Pharmaceutical composition for treating diseases associated with enhanced function of fibroblast growth factor receptor 3

Abstract

The present invention provides a pharmaceutical composition for treating diseases associated with enhanced function of fibroblast growth factor receptor 3 (FGFR3), the pharmaceutical composition containing, as an active ingredient, an inhibitor of cyclic AMP response element-binding protein (CREB) signaling.

Description

Pharmaceutical composition for the treatment of diseases involving hyperfunction of fibroblast growth factor receptor 3

[0001] The present invention relates to a pharmaceutical composition for the treatment of diseases involving hyperfunction of fibroblast growth factor receptor 3.

[0002] Achondroplasia (Ach) is characterized by disproportionate limb shortening and short stature. Ach is the most common chondrodysplasia, occurring at a frequency of 1 in 15,000–25,000 births. Mutations in the gene encoding fibroblast growth factor receptor 3 (FGFR3) have been identified in Ach patients (Non-Patent Literature 1, 2). Observation of bone overgrowth in FGFR3-deficient mice revealed that FGFR3 is a negative regulator of endochondral ossification in growth plate cartilage tissue, and that mutations causing Ach are gain-of-function mutations. It has been reported that over 97% of Ach cases result from an autosomal dominant missense mutation (p.Gly380Arg) in the transmembrane domain of FGFR3 (Non-Patent Literature 2–4). Ach patients without the p.Gly380Arg mutation have other less common FGFR3 mutations, such as p.Ser217Cys, Ser279Cys, p.Ser344Cys, and p.Gly375Cys.

[0003] In achondroplasia (Ach), based on the finding that the C-type natriuretic peptide (CNP) signaling pathway cross-talks with the MAPK signaling and down-regulates the MAPK signaling, a stabilized form of CNP called vosoritide has been developed. Vosoritide has been shown to rescue the Ach phenotype in mice and humans and is approved and used as a therapeutic agent for Ach in Japan. However, since there are other downstream pathways of FGFR3 signaling besides MAPK and the cells expressing NPR-B, the receptor for vosoritide, do not completely overlap with the cells expressing FGFR3, its effectiveness is limited and bone length does not fully recover even with vosoritide administration. Infigratinib, an FGFR inhibitor, is currently undergoing clinical trials in Japan as an anti-cancer drug and a therapeutic agent for Ach. Infigratinib is a pan-FGFR inhibitor that inhibits FGFR1-4 and has side effects due to the inhibition of FGFR1, 2, and 4 other than FGFR3. Therefore, the development of effective therapeutic agents with fewer side effects is desired.

[0004] In addition to the incomplete rescue by currently used therapeutic agents, important pathophysiological mechanisms affecting the growth plate pathology have not been discovered due to the lack of a systemic approach in Ach research. Most of the previous studies have focused on the proliferative and hypertrophic layers, while the abnormalities in the resting layer have not been fully studied. Also, other cellular signaling cascades besides the MAPK and STAT1 pathways have not been comprehensively studied. Therefore, elucidation of the molecular mechanisms as novel therapeutic targets in Ach is required.

[0005] Rousseau F et al. Nature (1994) 371: 252-254.Shiang R et al. Cell (1994) 78: 335-342.Vajo Z et al. Endocr Rev (2000) 21: 23-39.Wilkin DJ et al. Am J Hum Genet (1998) 63: 711-716.

[0006] The present invention aims to provide a pharmaceutical composition for the treatment of diseases involving hyperfunction of fibroblast growth factor receptor 3 (FGFR3). Furthermore, the present invention aims to provide a screening method for therapeutic agents for diseases involving hyperfunction of FGFR3.

[0007] To solve the above problems, the inventors screened knock-in mice and cultured cell lines having mutations that lead to enhanced FGFR3 function. As a result, they found that inhibitors of cyclic AMP response element-binding protein (CREB) signaling factors improve the phenotype of short stature in the knock-in mice and suppress the proliferation of the cultured cells. The present invention was completed based on these findings.

[0008] That is, the present invention provides the following. [1] A pharmaceutical composition for treating a disease associated with hyperfunction of fibroblast growth factor receptor 3 (FGFR3), comprising an inhibitor of cyclic AMP response element-binding protein (CREB) signaling as an active ingredient. [2] The pharmaceutical composition according to [1], wherein the disease is achondroplasia. [3] The pharmaceutical composition according to [1], wherein the disease is cancer. [4] The pharmaceutical composition according to [3], wherein the disease is bladder cancer, colorectal cancer, lung cancer, or uterine carcinosarcoma. [5] The pharmaceutical composition according to any one of [1] to [4], wherein the inhibitor is a substance that inhibits the function of CREB or Pappalysin-2. [6] The pharmaceutical composition according to any one of [1] to [4], wherein the inhibitor is an antibody or peptide that specifically binds to CREB or Pappalysin-2. [7] The pharmaceutical composition according to any one of [1] to [4], wherein the inhibitor is a substance that inhibits the expression of CREB or Pappalysin-2. [8] The pharmaceutical composition according to any one of [1] to [4], wherein the inhibitor is a nucleic acid that inhibits the expression of CREB or Pappalysin-2. [9] The pharmaceutical composition according to any one of [1] to [4], wherein the inhibitor is a gene therapy agent targeting the CREB gene or the Pappalysin-2 gene.

[10] The pharmaceutical composition according to [5], wherein the substance that inhibits the function of CREB is a substance that inhibits the phosphorylation of CREB.

[11] The pharmaceutical composition according to

[10] , wherein the substance that inhibits the phosphorylation of CREB is 666-15 or a derivative thereof.

[12] A method for screening a therapeutic agent for a disease associated with hyperfunction of FGFR3, comprising identifying a substance that inhibits the expression of CREB or Pappalysin-2.

[13] A method for screening a therapeutic agent for a disease associated with hyperfunction of FGFR3, comprising identifying a substance that inhibits the function of CREB or Pappalysin-2.

[0009] The present invention makes it possible to provide a pharmaceutical composition for the treatment of diseases involving hyperfunction of FGFR3. Furthermore, the screening method of the present invention makes it possible to obtain substances useful for the prevention, treatment, or improvement of diseases involving hyperfunction of FGFR3, and to provide a novel agent for the treatment of diseases involving hyperfunction of FGFR3.

[0010] In Example 1, FGFR3 Ach This figure shows the results of mouse generation and phenotypic analysis. Figure A shows the introduction of the p / Gly374Arg mutation and insertion of a neocassette at the mouse Fgfr3 gene locus. Arrowheads indicate FRP sequences, and arrows indicate guide RNA sequences. Figure B shows control mice and Fgfr3 at 28 days of age. Ach This figure shows the macroscopic morphology of a mouse. The scale bar indicates 5 mm. C and D are control mice and Fgfr3 mice. Ach This figure shows the changes in mouse body weight (C) and survival rate (D). E is the length of the femur, F is the length of the skeletal elements including the tibia, and G is the length of the ulna. In Example 2, Fgfr3 Ach This figure shows the results of histological analysis of mouse growth plate cartilage tissue. A shows hematoxylin-eosin (HE) staining, and B shows safranin O-fast green (SOFG) staining. In Example 2, Fgfr3 AchThis figure shows the results of histological analysis of mouse growth plate cartilage tissue. A and B show the histological staining images, and C shows the results of measuring the height of the resting layer (RZ), proliferating layer (PZ), hypertrophic layer (HZ), and the entire growth plate (GP). This figure shows the results of a short-term EdU tracking assay performed in Example 3. A is a diagram showing an overview of the short-term EdU tracking assay, B is a diagram showing the histological staining image of growth plate cartilage tissue, and C shows the results of measuring the number of EdU-positive cells in proliferating layer chondrocytes. This figure shows the results of a long-term EdU tracking assay performed in Example 3. A is a diagram showing an overview of the long-term EdU tracking assay, B is a diagram showing the histological staining image of growth plate cartilage tissue, and C shows the results of measuring the number of EdU-positive cells in resting layer chondrocytes. This figure shows the results of cell lineage trace analysis performed in Example 3. A and B are diagrams showing the histological images of growth plate cartilage tissue, and C shows the results of measuring the number of cells piled up in each column. This figure shows the results of cell lineage trace analysis performed in Example 3. Control mice (A, B) and Fgfr3 AchThis figure shows the histological features of mouse growth plate cartilage tissue (A, C) and the angles of clonal cell stacking relative to the longitudinal axis of the growth plate cartilage tissue (B, D). This figure shows an overview of the results of EdU labeling and cell lineage trace analysis in Example 3 (A) and histological staining images of growth plate cartilage tissue (B and C). This figure shows the results of single-cell RNA sequencing analysis performed in Example 4. A is a figure showing an overview of each sample used for analysis, B is a figure showing cell clusters, and C to H are figures showing the results of the analysis of chondrocyte marker expression. This figure shows the results of single-cell RNA sequencing analysis performed in Example 4. A is a figure showing cell clusters, and B to H are figures showing the results of the analysis of chondrocyte marker expression. This figure shows the results of single-cell RNA sequencing analysis performed in Example 4, showing the results of the analysis of marker genes and cell cycle-related genes in quiescent, prehypertrophic, and hypertrophic chondrocytes. This figure shows the results of single-cell RNA sequencing analysis performed in Example 4. Figure A shows cell clusters, Figure B shows the results of cell cluster analysis in each mouse sample, and Figure C shows the ratio of cell numbers in each cell cluster. Figure 4 shows the results of single-cell RNA sequencing analysis performed in Example 4, with A showing the results of identifying differentially expressed genes, and Figures B-I showing the results of analyzing the expression of the top 8 identified genes in each cluster. Figure 5 shows the results of immunohistochemistry using anti-Spondin-1 antibody (A) and anti-Pappalysin-2 antibody (B) in Example 4. The scale bar represents 50 micrometers. Figure 6 shows the results of Example 5. Figure A shows the results of IPA analysis of differentially expressed genes, Figure B shows the results of analyzing the expression level of the CREB signaling molecule in primary mouse chondrocytes, and Figures C and D show the results of luciferase assays. This figure shows the results of immunohistochemical staining performed in Example 5 using antibodies that recognize phosphorylated CREB (p-CREB) (A, B), CREB-binding protein (CBP) (C, D), phosphorylated FRS2 (p-FRS2) (E, F), and phosphorylated ERK (p-ERK) (G, H).This figure shows the results of analyzing Spondin-1 expression levels in chondrocytes (ATDC5) in Example 5. Figure A shows mRNA expression levels, and figures B and C show the results of analyzing protein expression levels. Fgfr3 was used in Example 5. Ach This figure shows the results of administering the CREB inhibitor 666-15 to mice. A shows the change in body weight, B shows the length of the femur, C shows the height of the growth plate, and D shows the histological image of the growth plate cartilage tissue. This figure shows the results of immunohistochemical staining of Spondin-1 (A, B) and CD73 (C) in Example 5. This figure shows the results of analyzing the expression of Pappalysin-2 and IGFBP5 in Example 5. A to C show the results of Western blot analysis, and D and E show the results of immunohistochemical staining. This figure shows the results of comparing the expression levels of Pappalysin-2 in each cancer cell line in Example 6. This figure shows the results of knockdown of Pappalysin-2 in Example 6. A shows the expression levels of Pappalysin-2 after each siRNA treatment, and B and C show the results of cell proliferation tests. This figure shows the results of knockout of Pappalysin-2 in Example 6. Figures A and B show microscopic images of control (A) and knockout (Pappa2 KO) cells (B), figures C and D show the results of cell proliferation tests, and figure E shows the results of the cell growth rate analysis.

[0011] In this specification, “diseases involving hyperfunction of fibroblast growth factor receptor 3 (FGFR3)” means any disease in which a patient exhibits abnormally increased activation of FGFR3. Constitutive activation of FGFR3 may preferably be due to gain-of-function mutations in the FGFR3 gene. Examples of diseases involving hyperfunction of FGFR3 include, but are not limited to, FGFR3 chondrodysplasia, craniosynostosis syndrome, LADD (lacrimo-auriculo-dento-digital) syndrome, Crouzon syndrome with acanthosis nigricans, Muwenke syndrome, and cancer. Examples of FGFR3 chondrodysplasia include achondroplasia (Ach), hypochondrodysplasia, thanatophoric dysplasia (TD) types 1 and 2, SADDAN (severe achondroplasia with developmental delay and acanthosis nigricans) syndrome, and CATSHL (camptodactyly, tall stature, and hearing loss) syndrome. Examples of cancers associated with increased FGFR3 function include, but are not limited to, bladder cancer, colorectal cancer, lung cancer, uterine carcinosarcoma, stomach cancer, cervical cancer, ovarian cancer, prostate cancer, bile duct cancer, melanoma, hepatocellular carcinoma, pancreatic cancer, and brain tumors.

[0012] [Pharmaceutical Composition] The present invention provides a pharmaceutical composition for the treatment of diseases involving hyperfunction of FGFR3, which contains a cyclic AMP response element-binding protein (CREB) signaling inhibitor as an active ingredient.

[0013] The active ingredient of the pharmaceutical composition of the present invention is not particularly limited as long as it is a substance that inhibits CREB signaling. For example, it may be a substance that disrupts, reduces, or suppresses CREB signaling, a substance that inhibits the expression of molecules involved in CREB signaling (hereinafter referred to as CREB signaling molecules), or a substance that inhibits the function of CREB signaling molecules. Examples of CREB signaling molecules include, but are not limited to, CREB, CREB phosphorylation enzymes, Pappalysin-2, and Spondin-1. Examples of CREB signaling inhibitors include, but are not particularly limited to, small molecule compounds or their derivatives or analogs, nucleic acids, proteins, peptides, antibodies, and gene therapy drugs. A substance that inhibits the expression of CREB signaling molecules may be a substance that inhibits the expression of a gene encoding a CREB signaling molecule, or a gene therapy drug that targets a gene encoding a CREB signaling molecule. The active ingredient of the pharmaceutical composition of the present invention may be a known CREB signaling factor inhibitor, or a substance identified by the screening method of the present invention described later.

[0014] If the active ingredient of the pharmaceutical composition of the present invention is a substance that inhibits the function of CREB or Pappalysin-2, it may be an antibody or peptide that specifically binds to CREB or Pappalysin-2. If the active ingredient of the pharmaceutical composition of the present invention is an antibody, it may be any antibody that can specifically bind to CREB or Pappalysin-2, and is not particularly limited. For example, it may be a naturally occurring immunoglobulin, a non-naturally occurring immunoglobulin, a single-chain antibody, a chimeric antibody, a human antibody, or a non-human antibody. In the pharmaceutical composition of the present invention, the antibody may be a complete antibody molecule, or an antigen-binding fragment such as Fv, Fab, Fab', Fab'-SH, F(ab')2, scFv, rIgG, taFv, diabody, triabody, or tetrabody. The antibody may also be a polyclonal antibody or a monoclonal antibody. These antibodies may be commercially available or self-produced. Antibodies and antigen-binding fragments can be manufactured by known methods. The binding affinity of the antibody can also be measured by known methods. Examples include ELISA, flow cytometry for titer measurement, isothermal titration calorimetry (ITC), surface plasmon resonance (SPR), biolayer interferometry, and fluorescence polarization.

[0015] When the active ingredient of the pharmaceutical composition of the present invention is a peptide, the peptide may be a polypeptide or protein having a length of about 10 amino acids or more. In the pharmaceutical composition of the present invention, the peptide may be a natural peptide, a synthetic peptide, or a recombinant peptide. Furthermore, in the pharmaceutical composition of the present invention, the peptide may be a peptide of biological origin, or a peptide consisting of an artificially designed sequence. The peptide can be produced by known methods.

[0016] The amino acid sequences of CREB and Pappalysin-2, and the nucleotide sequences of the genes encoding them, can be obtained from known databases (DDBJ / GenBank / EMBL, etc.). For example, the nucleotide sequence of the entire coding region of human CREB (GenBank: AY347527.1, SEQ ID NO: 1) and amino acid sequence (GenBank: AAQ24858.1, SEQ ID NO: 2), the nucleotide sequence of the entire coding region of mouse Creb (GenBank: M95106.1, SEQ ID NO: 3) and amino acid sequence (GenBank: AAA37456.1, SEQ ID NO: 4), the nucleotide sequence of the entire coding region of human Pappalysin-2 (GenBank: BC117193.1, SEQ ID NO: 5) and amino acid sequence (GenBank: AAI17194.3, SEQ ID NO: 6), and the nucleotide sequence of the entire coding region of mouse Pappalysin-2 (GenBank: BC094560.1, SEQ ID NO: 7) and amino acid sequence (GenBank: AAH94560.1, SEQ ID NO: 8) have been disclosed.

[0017] If the active ingredient of the pharmaceutical composition of the present invention is a substance that inhibits the function of CREB, the substance that inhibits the function of CREB may be a substance that inhibits the phosphorylation of CREB, a substance that promotes the dephosphorylation of CREB, a substance that inhibits the interaction with factors that interact with CREB, or a known CREB signaling factor inhibitor. Examples of known CREB signaling factor inhibitors include 666-15, H-89, KG-501, C646, LaSOM63, and ICSS-627.

[0018] The active ingredient of the pharmaceutical composition of the present invention may be a substance that inhibits the phosphorylation of CREB or a substance that promotes the dephosphorylation of CREB. The phosphorylation of CREB can be measured by known methods. Examples include, but are not limited to, electrophoresis that can separate phosphorylated / unphosphorylated forms, adding phosphate-labeled ATP to a solution, using an antibody that recognizes phosphorylation, and analysis by mass spectrometry.

[0019] The active ingredient of the pharmaceutical composition of the present invention may be a substance that inhibits the interaction between a factor that interacts with CREB and CREB. The interaction between a factor that interacts with the CREB signaling molecule can be measured by known methods. For example, it may be a gel shift assay, co-immunoprecipitation (Co-IP), pull-down assay, chromatin immunoprecipitation (ChIP), ChIP sequencing (ChIP-seq), reporter assay, far-western blotting, cross-linked protein interaction analysis, labeled transcription protein interaction analysis, interaction mapping, surface plasmon resonance, Förster resonance energy transfer (FRET), ELISA, analysis by mass spectrometry, etc., or it may be measured using a commercially available transcription factor assay kit or the like.

[0020] 666-15 (CAS No.: 1433286-70-4) is a substance that potently and selectively inhibits gene transcription mediated by CREB and effectively inhibits the phosphorylation of CREB. The information described in the PubChem database (NCBI) and the supplier's homepage is as follows.

[0021] PubChem CID: 71566396 Molecular formula: C 33 H 31 Cl2N3O5 IUPAC name: 3-(3-aminopropoxy)-N-[2-[3-[(4-chloro-2-hydroxyphenyl)carbamoyl]naphthalen-2-yl]oxyethyl]naphthalene-2-carboxamide; hydrochloride Trade name: compound 3i (666-15) Molecular weight: 620.5 Structural formula:

[0022]

[0023] H-89 (CAS No.: ***********) is a substance that potently and selectively inhibits cyclic AMP-dependent protein kinase (protein kinase A: PKA), and the phosphorylation of CREB is inhibited by inhibiting the activity of PKA. The information described in the PubChem database and the supplier's homepage is as follows.

[0024] PubChem CID: 5702541 Molecular formula: C 20 H 22 BrCl2N3O2S IUPAC name: N-[2-[[(E)-3-(4-bromophenyl)prop-2-enyl]amino]ethyl]isoquinoline-5-sulfonamide;dihydrochloride Product name: H 89 2HCl Molecular weight: 519.3 Structural formula:

[0025]

[0026] If the active ingredient of the pharmaceutical composition of the present invention is a substance that inhibits the expression of CREB or Pappalysin-2, it may be a nucleic acid that inhibits the expression of CREB or Pappalysin-2. Examples of nucleic acids that inhibit the expression of CREB or Pappalysin-2 include nucleic acid molecules containing a nucleic acid sequence that hybridizes under stringent conditions with a nucleic acid sequence complementary to the nucleic acid containing the base sequence encoding CREB or Pappalysin-2. Base sequence information encoding CREB or Pappalysin-2 can be obtained from known databases (DDBJ / GenBank / EMBL, etc.). The nucleic acid that inhibits the expression of CREB or Pappalysin-2 may be a nucleic acid molecule having an antisense sequence, a nucleic acid molecule capable of inhibiting or downwardly regulating gene expression via RNA interference or gene silencing, or a vector containing the nucleic acid encoding such nucleic acid molecules. In the pharmaceutical composition of the present invention, the nucleic acid molecule may consist only of RNA, only of DNA, or a fusion of DNA and RNA. Furthermore, nucleic acid molecules may be fused to a polynucleotide encoding a tag marker, such as a tag sequence or marker sequence, on their 5' or 3' end.

[0027] Nucleic acid molecules containing antisense sequences can be prepared by selecting candidate target sites of mRNA encoded by the CREB gene or Pappalysin-2 gene according to conventional methods. For example, candidate target regions can be selected and the sequence of the antisense oligonucleotide determined using methods such as mRNA higher-order structure prediction based on energy calculations, random oligo / RNaseH method, reverse transcriptase method, fluorescent nucleic acid probe method, and FRET method. The structure of the antisense oligonucleotide may be phosphate-bound types such as native type, phosphorothioate type, methylphosphonate type, phosphoramidate type, and 2'-O-methyl type, or non-phosphate types such as morpholidate type and polyamide nucleic acid. Furthermore, peptides or cholesterol may be introduced to enhance cell permeability, and alkylating agents or photocrosslinking agents may be introduced to provide crosslinking properties. Antisense oligonucleotides designed in this way can be synthesized using commercially available DNA synthesizers, and may be purified by reverse-phase HPLC, ion-exchange HPLC, gel electrophoresis, ethanol precipitation, etc., before use.

[0028] Nucleic acid molecules capable of inhibiting or downwardly regulating gene expression via RNA interference or gene silencing are not particularly limited, as long as they can inhibit protein production from the CREB gene or Pappalysin-2 gene. Examples include RNA molecules with RNA interference activity such as miRNA, siRNA, shRNA, and dsRNA. Nucleic acid molecules may be artificially chemically synthesized, biochemically synthesized, or synthesized within a living organism. It is preferable that the sequence of the RNA molecule with RNA interference activity and the sequence of the mRNA to be cleaved as the target are 100% identical, but they may not be 100% identical as long as the cleavage activity due to RNA interference remains. Such RNA molecules can be prepared by known methods based on CREB or Pappalysin-2 sequence information obtained from known databases (DDBJ / GenBank / EMBL, etc.).

[0029] When the active ingredient of the pharmaceutical composition of the present invention is a nucleic acid that inhibits the expression of CREB or Pappalysin-2, it can be administered in the form of a non-viral vector or a viral vector. When administered in the form of a non-viral vector, methods such as introducing nucleic acid molecules using liposomes (liposome method, HVJ-liposome method, cationic liposome method, lipofection method, lipofectamine method, etc.), microinjection method, and method of transferring nucleic acid molecules into cells together with a carrier (metal particles) using a gene gun can be used. When administering RNA molecules with RNA interference activity to a living organism using a viral vector, viral vectors such as recombinant adenoviruses and retroviruses can be used. By introducing DNA expressing RNA molecules with RNA interference activity into detoxified retroviruses, adenoviruses, adeno-associated viruses, herpesviruses, vaccinia viruses, poxviruses, polioviruses, Sindbisviruses, Sendai viruses, SV40, and other DNA or RNA viruses, and infecting cells or tissues with this recombinant virus, genes can be introduced into cells or tissues.

[0030] Substances that inhibit the expression of CREB or Pappalysin-2 may be gene therapies that target the CREB gene or the Pappalysin-2 gene. Examples of such gene therapies include viral vectors equipped with genome editing means that target the CREB gene or the Pappalysin-2 gene. Examples of viral vectors include lentiviral vectors, adenovirus vectors, and adeno-associated virus vectors. The genome editing means may be a CRISPR / Cas system. The CRISPR / Cas system consists of a Cas protein and guide RNA, and the guide RNA can be one that contains a nucleotide region complementary to the CREB gene or Pappalysin-2 gene and a region that interacts with the Cas protein. By infecting cells or tissues with a viral vector equipped with genome editing means that target the CREB gene or Pappalysin-2 gene, the expression of CREB or Pappalysin-2 can be inhibited by disrupting, substituting, etc., the CREB gene or Pappalysin-2 gene.

[0031] The inventors have developed a knock-in mouse (Fgfr3) that has a gain-of-function mutation in the Fgfr3 gene and exhibits a phenotype of achondroplasia (Ach), including short stature. Ach In mice, we found that the expression of CREB signaling molecules was increased in chondrocytes of the resting layer of the growth plate (Example 5). Notably, we found that inhibitors of CREB signaling molecules were found in Fgfr3 Ach We found that administering the substance to mice could rescue the Ach phenotype (Example 5). Furthermore, through analysis using FGFR3-activated cancer cells, we found that inhibiting the CREB signaling molecule suppressed the proliferation of cancer cells (Example 6). Therefore, the pharmaceutical composition of the present invention, which contains a CREB signaling inhibitor as an active ingredient, is useful for treating diseases accompanied by hyperfunction of FGFR3.

[0032] The pharmaceutical composition of the present invention can be formulated according to conventional methods by appropriately blending the above-mentioned active ingredient with a pharmaceutically acceptable carrier and additives. Specifically, it can be an oral preparation such as tablets, coated tablets, pills, powders, granules, capsules, liquids, suspensions, and emulsions; or a parenteral preparation such as injections, infusions, suppositories, ointments, and patches. The blending ratio of the carrier or additives can be appropriately set based on the range commonly used in the pharmaceutical field. There are no particular limitations on the carriers or additives that can be blended, but examples include various carriers such as water, physiological saline, other aqueous solvents, and aqueous or oily bases; and various additives such as excipients, binders, pH adjusters, disintegrants, absorption enhancers, lubricants, colorants, flavoring agents, and fragrances.

[0033] Examples of excipients include lactose, sucrose, D-mannitol, starch, crystalline cellulose, and light anhydrous silicic acid; examples of binders include crystalline cellulose, sucrose, D-mannitol, dextrin, hydroxypropylcellulose, hydroxypropylmethylcellulose, and high molecular weight compounds such as polyvinylpyrrolidone; examples of lubricants include magnesium stearate, calcium stearate, talc, and colloidal silica; examples of disintegrants include starch, carboxymethylcellulose, calcium carboxymethylcellulose, croscarmellose sodium, and sodium carboxymethyl starch; and examples of wetting agents include glycerin, but not limited to glycerin, butylene glycol, propylene glycol, sorbitol, and triacetin. If necessary, the material may be coated with a coating agent (such as sucrose, gelatin, hydroxypropylcellulose, or hydroxypropylmethylcellulose phthalate), or it may be coated with two or more layers.

[0034] For injectable preparations, the active ingredient may be dissolved or dispersed in an aqueous base such as physiological saline or an oily base acceptable for injection to prepare an injectable preparation for intravenous, intramuscular, or subcutaneous administration. Additives such as buffers, pH adjusters, isotonic agents, solubilizers, suspending agents, and stabilizers may be added as needed.

[0035] For injectable preparations, aqueous bases include, for example, physiological saline, sterile water for injection, and Ringer's solution. Oily bases include, for example, propylene glycol, polyethylene glycol, sesame oil, soybean oil, corn oil, peanut oil, cottonseed oil, olive oil, and propylene glycol fatty acid esters. Buffering agents include, for example, phosphates, acetates, carbonates, citrates, borates, glutamates, epsilon-aminocaproates, and buffer solutions such as Tris buffer. pH adjusters include, for example, inorganic acids such as hydrochloric acid, phosphoric acid, sulfuric acid, and carbonic acid; organic acids such as acetic acid, tartaric acid, lactic acid, citric acid, and succinic acid; inorganic bases such as sodium hydroxide; and organic bases such as sodium citrate and sodium tartrate. Examples of isotonic agents include inorganic salts such as sodium chloride, sugar alcohols such as D-mannitol, sorbitol, and xylitol, sugars such as fructose, glucose, glastose, ribose, xylose, mannose, maltotriose, and maltotetraose, and amino acids such as glycine and arginine. Examples of solubilizers include polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate, sodium citrate, lecithin, and nonionic surfactants such as polysorbate 80. Examples of suspending agents include surfactants such as stearyltriethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, and glyceryl monostearate, as well as polyvinyl alcohol, polyvinylpyrrolidone, sodium carboxymethylcellulose, methylcellulose, and hydroxymethylcellulose. Examples of stabilizers include albumin, globulin, gelatin, sorbitol, ethylene glycol, propylene glycol, and ascorbic acid.

[0036] Since the formulations obtained in this manner are safe and low in toxicity, the pharmaceutical compositions of the present invention can be administered orally or parenterally to humans and other animals, such as rats, mice, rabbits, sheep, pigs, cattle, horses, cats, dogs, and monkeys.

[0037] The content of the active ingredient in the pharmaceutical composition of the present invention is appropriately determined depending on the type of active ingredient (low molecular weight compound, peptide, etc.), the type of cancer to be treated, the dosage form, the method of administration, the carrier, etc. For example, the active ingredient may be added in a ratio of 0.01 to 100% (w / w) of the total amount of the formulation, or in a ratio of 0.1 to 95% (w / w).

[0038] The daily dose of the pharmaceutical composition of the present invention cannot be uniquely determined as it varies depending on the type of disease to be treated, the symptoms and severity of the disease, the patient's age, sex or weight, and the method of administration. However, a physician can determine an appropriate dose by considering the above circumstances. The pharmaceutical composition of the present invention may be intended for systemic or local effects. The dose of the active ingredient is selected from a range of 0.001 mg to 100 mg per kg of body weight per dose. Alternatively, a dose of 0.1 to 1000 mg, preferably 0.1 to 50 mg, per patient can be selected. The number of daily doses for adults may be 1 to 6 times, and the dose may be increased or decreased depending on the symptoms.

[0039] The pharmaceutical composition of the present invention may be used in combination with other therapeutic agents or treatments. Using it in combination means that the timing of application of the pharmaceutical composition of the present invention overlaps with the timing of application of the other therapeutic agent or treatment; it does not require simultaneous administration or treatment. For example, when the pharmaceutical composition of the present invention is used for the treatment of cancer, other cancer therapeutic agents or treatments used in combination with the pharmaceutical composition of the present invention are not particularly limited, but examples include chemotherapy (chemotherapeutic agents), immunotherapy (immunotherapy agents, immune checkpoint inhibitors, CAR-T therapy agents, etc.), and hormone therapy (hormone therapy agents).

[0040] [Screening Method] The present invention provides a screening method for therapeutic agents for diseases involving hyperfunction of FGFR3. The screening method of the present invention may also be a method for identifying substances that inhibit CREB signaling. Substances that inhibit CREB signaling may be substances that inhibit the expression of CREB signaling molecules, or substances that inhibit the function of CREB signaling molecules. Examples of CREB signaling molecules include, but are not limited to, CREB, CREB phosphorylation enzymes, Pappalysin-2, and Spondin-1.

[0041] The screening method of the present invention may include a step of identifying a substance that inhibits CREB signaling. A substance that inhibits the expression of a CREB signaling molecule may be a substance that inhibits the expression of a gene encoding a CREB signaling molecule. A substance that inhibits the function of a CREB signaling molecule may be a substance that inhibits the phosphorylation of CREB, a substance that promotes the dephosphorylation of CREB, a substance that inhibits the protease activity of Pappalysin-2, or a substance that inhibits the interaction with factors that interact with the CREB signaling molecule.

[0042] The test substances used in the screening method of the present invention are not particularly limited and may include natural compounds, synthetic compounds, organic compounds, inorganic compounds, nucleic acid oligos, proteins, peptides, non-peptide compounds, compound libraries, nucleic acid oligo libraries, peptide libraries, expression products of gene libraries, cell extracts, cell culture supernatants, fermentation microbial products, marine organism extracts, plant extracts, prokaryotic cell extracts, eukaryotic single-cell extracts, animal cell extracts, plasma, etc. The test substances may be novel or known substances. These test substances may form salts. As salts of the test substances, salts with physiologically acceptable acids or bases are preferred. Furthermore, these test substances may be modified with labeling substances. The labeling substances are not particularly limited as long as they are detectable and include, for example, radioisotope-containing compounds, stable isotope-containing compounds, biotin, lipids, fluorescent dye molecules, non-fluorescent dye molecules, enzymes, enzyme substrates, affinity tags, etc.

[0043] A first embodiment of the screening method of the present invention may include the following steps (1) to (4): (1) a step of bringing cells expressing a CREB signaling molecule into contact with a test substance; (2) a step of measuring the expression level of the CREB signaling molecule; (3) a step of measuring the expression level of the CREB signaling molecule in the absence of the test substance; and (4) a step of identifying a substance that reduces the expression level of the CREB signaling molecule by comparing it with the expression level in the absence of the test substance.

[0044] In step (1), cells expressing the CREB signaling molecule are brought into contact with the test substance. In the first embodiment, if the CREB signaling molecule is CREB or Pappalysin-2, contact between cells expressing CREB or Pappalysin-2 and the test substance may be achieved by culturing the cells expressing CREB or Pappalysin-2 and adding the test substance to the culture medium, or by introducing the test substance into cells expressing CREB or Pappalysin-2 in vitro or ex vivo. The test substance may be added at multiple concentrations within a defined concentration range.

[0045] The cells expressing CREB or Pappalysin-2 may be cells expressing endogenous CREB or endogenous Pappalysin-2, or cells expressing recombinant CREB or recombinant Pappalysin-2 derived from the introduced gene. Examples of cells expressing endogenous CREB and / or endogenous Pappalysin-2 include SaOS-2 cells, C2C12 cells, BeWo cells, JEG-3 cells, HEK293 cells, and HepG2 cells. The host cell may be any cell capable of expressing each introduced gene product and is not particularly limited. For example, mammalian cells may be used. Examples of mammalian cells include HEK293 cells, CHO cells, NIH / 3T3 cells, and COS-7 cells.

[0046] The CREB and Pappalysin-2 used in step (1) may be of any biological origin, including mammalian origin. Examples of mammals include humans, chimpanzees, monkeys, dogs, goats, cattle, mice, and rats, with humans being preferred.

[0047] The amino acid sequences of CREB and Pappalysin-2, and the nucleotide sequences of the genes encoding them, can be obtained from known databases (DDBJ / GenBank / EMBL, etc.). For example, the nucleotide sequence of the entire coding region of human CREB (GenBank: AY347527.1, SEQ ID NO: 1) and amino acid sequence (GenBank: AAQ24858.1, SEQ ID NO: 2), the nucleotide sequence of the entire coding region of mouse Creb (GenBank: M95106.1, SEQ ID NO: 3) and amino acid sequence (GenBank: AAA37456.1, SEQ ID NO: 4), the nucleotide sequence of the entire coding region of human Pappalysin-2 (GenBank: BC117193.1, SEQ ID NO: 5) and amino acid sequence (GenBank: AAI17194.3, SEQ ID NO: 6), and the nucleotide sequence of the entire coding region of mouse Pappalysin-2 (GenBank: BC094560.1, SEQ ID NO: 7) and amino acid sequence (GenBank: AAH94560.1, SEQ ID NO: 8) have been disclosed.

[0048] In steps (2) and (3), the expression level of the CREB signaling molecule is measured. The expression level of the CREB signaling molecule may be measured by the amount of protein, or by the amount of mRNA of the gene encoding the molecule. The expression level of the CREB signaling molecule can be measured by known methods. For example, quantitative PCR, microarrays, RNA sequencing, Western blotting, ELISA, or immunohistochemical staining may be used.

[0049] In step (4), a substance that reduces the expression level of CREB signaling molecules is identified. A method for identifying a substance that reduces the expression level of CREB signaling molecules may be used to select a substance that reduces the expression level of CREB signaling molecules by comparing the expression level of CREB signaling molecules in a sample that has not been exposed to the test substance with the expression level of CREB signaling molecules in a sample that has been exposed to the test substance. The degree of reduction in expression level is not particularly limited, but for example, a substance that reduces the expression level by 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less compared to a control that has not been exposed to the test substance may be selected, or a substance in which a statistically significant difference is detected may be selected.

[0050] A second embodiment of the screening method of the present invention may include the following steps (1) to (4): (1) a step of bringing cells expressing CREB into contact with a test substance; (2) a step of measuring the phosphorylation of CREB; (3) a step of measuring the phosphorylation of CREB in the absence of the test substance; and (4) a step of identifying a substance that reduces the amount of CREB phosphorylation by comparing it with the phosphorylation level in the absence of the test substance.

[0051] Step (1) can be carried out in the same manner as step (1) of the first embodiment, except that cells expressing CREB are used.

[0052] In steps (2) and (3), the phosphorylation of CREB is measured. The phosphorylation of CREB can be measured by known methods. For example, electrophoresis that can separate phosphorylated / unphosphorylated forms, adding phosphate-labeled ATP to a solution, using an antibody that recognizes phosphorylation, or analysis by mass spectrometry may be used.

[0053] In step (4), a substance that reduces the amount of CREB phosphorylation is identified. A method for identifying a substance that reduces the amount of CREB phosphorylation may be performed by comparing the amount of CREB phosphorylation in a sample that has not been exposed to the test substance with the amount of CREB phosphorylation in a sample that has been exposed to the test substance, and selecting the test substance that reduces the amount of phosphorylation. The extent to which the test substance reduces the amount of CREB phosphorylation is not particularly limited, but for example, a test substance that reduces it to 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less compared to a control that has not been exposed to the test substance may be selected, or a test substance in which a statistically significant difference is detected may be selected.

[0054] A third embodiment of the screening method of the present invention may include the following steps (1) to (4): (1) a step of bringing cells expressing pappalysin-2 into contact with a test substance; (2) a step of measuring the expression level of insulin-like growth factor-binding protein (IGFBP); (3) a step of measuring the expression level of IGFBP in the absence of the test substance; and (4) a step of identifying a substance that increases the expression level of IGFBP by comparing it with the expression level in the absence of the test substance.

[0055] Step (1) can be carried out in the same manner as step (1) of the first embodiment, except that cells expressing Pappalysin-2 are used.

[0056] In steps (2) and (3), the expression level of insulin-like growth factor-binding protein (IGFBP) is measured. Pappalysin-2 is a specific degrading enzyme for IGFBP type 5 (IGFBP5) and type 3 (IGFBP3), and is known to activate the IGF signaling pathway by degrading IGFBP bound to IGF, thereby releasing activated IGF, which then binds to IGF receptors on target cells. The expression level of IGFBP can be measured by known methods. For example, quantitative PCR, microarrays, RNA sequencing, Western blotting, ELISA, or immunohistochemical staining may be used.

[0057] In step (4), substances that increase IGFBP expression are identified. A method for identifying substances that increase IGFBP expression may be to compare a sample that has not been exposed to the test substance with a sample that has been exposed to the test substance, and select the test substance that increases IGFBP expression. The extent to which the test substance increases IGFBP expression is not particularly limited, but for example, a test substance that increases IGFBP expression by 120% or more, 130% or more, 140% or more, 150% or more, 160% or more, 170% or more, 180% or more, 190% or more, or 200% or more compared to a control that has not been exposed to the test substance may be selected, or a test substance in which a statistically significant difference is detected may be selected.

[0058] A fourth embodiment of the screening method of the present invention may include the following steps (1) to (4): (1) bringing cells expressing a CREB signaling molecule into contact with a test substance; (2) measuring the interaction between the CREB signaling molecule and a factor that interacts with it; (3) measuring the interaction between the CREB signaling molecule and a factor that interacts with it in the absence of the test substance; and (4) identifying a substance that reduces the interaction between the CREB signaling molecule and a factor that interacts with it, compared to the interaction level in the absence of the test substance. Step (1) can be carried out in the same way as step (1) of the first embodiment.

[0059] Steps (2) and (3) measure the interaction between the CREB signaling molecule and the factors that interact with it. The interaction between the CREB signaling molecule and the factors that interact with it can be measured by known methods. For example, this may include gel shift assays, co-immunoprecipitation (Co-IP), pull-down assays, chromatin immunoprecipitation (ChIP), ChIP sequencing (ChIP-seq), reporter assays, far-western blotting, cross-linked protein interaction analysis, labeled transcription protein interaction analysis, interaction mapping, surface plasmon resonance (SPR), Förster resonance energy transfer (FRET), ELISA, and mass spectrometry analysis, and commercially available transcription factor assay kits may also be used.

[0060] Step (4) identifies substances that reduce the interaction between CREB signaling molecules and factors that interact with them. A method for identifying substances that reduce the interaction between CREB signaling molecules and factors that interact with them may be to compare the interaction level when the test substance is not in contact with the interaction level of a sample in contact with the test substance, and select test substances that reduce the interaction between CREB signaling molecules and factors that interact with them. The extent to which the test substance reduces the interaction between CREB signaling molecules and factors that interact with them is not particularly limited, but for example, test substances that reduce the interaction by 80% or less, 70% or less, 60% or less, 50% or less, 40% or less, 30% or less, 20% or less, or 10% or less compared to a control that has not been in contact with the test substance may be selected, or test substances in which a statistically significant difference is detected may be selected.

[0061] The present invention encompasses the following inventions: (A1) A method for preventing, improving, or treating a disease involving hyperfunction of fibroblast growth factor receptor 3 (FGFR3), comprising the step of administering an effective amount of a cyclic AMP response element-binding protein (CREB) signaling inhibitor. (A2) A method for preventing, improving, or treating achondroplasia, comprising the step of administering an effective amount of a substance that inhibits the function of CREB signaling or inhibits the expression of CREB signaling. (A3) A method for preventing, improving, or treating cancer, comprising the step of administering an effective amount of a substance that inhibits the function of CREB signaling or inhibits the expression of CREB signaling. (B1) A substance that inhibits CREB signaling for use in the prevention, improvement, or treatment of diseases involving hyperfunction of FGFR3. (B2) A substance that inhibits the function of CREB signaling or inhibits the expression of CREB signaling for use in the prevention, improvement, or treatment of achondroplasia. (B3) A substance that inhibits the function of CREB signaling or inhibits the expression of CREB signaling for use in the prevention, improvement, or treatment of cancer. (C1) Use of a substance that inhibits CREB signaling for the manufacture of a medicine for the prevention, improvement or treatment of a disease involving hyperfunction of FGFR3. (C2) Use of a substance that inhibits the function of CREB signaling or the expression of CREB signaling for the manufacture of a medicine for the prevention, improvement or treatment of achondroplasia. (C3) Use of a substance that inhibits the function of CREB signaling or the expression of CREB signaling for the manufacture of a medicine for the prevention, improvement or treatment of cancer.

[0062] The present invention will be described in detail below with reference to examples, but the present invention is not limited to these examples.

[0063] 1. Materials and Methods 1-1. Statement on Research Ethics All experiments were conducted in accordance with relevant guidelines and regulations. Experiments using recombinant DNA were conducted with the approval of the Osaka University Recombinant DNA Experiment Safety Committee (Approval Number: #04794). All animal experiments were conducted with the approval of the Osaka University Animal Experiment Committee (Approval Numbers: #Doi-03-044-027, #Biken-AP-H30-01 and #Biken-AP-R03-01).

[0064] 1-2. Experimental Animals (1) Creation of Animal Models Using the CRISPR / Cas9 system, the p.Gly374Arg (c.1120G>A) mutation was introduced into the Fgfr3 gene on one allele of C57BL / 6 mouse ES cells (EGR-G101). The target sequence of the guide RNA is as follows: 5'-tacgcaggcgtcctcagcta-3' (SEQ ID NO: 9). To prevent the knock-in allele and vector from being cleaved by sgRNA / Cas9, c.1107C>A, c.1110C>A, and c.1113C>G mutations were also introduced to establish ScaI restriction enzyme sites without altering the amino acid sequence. From the genomic DNA of the mutated ES cells, the 5' homologous arm sequence containing c.1120G>A and the 5' homologous arm sequence were PCR cloned. These homologous arms were inserted into pNT1.1 containing a neocassette to create a targeting vector (Figure 1A, top panel). EGR-G101 cells were introduced with the targeting vector, a plasmid encoding Cas9, and guide RNA designed to target intron 9 (target sequences: 5'-gatgcctccttatctccata-3' (SEQ ID NO: 10) and 5'-ggctccacaccttgcctcat-3' (SEQ ID NO: 11)). The mutated ES cell clones were established and used to create chimeric mice, which were then crossed with C57BL / 6 mice to produce Fgfr3. Ach-neo A knock-in mouse was created. To remove the neocassette adjacent to the FRT sequence, a fabricated Fgfr3 was used. Ach-neoKnock-in mice were crossed with B6-Tg(CAG-FLPe)36 mice (provided by RIKEN BRC through the National BioResource Project of the Ministry of Education, Culture, Sports, Science and Technology) that express flippase (Flp) under the control of the CAG promoter, resulting in offspring mice (Fgfr3) carrying the mutant allele. Ach ) was created.

[0065] (2) For genetic tracing of mouse lineage clones for cell lineage tracing analysis, Col11a2-CreERT; Rosa26R-Confetti; CAG-Flp; Fgfr3 Ach-neo A strain was created. Col11a2-CreERT mice were created as previously reported (Yahara Y et al., Nat Commun 7, 10959, 2016). Col11a2-CreERT mice express CreERT under the control of a chondrocyte-specific Col11a2 promoter / enhancer. Cre-mediated DNA recombination is tamoxifen-dependent. Rosa26R-Confetti (obtained from Jackson Laboratory; hereinafter referred to as R26R-Confetti or Confetti) is a reporter mouse strain containing the brainbow 2.1 construct. During Cre-mediated DNA recombination, each allele randomly and probabilistically expresses one of four different fluorescent proteins (nuclear green, cytoplasmic red, cytoplasmic yellow, and membrane-bound cyan), allowing for clone identification. Col11a2-CreERT and R26R-Confetti homozygous mice and CAG-FLPe heterozygous mice or FGFR3-KI neo By crossing heterozygous mice, mice possessing Col11a2-CreERT and R26R-Confetti and CAG-FLPe, as well as Col11a2-CreERT and R26R-Confetti and FGFR3-KI neo Mice were created that possessed the following traits, and these mice were crossbred to produce Col11a2-CreERT and R26R-Confetti, and CAG-FLPe and FGFR3-KI. neo Mice with the following characteristics (Col11a2-CreERT; Rosa26R-Confetti; CAG-Flp; Fgfr3)Ach-neo To spatially isolate each clone through recombination at various efficiencies, the generated mice were given a single intraperitoneal injection of tamoxifen at a dose of 100 μg per body weight (grams).

[0066] 1-3. Short-term and long-term EdU tracking assays EdU (5-ethinyl-2'-deoxyuridine, Invitrogen) was dissolved in phosphate-buffered saline (PBS) and administered to mice of specified age (see Figures 4A and 5A). Mice were euthanized at 21 days of age. To detect EdU in frozen sections, the Click-iT Imaging Kit with Alexa Fluor 488-azide (Invitrogen, catalog number: C10337) was used according to the manufacturer's protocol.

[0067] 1-4. Histological analysis specimens were fixed with 4% paraformaldehyde and embedded in paraffin. Semi-serial sections were stained with hematoxylin-eosin or safranin O-fast green and hematoxylin. The mean height of the growth plate cartilage layer was measured and calculated at 20 locations on the proximal tibia growth plate using BZ-X800 analyzer software (KEYENCE).

[0068] For immunohistochemical analysis, samples were treated with hyaluronidase and EDTA to expose masked antigens. The following antibodies were used for immunostaining: goat anti-type I collagen antibody (1500-fold dilution, Southern Biotech, catalog number: 1310-01), goat anti-type II collagen antibody (300-fold dilution, Southern Biotech, catalog number: 1320-01), mouse anti-type X collagen antibody (monoclonal antibody, 500-fold dilution, Thermo Fisher Scientific, catalog number: 14-9771-82), and rabbit anti-phosphorylated Erk1 / 2 (Thr202 / Tyr204) antibody (100-fold dilution, Cell Signaling). Raybiotech, Inc. (catalog number: 4370s), rabbit anti-phosphorylated FRS2 (Tyr436) antibody (100-fold dilution, Raybiotech, Inc., catalog number: PEL-FRS2-Y436), rabbit anti-CD73 antibody (1500-fold dilution, abcam, Inc., catalog number: ab175396), rabbit anti-F-spondin antibody (300-fold dilution, abcam, Inc., catalog number: ab215165), rabbit anti-phosphorylated CREB (Ser133) antibody (300-fold dilution, Cell Signaling Technology, Inc., catalog number: 9198s), rabbit anti-CBP antibody (1000-fold dilution, Invitrogen, Inc., catalog number: PA1-847), and anti-mouse Ig-HRP (undiluted, DAKO, Inc., catalog number: K1497). Anti-type I collagen antibodies, anti-type II collagen antibodies, anti-type X collagen antibodies, anti-F-spondin antibodies, anti-phosphorylated Erk antibodies, anti-phosphorylated CREB antibodies, anti-phosphorylated FRS2 antibodies, and anti-CD73 antibodies were detected using the CSA II Biotin-free Tyramide Signal Amplification System Kit (Agilent Technologies) with 3,3'-diaminobenzidine (DAB) as the chromogen. Antigen-antibody binding of CD73 was detected using the ImmPACT AMEC Red Peroxidase Substrate Kit (Vector Laboratories, product number: SK-4285). Each kit was used according to the manufacturer's protocol.

[0069] 1-5. Single-cell RNA sequencing (scRNA-seq) analysis (1) Single-cell preparation sample collection, barcoding of cells, and flow cytometry were performed as described in a previous report (Kamatani T et al., Biomaterials 284, 121491, 2022). Briefly, mice were euthanized and tissue around the growth plate cartilage of the proximal tibia was excised. The sample was cut into 1-2 mm pieces and incubated for 4 hours in digestion medium (prepared medium supplemented with 0.2 mg / mL Liberase (Roche) and 2 kU / mL DNase I (Merck)). Subsequently, the sample was filtered using a 70 μm cell strainer (BD Biosciences). Cell surface proteins were biotinylated and the cell surface was labeled as described in a previous report (Sugimoto M et al., DNA Res 29 (3), dsac017, 2022). Cells were resuspended and washed in PBS (1 mL) supplemented with 1% fetal bovine serum (FBS) and 1 ng of EZ-Link Sulfo-NHS-Biotin (Thermo Fisher Scientific) at 4°C for 10 minutes. Washed cells were stained with 0.6 μg / mL TotalSeq (A0951-A0954, BioLegend) at 4°C for 20 minutes, and after washing, resuspended in PBS supplemented with 10% FBS and 1 μM Sytox Blue Dead Cell Stain (Invitrogen) at room temperature for 5 minutes. PE-positive and Sytox blue-negative cells were sorted using a FACS Aria II flow cytometer (BD Bioscience) and BD FACS Diva 9.0.1 (BD Bioscience), and the cells were suspended in PBS supplemented with 20% FBS.

[0070] (2) Library preparation, sequencing, and FASTQ file preprocessing Library preparation and initial processing of paired-end FASTQ files were performed according to the TAS-seq workflow summarized in a previous report (Shichino S et al., Commun Biol 5(1): 602, 2022). Single-cell suspensions were used for cDNA synthesis using the BD Rhapsody Express Single-Cell Analysis System (BD Biosciences) and the BD Rhapsody Targeted & Abseq Reagent Kit (BD Biosciences), and cDNA synthesis was performed according to the manufacturer's protocol. Reverse-transcribed BD Rhapsody beads (BD Biosciences) were treated with exonuclease I at 37°C and 1200 rpm for 60 minutes on an Eppendorf ThermoMixer C (Eppendorf) with ThermoTop (Eppendorf) attached. The beads were cooled on ice and the supernatant was removed. After washing the beads, they were resuspended and stored at 4°C. During the washing process, the DNA LoBind tubes (Eppendorf) containing the beads were replaced twice. The cDNA was amplified by the TAS-seq method by Immunogenetex and sequenced using an Illumina Novaseq 6000 sequencer (Illumina) with the Novaseq 6000 S4 Reagent Kit v1.0 or v1.5.

[0071] To assign cDNA reads to each transcript, a bowtie2-index constructed from reference RNA sequences (cDNA and ncRNA fasta files obtained from the Ensembl database; GRCm38.p6 Ensembl release 102 (Yates AD et al., Nucleic Acids Res 48(D1): D682-D688, 2020)) was used. The inflection point of the knee plot (total read count vs. rank of the read count) was detected from single-cell gene expression matrix files using the DropletUtils package (Lun ATL et al., Genome Biology 20:63, 2019) from R 3.6.3 (https: / / cran.r-project.org / ). Cells with a total read count exceeding the inflection point were considered valid. Demultiplexing of single cells via TotalSeq streptavidin / anti-biotin expression was performed as previously reported (Shichino S et al., bioRxiv, doi:10.1101 / 2021.08.03.454735, 2021).

[0072] (3) Data processing and analysis sequencing depth was approximately 132,000 reads per cell. The data was imported into the Seurat R package (version 4.0.2; Hao Y et al., Cell 184(13): 3573-3587.e29, 2021). Quality control was performed on the entire dataset, and cells with 2000–7000 genes detected and mitochondrial transcripts of less than 6% were retained. As described in a previous report (Shichino S et al., Commun Biol 5(1): 602, 2022), log normalization using a scale factor of 1 million molecules was applied to the entire dataset of each cell to identify the top 5000 highly variable genes. Cell cycle phase scores were calculated from the integrated data using the CellCycleScoring function, and the data was scaled by regression to reduce cell cycle heterogeneity. For data clustering, dimensionality reduction using UMAP (Uniform Manifold Approximation and Projection), and 2D data projection, principal component analysis (PCA) was performed on the scaled expression values ​​using the first 30 principal components to construct SNN graphs. Differential expression genes (DEGs) between clusters were identified using Seurat's FindMarkers function. DEGs were targeted for Ingenuity Pathway Analysis (IPA, QIAGEN, version 81348237).

[0073] 1-6. Cell Culture (1) Primary Mouse Chondrocytes Primary chondrocytes were prepared from C57BL / 6 mice 18.5 days post-mating, as described in a previous report (Gosset M et al., Nature Protocols 3, 1253-1260, 2008). Briefly, epiphyseal cartilage was excised from the knee, elbow, shoulder joints and femoral head of the mice and digested overnight at 37°C in Dulbecco's Modified Eagle Medium / Nutrient Mixture F-12 (DMEM / F12, Invitrogen) containing 5% FBS and 1% penicillin-streptomycin (Life Technologies) with 3 mg / mL collagenase D (Roche). Approximately 5 × 10⁴ cells were obtained from each mouse.5 Primary chondrocytes were cryopreserved in LaboBanker (Kurabo Industries Ltd.). Before the experiment, the cells were lysed, seeded in culture dishes, and cultured in DMEM / F12 medium supplemented with 5% FBS and 1% penicillin-streptomycin. The culture period was less than 10 days. Chondrocytes were divided into 0.5 × 10⁶ wells. 5 The cells were prepared and seeded into 12-well tissue culture plates (Corning). Chondrocytes were cultured in DMEM / F12 medium containing 5% FBS and 1% penicillin-streptomycin (Invitrogen) under 5% CO2 and humidified air. Before the experiment, the cells were pre-treated overnight in serum-free serum-starvation medium. Cells for Western blotting analysis were treated for 30 minutes with 10 ng / mL bFGF (basic fibroblast growth factor, PeproTech) dissolved in PBS, or with 10 μM forskolin (F3917, Sigma-Aldrich) or 30 nM NVP-BGJ398 (ChemScene) dissolved in dimethyl sulfoxide (DMSO). Primary chondrocytes were pre-cultured with or without 30 nM NVP-BGJ398 1 hour before 10 ng / mL bFGF stimulation. Primary chondrocytes were treated with 10 μM forskolin, 30 nM NVP-BGJ398, or 1 μM 666-15 (Selleck Chem, product number: S8846) for 72 hours, lysed, and analyzed by Western blotting.

[0074] (2) Rat chondrosarcoma cells: Rat chondrosarcoma (RCS) cells were donated by Dr. James H. Kimura (Section of Biochemistry, Bone and Joint Center, Henry Ford Hospital). RCS cells were cultured at 37°C under 5% CO2 in DMEM supplemented with 10% FBS and 1% penicillin-streptomycin. RCS cells were used in a luciferase assay.

[0075] (3) ATDC5 cells ATDC5 cells were obtained from Riken BRC and cultured in maintenance medium containing 5% FBS. The maintenance medium consisted of a 1:1 mixture of DMEM and Ham F-12 medium (Nacalai Tesque Co., Ltd., catalog number: 08460-95). ATDC5 cells were treated with 10 μM forskolin or 1 μM 666-15 for 48 hours and were subjected to mRNA expression analysis by real-time quantitative RT-PCR.

[0076] 1-7. Western blot analysis: Primary mouse chondrocytes were lysed in RIPA buffer (10 mM Tris-HCl (pH 7.5), 150 mM NaCl, 0.1% SDS, 0.1% sodium deoxycholate, 1 mM EDTA, 1% NP-40, cOmplete® protease inhibitor (Roche), phosphatase inhibitor cocktail 1 (Sigma-Aldrich), and phosphatase inhibitor cocktail 2 (Sigma-Aldrich)). Growth plate cartilage tissue was excised from the proximal tibia of 21-day-old mice, frozen in liquid nitrogen, disrupted using a multi-bead shocker (Yasui Kikai Co., Ltd.), and lysed in RIPA buffer. Samples were separated on a 4-12% concentration gradient SDS-PAGE, and proteins were electroblotted onto a PVDF membrane (Invitrogen). The following primary antibodies were used to immunostain the blotted membranes: rabbit anti-phosphorylated CREB antibody (Ser133) (1000-fold dilution, Cell Signaling Technology, catalog number: #9198s), rabbit anti-CREB antibody (1000-fold dilution, Cell Signaling Technology, catalog number: #9197s), rabbit anti-phosphorylated ERK antibody (Thr202 / Tyr204) (1000-fold dilution, Cell Signaling Technology, catalog number: #4370s), rabbit anti-ERK antibody (1000-fold dilution, Cell Signaling Technology, catalog number: #9102s), rabbit anti-histone H3 antibody (Cell Signaling Technology, catalog number: #9715s), and rabbit anti-β-actin antibody (1000-fold dilution, Cell Signaling Technology, catalog number: #4967s). Goat anti-rabbit IgG-HRP antibody (5000-fold dilution, Santa Cruz) was used as the secondary antibody. The ECL system and LAS4000 (GE Healthcare) were used according to the manufacturer's protocol, and chemiluminescence detection was performed.

[0077] 1-8. Luciferase assays were performed using the following commercially available plasmids: pTAL (Clontech), pTAL-CRE (Clontech), pM (Clontech), pGL4.10 (Promega), and pRL-TK (Promega). RCS cells were transfected in 12-well plates with the pTAL-CRE vector (0.5 μg / well) and the internal reporter pRL-TK (0.03 μg) using known methods. Forty-eight hours after gene transfer, cells were treated with bFGF (0, 10, 30, 100, 300, or 1000 ng / mL, Fujifilm Wako Pure Chemical Corporation, catalog number: 064-05381), IGF-I (insulin-like growth factor 1, 10 ng / mL, PeproTech, catalog number: 100-11), IGF-II (10 ng / mL, PeproTech, catalog number: 100-12), EGF (epidermal growth factor, 10 ng / mL, PeproTech, catalog number: AF-100-15), or HGF (hepatocyte growth factor, 10 ng / mL, PeproTech, catalog number: 100-39H) for six hours. Cells were harvested and luciferase activity was measured using a Dual-luciferase Reporter Assay System (Promega, catalog number: #E1910). CRE gene-specific promoter activity was expressed as a multiplier change relative to the reporter activity of an empty vector. Measured luciferase activity was normalized to Renilla luciferase activity.

[0078] 1-9. mRNA Expression Analysis: Total RNA was extracted using the RNeasy kit (Qiagen) according to the manufacturer's protocol. For quantitative reverse transcription PCR, single-stranded cDNA was synthesized from total RNA using ReverTra Ace (registered trademark, Toyobo Co., Ltd., product number: TRT-101) and Oligo(dT)20 Primer. PCR amplification was performed using the KAPA SYBR FAST qPCR Master Mix ABI prism kit (KAPA Biosystems) and the StepOnePlus Real-Time PCR System (Thermo Fisher Scientific) according to the manufacturer's protocol. The sequences of each PCR primer used are as follows: mouse Actb-F: 5'-GGCTGTATTCCCCTCCATCG-3' (SEQ ID NO: 12) mouse Actb-R: 5'-CCAGTTGGTAACAATGCCATGT-3' (SEQ ID NO: 13) mouse Spondin1-F: 5'-GATGCCTGAGTGCCAT-3' (SEQ ID NO: 14) mouse Spondin1-R: 5'-CTGCTCCAGGTCCTCG-3' (SEQ ID NO: 15) RNA expression levels of target genes were normalized by β-actin RNA expression levels and expressed as relative expression levels.

[0079] 1-10. Administration of CREB inhibitor 666-15: 10 mg of 666-15 (Selleck, product number: S8846) was dissolved in 100 mL of DMSO. The prepared solution was stored at -20°C. Fgfr3 Ach Mice were intraperitoneally injected with 666-15 at a dose of 10 mg / kg for 5 days each week. Three weeks after the start of treatment, Fgfr3 mice were 28 days old. AchMice were euthanized and X-ray imaging was performed (Faxitron® X-ray DX-50, Faxitron). The hind limbs were dissected, and the femurs were isolated and used for X-ray imaging. The length of the femur was measured using FIJI ImageJ software (National Institutes of Health). As described in a previous report (Ozaki T et al., Sci Rep 10, 20915, 2020), the distance between the lateral metaphysical terminal of the femoral head and the bottom surface of the concave area between the femoral condyles was measured and defined as the femoral length.

[0080] 1-11. Cell proliferation test (1) Cultured cells Human bladder cancer cell lines were used. Rt112 cells were obtained from K.A.C. Co., Ltd. (product name: RT112 / 84 (frozen) EC85061106-F0, ECACC strain number: 85061106). T24 cells (cell number: RCB0431) and 5637 cells (cell number: RCB1191) were provided by the RIKEN Cell Bank. Rt112 cells and 5637 cells were cultured in RPMI1640 medium supplemented with 10% FBS and 1% penicillin-streptomycin at 37°C and 5% CO2. T24 cells were cultured in MEM medium supplemented with 10% FBS and 1% penicillin-streptomycin at 37°C and 5% CO2. As a control, the HeLa cell line (RCB0007, RIKEN Cell Bank) was used.

[0081] (2) Modification of the PAPPA2 gene PAPPA2 knockdown was performed using a commercially available siRNA reagent (product name: ON-TARGETplus Human PAPPA2 (60676) siRNA - Set of 4, 2 nmol, Dharmacon, product number: LQ-005998-00-0002, QTE number / SO number: QTE-3164696G / SO-3164696G). Gene transfer was performed using Lipofectamine® 2000 (Thermo Fisher Scientific) according to the manufacturer's protocol. PAPPA2 knockout was performed using the CRISPR / Cas9 system. A vector targeting hPAPPA2 and expressing EGFP / Puro as a marker was synthesized by VectorBuilder (Vector ID: VB900098-2002nca, Vector name: pRP[CRISPR]-EGFP / Puro-hCas9-U6 >hPAPPA2[gRNA#13246], Vector size: 10603 bp, Guide sequence: CAAGCACAACCCGGTGTCGC (SEQ ID NO: 16)). The vector was introduced by electroporation.

[0082] (3) Cell proliferation test The test was performed using the Cell Proliferation / Cytotoxicity Assay Kit (CK04 Cell Counting Kit-8®, Dojin Chemical Research Institute Co., Ltd.). Cells in the logarithmic growth phase were counted to a concentration of 2000 cells per well, and 100 μL of each cell was seeded into each well of a 96-well plate. The cells were pre-cultured in a CO2 incubator at 37°C for 24 hours. 10 μL of Cell Counting Kit-8 solution was added to each well, and a color reaction was performed in a CO2 incubator at 37°C for 1 hour. The absorbance was then measured using a microplate reader. The measurement wavelength was 450 nm.

[0083] 1-12. Statistical analysis data were expressed as mean ± standard deviation. Student's t-test was used for comparisons between two samples, and one-way ANOVA and Tukey's HSD (Honestly Significant Difference) test were used for comparisons between multiple groups. A p-value of less than 0.05 was considered statistically significant. GraphPad Prism 8 (GraphPad Software) was used for statistical analysis.

[0084] 2. Results [Example 1: Fgfr3 Ach [Mouse Generation] Using the CRISPR / Cas9 system, the p.Gly374Arg mutation was introduced into one allele of the Fgfr3 gene in mouse ES cells. In vitro fertilization was performed using sperm obtained from these chimeric mice to generate nine knock-in mice. Since all nine knock-in mice died before 6 weeks of age, it was suggested that the p.Gly374Arg mutation is lethal in mice. Because it became difficult to establish a standard knock-in mouse line, a conditional knock-in method was used. Insertion of the neocassette into intron 9 (previously designated as intron 10) inhibits the expression of the Fgfr3 allele (Iwata T et al., Hum Mol Genet 9: 1603-1613, 2000; Chen L et al., J Clin Invest 104: 1517-1525, 1999). Using the CRISPR / Cas9 system, the p.Gly374Arg mutation was introduced into exon 9 of the Fgfr3 allele in mouse ES cells, and a neocassette adjacent to the FRT sequence was inserted into intron 9 (Fgfr3 Ach-neo (Figure 1A). After generating mice from ES cells, they were crossed with CAG-Flp transgenic mice. Neocasses adjacent to FRT at both ends were excised from oocytes, leaving a p.Gly374Arg mutation and one FRT sequence at the Fgfr3 locus of the offspring mice (Fgfr3 Ach ). To perform trace analysis using the CreER / loxP system, the Flp / FRT system was used instead of the Cre / loxP system. Fgfr3 AchThe mice developed short stature (Figure 1B), and both males and females experienced a significant decrease in body weight from 18 to 28 days after birth (Figure 1C). Furthermore, 85% of the mice lost Fgfr3 by 36 days after birth. Ach The mouse died (Figure 1D). At 21 days postnatal, Fgfr3 Ach The skeletal elements of the mice, including the femur, tibia, and ulna, were significantly shorter than those of the control mice (Figure 1E–G). These results were consistent with the phenotype of mice with the p.Gly374Arg mutation previously reported (Wang Y et al., PNAS 96: 4455-4460, 1999).

[0085] [Example 2: Fgfr3] Ach [Histological analysis of mouse growth plate cartilage tissue] From histological analysis, Fgfr3 at 21 and 28 days postnatology Ach The height of the growth plate cartilage tissue in mice was shown to be significantly reduced compared to control mice (Figures 2 and 3). Fgfr3 Ach In mice, the height of the proliferative layer (hereinafter also referred to as PZ) and the hypertrophic layer (hereinafter also referred to as HZ or hypertrophic chondrocyte layer) was reduced, suggesting that chondrocyte proliferation and terminal hypertrophic differentiation were inhibited (Figures 3B, 3C). Importantly, the inventors of this invention discovered a unique abnormality in the resting chondrocyte layer that had not been reported before. At 21 days postnatal, Fgfr3 Ach The resting layer (hereinafter also referred to as RZ or resting chondrocyte layer) of mice was significantly enlarged compared to control mice (Figure 3A-C). Weak staining of safranin O (SOFG) and weak immunohistochemical staining of type II collagen (COL2) revealed that Fgfr3 Ach The enlarged resting layer of mice was shown to contain only a limited amount of proteoglycans (Figures 3A, 3B).

[0086] [Example 3: Fgfr3] Ach[Trace Analysis of the Restless Chondrocyte Layer in Mice] To analyze chondrocyte proliferation, we performed 5-ethynyl-2'-deoxyuridine (EdU) labeling experiments. To detect actively dividing cells, EdU was administered to 20-day-old mice, and they were euthanized at 21 days old. A short-term EdU tracking assay was then performed, and chondrocytes in the proliferative zone (PZ) were specifically labeled (Figures 4A, 4B). In line with previous reports on Ach model mice (Naski M et al., Development 125: 4977-4988, 1998; Wang Y et al., PNAS 96: 4455-4460, 1999; Komla-Ebri D et al., J Clin Invest 126: 1871-1884, 2016; Lorget F et al., Am J Hum Genet 91: 1108-1114, 2012), Fgfr3 Ach The number of labeled chondrocytes was significantly reduced in mice (Figure 4C).

[0087] To analyze dormant stem cells in growth plate cartilage tissue, a long-term EdU labeling tracking assay was performed. Mice were administered EdU for consecutive days from postnatal day 4 to day 7 and euthanized on postnatal day 21. In control mice, only a few cells in the resting zone (RZ) were specifically labeled with EdU (Figures 5A, 5B). This result indicates that while most cells that took up EdU between postnatal day 4 and day 7 underwent cell division, some cells retained EdU until postnatal day 21 after undergoing a certain limit of cell division. In contrast, Fgfr3 Ach In mice, various cells were labeled in the expanded resting layer (Figures 5B, 5C), suggesting that many cells that incorporated EdU between day 4 and day 7 after birth underwent a certain limit of cell division and remained in the resting layer until day 21 after birth. From this behavior of resting layer chondrocytes, Fgfr3 Ach This suggests a decrease in the supply of proliferating chondrocytes from the quiescent chondrocyte layer in mice.

[0088] To further analyze the stem cell characteristics of the resting chondrocyte layer, Fgfr3 AchCell lineage tracing analysis was performed by crossing mice with chondrocyte-specific Col11a2-CreERT mice and multicolor R26R-Confetti reporter mice (Figures 6 and 7). Tamoxifen was administered to 11-day-old mice, and they were euthanized on 21-day-old mice. In control mice, cells piled up in each column of growth plate cartilage tissue expressed a single color, suggesting that quiescent stem cells were generating clonal progeny cells that migrated to the primary ossification center (Figure 6A). This result is consistent with a previous report (Newton PT et al., Nature 567: 234-238, 2019), indicating the success of this experiment. In contrast, Fgfr3 Ach In mice, only a few cloned cells were piled up (Figures 6B, 6C). When tamoxifen was administered on day 20 after birth and euthanized on day 24 after birth (p20-24), Fgfr3 Ach The angle of stacking of clonal cells relative to the longitudinal axis of growth plate cartilage tissue in mice was more varied than in control mice (Figure 7A-D). From these results, Fgfr3 Ach In mice, it was suggested that cloned progeny cells move in random directions within the resting layer.

[0089] In summary, the results of the EdU labeling and cell lineage tracing experiments described above show that in control mice, resting chondrocytes behave like stem cells, but Fgfr3 Ach The results suggest a different pattern in mice. In control mice, one daughter cell of a resting chondrocyte constantly undergoes self-renewal, while the other differentiates into a proliferating chondrocyte that migrates to the primary ossification center and forms a column (Figure 8A left). In contrast, Fgfr3 Ach In mice, the majority of quiescent chondrocytes undergo a certain limit of cell division, and their offspring cells migrate in random directions and remain in the quiescent layer. As a result, the quiescent layer expands, and Fgfr3 Ach The number of proliferative lamina chondrocytes and hypertrophic lamina chondrocytes in mice decreases by postnatal day 21 (Figure 8A right).

[0090] Notably, the height of the resting chondrocyte layer decreased from postnatal day 21 to day 28. This decrease in proliferating and hypertrophic chondrocytes resulted in a dramatic reduction in the overall height of the growth plate cartilage tissue, ultimately leading to partial premature closure of the growth plate by postnatal day 28 (Figure 2, Figure 8B). This finding supports Fgfr3 Ach This suggests that the cell population in the enlarged resting layer of mice is significantly depleted after 21 days postnatology, and that the overall chondrocyte population in the growth plate decreases by 28 days postnatology. Immunohistochemical staining for CD73, a chondrocyte stem cell marker, showed that resting layer chondrocytes in control mice at 21 days postnatology express CD73, but Fgfr3 Ach Chondrocytes in the enlarged resting layer of mice were shown not to express CD73 (Figure 8C). This result supports the idea that these chondrocytes have lost their stem cell characteristics.

[0091] [Example 4: Fgfr3] Ach [Single-cell RNA sequencing analysis of mouse growth plate cartilage tissue] Fgfr3 Ach To investigate how excessive Fgfr3 signaling induces abnormalities in quiescent chondrocytes in mice, we used one set of Fgfr3 at 19 days postnatal and two sets at 22 days postnatal. AchSingle-cell RNA sequencing (scRNA-seq) analysis was performed on growth plate cartilage tissue excised from mice and control mice (Figure 9A). A total of 6438 cells were analyzed, and the data were deposited into the Gene Expression Omnibus database (NCBI database, GSE275171). Each analyzed cell had an average of 131,911 reads. After data processing, principal component analysis (PCA), data clustering, dimensionality reduction using UMAP (Uniform Manifold Approximation and Projection), and two-dimensional projection were performed using Seurat. With a resolution parameter set to 0.1, eight cell clusters were identified (Figure 9B). Feature plotting using the chondrocyte marker Col2a1 and the blood cell markers Lys2, Hba-a1, Vpreb3, Mpo, and Emcn revealed that clusters #0, #1, and #3 consisted of chondrocytes, while the other clusters consisted of blood cells present in the bone marrow (Figures 9C-H).

[0092] Using the subset function, cells from clusters #0, #1, and #3 were selected, and another cluster analysis was performed (Figures 10 and 11). This dataset contained 4413 cells, with an average of 123,355 reads per cell. Setting the resolution parameter to 0.3 revealed five cell clusters (Figure 10A). Feature plots using chondrocyte markers confirmed that all of these cells were chondrocytes (Figures 10B-H). Regarding the differentiation stage of chondrocytes, the feature plot function revealed that clusters #2 and #3 were rich in quiescent chondrocytes, as evidenced by the preferential expression of quiescent chondrocyte marker genes Clu and Pthlh (Figures 11A, 11B). In contrast, preferential expression of Sp7, Pth1r, Ihh, and Col10a1 revealed that cluster #0 was remarkably rich in pre-hypertrophic and hypertrophic chondrocytes (Figures 11C-F). The remaining clusters, #1 and #4, are thought to be cells associated with proliferating chondrocytes, and cluster #4 was shown to be mostly dividing cells based on its high G2M and S scores (high expression of cell cycle-related genes) (Figure 11G, 11H).

[0093] Fgfr3 Ach When comparing the number of cells within each cluster between mouse samples and control mouse samples, cluster #0 (pre-hypertrophic and hypertrophic chondrocytes) was found to be rich in cells derived from control mice (Figure 12A-C). This result is related to Fgfr3. Ach This is consistent with histological findings that the height of the hypertrophic chondrocyte layer is reduced in mice (Figure 3B, 3C). On the other hand, cluster #3 is Fgfr3 Ach The cells were rich in mouse-derived cells (Figures 12A-C). The enrichment pattern described above was consistently observed even when the data was reduced to individual mouse samples (Figures 12B, 12C).

[0094] Histological analysis of the growth plate and scRNA-seq analysis revealed that cluster #3 is Fgfr3. AchThis suggests a correspondence with cells in the expanded resting layer of the mouse. To confirm this hypothesis, we identified marker genes in cluster #3. Using Seurat's FindMarkers function, we identified differentially expressed genes (DEGs) between cluster #3 and the remaining clusters (Figure 13A). Feature plotting confirmed that DEGs were preferentially expressed in cluster #3 (Figures 13B-I, cluster #3 is indicated by a dotted line). The highest-ranking DEGs were the Spon1 gene encoding Spondin-1 (also known as F-spondin) and the Pappa2 gene encoding Pappalysin-2 (also known as Pregnancy-associated plasma protein A2 or Pregnancy-associated plasma protein E1) (Figure 13A).

[0095] Immunohistochemical analysis using anti-Spondin-1 and anti-Pappalysin-2 antibodies revealed that Spondin-1 and Pappalysin-2 are associated with Fgfr3 Ach It was shown to be specifically expressed in the expanded resting zone (RZ) of mice (Figures 14A, 14B). Only very weak expression was detected in the resting zone of control mice (Figures 14A, 14B). From these results, cluster #3 is Fgfr3 Ach It was confirmed that these cells correspond to the enlarged resting chondrocyte layer of mice.

[0096] [Example 5: Fgfr3] Ach [Analysis of molecular mechanisms in the enlarged resting chondrocyte layer of mice] Fgfr3 AchTo investigate the molecular mechanisms underlying the abnormal resting chondrocyte layer in mice, Ingenuity Pathway Analysis (IPA) was performed on the DEG between cluster #3 and the remaining clusters, revealing that it was rich in the cyclic AMP response element-binding protein (CREB) pathway (Figure 15A, "CREB Signaling in Neurons"). Immunohistochemistry using an antibody that recognizes phosphorylated CREB (p-CREB), the activated form of CREB, revealed the expression of phosphorylated CREB in resting and hypertrophic chondrocytes of control mice (Figure 16A). Fgfr3 Ach In mice, cells in the expanded quiescent layer also expressed phosphorylated CREB (Figure 16B). Phosphorylated CREB promotes the recruitment of its co-factor, CREB-binding protein (CBP), thereby stimulating the transcription of CREB-dependent genes. CBP is involved in Fgfr3 Ach Since it was also expressed in enlarged resting lamina chondrocytes of mice (Figure 16D), it was suggested that there is an interaction between phosphorylated CREB and CBP for CREB activation in those cells. FRS2, a direct substrate of the fibroblast growth factor receptor (FGFR), is expressed in Fgfr3 Ach Phosphorylation was observed in chondrocytes within the enlarged resting layer of mice (p-FRS2, Figure 16F), indicating that the FGFR3 signaling pathway was activated in these cells.

[0097] To analyze whether excessive FGFR3 signaling activates the CREB pathway, in vitro experiments were performed using primary mouse chondrocytes. Addition of basic fibroblast growth factor (bFGF) enhanced CREB phosphorylation, but this reaction was abolished by the addition of the FGFR inhibitor BGJ398 (Figure 15B). In rat chondrosarcoma (RCS) cells, bFGF treatment significantly activated a luciferase reporter vector regulated by a cAMP-responsive recognition sequence (CRE), but insulin-like growth factor 1 (IGF1), IGF2, epidermal growth factor (EGF), and hepatocyte growth factor (HGF) did not (Figure 15C). The inventors found that bFGF2 dose-dependently activated the CRE-luciferase reporter vector in RCS cells (Figure 15D). These results suggest that Fgfr3 Ach The study suggested that excessive FGFR3 signaling in the enlarged resting chondrocyte layer of mice upregulates CREB activation.

[0098] Fgfr3 Ach Regarding Spondin-1 (Figure 13B), a marker for the enlarged resting chondrocyte layer in mice, Spondin-1 mRNA expression increased in chondrocyte ATDC5 cells upon addition of forskolin, and this reaction was abolished by the further addition of the CREB inhibitor 666-15 (Figure 17A). Forskolin is a cAMP analog that activates CREB. In primary chondrocytes, the addition of bFGF increased Spondin-1 protein expression, but this reaction was abolished by the further addition of 666-15 (Figures 17B, 17C). These results suggest that Fgfr3 Ach This suggests that excessive FGFR3 signaling in mouse quiescent chondrocytes increases Spondin-1 expression via CREB.

[0099] Immunohistochemical analysis revealed that extracellular signal-regulated kinases (ERKs) are phosphorylated in hypertrophic chondrocytes of control mice, but Fgfr3 AchChondrocytes in the enlarged resting layer of mice were shown to be unphosphorylated (p-ERK, Figure 16G, 16H). From this discovery, Fgfr3 Ach The study suggested that CREB phosphorylation in the enlarged resting layer of mice is an independent reaction from the ERK signaling pathway.

[0100] CREB is Fgfr3 Ach To determine if it is mediating the abnormal phenotype in mice, Fgfr3 Ach Mice were administered the CREB inhibitor 666-15 from day 7 to day 27 after birth, and euthanized on day 28. The 666-15 treatment was performed using Fgfr3 Ach The administration of 666-15 significantly restored body weight (Figure 18A) and bone growth (Figure 18B) in mice. Histological analysis showed that administration of 666-15 increased Fgfr3 at 28 days postnatology. Ach It was revealed that it significantly rescued the overall decrease in the chondrocyte population of the mouse growth plate (Figure 18C, 18D). From these results, it was found that administration of 666-15 promotes Fgfr3 Ach The study demonstrated that bone growth in mice could be restored.

[0101] From immunohistochemical analysis, Fgfr3 Ach Administration of 666-15 to mice was shown to reduce the expression of Spondin-1, a marker of enlarged resting chondrocytes (Figure 19A, 19B). Immunohistochemical staining also showed that 666-15 administration enhanced CD73 expression in the resting chondrocyte layer (Figure 19C), suggesting the restoration of stem cell characteristics. These results suggest that activated CREB is at least partially related to Fgfr3 Ach This study demonstrates that it is the cause of abnormalities in chondrocytes within the resting lamina and short stature in mice.

[0102] Western blot analysis of growth plate cartilage tissue revealed Fgfr3 Ach In mice, the expression of Pappalysin-2 (Pappa2) was shown to be significantly increased (Figures 20A, 20B). Pappalysin-2 activates the IGF signaling pathway by degrading IGFBP5 (insulin-like growth factor-binding protein 5). AchIn mice, IGFBP5 expression was significantly reduced in growth plate cartilage tissue (Figure 20A, 20C). Immunohistochemical analysis revealed that Fgfr3 Ach In mouse growth plate cartilage tissue, pappalysin-2 expression was upregulated and IGFBP5 was attenuated in enlarged quiescent chondrocytes (Figures 20D, 20E). These results suggest that Fgfr3 Ach The study showed that IGF signaling mediated by Pappalysin-2 was activated in the enlarged resting chondrocyte layer of mice, suggesting that Pappalysin-2 may be involved in the pathogenesis of achondroplasia.

[0103] [Example 6: Analysis of the effect of PAPPA2 on cell proliferation] To confirm whether Pappalysin-2 is involved in cell proliferation, the expression of Pappalysin-2 in FGFR3-activated cancer cells was analyzed (Figure 21A). Western blot analysis compared the expression of Pappalysin-2 in human cervical cancer cell lines (Hela cells), human esophageal cancer cell lines (TE1 cells, KYSE150 cells, KYSE450 cells), and human bladder cancer cell lines (T24 cells, 5637 cells, RT112 cells). It was confirmed that Pappalysin-2 expression was particularly increased in RT112 cells (Figures 21A, 21B). Among the human bladder cancer cell lines, T24 cells and 5637 cells are FGFR3 wild-type, while RT112 cells are FGFR3-activated due to FGFR3-TACC3 translocation. These results indicate that Pappalysin-2 expression is upregulated in FGFR3-activated cancer cells.

[0104] To analyze the function of pappalysin-2 in the proliferation of FGFR3-activated cancer cells, pappa2 knockdown was performed using siRNA in RT112 and T24 cells (Figure 22). The target sequences and antisenses for each siRNA are as follows. A commercially available control siRNA (Dharmacon, product number: D-001810-01, referred to as siRNA control or scramble in the figure) was used as a control. siRNA Pappa2-1: Target sequence: CAUCAUCGCAGGUGUGUUU (SEQ ID NO: 17) Antisense: AAACACACCUGCGAUGAUG (SEQ ID NO: 18) siRNA Pappa2-2: Target sequence: GCCCAAGCAUUCCCUUAAA (SEQ ID NO: 19) Antisense: UUUAAGGGAAUGCUUGGGC (SEQ ID NO: 20) siRNA Pappa2-3: Target sequence: GGGCUCCGUUCACCAACUA (SEQ ID NO: 21) Antisense: UAGUUGGUGAACGGAGCCC (SEQ ID NO: 22) siRNA Pappa2-4: Target sequence: CAAGAGGGCAUACAUGAGU (SEQ ID NO: 23) Antisense: ACUCAUGUAUGCCCUCUUG (SEQ ID NO: 24) Western blot analysis showed that of the four types of Pappa2 siRNAs created, siRNA Pappa2-2 and siRNA Pappa2-3 suppressed Pappalysin-2 expression (Figure 22A). When RT112 cells with FGFR3 activating mutations and T24 cells with FGFR3 wild type were treated with each siRNA and subjected to cell proliferation tests, no changes in cell proliferation were observed in T24 cells due to siRNA treatment. However, in RT112 cells, cell proliferation was significantly suppressed by treatment with siRNA Pappa2-3 (siRNA3 in the figure) and a mixture of siRNA Pappa2-1 to siRNA-3 (siRNA123 in the figure) (Figures 22B, 22C).

[0105] To further analyze the function of pappalysin-2 in the proliferation of FGFR3-activated cancer cells, we performed pappa2 knockout using the CRISPR / Cas9 system in RT112 cells and compared the effects on cell proliferation. We found that pappa2 knockout (Pappa2 KO) significantly suppressed the proliferation of RT112 cells (Figure 23A-E). These results indicate that pappalysin-2-mediated signaling is activated in FGFR3-activated cancer cells, suggesting that pappalysin-2-mediated signaling could be a new therapeutic target in FGFR3-activated cancers.

[0106] It should be noted that the present invention is not limited to the embodiments and examples described above, and various modifications are possible within the scope of the claims. Embodiments obtained by appropriately combining the technical means disclosed in different embodiments are also included within the technical scope of the present invention. Furthermore, all academic and patent documents mentioned herein are incorporated herein by reference.

Claims

1. A pharmaceutical composition for the treatment of diseases involving hyperfunction of fibroblast growth factor receptor 3 (FGFR3), comprising an inhibitor of cyclic AMP response element-binding protein (CREB) signaling as an active ingredient.

2. The pharmaceutical composition according to claim 1, wherein the disease is achondroplasia.

3. The pharmaceutical composition according to claim 1, wherein the disease is cancer.

4. The pharmaceutical composition according to claim 3, wherein the disease is bladder cancer, colorectal cancer, lung cancer, or uterine carcinosarcoma.

5. The pharmaceutical composition according to any one of claims 1 to 4, wherein the inhibitor is a substance that inhibits the function of CREB or Pappalysin-2.

6. The pharmaceutical composition according to any one of claims 1 to 4, wherein the inhibitor is an antibody or peptide that specifically binds to CREB or Pappalysin-2.

7. The pharmaceutical composition according to any one of claims 1 to 4, wherein the inhibitor is a substance that inhibits the expression of CREB or Pappalysin-2.

8. The pharmaceutical composition according to any one of claims 1 to 4, wherein the inhibitor is a nucleic acid that inhibits the expression of CREB or Pappalysin-2.

9. The pharmaceutical composition according to any one of claims 1 to 4, wherein the inhibitor is a gene therapy drug that targets the CREB gene or the Pappalysin-2 gene.

10. The pharmaceutical composition according to claim 5, wherein the substance that inhibits the function of CREB is a substance that inhibits the phosphorylation of CREB.

11. The pharmaceutical composition according to claim 10, wherein the substance that inhibits the phosphorylation of CREB is 666-15 or a derivative thereof.

12. A screening method for therapeutic agents for diseases involving hyperfunction of FGFR3, comprising identifying substances that inhibit the expression of CREB or Pappalysin-2.

13. A screening method for therapeutic agents for diseases involving hyperfunction of FGFR3, comprising identifying substances that inhibit the function of CREB or Pappalysin-2.

Images