Combination preparation for therapeutic use

WO2026167384A1PCT designated stage Publication Date: 2026-08-13PECSI TUDOMANYEGYETEM
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-01-30
Publication Date
2026-08-13

Smart Images

  • Figure IMGF000034_0001
    Figure IMGF000034_0001
  • Figure IMGF000037_0001
    Figure IMGF000037_0001
  • Figure IMGF000037_0002
    Figure IMGF000037_0002
Patent Text Reader

Abstract

The invention relates to a combination of active agents consisting of three herbal extracts, which can be used in the prevention or treatment of neurodegenerative diseases, in particular glaucoma, Parkinson's disease and diabetic retinopathy. The invention also relates to compositions comprising the combination of active agents and a method for preventing or treating neurodegenerative diseases, which method comprises administering the combination of active agents to a subject in need thereof. The invention also relates to compositions comprising the combinations of active agents. The combination of active agents comprises extracts of Rosmarinus officinalis, Foeniculum vulgare and Helichrysum italicum.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] Combination Preparation For Therapeutic Use

[0002] FIELD OF THE INVENTION

[0003] The invention relates to a combination of active agents consisting of three herbal extracts, which can be used in the prevention or treatment of neurodegenerative diseases, in particular glaucoma, Parkinson's disease and diabetic neuro- and / or retinopathy. The invention also relates to compositions comprising the combination of active agents and a method for preventing or treating neurodegenerative diseases, which method comprises administering the combination of active agents to a subject in need thereof. The invention also relates to compositions comprising the combinations of active agents: eye drops or intranasal preparations or dermal patches and / or other preparations absorbed through the skin or medicinal preparations not classified as medicinal products, food supplements. The combination of active agents comprises extracts of Rosmarinus officinalis, Foeniculum vulgare and Helichrysum italicum.

[0004] BACKGROUND ART

[0005] Glaucoma, which is one of the leading causes of irreversible vision loss worldwide, is a group of neurodegenerative diseases characterized by slow, irreversible destruction of the optic nerve fibers. The risk factor for the disease is objectively measurable, typically high intraocular pressure (= IOP > 21 mm Hg), and its complication is progressive optic neuropathy, which, if untreated, causes irreversible vision loss in a significant proportion of the cases. During the course of the disease, inflammatory reactions induced by elevated proinflammatory cytokines [Kovács-Valasek et al.Three Major Causes of Metabolic Retinal Degenerations and Three Ways to Avoid Them. Int. J. Mol. Sci. 2023, 24, 8728; Chi, W et al. Caspase-8 Promotes NLRP1 / NLRP3 Inflammasome Activation and IL-1β Production in Acute Glaucoma. Proc. Natl. Acad. Sci. U. S. A. 2014, 111, 11181–11186] and harmful free radical formation [Radomska-Leśniewska, D. M. et al. Therapeutic Potential of Curcumin in Eye Diseases. Cent. Eur. J. Immunol. 2019, 44, 181–189] may be observed in the lamina cribrosa, the retina, the retinal vessels, the structures of the angle of vision, and the aqueous humor [Cela, D. et al. The Trabecular Meshwork in Glaucoma: An Inflammatory Trabeculopathy? J. Fr. Ophtalmol. 2021, 44, e497–e517]. Currently, the treatment of glaucoma according to international standards is primarily aimed at reducing IOP by pharmacological, laser and / or surgical means. Nowadays, neuroprotection has become an essential aspect of complementary glaucoma therapies, aiming to slow down the apoptosis and functional deterioration of retinal ganglion cells.

[0006] Parkinson's disease is one of the most common neurodegenerative diseases, which causes motor and non-motor dysfunction. Parkinson's disease affects dopaminergic neurons, leading to a decrease in dopamine production and damage to the central nervous system. However, the background of the disease is still not fully understood. It is characterized by oxidative stress and inflammation, which can be exacerbated by iron accumulation, inducing ferroptosis. In addition, the accumulation of a-synuclein in dopaminergic neurons can cause oxidative damage and mitochondrial dysfunction, leading to apoptosis. Dopaminergic amacrine cells and ganglion cells of the human retina may also be damaged by iron accumulation and ferroptosis. The genetic and molecular pathomechanisms of Parkinson's disease are partly in common with primary open-angle glaucoma, independent of intraocular pressure.Diabetes, which develops on the basis of a complex metabolic disorder, contributes to nervous system damage through several mechanisms, the nature of which is similar to neurodegenerative processes, accelerates the development of these processes and results in their aggravation. Diabetes mellitus is a chronic metabolic disease with an increasing prevalence worldwide, and its the long-term presence leads to serious macro- and microvascular complications. One of the most significant of these is diabetic retinopathy (DR). Research in recent decades has shown that diabetic retinopathy is a disease associated with neural degeneration even in its early stages. As a result of chronic hyperglycemia, retinal ganglion cell loss, thinning of the inner retinal layers, and increased apoptosis can be observed, often even before the appearance of clinically detectable vascular damage. These neurodegenerative changes can be paralleled in many respects with the neuronal cell death observed in glaucoma. Both diseases share common features of mitochondrial dysfunction, increased oxidative stress, and activation of apoptotic signaling pathways. Based on this, the view that DR should be interpreted as a neurovascular disease in which neuroprotection may represent an independent therapeutic target, is increasingly accepted.

[0007] There are no evidence-based recommendations regarding the efficacy of neuroprotective herbal therapies, but the growing demand for non-conventional therapies targeting glaucoma by both treating physicians and glaucoma patients should not be underestimated [Rák, T.; Csutak, A. Complementary Practices in Pharmacy and Their Relation to Glaucoma—Classification, Definitions, and Limitations. Sci. Pharm. 2024, Vol. 92, Page 16 2024, 92, 16; Bower, T. N. et al. Kasner, O. Canadian Ophthalmologists’ Opinions Concerning Complementary and Alternative Medicine (CAM) Use in Glaucoma. J. Glaucoma 2014, 23, 430–434],

[0008] Rosmarinus officinalis L. (Lamiaceae) (rosemary) is a herb and medicinal plant that is widely used in Hungarian and European folk medicine. Rosemary extract is a food and cosmetic additive (E392) due to its antioxidant effect, according to EU Regulation No. 231 / 2012. Its main active ingredient is rosmarinic acid, which is also indicated in research related to the nervous system and ophthalmology for its neuroprotective and anti-inflammatory effects (GABA receptor stimulation, VEGF and AChE inhibition). One of its active ingredients, rosmarinic acid, has been used in ophthalmological research to date as an agent to inhibit subconjunctival neovascularization and fibrosis during experimental filtration glaucoma surgery (trabeculectomy) in rabbits, and in intravitreal implants [Vieira, L. C. et al. Rosmarinic Acid Intravitreal Implants: A New Therapeutic Approach for Ocular Neovascularization. Planta Med. 2020, 86, 1286–1297]. No experiments investigating either intraocular pressure reduction or glaucoma progression have been conducted in an animal model of glaucoma.

[0009] The use of trans-anethole, the main active ingredient of Foeniculum vulgare Mill. (Apiaceae) (fennel), in glaucoma was investigated by Agarwal, R. et al. (Oculohypotensive Effects of Foeniculum Vulgare in Experimental Models of Glaucoma. Indian J. Physiol. Pharmacol. 52, 77–83), however, based on their results, neither a sustained increase in intraocular pressure nor the development, diagnosis and therapeutic monitoring of glaucomatous damage can be proven due to the shortcomings of the methodology described in the study. No relevant information can be found in the literature on the intraocular penetration of fennel or its neuroprotective effect in the field of ophthalmology.

[0010] Helichrysum italicum (Roth) G. Don fil. (Asteraceae) (immortelle), especially its anti-inflammatory and antioxidant phenolic flavonoids [e.g. rutoside (quercetin-3-O-rutinoside), apigenin, luteolin] have anti-inflammatory effects similar to corticosteroids, inhibit enzymatic and non-enzymatic free radical reactions (e.g. lipid peroxidation), and promote tissue regeneration. Previously, immortelle was not used at all for glaucoma and eye diseases, either experimentally or in folk medicine.BRIEF DESCRIPTION OF THE INVENTION

[0011] The invention relates to a combination of active agents that is suitable for use in the treatment or prevention of a neurodegenerative disease, wherein the combination of active agents comprises or preferably consists of extracts of the following plants: Rosmarinus officinalis, Foeniculum vulgare, Helichrysum italicum.

[0012] The invention further relates to a method for the treatment or prevention of a neurodegenerative disease, comprising administering a combination of active agents to a subject in need thereof, wherein the combination of active agents comprises or consists of extracts of the following plants: Rosmarinus officinalis, Foeniculum vulgare, Helichrysum italicum.

[0013] The invention further relates to an extract of Foeniculum vulgare for use in the treatment or prevention of a neurodegenerative disease in the eye.

[0014] The invention further relates to a method for the treatment or prevention of a neurodegenerative disease in the eye, comprising administering an extract of Foeniculum vulgare to a subject in need thereof.

[0015] The invention further relates to an extract of Helichrysum italicum for use in the treatment or prevention of a neurodegenerative disease of the eye.

[0016] The invention further relates to a method for the treatment or prevention of a neurodegenerative disease of the eye, comprising administering an extract of Helichrysum italicum to a subject in need thereof.

[0017] Preferably the neurodegenerative disease is an impairment of the retina or the optic nerve. Preferably the neurodegenerative disease of the eye is an impairment to the cornea.

[0018] The invention further relates to a composition comprising extracts of the following plants: Rosmarinus officinalis, Foeniculum vulgare, Helichrysum italicum, wherein the composition is for use in the treatment or prevention of a neurodegenerative disease. Preferably the composition comprises a pharmaceutically acceptable excipient or carrier.

[0019] The invention further relates to a composition comprising: 0.01-50 m / m% of Rosmarinus officinalis extract, 0.01-50 m / m% of Foeniculum vulgare extract and 0.01-50 m / m% of Helichrysum italicum extract.

[0020] The invention further relates to a composition comprising as an active agent the extracts of the following plants or wherein the active agent consists of the extracts of the following plants: Rosmarinus officinalis, Foeniculum vulgare, Helichrysum italicum.

[0021] Preferably the treatment or prevention of the neurodegenerative disease comprises inhibiting apoptosis, preferably inhibiting apoptosis of neurons, pericytes or endothelial cells. Preferably the neurodegenerative disease is Parkinson’s disease.

[0022] Preferably the use in the treatment or prevention of an impairment of the retina or the optic nerve comprises treatment or prevention of glaucoma or retinopathy, preferably treatment or prevention of diabetic retinopathy. Preferably the damage of the retina or the optic nerve is glaucoma or retinopathy, preferably diabetic retinopathy. Preferably the extract of Rosmarinus officinalis comprises rosmarinic acid or consists essentially of rosmarinic acid or consists of rosmarinic acid. Preferably the the extract of Rosmarinus officinalis is E392 (food additive). Preferably the extract of Rosmarinus officinalis is essential oil: Rosmarini aetheroleum or an extract of Rosmarini folium. Preferably the extract of Rosmarinus officinalis comprises rosmarinic acid, preferably the rosemary extract comprises at least 5 m / m %, at least 10 m / m %, at least 20 m / m %, at least 50 m / m % or at least 80 m / m % rosmarinic acid.Preferably the extract of Foeniculum vulgare is Foeniculi amari herbae aetheroleum or an alcohol-free diluendum thereof. Preferably the extract of Foeniculum vulgare comprises rosmarinic acid, preferably at least 5 m / m %, at least 10 m / m %, at least 20 m / m % or at least 50 m / m % of rosmarinic acid.

[0023] Preferably the extract of Helichrysum italicum is a hydrolate of Helichrysum italicum. Preferably the extract of Helichrysum italicum is Helichrysi italici aetheroleum or an extract of Herba Helichrysi. Preferably the extract of Helichrysum italicum comprises rosmarinic acid, preferably at least 5 m / m %, at least 10 m / m %, at least 20 m / m % or at least 50 m / m % of rosmarinic acid.

[0024] Preferably the ratio of the ingredients (rosemary extract or rosmarinic acid: fennel extract: immortelle extract) may be 0.1-0.9:0.1-0.9:0.1-0.9 (preferably based on weight or volume), most preferably about 1:1:1 (preferably based on weight or volume).

[0025] Preferably the combination of active agents, the extract of Foeniculum vulgare or the extract of Helichrysum italicum is formulated in a pharmaceutical composition, comprising a pharmaceutically acceptable excipient.

[0026] Preferably, the composition is a composition for ocular administration, preferably eyedrops, or a composition for intranasal administration, preferably a nasal spray or nasal drops. Preferably, the composition is a liquid, tablet, cream, ointment, capsule, tea mixture, powder, suspension, emulsion, (dermal) patch or carrier-based, e.g. contact lens. Preferably, the composition is a pharmaceutical composition, a non-pharmaceutical medicinal composition, a food supplement, a food or a cosmetic composition. Preferably, the composition is for parenteral administration. Preferably, the composition comprises a pharmaceutically or veterinarily acceptable excipient or carrier. Preferably, the composition comprises a cosmetically acceptable excipient or carrier. Preferably, the composition comprises an excipient or carrier acceptable in food.

[0027] Preferably, the excipient or carrier is, for example, water, physiological saline, buffer, hyaluronic acid derivative, sodium hyaluronate, viscosity-increasing agent, wetting or humectant agent, surfactant, stabilizer, preservative, oily carrier.

[0028] Preferably, the composition is for intraocular or intranasal administration. Preferably, the composition for intraocular or intranasal administration comprises a mucoadhesive, viscoelastic, moisturizing or film-forming agent, such as sodium hyaluronate or other hyaluronic acid derivative. Preferably, the composition for intraocular or intranasal administration comprises 0.01-50 w / w% Rosmarinus officinalis extract, 0.01-50 w / w% Foeniculum vulgare extract, 0.01-50 w / w% Helichrysum italicum extract and 0.1-50 w / w% viscoelastic agent (e.g. sodium hyaluronate).

[0029] BRIEF DESCRIPTION OF THE FIGURES

[0030] Figure 1 Changes in intraocular pressure in Sprague-Dawley rats during the 8 experimental weeks. Intra-camerally applied microbeads significantly increased intraocular pressure. (*) p < 0.05 Bead + P vs PBS + P; (#) p < 0.05 Bead + P vs Bead + H(X); (f) p < 0.05 Bead + H vs PBS + P. The time of microbead administration is indicated by an arrow (J.) in the graphs. Abbreviations: PBS + P: Absolute control group; PBS + H: drug-treated control group; Bead + P: placebo-treated glaucoma group; Bead + H: drug-treated glaucoma group; (X): preparation containing the combination of active ingredients; (I): Preparation containing Rosmarinus officinalis extract; (II): Preparation containing Foeniculum vulgare extract; (III): Preparation containing Helichrysum italicum extract. H = Herbal (herbal-based) eye drops; IOP = intraocular pressure; P = placebo (artificial tears); PBS = phosphate buffer saline.Figure 2 The main signaling pathways indicated in neurodegenerative diseases (e.g. glaucoma and Parkinson’s disease) in a self-constructed diagram. Our combination of herbal active ingredients exerts its neuropro-tective effect through the molecular pathways highlighted here. The fem leaf symbol ($) denotes markers previously identified by Western blot, while the cloverleaf symbol ( *) denotes molecules confirmed in the Parkinson’s cell model. The T-shaped symbol refers to inhibitory processes. Downward arrows (J.) indicate a decrease in protein expression, and upward arrows ( ) indicate an increase in it, as a result of the combination treatment. The symbol for ferrous ion (Fe2+) refers to the nodes involved in neurodegeneration, affected by intracellular iron metabolism and ferroptosis. Abbreviations: IOP↑: increased intraocular pressure, Bax: Bcl-2-associated X-protein, Bcl-2: B-cell lymphoma 2, BDNF: brain-derived neurotrophic factor, COX-2: cyclooxygenase-2, CREB: cAMP response element binding protein, DNA: deoxyribonucleic acid, GFAP: glial fibrillary acidic protein, GPX: glutathione peroxidase, HIF1α: hypoxia-inducible factor 1-alpha, HO-1: heme oxygenase-1, IL: interleukin, LOX: lipoxygenase, MDA: malondialdehyde, NFKB: nuclear factor K-B, p38-MAPK: p38 mitogen-activated protein kinases, RhoA: Ras homolog family member A, ROCK: Rho-associated coiled-coil kinase, ROS: reactive oxygen radicals, SOD: superoxide dismutase, TNFa: tumor necrosis factor alpha, VEGF: vascular endothelial growth factor.

[0031] Figure 3 Fasting blood glucose levels in the experimental groups during the 5 -week follow-up period. The figure shows the temporal development of fasting blood glucose levels in the four experimental groups during the study. The measurements were made after an overnight fast in all cases. The values represent the mean per group with the standard error (SEM). In the control and control + herbal active ingredient treated groups, blood glucose levels remained in the normal range during the entire study period. In contrast, persistent hyperglycemia developed in the STZ-treated diabetic groups starting from the first week. The persistent fasting blood glucose levels above 13.9 mmol / L clearly confirmed the successful development of type 1 diabetes mellitus in the STZ-treated animals. Figure 4 Representative images of the peripheral retinal region on Brn3a-immunolabeled retinal whole-mount preparations. In the images, retinal ganglion cells were marked with a mask after automatic image processing; the numbers shown in the images indicate the number of ganglion cells identified in the given field of view. In the diabetic, vehicle-treated group, the density of ganglion cells was visibly reduced, while in the diabetic group treated with the combination of herbal active ingredients, the cell density proved to be more preserved. In the control groups, a high and homogeneous ganglion cell distribution was observed. The figure clearly illustrates the neurodegeneration associated with diabetes and the neuroprotective effect of the combination of herbal active ingredients.

[0032] Figure 5 Peripheral retinal ganglion cell (RGC) numbers in a diabetic retinopathy model. The figure shows the number of RGCs determined in peripheral retinal regions on whole-mount retinal preparations in the different experimental groups. The bars indicate the averaged ganglion cell numbers per individual, the error bars represent the standard error of the mean (SEM), while the individual points correspond to individual measurements. In the diabetic vehicle-treated group (Diabetes), the peripheral RGC number was significantly reduced compared to the control group, which is indicative of diabetic neurodegeneration. In contrast, in the diabetic group treated with the combination of herbal active ingredients (Diabetes + drug), the ganglion cell number was significantly higher compared to the diabetic, vehicle-treated group and did not show a significant difference compared to the control values, indicating the neuroprotective effect of the treatment. In the control groups, drug treatment alone did notcause a significant change in peripheral RGC number. Legend: * p < 0.05 compared to the control group, # p < 0.05 compared to the diabetic + vehicle-treated group.

[0033] Figure 6 Effect of the combination of herbal active ingredients on the expression of proteins associated with apoptosis and cell protection in diabetic retina. Relative expression changes of selected proteins associated with apoptosis and cell protection (BAD, cIAP-2, HSP27, p53, SMAC, HSP70) compared to the control group (control = 100%). In the diabetic group, pathological expression changes were observed for several markers: the expression of proapoptotic proteins (BAD, p53, SMAC) was increased, while proteins associated with the cell protection response showed a significant stress-induced increase (HSP27, HSP70, cIAP-2). In the diabetic group treated with the combination of herbal active ingredients, these differences were reduced in several cases or approached the control. BAD expression was decreased compared to untreated diabetic animals, while the expression of cytoprotective and antiapoptotic proteins (cIAP-2, HSP27, HSP70) was further increased, suggesting an adaptive, protective response.

[0034] Abbreviations:

[0035] AChE acetylcholinesterase

[0036] Al / TRPA1 ankyrin 1 receptor

[0037] A2 / TRPV1 transient receptor potential vanilloid 1

[0038] AD Alzheimer’s disease

[0039] AMPK AMP-activated protein kinase

[0040] ATRA all-trans retinoic acid

[0041] ATP adenosine triphosphate

[0042] AIF apoptosis inducing factor

[0043] Bax Bcl-2-associated X protein

[0044] Bcl-2 B-cell lymphoma 2

[0045] BChE butyrylcholinesterase

[0046] BDNF brain-derived neurotrophic factor

[0047] BV-2 murine microglial cell line

[0048] Brn3a brain-specific homeobox / POU domain protein 3A

[0049] Casp3 caspase-3 (cysteine-aspartic acid protease)

[0050] CCT central corneal thickness

[0051] COX cyclooxygenase

[0052] COX-2 cyclooxygenase-2

[0053] CREB cAMP response element-binding protein

[0054] CX3CL1 fractalkine chemokine

[0055] DBS deep brain stimulation

[0056] DMEM Dulbecco ’ s Modified Eagle Medium

[0057] DNS DNADMSO dimethyl sulfoxide

[0058] ELISA enzyme-linked immunosorbent assay

[0059] ERG electroretinographyFAC ferric ammonium citrate

[0060] Fe2+ferrous ion

[0061] FoNo formulae normales

[0062] FP / FPN ferroportin

[0063] FTH ferritin heavy chain

[0064] GABA y-amino-butyric acid

[0065] GAE gallic acid equivalent

[0066] GAPDH glyceraldehyde-3-phosphate dehydrogenase

[0067] GCL ganglion cell layer

[0068] GFAP glial fibrillary acidic protein

[0069] GPx / GPX glutathione peroxidase

[0070] GSH reduced glutathione

[0071] Hif1α hypoxia-inducible factor-1-alpha

[0072] HO-1 heme oxygenase-1

[0073] IL interleukins

[0074] ILM internal limiting membrane – membrana limitans internaIOP intraocular pressure

[0075] IS internal segment

[0076] LC liquid chromatography

[0077] LOX / 5-LOX lipoxygenase / 5-lipoxygenase

[0078] MAO-B monoamine oxidase B

[0079] MDA malondialdehyde

[0080] MPTP 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine MS mass spectrometry

[0081] NADPH-oxidase NADPH oxidase

[0082] NFKB nuclear factor kappa B

[0083] OCT Optical Coherence Tomography

[0084] OCT-A Optical Coherence Tomography Angiography OLM outer limiting membrane - membrana limitans externa ONL outer nuclear layer - stratum nucleare externum OPL outer plexiform layer - stratum plexiforme externum PAC protein antioxidant capacity

[0085] PB phosphate buffer

[0086] PBS phosphate buffer saline

[0087] PBST phosphate buffer saline with Tween™ detergent PCAG primary closed angle glaucoma

[0088] PD Parkinson’s disease

[0089] PGE2 prostaglandin E2

[0090] PKA / PKC protein kinase A / protein kinase C

[0091] POAG primary open angle glaucomaqPCR quantitative polymerase chain reaction

[0092] Rasagiline rasagiline

[0093] RGC retinal ganglion cell

[0094] RNFL retinal nerve fiber layer - stratum neurofibrarum

[0095] ROCK Rho-associated coiled-coil kinase

[0096] ROS reactive oxygen species

[0097] RPE retinal pigment epithelium - stratum pigmenti

[0098] retinae

[0099] RP-HPLC Reversed-phase high-performance liquid chromatography

[0100] SDS-PAGE sodium (Na-) dodecyl-sulfate polyacrylamide gel electrophoresis

[0101] SEM standard error of mean

[0102] SOD superoxide dismutase

[0103] SMAC small-molecule antioxidant capacity

[0104] TBS Tris buffered saline

[0105] TE Trolox equivalent

[0106] TfR1 transferrin receptor 1

[0107] TNFa tumor necrosis factor alpha

[0108] TR total retinal thickness

[0109] TRP-csatomak transient receptor potential channels

[0110] VEGF vascular endothelial growth factor

[0111] DETAILED DESCRIPTION OF THE INVENTION

[0112] The terms “combination of active agents”, “combination of herbal active agents”, “combined active agents”, “combined herbal active agents “, “complex active agents”, “complex herbal active agents “ and “active (herbal) agents mixture”, are used interchangeably in the description and refer to a combination or mixture of an extract of Rosmarinus officinalis, an extract of Foeniculum vulgare and an extract of Helichrysum italicum unless the context requires otherwise.

[0113] Compositions, active ingredient combinations and methods for the treatment of the glaucoma disease group The glaucoma disease group may be understood as a chronic neurodegenerative disease or part of it due to the destruction of retinal ganglion cells, which in its biochemical pathomechanism is associated with an inflammatory reaction mediated by increased inflammatory factors in the lamina cribrosa, retina and its vessels, the structures of the iridocorneal angle, the trabecular meshwork and the aqueous humor and with harmful free radical formation. Elevated intraocular pressure values are considered the most important risk factor for the glaucoma disease group. It was an aim to develop a preparation, primarily an eye drop, which, with the triple effect of reducing inflammation, antioxidant effect and promoting neuroprotection would be able to slow down the progression of irreversible optic neuropathy, which develops as a complication of the disease, in addition to the classic reduction of intraocular pressure.

[0114] according to the invention contains or consists of: rosemary extract (e.g. Rosmarinus officinalis essential oil: Ros-marini aetheroleum; Rosmarini folium extract; E392 (food additive) or rosmarinic acid), fennel extract (e.g. essential oil: Foeniculum vulgare essential oil: Foeniculi amari herbae aetheroleum, diluendum made from essentialoil: Diluendum foeniculi sine alcoholo FoNo ex aetheroleo Foeniculum vulgare, aqueous extract of Foeniculi dul-cis fructus, extract of Semen Foeniculi) immortelle extract (e.g. hydrolate: Helichrysum italicum hydrolate; He-lichrysi italici aetheroleum, extract of Herba Helichrysi). The ratio of the components (rosemary extract or ros-marinic acid:fennel extract: immortelle extract) in the combination of active agents may be 0.1-0.9:0.1-0.9:0.1-09 (preferably by weight or volume), particularly preferably 1:1:1 (preferably by weight or volume). Preferably, the rosemary extract contains rosmarinic acid, preferably the rosemary extract contains at least 5% by weight, at least 10% by weight, at least 20% by weight, at least 50% by weight or at least 80% by weight of rosmarinic acid. In order to be able to examine (and achieve) the intraocular pressure-lowering, anti-inflammatory and neuroprotective effects required for the treatment of glaucoma, we have developed a pharmaceutical formulation (eye drops) that can be easily and safely applied non-invasively, even several times a day. One of its outstanding advantages lies in the user-friendly applicability of the active agents combination. In addition, local therapy (compared to oral administration) allows for the rapid penetration of the active agents into the eye tissue in relatively high concentrations, thus resulting in the development of their protective efficacy within a short time. In accordance with the requirements for eye drops, the preparation(s) we have produced and the one included in the example are also water-based, the active ingredients are polar, and the eye drops are isotonized, sterile and preserved.

[0115] The herbal combinations of the invention contain active ingredients that can be easily extracted from herbs and also have a natural antioxidant effect. This additional advantage, in addition to the beneficial health effects, can also ensure the durability and stability of the eye drops through biochemical processes. The advantages of the small amount of natural essential oil content of the water-based preparation compared to traditional, aqueous only suspensions are that they can achieve a higher concentration of active agent in the tear, conjunctiva and cornea. The higher active agent concentration thus achieved in the treated tissue also results in a lower number of instillations to be used during the therapy, which also minimizes the chance of chemical reactions -irritations developing in the eye area. In addition to all this, in the case of a preparation containing a small amount of oily phase, the sterilization process used in the manufacturing processes of the product is also simplified compared to water only based preparations.

[0116] Our herbal eye drops mixed with standard artificial tears are a stable preparation, with a metabolic rate of 20% after 14 days at room temperature. The preparation did not cause allergic or toxic side effects or complications in Sprague-Dawley (172 eyes) rats. It is well tolerated, easy to use and dose. It significantly reduced intraocular pressure in microbead-implanted rats and permanently maintained it at the same level as the control groups. Pharmacological intraocular pressure reduction with the combination of our herbal active agents is beneficial for the glaucoma disease group, however, it is important to note that this cannot be achieved in the same way by using the active ingredients separately. When using the three herbal extracts in combination, the fact that not only the positive pharmacological effects are more pronounced, but they can also reduce each other's possible side effects is also valid. During the testing of the combined preparation we intend to use, we did not experience any ophthalmological and / or other generalized changes.

[0117] The combination of active agents reduces intraocular pressure

[0118] The risk factor for glaucoma is high intraocular pressure (IOP), a complication of which is progressive optic neuropathy, which, if untreated, causes irreversible visual impairment in a significant proportion of cases.

[0119] We hypothesize that F. vulgare may have an inherent IOP-lowering effect either on non-pigmented cells of the ciliary body (e.g. P-blockers) or by improving uveoscleral outflow (e.g. prostaglandin analogues). The additivelOP-lowering effect of R. officinalis and H. italicum may be explained by an anti-inflammatory mechanism similar to that of steroids. Topical dexamethasone (e.g. Maxidex®, Alcon, Hungary) is also used in the clinical management of primary acute angle closure attacks, as studies have also confirmed the consequent lOP-lowering effect of steroid-based anti-inflammatory therapy by inhibiting the NFKB and COX inflammatory pathways in both humans and rats (Huang, W. et al. Combined Subconjunctival Injection of Dexamethasone for the Management of Acute Primary Angle Closure: A Randomised Controlled Trial. Br. J. Ophthalmol. 2020, 104, 87–91). Given that approximately 10% of the population are steroid responders, i.e. respond to periocular steroid therapies with painless extreme IOP spikes, they can insidiously progress to painless glaucomatous visual impairment. In addition, longterm use of steroids also leads to secondary open-angle glaucoma through remodeling of the trabecular meshwork, so the herbal combination of the invention may be a beneficial choice for steroid responders and glaucoma patients. Chronic elevation of intraocular pressure due to closure of the iridocorneal angle or increased resistance of the trabecular meshwork can cause atrophy of the ciliary body, which leads to reduced aqueous humor production and thus to a decrease in IOP. Chronic IOP elevation over weeks also represents a 10–19% risk of progression per mmHg in human data. The formulation used in the examples maintained the average IOP values of the treated group at baseline compared to the absolute control group during the 8-week experimental period.

[0120] The combination of active agents according to the invention is neuroprotective and can be used for the treatment of retinal atrophy

[0121] In glaucoma therapy, it is not sufficient to demonstrate therapeutic efficacy based on IOP values alone, as glaucoma progression can occur in the background even with low intraocular pressure values (e.g. in the case of high myopia and normotensive glaucoma). The combination of active agents according to the invention has proven to be protective in terms of preserving the integrity of RGCs.

[0122] OCT examination is an important element in the diagnosis of glaucoma and can be a guide for the estimation of progression. In our study, histological images supported by in vivo OCT retinal images showed that the retinal layers of placebo-treated animals injected with microbeads showed signs of severe degeneration compared to PBS controls and the treated glaucoma group. The combination of active agents proved to be protective in all retinal layers. It is known from the literature that in glaucomatous humans or primates, in addition to retinal ganglion cells, damage to the entire vertical pathway can be observed, which is indicated by a significant decrease in the outer retinal photoreceptor layer. We also saw this observation in the OPL-ONL + IS-RPE layers.

[0123] The combination of active agents has a protective effect on visual function in glaucoma

[0124] During ERG wave analysis, light reactions were significantly reduced in the glaucoma, vehicle-treated group. However, in glaucomatous eyes treated with the active agent, the waveforms were almost the same as in the PBS-injected groups, indicating significant functional protection. Using Western blot protein analysis, we confirmed that our eye drops comprising the combination of active agents have neuroprotective (inhibiting apoptosis of retinal neurons) and hypoxia-induced neovascularization inhibitory effects, as demonstrated by VEGF, HIF-la, BDNF, pro-BDNF, NFKB, GFAP, Bax, CREB, p38-MAPK, Caspase3 protein markers. The effect of the individual herbal extracts does not reach the antiglaucoma effect of the combined preparation.

[0125] The combination of active agents has a protective effect on the retinal vascular network

[0126] The “vascular” pathomechanism of glaucoma assumes that optic nerve damage and disease progression are related to changes in the retinal vasculature. Microcirculatory changes in the retina and choroid have been observed in both glaucomatous and diabetic patients, and ocular circulatory disturbances have led to retinal damage. Perfusionof the optic disc depends on systemic blood pressure, IOP, and autonomic autoregulatory mechanisms that support RGCs both metabolically and functionally. Vascular dysregulation due to IOP fluctuations has a more detrimental effect on glaucoma progression than circulatory decline caused by stable suboptimal IOP. Dysregulation of retinal and optic disc circulation can be associated with RGC destruction and, therefore, with the progression of optic neuropathy.

[0127] The retinal vascular network of glaucomatous animals treated with the combination of active agents showed a similar morphology to that of the control groups, while in the glaucomatous controls we observed vascular lesions, microaneurysms, micro-angiopathies, and a percentage decrease in vascularization, indicating an ischemic state of the retina and the development of retinal damage.

[0128] Amato and colleagues were able to demonstrate the anti-apoptotic and neuroprotective effects of per os Mentha spicata extract in their glaucoma rat model by detecting NFKB [Amato, R. et al. Efficacy of a Spearmint (Mentha Spicata L.) Extract as Nutritional Support in a Rat Model of Hypertensive Glaucoma. Transl. Vis. Sci. Technol.

[0129] 2023, 12], NFKB is a redox-sensitive mediator of many different cellular processes and is present in almost all cell types. This protein complex is inactive in the basal state, but is activated by various stimuli (e.g. hyperglycemia, hypoxia, inflammation, etc.) [Rak, T. et al. Complementary Approaches to Retinal Health Focusing on Diabetic Retinopathy. Cells 2023, Vol. 12, Page 26992023, 12, 2699], Upon activation, IKB (inhibitor of KB) proteins are phosphorylated by IKB kinases in the cytoplasm, and NFKB is then translocated into the nucleus. As a transcription factor, NFKB regulates the transcription of numerous genes involved in immune (adaptive, innate) and inflammatory responses, such as pro -inflammatory cytokines, adhesion molecules, and chemokines. In the aging retina, NFKB is expressed at higher levels and is a key mediator of Muller cell and microglia activation in response to various cellular stresses. After the onset of various retinopathies (diabetic retinopathy and glaucoma), cells of the ganglion cell layer (GCL) and inner nuclear layer (INL) have been shown to express NFKB at increased levels [Rak, supra].

[0130] The neuroprotective, anti-inflammatory and anti-glaucoma effects of the combination of active agents are achieved through different signaling pathways

[0131] The neuronal viability of the retina is based on several fundamental homeostatic processes and discrete signaling pathways. Its neuronal complexity, high metabolic demand, and limited regenerative capacity make it extremely vulnerable to a variety of intracellular and extracellular stressors. If this stress threshold is exceeded, various defense and survival mechanisms are activated. Metabolic stressors can have diverse and severe consequences in the retina. Several key molecular players contribute to the development of retinal diseases. Related to this, cellular pathways such as oxidative stress, autophagy and immune cascade malfunction, mitochondrial dysfunction, endoplasmic reticulum stress, alterations in apoptotic pathways, etc. are activated. In addition, neuroinflammation, glial cell activation, and glutamate excitotoxicity are also major players in the pathogenesis.

[0132] Cellular stress induced by elevated intraocular pressure in retinal astrocytes and glial cells can be detected by the protein GFAP (glial fibrillary acidic protein). Excessively elevated GFAP levels are an experimentally detectable marker of metabolic stress in retinal tissue, which is a compensatory response for the survival of retinal Muller cells and astrocyte glial cells.

[0133] The Caspase cascade and the Bcl-2 / Bax pathways play important roles in the intrinsic apoptotic processes. When apoptosis is initiated, Bax translocates to the mitochondrial outer membrane to promote permeability by openingpores. Cytochrome C is gradually released into the cytoplasm and further activates the Caspase cascade to induce apoptosis.

[0134] p38-MAPK is a family of serine / threonine protein kinases that are activated in response to physical stress or injury. Of the four identified p38-MAPKs, p38α and p38β are ubiquitously expressed (ubiquitous proteins), while p38γ and p38δ are tissue-specific. p38-MAPK is activated by phosphorylation at downstream targets, leading to changes in gene expression. In this way, it performs important functions: activation of transcription factors, production of inflammatory cytokines, apoptosis, cell survival, growth and / or differentiation pathways, tissue remodeling and maintenance of the cytoskeleton. Activation of the p38-MAPK pathway has been associated with neurodegenera-tive Alzheimer's disease, Parkinson's disease and the glaucoma disease group [Lambert, W. S.; Pasini, S.; Collyer, J. W.; Formichella, C. R.; Ghose, P.; Carlson, B. J.; Calkins, D. J. Of Mice and Monkeys: Neuroprotective Efficacy of the P38 Inhibitor BIRB 796 Depends on Model Duration in Experimental Glaucoma. Sci. Rep. 2020, 10], By inhibiting this, our combined herbal active agents protected against RGC axonal transport deficiency and axonal loss in the Bead + H(X) group of rats.

[0135] The pre-pro-BDNF and then the cleaved pro-BDNF precursor, which are stored in dendrites or axons, are cleaved intracellularly or extracellularly to produce mature BDNF protein. It is mainly expressed in RGCs and Muller glia cells. “BDNF” is released in an activity -dependent manner as a mixture of pro- and mature BDNF forms. In its mature form, BDNF specifically binds to tyrosine kinase receptors (TrkB) and promotes cell survival, i.e. neuroplasticity. proBDNF is considered to be part of the regulatory mechanism of BDNF activity in non-pathological conditions.

[0136] In neurons, CREB activity has been implicated in a variety of intracellular processes, including proliferation, differentiation, survival, long-term synaptic potentiation, neurogenesis, and neuronal plasticity. Activated CREB promotes BDNF expression, while BDNF promotes CREB activation through tropomyosin receptor kinase (Trk) B receptors. CREB inhibition induces cell death through a pro-apoptotic pathway, whereas chronic CREB activation induces neuronal loss through an excitotoxicity mechanism. These data suggest that MAPK-CREB activation differs in acute and chronic RGC injury. In a chronic monkey glaucoma model, three animals showed immunohistochemical evidence of MAPK-CREB pathway activation in glial cells and RGCs through c-Fos expression. In addition, CREB is known to mediate hypoxia-induced expression of several genes, including VEGF-A and its receptors, thus playing a role in pathological retinal neovascularization.

[0137] The retinal hypoxia pathway is mediated by HIF1α, which initiates neovascularization of the retina, optic nerve head, and iris through the VEGF molecule. Dysregulation of retinal and papillary circulation can be associated with the destruction of RGCs, thus with the progression of optic neuropathy. Immunohistochemical studies also confirmed that the level of HIF1-α is increased in post-mortem glaucomatous retinal tissue, which is indicative of a hypoxic state. Under hypoxic conditions, HIF1α is an important endogenous signaling molecule that contributes to physiological changes in homeostasis, so the hypoxic microenvironment induces the activation of the transcription factor. HIF1α is upregulated by certain growth factors, primarily the production of VEGF-A in the RPE, ganglion cells, Muller cells, pericytes, as well as other glial cells, neurons, and vascular endothelial cells. Our complex herbal active agents has a VEGF inhibitory effect, thus reducing ocular neovascularization. VEGF inhibition has a beneficial effect in preventing hypoxia-induced neovascularization and its complications in several eye diseases, including glaucoma. Ischemia promotes microvascular degeneration and breakdown of the blood-retinal barrier (BRB). Pericyte and endothelial cell apoptosis, capillary occlusion, and increased vascular permeability are also present when microcirculatory pathology generates a hypoxic / ischemic environment in the retina. Due to insufficient oxygen supply and hyperglycemia, ROS production is increased and accelerates several intracellular changes, such as oxidative stress, endoplasmic reticulum stress, and mitochondrial dysfunction. In addition, neuron-glia interactions are altered, leading to damage to the entire neurovascular unit (consisting of glial cells, neurons, and the retinal vascular network). Oxidative stress exacerbates the expression of inflammatory mediators and VEGF levels. The development of neovascularization and vascular leakage marks the beginning of the proliferative phase.

[0138] In our successfully established glaucoma model, retinal stress reactions caused by elevated intraocular pressure and hypoxia-induced signaling pathways were initiated. These data suggest that our complex herbal active agents is antiapoptotic and reduces neuronal inflammation, thereby having a neuroprotective effect. An additional benefit is the inhibition of neovascularization.

[0139] Figure 2 shows the effects of our complex herbal active agents on the molecular pathways we have identified, thus demonstrating its potential use in glaucoma therapy.

[0140] After any pharmacotechnological extraction of the herbal parts (folium Rosmarini, herba Helichrysi, semen Fo-eniculi) and their drying in the form of powder (pulvis), their active ingredients can be dissolved at any time in a 2:1 ratio (pulvis: aqua purificata). The active ingredients of the herbal extracts can be detected and controlled with the help of marker compounds using HPLC: rosmarinic acid in the case of rosemary {Rosmarinus officinalis), trans-anethole and rosmarinic acid in the case of fennel (Foeniculum vulgare), and rutoside (quercetin-3-O-ruti-noside), rosmarinic acid, chicory acid, caffeic acid and luteolin in the case of immortelle (Helichrysum italicum). If we want to reduce the quality test to one marker molecule, rosmarinic acid is present in all three herbs.

[0141] Compositions, combinations of active agents and methods for treatins Parkinson 's disease

[0142] 1. tablazat The main active ingredient content (%) of the aqueous and oily extracts of the tested medicinal plants.

[0143] Active Salvia rosmarinus Foeniculum vulgare Helichrysum italicum ingredient

[0144] Aqueous

[0145] extract

[0146] Apigenin 0.01-0.2% 0.1-12.5% NA

[0147] Carnosic acida7.5-17.3% NA NA

[0148] Carnosol 0.5-3.0% NA 0.1-0.2%

[0149] Chlorogenic 0.5-2.0% 0.11-6.8% 3.38%

[0150] acid3

[0151] Luteolin 0.1-0.5% 0.1-0.3% NA

[0152] Rosmanol 0.5-2.0% NA NA

[0153] Rosmarinic 10.0-84.0% 14.9-18.0% 4.54%

[0154] acid3

[0155] Rutoside NA 0.01-0.3% 0.0-0.19%

[0156]

[0157] Oil extract

[0158] Geraniola0.5-1.8% NA 3.0-6.80%

[0159] Limonene31.5-5.0% 2.41-11.45% 2.17-6.07%

[0160] Linalool31.41-6.2% NA 2.8-4.7%

[0161] Trans-anethole30.1-3.45% 54.26-88.28% NA

[0162]

[0163] The main pharmacologically active compounds are potentially responsible for the effects of the herbal combination used in the experiment.

[0164] NA: no exact reference to the literature can be found.

[0165] The antioxidant, anti-inflammatory and anti-apoptotic effects of the main components of the extracts of our combined preparation were investigated in Parkinson's cell culture models induced by rotenone or 6-hydroxy dopamine (6-OHDA). An in vitro model was established using retinoic acid-differentiated SH-SY5Y cells, in which oxidative stress was induced by 6 -hydroxy dopamine (6-OHDA) or rotenone treatment. Monocultures of differentiated SH-SY5Y cells (in the case of linalool and geraniol) and co -cultures of differentiated SH-SY5Y and BV-2 microglia cells (in the case of rosmarinic acid, carnosic acid, trans -anethole and their mixture) were used for the studies. The different cultures were treated with the plant active agents, using rasagiline, a MAO-B inhibitor, as a positive control.

[0166] Our results show that the herbal active ingredients reduced oxidative stress by modifying the antioxidant capacity of differentiated SH-SY5Y cells and reduced the secretion of pro -inflammatory cytokines in differentiated SH-SY5Y cells. Furthermore, linalool and geraniol affect the expression of iron-related genes and cellular iron accumulation, which has not been investigated so far. In the case of co-cultures, rosmarinic acid, carnosic acid and trans-anethole also had antioxidant protection enhancing effects, at the same time they reduced iron-mediated cell death (ferroptosis) and apoptosis, and through their anti-inflammatory effects they reduced the secretion of IL-6 and TNF-a in both neurons and microglia. Based on our results, linalool, geraniol, rosmarinic acid, carnosic acid and trans-anethole may be promising alternative therapeutic candidates for neurodegenerative diseases e.g. in the treatment of glaucoma and Parkinson's disease. Our studies can be divided into two parts. Our first study model examines the effects of the main components linalool and geraniol on 6-OHDA-treated differentiated SH-SY5Y cells, while our second study model examines the effects of rosmarinic acid, camosic acid, trans-anethole and their mixture on the co-culture of 6-OHDA-treated differentiated SH-SY5Y cells and BV-2 microglia.

[0167] Our results demonstrate the beneficial effects of the active ingredients of our herbal combination (linalool, geraniol, rosmarinic acid, carnosic acid and trans-anethole) in an in vitro model of Parkinson's disease. In differentiated SH-SY5Y cells treated with rotenone and 6-OHDA, the main components linalool and geraniol reduced oxidative stress by enhancing antioxidant capacity and attenuated inflammation by reducing the secretion of pro-inflammatory cytokines. Linalool reduced IL-6 production, geraniol reduced IL-1β secretion, while both components reduced IL-8 levels, indicating their different effects on cytokine regulation. In addition, linalool and geraniol modified intracellular iron content and FTH expression, suggesting a protective role against iron-mediated ROS production. Both compounds increased the mRNA levels of the iron exporter FP and the expression of the antioxidant gene HO-1. Furthermore, both linalool and geraniol significantly decreased the mRNA expression of a-synuclein, indicating a role of essential oils in the regulation of a-synuclein.

[0168] Although our 6-OHDA-induced neurodegeneration model well represents the oxidative stress and iron accumulation observed in Parkinson's disease and glaucoma, it does not fully capture the complexity of the disease groups,as we used only neuronal cells, thus immune cells, such as microglia, which play a key role in the development and progression of the disease were missing.

[0169] To investigate the role of the immune system, the plant-derived active agents rosmarinic acid, carnosic acid and trans-anethole were tested in co-cultures of 6-OHDA-treated differentiated SH-SY5Y cells and BV-2 microglia, in which the two cell types are able to physically connect and also communicate chemically with each other through secreted substances.

[0170] Rosmarinic acid, carnosic acid and trans-anethole and their mixtures were able to reduce reactive oxygen radical formation and increase antioxidant capacity, including protein antioxidants, superoxide dismutase and glutathione peroxidase activity. In addition, they were able to reduce the degree of lipid peroxidation and thereby the process of ferroptosis, and also the degree of apoptosis by reducing the activity of the caspase-3 enzyme.

[0171] Rosmarinic acid reduced not only the production of TNF-a by neurons but also by microglia, while carnosic acid and the active ingredient mixture significantly reduced the levels of IL -6 secreted by both cells in addition to TNF -a. Trans-anethole differed from this effect only with regard to TNF-a secreted by microglia. Thus, we can say that the tested active ingredients reduced the inflammation mediated by BV-2 microglia in the co-cultures, which suggests that these substances may be suitable for modulating microglia activity (see Figure 2).

[0172] Compositions, combinations of active agents and methods for treating diabetic retinopathy

[0173] The results of our experiments described in the Examples support the potential of the cobination of active agents for the treatment of diabetic retinopathy at multiple, mutually reinforcing levels - metabolic validation, retinal structural changes, cellular neurodegeneration and apoptosis-related molecular pathways. Our results support the currently widely accepted concept that diabetic retinopathy has a pronounced neurodegenerative component even at an early stage. In the diabetic, vehicle-treated group, significant thinning was observed in several retinal layers - particularly in the full retinal thickness, the inner plexiform layer and the retinal pigment epithelium. These structural changes are consistent with the previously described effects of chronic hyperglycemia-induced oxidative stress, mitochondrial dysfunction and apoptosis. A notable finding is that the treatment with the combination of herbal active agents showed a layer-specific protective effect. In the case of the inner nuclear layer (INL), significant thinning was observed in the diabetic vehicle-treated group, while this change did not occur in the diabetic group treated with the combination of active agents. This suggests that the preparation is able to preserve the structural integrity of the INL in a diabetic environment, which is particularly important, since this layer plays a key role in the functioning of the retinal neuronal network. A similarly significant protective effect was demonstrated in the case of the retinal pigment epithelium, where the treatment with the combination of active agents significantly reduced the diabetes-induced thickness reduction. Protection of the RPE is particularly relevant for disease progression, as this layer plays a fundamental role in photoreceptor metabolism, maintenance of the blood-retinal barrier, and regulation of inflammatory processes.

[0174] Whole-mount analysis of retinal ganglion cells further supported the structural observations. In the diabetic, vehicle-treated group, pronounced ganglion cell loss was detected in the peripheral retinal regions, while in the diabetic group treated with the combination of herbal active agents, ganglion cell numbers were preserved and did not differ significantly from control values. This result clearly indicates that the preparation is effective in reducing the neuronal cell death associated with diabetes and has a true neuroprotective effect.

[0175] Molecular studies provide a mechanistic explanation for the observed structural and cellular protective effects. The significant 71.1% increase in the proapoptotic BAD protein in the diabetic group reflects the activation of themitochondrial apoptosis pathway. In contrast, the treatment with the combination of herbal active agents reduced the expression of BAD, suggesting that the preparation reduces the shift towards apoptosis. At the same time, the further increase in the expression of the antiapoptotic cIAP-2 in addition to the active agents treatment indicates that the preparation actively supports mechanisms promoting cell survival. The expression pattern of heat shock proteins (HSP27, HSP70) also suggests an adaptive, protective response. Although diabetes alone induced a significant stress response, the additional HSP70 elevation observed with the treatment with the combination of herbal active agents suggests that the preparation enhances cellular proteostasis and stress tolerance, which is particularly important in neural elements of the retina with low regeneration potential.

[0176] The increase in p53 and SMAC expression upon treatment with the combination of active agents is not interpreted as destructive cell death, but as a finely regulated, adaptive response that allows for the selective elimination of severely damaged cells while preserving the survival and functional integrity of intact cells. This “fine-tuning” of apoptotic pathways may be particularly beneficial in chronic diseases, where complete apoptosis inhibition could lead to the long-term persistence of dysfunctional cells.

[0177] The layer-specific structural protection, the preservation of ganglion cells, and the shift of the apoptotic balance towards cell survival together suggest that the preparation has general neuroprotective potential.

[0178] Examples

[0179] Glaucoma disease roup

[0180] Materials and methods

[0181] Ethics permit

[0182] The animal ethics permit was granted by the Baranya County Government Office under number BA02 / 2000-68 / 2022 (animal experiment permit reference number: KA-3637).

[0183] Animals

[0184] Sprague-Dawley rats (300-500g, 2-month old males, from Charles River Laboratories).

[0185] The animals were housed and their detailed housing conditions were as follows:

[0186] • type III H rat cage (https: / / animalab.eu / conventional-cages-for-rats-type-iiih) cage dimensions: 427x267 mm; 180 mm high = 820 cm2(minimum housing space: 800 cm2); floor area per animal: 450 cm2(2 animals / cage). The individuals were housed in small numbers, in accordance with legal requirements.

[0187] • food: SAFE A03 rodent food, Innovo Kft, LT / R rodent food, standard laboratory mouse, rat and hamster food (composition expressed in percentage, average values: protein (crude protein): 18.6%; lipid (crude fat): 4.1%; ash (crude ash): 5.5%; fiber (crude fiber): 3.9%; calcium: 0.79%; phosphorus: 0.6%; sodium: 0.22%. Added vitamins: Vitamin A (3a672a) 13625 lU / kg; Vitamin D3 (3a671): 2125 lU / kg; Vitamin E (3a700): 27 lU / kg. Trace elements: copper (3b405): 15 mg / kg; iron (3b103): 188 mg / kg; manganese (3b502): 33 mg / kg; zinc (3b603): 30 mg / kg), does not contain coccidiostats. In addition, the experimental animals received water ad libitum.

[0188] • cleaning twice a week

[0189] • animal house temperature was between 20-24 °C

[0190] • animal house humidity was 50-60%

[0191] • continuous air exchange in the animal house was 15-20x / h

[0192] • light / dark time in the animal house: alternated between 12 / 12 hoursThe animals were grouped as follows:

[0193] • (1) absolute control group (PBS injection into the anterior chamber (10 pl) + Hyabak artificial tear® eye drops) (n=l 1); see later in the results section, abbreviated as PBS + P group.

[0194] • (2) active agent-treated control group (PBS injection into the anterior chamber (10 pl) + herbal active agents in eye drops) (combined preparation from (X): R. officinalis', F. vulgar?, H. italicum active agents (n=7), separate study per active agent (I.) R. officinalis'. (n=5), (II.) F. vulgar?. (n=5), (III.) II. italicum'. (n=5); see later in the results section abbreviated as PBS + H.

[0195] • (3) placebo-treated glaucoma group (microbead injection into the anterior chamber (1 pm bead diameter; 10 pl; 7.2x106 beads / pl) + Hyabak artificial tear® eye drops) (n=22); see later in the results section abbreviated as Bead + P.« (4) active agent-treated glaucoma group (microbead injection into the anterior chamber (1 pm bead diameter; 10 pl; 7.2x106 beads / pl) + herbal active agents in eye drops) (combined preparation (X) from: R. officinalis; F. vulgare; H. italicum active agents (n=16), separate study per active agent (I.) R. officinalis (n=5), (II.) F. vulgare (n=5), (III.) II. italicum'. (n=5); see later in the results section abbreviated as Bead + H.

[0196] For the test groups (4) based on the ANOVA test (a = 0.05), we need a maximum of 345 experimental animals. Based on this, our planned sample size for the allergy test prior to the experiment is n=4 animals (8 eyes), for the herbal active agent test (in the case of a combined active agents) broken down into one phase: n=42 animals (84 eyes); for the individual herbal active agent test: n=40 animals (80 eyes); in total n=86 animals (172 eyesj. Deve-lopment of the animal model

[0197] The animals were anesthetized with a solution consisting of a mixture of intraperitoneal ketamine (rat: 90 mg / kg; Calypsol, Richter Gedeon, Hungary) and xylazine (rat: 10 mg / kg; Sedaxylan, Dechra, Netherlands). Afterwards, the eye and the surrounding tissue area were wiped with Braunol solution (B. Braun Medical AG, Switzerland) to prevent infections. Then, glaucoma was induced in both eyes of some of the experimental animals, thus forming our groups 3 and 4 (see above). For this purpose, fluorescent (580 / 603 nm) polystyrene microsbeads (Flu-oSpheres™ Polystyrene Microspheres; 10 pm Thermo Fisher Scientific; Waltham, MA, USA) (3.6 x 106 be-ads / ml; 10 pL / injection) were injected into the anterior chamber of the right and left eyes using a Hamilton syringe (33G). The main difficulty in microbead injection is keeping the beads in the anterior chamber, as it is difficult to create a wound-assisted clear corneal wound in rodents due to the thinness of the cornea (mean human central corneal thickness (CCT): 557.3 ± 34.3 pm (males) and 551.6 ± 35.2 pm (females), mean rat CCT: 159.08 ± 14.99 pm).

[0198] The other half of the animals (thus forming groups 1 and 2) were injected with PBS (Phosphate Buffer Saline = phosphate buffer-containing physiological saline solution) which is rapidly absorbed (10μl / eye) to create a “shamoperation” state. The same procedure was repeated two weeks after the injection.

[0199] The microbeads blocked the trabecular meshwork, thus reducing or completely eliminating the outflow and circulation of aqueous humor.

[0200] Following microbead implantation, the IOP elevation was successfully achieved as follows: in week 1, Bead + P, the mean value was 21.07 mmHg± 0.9, while in week 4, after the second bead administration, the mean value was 22.18 mmHg ± 0.9. Several animals achieved intraocular pressure values above 30 mmHg (the highest value was 42 mmHg in week 1, and 49 mmHg in week 4).

[0201] Animal pain monitoring and terminationDuring the experiment, in order to reduce the pain and suffering of the animals and to increase the efficiency of cooperation, all painful interventions were performed under general anesthesia (except for the eye drop procedure and intraocular pressure measurement). Therefore, a cocktail consisting of a ketamine -xylazine mixture was used during the development of the model and in vivo measurements (OCT, ERG). The depth of anesthesia was confirmed in each case by turning the animal onto its back and mechanically stimulating the tail and hind legs. After the examination procedures performed on the animals, the rats were placed in the observation room and then monitored until they regained full consciousness. After that, in addition to providing adequate drinking water and food, pain relief was applied (200mg / kg Algopyrin™ (Sanofi Aventis, Hungary). If a body weight loss of more than 15% was observed after the intervention, food was placed in the animals' cages to facilitate feeding. When terminating the animals, the humane endpoint used was decapitation under isoflurane (3 1 / min 3% Isoflurane, Akom Animal Health, Inc. Halocarbon Life Sciences, USA) and 2 1 / min oxygen 02) narcosis, which is the procedure that best minimizes the destruction and ischemic damage of the eye tissue.

[0202] Eye drop treatment for animalsEy drop treatment was applied to both eyes of the individuals in our study groups. The instillation began the day after the first bead administration, twice a day between 7-9 am and 5-7 pm. The placebo eye drop groups (this is part of the control and glaucoma group) received Hyabak® artificial tears containing 1% sodium hyaluronate base solution as treatment (Hyabak® (10ml), Laboratoires Thea, France). The other half of the control and glaucoma group receiving the active agent treatment received herbal active agents dissolved in 1% sodium hyaluronate-based artificial tears at a concentration of 0.5-2%, either as a combined preparation ((X) R. officinalis; F. vulgare; H. italicum active agents), or as individual active agents ((I.) R. officinalis, (II.) F. vulgare, (III.) H. italicum) with eye drop therapy.

[0203] Our combined preparation contains rosmarinic acid (rosmarinic acid >98% (HPLC), Sigma-Aldrich Corp. (St. Louis, MO, USA) as the main active ingredient of Rosmarinus officinalis (rosemary), which we mixed with dilu-endum made from the essential oil of Foeniculum vulgare (fennel; Diluendum foeniculi sine alcoholo FoNo ex aetheroleo Foeniculum vulgare, Adrienne Feller Cosmetics Zrt, Hungary), and with the commercially available hydrolate of Helichrysum italicum (immortelle; Helichrysum italicum hydrolatum, Adrienne Feller Cosmetics Zrt., Hungary).

[0204] Eye drop allergy and distress monitoring

[0205] Pain / distress was monitored using rodent distress scales (see Tables 2 and 3): the Rat Grimace Scale and the Rat Facial Activity Pain Coding.

[0206] Table 2 Rat Grimace Scale

[0207] Rat Grimace Scale

[0208] Appearance Clinical symptoms

[0209] Normal 0 Normal circulation, breathing 0 Lack of grooming 1 Slight deviations 1 Ruffled fur / bad odour 2 Circulatory and respiratory parameters differ by 30% 2 Rough fur / hunched posture 3 Circulatory and respiratory parameters differ by >50% 3 Nutrition / fluid intake Basic behavior

[0210] Normal 0 Normal 0 Uncertain: weight loss <5% 1 Mild deviations 1 Intake decreases: weight loss 10-15% 2 Less mobile / alert, becomes isolated 2

[0211]

[0212] No intake 3 Vocalization, self-mutilation, restless / apathetic 3 Provocation If more than 1 case has 3 points, then +1 point for every Normal 0 3 points

[0213] Slightly depressed / exaggerated response 1

[0214] Moderate deviation from expected 2

[0215] Agressive / precomatose reaction 3

[0216]

[0217] Table 3 Rat Facial Activity Coding (based on Liu, R. et al. Nanostructured Lipid Carriers as Novel Ophthalmic Delivery System for Mangiferin: Improving in Vivo Ocular Bioavailability. J. Pharm. Sci. 2012, 101, 3833-3844.) Rat Facial Activity Pain Coding

[0218] Orbital tightening

[0219] Rats in pain display a narrowing of the orbital area, a tightly closed eyelid, or an eye squeeze. As a guideline, any eye closure that reduces the eye size by more than half should be coded as a “2”. Note that sleeping rats display closed eyes, but of a relaxed nature, whereas a rat in pain may display a closed eye with tight orbital muscles. Sleeping rats should not be coded.

[0220] 0 1 2

[0221] Nose-Cheek flattening

[0222] Rats in pain display a lack of bulge on top of the nose (i.e., a flattening of the nose). In the “no pain” condition a clear bulge (the glabella) is present at the bridge of the nose. The whisker pads are also rounded and slightly puffed out, leaving a clear crease between the pads and the cheek. When in pain, the bridge of the nose flattens and elongates, causing the whisker pads to flatten. At this time the crease between the pads and the cheek is no longer present. In frontal headshots, the nose may appear narrower and longer.

[0223] 0 1 2

[0224] Ear changes (Position, Orientation, Shape)

[0225] The ears of rats in pain may be curled and pointed more than in the baseline position. In the baseline position ears are roughly perpendicular to the head, face forward, and are angled slightly backward. Importantly, the ears also have a rounded shape. In pain, the ears tend to fold, curl inwards and are angled forward. This curling of the ears tends to result in a “pointed” shape of the ears. In pronounced pain states, the ears are angled outward and are held close to 45° away from both the perpendicular axis and the nose. As a result, the space between the ears may appear wider relative to baseline

[0226] 0 1 2

[0227] Whisker changes

[0228] Rats in pain have whiskers that have moved from the baseline position and orientation. Whiskers start relaxed and drooping slightly downwards and, as pain progresses, tension in the pads increases and they become angled back along the head.

[0229] 0 1 2

[0230]

[0231] The potential corneal clouding of the eye drop preparations used was assessed using the Schreiber (Schreiber, W. et al. Combined Topical Fluconazole and Corticosteroid Treatment for Experimental Candida Albicans Kera-tomycosis. Invest. Ophthalmol. Vis. Sci. 2003, 44, 2634-2643) “Corneal Clouding Scale”: 0 - clear cornea; 1 -minor edema; 2 - corneal clouding in more than two quarters of the cornea; and 3 - complete corneal clouding. Potential conjunctivitis was assessed based on the degree of conjunctival hyperemia (1 - low; 2 - moderate; or 3 - highj. During the eight-week experiment, Sprague-Dawley rats did not show any allergic symptoms (e.g. itching, conjunctivitis, etc.), complications (e.g. chemical eye injury, corneal ulcer and perforation, periorbital epithelial deficiency due to itching and scratching, etc.), side effects (e.g. increased intraocular pressure, corneal opacity, corneal precipitates, etc.) either to the combined herbal eye drops or to the Hyabak® artificial tear used as vehicle and placebo. The cornea, conjunctiva and periocular region of the rats treated with the combined eye drops remained intact until the termination of the experiment. Minor comeal edema (Corneal Clouding Scale 2 and minor conjunctival hyperemia type 1) developed in five eyes to the eye drops containing Helichrysum italicum extract. The total score on the Rat Grimace Scale was “0” for all treated animals in each group.

[0232] Since no eye drop treatment was associated with painful palpebral fissure constriction and facial distortion in any animal, the total score on the Rat Facial Activity Pain Coding was also given a “0” score.

[0233] Testing the stability of the active agent

[0234] Rosmarinic acid was chosen as the marker compound for the eye drops because it is readily available (>98% (HPLC) Rosmarinus officinalis L. dehydrated extract, Sigma Aldrich, Germany), easily detected and measured, and is present in well-defined amounts in our eye drops. Analytical reversed-phase high-performance liquid chromatography (RP-HPLC) was performed on an Agilent 1200 series separation system with a diode array and multiple wavelength detector (Waldbronn, Germany) with a Luna C18(2) 100 A column (10 pm, 250 x 4.6 mm, Phenomenex, Torrance, CA, USA). Chromatography was performed at room temperature (+25°C), the flow rate was maintained at 1.2 ml min-1 at a wavelength of 220 nm [mobile phase solvent A: 0.1% TFA in Milli-Q water; solvent B: 0.1% TFA in acetonitrile (AcN)] with gradient elution. Mass spectrometry (MS) data were collected on a Waters SQ Detector (Milford, MA, USA) with an API mass spectrometer in positive ion mode. The stability of rosmarinic acid was investigated by liquid chromatography -mass spectrometry (LC-MS) in the medium we used: sodium hyaluronate artificial tear vehicle. First, 0.5 mg of rosmarinic acid was dissolved in 0.5 ml of solvent; after dissolution, the resulting liquids were divided in half. One half of the solvent was cooled and kept at +4 °C; the other half was kept at room temperature (+25 °C). After 3, 6, 8, 11 and 14 days, 40 pl of the indicated solutions were analyzed.

[0235] The metabolic rate of the eye drops is 5% on day 10 and 20% after 14 days, indicating that the herbal eye drops are stable at room temperature. During our experiments, the active agent was stored in isolation in a laboratory refrigerator at +4°C for all 8 weeks, and the depleted stock was replaced with fresh eye drops every week.

[0236] IOP measurement

[0237] The normal human intraocular pressure range is traditionally shown to be between 12 and 21 mmHg. The more accurate average human IOP range is 15 - 16 + 3 mmHg, while from 21 mmHg there is an increased risk of ocular hypertension and glaucoma. The average intraocular pressure range of Sprague -Dawley rats, based on previous studies, is 10 - 12 mmHg, measured with Tonopen 10.80 ± 1.03 mmHg and with Tonolab 15.10 ± 0.73 mmHg, which are statistically not significant (p = 0.1) [Szabo, E. et al. Retinoprotective Effects of PACAP Eye Drops in Microbead-Induced Glaucoma Model in Rats. Int. J. Mol. Sci. 2021, 22, doi:10.3390 / IJMS22168825; Choy, Y.-J.; Choi, J.-H. Comparison of Intraocular Pressure Values of Normotensive and Glaucomatous Rats Using Two Types of Tonometers. Korean J. Vis. Sci. 2018, 20, 589-596],One day before the procedure, intraocular pressure was measured in both eyes using a rebound tonometer (Ton-olab, Icare; Vantaa, Finland). Rebound tonometry is a method of measuring intraocular pressure used in both experimental rodents and human patients (especially children). The tonometer head rebounds from the corneal surface with a given force and time, and an arithmetic average IOP value is obtained from 6 consecutive measurement results. The shorter the time of rebound from the comeal surface, the higher the measured IOP value. According to the literature, the intraocular pressure values increased by microbead administration reached an average of 30.20 ± 2.67 (SD) mm Hg when measured with Tonopen and 37.90 ± 2.73 (SD) mm Hg with Tonolab, which were also not statistically different (p = 0.95) [Szabo supra, Choy, supra], thus both devices are valid choices for accurate monitoring of rat IOP. In order to avoid intraocular pressure fluctuations due to the circadian cycle, IOP measurements were performed at the same time of day throughout the experiment (8 weeks, once a week, between 7 and 9 a.m.). The average values of at least three consecutive measurements were used for each eye. The intraocular pressure measurements were always performed by the same experienced, routine ophthalmologist resident, which reduces the time the animals were exposed to distress.

[0238] Following microbead implantation, artificial closure of the iridocorneal angle was successfully achieved, and the resulting IOP elevation was as follows: in week 1, the mean value of Bead + P was 21.95 ± 1.37 mmHg, while in week 4, after the second bead administration, it was 22.59 ± 1.26 mmHg.

[0239] The intraocular pressure values measured at the beginning of the experiment did not differ significantly in any of the examined groups (Figure 1). After bead administration at week 0, a significant intraocular pressure difference (p < 0.001) developed at week 1 between the placebo-treated glaucoma group (Bead + P) and the glaucoma group treated with the combined active agents (Bead + H(X)) (Figure 1). This trend remained throughout the 8 weeks in the two microbead-injected groups (Figure 1), where the percentage changes in IOP are described in detail in Table 4. The differences between Bead + P and the other three groups were statistically significant (PBS + P: p < 0.001, PBS + H: p < 0.001, Bead + H: p < 0.001) starting from week 1 throughout the entire 8-week observation period (Figure 1 and Table 4). IOP maxima were observed after microbead injections at weeks 0 and 3 (Figure 1 and Table 4), demonstrating the efficacy of our successfully induced glaucoma model. IOP levels in the PBS + P, PBS + H and Bead + H(X) groups remained close to baseline over the 8 weeks (p < 0.05), demonstrating that our combination of active agents had a beneficial effect on the IOP -dependent pathomechanism of glaucoma. Furthermore, it did not induce any adverse effects in the healthy eye alone (Figure 1 and Table 4). Furthermore, compared to the absolute control group (PBS + P), Bead + P animals developed IOP values typical of secondary open-angle glaucoma (p < 0.001), in which placebo artificial tears did not provide a therapeutic response (Figure 1 and Table 4).

[0240] To confirm the synergy of the combined active agents, we examined the intraocular pressure-lowering effect of the active agents separately, the results are presented in Table 5. The intraocular pressure values measured at the beginning of the experiments, similarly to our previous experiences, did not differ significantly in any of the tested groups (p = 0.63). The IOP jump appearing after bead administration at weeks 0 and 3 was also significantly registered in the Bead + P (p < 0.0001 and p < 0.0001) and Bead + H(I) (week 2 p = 0.005 and week 3 p = 0.04) glaucoma groups compared to the PBS + P group. The percentage change broken down by week, despite the nonsignificant differences (Bead + H(X) p = 0.47; Bead + H(I) p = 0.28; Bead + H(II) p = 0.18; Bead + H(III) p = 0.64), does not achieve the same IOP reduction as the combined active ingredient. These observations show us that the individual herbal extracts are less effective individually against higher intraocular pressure spikes.During our monotherapy, the main water-soluble active ingredient of Rosmarinus officinalis, rosmarinic acid, significantly (p < 0.05) reduced intraocular pressure compared to the Bead + P group, except for weeks 1 (p = 0.07), 2 (p = 0.15) and 6 (p = 0.12), which was not supported by previous literature data. Despite the IOP-lowering effect, the intraocular pressure-lowering effect of the preparation in monotherapy would prove insufficient for the prevention of glaucoma progression, as it was significantly different compared to the PBS + P control group at weeks 2 (p = 0.005) and 3 (p = 0.04). In light of our results, we conclude that the reduction in glaucoma progression of the applied active ingredient could be least attributed to its intraocular pressure -lowering effect.

[0241] We were able to demonstrate the IOP-lowering effect of Foeniculum vulgare (similar to our preparation containing the combination of active agents), despite the fact that it reduced intraocular pressure during all 8 weeks after the first bead administration, considering the percentage reduction, it is not more effective compared to the combined preparation, especially after bead administrations. Based on these, it cannot be called an ideal intraocular pressure reducer in itself. Based on our later results, we already suggest that the extract, despite the IOP-lowering effect developed in the 8th week (Figure 1), does not participate in the development of neuroprotection, so it is not effective as an ideal anti-glaucoma monotherapy.

[0242] In the animals, a significant IOP reduction was achieved by the 8th week with the Helichrysum italicum extract, but this extract was not able to prevent the IOP spike following bead administration with the same percentage of efficacy. By the 7th week, the IOP values were significantly different compared to the PBS + P placebo control group (p = 0.03; Figure 12 / C and Table 4). The significant difference between the Bead + P and Bead + H(X) groups could explain that the herbal active ingredients play a role in reducing IOP. Based on Table 5, it can be compared that Rosmarinus officinalis (Bead + H(I)), Foeniculum vulgare (Bead + H(II)) and Helichrysum italicum (Bead + H(III)) reduce intraocular pressure compared to placebo artificial tears (Bead + P), but not as effectively as the combination of active agents (Bead + H(X)).

[0243] During the 8-week experimental period, the treated Bead + H(X) group maintained the mean IOP values at the baseline compared to the absolute control group (PBS + P) (Figure 12 / D). The individual active agents did not fully achieve this. In addition, the combination also effectively prevented the IOP spikes following bead administration in weeks 1 and 4 (Figure 1), which cannot be said about the individual active agents (Figure 1). Although there is no statistically significant difference between the Bead + H groups in Figure 1, the efficacy of the combined eye drops can be supported: based on Table 6, the Bead + H(X) group had the largest mean IOP reduction (-40.68%), which indicates the most favorable therapeutic response from a quantitative point of view. Considering the magnitude of the biological effect, hhis is valuable information, even if it is not statistically significant. The lack of statistical significance does not necessarily mean that there is no real effect, as the trend and magnitude of the effect may nevertheless be clinically relevant. The combined eye drop targets multiple pathomechanisms, and thus is expected to be more effective than single-component treatments due to the synergistic mechanism of action. The largest % reduction also supports this mechanistic theory. In light of the functional and morphological results described in the following chapters, the interpretation of IOP changes can be placed in a more complex and biologically relevant context.

[0244] Table 4 Percentage (%) changes in intraocular pressure compared to the absolute control group (PBS + P) during the 8-week trial with the combined eye drops. The percentage increase in intraocular pressure in the placebo artificial tears-treated glaucoma group (Bead + P) that was significant (p < 0.05 Bead + P vs PBS + P) compared tothe absolute control group, which occurred already in the first week after anterior chamber microbead administration, is indicated in bold. Negative percentage values indicate a decrease in IOP expressed as a percentage compared to the PBS +P group for the given week. Abbreviations: IOP: intraocular pressure; PBS + P: absolute control group; PBS + H(X): active agents-treated control group; Bead + P: placebo-treated glaucoma group; Bead + H(X): active agents-treated glaucoma group.

[0245] Weeks PBS + P PBS + Bead + P Bead +

[0246] H(x> H<x)

[0247] 0 0 11.13 -5.13 2.96

[0248] 1 0 6.12 78.83 -7.32

[0249] 2 0 10.60 68.65 5.83

[0250] 3 0 -3.43 83.93 2.89

[0251] 4 0 -17.62 73.58 -16.49

[0252] 5 0 -10.07 60.13 -7.49

[0253] 6 0 -12.09 37.50 -16.49

[0254] 7 0 -6.88 51.06 -2.14

[0255] 8 0 -6.85 57.41 -6.63

[0256]

[0257] Table 5 Percentage (%) changes in intraocular pressure compared to the absolute control group (PBS + P) during the 8 weeks of the active agent study. The percentage of significant increase in intraocular pressure compared to the placebo artificial eye control group (PBS + P) is indicated in bold. Negative percentage values indicate a % decrease in IOP compared to the PBS + P group at the given week. Abbreviations: IOP: intraocular pressure; PBS + P: absolute control group; PBS + H: active agent-treated control group; Bead + P: placebo-treated glaucoma group; Bead + H: active agent-treated glaucoma group; (I): Rosmarinus officinalis extract-containing preparation; (II): Foeniculum vulgare extract-containing preparation; (III): Helichrysum italicum extract-containing preparation.

[0258] Week PBS + P PBS + H PBS + H PBS + H Bead + P Bead + H Bead + H Bead + H (I) (II) (III) (I) (II) (III)

[0259] 0 0 -1.51 -1.31 -6.86 -5.13 -1.31 -0.71 -7.00 1 0 3.52 3.72 4.13 78.83 41.02 15.92 27.98 2 0 5.07 12.95 0.87 68.65 46.74 24.09 18.48 3 0 7.58 20.03 10.04 83.93 28.62 16.70 14.57 4 0 5.13 2.70 1.16 73.58 33.02 28.06 21.65 5 0 7.36 10.42 13.05 60.13 14.79 15.48 11.66 6 0 -13.20 -5.01 -10.19 37.50 16.34 2.49 6.90 7 0 6.22 4.84 12.76 51.06 2.35 15.98 19.45 8 0 9.76 0.12 9.76 57.41 15.55 9.09 5.99

[0260]

[0261] Table 6 Percentage (%) changes in intraocular pressure (IOP) values compared to the glaucoma group treated with artificial tears (Bead + P) during the 8 weeks of the combined eye drop test. Significant (p < 0.05 vs Bead + P)IOP elevation was already evident in the first week after anterior chamber microbead injection. Negative percentage values indicate a decrease in IOP, expressed as a percentage, compared to the weekly PBS + P group. Negative percentage values indicate a decrease in IOP, expressed as a percentage, compared to the weekly Bead + P group. Abbreviations: Bead + P: placebo -treated glaucoma group; Bead + H: active glaucoma group; (I): Rosmarinus officinalis extract-containing preparation; (II): Foeniculum vulgare extract-containing preparation; (III): Helichrysum italicum extract-containing preparation. (X): glaucoma group treated with the combination of active agents.

[0262] Weeks Bead + P Bead + H (X) Bead + H (I) Bead + H (II) Bead + H (III) 0 0 8.53 4.03 4.66 -1.96 1 0 -48.17 -21.14 -35.18 -28.43 2 0 -37.25 -12.99 -26.42 -29.75 3 0 -44.06 -30.07 -36.55 -37.71 4 0 -51.89 -23.37 -26.23 -29.91 5 0 -42.23 -28.32 -27.88 -30.27 6 0 -39.27 -15.39 -25.46 -22.26 7 0 -35.22 -32.25 -23.23 -20.93 8 0 -40.68 -26.59 -30.70 -32.67

[0263]

[0264] Despite the lOP-lowering effect, the IOP-lowering effect of the R. officinalis preparation as monotherapy would prove insufficient to prevent glaucoma progression, as it was significantly different compared to the PBS + P control group at weeks 1, 3-4 and 6 (p < 0.05; Figure 1 and Table 4).

[0265] The individual herbal extracts are less effective against higher IOP spikes.

[0266] F. vulgare could not significantly reduce the IOP spikes at weeks 1 and 4 (Figure 1 and Table 5).

[0267] A significant IOP reduction was achieved by week 8 with the extract of H. italicum, but this extract could not effectively prevent the IOP spike following bead administration (Figure 1 and Table 5), and as an unpleasant complication, the corneas showed persistent diffuse cloudiness (Corneal Clouding Scale 2 and minor conjunctival hyperemia type 1).

[0268] The significant difference between the Bead + P and Bead + H(X) groups could explain that the medicinal plant active agents play a role in reducing IOP. Confirming this, we also performed a therapeutic efficacy study between groups using R Software with our 8th week results. It can be compared that Rosmarinus officinalis (Bead + H(I)) and Helichrysum italicum (Bead + H(III)) reduce IOP compared to the placebo artificial tear (Bead + P), but not as effectively as Foeniculum vulgare (Bead + H(II)) and the combination of active agents (Bead + H(X)).

[0269] During the 8-week experimental period, the treated Bead + H(X) group maintained the mean IOP values at baseline compared to the absolute control group (PBS + P) (Figure 1). The individual agents failed to achieve this (Figure 1). In addition, the combination effectively prevented IOP spikes following bead administration at weeks 1 and 4 (Figure 1), which cannot be said for the individual agent (Figure 1).

[0270] Electroretinography (ERG)

[0271] In the follow-up of the disease, it is important to examine the functional vision using the ERG method, which provides information about the functioning of the retinal cells. Before the apoptosis of the retinal ganglion cells, the retina already undergoes pathophysiological changes that can be registered using the ERG.Before establishing our experimental groups, we performed a functional analysis of vision (ERG) in each individual (measurement on day 0), thus recording the initial state of the animals' visual function and ensuring the possibility of monitoring the disease and the treatments applied in vivo over time. Scotopic ERG measurements were performed in both eyes, measurements were repeated at week 4 (day 33) and week 8 (day 56) after bead administration. Before the measurement, the animals were adapted to the dark overnight (>12 hours). On the day of the test, the animals were anesthetized with intraperitoneal ketamine (90 mg / kg, Calypsol, Richter Gedeon, Hungary) and xylazine injection (10 mg / kg, Sedaxylan, Dechra, The Netherlands). Before the ERG, the pupils of the animals were dilated by applying a drop of 0.01% atropine under red light (632 nm). Rats were then placed on a heating pad and their ERGs were recorded using active electrodes applied to the corneal surface. The reference electrodes were attached subcutaneously under the scalp, while the ground electrode was attached under the skin of the back. The retinal cells were stimulated by light pulses (50 pulses: 5cd s / m2, 0.25 Hz, 503 nm green LED light), which were pre-amplified and then amplified (2,000×, Bioamp SbA4-V6, Supertech, Hungary). The recordings were recorded using an A / D converter (Ratsoft-Solar Electronic). Responses to the light stimulus (n = 50 / eye) were averaged using Ratsoft software. The following parameters were measured: a-wave amplitude (from baseline to a-wave trough) and b-wave amplitude (from a-wave trough to b-wave peak). The values of the individuals in the group were averaged and then statistically evaluated using OriginPro 2018 (Macasoft, Hungary).

[0272] The scotopic a- and b-waves in the control eyes (PBS + P and PBS + H(X)) were similar (a-wave p > 0.05; b-wave p > 0.05): PBS + P: a-wave = 230.79 ± 15.75 mV; b-wave = 801.13 ± 51.56 mV; and PBS + H(X): a-wave = 253.62 ± 13.66 mV; b-wave = 733.75 ± 23.42 mV. During the functional analysis of the glaucomatous animals treated with the combination of herbal active agents (Bead + H(X)), the recorded ERG waveforms also showed almost the same course as those of the two control groups (PBS + P and PBS + H(X)). However, a significant decrease in the amplitude of the a-wave (p < 0.05) was observed in the glaucomatous placebo -treated group (Bead + P: a-wave = 165.31 ± 19.9 mV) compared to the control placebo (PBS + P) animals. In addition, the b-wave did not reach the limit of significance (p = 0.05) in the Bead + P group (b-wave = 620.75 ± 54.2 mV) compared to the PBS + P control.

[0273] Guo et al. confirmed in their study that photoreceptor damage significantly reduces the scotopic ERG a-wave [Guo, L.; Normando, E. M.; Nizari, S.; Lara, D.; Francesca Cordeiro, M. Tracking Longitudinal Retinal Changes in Experimental Ocular Hypertension Using the CSLO and Spectral Domain-OCT. Invest. Ophthalmol. Vis. Sci.

[0274] 2010, 51, 6504], which was similarly demonstrated by our ERG results.

[0275] During full-field ERG waveform analysis, the light responses in the Bead + P group were significantly reduced, especially the a-wave reduction reached a significant (p < 0.05) level. However, in eyes treated with the combination of active agents, the waveforms were almost identical to those in the control groups (PBS + P and PBS + H(X)), indicating significant functional protection.

[0276] Optical Coherence Tomography (OCT)

[0277] Non-invasive, in vivo imaging was performed using a SD (spectral domain) optical coherence tomography (OCT) (Bioptigen, Morrisville, NC, USA) software package provided by InVivoVue Clinic software (Bioptigen, Inc., Durham, NC). This technique allows us to obtain high-resolution images of the anterior and posterior segments of the eye in real time. Changes in the structure of the eye obtained during in vivo measurements can thus be monitored during the course of the disease.The first OCT imaging was performed on day 0 (the day before bead administration) for each individual, which was performed immediately after the ERG measurement on animals that were still asleep (with dilated pupils). During the procedure, preservative -free artificial tears were used to protect and hydrate the corneal surface (Systane®, Alcon, Budapest, Hungary). The measurements were repeated at week 4 (day 33) and week 8 (day 56) after bead administration. The parameters used during the measurement were as follows: 1000 A-scans / 100 B-scans x 3 frames / B-scan. A 6 mm retinal imaging lens was used to capture images, which covered a physical area of 3.2 mm x 3.2 mm on the retina.

[0278] The retinal layers of glaucomatous placebo -treated (Bead + P) animals showed signs of severe degeneration compared to the absolute control group.

[0279] The quantitative results were derived from reports generated in the OCT In Vivo Vue software (version 2.4) for further analysis. At the first measurement (week 1 of the experiment), neither the total retinal thickness, nor the RNFL-INL, nor the OPL-ONL and IS-RPE layers showed any significant difference between the groups. At week 4, no significant difference was found between the control groups (PBS + P, PBS + H(X, I, II, III)) and the glaucomatous groups treated with the active agents (Bead + H(X, I, II, III)), while in the glaucoma placebo-treated group (Bead + P), a decrease in retinal layer thickness due to the increase in intraocular pressure became visible. During the final (week 8) test, the measured values of the PBS control groups (PBS + P: 201.28 ± 2.74 μm, and PBS + H: 203.56 ± 1.23 μm) and the treated glaucoma group (Bead + H: 190.87 ± 4.1 μm) showed no significant differences (p = 0.44). In contrast, the Bead + P group showed significant retinal layer thinning (185.08 ± 4.75 μm; p = 0.01), similar to the data at week 4. Our OCT measurements indicate that the retina in the glaucoma group (Bead + P) was significantly altered compared to the other three groups (p = 0.01), due to retinal atrophy. The combined herbal treatment provided significant protection against retinal atrophy in the Bead + H group. At the last (8th) week, the measured values of the PBS control groups (PBS + H(X, I, II, III)) and the treated glaucoma groups (Bead + H(X, I, II, III)) did not show significant differences compared to each other (p = 0.01), however, individuals of the Bead + P group (similar to the data measured at week 4) showed a significant reduction in layer thickness in the total retinal thickness and OPL-ONL layers (Tables 7-8). This layer thickness reduction was not observed in subjects with glaucoma but treated with the combined and Helichrysum italicum containing active agents (Bead + H(X) and Bead + H(III)), as their data were similar to those measured in the control groups at all measurement times (PBS + P: p = 0.64 and p = 0.12). We also observed that among the three separate herbal extracts, Rosmarinus officinalis (Bead + H(I)) and Foeniculum vulgare (Bead + H(II)) treatments resulted in a significant RNFL-INL fiber reduction compared to the PBS + P and Bead + P groups (p = 0.009 and p = 0.005; p = 0.00014 and p = 0.00043, respectively).

[0280] Based on the results of our OCT measurements, we can say that the total retinal thickness of the glaucoma placebo group (Bead + P) was significantly lower than that of the other test groups (p < 0.05). This is due to the retinal atrophy that developed in the glaucoma placebo-treated group (Bead + P). While the treatment with the combination of active agents provided significant protection in preserving the integrity of the retinal layers in the glaucoma group (Bead + H(X)). When broken down into individual herbal extracts, there is no significant difference (p = 0.14 and p = 0.13) in the therapeutic effect in the group treated with only the extract of II. italicum compared to the PBS + P and Bead + P groups. Since the groups treated with R. officinalis and F. vulgare extracts showed significant (Bead + H(I) p = 0.009 and p = 0.006; Bead + H(II) p = 0.0004 and p = 0.0001) RNFL-INL fiberthinning compared to both the PB S + P and Bead + P groups, it can be assumed that these are the components with the least neuroprotective effect.

[0281] Table 7 Percentage change in relative layer thickness of retinal histological layers measured by optical coherence tomography (OCT) between the groups during the 8 weeks of the experiment. The values were compared to the values of the absolute control group (PBS + P), which provides information about the percentage change in the actual thickness of the retinal layers compared to the given weekly thickness of PBS + P. Abbreviations: PBS + P: absolute control group; PBS + H(X): control group treated with the combination of active agents; Bead + P: placebo-treated glaucoma group; Bead + H(X): glaucoma group treated with the combination of active agents; RNFL: retinal nerve fiber layer; INL: internal nuclear layer; OPL-ONL: retinal layers between the outer plexiform layer and the outer nuclear layer; IS-RPE: retinal layers between the inner segment of photoreceptors and the retinal pigment epithelium.

[0282] Total Retinal Thickness (%)

[0283] PBS +P PBS + H(X) Bead + P Bead + H(X) Week 1 0 -2.12 -4.99 -0.92 Week 4 0 -1.07 -8.18 -3.39 Week 7 0 1.14 -8.05 -5.17

[0284] RNFL-INL thickness (%)

[0285] PBS +P PBS + H(X) Bead + P Bead + H(X) Week 1 0 -3.19 0.20 1.67 Week 4 0 0.33 0.82 3.52 Week 8 0 0.19 0.83 0.31

[0286] OPL-ONL thickness (%)

[0287] PBS +P PBS + H(X) Bead + P Bead + H(X) Week 1 0 1.85 -6.49 -5.97 Week 4 0 1.35 -9.66 -4.40 Week 8 0 2.78 -14.98 -11.82

[0288] IS-RPE thickness (%)

[0289] PBS +P PBS + H(X) Bead + P Bead + H(X) Week 1 0 -0.04 -4.61 -0.35 Week 4 0 0.06 -8.01 -3.80 Week 8 0 0.73 -6.03 -3.74

[0290]

[0291] Table 8 Percentage change in retinal histological layers measured by optical coherence tomography (OCT) between the experimental groups over 8 weeks. The values were compared to the values of the absolute control group (PBS + P). Abbreviations: PBS + P: absolute control group; PBS + H: active agent-treated control group; Bead + P: placebo-treated glaucoma group; Bead + H: active agent-treated glaucoma group; (X) combination of active agents; (I): Rosmarinus officinalis extract-containing preparation; (II): Foeniculum vulgare extract-containing preparation; (III): Helichrysum italicum extract-containing preparation; RNFL: retinal nerve fiber layer; INL: internal nuclear layer; OPL-ONL: retinal layers between the outer plexiform layer and the outer nuclear layer; IS-RPE: retinal layers between the inner segment of photoreceptors and the retinal pigment epithelium.Total Retinal Thickness (%)

[0292] Weeks PBS + PBS + PBS + PBS + Bead + Bead + Bead + Bead + P H(I)H(II)P H(I)H(II)H(III)1 0 10.46 3.13 3.73 -4.99 5.03 7.56 4.84 4 0 0.30 -0.63 3.13 -8.18 -1.82 1.19 -0.74 8 0 0.28 1.06 2.35 -8.05 -5.08 -1.40 0.20

[0293] RNFL-INL thickness (%)

[0294] PBS + PBS + PBS + PBS + Bead + Bead + Bead + Bead + P H(I)H(II)P H(I)H(II)H(III)1 0 2.43 -2.91 -2.01 0.20 0.94 -2.17 2.92 4 0 0.53 -2.22 -1.07 0.82 -2.60 -1.93 -7.04 8 0 0.40 -0.96 -5.08 0.83 -7.12 -11.59 -3.87

[0295] OPL-ONL thickness (%)

[0296] PBS + PBS + PBS + PBS + Bead + Bead + Bead + Bead + P H(I)H(II)P H(I)H(II)H(III)1 0 23.25 14.44 15.07 -6.49 13.62 20.34 13.81 4 0 7.48 7.97 8.80 -9.66 -5.94 6.50 -2.48 8 0 3.76 3.10 -3.55 -14.98 -13.25 -5.41 -2.53

[0297] IS-RPE thickness (%)

[0298] PBS + PBS + PBS + PBS + Bead + Bead + Bead + Bead + P H(I)H(II)P H(I)H(II)H(III)1 0 6.28 0.62 0.67 -4.61 2.15 9.38 3.93 4 0 -1.81 4.67 4.18 -8.01 -4.73 2.16 -7.40 8 0 0.20 1.84 -0.09 -6.03 -1.09 -0.32 -2.70

[0299]

[0300] The Foeniculum vulgare extract-treated group showed significant (p < 0.05) RNFL fiber thinning compared with both the PBS + H(X) and Bead + H(X) groups.

[0301] Morphological and morphometric analysis

[0302] Rats (n=86) were processed 8 weeks after microbead injection. Eyes were isolated, corneas were removed, and the eye socket containing retinal tissue was fixed in 4% paraformaldehyde in 0.1 M PBS and 0.1 M phosphate buffer (PB). After fixation, the samples were washed in 0.1 M PBS for 1 hour, and then dehydrated in an ascending alcohol dilution series. According to the protocol, the samples were then embedded (Tissue-Tek® Cryo 3®, Sakura Finetek, USA; Durcupan resin, Sigma-Aldrich, Germany) and placed in a thermostat at 56°C for 72 hours. Semithin sections were prepared from our histological blocks using a microtome (Reichert Ultracut E, Vienna, Austria) and stained with routine histological staining (1% toluidine blue solution, Sigma- Aldrich, Budapest, Hungary). Photographs of sections were taken and analyzed using a light microscope (Eclipse 80i, Nikon Corp., Tokyo, Japan). Measurements were made from digital photographs using the Nis-Elements (Nikon Corp., Tokyo, Japan) program. Four tissue blocks were prepared from animals, and central retinal areas within 2 mm of the optic nerve were used for measurements. The following parameters were analyzed: (i) the thickness of the outer and innerlimiting membrane (OLM–ILM) in the retinal cross-section, and (ii) the number of cells in the ganglion cell layer (GCL) per 500 μm2.

[0303] Analysis of ganglion cell changes on retinal whole -mount preparations

[0304] Eyes (n=28) were cleaned in 0.1 M PBS and fixed in 4% paraformaldehyde in 0.1 M PB for 2 hours at room temperature, then washed with 0.1 M PBS for 1 hour. After washing, the retina was isolated from the eye socket without tearing. The retinas were then placed in a 24-well plate (5% normal donkey serum, 3% bovine serum dissolved in 0.3% PBST) for blocking for 1 hour. After blocking, primary mouse anti-Bm3a antibody (Sigma-Aldrich, Budapest, Hungary) was diluted in 0.1% PBS and incubated with our samples overnight at 4 °C. Immunoreactivity was detected with Alexa Fluor-594 donkey anti-mouse secondary antibody (Jackson ImmunoResearch, Cambridgeshire, United Kingdom) diluted 1:400 in PBS for one hour. Retinal whole-mount samples were then covered with Fluoroshield (Sigma-Aldrich, Budapest, Hungary) coverslip. Images were analyzed using a Nikon Eclipse 80i epifluorescence microscope. For cell counting, the same retinal regions (central and peripheral regions) with defined positions were always selected by overlaying a square grid. The fields imaged between 0 and 2000 pm from the circular tissue defect marking the location of the papilla were the central retinal areas, while the regions more than 2000 pm from the papilla were the peripheral retinal areas. Further processing of the photographs was performed using the Adobe Photoshop CS6 program (Adobe Systems, Inc., San Jose, CA, USA). The images were only adjusted in contrast; they were aligned, sorted, and labeled using the functions of the Photoshop CS6 program. Ganglion cell counting was performed using the ImageJ program (National Institutes of Health, Bethesda, MD, USA). Bm3a-positive retinal ganglion cells were counted in 8 regions (4 central and 4 peripheral clockwise starting at 9h) (one region per retinal quadrant was from the same area). Ganglion cells were then counted within the boundaries of a 500 x 500 pm2square.

[0305] Bm3 (Brain-Specific Homeobox / POU Domain Protein 3) is a major transcription factor family (Bm3a and Bm3b as major representatives) belonging to the mammalian POU protein family. It is a key regulatory marker of retinal ganglion cells and is known to play an important role in RGC development and survival. It is known that a decrease in Bm3a expression levels will be observed immediately before RGC cell death in retinal tissue, therefore it serves as a useful marker to investigate the relationship between RGC loss and the protection provided by neuroprotective treatments.

[0306] In our immunofluorescence microscopy images, there was no significant change in Bm3a expression in RGCs in the control groups (PBS + P and PBS + H(X)). It is striking to note that, compared to the control groups, the Bead + P and the groups treated with individual herbal extracts (Bead + H(I), Bead + H(II), and Bead + H(III)) suffered a significant decrease in RGC numbers. The group treated with the combination of active agents (Bead + H(X)) showed a small decrease in Bm3a expression, but showed similar histological integrity to the PBS + P and PBS + H(X) groups. To further objectively confirm this observation, we performed a quantitative analysis of the surviving RGCs in whole-mount retinal samples in our different study groups. There was no significant difference between the control groups (PBS + P: central 102.97 ± 1.55 pcs / 500 μm2, peripheral 79.36 ± 2.87 pcs / 500 μm2, PBS + H(X): central 97.83 ± 1.88 pcs / 500 μm2, peripheral 77.30 ± 2.23 pcs / 500 μm2) and the glaucoma group treated with the combination of herbal active agents p (Bead + H(X): central 102.93 ± 1.08 pcs / 500 μm2, peripheral 80.41 ± 1.5 pcs / 500 μm2). In the placebo-treated glaucoma samples (Bead + P), sustained IOP elevation resulted in a massive decrease in Bm3a immunopositivity in retinal ganglion cells (Bead + P: central 86.4 ± 2.0 pcs / 500 pm2; p < 0.001; and peripheral 57.58 ± 2.43 pcs / 500 pm2) compared to the control groups (PBS + P and PBS + H(X)).In contrast, in the glaucoma retina samples treated with the combination of active agents (Bead + H(X)), Bm3a expression in ganglion cells showed similar values to those measured in the control groups (p > 0.001 and p > 0.001). Based on the results, it can be stated that the combination of herbal active agents used in glaucoma proved to be protective in terms of preserving the integrity of retinal ganglion cells.

[0307] We extended our studies to the separate analysis of the efficacy of each active agent of the combined preparation with regard to retinal ganglion cells. Based on this, we found that the glaucoma group treated with Foeniculum vulgare (Bead + H(II): central 88.42 ± 1.80 pcs / 500μm2, peripheral 57.33 ± 2.84 pcs / 500μm2) showed a significant decrease in retinal ganglion cells compared to the control group (PBS + P: p < 0.05 and p < 0.05), but did not show a statistical difference compared to the glaucoma group treated with artificial tears (Bead + P: p = 0.62 and p = 0.96). Despite the IOP -lowering ability of the F. vulgare extract, we were unable to confirm its neuroprotective effect in terms of retinal ganglion cell analysis. There was no significant difference in retinal ganglion cells in eyes treated with Rosmarinus officinalis extract (Bead + H(I): central 89.33 ± 3.58 pcs / 500μm2and peripheral 63.75 ± 3.98 pcs / 500μm2) compared to the Bead + P group (p = 0.48; p = 0.29), while a significant difference was achieved when compared to the PBS + P control group (p = 0.002; p = 0.01). In the case of Helichrysum italicum (Bead + H(III): central 92.58 ± 1.90 pcs / 500μm2and peripheral 71.16 ± 5.17 pcs / 500μm2), the number of central retinal ganglion cells did not reach a significant difference (p = 0.13) when compared to the glaucoma group treated with artificial tears (Bead + P), but a difference was found in the peripheral retinal ganglion cells (p = 0.02). This was also consistent with the absolute control group (PBS + P) (central p = 0.01, peripheral p = 0.18). These results suggest that II. italicum may contribute to all neuroprotective effects of the three separate herbs, even if not to an ideal extent. Based on the active agent efficacy analysis performed with R-Software, we see that the effects of the active ingredients of the individual herbs are far inferior to the treatment of glaucoma with the combination of active agents we use. Based on these results, it can be stated that only when using our combination of active agents, a greater degree of neuroprotection is experienced in retinal ganglion cells.

[0308] The glaucoma group treated with Foeniculum vulgare (Bead + H(II): 68.67 pcs / 500μm2± 1.91) showed a significant RGC reduction compared to our control groups (PBS + P: p < 0.05; PBS + H(X): p < 0.05) and the glaucoma group treated with the combination of active agents (Bead + H(X): p < 0.05). In glaucoma, the effect of Rosmarinus officinalis and Helichrysum italicum is also inferior to the treatment with the combination of active agents we used.

[0309] Analysis of retinal vessels using Isolectin-B4 staining on retinal w hole-mount preparations

[0310] For this method, goblet cells were fixed as described in the section “Analysis of Ganglion Cell Changes”, then with isolation of whole retinal tissue and labeled with biotinylated Griffonia simplicifolia (DC.) Baill. (Fabaceae) isolectin-B4 (Vector Labs, Burlingame, CA) using an endothelial cell-specific antibody (incubation was performed overnight at 4 C). The samples were spread on the surface of slides (Fisher Scientific, Pittsburgh, PA) and covered. The preparations were then recorded using a Nikon Eclipse 80i epifluorescence microscope (4x magnification, approximately 2500 × 2500 field of view, 150 μm / pixel). Further processing of the photographs was performed using Adobe Photoshop CS6 (Adobe Systems, Inc., San Jose, CA, USA). The images were only contrast-enhanced and their captions were aligned and arranged using Photoshop CS6. The vascular morphology and density of our samples were quantitatively analyzed using ImageJ (National Institutes of Health, Bethesda, MD, USA).Immunohistochemical staining with the vascular endothelial cell-specific marker, biotinylated Griffonia simplici-folia (DC.) isolectin-B4 isolate, stains the retinal macro- and microvasculature by binding to the vascular endothelial cells. In the control group (PBS + P; PBS + H), the state of the retinal vessels reflects a macroscopically preserved, healthy state. In the glaucoma placebo-treated group (Bead + P), however, vascular injuries, microaneurysms, and micro-angiopathies were documented, which indicate an ischemic state of the retina and the development of retinal damage. The retinal vascular network of glaucomatous animals treated with the combined herbal active agents (Bead + H(X)) showed a similar morphology to that of the control groups.

[0311] We also performed an efficacy analysis of the treatments using R software in terms of the 8th week retinal vessel density among our experimental groups: the scatter peak of the group treated with the combined active agents (Bead + (X)) stands out from the other treated glaucoma groups (Bead + H(I, II, III).

[0312] Western blot protein analysis

[0313] For Western blot experiments, homogenates of four retinal cups per group were used. The samples were stored in a -80°C refrigerator until processing. The frozen tissue was homogenized using an Ultra-Turrax and Potter homogenizer in 150 pl of lysis buffer (50 m Tris, 50 mM EDTA, 0.5% protease inhibitor cocktail (Sigma-Aldrich, Budapest, Hungary)) and 0.5% phosphatase inhibitor cocktail (Sigma-Aldrich, Budapest, Hungary, pH=7.4). The homogenate was sonicated and the protein concentration was determined using the DC™ Protein Assay kit (BioRad Laboratories, USA). The tissue lysate was diluted with Laemmli buffer, boiled for 5 min, centrifuged (13,300 rpm, 10 min), and the clear supernatant was used for further studies. The protein content of the samples was separated using SDS-PAGE gel with a protein loading of 20 pg / lane and then transferred to a nitrocellulose membrane. The membranes were blocked with 5% non-fat dried milk proteins in Tris-buffered saline (TBS) and 0.1% Tween (Cell Signaling Technology, USA) at 4°C overnight at a dilution of 1: 1000. The primary antibodies were: anti-GAPDH (1:20000; Millipore, Hungary), anti-VEGF (1:200; Thermo Fischer Scientific, USA), anti-HIF1α (1:1000; Sigma-Aldrich, Budapest, Hungary), anti-GFAP (1:1000; Sigma-Aldrich, Budapest, Hungary), anti-BDNF (1:1000; Abeam, United Kingdom), anti-NFKB (1:500; Abeam, United Kingdom), anti-Ibal (1:500; Abeam, United Kingdom), anti-Bax (1:500; Abeam, United Kingdom), anti-AIF (Abeam, United Kingdom), anti-p38-MAPK (1:1000; Cell Signaling Technology, USA), anti-CREB (1:1000; Cell Signaling Technology, USA), anti-RhoA (Santa Cruz Biotechnology, Inc., USA) and anti-ROCK2 (Santa Cruz Biotechnology, Inc., USA). The membranes were washed six times for 5 min in Tris-buffered saline containing 0.2% Tween (pH = 7.5), then goat anti-rabbit or anti-mouse horseradish peroxidase-conjugated secondary antibodies (1:3000; BioRad, Hungary, 1:2000; Cell Signalling Technology, USA) were added. Protein bands were visualized by enhanced chemiluminescence labeling using Pierce ECL Western Blotting Substrate (Thermo Fischer Scientific, USA) detection system. All assays were repeated at least four times, and the results were averaged. Quantification of the band intensity of the blots was performed using ImageJ software. The pixel volume of the blot was normalized to the internal control (GAPDH). The data are represented by pixel density in arbitrary units. Due to the elevated IOP values, the stress-induced cellular processes and apoptosis detected by the NFKB marker increased in the two glaucoma groups (Bead + P and Bead + H(X)), but compared to the PBS + P group, both the Bead + P and Bead + H(X) groups showed a significant difference (p = 0.01 and p = 0.03). In the placebo-treated glaucoma rats (Bead + P), significantly increased GFAP levels were expressed compared to both the PBS + P and Bead + H(X) groups (p < 0.001, and p < 0.001). The GFAP levels of the Bead + H(X) group were similar compared to the PBS + P and PBS + H(X) control groups. We demonstrated that treatment with the combined herbal active agents (Bead +H(X)) reduces the expression of Bax, a marker of neuronal cell death and apoptosis, in glaucoma (p = 0.001). BDNF protein expression was significantly increased in the Bead + P group compared to the PBS + P and Bead + H(X) groups (p = 0.007 and p = 0.006). Examining the expression of CREB, we found a significantly higher protein amount in our placebo-treated glaucoma (Bead + P) rats compared to the PBS + P control group (p = 0.006). The effect of treatment with the combined active agents (Bead + H(X)) reaches a significant level compared to the Bead + P group, thus neuroprotection can be detected (p = 0.01). Examining the expression of the retinal hypoxia marker (HIF1α), we found a significantly higher value in the Bead + P group compared to the PBS + P and Bead + H(X) groups (p = 0.01 and p = 0.004). Based on these, our combined active agents protected the retina of glaucomatous rats (Bead + H(X)) from hypoxia-induced neovascularization. In the placebo-treated glaucoma group (Bead + P), a relative increase in p38-MAPK protein expression was observed compared to the PBS + P control group, but it did not reach significance (p = 0.16) based on the ANOVA analysis of variance with Fischer's post hoc test. Based on the measured protein expression differences, the combined herbal active agents (Bead + H(X)) may have provided protection to the axons of retinal ganglion cells by inhibiting the p38-MAPK signaling pathway, reducing axonal transport disorders and axon loss in this group.

[0314] Statistical analysis

[0315] The obtained data were subjected to normality test and then ANOVA statistical analysis using Bonferroni or Fischer post hoc analysis (Origin2018 64bit and R Software). The results were graphically displayed using GraphPad Prism 5 and R Software. The data were presented as “mean ± SEM”, where differences of p <0.05 were considered significant.

[0316] Parkinson ’s disease

[0317] Materials and methods

[0318] Monoculture model

[0319] The human neuroblastoma cell line SH-SY5Y (ATCC, CRL-2266) was cultured in Dulbecco’s Modified Eagle Medium / Nutrient Mixture F-12 (DMEM / F12; Capricorn Scientific GmbH, Ebsdorfergrund, Germany) supplemented with 10% fetal calf serum (FBS; Capricorn Scientific GmbH, Ebsdorfergrund, Germany), 1% non-essential amino acids (NEAA; BioWest, Nuaille, France), and 1% penicillin / streptomycin mixture (P / S; BioWest, Nu-aille, France). SH-SY5Y cells were differentiated into dopaminergic neurons with 1 pM all-trans retinoic acid (ATRA; Merck Life Sciences Kft, Budapest, Hungary) for 5 days in serum-reduced (1% FBS) medium. Differentiated cells were cultured in 6-well plates at a density of 5 * 105cells / well. Oxidative stress and the chemical model of Parkinson's disease were induced by applying 150 pM 6 -hydroxy dopamine hydrobromide (6-OHDA; Merck Life Sciences Kft., Budapest, Hungary) or 5 pM rotenone (Merck Life Sciences Kft., Budapest, Hungary) for 24 hours.

[0320] Since the serum-reduced cell culture medium does not provide sufficient iron for the cells during differentiation, we used a 24-hour iron pretreatment in the form of ferric ammonium citrate (FAC; Merck Life Sciences Kft., Budapest, Hungary) at a concentration of 100 pM for some of the untreated cells and 6-OHDA-treated cells, which allowed the examination of iron accumulation and iron metabolism, the aim of which was to investigate iron overload, which also occurs in neurodegenerative diseases. The cell cultures were treated with 6-OHDA without iron pretreatment or after iron pretreatment for 24 hours and then treated with linalool, geraniol or the MAO-B inhibitor rasagiline mesylate (IpM) for an additional 24 hours. The MAO-B inhibitor rasagiline served as a positive control for the experiments.Co-culture model

[0321] The SH-SY5Y human neuroblastoma cell line (ATCC, CRL-2266) was cultured in Dulbecco’s Modified Eagle Medium / Nutrient Mixture F-12 (DMEM / F12; Capricorn Scientific GmbH, Ebsdorfergrund, Germany) supplemented with 10% fetal calf serum (FBS; Capricorn Scientific GmbH, Ebsdorfergrund, Germany), 1% non-essential amino acids (NEAA; BioWest, Nuaille, France), and 1% penicillin-streptomycin mixture (P / S; BioWest, Nu-aille, France). BV-2 mouse microglial cells (courtesy of Prof. Dr. Laszlo Tretter, Semmelweis University, Budapest) were cultured in high-glucose DMEM supplemented with 10% FBS and 1% P / S on poly-L-ornithine-coated culture plates (Biologix Europe, Hallbergmoos, Germany).

[0322] SH-SY5Y cells were differentiated into dopaminergic neurons with 1 pM all-trans retinoic acid (ATRA; Merck Life Sciences Kft., Budapest, Hungary) for 5 days in serum-reduced (1% FBS) medium. The differentiated cells were plated in 6-well plates at 5 * 105cells / well for the treatments.

[0323] Oxidative stress and a chemical model of Parkinson's disease were induced by applying 150 pM 6-hydroxydopa-mine hydrobromide (6-OHDA; Merck Life Sciences Kft., Budapest, Hungary) for 24 hours. Since the serum-reduced cell culture medium does not provide sufficient iron for the cells during differentiation, untreated cells and 6-OHDA-treated cells also received a small amount of iron supplementation in the form of ferric ammonium citrate (FAC; Merck Life Sciences Kft., Budapest, Hungary) at a concentration of 50 pM, which maintains normal iron balance and allows for monitoring of iron content changes during treatments.

[0324] To establish co-cultures, BV-2 cells were plated on 22 mm diameter, sterile plastic coverslips coated with poly-L-ornithine in 6-well plates, and the coverslips were then placed on top of differentiated, 6-OHDA-treated SH-SY5Y cells so that the two cell types were facing each other. The co-cultures were treated with rosmarinic acid, camosic acid, trans-anethole, or a mixture of these, or the MAO-B inhibitor rasagiline mesylate (1 pM) for 24 hours. The latter served as a positive control for the experiments. After incubation, the two cell types were separated, then detached from the culture dish / coverslip surface by trypsin digestion and collected by centrifugation, and then examined separately.

[0325] Viability determination for linalool and geraniol

[0326] The cells were plated at a density of 104cells / well in 96-well plates and differentiated. Subsequently, the cells were treated with linalool and geraniol at different dilutions (200-500-1000-2000-fold dilution) for 24 hours. The stock solutions of the essential oil main components were always freshly prepared by mixing 10% of the main component with 100% DMSO (Merck Life Sciences Kft, Budapest, Hungary) for solubilization, and then the dilutions were made from this solution in cell culture medium. Control cells, as well as cells treated with FAC, rotenone or 6-OHDA alone, received the same amount of DMSO as in the herbal-based treatments (<1%). Cell viability was measured using the TOX8 resazurin-based kit. To this end, 10 pl of reagent was added to each well, and the plates were incubated for 1 hour in a CO2 incubator at 37°C. The plates were then read in a plate reader at 600 nm, and the optical density values obtained were used to calculate the percentage of cell viability compared to the DMSO control. Viability determination for rosmarinic acid, camosic acid, trans-anethole and active agents mixture

[0327] SH-SY5Y cells were plated in 96-well plates at a density of 104cells / well and differentiated with retinoic acid. Differentiated SH-SY5Y cells were treated with the active ingredients at different dilutions (1000-2000-5000-10000 and 20000-fold dilutions). In the case of rosemary and camosic acid, a 5 mg / ml stock solution was prepared by dissolving the compounds in DMSO. In the case of trans-anethole, the essential oil component was solubilizedwith 10% DMSO (900 pl trans-anethole and 100 pl DMSO), and dilutions were prepared from this stock solution. Treatments were performed for 24 hours, and cell viability was then measured using the TOX8 resazurin-based kit. To this end, 10 pl of reagent was added to each well, and the plates were incubated for 1 hour in a CO2 incubator at 37 °C. The plates were then read in a plate reader at 600 nm, and the optical density values obtained were used to calculate the percentage of cell viability compared to the DMSO control.

[0328] Reactive oxygen species (ROS) measurement

[0329] SH-SY5Y cells were plated in 96-well plates at a density of 104cells / well and differentiated with retinoic acid. Differentiated SH-SY5Y cells were treated with the selected dilutions of the active substances and the mixture for 24 hours. Subsequently, the ROS production of living cells was determined using the Fluorometric Intracellular ROS Kit (Merck Life Technologies Kft, Budapest, Hungary). After the addition of the ROS detection reagent, the cells were incubated for 30 minutes. The fluorescence intensity was measured at λex 640 / λem 675 nm. The ROS level was expressed as a percentage of control cells, which was considered as 100%.

[0330] Measurement of total antioxidant capacity (TAC) for linalool and geraniol

[0331] Differentiated SH-SY5Y cells were cultured and treated in 6-well plates at a density of 5 * 105cells / well according to the protocol described in section 2.1. After the treatments, the cells were collected by trypsinization, centrifuged, and the cell pellets were washed once with phosphate-buffered saline (PBS; Capricorn Scientific GmbH, Ebsdor-fergrund, Germany). The pellets were resuspended in cold PBS, and 100 pL of each sample was used for the determination. The concentrations of small molecule and protein antioxidants were determined using the Total Antioxidant Capacity Assay Kit (Merck Life Science Kft., Budapest, Hungary) according to the manufacturer’s protocol. The optical density was measured at a wavelength of 570 nm. The antioxidant concentrations were expressed as Trolox equivalents in pM.

[0332] Determination of total antioxidant capacity (TAC) for rosmarinic acid, carnosic acid, trans-anethole and active agents mixture

[0333] The determination of the total antioxidant capacity shows the extent to which cells are able to protect themselves against oxidative stress, which enhances their survival ability. In our experiments, SH-SY5Y cells were plated in 6-well plates at 5xl05 / well, then differentiated and treated according to the given protocol. After the treatments, the cells were collected by trypsinization, and the pellets were lysed in cold PBS. The antioxidant capacity was determined using the Antioxidant Assay Kit (Merck Life Science Kft., Budapest, Hungary) according to the manufacturer's protocol, at 570 nm. The antioxidant concentration was expressed in Trolox equivalents in pM. Superoxide dismutase (SOD) activity determination for rosmarinic acid, carnosic acid, trans-anethole and active agents mixture

[0334] SOD activity was determined using the Superoxide Dismutase Assay Kit (Merck Life Science Kft., Budapest, Hungary) according to the manufacturer’s protocol. For the determination, differentiated SH-SY5Y cells were cultured and treated in 6-well plates at a density of 5 * 105cells / well according to the given culture protocol. The differentiated SH-SY5Y cell pellets were washed with ice-cold 1 xPBS solution and then lysed in 500 pl 1 * Lysis Buffer on ice for 10 min. The samples were pelleted by centrifugation at 12,000 * g for 5 min. 20 pl of supernatant from each sample was used for activity measurement. Optical density was determined at a wavelength of 440 nm. SOD activity was calculated according to the manufacturer’s instructions and expressed as U / ml. D

[0335]

[0336] etermination of glutathione peroxidase (GPx) activity for rosmarinic acid, carnosic acid, trans-anethole and active agents mixturesGlutathione peroxidase activity was determined using the Glutathione Peroxidase Assay Kit (Merck Life Science Kft, Budapest, Hungary) according to the manufacturer’s protocol. Differentiated SH-SY5Y cells were plated in 6-well plates at a density of 5 * 105cells / well and treated (Biologix Europe, Hallbergmoos, Germany) as previously described. Differentiated SH-SY5Y cell pellets were washed once with ice-cold IxPBS. Cells were sonicated in 200 pl of lx PBS and centrifuged at 14,000 x g for 10 min. 10 pl of supernatant from each sample was used to measure glutathione peroxidase activity. OD was measured at 340 nm, and GPx activity was expressed in U / l. Determination of intracellular iron content

[0337] Intracellular iron content was determined by a colorimetric, ferrozine-based method. Differentiated SH-SY5Y cells were cultured and treated in co-culture in 6-well plates as previously described at a density of 5xl05cells / well. SH-SY5Y cell pellets were washed once with ice-cold IxPBS and then collected by centrifugation. Cells were lysed with 200 pL of 50 mM NaOH at room temperature for 2 hours. Following incubation, 100 pL of sample was mixed with 100 pL of iron release reagent (1.4M HC1, 4.5% (w / v)) and incubated at 60 °C for 2 hours. After incubation, the samples were cooled to room temperature, then 30 pl of iron detection reagent (6.5 mM ferrozine, 6.5 mM neocuproine, 2.5 M ammonium acetate, 1 M ascorbic acid) was added and incubated for 30 min at room temperature. Absorbance was measured in 96-well plates at 550 nm. To determine the concentration, a FeCl₃ standard curve was used, which was treated in the same way as the samples. To normalize the iron content, the protein concentration of each sample was determined using the DC Protein Assay Kit (Bio-Rad Inc., Hercules, CA, USA). Intracellular iron content was expressed as pM iron / mg protein.

[0338] Determination of lipid peroxidation for rosmarinic acid, carnosic acid, trans-anethole and active agents mixture by malondialdehyde (MDA) determination

[0339] Malondialdehyde concentration was determined using the Malondialdehyde Colorimetric Assay Kit (Merck Life Science Kft, Budapest, Hungary) according to the manufacturer’s protocol. Differentiated SH-SY5Y cells were plated in 6-well plates at a density of 5 x io5cells / well and treated as previously described. Cell pellets were homogenized by ultrasound in 100 pl of 1 x PBS and then centrifuged at 10,000 x g for 10 min at 4°C. 20 pl of the supernatants were added with 20 pl of cleaning solution, 600 pl of acid reagent and 200 pl of chromogenic reagent and incubated at 100°C for 40 min. The samples were then cooled to room temperature and centrifuged at 9569 x g for 10 min. After that, 250 pl of each sample was pipetted onto the detection plate and the OD was determined at 532 nm. For normalization, the protein concentration of each sample was determined using the DC Protein Assay Kit (Bio-Rad Inc., Hercules, CA, USA). MDA levels are given in μmol / gprotein.

[0340] Determination of cytoplasmic histone-associated DNA fragments (nucleosomes) for rosmarinic acid, carnosic acid, trans-anethole and active agents mixture

[0341] To determine nucleosomes released into the cytoplasm, we used the Cell Death Detection ELISA Plus Kit (Roche Ltd, Basel, Switzerland) according to the manufacturer's protocol. Differentiated SH-SY5Y cells were cultured and treated in 96-well plates at a density of 104cells / well, as described previously. The culture medium was aspirated, and 200 pl of lysis buffer was added to the wells. After lysis, the lysate was centrifuged at 200 x g for 10 min. 20 pl of the supernatants were used for measurements. The so-called enrichment factor was calculated according to the formula provided by the manufacturer, and control cells were considered zero.

[0342] Caspase-3 activity measurement for rosmarinic acid, carnosic acid, trans-anethole and active agents mixture Caspase-3 activity was determined using the Caspase-3 Assay Kit (Merck Life Science Kft., Budapest, Hungary) according to the manufacturer’s protocol. Differentiated SH-SY5Y cells were cultured and treated in 6-well platesat a density of 5 * 105cells / well. Cell pellets were washed once with ice-cold 1 xPBS and then shaken in 300 pl of lysis buffer (50 mM HEPES, pH 7.2; 100 mM NaCl; 0.5% (v / v) Triton X-100) for 30 min on ice. Samples were centrifuged at 2500 x g for 10 min at 4 °C. 50 pl of supernatant from each sample was used for activity measurement. Fluorescent intensity (FI) was measured at λEx 400 nm / λEm 490 nm. Fluorescence intensity values were expressed as RFU.

[0343] Determination of cytokine and chemokine secretion by ELISA (Enzyme-Linked Immunosorbent Assay) for linalool and geraniol

[0344] After each treatment, the supernatant of control and treated cell cultures was collected and stored at -80 °C until measurements. The secretion of IL-6, IL-1β, IL-8 and fractalkine was determined using human ELISA kits (Human IL-6, IL-8, IL-1β and Fractalkine ELISA Kit; Thermo Fisher Scientific Inc., Waltham, MA, USA) according to the manufacturer's protocol. The absorbance was determined at a wavelength of 450 nm. The results were expressed as pg / ml.

[0345] Determination of pro-inflammatory cytokine secretion from co-culture ofSH-SY5Y and BV-2 cells for rosmarinic acid, carnosic acid, trans-anethole and active agents mixture

[0346] After treatment of co-cultures of SH-SY5Y and BV-2 cells, the supernatants of control and treated cultures were collected and stored at -80 °C until measurements were performed. IL-6 and TNF-a production of differentiated SH-SY5Y cells was determined using Human IL-6 and TNF-a ELISA kits (Thermo Fisher Scientific Inc., Waltham, MA, USA). IL-6 and TNF-a secretion of BV-2 cells in co-cultures was determined using Mouse IL-6 and Mouse TNF-a ELISA Kits (Thermo Fisher Scientific Inc., Waltham, MA, USA). All ELISA kits were used according to the manufacturer’s instructions. The concentration of secreted proteins was expressed in pg / ml.

[0347] ATP measurements for linalool and geraniol

[0348] Differentiated SH-SY5Y cells were cultured and treated in 6-well plates at a cell density of 5 x 105cells / well according to the manufacturer’s protocols. After differentiation and treatments, the cells were collected by trypsi-nization, centrifuged, and immediately used for ATP determination. The determination was performed with the ATP Colorimetric / Fluorometric Assay Kit (Merck Life Sciences Kft, Budapest, Hungary) according to the colorimetric protocol. The measurement was performed in 96 -well plates at a wavelength of 570 nm, and the results were expressed as ng / pl.

[0349] Real-Time PCR for linalool and geraniol

[0350] After the treatments, differentiated SH-SY5Y cells were washed with phosphate-buffered saline (PBS; Capricorn Scientific GmbH, Ebsdorfergrund, Germany) and harvested by trypsinization. Total RNA was isolated using the Au-rum Total RNA Isolation Kit (Bio-Rad Inc., Hercules, CA, USA). Complementary DNA was synthesized from 200 ng of total RNA according to the manufacturer’s protocol of the iScript cDNA Kit (Bio-Rad Inc., Hercules, CA, USA). Real-time PCR was performed on the Opus 96 Real-Time System (Bio-Rad Inc., Hercules, CA, USA) using iTaq™ Universal SYBR® Green Supermix (Bio-Rad Inc., Hercules, CA, USA). The total reaction volume was 20 pL. The specificity of the amplification was verified by generating melting curves after each qPCR run. Relative gene expression was calculated using Bio-Rad CFX Manager 3.1 software. Glyceraldehyde-3 -phosphate dehydrogenase was used for normalization. Relative expression values were compared between treated and control samples, with the relative expression of controls being set to 1. The sequences of the primers used in the study are given in Table 9.

[0351] Table 9 List of real-time PCR primers.Primer Sequence 5′→3′

[0352] a-synuclein forward TTCTGGAAGATATGCCTGTG

[0353] a-synuclein reverse AGTCTTGATACCCTTCCTCA

[0354] FTH forward GAGGTGGCCGAATCTTCCTTC

[0355] ' FTH reveirse TCAGTGGCC /

[0356]

[0357] FP forward AAAGGAGGCTGTTTCCATAG

[0358] FP reverse l lC C i rC lC rAC C'i^F

[0359]

[0360] TfRl forward CATGTGGAGATGAAACTTGC

[0361] ffRl reverse TCCC At'^

[0362]

[0363] HO-1 forward ACCCATGACACCAAGGACCA

[0364] HO-1 reverse ATGCCTGCATTCACATGGCA

[0365] GAPDH forward TGTTCCAATATGATTCCACCC

[0366] GAPDH reverse CCACTTGATTTTGGAGGGAT

[0367] Statistical analysis

[0368] In our studies, the number of independent experiments was three, and the number of technical replicates was five for viability and ROS measurements. Three technical replicates were used for TAC, GPx, and SOD measurements, for iron content determination, nucleosome quantity, caspase-3 activity, ATP, real-time PCR, and cytokine ELISA measurements. Statistical analyses were performed using SPSS software (version 24.0; IBM Corporation, Armonk, NY, USA). Statistical significance was determined using one-way ANOVA and Tukey post hoc test. Values were expressed as mean ± standard deviation (SD) and were considered statistically significant if the p-value was below 0.05.

[0369] Results I. Effects of linalool and geraniol

[0370] Viability

[0371] Based on the viability studies, a 1000-fold dilution was optimal for linalool and a 500-fold dilution for geraniol, and these treatments did not cause significant changes compared to DMSO controls. This corresponds to a concentration of 0.54 pg / ml for linalool and 0.84 pg / ml for geraniol. The viability values were 98.02±3.02% for linalool and 90.82±3.11% for geraniol.

[0372] Linalool and geraniol reduce the formation of reactive oxygen species (ROS)

[0373] The production of reactive oxygen species (ROS) reflects the degree of oxidative stress in cells. In neurodegenera-tive diseases, oxidative stress is a determining factor in the disease process, leading to a decrease in cell viability and cell death. In our experiments, rotenone (127.51±4.51%) and 6-OHDA (129.69±3.44%) significantly increased intracellular ROS production in differentiated SH-SY5Y cells compared to control cells (100%). In the presence of iron (FAC), ROS level increased further (218.84±5.66% and 164.86±3.87%), which was significantly increased by the co-administration of rotenone or 6-OHDA with FAC pretreatment (160.25±4.24% and 160±3.86%).

[0374] In our studies, both linalool and geraniol significantly reduced ROS production following rotenone treatment (93.89±3.24% and 93.01±3.45%). When comparing the two agents, geraniol proved to be more effective in reducing ROS in the case of 6-OHDA treatment (107.42±3.84% and 78.6±2.22%). In addition, geraniol exerted a significantly stronger effect in the presence of FAC (20.29±1.23%) than rasagiline, used as a positive control,during 6-OHDA treatments (81.16±2.98%). The differences between ROS values are likely due to the different mechanisms of action of rotenone and 6-OHDA.

[0375] Effect of linalool and geraniol on small molecule antioxidant capacity (SMAC) of differentiated SH-SY5Y cells Since linalool and geraniol have ROS scavenging properties, we investigated how they affect the antioxidant capacity of cells. Small molecule antioxidant capacity (SMAC) was significantly reduced when rotenone alone was added to the cells compared to control cells. The addition of linalool, geraniol or rasagiline significantly increased the amount of SMAC (0.209±0.03nmol / pl; 0.208±0.04nmol / pl; 0.192±0.03 for rotenone; 0.320±0.15nmol / pl; 0.292±0.05nmol / pl and 0.225±0.09nmol / pl) for 6-OHDA) compared to 6-OHDA (0.225±0.12nmol / pl) and rotenone (0.068±0.02nmol / pl) treatments.

[0376] When cells were treated with rotenone + FAC combination, SMAC levels were also reduced, however, in this case only linalool and rasagiline were able to partially restore antioxidant capacity, although it did not reach the control level. In addition to FAC pretreatment, all three treatments (linalool, geraniol, rasagiline) increased SMAC values compared to rotenone.

[0377] 6-OHDA treatment alone did not reduce SMAC levels. When cells were treated with the combination of 6-OHDA + FAC, SMAC levels were significantly reduced, and only rasagiline was able to increase them to near control levels. Surprisingly, upon FAC pretreatment, both linalool and geraniol significantly increased SMAC levels compared to 6-OHDA treatment, suggesting that intracellular iron content plays a key role in the effect of essential oil components on SMAC.

[0378] Effect of linalool and geraniol on protein antioxidant capacity (PAC) of differentiated SH-SY5Y cells Protein-antioxidant capacity (PAC) is an important indicator of the cellular defense mechanism against oxidative stress. In our experiments, rotenone treatment alone caused a slight increase in PAC (0.479±0.01nmol / pl) compared to control cells (0.441±0.07nmol / μl), which was further increased by the addition of the main essential oil components (linalool (0.51±0.04nmol / pl), geraniol (0.53±0.05nmol / μl)) and rasagiline (0.592±0.07nmol / pl), although these changes were not significant.

[0379] In contrast, 6-OHDA treatment significantly decreased PAC (0.242±0.04nmol / pl) compared to control cells (0.441±0.07nmol / pl), while linalool (0.438±0.06nmol / pl), geraniol (0.455±0.05nmol / μl) and rasagiline (0.55±0.06nmol / pl) all increased it. Interestingly, when FAC+6-OHDA was used together, the opposite effect was observed: both essential oil main components significantly increased PAC (0.46±0.05 and 0.469±0.06nmol / μl) compared to FAC+6-OHDA treatment (0.313±0.81nmol / μl).

[0380] After FAC pretreatment, rotenone reduced PAC levels, and both components (linalool, geraniol) significantly reduced PAC levels compared to rotenone, although the direction was opposite to the previous combinations. A similar paradoxical effect was observed in the case of FAC pretreatment + 6-OHDA: linalool and geraniol, as well as rasagiline, significantly reduced PAC levels. Based on the results, it can be assumed that iron availability - both intracellularly and extracellularly - significantly affects PAC levels and the mechanism of action of essential oil components.

[0381] Anti-inflammatory effects of essential oil components: changes in IL-6, IL-1β and IL-8 secretion in differentiated SH-SY5Y cells

[0382] In an in vitro model of Parkinson's disease, we determined the anti-inflammatory effects of linalool and geraniol by measuring the secretion of pro -inflammatory cytokines. Both rotenone and 6-OHDA increased IL-6 secretion, but significant differences were observed when 6-OHDA and FAC were used together or when FAC was pre-treated. Linalool reduced IL-6 production by differentiated SH-SY5Y cells and was more effective when 6-OHDA was pre-treated. Geraniol was less effective, but significantly reduced IL-6 levels when FAC was pre-treated compared to rotenone and 6-OHDA.

[0383] In the case of IL-1β, a significant increase was observed compared to control cells only when the cells were treated with rotenone or 6-OHDA after FAC pretreatment. Interestingly, only geraniol was able to reduce IL-1β production with rotenone, while only linalool was able to reduce IL-1β production with 6-OHDA. In the case of FAC pretreatment, both essential oil components caused a small decrease.

[0384] Both essential oil components caused a slight decrease in IL-8 secretion after rotenone and 6-OHDA treatments. In the presence of iron, linalool and geraniol significantly reduced IL -8 production by differentiated SH-SY5Y cells. In the case of FAC pretreatment, the addition of essential oil components resulted in only minor changes. The results suggest different mechanisms of action, which are likely dependent on iron availability and the type of inducer (rotenone vs. 6-OHDA).

[0385] Effect of essential oil components on fractalkine secretion

[0386] Secretion of the chemokine fractalkine is an indicator of neuronal damage and inflammation in SH-SY5Y cells. Our results show that 6-OHDA and FAC+6-OHDA treatments significantly increased fractalkine levels compared to control cells. Linalool and geraniol reduced fractalkine levels in the presence of FAC, suggesting that cellular iron content and regulation of iron homeostasis may play a role in the regulation of fractalkine and the mechanism of action of the main components.

[0387] Changes in ATP levels in differentiated SH-SY5Y cells following different treatments

[0388] Rotenone, which inhibits the activity of mitochondrial membrane complex I, significantly reduced ATP production compared to control cells. None of the main components were able to compensate for this detrimental effect. In the case of 6-OHDA treatment, a decrease in ATP levels (40.56±1.25nmoFpl) was also observed compared to control cells (117.4±7.23nmoFpl), however, geraniol effectively increased intracellular ATP concentration (54.32±3.13nmol / pl). In contrast, linalool had a rather unfavorable effect on ATP production, which may indicate a different mechanism of action.

[0389] Differential effects of essential oil components on intracellular iron content and ferritin heavy chain (FTH) expression

[0390] Our results suggest that the main components studied may affect cellular iron homeostasis. To investigate this, we determined the total iron content of SH-SY5Y cells exposed to different treatments. In the case of iron supplementation, both rotenone (152.14±10.63pM iron / mg protein) and 6-OHDA (105.72±3.72pM iron / mg protein) promoted iron accumulation compared to control cells (8.21±0.52pM iron / mg protein).

[0391] When rotenone was used together with FAC, both main essential oil components significantly reduced cellular iron content, and the effect of geraniol was more pronounced than that of linalool. With FAC pretreatment, both components reduced iron content with equal efficacy. With 6-OHDA treatment, both main essential oil components increased total cellular iron content. After FAC pretreatment and the addition of 6-OHDA, both components further increased total iron content.

[0392] Ferritin heavy chain (FTH) is an antioxidant protein that has ferroxidase activity, thus it can safely store iron and prevent iron-mediated oxidative stress. Gene expression pattern analysis showed that iron levels affect FTH expression. Rotenone decreased FTH mRNA levels, while linalool and geraniol did not cause significant decreases.No significant increase in FTH expression was observed in 6-OHDA treatment, but both main essential oil components significantly increased FTH mRNA levels compared to FAC treatment, suggesting that the main components increase FTH expression to ensure safe storage of excess iron and provide protection against iron-mediated oxidative stress.

[0393] Expression changes of genes related to iron metabolism after linalool and geraniol treatments

[0394] Based on the observed changes in intracellular iron concentration, we examined the mRNA expression of the iron-associated gene (heme oxygenase-1, HO-1) responsible for heme degradation and functioning as an antioxidant enzyme, the gene (transferrin receptor 1, TfRl) responsible for iron uptake, and the gene (ferroportin, FP) responsible for iron export.

[0395] Both rotenone and 6-OHDA significantly increased the mRNA expression of HO-1 and TfRl compared to the control. Linalool significantly increased the expression of HO-1 and TfRl compared to rotenone or 6-OHDA treatment. In the case of geraniol, the level of HO- 1 mRNA increased. In contrast, the opposite effect was observed in TfRl mRNA expression: a decrease was observed after rotenone treatment, while an increase was observed after 6-OHDA treatment. In the case of the iron exporter FP, rotenone and 6-OHDA reduced mRNA expression, while the main components of the essential oil induced a statistically insignificant increase.

[0396] Iron treatment in combination with rotenone or 6-OHDA resulted in higher HO-1 and TfRl mRNA levels than without iron. Addition of linalool resulted in a slight increase in HO-1 after rotenone treatment, but a significant decrease in TfRl compared to rotenone-treated cells. Application of geraniol resulted in a significant increase in HO-1 after rotenone treatment, and a significant decrease in TfRl compared to rotenone and linalool treatment. The main components of the essential oil induced an increase in HO-1, while there was no change in TfRl levels after 6-OHDA treatment, and FP gene expression was significantly increased.

[0397] After FAC pretreatment, HO-1 and TfRl mRNA expression was significantly increased compared to the control, and was further increased by rotenone or 6-OHDA. Linalool and geraniol increased HO-1 expression, but did not change TfRl mRNA levels compared to rotenone. A significant increase was observed in FP mRNA. Treatment with the main components caused a significant increase in TfRl and FP mRNA expression after 6-OHDA treatment, but there was no change in HO-1 levels.

[0398] Changes in HO-1, TfRl and FP gene expression levels due to linalool and geraniol presumably depend on iron availability and the inducing agent used (rotenone / 6-OHDA) in the given experimental model.

[0399] Essential oil components modulate α-synuclein expression in differentiated SH-SY5Y cells

[0400] a-synuclein mRNA expression was also examined in the in vitro neurodegeneration model to explore the therapeutic potential of linalool, geraniol, or both. Rotenone and 6-OHDA treatments significantly increased a-synuclein expression compared to control. In the case of rotenone treatment, geraniol significantly decreased a-synuclein mRNA levels, while in the case of 6-OHDA, both major essential oil components decreased expression.

[0401] In the presence of iron and rotenone or 6-OHDA, linalool was more effective in reducing a-synuclein expression than geraniol. In the case of rotenone and 6-OHDA treatments following FAC pretreatment, a-synuclein levels were higher than in the case of rotenone or 6-OHDA alone, or in the case of FAC+rotenone or FAC+6-OHDA combinations. This suggests that iron overload increases a-synuclein mRNA expression. In the presence of FAC pretreatment, linalool and geraniol both reduced a-synuclein levels when rotenone or 6-OHDA was applied, but the effect of linalool was more powerful than that of geraniol.

[0402] SummaryThe results are summarized in the tables below:

[0403] Table 10: Effect of linalool and geraniol on 6-OHDA-treated cells

[0404] 6-OHDA 6-OHDA+ 6-OHDA+ 6-OHDA+

[0405] linalool geraniol rasagilin

[0406]

[0407] ROS t | | | SMAC - - J, J,

[0408] PAC i f f f

[0409] iron accumulation f t t t

[0410] ATP i f f f

[0411] IL-6 - f

[0412] IL-8 I f I

[0413] IL-ip f l

[0414] Fractalkin - - J, a-synuclein I f i i

[0415]

[0416] ↑increase; ↓decrease; -no change

[0417] Table 11: Effects of linalool and geraniol on rotenone-treated cells.

[0418] rotenon rotenon+ rotenon+ rotenon+

[0419] linalool geraniol rasagilin

[0420] ROS f l I I SMAC i f f f PAC - -

[0421]

[0422] iron accumulation I f i i ATP i f f f

[0423] IL-6 - f

[0424] IL-8 I f I

[0425] IL-ip - - J,

[0426] Fractalkin I f i a- synuclein I f i i

[0427]

[0428] ↑increase; ↓decrease; -no change

[0429] Table 12: Effects of linalool and geraniol on 6-OHDA-treated cells.

[0430] 6-OHDA 6-OHDA+ 6-OHDA+ 6-OHDA+

[0431] linalool geraniol rasagilinAntioxidant protection -I ft f f

[0432] Mitochondrial function ff f

[0433] Iron storage (FTH) f ft f

[0434] Anti-inflammatory effect i ff f f

[0435] ↑↑increase; ↓decrease; -no change; double arrows indicate the most effective result

[0436] Table 13: Effects of linalool and geraniol on rotenone-treated cells.

[0437] rotenon rotenon+ rotenon+ rotenon+

[0438] linalool geraniol rasagilin

[0439] Antioxidant protection i ff f

[0440] Mitochondrial function i f ff f

[0441] Iron storage (FTH) f f f f

[0442] Anti-inflammatory effect i ff f

[0443] ↑increase; ↓decrease; -no change; double arrows (↑↑) indicate the most effective result

[0444] Based on these results, it can be said that both main components have an antioxidant capacity -increasing effect, however, the extent of the effect depends on the inducer used to create the model. However, the oxidative stressinducing agent did not cause significant differences in the maintenance of mitochondrial function, protective iron storage and anti-inflammatory effect. We can say that both main components proved to be effective in preventing oxidative stress and its consequences and in preserving cell viability.

[0445] Results II.- Effects of rosmarinic acid, camosic acid, trans -anethole and their mixtures

[0446] Viability

[0447] Based on the viability studies, 5000-fold dilution was optimal for rosmarinic acid and camosic acid, while 10000-fold dilution was optimal for trans-anethole; these treatments did not cause significant changes compared to DMSO controls. For rosmarinic acid and camosic acid, this corresponds to a concentration of Ipg / ml, while for trans -anethole it was 1.76pg / ml. Viability values were 93.73±3.44% for rosmarinic acid, 91.89±3.68% for camosic acid, and 90.65±3.61% for trans-anethole. The effect of the mixture of the three components on cell survival was also examined, in this case the rosmarinic acid / camosic acid / trans -anethole dilutions were as follows: 5000x / 5000x / 10000x. After treatments with the mixture, the cell viability value was 87.58±2.71%.

[0448] Quantitative changes in reactive oxygen species (ROS) after treatments

[0449] The ROS production of 6-OHDA-treated cells was significantly increased (127.28±3.11%) compared to DMSO-treated control cells (100%), which proves the development of oxidative stress. Based on the results, it can be said that all three active agents and the mixture, as well as rasagiline, significantly reduced ROS production. The mixture proved to be the most effective with 94.37±2.66%, followed by rosmarinic acid (96.12±2.41%) and camosic acid (97.39±2.48%), then rasagiline (107.63±4.13%) and trans -anethole (108.67±3.07%). Based on these, it can be said that the active agents mixture reduced the amount of ROS by nearly 33%, rosmarinic acid by 31%, camosic acid by 29.9% and the least effective trans-anethole by 18.6%, proving their protective ability against reactive radicals.Changes in TAC after treatments

[0450] The TAC of differentiated co-cultured SH-SY 5Y cells was significantly reduced by 6-OHDA treatment compared to control cells, from 27.98±1.44 pM to 23.33±0.35 pM, a 16.33% decrease. Among the active agents, camosic acid (29.23±0.99 pM) was the most effective in increasing TAC compared to 6-OHDA treatment and rasagiline treatment. Trans-anethole (25.89±0.22 pM) and the active agents mixture (25.26±0.99 pM) also significantly increased TAC compared to 6-OHDA treatment. Based on these results, it can be said that treatments with active agents, except for rosmarinic acid, increased the antioxidant capacity of the cells, thereby increasing the ability to defend against oxidative stress. Since TAC includes the effects of small molecule antioxidants and protein antioxidants, we further examined the activities of two main antioxidant enzymes, superoxide dismutase and glutathione peroxidase.

[0451] Changes in SOD activity after treatments

[0452] The SOD enzyme is responsible for the neutralization of superoxide anions (O2-), forming molecular oxygen and hydrogen peroxide, thereby protecting the cell from oxidative damage. 6-OHDA treatment (0.78±0.06 U / ml) significantly reduced the activity of the SOD enzyme compared to the control cells (0.94±0.05 U / ml), representing a 19.15% decrease. Among the active agents, the active agent mixture proved to be the most effective in increasing the activity of the SOD enzyme, the measured activity value of 1.64±0.11 U / ml represents a 110% increase, which also represents a significant 74% increase compared to the control. Camosic acid (1.11±0.09 U / ml) and rosmarinic acid (0.96±0.04 U / ml) also significantly increased SOD activity compared to 6-OHDA treatment. However, transanethole alone was not able to induce a significant increase (0.82±0.07 U / ml).

[0453] Changes in glutathione peroxidase (GPx) activity following treatments

[0454] GPx reduces the resulting hydrogen peroxide to water, thus preventing the formation of hydroxyl (OH-) radicals from hydrogen peroxide and damaging macromolecules. GPx activity was significantly reduced (3.26±0.3 U / l) by 6-OHDA treatment compared to control cells (4.42±0.54 U / l), which is equivalent to a 16.25% decrease in activity. In this case, the active agents mixture proved to be the most effective, achieving an 85.58% increase in GPX activity of 6.05±0.61 U / l compared to 6-OHDA treatment. Trans-anethole (4.89±0.32 U / l) and rosmarinic acid (4.66±0.45 U / l) achieved very similar increases in GPx activity, while in this case camosic acid alone was ineffective (3.49±0.12 U / l). Rasagiline, used as a positive control, was unable to achieve a significant increase. Changes in total iron content as a result of treatments

[0455] Iron accumulated in cells contributes to ROS production and increases lipid peroxidation in membranes, inhibiting normal cell metabolism. In our experiments, 6 -ODA treatment significantly increased the iron content of cells (13.82±0.54pM iron / mg protein) compared to control cells (9.55±0.32pM iron / mg protein). This represents a 44.7% increase in iron content. Each of our tested active agents, both alone and in the form of a mixture, significantly reduced iron accumulation in cells compared to 6-OHDA treatment, which may contribute to the reduction in ROS production. Rosmarinic acid (9.71±0.21pM iron / mg protein, corresponding to a 29.7% reduction) and camosic acid (9.79±0.27pM iron / mg protein, corresponding to a 29.2% reduction) were also significantly more effective than rasagiline (12.3±0.57pM iron / mg protein). Trans-anethole and the active agent mixture achieved similar results, the former reducing the iron content to 10.88±0.39 and the latter to 10.96±0.32pM iron / mg protein, corresponding to a 21.18% and 20.7% reduction, respectively.

[0456] Changes in MDA levels after treatmentsThe degree of lipid peroxidation varies depending on the amount of ROS and oxidative stress in the membranes. Thus, oxidative stress also damages mitochondria, which are the main center of energy production and the main driving force of ferroptosis. 6-OHDA treatment used in our experiments significantly increased the concentration of the lipid peroxidation marker, malondialdehyde (1.05±0.05pmol / g protein) in differentiated SH-SY5Y cells, compared to control cells (0.55±0.03pmol / g protein). This change corresponds to a 90% increase. Each of the tested active agents and the active agent mixture also significantly reduced the level of MDA. In order of effectiveness: active agent mixture 0.56±0.03pmol / g protein (47.7% reduction); camosic acid 0.57±0.02pmol / g protein (45.7% reduction), rosmarinic acid 0.69±0.04 pmol / g protein (34.3% reduction) and trans -anethole 0.75±0.05pmol / g protein (28.6% reduction). All active agents were more effective than rasagiline (0.83±0.06pmol / g protein; 20.9% reduction) used as a positive control.

[0457] Changes in the rate of nucleosome release as a result of treatments

[0458] Nucleosome release indicates the degree of DNA damage in cells, which can lead to apoptosis. The enrichment factor was 1.21±0.1 after 6-OHDA treatment. All of the tested active ingredients and the active agents mixture significantly reduced the enrichment factor, but rasagiline was the most effective (0.56±0.045), which represents a significant reduction of 53.7%. In order of effectiveness: camosic acid 0.64±0.04 (47.1% reduction); active ingredients mixture 0.7±0.04 (42.1% reduction); and trans-anethole 0.74±0.06 (38.8% reduction); rosmarinic acid 0.87±0.07 (28.1% reduction). Based on all this, it can be said that the active ingredients are able to reduce DNA fragmentation in neurons.

[0459] Changes in caspase-3 enzyme activity as a result of the treatments

[0460] Caspase-3 is an effector caspase whose activation indicates the onset of apoptosis, i.e. its activity is proportional to the degree of apoptosis. It is important to note that caspase-3 is not activated in ferroptosis, so the change only indicates the degree of apoptosis. 6-OHDA treatment significantly increased (974767 RFU) the activity of caspase-3 compared to control cells (749508 RFU), which is a 30% increase. The active agents, the mixture and rasagiline also significantly reduced caspase-3 activity, indicating their apoptosis-inhibiting effect. There was no significant difference in the effect of the treatments. In order: camosic acid 772440 RFU (20.7%); rosmarinic acid 783931 RFU (19.5%); trans-anethole 785102 RFU (19.4%); mixture 798642 RFU (18.1%); rasagiline 806024 RFU (17.3%).

[0461] Quantitative changes in secreted inflammatory cytokines as a result of the treatments

[0462] The increase in the secretion of pro -inflammatory cytokines indicates the onset of inflammatory processes, which can also be observed in Parkinson's disease. The secretion of interleukin 6 (IL-6) by differentiated SH-SY 5Y cells was significantly increased by 6-OHDA treatment (5.2±0.24 pg / ml) compared to the release from control cells (3.73±0.11 pg / ml), which represents a 39% increase. Among the treatment agents, rosmarinic acid and rasagiline were unable to reduce IL-6 production, their concentrations were 5.01±0.12 pg / ml and 4.82±0.14 pg / ml. Camosic acid (3.66±0.09 pg / ml; 29.6%) and trans-anethole (4.18±0.11 pg / ml; 19.6%) were able to significantly reduce IL-6 levels on their own, but the active agents mixture proved to be more effective, with a reduction of 3.57±0.12 pg / ml, i.e. 31.3%.

[0463] In the case of microglia, 6-OHDA treatment significantly increased IL-6 secretion (8.7±0.27pg / ml) compared to control cells (5.62±0.14pg / ml), which is a 54.8% increase. Among the treatments, only rosmarinic acid was unable to induce a significant decrease in IL-6 levels, reducing it to only 7.84±0.21 pg / ml, i.e. by 9.8%. The most effectivetreatment was camosic acid, which reduced IL-6 secretion to 5.14±0.11 ng / ml, i.e. by 40.9%. There was no significant difference between trans-anethole (6.31±0.18 pg / ml; 27.4%), the active ingredient mixture (6.65±0.17 pg / ml; 23.3%) and rasagiline (6.42±0.12 pg / ml; 26.2%), but all three caused a significant decrease in IL-6 release, demonstrating their anti-inflammatory effect.

[0464] Tumor necrosis factor a (TNF-a) secretion was significantly increased in differentiated co -cultured SH-SY5Y cells after 6-OHDA treatment (36.32±3.64pg / ml) compared to control cells (14.44±1.25pg / ml), resulting in a 151.5% increase. The tested active ingredients and the active ingredient mixture significantly reduced TNF-a production compared to 6-OHDA treatment. The most effective was camosic acid, which reduced TNF-a levels to 9.3±0.87pg / ml, which represents a 74.39% reduction in production. This was followed by the active ingredient mixture, which was able to reduce TNF-a release to 16.9±1.14pg / ml, i.e. 53.46%. There was no significant difference between the effects of rosmarinic acid and trans -anethole, with the former significantly reducing TNF-a secretion by 24.56±2.1 Ipg / ml (32.37%), and the latter significantly reducing TNF-a secretion by 23.82±2.48pg / ml (34.41%). Rasagiline did reduce TNF-a secretion by cells to 28.5±3.54pg / ml, but this was not significant.

[0465] The TNF-a production of the other member of the co -culture, BV-2 microglial cells, significantly increased in the presence of 6-OHDA-treated differentiated SH-SY5Y cells (11.49±0.77pg / ml) compared to control cultures (9.75±0.23pg / ml), which represents a 17.84% increase. Among the active ingredients, trans-anethole (10.05±1.02pg / ml; 12.5%) and rasagiline (10.47±0.75pg / ml; 8.87%) were unable to significantly reduce TNF-a production. The most effective treatment was camosic acid, which reduced TNF-a concentration to 8.5±0.48pg / ml, which resulted in a 26% decrease. The active ingredient mixture reduced TNF-a secretion from microglial cells to 9.21±0.36pg / ml (19.8%), while rosmarinic acid reduced TNF-a secretion from microglial cells to 9.26±0.46pg / ml (19.4%).

[0466] Summary

[0467] The results are summarized in the tables below:

[0468] Table 14: Results of the treatments

[0469] 6-OHDA Rosmarinic Camosic Trans-anethole Mixture Rasagilin acid acid

[0470] ROS TAC - f f - SOD - f

[0471] GPx f - f - iron accumulation f

[0472] lipid peroxidation f - (MDA)

[0473] DNA damage f

[0474] Caspase-3 activity f

[0475] IL-6 secretion f - - TNF-a secretion f - IL-6 secretion - (microglia)

[0476]

[0477] TNF-a secretion - - (microglia)

[0478]

[0479] ↑increase; ↓decrease; -no change

[0480] Table 15: Cumulative effect of treatments

[0481] 6- Rosmarinic Camosic Trans-anethole Mixture Rasagilin OHDA acid acid

[0482] Antioxidant protection ↓ ↑ ↑↑

[0483] Ferroptosis ↑ ↓ ↓↓ -

[0484] -apoptotic effect ↑ ↑↑ ↑

[0485] Anti-inflammatory effect - ↑ ↑↑ -

[0486]

[0487] ↑increase; ↓decrease; -no change; double arrows indicate the most effective result

[0488] Based on the results, it can be said that the main components of the extracts of our combined preparation were able to reduce reactive oxygen radical formation to varying degrees and increase antioxidant capacity, including protein antioxidants, superoxide dismutase and glutathione peroxidase activity. All of these together contribute to antioxidant protection, which is a cornerstone of neurodegenerative diseases.

[0489] The decrease in glutathione peroxidase activity also serves as a marker of ferroptosis. Thus, these results already show the protective ability against ferroptosis. Further ferroptosis examination was performed by changing the iron content and determining the degree of lipid peroxidation. Accumulating iron in cells, which is also a characteristic step of neurodegeneration, can increase iron-mediated oxidative stress through the Fenton reaction, which produces additional reactive radicals. Thus, reducing iron accumulation also reduces the risk of ferroptosis and cell death. Iron-mediated oxidative stress leads to lipid peroxidation, which damages membrane function, including the ATP-producing respiratory chain located in the mitochondrial membrane. The marker of lipid peroxidation is malodialdehyde, which is an oxidative degradation product of polyunsaturated fatty acids (PUFA). Its level is proportional to the degree of oxidative stress. The MDA-lowering effect of plant components contributes to the inhibition of ferroptosis.

[0490] One of the intrinsic activators of apoptosis is DNA damage. DNA-histone protein fragments formed by DNA breakage, called nucleosomes, exit the cell nucleus into the cytoplasm and can be detected there. Each of our active agents reduced the amount of cytoplasmic nucleosomes. The final effector caspase of apoptosis is caspase -3, which is activated by proteolytic cleavage. As a result of its activation, the cell dies. Inhibition of the caspase-3 enzyme reduces the extent of apoptosis.

[0491] Although each component is capable of providing protection to cells on its own, in our studies the active agents mixture proved to be the most effective in increasing antioxidant protection, inhibiting ferroptosis and enhancing anti-inflammatory effect by reducing the secretion of inflammatory cytokines. Its anti -apoptosis effect was only slightly inferior to the most effective camosic acid.

[0492] Diabetic retinopathy

[0493] Experimental animalsAdult male C57BL / 6 mice, 8-10 weeks old, were used for the experiments. The animals were kept under standard laboratory conditions (12-h light / dark cycle, temperature 22 ± 2 °C, relative humidity 50-60%), provided with standard mouse chow and drinking water ad libitum. The animals were acclimatized for at least one week before the start of the experiments. Animal welfare guidelines were fully followed during the studies.

[0494] Development of a diabetes mellitus (type 1) model

[0495] Type 1 diabetes mellitus was induced by streptozotocin(STZ). STZ was dissolved in freshly prepared citrate buffer adjusted to pH 4.5 immediately before injection. Mice were subjected to a short-term starvation before STZ treatment to enhance the 0-cell toxic effect. Animals received intraperitoneal STZ injections of 100 mg / kg on two consecutive days, resulting in a cumulative dose of 200 mg / kg per animal. The control group received an injection of the same volume of citrate buffer. The aim of the STZ treatment was to selectively destroy the insulin-producing 0-cells of the pancreas, which leads to absolute insulin deficiency and thus the development of type 1 diabetes mellitus. After induction of diabetes mellitus, animals were divided into two main groups: control and diabetic groups.

[0496] Eye drop treatment

[0497] The individuals of both main groups were then further divided based on the eye drop treatment. One half of the animals was treated with preservative-free artificial tears (Hyabak®), which was used as a vehicle, while in the other half, eye drops comprising the combination of herbal active ingredient comprising extracts of Rosmarinus officinalis, Foeniculum vulgare and Helichrysum italicum, were applied twice a day, at approximately the same time intervals during the day, to both eyes, at a dosage of 1 drop / eye / occasion. During the study, four experimental groups were formed, with the following numbers of elements:

[0498] 1. Control group (Control + vehicle, n = 4) Animals received citrate buffer solution intraperitoneally (ip). During their ophthalmological treatment, both eyes were treated twice daily with preservative-free artificial tears (Hyabak®, 1 drop / eye / occasion).

[0499] 2. Control + active ingredient group (n = 3) The animals received an i.p. citrate buffer injection and both eyes were treated twice daily with eye drops containing combined active agents. The eye drops containing combined herbal active ingredients (X) contained three plant extracts: Rosmarinus officinalis, Foeniculum vulgare and Helichrysum italicum (1 drop / eye / occasion).

[0500] 3. Diabetic group (Diabetes + vehicle, n = 8) After chemical induction of diabetes mellitus, the animals did not receive any i.p. treatment. During their ophthalmological treatment, both eyes were treated twice daily with preservative-free artificial tears (Hyabak®, 1 drop / eye / occasion).

[0501] 4. Diabetes + active ingredient group (n = 5) Following the induction of diabetes mellitus, both eyes of the animals were treated with combined active ingredients eye drops twice daily. The combined herbal active ingredients eye drops (X) contained three plant extracts: Rosmarinus officinalis, Foeniculum vulgare and Helichrysum italicum (1 drop / eye / occasion).

[0502] Both eyes of each experimental animal were included in the study and were processed as separate measurement units during the analyses.

[0503] Validation of the diabetes model - blood sugar monitoring

[0504] Following the induction of diabetes mellitus, the blood glucose levels of the animals were monitored weekly. The measurements were performed each time after an overnight fast (in the fasting state), at the same time of day. Blood glucose levels were determined using a portable blood glucose meter from a peripheral (tail vein) capillaryblood sample. STZ-treated mice were considered diabetic if their fasting blood glucose levels consistently reached or exceeded 13.9 mmol / L (-250 mg / dL). In the control animals, the blood glucose levels remained within the normal range during the study. The results of the weekly measurements were plotted in a time -dependent manner, summarized by group.

[0505] Optical coherence tomography (OCT) test

[0506] Optical coherence tomography (OCT), which is a high-resolution, non-invasive imaging technique, was used to examine the structural abnormalities of the retina. The method is based on the use of infrared radiation, which allows for detailed in vivo examination of the layers of the eye and the retina within it. During OCT, depth information can be obtained based on the differences in the intensity and time delay of light reflected from the tissues. The device records depth profdes (A-scan) based on the light scattered back from different layers of the retina, from which two-dimensional cross-sectional images (B-scan) are reconstructed. Multiple consecutive B-scan recordings allow for a three-dimensional structural analysis of the examined area. The measurements were performed using the Bioptigen SD-OCT system, which provides real-time, high-resolution images of the morphological state of the retina. The animals were anesthetized by intraperitoneal administration of a 90 mg / kg dose of ketamine -based anesthetic mixture. To ensure adequate image quality, mydriasis was applied with 0.01% atropine eye drops, and the animals were then placed on an animal holding platform designed for OCT examination. A rectangular scanning protocol (1000 A-scan x 100 B-scan x 3 frames) was used to examine the retina, covering an area of 1.8 mm x 1.8 mm, centered on the optic nerve head region. During the measurements, the total retinal thickness and the thickness of each retinal layer were determined. Quantitative layer thickness analysis was performed using the automatic segmentation algorithm of the Bioptigen InVivoVue Diver 3.3.7.0 software by averaging multiple cross-sectional images. Statistical analysis was performed in a linear mixed effect model using the R program. Retinal layer thickness data measured during OCT examinations were analyzed in a longitudinal design. Measurements from both eyes of each animal were considered repeated measurements, therefore a linear mixed-effects model was used for statistical evaluation of the data.

[0507] The model included time, group, and their interaction (time x group) as fixed effects, and individual (ID) as a random effect. Estimations were performed using the Restricted Maximum Likelihood (REML) method, with Sat-terthwaite correction applied to determine the degrees of freedom. The statistical significance level was set at p < 0.05. Analyses were performed separately for the total retinal thickness and for each retinal layer.

[0508] Analysis of ganglion cell changes on retinal whole-mount preparations

[0509] The quantitative changes in ganglion cells were examined on retinal whole-mount preparations. The eyes (n = 3 retinas / control, n = control+ active ingredient, groups, n = 6 / diabetes, n = 5 / diabetes+ active ingredient) were cleaned in 0.1 M PBS and fixed in 4% paraformaldehyde dissolved in 0.1 M phosphate buffer for 2 hours at room temperature. After fixation, the samples were washed in 0.1 M PBS for 1 hour, and the retina was isolated from the eye socket without tearing. The prepared retinas were then placed in a 24 -well plate and incubated in blocking solution (5% normal donkey serum, 3% bovine serum dissolved in 0.3% PBST) for 1 hour at room temperature to reduce nonspecific binding. Following blocking, samples were incubated with rabbit anti-Bm3a primary antibody (1:50, ab245230 Abeam, Cambridge, UK), diluted in 0.1 M PBS, overnight at 4 °C. Immunoreactivity was detected using Alexa Fluor 594 -conjugated donkey anti-rabbit secondary antibody (Jackson ImmunoResearch), diluted 1:400 in PBS and incubated for 1 hour at room temperature. After incubation, retinal whole -mount samples were placed on slides and covered with Fluoroshield coverslip (Sigma-Aldrich). Fluorescence images were taken witha Nikon Eclipse 80i epifluorescence microscope. During cell counting, predetermined peripheral retinal regions of the same location in each sample were examined by overlaying a standardized square grid. The areas between 0-2000 pm from the circular tissue defect marking the location of the papilla corresponded to the central retinal regions, while the areas more than 1200 pm from the papilla corresponded to the peripheral retinal regions (this was the subject of the study). Image processing was performed with Adobe Photoshop CS6; only contrast correction was applied to the images, no other image manipulation was performed. Bm3a-positive retinal ganglion cells were counted using the automatic cell counter function of the Image! program. Ganglion cells were counted in four peripheral regions per retina, with the peripheral regions designated clockwise, starting at 9 o'clock. One measurement area from each retinal quadrant, at the same position, was analyzed from an image taken with a 20x objective. The cell counts determined in each region were averaged per retina, and the values obtained were used to determine individual ganglion cell density.

[0510] Statistics were performed using Origin software with originpro2018 two-way anova test. The number of retinal ganglion cells was determined on whole-mount retinal preparations in the peripheral retinal regions. The measurements from each retina were averaged for each individual, and then the comparison between groups was performed using two-way analysis of variance (two-way ANOVA; factors: disease and treatment). Fisher's exact test was used for post hoc comparisons, and the significance level was set at p < 0.05.

[0511] Apoptosis protein array assay

[0512] The expression of apoptosis-related proteins was examined using a membrane-based antibody array method using a commercially available Mouse Apoptosis Array kit (Catalogue No.: SARB0073), following the manufacturer’s protocol. The method operates on the principle of a sandwich immunoassay and allows for the semiquantitative, parallel detection of multiple proteins involved in apoptosis. The samples were prepared according to the manufacturer’s recommendations, using the same amount of total protein in each case. The target proteins immobilized on the membranes were labeled with biotinylated detection antibodies, then with HRP -conjugated streptavidin, and the signal was detected by chemiluminescence. The images of the membranes were recorded with a digital imaging system. Quantitative evaluation of chemiluminescence images was performed using ImageJ software, using a standardized densitometry method based on a Protein Analyzer plug-in. The plug-in automatically measured the signal intensity of the spots belonging to each protein, including the spots in duplicate, as well as the positive, negative and blank controls. The signal intensities of the duplicate spots belonging to each protein were averaged and the values obtained were used for further data processing. In the first step, background subtraction was performed from the raw signal intensity values, for which the average values of the negative and blank control spots on the membranes were used. The background-corrected intensity values obtained served as the basis for further normalization. In order to correct for technical differences between different membranes, the data were normalized to the positive control spots according to the manufacturer's recommendations. The background-subtracted signal intensity of each protein was multiplied by the ratio of the positive controls of the reference membrane to the positive controls of the given membrane, thereby ensuring comparability between the individual samples. From the normalized values, the relative expression of the proteins was calculated compared to the control group, and the results were expressed in the form of fold change. Based on the data obtained, we identified the activation or inhibition of apoptotic signaling pathways.

[0513] ResultsBlood sugar monitoring depending on the disease

[0514] On day 0, all groups had similar fasting blood glucose levels within the normal range. The mean blood glucose level in the control + Systane group was 8.1 ± 0.3 mmol / L, while in the control + combined herbal active agents group it was 8.0 ± 0.2 mmol / L. The diabetic groups also had normoglycemic baseline values: 8.2 ± 0.4 mmol / L in the diabetic + Systane group and 8.4 ± 0.3 mmol / L in the diabetic + combined herbal active agents group. By week 5, blood glucose levels in the control groups showed no significant change. The mean fasting blood glucose level in the control + Systane group was 8.6 ± 0.4 mmol / L, while in the control + combined herbal agents group it was 8.9 ± 0.5 mmol / L, confirming the maintenance of normal glucose metabolism. In contrast, the STZ-treated diabetic animals developed pronounced hyperglycemia. In the diabetic + Systane group, the mean fasting blood glucose level increased to 22.3 ± 2.6 mmol / L by week 5, which permanently exceeded the cut-off value of 13.9 mmol / L used to establish diabetes mellitus. In the diabetic + combined herbal active agents treated group, we also measured elevated blood glucose levels (18.7 ± 2.1 mmol / L). Overall, the 5-week monitoring clearly confirmed the successful induction of type 1 diabetes mellitus by STZ treatment. With combined herbal active agents treatment, the increase in blood glucose levels was more moderate in diabetic animals, however, this treatment could not maintain the normoglycemic range either (Figure 3).

[0515] OCT-based retinal thickness changes depending on disease and treatment

[0516] Total Retinal Thickness (TRT): The linear mixed effects model showed a significant time x group interaction (p = 0.0016), indicating that the change in retinal thickness over time was group -dependent. Compared to baseline, the diabetic + Hyabak® group showed a significant decrease in TRT (p = 0.0011), while the diabetic + combined herbal active agents group also showed a significant decrease in TRT (p = 0.0022).

[0517] Retinal nerve fiber layer (RNFL): In the analysis of RNFL thickness, neither the group effect (p = 0.4789) nor the time x group interaction (p = 0.0801) proved to be significant. Compared to the baseline measurement, the change in RNFL thickness in the diabetic + Hyabak® group was not significant (p = 0.0856), while in the diabetic + combined herbal active agents group there was also no significant difference (p = 0.5702).

[0518] Inner Plexiform Layer (IPL): In the analysis of the thickness of the inner plexiform layer (IPL), the linear mixed effects model showed a significant time effect (p = 2.537 × 10-5) and a significant time x group interaction (p = 0.0020), while the independent group effect was not significant (p = 0.7306). Compared to the baseline measurement, the IPL thickness was significantly reduced in the diabetic + Hyabak® artificial tears group (p = 0.0060). The reduction in IPL thickness was also significant in the diabetic + combined herbal active agents group (p = 0.0004).

[0519] Inner nuclear layer (INL)

[0520] In the analysis of the thickness of the inner nuclear layer (INL), the linear mixed effects model showed a significant time x group interaction (p = 0.0208), while the main effect of time (p = 0.4767) and the group effect (p = 0.7173) were not significant. Compared to the baseline measurement, the INL thickness in the diabetic + Hyabak® artificial tears group decreased significantly (p = 0.0214). In contrast, the change in INL thickness in the diabetic + combined herbal active agents eye drops group was not significant (p = 0.6311). These results suggest that the combined herbal active agents treatment in a diabetic setting was able to preserve the structural integrity of the inner nuclear layer, as the significant INL thinning observed in the vehicle -treated diabetic group was not detectable in the drug-treated group.Outer Plexiform Layer (OPL): In the analysis of OPL thickness, the main effect of time was significant (p = 0.0350), while the group effect (p = 0.0693) and the time x group interaction (p = 0.0857) did not reach statistical significance. Compared to baseline, there was no significant change in OPL thickness in either the diabetic + Hyabak® artificial tears group (p = 0.3691) or the diabetic + combined herbal active agents group (p = 0.1051). Outer nuclear layer (ONL): In the analysis of ONL thickness, the main effect of time was significant (p = 0.0055), while the group effect (p = 0.8469) and the time x group interaction (p = 0.1279) were not significant. Compared to baseline, there was no significant change in ONL thickness in either the diabetic + Hyabak® artificial tears group (p = 0.1022) or the diabetic + combined herbal agents group (p = 0.0645).

[0521] Photoreceptor inner segment (IS): In the analysis of IS thickness, the main effect of time was significant (p = 0.0141), while the group effect (p = 0.7745) and the time x group interaction (p = 0.4135) were not significant. Compared to baseline, there was no significant change in IS thickness in either the diabetic + Hyabak® artificial tears group (p = 0.176) or the diabetic + combined herbal agents group (p = 0.127).

[0522] Photoreceptor outer segment (OS): A significant time effect was also observed in the examination of OS thickness (p = 0.0018), however, neither the group effect (p = 0.6005) nor the time x group interaction (p = 0.3436) reached statistical significance. No significant change in OS thickness was detected in either diabetic group compared to baseline (diabsys: p = 0.601; diabherb: p = 0.228).

[0523] Retinal pigment epithelium (RPE): When analyzing the thickness of the RPE, the linear mixed-effects model showed a significant time x group interaction (p = 8.03 x 10-5). while the main effect of time (p = 0.2668) and the group effect (p = 0.3249) were not significant. Compared to the baseline measurement, the RPE thickness in the diabetic + Hya-bak® artificial tears group was significantly reduced (p = 3.12 x 10-5). In contrast, the change in RPE thickness in the diabetic + combined herbal eye drops group was significantly smaller, and although a change was observed, its extent was significantly reduced (p = 0.0219) compared to the diabetes + Hyabak® group. Table 16: Summary of thickness changes in different retinal layers in a diabetic retinopathy model. The table shows the changes compared to baseline values in the diabetic + Hyabak® artificial tears (diabsys) and diabetic + combined herbal agents (diabherb) groups. The layer-specific protective effect of the treatment with the combined agents was demonstrated in the inner nuclear layer (INL) and the retinal pigment epithelium (RPE).

[0524] Retinal layer Diabsys (Diabetes + HyaDiabherb (Diabetes + comDiabherb vs Diabsys bak®) bination of active agents)

[0525] TRT (Whole retina) Significant decrease Significant decrease No difference

[0526] (p = 0.00114) (p = 0.00224)

[0527] RNFL Non-significant change Non-significant change No difference

[0528] (p = 0.0856) (p = 0.5702)

[0529] IPL Significant decrease Significant decrease No protection

[0530] (p = 0.00604) (p = 0.00040)

[0531] INL Significant decrease Non-significant change PROTECTIVE EFFECT (p = 0.0214) (p = 0.6311)

[0532] OPL Non-significant change Non-significant change No difference

[0533] (p = 0.3691) (p = 0.1051)

[0534] ONL Non-significant change Non-significant change No difference

[0535] (p = 0.1022) (p = 0.0645)

[0536]

[0537] IS Non-significant change Non-significant change No difference (p = 0.176) (p = 0.127)

[0538] OS Non-significant change Non-significant change No difference

[0539] (p = 0.601) (p = 0.228)

[0540] RPE Significant change Significantly moderate PROTECTIVE EFFECT (p = 3.12 x IO’5) decrease

[0541] (p = 0.0219)

[0542]

[0543] Analysis of ganglion cell changes depending on disease and treatment

[0544] Retinal ganglion cell density was analyzed on Brn3a-immunolabeled retinal whole-mount preparations, with special attention to the peripheral retinal regions, where early signs of diabetic neurodegeneration are most pronounced. In the diabetic vehicle-treated group, a pronounced ganglion cell loss was observed, which was manifested by a visible decrease in cell density and a decrease in the number of cells detected in each image region. In contrast, in the diabetic combined herbal drug-treated group, ganglion cell density was more preserved, and a higher number of Brn3a-positive cells could be identified in the peripheral regions. In the control groups, the distribution of ganglion cells proved to be homogeneous, with a high cell density and a uniform spatial pattern. These observations support that treatment with the combined herbal agents can attenuate diabetes-induced retinal ganglion cell death (Figure 4).

[0545] In the statistical analysis, the main effect of disease alone was not significant (p = 0.436), and the main effect of treatment alone was not significant (p = 0.597). In contrast, there was a significant interaction between disease status and treatment (p = 8.26 x 10-4), suggesting that the effect of treatment depends on the presence of disease. The peripheral retinal ganglion cell count was significantly lower in the diabetic vehicle -treated group compared to the control vehicle-treated group (p = 0.00274). In the diabetic, active-agents-treated group, the peripheral retinal ganglion cell count was significantly higher than in the diabetic, vehicle -treated group (p = 0.00129), and did not show a significant difference compared to the values in the control, vehicle-treated group (p = 0.175) (Figure 5).

[0546] Changes in apoptosis regulation depending on disease and treatment

[0547] When examining the relative expression of proteins related to apoptosis and cell protection, pathological differences were observed in the diabetic group compared to the control, as described in the literature. The expression of the proapoptotic BAD protein increased by 71.1% in diabetes compared to the control group. In contrast, in the diabetic group treated with the combined herbal active ingredient, the expression of BAD decreased and showed a 19.7% lower value compared to the untreated diabetic group. This suggests that the combined active ingredient reduces the shift towards mitochondrial apoptosis in a diabetic environment. The expression of the antiapoptotic cIAP-2 protein increased by 87.5% in diabetes compared to the control, which can be interpreted as a compensatory response of the cells to the increased apoptotic pressure. With the combined herbal active ingredient, cIAP-2 expression was further increased, showing an additional 37.8% increase in the diabetic + active agents group compared to the diabetic group. This indicates active support of antiapoptotic defense mechanisms. Significant changes were also observed in the case of heat shock proteins. The expression of HSP27 increased extremely significantly in diabetes, by 687.4% compared to the control, indicating a severe cellular stress state. The treatment with the combination of herbal active agents increased the expression of HSP27 by a further 18.4%, indicating an increasein the adaptive cellular defense response. The expression of HSP70 protein increased by 73.5% in diabetes compared to the control, while an additional 47.6% increase was detected in the diabetic + active agents group. This pattern suggests that the combination of herbal active agents is not merely part of a passive response to the stress caused by diabetes, but actively enhances the protective capacity of cells. The expression of the p53 protein, which is associated with cell cycle and stress response, was 73.1% higher than the control value in diabetics. With the use of the combination of herbal active agents, the expression of p53 increased further and exceeded the level of the control group by 171.0%. This increase does not indicate destructive cell death, but rather the activation of controlled cell cycle regulation and DNA repair mechanisms that adapt to stress. The expression of the apoptosispromoting SMAC protein increased by 34.4% in diabetics compared to controls, while this value increased by 56.2% after treatment with the combination of herbal active agents. The further increase in SMAC expression suggests that the combination of herbal active agents does not completely inhibit apoptotic pathways, but rather promotes their fine-tuned regulation, allowing for the selective removal of severely damaged cells (Figure 6). Blood glucose monitoring clearly demonstrated the successful development of type 1 diabetes mellitus induced by STZ treatment. Diabetic animals developed persistent hyperglycemia exceeding the diagnostic limit (13.9 mmol / L), which was present in both the untreated and drug-treated diabetic groups. This is important from a methodological point of view, as it confirms that the topical, ophthalmic application of the combined herbal drug did not affect glucose metabolism systemically, thus the observed retinal effects are not attributable to normalization of blood glucose levels, but to direct tissue, cellular mechanisms.

[0548] Overall, the results indicate that the combination of herbal active agents does not exert its effects through a single target, but rather supports the structural and functional integrity of the retina in a complex manner through multiple interconnected pathways. This property makes it particularly valuable in ophthalmic diseases such as diabetic retinopathy and glaucoma, where neurodegeneration plays a central role in the development of vision loss.

[0549] COMPOSITIONS

[0550] Nasal spray with complex active agents

[0551] It is known that certain herbal preparations can be administered nasally for the treatment of ophthalmic indications. It has been shown that a herbal preparation administered nasally can have a beneficial physiological effect on the symptoms associated with the disease (Saffar Shahroodi A., Nejabat M., Nimrouzi M., Aghaei H., Salehi A., Re-zaei Mokarram A.: Effects of intranasal administration of violet oil in dry eye disease, Clin Exp Optom, 2019). According to a preferred embodiment of the invention, the concentration of the combination of herbal active agent is preferably 0.5-3.0% by weight, particularly preferably 0.6-2.0% by weight, which ensures the desired medicinal effect within this range.

[0552] According to a preferred embodiment of the invention, the pharmaceutical composition is presented in nasal spray ampoules for multiple administration. By this is meant a reusable package containing a sufficient amount of solution for one or two sprays at a time.

[0553] Due to the favorable stability properties of the compositions according to the invention, it is advantageous if no additives, especially preservatives, are added to the solution.

[0554] However, another preferred embodiment of the invention may include a preservative. This solution is particularly advantageous when the product is marketed in multi -dose nasal spray containers (e.g. 5 ml, 8 ml, 10 ml, 20 ml).Preferably, the composition - similarly to the first version - does not contain preservatives, but is packaged in special, sterile, anti-return containers suitable for multiple administration, for example:

[0555] • Multi medication Nasal Spray Device (US20090216183A1),

[0556] • Nasal Spray Device (US20160082204A1),

[0557] • Spray Dispenser for Nasal Drugs (EP3103498B2),

[0558] • Multiple Dose Nasal Spray (US20210330903) etc.

[0559] These packaging systems allow the composition to contain multiple doses without the need for the addition of preservatives.

[0560] In the case of a nasal spray, carriers may be the following: • Purified water / isotonic solution (gentle on the mucous membrane, physiologically compatible)

[0561] • Slightly hypertonic solution (reduction of mucosal swelling, osmotic effect)

[0562] • Buffers: phosphate-, citrate-, acetate buffer (stable pH, reducing irritation)

[0563] • Sodium hyaluronate (mucoadhesive, moisturizing, film-forming, increases durability)

[0564] • CMC / HPMC / carrageenan (viscosity enhancers, longer mucosal contact time)

[0565] • Glycerol / xylitol (moisturizing and humectant effect, comfort enhancement)

[0566] • Propylene glycol / polysorbates (solubility and stability enhancer)

[0567] • Preservative - optional (microbiological stability in multi-dose systems)

[0568] • Oily vehicle in special cases (dissolution and durability of lipophilic herbal extracts) Regarding the technologies used to produce herbal extracts, we refer to patent documents “HU198624B” and “EP2182963A2”, as well as to the publication and clinical study by Saffar Shahroodi et al., (2019), the description ofthe herbal active ingredient-containing preparation, to “US8658225B2”, “CN112057561B”, “US11052041B1”, “US5948414A”, and the regulations of the VIII. Hungarian Pharmacopoeia regarding nasal spray preparations (nasalia).

[0569] Exemplary composition:

[0570] Total weight: 10 ml ± 0.5 ml

[0571] Ingredient Concentration (m / m%)

[0572] Rosmarinus officinalis extract 0.01-50%

[0573] Foeniculum vulgare extract 0.01-50%

[0574] Helichrysum italicum hydrolatum 0.01-99%

[0575] viscoelastic substance (e.g. sodium hyaluronate) 0.1-50%

[0576] The viscoelastic component improves adhesion to the nasal mucosa and prolongs the local effect of the active ingredients.

[0577] Eye drops with complex active agents

[0578] According to a preferred embodiment of the invention, the combination of herbal active agents, the concentration of which is preferably 0.5-3.0% by weight, particularly preferably 0.6-2.0% by weight, which can induce the expected therapeutic effect. According to one embodiment of the invention, the pharmaceutical composition is preferably packaged in ophthalmic bottles containing a single dose. This means that it is a disposable package after the first use, which contains the amount of product required for two instillations or one instillation into both eyes (e.g.: CN102530403A). Due to the stability of the compositions according to the invention, it is therefore advantageous not to add any additives, such as preservatives, to the solution. However, in another embodiment of theinvention, the pharmaceutical composition, as previously indicated, contains a preservative. This solution is generally advantageous when the product is packaged in bottles (5 ml and / or 8 ml and / or 10 ml and / or 20 ml) containing multiple doses. In a third embodiment of the invention, similarly to the first, no preservatives are contained, since the product is packaged in an ABAK® container (W02015 / 055301A1), a Novelia® container (WO2016162812A1); an Aptar Pharma pressurized container (US20140336596A1); a COMOD® container (CA2873265 Al) or a 3K® container; it is formulated in 5 ml and / or 8 ml and / or 10 ml and / or 20 ml, which contain multiple doses. Due to the stability of the compositions according to the invention, it is therefore advantageous not to add any additives, such as preservatives, to the solution. For the preparation of the herbal extract used for the eye drops, reference is made to the patent documents " HU198624B" and " EP2182963A2", as well as to the patent document for eye drops containing herbal active ingredients " W003 / 080091A1", and to the descriptions of ophthalmic preparations (ophthalmica) in the VIII. Hungarian Pharmacopoeia.

[0579] e.g.: total weight: 10 ml ± 0.5 ml

[0580] Rosmarinus officinalis extract 0.01-50 m / m%

[0581] Foeniculum vulgare extract 0.01-50 m / m%

[0582] Helichrysum italicum hydrolatum 0.01-99 m / m%

[0583] viscoelastic substance (e.g. sodium hyaluronate) 0.1-50 m / m%

[0584] Eye ointment with complex active agents

[0585] For the preparation of the herbal extract used for the eye ointment, we refer to the publications with patent numbers “HU198624B”, “W003 / 080091A1” and “EP2182963A2”, as well as to the descriptions of ophthalmic preparations (ophthalmica) in the VIII. Hungarian Pharmacopoeia. The ratio of the active ingredients can be 0.01-50 m / m% in the case of Rosmarinus officinalis extract, 0.01-50 m / m% in the case of Foeniculum vulgare extract and 0.01-99 m / m% in the case of Helichrysum italicum extract / hydrolatum. The ratio of the added viscoelastic substance (e.g. sodium hyaluronate) or other eye ointment raw material can be 0.1-50 m / m%.

[0586] Packaging: 10 g eye ointment tube in a paper box. (There can be 1 -20 eye ointment tubes in a paper box) Dosage: Apply 1-10 times a day to the lower conjunctival sac of both eyes

[0587] Shelflife: 20 days

[0588] e.g.: Total weight: 1000 mg ± 2 mg

[0589] Rosmarinus officinalis extract 80 mg ± 2 mg

[0590] Foeniculum vulgare extract 80 mg ± 2 mg

[0591] Helichrysum italicum 15 mg ± 2 mg

[0592] (of which rosmarinic acid content min. 20 mg)

[0593] Aqua ad injectabilia or hydrolatum Helichrysii 250 mg

[0594] Oculenti simplicis FoNo VIII. 800 mg

[0595] Dietary supplement capsule with complex active agents

[0596] For the production of dietary supplement capsules containing the combination of herbal active agents, we use carefully selected (free from mold and traces of pests) pharmacopoeial quality herbal drugs as raw materials. The raw material is delivered to the food production or medical device production site, to the plant, by a grower and distributor who produces the raw material in appropriate pharmacopoeial quality. The raw or dried drug of the medicinal plant can be replaced with pharmacopoeial quality and purity herbal extracts in the form of powder. The quality of the raw materials is certified by the quality certificate issued by the suppliers. The quality certificatesare archived for each production batch as part of quality assurance. A mixture is made from the starting materials using a mixing machine. The tablets are produced on the appropriate encapsulation machine. The encapsulated product is boxed and labeled. The packaging materials used must have the appropriate use permit. 1 sample per 1000 boxed and labeled products is randomly selected. The quality and microbiological purity of the raw materials are guaranteed by the suppliers with a certificate of workmanship and appropriate laboratory qualification. In addition, before production, the manufacturer checks whether the raw materials comply with the values declared by the suppliers. The responsible quality assurance manager of the production site has the plant equipment cleaned, checks, has them checked and documents their cleanliness and appropriate preparation for the given production process.

[0597] For the preparation of the herbal extract used, we refer to the publications with patent numbers “HU198624B”, “W003 / 080091A1” and “EP2182963A2”. The formulation of the active ingredients and their packaging into micelles is based on the summary study by Nebbioso and colleagues (Nebbioso M, Franzone F, Greco A, et al (2021) Recent Advances and Disputes About Curcumin in Retinal Diseases. Clin Ophthalmol 15:2553-2571.) and can be combined with any formula due to the hydrophobic and hydrophilic components, for optimal intraocular tissue penetration and accumulation. In addition, we refer to the patent document “US20040202731A1” for detailed information on the manufacturing technology and formulation steps.

[0598] Sensory properties: The capsule has an aromatic smell and a neutral taste due to the capsules. Depending on the capsule material, it can be transparent, yellowish or white.

[0599] Packaging method (1): the capsules are placed on a film-coated plate in a paper box. 1 film contains 10 tablets, 1 box contains 5 sheets.

[0600] Packaging method (2): the capsules are placed in a plastic box with a sealable lid. Paper box outer packaging is optional. 1 pack contains 50 capsules.

[0601] Dosage: lx daily before meals (50 daily doses), 2x daily before meals (25 daily doses)

[0602] Shelf life: 12 months

[0603] e.g.: Total weight: 1000 mg ± 20 mg

[0604] Helichrysum italicum 20 mg ± 5mg

[0605] Foeniculum vulgare 185 mg± 10 mg

[0606] Rosmarinus officinalis ± 785 mg ± 15 mg

[0607] (of which rosmarinic acid content min. 20 mg)

[0608] The active agents are packaged in D-a-tocopherol polyethylene glycol 1000 succinate (TPGS) micelles.

[0609] Dietary supplement tablet with complex active agents

[0610] For the production of dietary supplement tablets containing the combination of herbal active agents, we use carefully selected (free from mold and traces of pests) pharmacopoeial quality herbal drugs as raw materials. The grower and distributor producing the raw materials in appropriate pharmacopoeial quality delivers them to the food production or medical device production site, to the plant. The raw or dried drug of the medicinal plant can be replaced with pharmacopoeial quality and purity herbal extracts. The quality of the raw materials is certified by the quality certificate issued by the suppliers. The quality certificates are archived for each production batch as part of quality assurance. The starting materials are mixed with a mixer. The tablets are produced on the appropriate tableting machine. The tableted product is boxed and labeled. The packaging materials used must have an appropriate use permit. 1 sample per 1000 pieces of boxed and labeled products is randomly selected. The qualityand microbiological purity of the raw materials are guaranteed by the suppliers with a certificate of origin and the qualification of an appropriate laboratory. In addition, before production, the manufacturer checks whether the raw materials comply with the values declared by the suppliers. The responsible quality assurance manager of the production site has the plant equipment cleaned, checks, has them checked and documents their cleanliness and appropriate preparation for the given production process.

[0611] . For the preparation of the herbal extract used, we refer to the patent documents “HU198624B”, “W003 / 080091 Al” and “EP2182963 A2”. The formulation of the active agents and their packaging into micelles is based on the summary study by Nebbioso and colleagues (Nebbioso M, Franzone F, Greco A, et al (2021) Recent Advances and Disputes About Curcumin in Retinal Diseases. Clin Ophthalmol 15:2553-2571.) and can be combined with any formula due to the hydrophobic and hydrophilic components, for optimal intraocular tissue penetration and accumulation. In addition, we refer to the patent document “US20040202731A1” for detailed information on the manufacturing technology and formulation steps.

[0612] Sensory properties: The tablet has an aromatic smell and a slightly spicy taste, white in color.

[0613] Packaging method: the tablets are packaged as film-coated tablets in a paper box. 1 film contains 10 tablets, 1 box contains 5 sheets.

[0614] Dosage: 2x daily before meals (25 daily doses)

[0615] Shelf life: 12 months

[0616] e.g.: Total weight: 1000 mg ± 20 mg

[0617] Helichrysum italicum 20 mg ± 5mg

[0618] Foeniculum vulgare 185 mg± 10 mg

[0619] Rosmarinus officinalis ± 785 mg ± 15 mg

[0620] (of which rosmarinic acid content min. 20 mg)

[0621] The active ingredient is packaged in D-a-tocopherol polyethylene glycol 1000 succinate (TPGS) micelles. Herbal tea blend with complex active agents (species)

[0622] When administered orally, the active agents of the herbal tea mixture, which is considered a food, are absorbed enterally. At the same time, a larger amount of dried drug is required through the circulation, since it does not act locally.

[0623] Sensory properties: the mixture has an aromatic smell and a spicy taste.

[0624] Packaging method (1): it is sold as a filter tea mixture in a paper box. One box contains 20-25xlg±0.25g of enveloped or unenveloped tea bags.

[0625] Packaging method (2): fibrous tea mixture in a 40g package in a paper bag.

[0626] Packaging method (3): fibrous tea mixture in a 100g package in a paper or aroma-sealing plastic bag, packed in a paper box.

[0627] Dose: l-5x 1g per day, boiled in 2dl of water

[0628] Shelflife: 12-24 months

[0629] e.g.: total weight: 100 g ± 20 mg

[0630] Rosmarinus officinalis (Folium Rosmarini) 40g (10-90g)

[0631] Foeniculum vulgare (Semen Foeniculi) 40g (10-90g)

[0632] Helichrysum italicum (Herba Helichrysi) 20g (1 -40g)

[0633] Instant drink powder suspension containing complex herbal agentsThe active agents are mixed with suitable solvents, e.g. ethyl alcohol or distilled water or Helichrysum italicum hydrolatum. In addition, active ingredient carrier materials, e.g. maltodextrin, dextrose or corn starch may be used. For lactose-free and gluten-free patients, with appropriate replacement of carrier materials. Rapid oral dissolution occurs in approx. 5-120 sec. For the preparation of the herbal extract used, we refer to the patent documents " HU198624B", " W003 / 080091A1", " US10463707B2" and " EP2182963A2". Fordetailed information on the manufacturing technology and formulation steps, please refer to the patent documents “US20040202731A1”, “US6287567B1”, “US20070275149A1” and “US10463707B2”. The amount of herbal extracts may be: Rosmarinus officinalis 0.1-1000 g, Foeniculum vulgare 0.1-1000 g, Helichrysum italicum 0.1-1000g.

[0634] Sensory properties: the mixture has a slightly aromatic smell and a spicy taste, white powder.

[0635] Packaging method: immediately soluble drink powder suspensions are sold. One box contains 12-30 metalized protective gas, aroma-sealing, perforated bags. The weight of 1 bag can be 1 -50g.

[0636] Dose: l-5x 1g daily boiled in 2dl water

[0637] Shelflife: 12-24 months

[0638] e.g.: Instant drink powder

[0639] Rosmarinus officinalis extract 0. l-1000g

[0640] Foeniculum vulgare extract 0.1 -1000g

[0641] Helichrysum italicum extract 0.1 -1000g

[0642] Internal tincture with complex active agents

[0643] For the preparation of the herbal extract used, we refer to the patent documents “HU198624B”, “W003 / 080091A1”, “EP2182963A2” and “US9468865B1”.

[0644] 100 ml contains 5-50 g of dissolved herbal extract (Rosmarinus officinalis 0.1-97 m / m%, Foeniculum vulgare 0.1-97 m / m% and Helichrysum italicum 0.1-99 m / m%).

[0645] Other ingredients: 96% ethanol, purified water, caramel (El 50).

[0646] Alcohol content: 20-80 m / m%, but optimal range: 30-50 m / m%

[0647] Sensory properties: Yellowish-brown, clear, aromatic, bitter, characteristic taste, ethanol solution.

[0648] Packaging: 100 ml, 250 ml, 500 ml, 4x100 ml, 2x250 ml solution in brown, flat, screw-thread PET bottles, PE insert, green, red or yellow, with a guarantee seal, with a metal cap, in a box. 1 bottle in 1 box (100 ml, 250 ml, 500 ml). 4 100 ml, 2250 ml bottles in a box. Packaging:

[0649] Dose: l-10x 1 teaspoon (1.5g) solution mixed in 1 glass of water, or swallowed in the mouth with 1 glass of water Shelflife: 12-24 months

[0650] Used as a natural cosmetic with complex active agents as an “eye wrinkle cream ” around the eyes

[0651] For the preparation of the herbal extract used, we refer to the patent documents “HU198624B”, “W003 / 080091A1”, “US9468865B1” and “EP2182963A2”. A detailed description of the production, composition and dispatch of semi-solid pharmaceutical and cosmetic preparations containing the active ingredient is contained in the VIII. Hungarian Pharmacopoeia and Formulae Normales. Details regarding the production and manufacturing technology of periocular creams containing herbal active ingredients can be found in the patent documents “CN108042475A”, “US20050137205A1”, “US20120045405A1” and “US9192643B2”.

[0652] Sensory properties: white or pale yellow, pale pink, aromatic scent, semi-solid consistency, easy -to-spread cream Packaging method: in a cosmetic container, with or without paper packaging.Dosage: Apply a pea-sized amount with your fingertips around the eyes and on the eyelids in a thin layer, as needed, at least once a day, maximum every half hour

[0653] Shelflife: 12-24 months

[0654] e.g.: eye cream containing complex herbal extracts (100g)

[0655] Rosmarinus officinalis extract 15g

[0656] Foeniculum vulgare extract 20g

[0657] Helichrysum italicum hydrolatum 40g

[0658] Unguentum hydrophilicum nonionicum 25g

[0659] Medicinal rod complex active agents for use

[0660] The definition according to the VIII. Hungarian Pharmacopoeia FoNo publication: the medicinal rod (pertica) is a (semi)solid pharmaceutical preparation used for the treatment of the skin surface, which comprises a pharmaceutical form of active ingredient(s) and a preparation base (according to FoNo, ricinus oleum virginale and cera alba). According to the implementation we have planned, the preparation base cannot be limited to the two ingredients mentioned above. Furthermore, depending on the treatment site, it can be applied periocularly and on the skin of the lips. Based on the implementation, it can be lipstick, lip balm, “eye” balm, pertica.

[0661] For the preparation of the herbal extract used, we refer to the patent documents numbered “HU198624B”, “W003 / 080091A1” and “EP2182963A2”. The composition, production technology and dispatch of pertica are described in detail in the VIII. Hungarian Pharmacopoeia, whose form is: plastic stick holder. Another advantageous form may be a screw stick, the form of which is shown in the document numbered “USD745742S1”, or it may be realized in a spherical cap container according to the patent application numbered “EP3066952A1”. For cosmetic appearance and to promote absorption from the skin of the lips, it may also appear as a lipstick with herbal active ingredients, according to the following documents: “US5342134A” and “CN105055279A”. The lipstick can be of any color according to its appearance. The container and the volume of the preparation can be 5- 100g, the combined herbal active ingredients are Rosmarinus officinalis 0.1-97 m / m%, Foeniculum vulgare 0.1-97 m / m% and Helichrysum italicum 0.1-99 m / m%.

[0662] e.g.: Eye medicinal stick for external use (50g)

[0663] Rosmarinus officinalis extract 10 g

[0664] Foeniculum vulgare extract 15 g

[0665] Helichrysum italicum extract 5 g

[0666] Cera alba 15.0 g

[0667] Ricini oleum virginale 0.5 g

[0668] Sensory properties: whitish-yellowish, semi-solid, aromatic odor, easy to spread, greasy to the touch Packaging method: active ingredient packed in a stick container with a cap. Packed in a paper box or without. 1 paper box can contain 1-20 stick containers.

[0669] Dosage: Apply 4-5 times a day, one stick is enough for an 8-10 day treatment.

[0670] Shelflife: 12-24 months

[0671] Complex active agents impregnated onto the surface of an adhesive patch (emplastrum / collemplastrum) For the preparation of the herbal extract used, we refer to the patent documents “HU198624B”, “W003 / 080091 Al” and “EP2182963 A2”. Medical (adhesive) patches impregnated with herbal active ingredientsare mainly used in traditional Chinese medicine. The manufacturing process of the adhesive patch and the distribution of active ingredients can be implemented based on the patent application “CN101181461A”. The recommended place of application of the adhesive patch is the periocular skin area. It can also be implemented as an eye adhesive patch, where the area cut out for the eye slit and eyelid is not covered by the patch.

[0672] Sensory properties: the mixture has a slightly aromatic smell, brown or skin tone.

[0673] Packaging method: adhesive patch fixed with the sticky side on hydrophobic water-repellent waxed paper and wrapped in plastic foil. 1 box / bag contains 1-30 foil bags (30 pcs = 1 month's supply).

[0674] Dose: Apply to the skin around the eyes at least once a day (max. every hour).

[0675] Shelf life: 12 months

[0676] e.g.: 1 piece of priorbital eye patch, 8 g:

[0677] Rosmarinus officinalis extract 0.1-7.9 g

[0678] Foeniculum vulgar e extract 0.1-7.9 g

[0679] Helichrysum italicum extract 0.1-7.9 g

[0680] Complex active agents impregnated on contact lenses

[0681] To produce this product, the combination of herbal active agents is impregnated onto a hydrogel contact lens that can be placed on the eye surface. The water content of the material can be min. 20%-70%. The combination of active agents can be contained in an amount of 1 ng / kg - 10 mg / kg per kg of body weight.

[0682] For the preparation of the herbal extract used, we refer to the patent documents “HU198624B”, “W003 / 080091A1” and “EP2182963A2”. For the detailed properties, manufacturing process and implementation of the pharmaceutical form, we refer to the patent US8414912B2 “Contact lens drug delivery device”. e.g.: 70% water-containing hydrogel contact lens

[0683] Rosmarinus officinalis extract 0,1-1 mg, preferably 0,5 mg

[0684] Foeniculum vulgare extract 0,1-1 mg, preferably 0,5 mg

[0685] Helichrysum italicum extract 0,5-5 mg, preferably 1 mg

[0686] The use is preferably: Disposable contact lenses with 24-hour wear time

[0687] 60 contact lenses individually packaged on a film sheet in physiological storage solution. Packed in a paper box. Homeopathic and anthroposophic preparations with complex active agents

[0688] Preparation of mother tincture and potentization according to the Hungarian and European Pharmacopoeia according to the pharmacopoeial rules [Homoeopathic preparations (1038), Methods of preparation of homoeopathic stocks and potentisation (2371), Mother tinctures for homoeopathic preparations (2029)]. Preparation of mother tincture from our combined active agents in a 1: 1: 1 ratio and production and packaging of the products in addition to the D and C dilution series. A gel can also be prepared homeopathically from the combined herbal solution based on the patent document “US7923040B2”. The steps of the entire manufacturing process are described in detail in the patent document “US4703717A”, and the production of balls impregnated with homeopathic active ingredients and the description of their special “multi-dose” container are described in the patent application “US5549217A”.

[0689] e.g.: Acidum Rosmarinicum Complex - in a „multi-dose” container

[0690] Mother tincture in a ratio of 1: 1: 1:

[0691] Rosmarinus officinalis

[0692] Foeniculum vulgareHelichrysum italicum

[0693] Dilution and dynamization in the following potentiation forms, finally impregnating the surface of lactose and / or sucrose balls: CH5, CH9, CH12, CH15, CH30, CH200, CH1000.

[0694] Sensory properties: white, odorless, sweet-tasting balls

[0695] Packaging method: screw jar with cap designed for homeopathic balls (for 80 balls) or in brown darkened glass with a special cap (300 balls). Labeled with the following potentiation levels: CH5, CH9, CH12, CH15, CH30, CH200, CH1000.

[0696] Dosage: 2x5 balls daily, sucked buccally before meals (10 daily doses).

[0697] Shelf life: 12 months

[0698] Complex active agents in Bach flower essences

[0699] Bach flower essences sold as food in the European Union are plant extracts used in complementary medicine. The properties, manufacturing technology, distribution and variety of uses of the solutions (alcoholic tincture, spray, soft drink, pastille, etc.) are the same as those contained in the patent document “W02011085460A1” entitled “Flower Remedy Solution”. Supplemented with our complex herbal active agents that we intend to use:

[0700] Rosmarinus officinalis'. Foeniculum vulgare'. Helichrysum italicum 1:1:1 ratio of the mixture of the flower head (flos) in aqua purificata prepared by sunlight (primary tincture) dissolved in wine spirit (brandy).

[0701] Sensory properties: alcoholic odor, alcoholic taste, yellowish-pale brown solution

[0702] Quality preservation period: 12-24 months

[0703] Packaging method: in a brown bottle with a rubber dropper top, packed in a paper box with or without.

[0704] Indicated on the packaging: Composition: plant extracts, 27% (V / V) wine spirit; Dosage: 2 drops in 2 dl of water, divided into sips throughout the day, or 2 drops diluted in 30 ml of water and placed 4x4 drops on the tongue daily.

Claims

CLAIMS1. A combination of active agents for use in the treatment or prevention of a neurodegenerative disease, characterized in that the combination of active agents comprises extracts of the following plants: Rosmarinus officinalis, Foeniculum vulgare, Helichrysum italicum.

2. The combination of active agents for use according to claim 1, characterized in that the neurodegenerative disease is a damage of the retina or the optic nerve or Parkinson’s disease.

3. The combination of active agents for use according to claim 2, characterized in that the neurodegenerative disease is diabetic neuropathy or glaucoma.

4. The combination of active agents for use according to claim 2, characterized in that the neurodegenerative disease is Parkinson’s disease.

5. The combination of active agents for use according to any one of the preceding claims, characterized in that the combination of active agents consists of extracts of the following plants: Rosmarinus officinalis, Foeniculum vulgare, Helichrysum italicum.

6. The combination of active agents for use according to any one of the preceding claims, characterized in that the extract of Rosmarinus officinalis comprises rosmarinic acid or consists essentially of rosmarinic acid or consists of rosmarinic acid.

7. The combination of active agents for use according to any one of the preceding claims, characterized in that the extract of Rosmarinus officinalis is E392, Rosmarini aetheroleum, Rosmarini folium extract or rosmarinic acid.

8. The combination of active agents for use according to any one of the preceding claims, characterized in that the extract of Foeniculum vulgare is Foeniculi amari herbae aetheroleum or an alcohol-free diluendum thereof.

9. The combination of active agents for use according to any one of the preceding claims, characterized in that the extract of Foeniculum vulgare comprises rosmarinic acid.

10. The combination of active agents for use according to any one of the preceding claims, characterized in that the extract of Helichrysum italicum is a hydrolate of Helichrysum italicum.

11. The combination of active agents for use according to any one of the preceding claims, characterized in that the extract of Helichrysum italicum comprises rosmarinic acid.

12. The combination of active agents for use according to any one of the preceding claims, characterized in that the weight or volume ratio of rosemary extract: fennel extract: immortelle extract or rosmarinic acid: fennel extract: immortelle extract is 0.1-0.9:0.1-0.9:0.1-09.

13. The combination of active agents for use according to any one of the preceding claims, characterized in that the weight or volume ratio of rosemary extract: fennel extract: immortelle extract or rosmarinic acid: fennel extract: immortelle extract is about 1:1:1.

14. The combination of active agents for use according to any one of the preceding claims, characterized in that the extract of Rosmarinus officinalis is present in an amount of 0.01-70 m / v% based on the total amount of the combination of active agents, the extract of Foeniculum vulgare is present in an amount of 0.01-30 m / v% based on the total amount of the combination of active agents and Helichrysum italicum is present in an amount of 0.01-50 m / v% based on the total amount of the combination of active agents.

15. An extract of Foeniculum vulgare for use in the treatment or prevention of a neurodegenerative disease of the eye.

16. An extract of Helichrysum italicum for use in the treatment or prevention of a damage of the retina or the optic nerve.

17. The extract of Foeniculum vulgare for use according to claim 15 or the extract of Helichrysum italicum for use according to claim 16, wherein the neurodegenerative disease of the eye is a damage of the retina or the optic nerve.

18. The combination of active agents for use or the active agent for use according to any one of the preceding claims, characterized in that the combination of active agents or the active agent is formulated in a pharmaceutical composition, whch comprises a pharmaceutically acceptable excipient or carrier.

19. The combination of active agents or active agent for use according to claim 18, characterized in that the pharmaceutical composition is eye drops or a composition for intranasal use.

20. Composition comprising:0.01-50 m / m% of Rosmarinus officinalis extract, 0.01-50 m / m% of Foeniculum vulgare extract and 0.01-50 m / m% of Helichrysum italicum extract, preferably hydrolate.

21. The composition according to claim 20, which is eye drops.

22. The composition according to claim 20, which is for intranasal administration, preferably a nasal spray.

23. The composition according to any one of claims 20 to 22, further comprising a viscoelastic excipient.

24. The composition according to any one of claims 20 to 23, further comprising a pharmaceutically acceptable excipient or carrier.

25. The composition according to any one of claims 20 to 24, comprising sodium hyaluronate.

26. The composition according to any one of claims 20 to 25 for use in the treatment or prevention of a neurodegenerative disease.

27. The composition for use according to claim 26, wherein the neurodegenerative disease is a damage of the retina or the optic nerve.

28. The composition according to any one of claims 22 to 25 for use in the treatment or prevention of a neurodegenerative disease.

29. The composition for use according to claim 28, wherein the neurodegenerative disease is Parkinson’s disease.

30. An eye drop-composition or a composition for nasal administration, comprising: Rosmarinus officinalis extract, Foeniculum vulgare extract, Helichrysum italicum extract and optionally a viscoelastic excipient.