 antibodies described in WO 2023 / 174897 A1 and Kellner et al., 2024, those cells can now be targeted for the treatment of cancer. An exemplary sequence of human SRRM2 is provided by UniProt database entry Q9LIQ35, version 2 of 6 March 2007 and exemplified in SEQ ID NO: 12. The utility of the present invention was demonstrated by its use in treating solid cancer in patients, as defined herein. Specifically, treatment of solid adenocarcinoma patients with SRRM2 specific CAR-T cells led to reduction of cancer-associated symptoms in said patients.

[0062] The term “solid tumor” is used synonymously with the term “solid cancer” herein.

[0063] Further, surface SRRM2 was found to be significantly elevated on cancer cell lines derived from solid tumors and of solid cancer tissues when compared to the expression on normal cells, especially in tumor adjacent tissues (cf. Example 2). This implies a low probability of on-target off-tumor toxicity associated with SRRM2, positioning it as a potential candidate target for CAR-T therapy. Notably, SRRM2 is expressed on the cell membrane of multiple cancer cell lines (cf. Examples 1c, 2a). Cell surface expression is also found in tumor tissue of solid adenocarcinoma, especially ovarian cancer, bile duct cancer, stomach cancer, lung cancer, cholangiocarcinoma, and pancreatic cancer (cf. Example 2c). Furthermore, also conjugates comprising a drug and the anti-SRRM2 antibody of the invention are able to reduce the tumor volume of tumor-bearing mice (cf. Example 4).

[0064] Accordingly, the data provided herein impressively underline that surface expressed SRRM2 is significantly elevated on the surface of solid cancer cells derived from cancer patients and is therefore an optimal target for immunotherapy, specifically CAR-T cell therapy (cf. Example 6).

[0065] The present invention thus comprises an antibody that binds to human serine / arginine repetitive matrix protein 2 (SRRM2) present on the cell surface of a target cell, for use in a method for the treatment of a solid tumor in a human patient.

[0066] The human patient to be treated may have weight of between 16 and 150 kg, preferably 18 to 140kg, more preferably 20 to 130kg, still more preferably 22 to 120kg.

[0067] Alternatively, or additionally, the patient to be treated may have a body height between 70 and 220cm, preferably between 80 and 200cm, more preferably between 90 and 200cm.

[0068] The patient to be treated may be at least 1 year old, preferably 2 years, more preferably between 2 and 80 years old.

[0069] The SRRM2 protein within the context of the present invention may be a human SRRM2 protein having SEQ ID NO: 12 or may be a modified protein having an amino acid sequence derived from the sequence described above by the modification of one or more amino acids. Examples of the modified protein having a sequence derived from the sequence described above by the modification of one or more amino acids can include polypeptides having 70 % or more, preferably 80 % or more, more preferably 90 % or more, even more preferably 95 % or more homology to the amino acid sequence. Alternatively, partial peptides of these SRRM2 proteins may be used.

[0070] The term "homology" as used herein in its usual meaning includes identical amino acids as well as amino acids, which are regarded to be conservative substitutions (for example, exchange of a glutamate residue by an aspartate residue) at equivalent positions in the linear amino acid sequence of two proteins that are compared with each other. By "identity" or "sequence identity" is meant a property of sequences that measures their similarity or relationship. The term "sequence identity" or "identity" as used in the present invention means the percentage of pair-wise identical residues - following (homology) alignment of a sequence of a polypeptide of the invention with a sequence in question - with respect to the number of residues in the longer of these two sequences. Identity is measured by dividing the number of identical residues by the total number of residues and multiplying the product by 100.

[0071] The percentage of sequence homology or sequence identity can, for example, be determined herein using the program BLASTP, version blastp 2.2.5 (November 16, 2002; cf. Altschul et al., 1997). In this embodiment, the percentage of homology is based on the alignment of the entire polypeptide sequences (matrix: BLOSLIM 62; gap costs: 11.1; cutoff value set to 10-3), optionally including the propeptide sequences, using the human IL-4 as reference in a pairwise comparison. It is calculated as the percentage of numbers of "positives"(homologous amino acids) indicated as result in the BLASTP program output divided by the total number of amino acids selected by the program for the alignment. It is noted in this connection that this total number of selected amino acids can differ from the length of the porcine NTCP.

[0072] The SRRM2 protein used in the present invention is not limited by its origin and is preferably a human SRRM2 protein.

[0073] The term “antibody” as used herein and in the context of the present invention may comprise chimeric antibodies, humanized antibodies, monovalent antibodies, polyvalent antibodies, low-molecular antibodies, a diabody or a scFv.

[0074] Chimeric antibodies refer to antibodies comprising variable and constant regions of different origins ligated with each other. For example, mouse-human heterogeneous chimeric antibodies are antibodies comprising the heavy and light chain variable regions of a mouse antibody and the heavy and light chain constant regions of a human antibody. Mouse antibody variable region-encoding DNAs are ligated with human antibody constant region-encoding DNAs, and the ligation products can be incorporated into expression vectors to prepare chimeric antibody-expressing recombinant vectors. Cells transformed with these vectors (recombinant cells) can be cultured for the expression of the DNA insert to obtain the chimeric antibodies produced during the culture.

[0075] In general, the chimeric antibodies comprise non-human animal-derived antibody variable regions and human antibody-derived constant regions. By contrast, the humanized antibodies comprise non-human animal-derived antibody complementarity-determining regions (CDRs), human antibody-derived framework regions (FRs), and human antibody-derived constant regions. The humanized antibodies are also called reshaped human antibodies. Specifically, for example, humanized antibodies comprising non-human animal (e.g., mouse) antibody CDRs grafted in human antibodies are known in the art. The humanized antibodies are useful as active ingredients for a therapeutic agent of the present invention, owing to their reduced antigenicity in the human body.

[0076] Each antibody variable region usually comprises 3 CDRs flanked by 4 FRs. The CDR regions substantially determine the binding specificity of the antibody. The CDRs have diverse amino acid sequences. On the other hand, amino acid sequences constituting the FRs often exhibit high homology among antibodies having different binding specificities. Therefore, ingeneral, the binding specificity of a certain antibody can allegedly be transplanted to other antibodies through CDR grafting.

[0077] The antibody, which binds to human SRRM2 may encompass bivalent antibodies typified by IgG (lgG1, lgG2, lgG4, etc.) and also monovalent antibodies or polyvalent antibodies typified by IgM, as long as these antibodies bind to the SRRM2 protein. The polyvalent antibody may encompass polyvalent antibodies having antigen-binding sites, all of which are the same as each other or some or all of which are different from each other. Preferably, the antibody, which binds to human SRRM2 is an IgG antibody.

[0078] The term “binds to SRRM2” or “binds to human SRRM2” as used herein and in the context of the present invention means binding to (human) SRRM2 present or localized on the cell surface and not to intracellular SRRM2.

[0079] The antibody, which binds to human SRRM2 may also be a low-molecular antibody that encompasses an antibody fragment deficient in a portion of the whole antibody (e.g. whole IgG). Such partial deficiency of the antibody molecule is accepted as long as the resultant antibody fragment is capable of binding to the SRRM2. It is preferred that the antibody fragment should contain one or both of heavy chain variable (VH) and light chain variable (VL) regions. It is also preferred that the antibody fragment should contain CDRs. The number of CDRs contained in the antibody fragment is not particularly limited and is preferably at least 6 CDRs: heavy chain CDR1, CDR2, and CDR3 and light chain CDR1, CDR2, and CDR3.

[0080] The antibody, which binds to human SRRM2, for use in the treatment or used in a method for the treatment of a solid tumor in a human patient may be part of a pharmaceutical composition, which further comprise pharmaceutical acceptable excipients, carrier or the like, to be administered to the human patient.

[0081] The amino acid sequence of VH or VL can contain one or more substitution, deletion, addition, and / or insertion. Furthermore, the antibody or antibody fragment for use in the treatment or used in a method for the treatment of a solid tumor in a human patient, which may be employed in the pharmaceutical composition of the present invention, may be deficient in a portion of one or both of VH and VL, as long as the resultant antibody fragment is capable of binding to the human SRRM2. Moreover, its variable region may be chimerized or humanized. Specific examples of the antibody fragment can include Fab, Fab’, F(ab’)2, and Fv. Moreover, specific examples of the low-molecular antibody can include Fab, Fab’, F(ab’)2, Fv, scFv(single chain Fv), diabody, sc(Fv)2 (single chain (Fv)2), and scFv-Fc. In the present invention, the low molecular antibody is preferably a diabody or sc(Fv)2. These antibody multimers (e.g., dimers, trimers, tetramers, and polymers) are also encompassed by the low-molecular antibody.

[0082] The term “diabody” as used herein and in the context of the present invention may refer to a bivalent antibody fragment constructed by gene fusion. The diabody is a dimer comprising two polypeptide chains. Usually, each of the polypeptide chains constituting the dimer comprises heavy and light chain variable regions linked via a linker on the same chain. The linker in the diabody is generally too short to allow paring between heavy and light chain variable regions on the same chain. Specifically, the number of amino acid residues constituting the linker is, for example, approximately 5 residues. Therefore, heavy and light chain variable regions encoded on the same polypeptide chain cannot together form a single chain variable region fragment. Instead, they form a dimer by pairing with another single chain variable region fragment. As a result, the diabody has two antigen-binding sites.

[0083] The scFv, as used in the context of the present invention, may be obtained by linking heavy and light chain variable regions of the antibody. In the scFv, the heavy and light chain variable regions are linked via a linker, preferably, a peptide linker. The heavy and light chain variable regions in the scFv can be derived from any of the antibodies described in the present specification. The peptide linker that links the variable regions is not particularly limited. For example, an arbitrary single chain peptide of approximately 3 to 25 residues can be used as the linker.

[0084] The antibody, which binds to human SRRM2 according to the present invention, may also encompass binding entities, such as lipocalins, an aptamer or an anticalin.

[0085] The antibody which binds to human SRRM2 used in the present invention can have various formats. However, it needs to bind to the SRRM2 protein and is not particularly limited by its origin, type, shape, etc., but may have a cytotoxic activity. Specifically, an antibody can be used, such as a non-human animal-derived antibody (e.g., a mouse, rat, or camel antibody), a human-derived antibody, a chimeric antibody, or a humanized antibody as described above. The antibody, which binds to human SRRM2 used in the present invention may in one embodiment be a polyclonal or monoclonal antibody and is preferably a monoclonal antibody.

[0086] The antibody which binds to human SRRM2 used in the present invention can be obtained as a polyclonal or monoclonal antibody using means known in the art. The antibody used in the present invention is in particular preferably a mammal-derived monoclonal antibody. The mammal-derived monoclonal antibody encompasses, for example, those produced by hybridomas and those produced by hosts transformed with expression vectors containing an antibody gene by a genetic engineering approach.

[0087] In some embodiments of the present invention, the antibody which binds to human SRRM2 may be modified to form a chimeric antigen receptor (CAR), expressed by an immune cell(s), preferably NK cells, NK-T cells, or macrophages, most preferably T cells (CAR T cells). CARs (also known as chimeric immunoreceptors, chimeric T cell receptors or artificial T cell receptors) are receptor proteins that have been engineered to give T cells the ability to target a specific protein. CARs link an extracellular antigen recognition domain with an internal signaling domain capable of mediating T cell activation upon antigen binding. In the present invention, the extracellular region may comprise the light and heavy chains of the antibody that recognizes human SRRM2, formed into a single-chain variable fragment (scFv). A CAR so described shall result in T cell activation upon SRRM2 binding. In addition, a hinge region and transmembrane domain shall also form parts of the CAR. Non-limiting examples of scFvs may comprise (a) a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 2; (b) a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 4; (c) a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 6; (d) a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 7; (e) a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 9; or (f) a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence withat least 85% identity to the amino acid sequence shown in SEQ ID NO: 11. Further non-limiting examples of scFvs may comprise (a) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 13, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 14, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 15, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 16, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 17, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 18; (b) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 19, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 20, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 21, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 22, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 23, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 24; (c) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 28, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 29, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 30; (d) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 31 , light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 32, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 33; (e) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 34, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 35, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 36, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 37, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 38, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 39; or (f) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 40, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 41, and heavy chain CDR3 havingthe amino acid sequence as set forth in SEQ ID NO: 42, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 43, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 44, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 45.

[0088] In some embodiments of the present invention, the antibody which binds to human SRRM2 may be modified to form a chimeric antigen receptor (CAR) expressed by an immune cell(s), including, but not limited, to T cells, NK cells, NK-T cells, or macrophages, wherein said immune cells may be derived from induced pluripotent stem cells (iPSCs)

[0089] In some embodiments of the present invention, the antibody which binds to human SRRM2 may be modified to form a chimeric antigen receptor (CAR), expressed by an immune cell(s), including but not limited to T cells, NK cells, NK-T cells, or macrophages, wherein said immune cells are immune cells in which p2-immunoglobulin has been inactivated.

[0090] In some embodiments of the present invention, the antibody of the present invention which binds to human SRRM2 is expressed by an autologous cell population. Autologous cell population means a cell population of the patient to be treated with the antibody. The advantage of using the autologous cell population is the reduction or missing of any incompatibility of the patient’s organism and the antibody expressing cell population resulting in no or less symptoms of e.g. GvHD.

[0091] In some embodiments of the present invention, the antibody of the present invention which binds to human SRRM2 is expressed by an allogeneic cell population. The advantage of using the allogenic cell population is the independence from the blood cells of a specific patient. Especially the blood cells of cancer patients may be not as vital as blood cells from healthy donors.

[0092] As set forth above, the present invention comprises the finding that SRRM2 is present on the cell surface of solid tumor cells obtained from solid cancer patients, e.g. adenocarcinoma patients, and can be bound by the antibody used in the present invention. Accordingly, it is particularly envisaged in the context of the present invention that the antibody which binds to human SRRM2 on the surface of a target cell binds to non-permeabilized cells. “Permeabilization of cells” refers to the breakup of the cell membrane by electrical, mechanical or chemical means, i.e. the cell membrane becomes permeable. However, contrary thereto, the cells bound by the antibody of the present invention have an intact cell membraneexpressing SRRM2, i.e. these cells are non-permeabilized (cf. Example 2a). It is equally envisaged that the antibody used in the context of the present invention which binds to human SRRM2 on the surface of a target cell binds to living cells. A “living cell” is a structural and functional unit comprising at least an intact cell membrane, a nucleus, and the cytoplasm, that controls the substances that go into and out of the cell and is able to function independently.

[0093] The antibody which binds to human SRRM2 may be modified with various molecules such as polyethylene glycol (PEG). Further, the antibody, which binds to human SRRM2 may also be modified with a cytotoxic substance such as a chemotherapeutic agent, a toxic peptide, a radioactive chemical, or the like having a cytotoxic activity.

[0094] Specific examples of the antibody used in the present invention, which recognizes SRRM2 present on the cell surface of a target cell such as a solid cancer cell and binds thereto, may include the antibodies given and described herein.

[0095] As described above, an antibody, which binds to human SRRM2 of the present invention or which is for use in the treatment or used in a method for the treatment of a solid tumor in a human patient or as used in the pharmaceutical composition of the present invention or as used in the methods of the present invention including the substitution, deletion, addition, and / or insertion of one or more amino acids is also incorporated in the scope of the present invention and may be prepared or occur naturally. Examples of a method for introducing a mutation in the polypeptide include site-directed mutagenesis (Hashimoto-Gotoh et al., 1995; Zoller et al., 1983; Kramer et al., 1984; Kramer W et al., 1987; Kunkel, 1985; Kunkel et al., 1988). This is one of the methods well known by those skilled in the art for preparing a polypeptide functionally equivalent to a certain polypeptide. Those skilled in the art can appropriately introduce a mutation in the antibody of the present invention or the antibody for use in the treatment or used in a method for the treatment of a solid tumor in a human patient or the antibody as used in the pharmaceutical composition of the present invention or as used in the methods of the present invention using such a method and thereby prepare an antibody functionally equivalent to such antibody. Moreover, amino acid mutations may occur in the natural world. Such an antibody that has an amino acid sequence derived from the amino acid sequence of the antibody of the present invention or the antibody for use in the treatment or used in a method for the treatment of a solid tumor in a human patient or the antibody as used in the pharmaceutical composition of the present invention or as used in the methods of the present invention comprising the mutation of one or more amino acids, is functionally equivalent or a variant to the antibody and is also encompassed by the antibody of the presentinvention or the antibody for use in the treatment or used in a method for the treatment of a solid tumor in a human patient or the antibody as used in the pharmaceutical composition of the present invention or as used in the methods of the present invention, especially the antibody for use in the treatment or used in a method for the treatment of a solid tumor in a human patient.

[0096] The number of amino acids mutated in such a variant is usually within 50 amino acids, preferably within 30 amino acids, more preferably within 10 amino acids (e.g. within 5 amino acids).

[0097] For amino acid residues to be mutated, it is preferred that this mutation should be performed conservatively between amino acids having the same side chain property. For example, the following classification based on the properties of amino acid side chains has been established: hydrophobic amino acids (A, I, L, M, F, P, W, Y, and V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, and T), amino acids having an aliphatic side chain (G, A, V, L, I, and P), amino acids having a hydroxyl group-containing side chain (S, T, and Y), amino acids having a sulphur atom-containing side chain (C and M), amino acids having a side chain containing carboxylic acid and amide (D, N, E, and Q), amino acids having a base-containing side chain (R, K, and H), and amino acids having an aromatic group-containing side chain (H, F, Y, and W) (all symbols within the parentheses represent single letter codes of amino acids).

[0098] A polypeptide having an amino acid sequence modified from a certain amino acid sequence by the deletion and / or addition of one or more amino acid residue(s) and / or the substitution thereof by other amino acids is already known to maintain the biological activity of the original polypeptide (Mark etal., 1984; Wang et al., 1982). Specifically, when amino acids in an amino acid sequence constituting a certain polypeptide are substituted by amino acids classified in the same group there as, it is generally said that the polypeptide is likely to maintain its activity. In the present invention, the substitution between amino acids within the same amino acid group described above is referred to as conservative substitution.

[0099] The term “surface” or specifically “cell surface” as used herein means the cell membrane of a target cell. The cell membrane, which may also be known as plasma membrane, is the thin membrane that surrounds every living cell, delimiting the cell from the environment around it. Enclosed by this cell membrane are the cell’s constituents, often large, water-soluble, highly charged molecules such as proteins, nucleic acids, carbohydrates, and substances involved in cellular metabolism. The cell membrane, therefore, has at least twofunctions: first, to be a barrier keeping the constituents of the cell in and unwanted substances out and, second, to be a gate allowing transport into the cell of essential nutrients and removal of waste products from the cell. ER-derived vesicles may also participate in the building or formation of the cell membrane.

[0100] The antibody, which binds to human SRRM2 binds to a SRRM2 polypeptide extracellularly. In other words, an antibody as described herein binds to SRRM2 when it is outside the target cell, which also comprises SRRM2 to be specifically on the surface of the target cell. Thus, the antibody binds to SRRM2 which is present on the cell surface of the target cell. Furthermore, the antibody may bind to SRRM2 present on the cell surface of said target cell which is externalized. Accordingly, the antibody, which binds to human SRRM2 is not an intracellular antibody, which is also called an intrabody. An “intrabody” (from intracellular and antibody) is an antibody that works within the cell to bind to an intracellular protein, e.g. intracellular SRRM2. This requires the expression of the antibody within the target cell, which can be accomplished, e.g. in transgenic animals or by gene therapy. As a result, intrabodies are antibodies that have been modified for intracellular localization and include antibodies, which are produced in prokaryotes or other non-target cells. The term “intrabody” can apply to several types of protein targeting: the antibody may remain in the cytoplasm, or it may have a nuclear localization signal, or it may undergo co-translational translocation across the membrane into the lumen of the endoplasmic reticulum, provided that it is retained in that compartment through a KDEL sequence.

[0101] The “target cell” is preferably a solid cancer cell. The term “solid cancer” or “solid tumor”, as used herein, comprise a solid adenocarcinoma. The solid adenocarcinoma may comprise any one or more of the following: pancreatic adenocarcinoma, lung adenocarcinoma, breast adenocarcinoma, colorectal adenocarcinoma, rectum adenocarcinoma, prostatic adenocarcinoma, esophageal adenocarcinoma, gastric adenocarcinoma, adrenal adenocarcinoma, vaginal adenocarcinoma, vulvar adenocarcinoma, bile duct adenocarcinoma, gall bladder adenocarcinoma, salivary gland adenocarcinoma, thyroid adenocarcinoma, duodenal adenocarcinoma, renal adenocarcinoma, urinary bladder adenocarcinoma, ovary adenocarcinoma or endocervical adenocarcinoma.

[0102] The term “pharmaceutically acceptable carrier, diluent or excipient” as used in the context of the present invention, may comprise any pharmaceutically acceptable carrier, diluent or excipient for a pharmaceutical composition known by the person skilled in the art. It will be understood that such antibodies or pharmaceutical composition as described hereinmay be mixed with carriers or diluents, which will not interfere with the intended purpose of the present invention. For example, such a carrier as used within the present invention may be a carrier protein, such as bovine serum albumin (BSA) or keyhole limpet hemocyanin (KLH).

[0103] In one embodiment of the present invention, said antibody, which binds to human SRRM2, has cytotoxic activity. In the context of the present invention, the phrase “cytotoxic activity” may refer to having a SRRM2 binding activity and may also include having an activity equivalent to that of the antibody, which binds to human SRRM2 of the present invention. In the present invention, the equivalent activity is not necessarily required to be an identical activity and may be, for example, 50% or more, preferably 70% or more, more preferably 90% or more activity compared with the activity of any of the antibodies (a) to (e) as described herein. Examples of the upper limit of the activity can include, but is not particularly limited to, 1000% or less, 500% or less, 300% or less, 150% or less, and 100% or less.

[0104] In one further embodiment of the present invention, said antibody, which binds to human SRRM2 has antibody-dependent cell-mediated cytotoxicity (ADCC) or complementdependent cytotoxicity (CDC). Thus, examples of the cytotoxic activity according to the present invention can include ADCC and / or CDC activities. In the context of the present invention, the ADCC activity means the activity of damaging target cells through the binding of Fey receptorbearing cells (immunocytes, etc.) via the Fey receptors to the Fc domains of antibodies specifically attached to the cell surface antigens of the target cells. On the other hand, the CDC activity means a cytotoxic activity mediated by the complement system. Whether or not the antibody has an ADCC activity or has a CDC activity can be determined by a method known in the art.

[0105] Thus, the antibody, which binds to human SRRM2 on the cell surface of the present invention may have activities such as an ADCC activity and as such, may be useful as a pharmaceutical drug, preferably, an anti-cancer agent, wherein the cancer is a solid cancer e.g. solid adenocarcinoma and / or a solid adenocarcinoma of any one or more of pancreatic adenocarcinoma, lung adenocarcinoma, breast adenocarcinoma, colorectal adenocarcinoma, rectum adenocarcinoma, prostatic adenocarcinoma, esophageal adenocarcinoma, gastric adenocarcinoma, adrenal adenocarcinoma, vaginal adenocarcinoma, vulvar adenocarcinoma, bile duct adenocarcinoma, gall bladder adenocarcinoma, salivary gland adenocarcinoma, thyroid adenocarcinoma, duodenal adenocarcinoma, renal adenocarcinoma, urinary bladder adenocarcinoma, ovary adenocarcinoma or endocervical adenocarcinoma.1

[0106] In one embodiment of the present invention, said antibody, which binds to human SRRM2, is conjugated with a cytotoxic substance.

[0107] In one preferred embodiment, the antibody, which binds to human SRRM2 may be conjugated with a cytotoxic substance, such as a chemotherapeutic agent, a toxic peptide, or a radioactive chemical. Such a modified antibody (hereinafter, referred to as an antibody conjugate) can be obtained by chemically modifying the obtained antibody. A method for the antibody modification has already been established in the art.

[0108] Examples of the chemotherapeutic agent whose cytotoxic activity functions through the conjugation to the antibody that binds SRRM2 can include the following chemotherapeutic agents: azaribine, anastrozole, azacytidine, bleomycin, bortezomib, bryostatin-1, busulfan, camptothecin, 10-hydroxycamptothecin, carmustine, celebrex, chlorambucil, cisplatin, irinotecan, carboplatin, cladribine, cyclophosphamide, cytarabine, dacarbazine, docetaxel, dactinomycin, daunomycin glucuronide, daunorubicin, dexamethasone, diethylstilbestrol, doxorubicin, doxorubicin glucuronide, epirubicin, ethinyl estradiol, estramustine, etoposide, etoposide glucuronide, exatecan, floxuridine, fludarabine, flutamide, fluorouracil, fluoxymesterone, gemcitabine, hydroxyprogesterone caproate, hydroxyurea, idarubicin, ifosfamide, leucovorin, lomustine, mechlorethamine, medroxyprogesterone acetate, megestrol acetate, melphalan, mercaptopurine, methotrexate, mitoxantrone, mithramycin, mitomycin, mitotane, monomethyl auristatin E (MMAE), phenylbutyrate, prednisone, procarbazine, paclitaxel, pentostatin, semustine, streptozocin, tamoxifen, taxanes, taxol, testosterone propionate, thalidomide, thioguanine, thiotepa, teniposide, topotecan, uracil mustard, vinblastine, vinorelbine, vincristine or a derivative or an analog thereof. Especially preferred are antibody conjugates comprising monomethyl auristatin E (MMAE) or exatecan or a derivative or an analog thereof, e.g. the exatecan derivative Deruxtecan (DXd). Non-limiting examples are shown in Example 4.

[0109] The chemotherapeutic agent is preferably a low-molecular chemotherapeutic agent. The low-molecular chemotherapeutic agent is unlikely to interfere with the antibody even after its conjugation to the antibody. The low-molecular chemotherapeutic agent usually has a molecular weight of 100 to 2000, preferably 200 to 1000. All chemotherapeutic agents exemplified above are low-molecular chemotherapeutic agents. These chemotherapeutic agents encompass prodrugs that are converted in vivo to active chemotherapeutic agents. The prodrug activation may be an enzymatic conversion or a non-enzymatic conversion.

[0110] Examples of toxic peptides are snake venom peptides comprising Three-Finger Toxins (3FTxs), a disintegrin, a Kunitz-type inhibitor, a natriuretic peptide, ora Sarafotoxin as reviewed in Munawar et al., 2018. Further examples are a trypsin inhibitor, an islanditoxin, a pallotoxin, or an amatoxin as mentioned in Khan etal., 2018.

[0111] Examples of a radioactive chemical are chemicals having a cytotoxic radionuclide, such radionuclide could be for example iodine-131 , indium-111 , yttrium-90, lutetium-177, actinium-225, gallium-68, or bismuth-213 as reviewed in Hofland etal., 2022 and Martini ova etal., 2022 (see also Drecoll etal., 2009). The antibody coupled to the cytotoxic substance could be used for delivering the cytotoxic substance specifically to the target cell which may reduce unwanted side effects.

[0112] The antibody could also be coupled to a substance used for in-vivo imaging. Such substances are for example diagnostic used radionuclides, like technetium-99m, fluor-18, carbon-11, nitrogen-13, oxygen-15, copper-68 or iodide-124 (cf. e.g. Bhattacharyya et al., 2011; Martiniova et al., 2022). Further examples of such substances are gadolinium, a magnetic metal particle, or a fluorophore.

[0113] In one embodiment of the present invention, said antibody, which binds to human SRRM2, is less than 20 % cross-reactive with SRRM2-related proteins. This means preferably that said antibody, which binds to human SRRM2, is less than 20 % cross-reactive with other serine / arginine repetitive matrix proteins such as SRRM1, SRRM3, SRRM4 or SRRM5. More preferably, said antibody, which binds to human SRRM2 is less than 15 % cross-reactive with SRRM2-related proteins, e.g. SRRM1, SRRM3, SRRM4 or SRRM5. Even more preferably, said antibody, which binds to human SRRM2, is less than 10 % cross-reactive with SRRM2-related proteins, e.g. SRRM1, SRRM3, SRRM4 or SRRM5. Even more preferably, said antibody, which binds to human SRRM2, is less than 5 % cross-reactive with SRRM2-related proteins, e.g. SRRM1, SRRM3, SRRM4 or SRRM5. Even more preferably, said antibody, which binds to human SRRM2, is less than 3 % cross-reactive with SRRM2-related proteins, e.g. SRRM1, SRRM3, SRRM4 or SRRM5. Even more preferably, said antibody, which binds to human SRRM2, is less than 2 % cross-reactive with SRRM2-related proteins, e.g. SRRM1, SRRM3, SRRM4 or SRRM5. Even more preferably, said antibody, which binds to human SRRM2, is less than 1 % cross-reactive with SRRM2-related proteins, e.g. SRRM1, SRRM3, SRRM4 or SRRM5.

[0114] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 2 or an antibody, which binds to the same epitope.

[0115] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 or an antibody, which binds to the same epitope.

[0116] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 2 or an antibody, which binds to the same epitope.

[0117] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 2 or an antibody, which binds to the same epitope.

[0118] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 4 or an antibody, which binds to the same epitope.

[0119] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 4 or an antibody, which binds to the same epitope.

[0120] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 4 or an antibody, which binds to the same epitope.

[0121] In one embodiment, said antibody, which binds to human SRRM2 is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 4 or an antibody, which binds to the same epitope.

[0122] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 6 or an antibody, which binds to the same epitope.

[0123] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 6 or an antibody, which binds to the same epitope.

[0124] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 6 or an antibody, which binds to the same epitope.

[0125] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 6 or an antibody, which binds to the same epitope.

[0126] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 7 or an antibody, which binds to the same epitope.

[0127] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 7 or an antibody, which binds to the same epitope.

[0128] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 7 or an antibody, which binds to the same epitope.

[0129] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 7 or an antibody, which binds to the same epitope.

[0130] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 9 or an antibody, which binds to the same epitope.

[0131] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 9 or an antibody, which binds to the same epitope.

[0132] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 9 or an antibody, which binds to the same epitope.

[0133] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 9 or an antibody, which binds to the same epitope.

[0134] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 11 or an antibody, which binds to the same epitope.

[0135] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 11 or an antibody, which binds to the same epitope.

[0136] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 11 or an antibody, which binds to the same epitope.

[0137] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 11 or an antibody, which binds to the same epitope.

[0138] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 13, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 14, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 15, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 16, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 17, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 18, or an antibody, which binds to the same epitope.

[0139] In one embodiment, said antibody, which binds to human SRRM2 is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 19, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 20, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 21, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 22, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 23, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 24, or an antibody, which binds to the same epitope.

[0140] In one embodiment, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 28, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 29, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 30, or an antibody, which binds to the same epitope.

[0141] In one embodiment of the present invention, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 31 , light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 32, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 33, or an antibody, which binds to the same epitope.

[0142] In one embodiment of the present invention, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 34, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 35, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 36, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 37, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 38, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 39, or an antibody, which binds to the same epitope.

[0143] In one embodiment of the present invention, said antibody, which binds to human SRRM2, is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 40, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 41, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 42, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 43, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 44, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 45, or an antibody, which binds to the same epitope.

[0144] The antibodies described herein, especially the antibodies 13F11, 18A4, 18A4-2.23A7, 14B6, and 24A6 which sequences of their variable regions and CDRs are mentioned in Table 1 and the sequence listing, might bind to AA 1889-2036 or AA 2088-2150 of human SRRM2 as mentioned in Example 3.

[0145] The antibodies described herein may contain constant regions. The constant regions used are not particularly limited, and any constant region may be used. Preferable examples of the constant regions used in the present invention can include human-derived constant regions. For example, a human lgG1-derived, human lgG2-derived, human lgG3-derived, or human lgG4-derived constant region can be used as a heavy chain constant region. Also, for example, human K chain-derived or human A chain-derived constant region can be used as a light chain constant region. The constant regions used in the present invention may be constant regions having a native sequence or may be modified constant regions having a sequence derived from the native sequence by the modification of one or more amino acids.

[0146] The antibodies described herein may also contain framework regions (FRs). The FRs used are not particularly limited, and any FR may be used as long as the resulting antibody maintains its binding activity to human SRRM2 present on the cell surface of a target cell. Preferable examples of the FRs used in the present invention can include human antibody derived FRs. Since the technique of FR replacement with the antigen binding activity of an antibody maintained is known in the art, those skilled in the art can appropriately select FRs. The FRs used in the present invention may be FRs having a native sequence or may be FRs having a sequence derived from the native sequence by the modification of one or more amino acids.

[0147] Whether or notan antibody shares an epitope with a certain antibody can be confirmed based on their competition for the same epitope. The competition between the antibodies is detected by cross-blocking assay or the like. The cross-blocking assay is preferably, for example, competitive ELISA assay. Specifically, in the cross-blocking assay, SRRM2 proteins coated on the wells of a microtiter plate may be pre-incubated in the presence or absence of a candidate competing antibody and the antibody, which binds to human SRRM2 of the present invention is then added to the wells. The amount of the antibody of the present invention bound to the SRRM2 protein in the well indirectly correlates with the binding ability of the candidate competing antibody (antibody to be tested) that competes therewith for the binding to the same epitope. Specifically, the larger affinity the antibody to be tested has for the same epitope, the smaller amount of the antibody of the present invention is bound to the SRRM2 protein-coated well, while the larger amount of the antibody to be tested is bound to the SRRM2 protein-coated well.

[0148] The amount of the antibody bound to the well can be measured easily by labelling the antibody in advance. For example, a biotin-labelled antibody can be measured by use of an avidin-peroxidase conjugate and an appropriate substrate. The cross-blocking assay using enzyme (e.g., peroxidase) labelling is particularly referred to as competitive ELISA assay. The antibody can be labelled with other detectable or measurable labelling substances. Specifically, radio-labelling or fluorescent labelling or the like is known in the art.

[0149] Provided that a candidate antibody can bind to human SRRM2 present on the cell surface of a target cell by at least 80%, preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 99%, compared to the binding activity obtained in a control test performed in the absence of the candidate antibody, this candidate antibody is determined as an antibody that binds to substantially the sameepitope as that to which the antibody of the present invention binds or to which the antibody, which binds to human SRRM2 and is for use in the treatment or used in a method for the treatment of a solid tumor in a human patient or which is used in the pharmaceutical composition binds.

[0150] In a further aspect the antibody as referred to herein is comprised by a pharmaceutical composition which is for use in a method for the treatment of solid cancer in a human patient. It is preferred for said embodiment that said solid cancer is characterized by cells, wherein human SRRM2 is present on their cell surface, i.e. the SRRM2 bound by the antibody of the present invention is membrane-expressed SRRM2. It is also preferred for said embodiment that said solid cancer is adenocarcinoma.

[0151] The present invention also covers the use of the pharmaceutical composition according to the present invention for the manufacture of a medicament for the treatment of solid cancer, preferably adenocarcinoma.

[0152] In one embodiment, the present invention also covers the use of an antibody, which binds to human SRRM2 as described herein, for the manufacture of a medicament for the treatment of solid cancer, preferably adenocarcinoma.

[0153] It is further envisaged in the context of the present invention that the solid cancer patient to be treated with the antibody binding to human SRRM2 as described herein is refractory to previous cancer therapy and / or in relapse after previous cancer therapy, i.e. said patient has already received a first (or even several) cancer treatment(s), but is now in the condition or need to receive a further cancer treatment. Said previous blood cancer therapy or treatment may comprise e.g. one or several cycles of chemotherapy and / or targeted cancer therapy known to those skilled in the art. “Relapsed” means in this respect that the solid cancer returns after it has been in remission after the previous cancer treatment. “Refractory” means in this respect that the solid cancer has stopped responding to previous cancer treatment

[0154] The present invention also comprises a method of treating solid cancer, wherein the method comprises administering the antibody of the invention or a therapeutically effective amount of the pharmaceutical composition comprising the antibody according to the present invention to a patient. The antibody or the pharmaceutical composition according to the present invention is preferred to be administrated via parenteral routes, including, but not limited to, intravenous, intradermal, intramuscular, intrathecal, or intraperitoneal administration. Alternateroutes include, but are not limited to: oral, rectal, ophthalmic (including intravitreal or intracameral), nasal, topical (including buccal and sublingual), intrauterine, vaginal or subcutaneous, intracranial, intratracheal, epidural, transdermal, intracerebroventricular, intracerebral, intravaginal, intrauterine, or intraspinal routes. Further preferred is the administration via intratumoral injection.

[0155] Further, the present invention comprises a method of treating solid cancer, wherein the method comprises administering the antibody or a therapeutically effective amount of the antibody, which binds to human SRRM2 described herein to a patient. It is preferred for said embodiment that said solid cancer is characterized by cells, wherein human SRRM2 is present on their cell surface. In this respect it is also envisaged that the method for the treatment of solid cancer in a human patient comprises, prior to the treatment of the solid cancer in said human patient, determining whether a target cell of said human patient has SRRM2 present on the cell surface as described elsewhere herein.

[0156] The term “therapeutically effective amount” refers to an amount of the antibody or pharmaceutical composition according to the present invention or drug effective to “treat” cancer in the patient. Specifically, in the case of cancer, the therapeutically effective amount of the antibody / pharmaceutical composition / drug can reduce the number of cancer cells; reduce the tumour size; inhibit or stop cancer cell infiltration into peripheral organs; inhibit and stop tumour metastasis; inhibit and / or stop tumour growth; relieve to some extent one or more of the symptoms associated with the cancer, or a combination of such effects on cancer cells. To the extent the antibody / pharmaceutical composition / drug prevents the growth and / or kills existing cancer cells, it can be referred to as cytostatic and / or cytotoxic.

[0157] Terms such as “treating” or “treatment” or “to treat” refer to both 1) therapeutic measures that cure, slow down, lessen symptoms of, and / or halt progression of a diagnosed pathologic condition or disorder and 2) prophylactic or preventative measures that prevent or slow the development of a targeted pathologic condition or disorder. Thus, those in need of treatment include those already with the disorder; those prone to have the disorder; and those in whom the disorder is to be prevented. A subject or patient is successfully “treated” according to the methods of the present invention or with the pharmaceutical composition or antibody, which binds to human SRRM2 according to the present invention if the patient shows one or more of the following: a reduction in the number of or complete absence of cancer cells; a reduction in the tumor size; inhibition of or an absence of cancer cell infiltration into peripheral organs including the spread of cancer into soft tissue and bone; inhibition of or an absence oftumor metastasis; inhibition or an absence of tumor growth; relief of one or more symptoms associated with the specific cancer; reduced morbidity and mortality; and improvement in quality of life.

[0158] The antibody to be administered to humans can also be converted to a genetically recombinant antibody that has been engineered artificially, for example, for the purpose of reducing heteroantigenicity in humans. The genetically recombinant antibody encompasses, for example, chimeric antibodies and humanized antibodies as defined herein. These engineered antibodies can be produced using a method known in the art.

[0159] “Extracellular vesicles” (EV) as used herein may relate to lipid bilayer-delimited particles that are naturally released from almost all types of cells and, unlike a cell, cannot replicate. EVs typically range in diameter from near the size of the smallest physically possible unilamellar liposome (around 20-30 nanometers) to as large as 10 pm or more, although the vast majority of EVs are smaller than 200 nm.

[0160] EVs can be divided according to size and synthesis route into exosomes, microvesicles and apoptotic bodies. Accordingly, the EV is preferably selected from the group consisting of exosomes, microvesicles and apoptotic bodies. Usually, they carry a cargo of proteins, nucleic acids, lipids, metabolites, and even organelles from the parent cell. Diverse EV subtypes have been proposed. Accordingly, the EV may also be one or more of the following: ectosomes, microvesicles, microparticles, exosomes, oncosomes, apoptotic bodies, exomeres and the like. Preferably, the EV is an oncosome. In the context of EVs, the sample preferably is ascites fluid.

[0161] EVs may be isolated and / or enriched from the sample by using an antibody or antibody fragment that specifically binds to a biomarker present on the surface of an EV prior to determining in a sample obtained from said patient whether SRRM2 is present on the surface of extracellular vesicles. Such biomarkers for EV include, e.g., for exosomes Alix, Tsg101, tetraspanins such as CD81, CD63 and CD9 or flotillin, for microvesicles integrins, selectins or CD40 and for apoptotic bodies Annexin V or phosphatidylserine. Antibodies against these markers are commercially available, e.g., from Abeam. Methods for isolating and / or enriching EVs are further described in Campos-Silva etal., (2019); Pugholm et al., (2015); or Kellner et al., 2024, both of which are hereby incorporated by reference in its entirety.

[0162] A “subject” or “patient” in the context of the present invention is a human being. For example, the patient may be a patient being suspected of having a disease or clinical condition associated with solid cancer or being diagnosed with such a disease or clinical condition.

[0163] Said “sample” obtained from said patient is preferably, but not limited to, a sample of blood, lymph fluid, lymphatic tissue or bone marrow.

[0164] The step of “determining whether a target cell of said human patient / subject has SRRM2 present on the cell surface” may comprise to determine the presence of SRRM2 or the fragments thereof by contacting the sample with at least one SRRM2 binder. The at least one binder may, for example, be the antibody according to the present invention or as described herein. It is preferred that at least one binder is less than 20% cross-reactive with other proteins, particularly other peroxiredoxins such as SRRM 1 , SRRM3, SRRM4 or SRRM5, more preferably less than 15 %, more preferably less than 10%, more preferably less than 5%, even more preferably less than 3%, even more preferably less than 2% and even more preferably less than 1% cross reactive. The SRRM2 binder may also comprise the antibody which binds to human SRRM2 on the cell surface of a target cell modified with a substance used for said diagnostic purpose, e.g. a radioactive chemical, a magnetic chemical, or a fluorescence moiety known to those skilled in the art.

[0165] In some embodiments, the antibody, which binds to human SRRM2, of the present invention or described herein may contain human Fc regions that are modified to enhance effector function, for example, antigen-dependent cell-mediated cytotoxicity (ADCC) and / or complement dependent cytotoxicity (CDC). This can be achieved by introducing one or more amino acid substitutions in a Fc region of the antibody. For example, cysteine residue(s) can be introduced in the Fc region to allow interchain disulfide bond formation in this region to improve complement-mediated cell killing and antibody-dependent cellular cytotoxicity (ADCC). Homodimeric antibodies with enhanced anti-tumor activity can also be prepared using heterobifunctional cross-linkers as known to the person skilled in the art. Alternatively, an antibody may be engineered, which has dual Fc regions.

[0166] Furthermore, the antibodies as described herein may have substitution, deletion, addition and / or insertion of one or more amino acids in their CDR sequences as long as the resulting antibodies are functionally equivalent to the antibodies (a) to (d). The term "functionally equivalent" refers to being comparable in avidity for SRRM2 and cytotoxicity. The term "equivalent" refers to having at least 50%, preferably having at least 60%, more preferablyhaving at least 70%, more preferably having at least 80%, even more preferably at least 90%, even more preferably at least 95% and even more preferably at least 99% activity, compared with the antibodies (a) to (d). The upper limit of the activity is not particularly limited and may be higher than that of the antibodies (a) to (d). The avidity or cytotoxicity can be assayed by a method generally known by those skilled in the art.

[0167] The present invention further relates to an antibody, which binds to human serine / arginine repetitive matrix protein 2 (SRRM2) present on the cell surface of a target cell for use in a method of killing said target cell, wherein said target cell is a solid cancer cell having SRRM2 present on the cell surface. Specifically, the present invention provides for an antibody, which binds to human serine / arginine repetitive matrix protein 2 (SRRM2) present on the cell surface of a target cell for use in a method of treating solid cancer as defined elsewhere herein.

[0168] “Target cell”, as used herein, refers to a solid cancer cell that expresses human serine / arginine repetitive matrix protein 2 (SRRM2) on its surface, unless otherwise stated.

[0169] In one embodiment, the antibody for use is used in a method for the treatment of solid cancer in a subject, optionally comprising, prior to the treatment of said solid cancer in said subject, determining whether a target cell of said subject has SRRM2 present on the cell surface as described herein using said antibody. Said antibody used in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 2 or an antibody, which binds to the same epitope.

[0170] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 2 or an antibody, which binds to the same epitope.

[0171] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chainvariable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 2 or an antibody, which binds to the same epitope.

[0172] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 2 or an antibody, which binds to the same epitope.

[0173] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 4 or an antibody, which binds to the same epitope.

[0174] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 4 or an antibody, which binds to the same epitope.

[0175] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 4 or an antibody, which binds to the same epitope.

[0176] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 4 or an antibody, which binds to the same epitope.

[0177] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chainvariable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 6 or an antibody, which binds to the same epitope.

[0178] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 6 or an antibody, which binds to the same epitope.

[0179] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 6 or an antibody, which binds to the same epitope.

[0180] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 6 or an antibody, which binds to the same epitope.

[0181] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 7 or an antibody, which binds to the same epitope.

[0182] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 7 or an antibody, which binds to the same epitope.

[0183] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chainvariable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 7 or an antibody, which binds to the same epitope.

[0184] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 7 or an antibody, which binds to the same epitope.

[0185] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 9 or an antibody, which binds to the same epitope.

[0186] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 9 or an antibody, which binds to the same epitope.

[0187] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 9 or an antibody, which binds to the same epitope.

[0188] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 9 or an antibody, which binds to the same epitope.

[0189] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chainvariable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 11 or an antibody, which binds to the same epitope.

[0190] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence with at least 90% identity to the amino acid sequence shown in SEQ ID NO: 11 or an antibody, which binds to the same epitope.

[0191] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence with at least 95% identity to the amino acid sequence shown in SEQ ID NO: 11 or an antibody, which binds to the same epitope.

[0192] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence with at least 99% identity to the amino acid sequence shown in SEQ ID NO: 11 or an antibody, which binds to the same epitope.

[0193] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 13, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 14, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 15, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 16, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 17, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 18, or an antibody, which binds to the same epitope.

[0194] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 19, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 20, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 21, and a light chain variable region comprising lightchain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 22, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 23, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 24, or an antibody, which binds to the same epitope.

[0195] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 28, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 29, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 30, or an antibody, which binds to the same epitope.

[0196] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 31 , light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 32, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 33, or an antibody, which binds to the same epitope.

[0197] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 34, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 35, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 36, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 37, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 38, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 39, or an antibody, which binds to the same epitope.

[0198] In one embodiment the antibody for use in a method for the treatment of solid cancer is an antibody comprising a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 40, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 41, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 42, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 43, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 44, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 45, or an antibody, which binds to the same epitope.

[0199] All embodiments, which are described herein for the pharmaceutical composition of the present invention, the antibody, which binds to human SRRM2 present on the cell surface of a target cell of the present invention, as described herein as well as the respective definitions as described above, also apply for the antibody for use in a method for the treatment of solid cancer in a human patient, comprising, prior to the treatment of solid cancer in said human patient, determining whether a target cell of said subject has SRRM2 present on the cell surface as described herein.

[0200] In one preferred embodiment, the antibody that binds to human serine / arginine repetitive matrix protein 2 (SRRM2) present on the cell surface of a target cell, for use in a method for the treatment of a solid tumor in a human patient, wherein said solid tumor is characterized by target cells, wherein SRRM2 is present on the cell surface of said target cells and wherein the solid tumor is preferably an adenocarcinoma and more preferably a pancreatic adenocarcinoma, wherein said antibody is part of a chimeric antigen receptor (CAR) and comprises a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 19, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 20, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 21, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 22, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 23, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 24.

[0201] The description of the sequences, shown in the sequence listing and as used in the context of the present invention, is as follows:

[0202] SEQ ID NO: 1 shows the amino acid sequence of the VH-region of antibody 13F11.

[0203] SEQ ID NO: 2 shows the amino acid sequence of the VL-region of antibody 13F11.

[0204] SEQ ID NO: 3 shows the amino acid sequence of the VH-region of antibody 23A7.

[0205] SEQ ID NO: 4 shows the amino acid sequence of the VL-region of antibody 23A7.

[0206] SEQ ID NO: 5 shows the amino acid sequence of the VH-region of antibody 18A4 and of antibody 18A4-2.

[0207] SEQ ID NO: 6 shows the amino acid sequence of the VL-region of antibody 18A4.

[0208] SEQ ID NO: 7 shows the amino acid sequence of the VL-region of antibody 18A4-2.

[0209] SEQ ID NO: 8 shows the amino acid sequence of the VH-region of antibody 14B6.

[0210] SEQ ID NO: 9 shows the amino acid sequence of the VL-region of antibody 14B6.

[0211] SEQ ID NO: 10 shows the amino acid sequence of the VH-region of antibody 24A6.

[0212] SEQ ID NO: 11 shows the amino acid sequence of the VL-region of antibody 24A6.

[0213] SEQ ID NO: 12 shows the amino acid sequence of human SRRM2 as shown in UniProt database entry Q9UQ35, version 2 of 6 March 2007.

[0214] SEQ ID NO: 13 shows the amino acid sequence of the VH-CDR1 of antibody 13F11.

[0215] SEQ ID NO: 14 shows the amino acid sequence of the VH-CDR2 of antibody 13F11.

[0216] SEQ ID NO: 15 shows the amino acid sequence of the VH-CDR3 of antibody 13F11.

[0217] SEQ ID NO: 16 shows the amino acid sequence of the VL-CDR1 of antibody 13F11.

[0218] SEQ ID NO: 17 shows the amino acid sequence of the VL-CDR2 of antibody 13F11.

[0219] SEQ ID NO: 18 shows the amino acid sequence of the VL-CDR3 of antibody 13F11.

[0220] SEQ ID NO: 19 shows the amino acid sequence of the VH-CDR1 of antibody 23A7.

[0221] SEQ ID NO: 20 shows the amino acid sequence of the VH-CDR2 of antibody 23A7.

[0222] SEQ ID NO: 21 shows the amino acid sequence of the VH-CDR3 of antibody 23A7.

[0223] SEQ ID NO: 22 shows the amino acid sequence of the VL-CDR1 of antibody 23A7.

[0224] SEQ ID NO: 23 shows the amino acid sequence of the VL-CDR2 of antibody 23A7.

[0225] SEQ ID NO: 24 shows the amino acid sequence of the VH-CDR3 of antibody 23A7.

[0226] SEQ ID NO: 25 shows the amino acid sequence of the VH-CDR1 of antibody 18A4 and of antibody 18A4-2.

[0227] SEQ ID NO: 26 shows the amino acid sequence of the VH-CDR2 of antibody 18A4 and of antibody 18A4-2.

[0228] SEQ ID NO: 27 shows the amino acid sequence of the VH-CDR3 of antibody 18A4 and of antibody 18A4-2.

[0229] SEQ ID NO: 28 shows the amino acid sequence of the VL-CDR1 of antibody 18A4.

[0230] SEQ ID NO: 29 shows the amino acid sequence of the VL-CDR2 of antibody 18A4.

[0231] SEQ ID NO: 30 shows the amino acid sequence of the VL-CDR3 of antibody 18A4.

[0232] SEQ ID NO: 31 shows the amino acid sequence of the VL- CDR1 of antibody 18A4-2.

[0233] SEQ ID NO: 32 shows the amino acid sequence of the VL-CDR2 of antibody 18A4-2.

[0234] SEQ ID NO: 33 shows the amino acid sequence of the VL-CDR3 of antibody 18A4-2.

[0235] SEQ ID NO: 34 shows the amino acid sequence of the VH-CDR1 of antibody 14B6.

[0236] SEQ ID NO: 35 shows the amino acid sequence of the VH-CDR2 of antibody 14B6.

[0237] SEQ ID NO: 36 shows the amino acid sequence of the VH-CDR3 of antibody 14B6.

[0238] SEQ ID NO: 37 shows the amino acid sequence of the VL-CDR1 of antibody 14B6.

[0239] SEQ ID NO: 38 shows the amino acid sequence of the VL-CDR2 of antibody 14B6.

[0240] SEQ ID NO: 39 shows the amino acid sequence of the VL-CDR3 of antibody 14B6.

[0241] SEQ ID NO: 40 shows the amino acid sequence of the VH-CDR1 of antibody 24A6.

[0242] SEQ ID NO: 41 shows the amino acid sequence of the VH-CDR2 of antibody 24A6.

[0243] SEQ ID NO: 42 shows the amino acid sequence of the VH-CDR3 of antibody 24A6.

[0244] SEQ ID NO: 43 shows the amino acid sequence of the VL-CDR1 of antibody 24A6.

[0245] SEQ ID NO: 44 shows the amino acid sequence of the VL-CDR2 of antibody 24A6.

[0246] SEQ ID NO: 45 shows the amino acid sequence of the VL-CDR3 of antibody 24A6.

[0247] SEQ ID NO: 46 shows the nucleotide sequence of one SRRM2 specific gRNA.

[0248] SEQ ID NO: 47 shows the nucleotide sequence of an other SRRM2 specific gRNA.

[0249] SEQ ID NO: 48 shows the amino acid sequence of fragment tr04.

[0250] An overview of the SEQ ID NOs and detailed sequences, as used in the context of the present invention, is given in the following Table 1 (in case of conflict between the sequences shown in Table 1 and the sequences of the sequence listing, which has to be filed for formal reasons, the sequences of Table 1 supersede the sequences of the sequence listing):

[0251] Table 1:

[0252] The following abbreviations were used in the context of the present invention: VH = variable heavy chain; VH = variable heavy chain; VL = variable light chain; CDR = complementarity determining region; VH-CDR = CDR of a variable heavy region; VL-CDR = CDR of a variable light region; CDRs can be determined by using the Kabat algorithm, e.g., http: / / abysis.org / abysis / .

[0253] It is noted that as used herein, the singular forms “a”, “an”, and “the”, include plural references unless the context clearly indicates otherwise. Thus, for example, reference to “a reagent” includes one or more of such different reagents and reference to “the method” includes reference to equivalent steps and methods known to those of ordinary skill in the art that could be modified or substituted for the methods described herein.

[0254] Unless otherwise indicated, the term "at least" preceding a series of elements is to be understood to refer to every element in the series. Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. Such equivalents are intended to be encompassed by the present invention.

[0255] The term "and / or", wherever used herein, includes the meaning of "and", "or" and "all or any other combination of the elements connected by said term".

[0256] The terms “less than” or in turn “more than” do not include the concrete number.

[0257] For example, “less than 20” means less than the number indicated. Similarly, “more than” or “greater than” means more than or greater than the indicated number, e.g. “more than 80 %” means more than or greater than the indicated number of 80 %.

[0258] Throughout this specification and the claims which follow, unless the context requires otherwise, the word “comprise”, and variations such as “comprises” and “comprising”, will be understood to imply the inclusion of a stated integer or step or group of integers or steps, but not the exclusion of any other integer or step or group of integer or step. When used herein the term “comprising” can be substituted with the term “containing” or “including” or sometimes, when used herein, with the term “having”. When used herein, “consisting of" excludes any element, step, or ingredient not specified.

[0259] The term “including” means “including but not limited to”. “Including” and “including but not limited to” are used interchangeably.

[0260] It should be understood that this invention is not limited to the particular methodology, protocols, material, reagents, and substances, etc., described herein and as such can vary. The terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention, which is defined solely by the claims.

[0261] All publications cited throughout the text of this specification (including all patents, patent application, scientific publications, instructions, etc.), whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. To the extent the material incorporated by reference contradicts or is inconsistent with this specification, the specification will supersede any such material.

[0262] The content of all documents and patent documents cited herein is incorporated by reference in their entirety.

[0263] A better understanding of the present invention and of its advantages will be had from the following examples, offered for illustrative purposes only. The examples are not intended to limit the scope of the present invention in any way. The term “example(s)” and “figure(s)” are used interchangeably in this document.

[0264] The invention is further characterized by the following items:An antibody that binds to human serine / arginine repetitive matrix protein 2 (SRRM2) present on the cell surface of a target cell, for use in a method for the treatment of a solid tumor in a human patient.The antibody for the use of item 1 , wherein said solid tumor is characterized by target cells, wherein SRRM2 is present on the cell surface of said target cells.The antibody for the use of any one of the preceding items, wherein SRRM2 present on the cell surface of said target cell is externalized.The antibody for the use of any one of the preceding items, wherein said target cell is a non-permeabilized target cell.The antibody for the use of any one of the preceding items, wherein said target cell is a living target cell.The antibody for the use of any one of the preceding items, wherein said antibody binds to SRRM2 which is externalized on the cell surface of a target cell.The antibody for the use of any one of the preceding items, wherein said antibody binds to SRRM2 on a non-permeabilized target cell.The antibody for the use of any one of the preceding items, wherein said antibody binds to SRRM2 on a living target cell.The antibody for the use of any of the preceding items, wherein the antibody is not an intracellular antibody.The antibody for the use of any one of the preceding items, wherein said solid tumor is a solid adenocarcinoma.The antibody for the use of item 10, wherein said solid adenocarcinoma is pancreatic adenocarcinoma, lung adenocarcinoma, breast adenocarcinoma, colorectal adenocarcinoma, rectum adenocarcinoma, prostatic adenocarcinoma, esophageal adenocarcinoma, gastric adenocarcinoma, adrenal adenocarcinoma, vaginal adenocarcinoma, vulvar adenocarcinoma, bile duct adenocarcinoma, gall bladderadenocarcinoma, salivary gland adenocarcinoma, thyroid adenocarcinoma, duodenal adenocarcinoma, renal adenocarcinoma, urinary bladder adenocarcinoma, ovary adenocarcinoma or endocervical adenocarcinoma.The antibody for the use of any one of the preceding items, wherein the human patient to be treated has a weight of between 16 and 150 kg, preferably 18 to 140kg, more preferably 20 to 130kg, still more preferably 22 to 120kg.The antibody for the use of any of the preceding items, wherein the patient to be treated has a body height between 70 and 220cm, preferably between 80 and 200cm, more preferably between 90 and 200cm.The antibody for the use of any of the preceding items in which the patient to be treated is at least 1 year old, preferably 2 years, more preferably between 2 and 80 years old.The antibody for the use of any of the preceding items, wherein said antibody has cytotoxic activity, preferably antigen-dependent cellular cytotoxicity (ADCC) and / or complement-dependent cytotoxicity (CDC).The antibody for the use of any of the preceding items, wherein said antibody is conjugated with a cytotoxic substance.The antibody for the use of any of the preceding items, wherein said antibody is conjugated with monomethyl auristatin E or exatecan or a derivative or an analog thereof.The antibody for the use of any of the preceding items, wherein said antibody is a bispecific antibody.The antibody for the use of item 18, wherein said bispecific antibody is a T-cell engaging antibody or a NK-cell engaging antibody.The antibody for the use of any one of the preceding items, wherein said antibody is (a) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQID NO: 1 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 2; (b) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 3 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 4; (c) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 6; (d) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 7; (e) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 9; (f) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 11 ; or (g) an antibody which binds to the same epitope as that in the human SRRM2 protein to which the antibody of (a), (b), (c), (d), (e) or (f) binds.The antibody for the use of any of the preceding items, wherein said antibody is an antibody comprising(a) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 13, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 14, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 15, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 16, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 17, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 18;(b) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 19, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 20, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 21 , and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 22, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 23, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 24;(c) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 28, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 29, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 30;(d) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 31, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 32, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 33;(e) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 34, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 35, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 36, and a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 37, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 38, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 39;(f) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 40, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 41, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 42, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 43, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 44, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 45; or(g) an antibody which binds to the same epitope as that in the human SRRM2 protein to which the antibody of (a), (b), (c), (d), (e) or (f) binds.The antibody for the use of any of the preceding items, wherein said antibody is part of a chimeric antigen receptor (CAR).The antibody for the use of item 22, wherein said CAR comprises the heavy chain variable region and the light chain variable region according to any one of the alternatives (a) to (d) of item 20, preferably with a VH to VL orientation.The antibody for the use of item 22, wherein said CAR comprises the heavy chain variable region and the light chain variable region according to any one of the alternatives (a) to (d) of item 21, preferably with the VH to VL orientation.The antibody for the use of any one of items item 22 to 24, wherein said CAR is expressed by a T cell, NK cell, NK-T cell or macrophage.The antibody for the use of any of the preceding items, wherein said antibody is expressed by an autologous cell population.The antibody for the use of any of items 1 to 25, wherein said antibody is expressed by an allogeneic cell population.The antibody for the use of any of the preceding items, wherein the route of antibody administration is intratumoral and / or parenteral, including, but not limited to, intravenous, intradermal, intramuscular, or intraperitoneal administration or any combination thereof.The antibody for the use of any of the preceding items, wherein the method for the treatment of a solid tumor in a human patient comprises, prior to the treatment of the solid tumor, determining whether the target cell of the human patient has SRRM2 protein present on the cell surface.EXAMPLESMaterials and Methods:Cells and antibodies

[0265] Cell lines were grown in DMEM supplemented with 7% FCS at 37 °C in a humified atmosphere with 5% CO2. SKOV-3 (ovarian cancer; ATCC HTB-77), UWB1.289 (ovarian cancer; ATCC CRL-2945), T-47D (breast cancer; ATCC HTB-133), HeLa (cervical cancer; ATCC CCL-2), SkBr3 (breast cancer; ATTCC HTB-30) and Capan-1 (pancreatic cancer; ATCC HTB-79) were obtained from ATCC; PCI-1 is a human hypopharyngeal cancer cell line and a kind gift from Prof. T. Whiteside (Pittsburgh, PA). The generation of HAP1 cell lines carrying GFP-tagged SRRM2 mutants has been described recently (llik et al., 2020). Primary PBMCs from anonymized volunteer blood donors were purchased from the Division of Transfusion Medicine of the LMU University Hospital Munich after informed consent of the donors. Primary hepatocytes were obtained from HTCR Services GmbH (Munich, Germany). The following primary antibodies were used: EpCAM (clone C21520; a kind gift of Dr. H. Lindhofer, Munich), SRRM2 (Abeam; clone 122719, Biozol; catalog no. 9206; Invitrogen; clone PA5-6682, and Sigma Aldrich; clone SC-35). CD3, CD4, CD8, CD45 and CD63-HRP antibodies were purchased from Thermo Fisher Scientific (Darmstadt, Germany). The anti-HIS antibody and isotype control antibody were obtained from the Core Facility Monoclonal Antibodies, Helmholtz Munich. Fluorochrome and HRP-labeled secondary antibodies were purchased from Jackson ImmunoResearch (Cambridgeshire, UK).Generation of antibodies

[0266] A Lou / c rat was immunized with a mixture of extracellular vesicles, which were derived from SKOV-3, Capan-1, T-47D and HeLa cells and isolated from conditioned supernatants by serial centrifugation. Briefly, conditioned FCS-free supernatants were collected, subjected to repeated centrifugations at increasing centrifugal force (10 min at 300 x g, 4 °C, and 20 min at 5,000 x g, 4 °C), filtrated (pore size 0.45 pm) and finally precipitated at 100,000 x g, 4 °C in a SW28 rotor. Pelleted vesicles were resuspended in 100 pl of PBS and injected i.p. and s.c. with CpG as adjuvant. A boost injection was given five months later, and spleen cells were fused with myeloma cell line P3x63Ag8.653 (ATCC, CRL-1580). Hybridoma supernatants were screened ten days later for IgG production, and positive clones were further expanded and subcloned at least twice by limiting dilution to obtain stable monoclonal cell lines. Theseexperiments resulted in the antibodies 13F11, 23A7, 18A4, 18A4-2, 14B6, and 24A6 (all rat lgG2b).Immunoblottinq

[0267] Cells were lysed in ice-cold RIPA lysis buffer (0.1% SDS, 50 mM Tris-HCI pH 8.0, 0.5% DOC, 1% NP-40, 150 mM NaCI) and protease inhibitors (Roche, Penzberg, Germany). After 20 min of incubation on ice lysates were centrifuged at 14,000 rpm for 20 min at 4 °C. The supernatant was transferred to a new tube, and the protein concentrations were measured with a Bradford protein assay (Bio-Rad Laboratories, Munich, Germany). 20 pg of each cell lysate were resolved on 6-10% bis-tris / acrylamide gels, blotted onto nitrocellulose membrane (GE Healthcare), followed by blocking for 1 h in 5% non-fat milk and an incubation with primary antibodies at 4 °C under constant shaking overnight. The membrane was washed in TBS / 0.05% Tween-20, incubated with HRP-coupled secondary antibodies at room temperature for 2 h and finally developed with ECL. Signals were quantified on a Vilber Fusion FX6 (Marne-la-Vallee, France).Immunoprecipitation

[0268] Immunoprecipitations were performed using activated CNBr beads (Sepharose 4 Fast Flow, GE Healthcare). 0.5 g beads were solved in 5 ml 1mM HCI and incubated at RT for 20 min. Beads were centrifuged at 3,000 x g for 1 min and washed 15 times. A subclass-specific mouse anti-rat lgG2b antibody (TIB 174 / RG7 / 11.1 , ATCC) was coupled to the beads (2mg antibody in coupling buffer 0.3 M NaHCOs, 1.5 M NaCI, pH 8.3) at RT for 1 h After that, beads were washed in coupling buffer and all unspecific binding sites were blocked with ethanolamine (1 M) at RT for 2 h. After washing in wash buffer (100 mM T ris / HCI, 0.5 M NaCI, pH 4.0) and in NaOAc buffer (0.1 M NaOAc, 0.5 M NaCI), beads were resuspended in PBS and used for coupling with e.g. 23A7 (EX-02) or isotype control antibodies. Therefore, 500 pl hybridoma supernatants were incubated with 60 pl anti-subclass specific beads at 4 °C overnight. Antibody-coupled beads were washed in PBS and incubated with 1 mg cell lysate at 4 °C overnight, then washed trice in RIPA buffer with protease inhibitors. Finally, beads were pelleted by centrifugation, the supernatants were discarded, and beads were resuspended in 3x Laemmli buffer. After a final centrifugation at 1 ,000x g for 5 min, the supernatant was used for PAGE and Western blot analysis.

[0269] Pull-down of truncated SRRM2 proteins and immunoblotting were carried out using whole-cell lysate prepared from respective HAP1 cell lines (as published in llik et al., 2020). ~10 million cells were resuspended with 600 pl of 1x NLB + 1x complete Protease InhibitorCocktail + 1x PhosSTOP, and kept on ice for 15 min. The lysate was cleared by centrifugation at -20,000 ref for 10 min at 4°C. Clarified lysate was split into two tubes; to one tube 25 pl (slurry) of GFP-trap agarose beads were used (Chromotek, Munich, Germany), incubations were carried out overnight in the cold-room. Bound proteins were eluted with 50 pl of 1xLDS sample buffer (Thermo Fisher Scientific, NP0007) + 100 mM beta-mercaptoethanol at 80 °C for 10 min and run on 3-8% Tris-acetate gels (Thermo Fisher Scientific, EA0375PK2). Gels were run at 80V for 3 h and transferred onto a PVDF membrane in Tris-Glycine buffer for 90 min at 90V. Antibody incubations were done at 4 °C overnight.Mass spectrometry

[0270] Eluted proteins from IPs were proteolyzed with LysC and trypsin with filter-aided sample preparation procedure as described (Grosche et al., 2016). Acidified eluted peptides were analyzed on a Q Exactive HF mass spectrometer (Thermo Fisher Scientific, Waltham, MA, USA) in the data-dependent mode. Approximately 0.5 pg peptides per sample were automatically loaded to the online coupled ultra-high-performance liquid chromatography (UHPLC) system (Ultimate 3000, Thermo Fisher Scientific). A nano trap column was used (300-pm ID X 5 mm, packed with Acclaim PepMap100 C18, 5 pm, 100 A; LC Packings, Sunnyvale, CA) before separation by reversed phase chromatography (Acquity UHPLC M-Class HSS T3 Column 75 pm ID X 250 mm, 1.8 pm; Waters, Eschborn, Germany) at 40 °C. Peptides were eluted from the column at 250 nL / min using increasing ACN concentration (in 0.1% formic acid) from 3% to 41% over a linear 95-min gradient. The normalized collision energy was 27, and the spectra were recorded in profile mode.

[0271] The raw files were loaded to the Progenesis QI software (version 4.1, Waters) for label free quantification and analyzed as described in Hauck etal., 2010; Merl et al., 2012. MS / MS spectra were exported as Mascot generic file and used for peptide identification with Mascot (version 2.4, Matrix Science Inc., Boston, MA, USA) in the SwissProt Human protein database (release 2017_02, 20237 sequences). Search parameters used were as follows: 10 ppm peptide mass tolerance and 0.6 Da fragment mass tolerance, one missed cleavage allowed, carbamidomethylation was set as fixed modification, methionine oxidation and asparagine or glutamine deamidation were allowed as variable modifications. A Mascot-integrated decoy database search was included, and peptide assignments were filtered for a Mascot percolator ion score cut-off of 13 and a significance threshold of p < 0.01. Peptide assignments were reimported into the Progenesis QI software, and the abundances of all unique peptides allocated to each protein were summed up. The resulting normalized abundances of the individual proteins were used for calculation of fold-changes of protein ratios between eluates from theantibodies and an isotype control. Proteins with at least 2 unique peptides and spectral counts in the antibody IP and no spectral counts in the isotype control were considered.Flow Cytometry

[0272] For flow cytometric analysis of SRRM2 expression, cells were stained with either of the three SRRM2-specific antibodies in FACS-Buffer (PBS + 2 % FSC) or with an isotype control antibody for 20 min followed by staining with an anti-rat-Alexa Fluor® 647 secondary antibody (Jackson Immuno Research). All stainings were performed on ice.Generation of SRRM2 knockout cells

[0273] SRRM2-specific CRISPR-RNAs (crRNA) were designed with a freely available online tool (IDT). Each of those different specific crRNAs were fused to a transactivating RNA (tracrRNA) building a guideRNA (gRNA), which was then complexed with CAS9 Nuclease. Individual complex-combinations were introduced into A549 lung cancer cells by electroporation using a 4D-Nucleofector Protocol from Lonza. Electroporated cells were analyzed by Fluorescence Activated Cell Sorting (FACS) one week later for binding of SRRM2 antibodies 13F11, 18A4 and 23A7. Cell clones were generated by sorting and limited dilution cloning. Finally, clones were re-analyzed by FACS. Identified knockout clones were then checked by screening for CRISPR / CAS9 mediated mutation. Therefore, genomic DNA from parental cells and knockout clones were isolated, sequenced and compared to the wildtype sequence.

[0274] In a further experiment SKOV-3 SRRM2 knock-out cells were established as described above for A549 cells. Using FACS the binding of the SRRM2 antibody 23A7 to SKOV-3 KO cells and SKOV-3 wildtype cells were analyzed.

[0275] The following gRNA were used:

[0276] Hs.Cas9.SRRM2.1.AC: AGGATTAGGCCGCTTCACCA (SEQ ID NO: 46) and Hs.Cas9.SRRM2.1.AQ: GTAAGAATCACTGATGCCAA (SEQ ID NO: 47).Confocal Microscopy using SRRM2 specific antibody 18A4

[0277] 1 x 105UWB1.289 human ovarian cancer cells were seeded on cover slips and grown over night. The medium was removed, and cells were washed with PBS and blocked with 3% BSA in TBS with 0.1% Tween 20. For staining, cells were incubated with the 1st antibody, diluted in TBS with 1% BSA and 0.1% Tween 20 for 1 hour at room temperature. Then, cells were washed three times before incubation with the secondary antibody (goat anti-rat-Alexa647) in the dark for 40 min. After additional washing steps the cells were fixed in 4% PFA for 10 min, permeabilized with PBS containing 0.3% Tween20 and washed. After a final washing step, nuclei were stained with DAPI (diluted 1:10,000) for 10 minutes, a mounting medium (Vectashield) was added, and cover slips were mounted upside-down on microscope slides. Slides were analyzed on a Leica SP8X STED microscope using the Leica LAS X software. The 1st antibody used were the SRRM2-specificic antibody 18A4 or the membrane protein CD47 specific antibody 18F10.Confocal microscopy using SRRM2 specific antibody 23A7 and commercially available SRRM2 specific antibodies

[0278] Capan-1, HeLa, UWB1.289, and A549 cells were plated on a cover slips in 12-well plates in normal media over night to 70% confluency. The cells were washed once with PBS, fixed using 4% PFA for 10 min followed by a permeabilization step with 0.3% Triton-X 100 for another 10 min. Antigen blocking was performed with 3% bovine serum albumin (BSA) in PBS for 40 min. All further antibody dilutions were prepared in PBS containing 1% BSA and 0.1% Triton-X 100. Subsequently, cells were incubated for 1 h with 23A7 antibody, Abeam antibody #122719, or polyclonal Biozol antibody (MBS9609206) (diluted to 1 pg / ml) and for surface staining either with EpCAM clone C215, diluted to 1 pg / ml, or CD49c (Santa Cruz, Heidelberg; clone sc13545, diluted 1:250) antibodies. The sample was then washed three times followed by an incubation for 1 h with the following secondary antibodies: goat anti-rat Alexa Fluor 647 antibody (Thermo Fisher, #A78947, 1 pg / ml), goat anti-mouse Alexa Flour 488 antibody (Thermo Fisher, #A-11001, 1pg / ml) and DAPI (diluted 1:10,000). After washing four times, cover slips were mounted using PoLong Gold antifade mountant (Thermo Fisher, #P36930) Cells were imaged with a Leica TCS SP8 laser scanning microscope system. For surface staining, cells were first blocked, afterwards fixed and permeabilized as described above. Afterwards an extra staining step with DAPI (diluted 1:10,000) was performed for 10 min.Immunohistochemistry

[0279] Paraffin sections of bile duct cancer, ovarian cancer, pancreatic cancer, stomach cancer and cancer-adjacent tissue were mounted onto superfrost plus slides. After fixation in acetone, slides were incubated with the primary antibody 13F11 followed by an incubation with a suitable biotinylated secondary antibody. Slides were developed with 0.01% 3-amino-9-ethylcarbazole (AEC) as chromogen. After counterstaining with hematoxylin, slides were cover-slipped with Kaiser’s glycerol gelatine. IHC staining and scoring were evaluated by a trained pathologist.Immunohistochemistry using a multi-organ tissue chip

[0280] A multi-organ tissue chip was used. The multi-organ normal tissue combination chip (Mu FDA 1021a) included 98 samples representing 33 types of tissues and organs, such as the esophagus, stomach, small intestine, colon, liver, pancreas, appendix, tongue, salivary gland, lung, testis, prostate, breast, ovary, endometrium, cervix, kidney, bladder, tonsil, lymph node, thymus, spleen, skin, artery, mesothelium, skeletal muscle, peripheral nerve, cerebellum, cerebrum, eye, adrenal gland, thyroid gland, and heart, with 3 samples from each organ. Out of the total 98 samples analyzed, 79 were labelled as normal tissue, and 19 were labelled as cancer-adjacent tissue. The tissue was formalin fixed. The slides were baked at 60 °C for 30 minutes before conducting the experiment. The slides were deparaffinized to water using xylene and ethanol and washed with distilled water for 3 minutes. Antigen retrieval was performed with EDTA (pH 9.0) under high pressure for 2.5 minutes, endogenous peroxidase was inhibited with 3% H2O2 at room temperature for 10 minutes and the tissues was blocked with goat serum for 30 minutes. The EX-02 (23A7) antibody (1:2,000 diluted) was incubated at 37 °C for 1 hour, the tissue was washed with PBS for 2 minutes x 5 times and the secondary antibody (HRP-labelled goat anti-mouse / rabbit IgG polymer) was incubated at 37 °C for 30 minutes. The tissue was washed as before, followed by a DAB staining for 2 minutes, a Counterstain with hematoxylin for 1 minute, a differentiation with hydrochloric acid ethanol for 5 seconds, and blue in tap water for 2 minutes. The slides were dehydrated with graded ethanol, cleared in xylene, and mounted with neutral gum. The stained tissue was analyzed by a trained pathologist using a microscope.SRRM2 His fusion protein

[0281] HEK293 cells were transiently transfected with an expression plasmid encoding AA 1889-2150 of SRRM2 as a His fusion protein (herein referred to as trO4-His). 48 h later, cells were lysed in urea buffer (8 M urea, 0.1 M NaH2PO4, 10 mM Tris-HCI, 0.05% Tween-20, 20 mM imidazole and centrifuged at 4,500 rpm for 10 min. Supernatants were incubated with Ni-NTA agarose beads (Qiagen, Germany) overnight. The suspension was again centrifuged at 2,000 rpm for 5 min, and the supernatant was discarded. Beads were washed twice in lysis buffer and proteins were finally eluted with lysis buffer containing 0.5 M imidazole and stored at -20 °C.CAR design and viral vector production

[0282] Sequences of the rat-derived SRRM2-specific antibodies 13F11 and 23A7 were synthesized in VH^VL and VL^VH orientations and cloned into a lentiviral expression vector carrying a 2ndgeneration CAR backbone with 4-1BB / CD137 and CD3- transactivationdomains. The integrity of the CAR was confirmed by sequencing. Lentiviral vectors were produced by co-transfecting HEK293 cells with VSV-G envelope; GAG-Pol packaging factors, and Rev plasmids. Supernatants were harvested 72 h later, filtered, concentrated by centrifugation, tested on HEK293 cells to calculate the titer of infectious virus, and finally cryopreserved.Manufacturing and in vitro testing of CAR T-cells

[0283] Fresh or thawed PBMCs were resuspend in PRIME-XV medium (Fujifilm, USA). Cells were counted and adjusted to 2.0x106 / ml. Anti-CD3 (Miltenyi Biotec, Bergisch-Gladbach; Germany) and anti-CD28 (Miltenyi) antibodies were added to a final concentration of 100 ng / ml, and cells were cultured with IL-7 and IL-15 (AcroBiosystems, Beijing, China) both at final concentrations of 10 ng / ml at 37 °C for 24 h. EX-02 CAR lentiviral vector (Genscript, Nanjing, China) was added at a calculated multiplicity of infection (MOI) of 5.0. Medium was replaced by PRIME-XV medium containing IL-7 and IL-1524 h later, and the cell concentration was adjusted to 0.8x106 / ml. After four days of culture, samples were analyzed by flow cytometry using a BD Canto (BD Biosciences, Heidelberg, Germany) and analyzed using FlowJo (Tree Star, Ashland, OR). CD3, CD4, CD8, CD45 antibodies (Thermo Fisher Scientific) were used to characterize the human T-cell population; CAR expression on transduced cells was detected with an anti-rat IgG (H+L) F(ab')2fragment Alexa647 (#712-606-150; Jackson ImmunoResearch). Cells were harvested on day six of culture and used for functional assays.

[0284] For this, 50,000 adherent cancer target cells per well were seeded into E-plate 16 chambers, and SRRM2 specific CAR-T or mock-T cells were added 24 h later. Target cell lysis was continuously measured with a xCELLigence live cell analysis system (OMNI Life Science, Bremen, Germany). Alternatively, target cells and T cells were mixed in 96-well plates and incubated for 48 h. Afterwards, the supernatants were collected and IFN-y and IL-2 concentrations were measured with ELISA Flex human (ALP) kits (Mabtech, Nacka Strand, Schweden) and dead target cells were identified with Zombie Green (Biolegend, Amsterdam, The Netherlands), according to the manufacturer’s protocol.Preparing antibody-drug conjugates (ADC)

[0285] The SRRM2 specific antibody 23A7 was diluted with a buffer to a concentration of 5-20 mg / mL, a reducing agent in 1-16 times molar equivalent of the antibody was added and reacted in a water bath or ice bath at 0-37°Cfor 1-24 hours. Then one of a toxin linker VcM MAE or Deruxtecan in 10 times molar equivalent was added and reacted in a water bath or ice bath at 0-37°C for 1-24 hours to obtain the product. The purity was measured with SEC-HPLC, andthe DAR (drug-antibody-ratio) was confirmed by RP-PLC or HIC-HPLC. The following toxinlinkers were used: a) VcMMAE (Art.-No.: HY-15575) is the tubulin inhibitor monomethyl auristatin E (MMAE) linked via the lysosomally cleavable dipeptide, valine-citrulline (vc); b) Deruxtecan (Art.-No.: HY-13631E) is an ADC drug-linker conjugate composed of an DX-8951 derivative (DXd) and a maleimide-GGFG peptide linker.Xenograft model used for ADC experiments

[0286] 5-6 weeks old Balb / c nude mice were inoculated with 5 * 106BxPC-3 or BxPC-3-luc pancreatic cancer cells injected subcutaneously into the right lateral abdominal wall. After modeling, the body weight and tumor diameter were measured 2-3 times a week till the average tumor volume reached approximately 100-200 mm3. Mice were randomly divided into groups based on tumor volumes and were intravenously administrated with the drugs accordingly. Mice were observed 2-3 times per week for living conditions, body weight and measuring the tumor size to monitor the changes of tumors. 5-6 animals were used in each treatment group, wherein the treatment groups were PBS (negative control), Deruxtecan linked to an isotype antibody (8.29 mg / kg or 10 mg / kg) (negative control), MMAE (0.346 mg / kg (= 10mg / kg ADC conjugated MMAE)) (negative control), 23A7 antibody linked to VcMMAE (two groups: 1 mg / kg, 10 mg / kg or three groups: 2.5 mg / kg, 5 mg / kg, 10 mg / kg), and 23A7 antibody linked to Deruxtecan (two groups: 1 mg / kg; 10 mg / kg). The tumor volume was estimated by measuring the length and width of a tumor using calipers. The tumor volume was calculated with the equation V = 0.5 x [_ * W2, where V is the tumor volume, L is the tumor length, and W is the tumor width.Xenograft studies (Luc cells)

[0287] Female NOG mice, SPF grade, were purchased from Beijing Charles River Laboratory Animal Technology Co., Ltd. (experimental unit license number 110011231110590332). Mice were raised in the facility of Ruiye Model Animal (Guangzhou) Biotechnology Co., Ltd. (experimental animal use license number SYXK (Guangdong) 2020-0218). The design of the experimental study was approved by the Laboratory Animal Ethics Committee of Ruiye Model Animal (Guangzhou) Biotechnology Co., Ltd. (approval number: RYEth-20231026384). BxPC-3-luc cells and SKOV-3-luc cells, purchased from Guangzhou Yuanjing Biotechnology Co., Ltd., were cultured in DMEM with 10% FBS. Cells were counted, resuspended in DMEM and 300,000 cells per mouse were injected intraperitoneally in a final volume of 100 pl. No toxicity related to the SRRM2 specific CAR-T cells was observed, i.e. body weight, habitus and behavior were normal. Additionally, macroscopic post-mortem inspections did not reveal any indication for tissue and organ damage. Tumor growth rates were monitored by longitudinalmeasurements of whole-body bioluminescence signals using the IVIS Lumina Series III imaging system equipped with a camera box and warming stage (PerkinElmer Inc., Waltham, MA, USA). Briefly, mice were anesthetized with isoflurane and fixed in the imaging chamber.3 mg / mouse of D-Luciferin potassium salt (#122799; PerkinElmer Inc.) were injected intraperitoneally 17 min before imaging check. Total flux values were determined from the regions of interest (ROI) covering the entire abdomen of each mouse and were presented in photons (p) / second (sec), using Living Image software (PerkinElmer Inc., Boston, MA, USA).Experimental examplesExample 1: Generation of monoclonal antibodies binding to SRRM2Example 1a: Generation of monoclonal antibodies

[0288] From the immunization of a rat with a mixture of EVs isolated from the conditioned supernatants of SKOV-3, Capan-1, T-47D and HeLa cells, representing four major types of cancer, we obtained a series of hybridomas that we first tested by flow cytometry for binding to the cell lines of origin (data not shown). We identified hybridomas which bound to one, two or even all three cell lines, and these hybridomas were selected for more detailed investigations. Any one of the antibodies 13F11, 23A7, 18A4, and 18A4-2 was coupled to activated cyanogen bromide beads and incubated with lysate of ovarian cancer cell lines at 4 °C overnight. The next day, beads were precipitated by centrifugation, the bound proteins were eluted in Laemmli buffer and analyzed by mass spectrometry. Three independent experiments revealed confidence scores of >60, and enrichments of precipitated SRRM2 by factors of 1824.2, 182.6 and 40.8 as compared to precipitation with an isotype control antibody (see Fig. 1). The heavy and light chain sequences and the CDR sequences of the antibodies 13F11, 23A7, 18A4, 18A4-2, 14B6 and 24A6 are mentioned in Table 1 and in the sequence listing.Example 1b: SRRM2 antibody binds to SRRM2 from cancer cells in an immunoblot

[0289] Immunoblots with lysates from different cancer cell lines (Capan-1, SkBr-3, HeLa, SKOV-3, T-47D, and UWB1.289) substantiated the assumed specificity of 23A7 as it gave a specific signal at approximately 300 kDa, corresponding to the expected size of SRRM2 (Fig.2). Interestingly, the antibody also detected a minor band of approximately 200 kDa in size, pointing to the existence of different SRRM2 isoforms present in cancer cell lines at various ratios.Example 1c: Detection of SRRM2 on the surface of non-permeabilized cancer cells

[0290] Cells of the cancer cell lines MDA-MB231, MCF7, TOV, UWB1.289, U138, Capan-1, PANC-1, UD3, THP-1, HT-29, U-87, HeLa, Hep-G2, and Jurkat were incubated with 13F11 (solid lines in Fig. 3A, 3B) or an isotype control antibody (dotted line in Fig. 3A, tinted histogram in Fig. 3B). Furthermore, cells of the cancer cell lines T-47D, Capan-1, HeLa, SkBr-3, SKOV-3, and UWB1.289 and the normal hepatocytes and PBMCs were incubated with the 23A7 antibody (solid lines in Fig. 3C, 3D) or an isotype control antibody (tinted histogram in Fig. 3C, 3C). Cells were then washed and incubated with an Alexa647 labeled anti-rat IgG antibody. Fluorescence was then measured by flow cytometry on a FACS Canto. All the tested cancer cells expressed SRRM2 on their cell surface binding the SRRM2 specific antibodies 13F11 and 23A7. However, normal non-cancerous cells do not express SRRM2 on their cell surfaces as shown for normal hepatocytes and PBMCs.Example 1d: Binding of SRRM2 antibody is prohibited in a SRRM2-KO cancer cell lines

[0291] To further verify the binding specificity of the SRRM2 antibodies, two SRRM2 knockout cancer cell lines were established and the binding of the SRRM2 antibody tested using flow cytometry.

[0292] In a first experiment A549 human lung cancer cells were transfected with a ribonucleoprotein complex consisting of SRRM2-specific gRNAs and Cas9 protein. Seven days later, binding of the antibodies to knockout and wildtype cells was compared by flow cytometry. For this, A549 Wildtype (bold line) and the A549 SRRM Knockout line #25 (tinted histogram) were incubated with any of the three antibodies 13F11, 18A4 and 23A7. Cells were washed and then incubated with an Alexa647 labeled anti-rat secondary antibody. Fluorescence was then measured on a FACS Canto. An isotype control antibody was included as a negative control (dotted line). Reduced fluorescence intensity of line #25 indicates the specificities of the antibodies for SRRM2 (see Fig. 4a).

[0293] In a second experiment SKOV-3 ovarian adenocarcinoma cells were transfected with a ribonucleoprotein complex consisting of SRRM2-specific gRNAs and Cas9 protein. Seven days later, binding of the antibody 23A7 to knockout and wildtype cells was compared by flow cytometry. For this, SKOV-3 Wildtype and the SKOV-3 SRRM2 Knockout cells were incubated with the 23A7 antibody (black line). Cells were washed and then incubated with an Alexa647 labeled anti-rat secondary antibody. Fluorescence was then measured on a FACS Canto. An isotype control antibody was included as a negative control (grey tinted histogram). Reducedfluorescence intensity of the SKOV-3 SRRM2 KO cells indicates the specificities of the antibodies for SRRM2 (see Fig. 4b).

[0294] In a third experiment SKOV-3 ovarian adenocarcinoma cells were transfected with a ribonucleoprotein complex consisting of SRRM2-specific gRNAs and Cas9 protein, followed by single-cell cloning. Seven days later, binding of the antibodies to knockout and wildtype cells was measured by flow cytometry. For this, SKOV-3 Wildtype (bold line) and a SKOV-3 SRRM2 knockout cells (dotted line) were incubated with the antibodies 13F11, 18A4, 23A7, 14B6, or 24A6. Cells were washed and then incubated with an Alexa647 labeled anti-rat secondary antibody. Fluorescence was then measured with a FACS Canto cytometer. An isotype control antibody was included as a negative control (tinted histogram). Reduced fluorescence intensity of the SKOV-3 SRRM2 KO cells indicates the specificities of the antibodies for SRRM2 (see Fig. 4c).Example 2: SRRM2 is expressed on the surface of cancer cells, but not normal cells Example 2a: Binding to SRRM2 on the surface of cells of cancer cell lines

[0295] A first experiment shows that the SRRM2 specific antibody 18A4 binds to cell surface SRRM2. UWB1.289 human ovarian cancer cells were co-stained with the SRRM2-specific antibody 18A4 and antibody 18F10, specific for the membrane protein CD47. The cancer cells were grown on microscope slides, washed in PBS, and incubated with the antibodies. Incubation with the antibodies prior to fixation secures that cells were vital and thus that the antibody bound to intact cells. Then, cells were fixed with 4% paraformaldehyde and again incubated with an Alexa647-coupled suitable anti-rat IgG secondary antibody. After fixation, cells were analyzed by confocal fluorescence microscopy. Nuclei were counter-stained with DAPI. The white color in the merged pictures indicates co-localization of both antibodies (see Fig. 5A). Thus, the antibody 18A4 bound to SRRM2 which were presented at the surface of the tested cancer cells as revealed by co-localization with the cell membrane protein CD47.

[0296] A second experiment shows that only the SRRM2 specific antibody 23A7 and not two commercially available SRRM2 antibodies binds to cell surface SRRM2. In a first series Capan-1, HeLa, UWB1.289, and A549 cells were grown on cover slips washed in PBS, and incubated with the antibodies Then, cells were fixed with 4 % paraformaldehyde and again incubated with an Alexa647-coupled suitable anti-rat IgG secondary antibody. After fixation, cells were analyzed by confocal fluorescence microscopy. Nuclei were counter-stained with DAPI. Thus, vital living cells were stained. In this first series it is clearly visible that only the 23A7 antibody and not the commercially available SRRM2 antibodies is able to bind to SRRM2on living cells, namely at the surface of the cells (Fig. 5B, part A). Since the commercially available antibodies were described as suitable for immunofluorescence microscopy, the cells were in a second series fixed and permeabilized prior to the addition of the antibodies.

[0297] In a second series Capan-1, HeLa, UWB1.289, and A549 cells were grown on cover slips washed in PBS, fixed with 4 % paraformaldehyde and permeabilized. After that the cells were incubated with the antibodies, nuclei counter-stained and analyzed by confocal fluorescence microscopy. The cells of the second series were permeabilized and thus not living cells. In the case permeabilized cells were used, the commercially available antibodies were able to enter the cell and stained SRRM2 present in the cell nucleus, but not the SRRM2 present on the cell surface (Fig. 5B, part B). Interestingly, the SRRM2 antibody 23A7 only bound to cell surface located SRRM2 in permeabilized cells. To conclude, the antibodies binding to the SRRM2 residing at the cell surface binds to a different epitope on SRRM2 than the commercially available antibodies tested, which epitope is not accessible in cell surface located SRRM2. In turn it seems that the antibodies binding to cell surface located SRRM2 do not or only barely bind to SRRM2 located in the cell nucleus of permeabilized cells.Example 2b: Commercially available SRRM2 antibodies did not bind to cell surface located SRRM2 of cancer cell lines

[0298] To further show that commercially available antibodies are not able to bind to cell surface located SRRM2 HeLa cells were incubated with the 23A7 antibody of the invention and the commercially available SRRM2 antibodies Sigma #S4045 (SC35), Abeam #122719, Invitrogen #PA5-66827, or Biozol #9206, washed, and then incubated with suitable Alexa647-labeled secondary antibodies. Binding was measured by flow cytometry. SRRM2 = black line; isotype control = tinted grey histogram. It is clearly shown that the commercially available SRRM2 antibodies tested were not able to bind SRRM2 present on the surface of HeLa cells, whereas the 23A7 antibody binds to cell surface located SRRM2 (Fig. 6A).

[0299] In a further experiment using the same method human A549 cells were analyzed by flow cytometry for the binding of the antibody 13F11 of the invention and the commercially available SRRM2 antibodies Sigma #S4045 (SC35), Abeam #122719, Invitrogen #PA5-66827, and Biosource #MBS9609206 as indicated above each corresponding histogram in Fig. 6B. Antibody application (black lines) was compared with a suitable isotype control antibody (gray lines), followed by incubation with a suitable Alexa-647 labelled secondary antibody (Fig. 6B). Only the antibody 13F11 achieved binding to cell-surface localized SRRM2 on living human cells in this experiment.Example 2c: SRRM2 is expressed on the cell surface of human cancer tissue.

[0300] Different human cancer tissues were stained using the IHC method with the 18A4 antibody to further show the expression of SRRM2 on the cell surface of cancer cells.

[0301] FFPE cancer tissues and cancer adjacent normal tissues from different locations (ovary, bile duct, pancreas, stomach, lung) were stained with 18A4 antibody, followed by incubation with a rat-specific secondary antibody coupled with HRP. Tissues were inspected by a trained pathologist and staining intensity was scored from 0 (negative) to 3+ (strong expression on the majority of cells). Of the ovarian cancer tissue 7 of 10 samples showed a moderate to strong (2+, 3+) expression of SRRM2 on the cell surface, whereas samples of the cancer-adjacent tissue showed no SRRM2 expression on the cell surface. Of the bile duct cancer tissue 9 of 11 samples showed a moderate to strong (2+, 3+) expression of SRRM2 on the cell surface, whereas all samples of the cancer-adjacent tissue showed no SRRM2 expression on the cell surface. Of the pancreatic duct cancer tissue 7 of 11 samples showed a moderate to strong (2+, 3+) expression of SRRM2 on the cell surface, whereas all samples of the cancer-adjacent tissue showed no SRRM2 expression on the cell surface. Of the gastric cancer tissue 7 of 9 samples showed a moderate to strong (2+, 3+) expression of SRRM2 on the cell surface, whereas 8 of 9 samples of the cancer-adjacent tissue showed no SRRM2 expression on the cell surface. Of the lung cancer tissue all of 15 samples showed a moderate to strong (2+, 3+) expression of SRRM2 on the cell surface. Among which, 3 samples were from squamous cell carcinoma of the cancer, showing 2 moderate and 1 strong cell surface expression; while the other 12 strong expression were all adenocarcinoma. The cell membranes of the lung tissue adjacent to the cancer in these cases were typically negative. The results are shown in Fig. 7A-7G. To conclude, most of the human cancer tissue analyzed had SRRM2 localized at the cell surface, whereas mostly the cancer-adjacent tissue showed no SRRM2 staining at the cell surface.

[0302] In a second study, the SRRM2 specific antibody 23A7 was used for IHC staining of human cancer tissue and cancer-adjacent tissue as mentioned above. Of the breast cancer tissues all 12 samples showed a moderate to strong (2+, 3+) expression of SRRM2 on the cell surface, whereas 4 of 5 samples of the cancer-adjacent tissue showed weak to negative SRRM2 expression on the cell surface. Of the NPC tissues 13 of 16 samples showed a moderate to strong (2+, 3+) expression of SRRM2 on the cell surface, whereas 7 of 8 samples of the cancer-adjacent tissue showed weak to negative SRRM2 expression on the cell surface. Of the NSCLC tissues all 6 samples showed a moderate to strong (2+, 3+) expression ofSRRM2 on the cell surface, whereas all 6 samples of the cancer-adjacent tissue showed weak to negative SRRM2 expression on the cell surface. Of the SCLC tissues 3 of 8 samples showed a moderate to strong (2+, 3+) expression of SRRM2 on the cell surface. Here the cancer adjacent tissues were not available for analysis. Of the cervical cancer tissues 13 of 17 samples showed a moderate to strong (2+, 3+) expression of SRRM2 on the cell surface, whereas all 5 samples of the cancer-adjacent tissue showed weak to negative SRRM2 expression on the cell surfaceExample 2d: SRRM2 is not expressed in normal human tissue

[0303] To further analyze if SRRM2 is expressed on the cell surface of normal and tumor adjacent tissue IHC staining of tissue of a multi-organ tissue chip was performed using the SRRM2 specific antibody 23A7. The multi-organ tissue chip comprised 98 samples representing 33 types of tissues and organs, such as the esophagus, stomach, small intestine, colon, liver, pancreas, appendix, tongue, salivary gland, lung, testis, prostate, breast, ovary, endometrium, cervix, kidney, bladder, tonsil, lymph node, thymus, spleen, skin, artery, mesothelium, skeletal muscle, peripheral nerve, cerebellum, cerebrum, eye, adrenal gland, thyroid gland, and heart, with 3 samples from each organ. Out of the total 98 samples analyzed, 79 were labelled as normal tissue, and 19 were labelled as cancer-adjacent tissue. The IHC staining was analyzed by a pathologist. From the 79 normal tissue samples 67 samples (84.8%) showed no expression of SRRM2 on the cell surface, namely the organs and tissues of stomach, colon, liver, pancreas, appendix, oral cavity tongue, oral cavity salivary gland, lung, testis, prostate, kidney, bladder, lymph node, thymus, spleen, skin, skeletal muscle, blood vessel, pericardium, peripheral nerve, cerebellum, cerebrum, eye, adrenal gland, thyroid gland, and heart. From the 79 normal tissue samples only one sample (1.27%) of a bladder tissue showed a SRRM2 staining at the cell surface and 11 samples (13.93%) scored 0 to 1 + with a weak or incomplete staining at the cell membrane. Thus, weak or incomplete staining was detected at the following samples: Esophagus: 3 / 3 (1+, 1+, 1+), Oral cavity tongue: 1 / 3 (0), Lung: 1 / 3 (1 +), Prostate: 1 / 3 (in stroma, 1 +), Bladder: 2 / 3 (1+, 3+), Kidney: 1 / 3 (1 +), Spleen: 2 / 3 (0, 0), Skeletal Muscle: 1 / 3 (0). Of the cancer-adjacent tissue 31.6% showed SRRM2 expression on the cell membrane (6 / 19 samples scored 2+ or 3+), 26.3% showed very low and weak staining of SRRM2 (scored 0 to 1 +), 42.1% showed no SRRM2 staining. In detail the following cancer-adjacent tissue was analyzed breast: 2 / 2 (0, 2+), endometrium: 3 / 3 (0, 2+, 3+), tonsil: 3 / 3 (0, 1+, 2+), and cervix: 3 / 3 (0, 2+, 3+). To conclude, normal human tissue cells in general does not have SRRM2 on their surface. In cancer-adjacent cell tissue the results are mixed with 31.6% of the cancer-adjacent tissue samples having SRRM2 on their tissue cell surface. While the cancer-adjacent tissue samples did not exhibit overt tumorcharacteristics, their proximity to cancerous regions suggests potential proteomic alterations, as referenced in studies by Bahmad et al., 2021, differentiating them from truly normal tissues. The observed expression in cancer-adjacent tissues or peritumoral tissues may not represent normal physiological conditions.Example 2e: SRRM2 is not expressed in normal monkey tissue

[0304] To further verify that SRRM2 is not expressed on the surface of normal tissue cells FFPE normal tissue samples of two healthy Cynomolgus monkey were IHC stained using the 18A4 antibody and a goat anti-rat IgG antibody coupled to HRP (ImmPRESS HRP Peroxidase detection kit; https: / / vectorlabs.com / products / enzymepolymer / immpress-hrp-goat-anti-rat-igg-kit). As shown in Figure 8 all tissue samples stained negative for SRRM2 or show cytoplasmic / nuclear staining. No membrane staining was observed. In Figure 8 means Mem = membrane; Cyto = cytoplasmic; Nucl = nuclear.Example 3: Binding of the SRRM2 specific antibodies of the invention to a part of SRRM2

[0305] The aim of this example is to show the part of SRRM2 where the inventive antibodies bind. From Kellner et al., 2024, (page 13 to 14) it is known that the antibody binds to the SRRM2 fragment tr04 (SEQ ID NO: 48), which corresponds to AA 1889-2150 of SRRM2. A 96-well cell cluster plate was coated with purified SRRM2-trO4-HIS or, as a control, MISP-HIS protein (each at 50 pg / ml) overnight and then blocked with nonfat milk powder in TBST. Antibodies 13F11, 18A4-2, 23A7 or an anti-MISP antibody were added for 2 hours at room temperature. After washing, the plate was incubated with a secondary antirat IgG antibody coupled to HRP and developed with TMB. After stopping the reaction with H2SO4, the absorbance was measured at 450 nm. The antibodies 13F11, 18A4-2, and 23A7 bound to fragment tr04 (SEQ ID NO: 48) having a far higher absorbance compared to the control as shown in Figure 9. Interestingly, the commercially available polyclonal Biozol antibody is derived from immunization with a fragment comprising AA #2037-2087 of SRRM2, and thus within the SRRM2 fragment tr04. However, as shown above, the Biozol antibody is not able to bind to SRRM2 present on the cell membrane of tested cancer cells. Thus, the antibodies 13F11, 18A4, 18A4-2, and 23A7 might bind to AA 1889-2036 or AA 2088-2150 of SRRM2.Example 4: Antibody-drug conjugates using the inventive antibody are able to kill tumor cells in a tumor-bearing mouse modelExample 4a: The inventive antibodies are internalized by cells having SRRM2 on their cell surface

[0306] Monoclonal antibodies can be modified to carry a toxin or radioactivity. These 'antibody drug conjugates' (ADCs) are increasingly used as a therapeutic regimen. For ADCs it is important that they bind to target cells and to be internalized into the target cells where the payloads can exert their activity. The internalization of 13F11 by SKOV-3 cells was tested. For this, SK-OV-3 cells were incubated with 13F11 for 10 min at room temperature and then thoroughly washed to remove free antibody. Samples of these cells were then incubated at 37 °C for one to five hours or kept on ice (= 0 hour). Then, the cells were stained with an Alexa647-coupled secondary anti-rat IgG antibody and fluorescence was measured by flow cytometry. A decrease in fluorescence over time indicates an internalization of the SRRM2-13F11 complex, resulting in reduced binding of the secondary antibody. The fluorescence measured after 0 hours at 37 °C was set to 100 % (see Fig. 10).Example 4b: Antibody-drug conjugates using the inventive antibody are able to kill tumor cells in a tumor-bearing mouse model

[0307] In a first experiment Balb / c nude mice having a tumor originating from BxPC-3 pancreatic cancer cells injected subcutaneously into the right lateral abdominal wall with a tumor volume of about 200 mm3were divided in 6 treatment groups. Treatment groups with 5 to 6 animals each were: Treatment group 1 received intravenous (i.v.) injection of PBS serving as negative control (PBS in Fig. 11); Treatment group 2 received i.v. injection of 8.29 mg / kg of Deruxtecan linked to an isotype antibody serving as a further negative control (ISO-DXd 8.29 mg / kg in Fig. 11), Treatment group 3 received i.v. injection of 1 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE 1 mg / kg in Fig. 11), Treatment group 4 received i.v. injection of 10 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE 10 mg / kg in Fig. 11), Treatment group 5 received i.v. injection of 1 mg / kg 23A7 antibody linked to Deruxtecan (EX02-DXd 1 mg / kg in Fig. 11), Treatment group 6 received i.v. injection of 10 mg / kg 23A7 antibody linked to Deruxtecan (EX02-DXd 10 mg / kg in Fig. 11). The study duration was 30 days counting after the first drug injection. The drug or control substances were i.v. injected at day 0, 8 and 15. Mice were observed 2~3 times per week for living conditions, body weight and measuring the tumor size to monitor the changes of tumors. The mice in the treatment groups with the 23A7 ADCs showed a dose-dependent tumor reduction. This could be seen in the tumor volume measured during the experiment as shown in Fig.11 A. The data shown in Fig. 11A were divided in two graphs showing the treatment groups 1, 2, 5, and 6 (PBS, ISO-DXd, and EX02-DXd) in Figure 11 B. Interestingly the treatment with 1 mg / kg 23A7-DXd (treatment group 5) was comparable to the PBS control and worse than the isotype antibody-DXd construct (Iso-DXd). In the treatment group 6 (10 mg / kg 23A7-DXd) the tumor volume was the same over the whole study and thus a tumor volume reduction compared to both controls (see Fig. 11 B). InFigure 11C the results of the treatment groups 1, 2, 3, and 4 (PBS, ISO-DXd, and EX02-MMAE) were shown. Using 1 mg / kg of the 23A7-MMAE conjugate (treatment group 3) the tumor volume was over the whole study smaller than both controls but still increased. Using 10 mg / kg of the 23A7-MMAE conjugate (treatment group 4) the tumor volume decreased beneath the tumor volume at study start (see Fig. 11 C). Thus, 10 mg / kg of the 23A7-MMAE conjugate was able to shrink a BxPC-3 tumor in the used tumor model. The explanted tumors after the end of the experiment of all treatment groups are shown in Fig.11D. During the experiment no toxicities were observed using the body weight as an indicator, which was comparable over all treatment groups (Fig. 11E).

[0308] In a second experiment only using MMAE conjugates Balb / c nude mice having a tumor originating from BxPC-3 pancreatic cancer cells injected subcutaneously into the right lateral abdominal wall with a tumor volume of about 100 mm3were divided in 6 treatment groups. Treatment groups with 5 to 6 animals each were: Treatment group 1 received intravenous (i.v.) injection of PBS serving as negative control (PBS in Fig. 12); Treatment group 2 received i.v. injection of 10 mg / kg of MMAE linked to an isotype antibody serving as a further negative control (ISO-MMAE 10 mg / kg in Fig. 12), Treatment group 3 received i.v. injection of 0.346 mg / kg MMAE (MMAE 0.346 mg / kg in Fig. 12), which equals 10mg / kg of ADC conjugated MMAE, serving as a further negative control, Treatment group 4 received i.v. injection of 2.5 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE 2.5 mg / kg in Fig. 12), Treatment group 5 received i.v. injection of 5 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE 5 mg / kg in Fig. 12), Treatment group 6 received i.v. injection of 10 mg / kg 23A7 antibody linked to VcMMAE (EX02-MMAE 10 mg / kg in Fig. 12). The study duration was 28 days counting after the first drug injection. The drug or control substances were i.v. injected at day 0 and 15. Mice were observed 2~3 times per week for living conditions, body weight and measuring the tumor size to monitor the changes of tumors. The mice in the treatment groups with the 23A7-MMAE conjugates showed a dose-dependent tumor reduction, whereas MMAE alone had no effect. This could be seen in the tumor volume measured during the experiment as shown in Fig. 12A and in the explanted tumors after the end of the experiment as shown in Fig. 12B. Using 5 mg / kg and 10 mg / kg of the 23A7-MMAE conjugate (treatment groups 5 and 6) the tumor volume decreased beneath the tumor volume at study start (see Fig. 12A). Thus, 5 mg / kg and 10 mg / kg of the 23A7-MMAE conjugate were able to shrink a BxPC-3 tumor in the used tumor model. During the experiment no toxicities were observed using the body weight as an indicator, which was comparable over all treatment groups (Fig. 12C). The organ coefficients (organ weight / body weight) of heart, spleen and kidney were comparable between alltreatment groups, however the organ coefficients of the liver were slightly higher in the treatment groups receiving MMAE or an ADC compared to PBS (see Fig. 12 d).

[0309] In summary, the SRRM2 specific antibody 23A7 is internalized by tumor cells presenting SRRM2 on their surface. Using 23A7-DXd conjugates and 23A7-MMAE conjugates in BxPC-3 tumor bearing mice were able to reduce the tumor volume at least in comparison to a PBS control. Noticeable 5 mg / kg and 10 mg / kg of the 23A7-MMAE conjugate were able to shrink the BxPC-3 tumor in the used mouse model. The injected substances showed no toxi cities.Example 5: Preparation and testing SRRM2 specific CAR-T cells in-vitro and in a mouse modelExample 5a: Preparation and in-vitro testing of CAR T cells

[0310] Chimeric antigen receptor (CAR)-T cells have emerged as promising immunotherapeutic tools, particularly against hematologic malignancies. To explore the reactivity and specificity of SRRM2 CAR-T cells, lentiviral vectors encoding single-chain variable fragments (scFv) were designed based on the variable heavy and light chain sequences of the SRRM2 specific antibodies 13F11 and 23A7 (in VH^VL and VL^VH orientations) fused to a 2nd-generation CAR backbone construct, carrying the CD3- and 4-1BB activation domains. Viral vectors were produced in HEK293 cells and used to transduce primary T cells that were pre-activated for two days with plate-bound CD3 and CD28 antibodies. During the development of this transduction protocol, we repeatedly observed a higher transduction and CAR expression rate with the 23A7 VH^VL constructs (not shown), which we therefore used for the subsequent experiments.

[0311] In a first series of experiments, primary T cells from two donors (1 and 2) were transduced with a retroviral vector encoding a chimeric antigen receptor (CAR) with a singlechain construct derived from antibody 13F11. Expression of the CAR on transduced T cells was tested by flow cytometry with a goat-anti rat IgG antibody (not shown). HO-8910 cells were incubated for 24 h with 13F11 CAR-T cells (columns 3-4 of the blots) or non-transduced control T cells (column 1-2 of the blots) at the E:T ratios indicated on the X-axis. Finally, interferongamma in the supernatants, which is a marker of T-cell activation, was quantified with a commercial ELISA assay (see Fig. 13A). A further experiment shows that the SRRM2-specific CAR-T cells also kill SRRM2-positive adenocarcinoma HO-8910 target cells (probably a HeLa-derivative) using different effector to target ratios. Here, killing was measured with a commercial LDH assay (see Fig. 13B).

[0312] In a second series of experiments, 13F11 or 23A7 CAR-T effector cells were cocultured with Hep G2 or HuCC-T1 target cells at E:T ratios of 10:1, 5:1 and 2:1. T-cell mediated target cell killing over time was measured in a xCELLigence system, and IFN-y secretion was quantified using commercial ELISA kits. We observed efficient Hep G2 and HuCC-T1 target cell killing (Fig. 14A-C) and concomitant high IFN-y levels specifically in cocultures with 13F11 CAR-T cells but not with mock-T cell. 23A7 CAR-T cells or mock-T cells obtained from four different donors were cocultured with surface SRRM2 positive PCI-1 head and neck cancer cells at different ratios for 48 h. Secretion of IFN-y into the supernatant was quantified with a commercial sandwich ELISA (Fig. 14D), showing target specific CAR-T cell activation stimulated by surface SRRM2 positive PCI-1 cells.

[0313] In a third series of experiments, 13F11 CAR-T cells were incubated with SKOV3, UWB 1.289, and PANC1 target cells at E:T ratios of 10:1, 5:1 and2:1 and T-cell killing over time was measured in a xCELLigence system and IFN-y secretion was quantified in ELISA assays. Efficient target cell killing and concomitant high IL2- and IFN-y levels specifically in cocultures with 23A7 CAR-T cells but not with mock-T cell was observed (Fig. 15 A-E).Example 5b: Testing of SRRM2 specific CAR-T cells in a tumor bearing mouse model

[0314] To gain insight into the in vivo activity of 23A7 CAR-T cells, a human xenograft model in immunocompromised NOG mice to mimic peritoneal metastasis was set up. To this end, a total of 300,000 BxPC-3-luc pancreatic cancer cells per mouse were injected intraperitoneally, and successful engraftment was confirmed by bioluminescence imaging one day later. At that timepoint (=day 0), mice (n=5 per group) were injected with either 4x10623A7 CAR-T cells (transduction rate 73%) or mock-T cells in a final volume of 100 pl intraperitoneally or received the same volume PBS as vehicle control. The injection of human T cells was well tolerated, and no adverse events were observed. To follow the xenograft growth over time, bioluminescence imaging was performed at days 5, 8, 12, 19 and 26 after T-cell injection (FIG.16A). These measurements revealed that 23A7 CAR-T cells had a statistically significant inhibitory activity as compared with mock-T cells, and both groups differed significantly from the PBS control group. At day 26, when the experiment had to be terminated for animal welfare reasons, 23A7 CAR-T cell treated animals reached an average tumor burden of 5.3 x 108light units (p / s) compared to 2.6 x 109p / s for the mock-T cell treated mice (p=0.014) and 3.6 x 109p / s for mice of the PBS group (p<0.01) (FIG. 16B). Mice treated with 23A7 CAR-T cells also revealed a significant higher CD8+ / CD4+ ratio and a lower percentage of CD45+ cells in the blood and the spleen as compared to mock-T treated animals, which has been shown to bepredictive for CAR-T efficacy and a low risk of treatment failure (Zhao et al., 2015; Galli et al., 2023) (Fig. 16C).

[0315] In a second experiment a total of 300,000 SKOV-3-luc ovarian cancer cells per mouse were injected intraperitoneally, and successful engraftment was confirmed by bioluminescence imaging one day later. At that timepoint (=day 0), mice (n=3 per group) were injected with either 4x10623A7 CAR-T cells (transduction rate 73%) or mock-T cells in a final volume of 100 pl intraperitoneally or received the same volume PBS as vehicle control. The injection of human T cells was well tolerated, and no adverse events were observed. To follow the xenograft growth over time, bioluminescence imaging was performed at days 1, 6, 12, and 18 after T-cell injection (FIG. 17A and B). Mice treated with 23A7 CAR-T cells also revealed higher counts of IL-5, I FNy, CD3+ cells, and CAR-T cells in the blood as well as a higher CD8+ / CD4+ ratio in the blood and the spleen as compared to mock-T treated animals (FIG. 17C).Example 6: Preliminary clinical trial of SRRM2 specific CAR-T cells administered to human patients suffering from pancreatic cancer

[0316] To further show that SRRM2 specific CAR-T cells are helpful in the treatment of solid cancer, SRRM2 specific CAR-T cells were used in a compassionate treatment of end-stage metastatic pancreatic cancer with a good safety profile in 6 patients.

[0317] This study was undertaken according to the Declaration of Helsinki and with the informed consent of the participating patients. The compassionate use of the drugs for patients having serious illnesses with no other effective treatment options received ethical approval from the Ethics Committee of the hospital.

[0318] The CAR was constructed using the variable regions (scFv) of the SRRM2 specific antibody 23A7, a hinge region from CD8, followed by a transmembrane domain (TMD) and 4-1BB and CD3 intracellular costimulatory domains. As quality tests the product visual appearance, pH value, cell viability, viable cell density, % of CD3+ cells, % of CD3+ CD4+ cells, % of CD3+ CD8+ cells, adjusted % of CAR expression, as well as mycoplasma, sterility, endotoxin levels, vector copy number (VCN), in vitro cytotoxicity, IFN-y release were tested.

[0319] 6 patients participated in this study. The characteristics were as followed:A) Patient HOP

[0320] Patient HOO, female, had pancreatic cancer (body and tail, CT4N2M1) involving the stomach wall, left adrenal gland, splenic vein, left renal vein, superior mesenteric artery, and celiac trunk; slightly enlarged retroperitoneal lymph nodes; recurrent abdominal pain, diagnosed for over a year, cachexia. The patient was 81 years old and had a body weight of 32.5 kg at the beginning of the trial. CT and PET scans revealed a 72x54 mm tumor that has spread to the abdominal aorta, gastric wall, and left adrenal gland for 6 months. The patient had a pathology confirmed adenocarcinoma with elevated CA19-9 (4261.79 kll / L). At the beginning of the trial the patient had worsening abdominal pain over the past two months. Despite treatment, her pain and severe gastrointestinal issues persisted. She was bedridden, unable to eat, and received deep vein nutrition. The tumor tissue showed a weak SRRM2 staining.

[0321] Patient HOO received 3 doses of SRRM2 specific CAR-T cell without lymphodepletion before each of the doses.

[0322] At the study start the patient received as a first dose 3.11 x 108CAR-T cells (9.57 x 106CAR-T cells / kg) via intratumoral and intravenous injection. The CAR-T cells expanded and reached 90.70% CAR+ / T-cell. Also, the CD8+ T cells expanded. The CD8+ T cells increased from 14% to 40% after the 1stdose. The blood CAR-T cells peaked at 4.77% on day 14 after the 1stdose.

[0323] 2 weeks after the first dose the patient reported significant pain reduction. 3 weeks after the first dose the patient had pain relieved, removed deep vein nutrition, normal diet, no weight loss. Thus, the symptoms of this patient got better already after a first dose of SRRM2 specific CAR-T cells.

[0324] The patient received on day 46 a second dose with 1.25 x 108CAR-T cells (4.17 x 106CAR-T cells / kg) via intratumoral injection, having a body weight of 30 kg. The CAR-T cell expansion was measured having 93.57% CAR+ / T-cell. The blood CAR-T cells peaked at 8.79% on day 7 after 2nddose (= day 53 after first dose).

[0325] The patient received a third dose with 1.26 x 109CAR-T cells (4.20 x 107CAR-T cells / kg) via intravenous injection on day 139. The CAR-T cell expansion was measured having 71.20% CAR+ / T-cell.

[0326] In total, the patient had no major organ adverse reactions after the first and second doses.

[0327] A stable disease (SD), according to the RECIST 1.1 criteria could be reached for 4.5 months (= Tumor size remains relatively unchanged = less than 30% decrease and less than 20% increase).

[0328] A CA19-9 response to the CAR-T infusions showing a reduction of the CA19-9 level after the first and third dose was detected. Thus, the CA19-9 level responded to the CAR-T infusions.

[0329] The patient had an overall survival (OS) during the study of 197 days.

[0330] In total, the patient showed a reduction in CA 19-9 levels, pain relief, and nutritional improvement suggesting a strong clinical benefit, providing a broader context for treatment efficacy beyond radiology, which only counts for the RECIS 1.1 criteria.B) Patient H01

[0331] Patient H01 presented at the start of the study with a pancreatic cancer (head and neck) diagnosed for over a year; multiple enlarged lymph nodes around the pancreatic head and in the retroperitoneum; and multiple abdominal ascites. The patient was 49 years old and had a body weight of 41 kg at the beginning of the trial. The cells of the ascites were stained positive for cell surface SRRM2.

[0332] Patient H01 got a lymphodepletion using cyclophosphamide (FC) and received then one dose of 1.59 x 108CAR-T cells (3.87 x 106CAR-T cells / kg) via peritoneal and intravenous injection. The CAR-T cells expanded and reached 88.29% CAR+ / T-cell. Also, the CD8+ T cells expanded.

[0333] The SRRM2 specific CAR-T cell administration resulted in a reduction of the ascites. The patient had an overall survival (OS) during the study of 92 days.C) Patient H02

[0334] Patient H02 presented at the study start with a pancreatic cancer (uncinate process, TxN3M1 stage IV) diagnosed for 8 months, with multiple liver metastases; enlarged lymph nodes in the retroperitoneum and mesenteric area; suspected portal vein, superior mesentericartery, and proximal splenic vein thrombosis or tumor thrombus; severe jaundice; and ascites. The patient was 48 years old and had a body weight of 47.5 kg at begin of the trial. The staining of a tumor biopsy was negative for cell surface located SRRM2.

[0335] Nevertheless, the patient got a lymphodepletion using cyclophosphamide (FC) and received then one dose of 3.97 x 108CAR-T cells (8.35 x 106CAR-T cells / kg) via intratumoral and intravenous injection. The CAR-T cells expanded and reached 90.36% CAR+ / T-cell. Also, the CD8+ T cells expanded.

[0336] The patient had an overall survival (OS) during the study of 57 days.D) Patient H03

[0337] Patient H03 presented at study start with an ampullary malignancy (duodenal papilla, cTxNOMO), diagnosed over a month ago; fullness of the distal common bile duct and pancreatic head; slightly enlarged lymph nodes around the pancreatic head, retroperitoneum, and gastric cardia. The patient was 72 years old and had a body weight of 65 kg at begin of the trial. The tumor cells were stained positive for cell surface located SRRM2.

[0338] Patient H03 received a first dose of 1.56 x 109CAR-T cells (2.4 x 107CAR-T cells / kg) via intravenous injection, with a prior lymphodepletion using cyclophosphamide (FC). The CAR-T cells were measured having 79.26% CAR+ / T-cell. The CD8+ T cells expanded.

[0339] The patient received after 70 days a second dose of 4.57 x 108CAR-T cells (7.03 x 106CAR-T cells / kg) via intravenous injection, without prior lymphodepletion. The CAR-T cells were measured having 78.10% CAR+ / T-cell.

[0340] The patient survived and had an overall survival (OS) during the study of 141 days.E) Patient H04

[0341] Patient H04 presented at study start with a recurrent metastatic pancreatic cancer postpancreatectomy (body and tail resection + splenectomy, stage IV) for over a year, involving left renal fascia, left adrenal area, left kidney upper pole, stomach wall, surrounding small intestine and colon, left perirenal fat capsule, peritoneal cavity, and anterior abdominal wall; multiple liver hypodense lesions, suggesting metastases; and ascites. The patient was 62 years old and had a body weight of 63 kg at begin of the trial. The cells of resection specimen were stained positive for cell surface located SRRM2.

[0342] Patient H04 got a lymphodepletion using cyclophosphamide (FC) and received then a first dose of 6.71 x 108CAR-T cells (1.07 x 107CAR-T cells / kg) via intravenous injection. The CAR-T cells expanded and reached 71.30% CAR+ / T-cell. Also, the CD8+ T cells expanded.

[0343] After the first dose the ascites with which the patient presented at study start, disappeared.

[0344] The patient received after 29 days a second dose of 5.02 x 108CAR-T cells (8.1 x 106CAR-T cells / kg) via peritoneal and intravenous injection, with prior lymphodepletion using cyclophosphamide (FC). The CAR-T cell expansion was measured having 72.19% CAR+ / T-cell.

[0345] After the second dose, the lymph node size was reduced.

[0346] The follow-up of patient H04 was lost during the study. Due to the lost of follow-up, only an overall survival of only 46 days could be counted.F) Patient H06

[0347] Patient H06 presented at the study start with a pancreatic head cancer T3N1M1 stage IV (periumbilical pain for over 2 months); and secondary lung malignancy with multiple nodular high-density lesions. The patient was 69 years old and had a body weight of 52 kg at begin of the trial. The tumor cells were stained positive for cell surface located SRRM2.

[0348] Patient H06 got a lymphodepletion using cyclophosphamide (FC) and received then a first dose of 1.23 109CAR-T cells (2.36 x 107CAR-T cells / kg) via intravenous injection. The CAR-T cells expanded and reached 83.90% CAR+ / T-cell. Also, the CD8+ T cells expanded.

[0349] The first dose resulted in a pain relief.

[0350] The patient received after 56 days a second dose of 5.41 x 108CAR-T cells (1.18 x 107CAR-T cells / kg) via intravenous injection, without prior lymphodepletion. The Car-T cell expansion was measured having 78.15% CAR+ / T-cell.

[0351] The second dose, resulted in a reduced lung shadow.

[0352] The patient had an overall survival (OS) during the study of 71 days.

[0353] In summary, the SRRM2 specific CAR-T cells expanded in weeks 1 to 4 after the first dose, visible as an increase in the % CAR-T / T cell ratio (see Fig. 18A). Furthermore, the expansion of CD8 T cells, shown as %CD8 / T cell in Fig. 18B, day 3 to 60 after the first dose indicates antigen (epitope) spreading and an expansion of other endogenous TCR T cell clones. The expansion of the SRRM2 specific CAR-T cells and of the CD8 T cells improves some of the symptoms of the patients participating in this clinical trial. A summary of the patients’ characteristics is shown in Table 2.REFERENCESAltschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, Miller W, Lipman DJ. Gapped BLAST and PSI-BLAST: a new generation of protein database search programs. Nucleic Acids Res.1997 Sep 1;25(17):3389-402.Bahmad HF, Jalloul M, Azar J, Moubarak MM, Samad TA, Mukherji D, Al-Sayegh M, Abou-Kheir W. Tumor Microenvironment in Prostate Cancer: Toward Identification of Novel Molecular Biomarkers for Diagnosis, Prognosis, and Therapy Development. Front Genet. 2021 Mar 26; 12:652747.Bhattacharyya S, Dixit M. Metallic radionuclides in the development of diagnostic and therapeutic radiopharmaceuticals. Dalton Trans. 2011 Jun 21 ;40(23):6112-28.Blencowe BJ, Bauren G, Eldridge AG, Issner R, Nickerson JA, Rosonina E, Sharp PA. The SRm160 / 300 splicing coactivator subunits. RNA. 2000 Jan;6(1):111-20.Campos-Silva C, Suarez H, Jara-Acevedo R, Linares-Espinos E, Martinez-Pineiro L, Yanez-M6 M, Vales-Gomez M. High sensitivity detection of extracellular vesicles immune-captured from urine by conventional flow cytometry. Sci Rep. 2019 Feb 14;9(1):2042.Chia PL, Ang KH, Thura M, Zeng Q. PRL3 as a therapeutic target for novel cancer immunotherapy in multiple cancer types. Theranostics. 2023 Mar21;13(6):1876-1891.Drecoll E, Gaertner FC, Miederer M, Blechert B, Vallon M, Muller JM, Alke A, Seidl C, Bruchertseifer F, Morgenstern A, Senekowitsch-Schmidtke R, Essler M. Treatment of peritoneal carcinomatosis by targeted delivery of the radio-labeled tumor homing peptide bi-DTPA-[F3]2 into the nucleus of tumor cells. PLoS One. 2009 May 27;4(5):e5715.Eldridge AG, Li Y, Sharp PA, Blencowe BJ. The SRm160 / 300 splicing coactivator is required for exon-enhancer function. Proc Natl Acad Sci U S A. 1999 May 25;96(11):6125-30.Galli E, Bellesi S, Pansini I, Di Cesare G, lacovelli C, Malafronte R, Maiolo E, Chiusolo P, Sica S, Sora F, Hohaus S. The CD4 / CD8 ratio of infused CD19-CAR-T is a prognostic factor for efficacy and toxicity. Br J Haematol. 2023 Nov;203(4):564-570.Gonzalez-Gronow M, Gopal U, Austin RC, Pizzo SV. Glucose-regulated protein (GRP78) is an important cell surface receptor for viral invasion, cancers, and neurological disorders. IUBMB Life. 2021 Jun;73(6):843-854.Grosche A, Hauser A, Lepper MF, Mayo R, von Toerne C, Merl-Pham J, Hauck SM. The Proteome of Native Adult Muller Glial Cells From Murine Retina. Mol Cell Proteomics. 2016 Feb;15(2):462-80.Hashimoto-Gotoh T, Mizuno T, Ogasahara Y, Nakagawa M. An oligodeoxyribonucleotide-directed dual amber method for site-directed mutagenesis. Gene. 1995 Jan 23;152(2):271-275.Hauck SM, Dietter J, Kramer RL, Hofmaier F, Zipplies JK, Amann B, Feuchtinger A, Deeg CA, Ueffing M. Deciphering membrane-associated molecular processes in target tissue of autoimmune uveitis by label-free quantitative mass spectrometry. Mol Cell Proteomics. 2010 Oct;9(10):2292-2305.Hofland J, Brabander T, Verburg FA, Feelders RA, de Herder WW. Peptide Receptor Radionuclide Therapy. J Clin Endocrinol Metab. 2022 Nov 25;107(12):3199-3208.Ilik iA, Malszycki M, Lubke AK, Schade C, Meierhofer D, Akta§ T. SON and SRRM2 are essential for nuclear speckle formation. Elife. 2020 Oct 23;9:e60579.Joo EJ, ten Dam GB, van Kuppevelt TH, Toida T, Linhardt RJ, Kim YS. Nucleolin: acharan sulfate-binding protein on the surface of cancer cells. Glycobiology. 2005 Jan;15(1):1-9.Khan F, Niaz K, Abdollahi M. Toxicity of Biologically Active Peptides and Future Safety Aspects: An Update. Curr Drug Discov Technol. 2018;15(3):236-242.Kellner M, Hermann J, Fackler S, Hu Y, Zhou T, Lu L, Ilik I, Aktas T, Feederle R, Hauck SM, Gires O, Gartner K, Li L, Zeidler R. The Nuclear Speckles Protein SRRM2 Is Exposed on the Surface of Cancer Cells. Cells. 2024 Sep 17; 13(18): 1563.Kramer W, Drutsa V, Jansen HW, Kramer B, Pflugfelder M, Fritz HJ. The gapped duplex DNA approach to oligonucleotide-directed mutation construction. Nucleic Acids Res. 1984 Dec 21;12(24):9441-9456.Kramer W, Fritz HJ. Oligonucleotide-directed construction of mutations via gapped duplex DNA. Methods Enzymol. 1987;154:350-367.Kunkel TA. Rapid and efficient site-specific mutagenesis without phenotypic selection. Proc Natl Acad Sci U S A. 1985 Jan;82(2):488-492.Kunkel TA, Roberts JD, Zakour RA. Rapid and efficient site-specific mutagenesis without phenotypic selection. Methods Enzymol. 1987;154:367-382.Mark DF, Lu SD, Creasey AA, Yamamoto R, Lin LS. Site-specific mutagenesis of the human fibroblast interferon gene. Proc Natl Acad Sci U S A. 1984 Sep;81(18):5662-5666.Merl J, Ueffing M, Hauck SM, von Toerne C. Direct comparison of MS-based label-free and SILAC quantitative proteome profiling strategies in primary retinal Muller cells. Proteomics.2012 Jun;12(12):1902-1911.Martiniova L, Zielinski RJ, Lin M, DePalatis L, Ravizzini GC. The Role of Radiolabeled Monoclonal Antibodies in Cancer Imaging and ADC Treatment. Cancer J. 2022 Nov-Dec 01;28(6):446-453.Munawar A, Ali SA, Akrem A, Betzel C. Snake Venom Peptides: Tools of Biodiscovery. Toxins (Basel). 2018 Nov 14;10(11):474.Perconti G, Maranto C, Romancino DP, Rubino P, Feo S, Bongiovanni A, Giallongo A. Pro-invasive stimuli and the interacting protein Hsp70 favour the route of alpha-enolase to the cell surface. Sci Rep. 2017 Jun 19;7(1):3841.Pugholm LH, Revenfeld AL, Sondergaard EK, Jorgensen MM. Antibody-Based Assays for Phenotyping of Extracellular Vesicles. Biomed Res Int. 2015;2015:524817.Sidera K, Patsavoudi E. Extracellular HSP90: conquering the cell surface. Cell Cycle. 2008 Jun 1;7(11): 1564-1568.Short NJ, Rytting ME, Cortes JE. Acute myeloid leukaemia. Lancet. 2018 Aug 18;392(10147):593-606.Tsai YL, Ha DP, Zhao H, Carlos AJ, Wei S, Pun TK, Wu K, Zandi E, Kelly K, Lee AS. Endoplasmic reticulum stress activates SRC, relocating chaperones to the cell surface where GRP78 / CD109 blocks TGF- signaling. Proc Natl Acad Sci U SA. 2018 May 1;115(18):E4245-E4254.Wang A, Lu SD, Mark DF. Site-specific mutagenesis of the human interleukin-2 gene: structure-function analysis of the cysteine residues. Science. 1984 Jun 29;224(4656):1431-1433.Wang J, Manley JL. Overexpression of the SR proteins ASF / SF2 and SC35 influences alternative splicing in vivo in diverse ways. RNA. 1995 May;1(3):335-346.Weidle UH, Maisel D, Klostermann S, Schiller C, Weiss EH. Intracellular proteins displayed on the surface of tumor cells as targets for therapeutic intervention with antibody-related agents. Cancer Genomics Proteomics. 2011 Mar-Apr;8(2):49-63. Erratum in: Cancer Genomics Proteomics. 2011 May-Jun;8(3):157.Zahler AM, Neugebauer KM, Lane WS, Roth MB. Distinct functions of SR proteins in alternative pre-mRNA splicing. Science. 1993 Apr 9;260(5105):219-222.Zhao Z, Condomines M, van der Stegen SJC, Perna F, Kloss CC, Gunset G, Plotkin J, Sadelain M. Structural Design of Engineered Costimulation Determines Tumor Rejection Kinetics and Persistence of CAR T Cells. Cancer Cell. 2015 Oct 12;28(4):415-428.Zoller MJ, Smith M. Oligonucleotide-directed mutagenesis using M13-derived vectors: an efficient and general procedure for the production of point mutations in any fragment of DNA. Nucleic Acids Res. 1982 Oct 25; 10(20) :6487-6500.Zoller MJ, Smith M. Oligonucleotide-directed mutagenesis of DNA fragments cloned into M13 vectors. Methods Enzymol. 1983;100:468-500.

Claims

CLAIMS1. An antibody that binds to human serine / arginine repetitive matrix protein 2 (SRRM2) present on the cell surface of a target cell, for use in a method for the treatment of a solid tumor in a human patient.

2. The antibody for the use of claim 1, wherein said solid tumor is characterized by target cells, wherein SRRM2 is present on the cell surface of said target cells.

3. The antibody for the use of any one of the preceding claims, wherein SRRM2 present on the cell surface of said target cell is externalized.

4. The antibody for the use of any one of the preceding claims, wherein said target cell is a non-permeabilized target cell.

5. The antibody for the use of any one of the preceding claims, wherein said target cell is a living target cell.

6. The antibody for the use of any one of the preceding claims, wherein said antibody binds to SRRM2 which is externalized on the cell surface of a target cell.

7. The antibody for the use of any one of the preceding claims, wherein said antibody binds to SRRM2 on a non-permeabilized target cell.

8. The antibody for the use of any one of the preceding claims, wherein said antibody binds to SRRM2 on a living target cell.

9. The antibody for the use of any of the preceding claims, wherein the antibody is not an intracellular antibody.

10. The antibody for the use of any one of the preceding claims, wherein said solid tumor is a solid adenocarcinoma.

11. The antibody for the use of claim 10, wherein said solid adenocarcinoma is pancreatic adenocarcinoma, lung adenocarcinoma, breast adenocarcinoma, colorectal adenocarcinoma, rectum adenocarcinoma, prostatic adenocarcinoma, esophageal adenocarcinoma, gastric adenocarcinoma, adrenal adenocarcinoma, vaginal adenocarcinoma, vulvar adenocarcinoma, bile duct adenocarcinoma, gall bladder92adenocarcinoma, salivary gland adenocarcinoma, thyroid adenocarcinoma, duodenal adenocarcinoma, renal adenocarcinoma, urinary bladder adenocarcinoma, ovary adenocarcinoma, or endocervical adenocarcinoma.

12. The antibody for the use of any one of the preceding claims, wherein the human patient to be treated has a weight of between 16 and 150 kg, preferably 18 to 140kg, more preferably 20 to 130kg, still more preferably 22 to 120kg.

13. The antibody for the use of any of the preceding claims, wherein the patient to be treated has a body height between 70 and 220cm, preferably between 80 and 200cm, more preferably between 90 and 200cm.

14. The antibody for the use of any of the preceding claims in which the patient to be treated is at least 1 year old, preferably 2 years, more preferably between 2 and 80 years old.

15. The antibody for the use of any of the preceding claims, wherein said antibody has cytotoxic activity, preferably antigen-dependent cellular cytotoxicity (ADCC) and / or complement-dependent cytotoxicity (CDC).

16. The antibody for the use of any of the preceding claims, wherein said antibody is conjugated with a cytotoxic substance.

17. The antibody for the use of any of the preceding claims, wherein said antibody is conjugated with monomethyl auristatin E orexatecan or a derivative or an analog thereof.

18. The antibody for the use of any of the preceding claims, wherein said antibody is a bispecific antibody.

19. The antibody for the use of claim 18, wherein said bispecific antibody is a T-cell engaging antibody or a NK-cell engaging antibody.

20. The antibody for the use of any one of the preceding claims, wherein said antibody is (a) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 1 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 2;(b) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID93NO: 3 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 4;(c) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 6;(d) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 5 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 7; (e) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 8 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 9; (f) an antibody comprising a heavy chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 10 and a light chain variable region having an amino acid sequence with at least 85% identity to the amino acid sequence shown in SEQ ID NO: 11 ; or (g) an antibody which binds to the same epitope as that in the human SRRM2 protein to which the antibody of (a), (b), (c), (d), (e) or (f) binds.

21. The antibody for the use of any of the preceding claims, wherein said antibody is an antibody comprising(a) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 13, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 14, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 15, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 16, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 17, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 18;(b) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 19, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 20, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 21 , and94a light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 22, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 23, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 24;(c) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 28, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 29, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 30;(d) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 25, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 26, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 27, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 31, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 32, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 33;(e) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 34, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 35, and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 36, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 37, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 38, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 39;(f) a heavy chain variable region comprising heavy chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 40, heavy chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 41 , and heavy chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 42, anda light chain variable region comprising light chain CDR1 having the amino acid sequence as set forth in SEQ ID NO: 43, light chain CDR2 having the amino acid sequence as set forth in SEQ ID NO: 44, and light chain CDR3 having the amino acid sequence as set forth in SEQ ID NO: 45; or95(g) an antibody which binds to the same epitope as that in the human SRRM2 protein to which the antibody of (a), (b), (c), (d), (e) or (f) binds.

22. The antibody for the use of any of the preceding claims, wherein said antibody is part of a chimeric antigen receptor (CAR).

23. The antibody for the use of claim 22, wherein said CAR comprises the heavy chain variable region and the light chain variable region according to any one of the alternatives (a) to (f) of claim 20, preferably with a VH to VL orientation.

24. The antibody for the use of claim 22, wherein said CAR comprises the heavy chain variable region and the light chain variable region according to any one of the alternatives (a) to (f) of claim 21, preferably with the VH to L orientation.

25. The antibody for the use of any one of claims claim 22 to 24, wherein said CAR is expressed by a T cell, NK cell, NK-T cell or macrophage.

26. The antibody for the use of any of the preceding claims, wherein said antibody is expressed by an autologous cell population.

27. The antibody for the use of any of claims 1 to 25, wherein said antibody is expressed by an allogeneic cell population.

28. The antibody for the use of any of the preceding claims, wherein the route of antibody administration is intratumoral and / or parenteral, including, but not limited to, intravenous, intradermal, intramuscular, or intraperitoneal administration or any combination thereof.

29. The antibody for the use of any of the preceding claims, wherein the method for the treatment of a solid tumor in a human patient comprises, prior to the treatment of the solid tumor, determining whether the target cell of the human patient has SRRM2 protein present on the cell surface.96