Pharmaceutical composition, biomarker, and uses for same
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2026-02-06
- Publication Date
- 2026-08-13
Smart Images

Figure JP2026004405_13082026_PF_FP_ABST
Abstract
Description
Pharmaceutical composition, biomarker and their uses
[0001] The present invention relates to a pharmaceutical composition for treating or preventing inflammatory diseases containing a meprin inhibitor, a method for evaluating the inhibitory effect of a test substance on the enhancement of IL-6 amp activation by reducing the enhancement of meprin-induced NF-κB signaling activation, the use of meprin or ISLR2 as an inflammatory disease biomarker, and further to a test kit for diagnosing inflammatory diseases containing a reagent for detecting meprin or ISLR2.
[0002] In inflammatory diseases such as autoimmune diseases, it is considered that an inflammatory reaction, which is a defense reaction of the living body, occurs continuously and causes tissue damage and organ dysfunction. The molecular mechanism of the onset of inflammatory diseases has not yet been fully elucidated, and intensive research is underway. One of the molecular mechanisms involved in the onset of inflammatory diseases elucidated in recent years is the IL-6 amplifier (IL-6 amplifier). The IL-6 amplifier is a mechanism in type I collagen-positive non-immune cells such as fibroblasts, keratinocytes, and vascular endothelial cells, in which NF-κB signaling is over-activated by the simultaneous activation of IL-6-STAT3 and NF-κB, and NF-κB target genes such as cytokines, chemokines, and growth factors including IL-6 are over-expressed to induce local inflammation (for example, Non-Patent Documents 1 and 2). The control of the activation of the IL-6 amplifier has attracted attention as a new means of treating and preventing inflammatory diseases.
[0003] On the other hand, meprin is a protein encoded by the leucine-rich repeat-containing immunoglobulin superfamily (ISLR / Islr) gene and is known as a specific marker for mesenchymal stromal / stem cells (MSCs) (Non-Patent Document 3). In addition, it has been reported that meprin-positive fibroblasts suppress the development of pancreatic cancer (Non-Patent Document 4), and it is also expressed in skeletal muscle stem cells and is involved in skeletal muscle regeneration via the Wnt signaling pathway (Non-Patent Document 5). However, the relationship between meprin and the onset of inflammatory diseases is not known.
[0004] Murakami, M., et al., Immunity, 812:50 (2019).Yamamoto, R., et al., International Immunology 35 (9): 403-421 (2023).Maeda, K., et al., Scientific Reports 6, 22288 (2016).Mizutani, Y., et al., Cancer Research 79 (20): 5367-5381 (2019). Zhang, K., et al., Nat Commun. 2018 Dec 3;9(1):5129.
[0005] This invention provides a novel therapeutic method for inflammatory diseases.
[0006] The inventors have found that mephrin is a ligand for the tumor necrosis factor (TNF) receptor, and that in non-immune cells it binds to the TNF receptor in the form of a complex with TNF-α, activating NF-κB signaling and enhancing the activation of the IL-6 amplifier. They also found that overexpression of mephrin promotes the development of inflammatory diseases, while suppression of mephrin expression suppresses the development of inflammatory diseases. Furthermore, they discovered that mephrin and its paralog, ISLR2 (Immunoglobulin Superfamily Containing Leucine Rich Repeat 2), are increased not only in the lesion sites of patients with inflammatory diseases but also in the blood and synovial fluid.
[0007] This disclosure provides the following inventions: 1. A pharmaceutical composition for the treatment or prevention of an inflammatory disease, comprising a mephrin inhibitor. 2. The pharmaceutical composition according to 1, wherein the mephrin inhibitor is a substance that can specifically bind to mephrin, for example, a specific antibody against mephrin or an antigen-binding fragment thereof. 3. The pharmaceutical composition according to 2, wherein the substance that can specifically bind to mephrin inhibits the binding of mephrin to the TNF receptor. 4. The pharmaceutical composition according to 2 or 3, wherein the substance that can specifically bind to mephrin inhibits the binding of mephrin to TNF-α. 5. The pharmaceutical composition according to 1, wherein the mephrin inhibitor is a nucleic acid that suppresses the expression of mephrin. 6. The pharmaceutical composition according to any one of 1 to 5, wherein the inflammatory disease is a disease that causes NF-κB-dependent inflammation. 7. The pharmaceutical composition according to any one of 1 to 6, wherein the inflammatory disease is rheumatoid arthritis, systemic lupus erythematosus, or psoriasis. 8. A method for evaluating the inhibitory effect of a test substance on IL-6 amplifier activation enhancement in non-immune cells expressing TNF receptors and positive type I collagen, using the reduction of mephrine-induced enhancement of NF-κB signaling activation in the presence of a STAT3 stimulator and an NF-κB stimulator as an indicator. Item 9. The method according to item 8, wherein the STAT3 stimulator comprises IL-6. Item 10. The method according to item 8 or 9, wherein the NF-κB stimulator comprises at least one of TNF-α and IL-17. Item 11. A method for evaluating the inhibitory effect of a test substance on IL-6 amplifier activation enhancement, using the reduction of binding affinity to mephrine, TNF-α, and the TNF receptor as an indicator. Item 12. A method for evaluating the inhibitory effect of a test substance on IL-6 amplifier activation enhancement, using the suppression of mephrine expression as an indicator. Item 13. Use of mephrine or ISLR2 as an inflammatory disease biomarker. Item 14. The use according to item 13, wherein the inflammatory disease is a disease that produces NF-κB-dependent inflammation. Item 15. The use described in paragraph 13 or 14, wherein the inflammatory disease is rheumatoid arthritis, systemic lupus erythematosus, or psoriasis. Paragraph 16. A diagnostic kit for inflammatory diseases comprising a substance capable of specifically binding to mephrin protein or ISLR2 protein, such as a specific antibody against mephrin protein or ISLR2 protein or an antigen-binding fragment thereof.Item 17. A diagnostic kit for inflammatory diseases comprising a primer set for amplifying the reverse transcript of ISLR mRNA or ISLR2 mRNA. Item 18. A diagnostic kit for inflammatory diseases comprising a probe for detecting the reverse transcript of ISLR mRNA or ISLR2 mRNA.
[0008] This disclosure also provides the following inventions: 1A. A composition for suppressing the enhancement of IL-6 amplifier activation, comprising a mephrin inhibitor. 2A. The composition according to 1A, wherein the mephrin inhibitor is a substance that can specifically bind to mephrin, for example, a specific antibody against mephrin or an antigen-binding fragment thereof. 3A. The composition according to 2A, wherein the substance that can specifically bind to mephrin inhibits the binding of mephrin to the TNF receptor. 4A. The composition according to 2A or 3A, wherein the substance that can specifically bind to mephrin inhibits the binding of mephrin to TNF-α. 5A. The composition according to 1A, wherein the mephrin inhibitor is a nucleic acid that suppresses the expression of mephrin.
[0009] This disclosure also provides the following inventions: 1B. A method for screening agents for the treatment or prevention of inflammatory diseases, using as an indicator the reduction of mephrin-mediated enhancement of NF-κB signaling activation in the presence of a STAT3 stimulator and an NF-κB stimulator in non-immune cells expressing the TNF receptor and positive type I collagen. 2B. The method according to 1B, wherein the STAT3 stimulator comprises IL-6. 3B. The method according to 1B or 2B, wherein the NF-κB stimulator comprises at least one of TNF-α and IL-17. 4B. A method for screening agents for the treatment or prevention of inflammatory diseases, using as an indicator the reduction of binding affinity of mephrin, TNF-α, and the TNF receptor. 5B. A method for screening agents for the treatment or prevention of inflammatory diseases, using as an indicator the suppression of mephrin expression.
[0010] This disclosure also provides the following inventions: 1C. A method for evaluating the likelihood of the onset or progression of an inflammatory disease in a subject, using mephrine or ISLR2 levels in a sample derived from the subject as an indicator. 2C. The method according to 1C, wherein the sample is prepared from cells, tissue or body fluids collected from the subject. 3C. The method according to 1C or 2C, wherein the sample is prepared from body fluids collected from the subject. 4C. The method according to 2C or 3C, wherein the body fluid is blood or synovial fluid. 5C. The method according to any one of 1C to 3C, wherein the inflammatory disease is a disease that causes NF-κB-dependent inflammation. 6C. The method according to any one of 1C to 4C, wherein the inflammatory disease is rheumatoid arthritis, systemic lupus erythematosus, or psoriasis.
[0011] According to the present invention, the enhancement of IL-6 amplifier activation can be suppressed, thereby providing new means of treatment and prevention for inflammatory diseases such as rheumatoid arthritis and psoriasis. Furthermore, it is possible to evaluate the likelihood of the onset or progression of inflammatory diseases.
[0012] This graph shows the relative expression levels of IL-6 mRNA and CCL2 mRNA in H4 cells stimulated with mephrin. This graph shows the relative expression levels of IL-6 mRNA and CCL2 mRNA in HDF cells stimulated with mephrin and IL-6, TNF-α, or IL-6+TNF-α. This graph shows the relative expression level of IL-6 mRNA in HDF cells stimulated with mephrin and IL-6+IL-17. This graph shows the relative expression levels of mephrin mRNA and IL-6 mRNA in mephrin shRNA-treated MEF cells stimulated with IL-6, TNF-α, or IL-6+TNF-α. This graph shows the relative expression levels of CXCL1 mRNA and STAT3 mRNA in mephrin shRNA-treated MEF cells stimulated with IL-6, TNF-α, or IL-6+TNF-α. The top panel shows the results of an NF-κB promoter assay using HEK293T cells incorporating a mephrin expression vector, and the bottom panel shows immunoblots using an anti-mephrin antibody. The immunoblots show the phosphorylation status of p65 / RelA and PDGFRB in HDF cells stimulated with TNF-α, mephrin, or PDGFB after treatment with a TNFR antagonist or PDGFR inhibitor. The immunoblots show the association of mephrin, TNFR, and TNF-α. Conceptual diagrams show the structures of soluble TNFR deletion mutants and mephrin deletion mutants. The immunoblot shows the association of the N-terminal domain of mephrin with TNFR's CRD1 and CRD4. The graph shows the relative expression levels of IL-6 mRNA and TNFR1 mRNA in siRNA-treated HDF cells stimulated with IL-6+TNF-α, or mephrin and IL-6+TNF-α. The siRNAs used were control siRNA (SiNC), p65-targeting siRNA (Sip65), and TNFR1-targeting siRNA (Si1-TNFR1, Si2-TNFR1, Si3-TNFR1). The image shows sensorgrams of the association assay of mephrin, soluble TNFR, and TNF-α using the BLI method. The image also shows graphs of ear thickness in imiquimod-induced dermatitis mice administered with control siRNA, p65 siRNA, or mephrin siRNA.The graphs above show the severity of anti-type II collagen antibody-induced arthritis in mice administered with a mephrin expression vector or an empty vector, and the immunoblots of serum with anti-mephrin antibody (bottom). The images also show mephrin-stained synovial tissue from mice administered with a mephrin expression vector or an empty vector. Other images include mephrin-stained synovial tissue from patients with osteoarthritis and rheumatoid arthritis, graphs of mephrin concentration in synovial fluid from patients with osteoarthritis and rheumatoid arthritis, graphs of serum mephrin and ISLR2 concentrations from patients with rheumatoid arthritis, graphs of serum mephrin and ISLR2 concentrations from patients with SLE, and graphs of serum ISLR2 concentrations from patients with rheumatoid arthritis and SLE. Finally, there is a sensorgram of the BLI assay for the association of mephrin, soluble TNFR, and TNF-α in the presence of anti-human mephrin antibody.
[0013] The following description may be based on representative embodiments or specific examples, but the present invention is not limited to such embodiments or specific examples. In this specification, numerical ranges represented using "~" or "-" mean ranges that include the numbers at both ends as the upper and lower limits, respectively, unless otherwise specified. The upper and lower limits of each numerical range exemplified in this specification can be combined in any way.
[0014] [Pharmaceutical Composition] This disclosure provides a composition, particularly a pharmaceutical composition, for the treatment or prevention of inflammatory diseases, which contains a mephrin inhibitor.
[0015] Mephrin, also known as ISLR (Immunoglobulin Superfamily Containing Leucine Rich Repeat), is a protein involved in cell adhesion. The precursor of human mephrin consists of 428 amino acids, as shown in Sequence ID No. 1. The amino acid sequence from the N-terminus (1-18) is the signal sequence, the amino acid sequence from the N-terminus (19-171) is the leucine-rich repeat domain, the amino acid sequence from the 239-340 is the immunoglobulin-like domain, and the site where glycosylphosphatidylinositol (GPI) is added to the C-terminus of alanine at position 401. Through processing, the precursor of human mephrin becomes a mature protein consisting of the amino acid sequence from the N-terminus (19-428), which is expressed on the cell membrane via a GPI anchor, and the GPI anchor is cleaved to become a soluble protein. The amino acid sequence of the human mephrine precursor is registered in the UniProt database with accession number A0A146E5L3, the nucleotide sequence of the human ISLR gene is registered in the National Center for Biotechnology Information (NCBI) of the US NIH as NM_005545.4, and the nucleotide sequence of the human ISLR mRNA is registered in NCBI as NM_012043.4 (accessed September 20, 2024).
[0016] In this disclosure, a mephrin inhibitor is a substance that has the ability to reduce the activity of mephrin that enhances IL-6 amplifier activation (hereinafter also simply referred to as mephrin activity). When non-immune cells expressing TNF receptors are stimulated with IL-6 and TNF-α, or IL-6 and IL-17, IL-6 amplifier activation occurs, and mephrin has the activity to enhance this IL-6 amplifier activation.
[0017] Mephrin inhibitors include substances that have the ability to suppress mephrin expression and substances that have the ability to inhibit mephrin activity. Substances that have the ability to suppress mephrin expression can suppress mephrin expression by at least approximately 50%, at least approximately 60%, at least approximately 70%, at least approximately 80%, at least approximately 90%, at least approximately 95%, at least approximately 98%, or at least approximately 99%. Substances that have the ability to inhibit mephrin activity can inhibit mephrin activity by at least approximately 50%, at least approximately 60%, at least approximately 70%, at least approximately 80%, at least approximately 90%, at least approximately 95%, at least approximately 98%, or at least approximately 99%.
[0018] The suppression of mephrin expression by a substance having the ability to suppress mephrin expression can be confirmed, for example, by co-administering type I collagen-positive non-immune cells (e.g., MEF cells), such as fibroblasts, keratinocytes, and vascular endothelial cells, with the substance, measuring the amount of ISLR mRNA by RT-PCR, and calculating the ratio of the ISLR mRNA amount to the amount of ISLR mRNA in the absence of the substance. A substance having the ability to suppress mephrin expression can suppress mephrin expression by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%.
[0019] The inhibition of mephrin activity by a substance capable of inhibiting mephrin activity can be confirmed using the IL-6 amplifier activation-enhancing activity of mephrin as an indicator. For example, this can be confirmed by measuring the amount of IL-6 mRNA by RT-PCR after co-occurring type I collagen-positive non-immune cells (e.g., MEF cells), such as fibroblasts, keratinocytes, and vascular endothelial cells, with the substance and IL-6, and then calculating the ratio of the amount of IL-6 mRNA to the amount of IL-6 mRNA in the absence of the substance and in the presence of IL-6. Here, co-occurrence with IL-6 can be replaced with co-occurrence with TNF-α, or co-occurrence with both IL-6 and TNF-α. A substance capable of inhibiting mephrin activity can inhibit mephrin activity by at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, at least 98%, or at least 99%.
[0020] One example of a substance capable of suppressing mephrin expression is nucleic acid that suppresses mephrin expression. Nucleic acids that suppress mephrin expression include nucleic acids that can suppress the transcription of ISLR mRNA from the ISLR gene encoding mephrin, nucleic acids that can degrade ISLR mRNA, and nucleic acids that can suppress protein translation from ISLR mRNA. Examples of nucleic acids that suppress mephrin expression include antisense nucleic acids against ISLR mRNA, and nucleic acids that cause RNA interference with ISLR mRNA, such as siRNA, shRNA, and miRNA.
[0021] The nucleic acid that suppresses mephrin expression may be any of the following: deoxyribonucleic acid (DNA), ribonucleic acid (RNA), or a chimeric nucleic acid containing both deoxyribonucleotides and ribonucleotides as constituent units. Furthermore, the nucleic acid that suppresses mephrin expression may contain, as constituent units, any of the deoxyribonucleotides found in natural DNA, namely dATP, dGTP, dCTP, and dTTP; ribonucleotides found in natural RNA, namely ATP, GTP, CTP, and UTP; or analogs of these nucleotides.
[0022] Examples of nucleotide analogs include dUTP (deoxyuridine triphosphate), dITP (deoxyinosine triphosphate), nucleotides in which the hydroxyl group at the 2' position of the ribose moiety is substituted (e.g., nucleotides having 2'-O-methyl-ribose, 2'-O-methoxyethyl-ribose, 2'-alkoxy-ribose, 2'-amino-ribose, 2'-fluoro-ribose), nucleotides in which the base portion is modified (e.g., nucleotides having 5-bromouracil, 5-methylcytosine, 5-iodouracil, 2-aminoadenine, 6-methyladenine), and nucleotides in which the phosphate group is replaced with a chemically modified phosphate group such as phosphorothioate (PS), methylphosphonate, or phosphorodithionate.
[0023] Nucleic acids that suppress mephrin expression can be designed based on the base sequences of known ISLR genes or ISLR mRNA, and can be artificially synthesized using genetic engineering or chemical synthesis techniques. Methods for genetic engineering, chemical synthesis, synthesis of non-natural nucleotides, and synthesis of nucleic acids containing them are well known to those skilled in the art.
[0024] Furthermore, expression vectors of nucleic acids that suppress mephrine expression are also included in the category of substances that have the ability to suppress mephrine expression. The term "expression vector" refers to a vector equipped with a mechanism for expressing the incorporated polynucleotide within a cell. In an expression vector, the polynucleotide to be expressed is operably ligated to a regulatory sequence such as a promoter. The term "operably ligated" means that the regulatory sequence such as a promoter is positioned close enough to the polynucleotide that it can influence its expression. For example, operably ligated polynucleotide to a promoter means that the polynucleotide is ligated in such a way that it can be expressed under the control of the promoter.
[0025] One example of a substance capable of inhibiting the activity of mephrin is a substance that can specifically bind to mephrin. Substances that can specifically bind to mephrin include specific antibodies against mephrin or their antigen-binding fragments, and aptamers against mephrin.
[0026] As shown in the examples described later, the IL-6 amplifier activation-enhancing activity of mephrin is thought to be at least partially related to the activation of NF-κB signaling caused by the binding of mephrin to the TNF receptor. Furthermore, it has been experimentally confirmed that mephrin also binds to TNF-α. Therefore, it is preferable that a substance that can specifically bind to mephrin inhibits the binding of mephrin to the TNF receptor, particularly the binding of mephrin to the cysteine-rich domain 1 (CRD1) or CRD4 of the TNF receptor. It is also preferable that a substance that can specifically bind to mephrin inhibits the binding of mephrin to TNF-α. The substance that can specifically bind to mephrin may bind to the N-terminal domain of mephrin, for example, the region from amino acids 1 to 171 or 19 to 171 of the amino acid sequence shown in SEQ ID NO: 1.
[0027] In this disclosure, the term "binding" means an attractive interaction between molecules and encompasses the term "association." For example, binding of mephrine to a molecule means that mephrine interacts attractively with that molecule and encompasses the association of mephrine with that molecule.
[0028] A substance that can specifically bind to mephrin preferentially binds to mephrin over non-target proteins and has a high binding affinity to mephrin. A substance that can specifically bind to mephrin may be a substance that binds to mephrin with an affinity at least 5 times stronger, preferably at least 10 times stronger, more preferably at least 1000 times stronger, than its affinity to non-target proteins. A substance that can specifically bind to mephrin may also be 10 -7 M, preferably 10 -8 M, more comfortable 10 -9 It may also be a substance that has a dissociation constant of M and binds to mephrine.
[0029] Specific antibodies against mephrin can originate from non-human animals such as mice, rats, sharks, rabbits, pigs, hamsters, camels, llamas, and goats, as well as from humans. Furthermore, the specific antibodies may be from any class (e.g., IgG, IgE, IgM, IgD, or IgA) and subclasses of immunoglobulin molecules.
[0030] The specific antibody against mephrin may be a polyclonal antibody or a monoclonal antibody, but it is preferable to use a monoclonal antibody when used in a pharmaceutical composition. The specific antibody may be a chimeric antibody, a humanized antibody, or a human antibody. The specific antibody may be a monospecific antibody having specificity for a single antigen, or a multispecific antibody (e.g., a bispecific antibody) having specificity for two or more antigens.
[0031] The antigen-binding fragment of a specific antibody against mephrin is defined as a partial fragment of the antibody derived from the specific antibody that retains the ability to specifically bind to the antigen. This fragment may include, but is not limited to, Fab (fragment of antigen binding), Fab', F(ab')2, Fv, single-chain antibodies (single-chain Fv), disulfide-stabilized antibodies (disulfide-stabilized Fv), and peptides containing CDR.
[0032] The specific antibody against mephrin and its antigen-binding fragment may be a conjugate bound to a functional molecule. Examples of functional molecules include non-peptide polymers (e.g., polyethylene glycol (PEG)), radioactive materials (e.g., 125 I, 131 Examples include toxins (e.g., diphtheria toxin, lysine, etc.), drugs (e.g., anticancer drugs, etc.), cytokines, growth factors, albumin, enzymes (e.g., peroxidase, alkaline phosphatase, etc.), biotin, streptavidin, fluorescent substances (e.g., FITC, rhodamine, GFP, etc.), pigment proteins (e.g., phycoerythrin, phycocyanin, etc.), and metal particles such as gold colloids.
[0033] Specific antibodies against mephrin and their antigen-binding fragments can be prepared using methods known to those skilled in the art. For example, specific antibodies can be prepared by creating mephrin using a genetic engineering technique based on the amino acid sequence of human mephrin or the base sequence of the ISLR gene encoding it, immunizing a suitable animal with this as an antigen, and then fusing the B cells of the animal with myeloma cells to obtain a hybridoma. For the hybridoma method, see, for example, Meyaard et al. (1997) Immunity 7:283-290; Wright et al. (2000) Immunity 13:233-242; Kaithamana et al. (1999) J.Immunol. 163:5157-5164.
[0034] Aptamers for mephrine are molecules that have the ability to specifically bind to mephrine due to their three-dimensional structure. Aptamers composed of nucleic acids are called nucleic acid aptamers, and aptamers composed of amino acids are called peptide aptamers. In this disclosure, either nucleic acid aptamers or peptide aptamers can be used.
[0035] Nucleic acid aptamers may be DNA, RNA, or chimeric nucleic acids, and may contain nucleotides found in natural DNA or RNA, or analogs of these nucleotides, as their constituent units. Nucleic acid aptamers can be prepared by methods known to those skilled in the art, such as the SELEX (systematic evolution of ligands by exponential enrichment) method. Peptide aptamers can be prepared by methods known to those skilled in the art, such as phage display or cell surface display. Furthermore, expression vectors of aptamers against mephrin are also included in substances that have the ability to suppress the function of mephrin.
[0036] The pharmaceutical compositions of this disclosure contain a mephrin inhibitor as an active ingredient and can be used for the treatment or prevention of inflammatory diseases by suppressing the enhancement of IL-6 amplifier activation by mephrin. As used in this disclosure, the term "treatment" includes all types of medically acceptable therapeutic interventions aimed at curing or temporarily relieving a disease or condition. The term "prevention" also includes all types of medically acceptable preventive interventions aimed at preventing or suppressing the onset or development of a disease. Therefore, the treatment or prevention of inflammatory diseases includes medically acceptable interventions for various purposes, including improving symptoms, delaying or halting progression, preventing onset, or preventing recurrence in inflammatory diseases.
[0037] The pharmaceutical compositions of this disclosure contain an effective amount of a mephrin inhibitor for the treatment or prevention of inflammatory diseases. The effective amount of the mephrin inhibitor can be appropriately determined depending on the dosage, the age, sex, weight, severity of the disease, and other factors. For example, the effective amount of the mephrin inhibitor may be 0.001 mg / kg to 200 mg / kg, 0.001 mg / kg to 100 mg / kg, 0.01 mg / kg to 100 mg / kg, 0.01 mg / kg to 50 mg / kg, 0.1 mg / kg to 40 mg / kg, 0.1 mg / kg to 30 mg / kg, 0.1 mg / kg to 20 mg / kg, or 0.1 mg / kg to 10 mg / kg per kg of body weight per day, administered once or more times per day. Administration may be, for example, three times a day, twice a day, once a day, every other day, every three days, every week, every two weeks, every three weeks, or every four weeks.
[0038] The pharmaceutical compositions of this disclosure may include, in addition to mephrine inhibitors, other pharmaceutically acceptable components, such as pharmaceutically acceptable additives (buffers, stabilizers, preservatives, excipients, etc.), pharmaceutically acceptable media (water, saline, phosphate-buffered saline (PBS), etc.), and other agents for the treatment or prevention of inflammatory diseases. Pharmacologically acceptable additives and media are well known to those skilled in the art and can be appropriately selected and used by those skilled in the art within the scope of their ordinary capacity.
[0039] The dosage form of the pharmaceutical composition may be any suitable for the administration route, and examples thereof include injections, infusions, topical agents, tablets, capsules, powders, granules, fine granules, pills, suspensions, emulsions, solutions, syrups, and the like.
[0040] The pharmaceutical composition can be administered parenterally or orally, and can be used, for example, by intravascular administration (preferably intravenous administration), intraperitoneal administration, intramuscular administration, subcutaneous administration, or the like.
[0041] The pharmaceutical composition of the present disclosure is administered to a subject at risk of developing or having developed an inflammatory disease. The subjects are humans and non-human animals, and examples of non-human animals include mammals such as rodents including mice, rats, hamsters, guinea pigs, primates including chimpanzees and rhesus monkeys, domestic animals including pigs, cows, goats, horses, and sheep, and pet animals including dogs and cats. The pharmaceutical composition is preferably administered to humans
[0042] Examples of inflammatory diseases that can be treated or prevented by the pharmaceutical composition of the present disclosure include diseases that cause NF-κB-dependent inflammation, such as rheumatoid arthritis, psoriasis, systemic lupus erythematosus, Behçet's disease, Sjögren's syndrome, polymyositis, dermatomyositis, hyperthyroidism, hypothyroidism, autoimmune adrenal insufficiency, essential thrombocythemia, multiple sclerosis, autoimmune hepatitis, chronic hepatitis, cirrhosis, chronic obstructive pulmonary disease, Crohn's disease, ulcerative colitis, and the like. Preferred inflammatory diseases for treatment or prevention by the pharmaceutical composition of the present disclosure are rheumatoid arthritis, systemic lupus erythematosus, or psoriasis.
[0043] The present disclosure also provides a composition for suppressing the enhancement of IL-6 amp activation, which contains the above-mentioned mefrin inhibitor.
[0044] [Method for Treating or Preventing Inflammatory Diseases] The present disclosure provides a method for preventing or treating an inflammatory disease, which includes administering a pharmaceutical composition containing the above-mentioned meprin inhibitor to a subject at risk of developing or suffering from an inflammatory disease. The present disclosure provides the use of the above-mentioned meprin inhibitor in the manufacture of a pharmaceutical composition for treating or preventing an inflammatory disease, and the use of the above-mentioned meprin inhibitor for treating or preventing an inflammatory disease. <> <>
[0045] Furthermore, the present disclosure provides a method for suppressing the enhancement of IL-6 amp activation, which includes administering a composition for suppressing the enhancement of IL-6 amp activation containing the above-mentioned meprin inhibitor to a subject in which suppression of the enhancement of IL-6 amp activation is desired.The present disclosure provides the use of the above-mentioned meprin inhibitor in the manufacture of a composition for suppressing the enhancement of IL-6 amp activation, and the use of the above-mentioned meprin inhibitor for suppressing the enhancement of IL-6 amp activation. <> <>
[0046] [Method for Evaluating the Effect of Suppressing the Enhancement of IL-6 Amp Activation] The present disclosure provides a method for evaluating the effect of suppressing the enhancement of IL-6 amp activation of a test substance, using as an index the reduction of the enhancement of NF-κB signal transduction activation by meprin in type I collagen-positive non-immune cells expressing TNF receptor in the presence of STAT3 stimulator and NF-κB stimulator. An embodiment of this evaluation method includes the steps of: measuring the amount of a substance whose expression or activity is enhanced along with NF-κB signal transduction activation in type I collagen-positive non-immune cells expressing TNF receptor in the presence of the test substance and in the presence of meprin, STAT3 stimulator and NF-κB stimulator; comparing the measured amount of the substance with the amount of the substance whose expression or activity is enhanced along with NF-κB signal transduction activation in the above-mentioned non-immune cells in the absence of the test substance and in the presence of meprin, STAT3 stimulator and NF-κB stimulator; and evaluating a test substance that reduces the amount of the substance whose expression or activity is enhanced along with NF-κB signal transduction activation as having an effect of suppressing the enhancement of IL-6 amp activation. <> <>
[0047] Examples of non-immune cells that express TNF receptors and are positive for type I collagen include fibroblasts, keratinocytes, endothelial cells, epithelial cells, glioma cells, synovial cells, and salivary gland cells. In these cells, it is known that stimulation with STAT3-stimulating factors and NF-κB-stimulating factors activates NF-κB signaling and the IL-6 amplifier.
[0048] Non-immune cells are incubated for an appropriate time in the presence of the test substance, as well as mephrine, a STAT3 stimulant, and an NF-κB stimulant, and then subjected to measurement of substances whose expression or activity is enhanced in conjunction with NF-κB signaling activation. Examples of STAT3 stimulants include IL-6, and examples of NF-κB stimulants include TNF-α, IL-17, TLR ligands, growth factors, norepinephrine, and ATP. As an example, non-immune cells are incubated for an appropriate time, for example, 1 to 3 hours, in the presence of the test substance, as well as approximately 25 to 200 ng / mL each of mephrine, IL-6, and TNF-α or IL-17 (for example, 50 to 100 ng / mL), and then subjected to measurement of substances whose expression or activity is enhanced in conjunction with NF-κB signaling activation.
[0049] Examples of substances whose expression or activity is enhanced in conjunction with NF-κB signaling activation include mRNA of NF-κB target genes, proteins encoded by NF-κB target genes, and substances that reflect the promoter activity of NF-κB target genes. NF-κB target genes may be, for example, the IL-6 gene, the CCL2 gene, or the CXCL1 gene. Substances that reflect the promoter activity of NF-κB target genes may be, for example, proteins encoded by reporter genes linked to the promoter of NF-κB target genes. One example of such a protein is luciferase encoded by a luciferase gene linked to the promoter of NF-κB target genes.
[0050] The amount of a substance whose expression or activity is enhanced in conjunction with NF-κB signaling activation can be measured by general methods capable of detecting specific gene expression, such as hybridization using base sequence information, quantitative PCR, RNA-Seq, etc., if the substance is mRNA. If the substance is a protein, it can be measured by general methods capable of detecting specific protein expression, such as ELISA using a specific antibody or its antigen-binding fragment, or immunoassays such as Western blotting. If the substance is a substance that reflects the promoter activity of an NF-κB target gene, the measurement should be performed according to the substance; for example, the amount of luciferase can be measured as the amount of light emitted from the luminescent substrate luciferin.
[0051] The measured amount of the substance is then compared to the amount of the substance whose expression or activity is enhanced in the non-immune cells in the absence of the test substance and in the presence of mephrine, STAT3 stimulator, and NF-κB stimulator, in response to NF-κB signaling activation. Mephrine has the ability to enhance IL-6 amplifier activation by enhancing NF-κB signaling activation. If the amount of the substance is reduced in the presence of the test substance, the test substance can be evaluated as having an inhibitory effect on IL-6 amplifier activation enhancement, which is suppressed by mephrine in the presence of STAT3 stimulator and NF-κB stimulator.
[0052] This disclosure also provides a method for evaluating the IL-6 amplifier activation enhancement inhibitory effect of a test substance, using the reduction in binding affinity to mephrine, TNF-α, and TNF receptors as an indicator. One embodiment of this evaluation method includes the steps of: measuring the binding strength of mephrine, TNF-α, and TNF receptors in the presence of the test substance; comparing the measured strength with the binding strength of mephrine, TNF-α, and TNF receptors in the absence of the test substance; and evaluating the test substance that reduces the binding strength of mephrine, TNF-α, and TNF receptors as having an IL-6 amplifier activation enhancement inhibitory effect.
[0053] The binding strength of mephrin, TNF-α, and the TNF receptor can be measured by biolayer interferometry, surface plasmon resonance, affinity chromatography, Native PAGE, and other common methods capable of detecting intermolecular interactions.
[0054] The measured binding strength is then compared to the binding strength of mephrine, TNF-α, and the TNF receptor in the absence of the test substance. Mephrine has the ability to bind to the TNF receptor in the form of a complex with TNF-α. If the binding strength of mephrine, TNF-α, and the TNF receptor is reduced in the presence of the test substance, the test substance can be evaluated as having an inhibitory effect on the binding of the mephrine-TNF-α complex to the TNF receptor, and therefore an inhibitory effect on IL-6 amplifier activation enhancement.
[0055] This disclosure also provides a method for evaluating the IL-6 amplifier activation enhancement inhibitory effect of a test substance, using the suppression of mephrine expression as an indicator. One embodiment of this evaluation method includes the steps of: measuring the amount of mephrine expression in cells capable of expressing mephrine in the presence of the test substance; comparing the measured amount of mephrine expression with the amount of mephrine expression in the same cells in the absence of the test substance; and evaluating the test substance that reduces the amount of mephrine expression as having an IL-6 amplifier activation enhancement inhibitory effect.
[0056] Mephrin is known to be expressed in many human-derived and non-human mammalian-derived cells. In this evaluation method, known cultured cell lines that express mephrin may be used as is, or they may be used after incorporating the ISLR gene. The cells are incubated in the presence of the test substance for an appropriate time, and then subjected to measurement of expression levels.
[0057] Mephrin expression levels can be measured as the amount of ISLR mRNA or the amount of mephrin protein. These measurements can be performed using general methods capable of detecting the expression of specific genes or proteins, as illustrated above.
[0058] The measured mephrin expression level is then compared to the mephrin expression level in the cells in the absence of the test substance. If the mephrin expression level is reduced in the presence of the test substance, the test substance can be evaluated as having an inhibitory effect on IL-6 amplifier activation enhancement.
[0059] Since inhibiting IL-6 amplifier activation enhancement can suppress the onset of inflammatory diseases, test substances evaluated as having IL-6 amplifier activation enhancement inhibitory effects using the above evaluation method are expected to be useful in the treatment or prevention of inflammatory diseases. Thus, the above method for evaluating IL-6 amplifier activation enhancement inhibitory effects can be used for drug screening for the treatment or prevention of inflammatory diseases.
[0060] [Method for evaluating the likelihood of developing or progressing inflammatory diseases] This disclosure provides a method for evaluating the likelihood of developing or progressing inflammatory diseases in a subject (hereinafter also referred to as the disease likelihood evaluation method) using mephrin or ISLR2 levels in a subject-derived sample (hereinafter also referred to as the subject sample) as indicators. Mephrin and ISLR2 can be used as biomarkers in the disease likelihood evaluation method.
[0061] Subjects may be any subjects at risk of developing or already suffering from an inflammatory disease, specifically humans and non-human animals as exemplified in the description of the pharmaceutical composition. The inflammatory diseases whose onset or progression is evaluated are as exemplified in the description of the pharmaceutical composition, and are preferably rheumatoid arthritis, systemic lupus erythematosus, or psoriasis.
[0062] Subject specimens are prepared from biological samples taken from subjects, such as cells, tissues, or body fluids. Cells and tissues are preferably taken from the site of an inflammatory disease or a site where a lesion may develop. Body fluids include, for example, blood, lymph, synovial fluid, saliva, airway mucus, bone marrow fluid, urine, semen, or peritoneal fluid, and are preferably blood or synovial fluid. The specimen may be the biological sample itself, or it may be prepared by subjecting the biological sample to general pretreatment for the detection of mRNA or proteins. Suitable specimens are blood, plasma, or serum.
[0063] In assessing disease potential, mephrin or ISLR2 levels in the subject's sample are used as indicators. The mephrin or ISLR2 levels may be the amount or concentration of mephrin protein, the amount or concentration of ISLR2 protein, the amount or concentration of mephrin mRNA (i.e., ISLR mRNA), or the amount or concentration of ISLR2 mRNA. These measurements can be made by general methods capable of detecting the expression of specific genes or proteins, as illustrated above.
[0064] ISLR2 (Immunoglobulin Superfamily Containing Leucine-Rich Repeat 2) is a paralog of mephrin and is known to be involved in axon elongation. The precursor of human ISLR2 consists of 745 amino acids. According to NCBI, there are two isoforms of ISLR2 (isoform X1, X2). The functional differences between them are unknown.
[0065] One embodiment of a method for assessing disease likelihood includes the steps of: measuring the mephrine or ISLR2 level in a subject sample; comparing the measured mephrine or ISLR2 level to a cutoff value; and, if the mephrine or ISLR2 level in the subject sample exceeds the cutoff value, assessing that the subject has or is likely to develop an inflammatory disease, or that the subject's inflammatory disease is progressing or is likely to progress.
[0066] An example of a cutoff value is the mephrine or ISLR2 level in a sample derived from a control subject. A control subject is a person who can be clinically determined not to have developed an inflammatory disease. If the mephrine or ISLR2 level in a subject's sample is higher than the mephrine or ISLR2 level in a sample derived from a control subject, the subject can be evaluated as having developed or being highly likely to develop an inflammatory disease.
[0067] Another example of a cutoff value is the mephrine or ISLR2 level in samples from patients with inflammatory diseases whose disease has not progressed. Patients with inflammatory diseases whose disease has not progressed are those who have developed an inflammatory disease but whose disease is clinically judged not to be progressing. If the mephrine or ISLR2 level in a subject's sample is higher than the mephrine or ISLR2 level in samples from patients with inflammatory diseases whose disease has not progressed, the subject's inflammatory disease can be assessed as progressing or likely to progress.
[0068] Another example of a cutoff value is one determined by pre-measuring mephrine or ISLR2 levels in samples from multiple patients and controls with inflammatory diseases, and then performing ROC analysis using these measurements. In ROC analysis, an ROC curve is created with 1-specificity (false positive rate) on the x-axis and sensitivity (positive rate) on the y-axis. Then, the cutoff value is determined using methods commonly used to find the cutoff value from the ROC curve, such as setting the cutoff value at the point where Youden's index (sensitivity + specificity - 1) is maximum, or setting the cutoff value at the point where the distance from the upper left corner of the ROC curve is minimum. If the mephrine or ISLR2 level in a subject's sample exceeds the value determined by ROC analysis based on the mephrine or ISLR2 levels in samples from multiple patients and controls with inflammatory diseases, the subject can be evaluated as having or being highly likely to develop an inflammatory disease.
[0069] Another example of a cutoff value is one determined by pre-measuring mephrine or ISLR2 levels in samples from multiple inflammatory disease patients with progressive disease and multiple inflammatory disease patients with no disease progression, and then performing ROC analysis using these measurements. If the mephrine or ISLR2 level in a subject's sample exceeds the value determined by ROC analysis based on the mephrine or ISLR2 levels in samples from multiple inflammatory disease patients with progressive disease and multiple inflammatory disease patients with no disease progression, the subject's inflammatory disease can be assessed as progressing or likely to progress.
[0070] The cutoff value is preferably determined by measuring the mephrine or ISLR2 level in the subject sample using a sample derived from a patient with an inflammatory disease or a control, prepared in the same manner as the subject sample, and using the same method as for measuring the mephrine or ISLR2 level in the subject sample.
[0071] If the mephrine or ISLR2 level in a subject's sample exceeds a cutoff value, the subject is predicted to be at high risk of developing or progressing an inflammatory disease, and a physician can make a diagnosis based on this information and take therapeutic or preventive measures against the development or progression of the inflammatory disease. Thus, this disclosure provides a method for treating or preventing an inflammatory disease, comprising the step of administering the above-described pharmaceutical composition to a subject who has developed or is at high risk of developing an inflammatory disease, or whose inflammatory disease is progressing or is at high risk of progressing, based on the mephrine or ISLR2 level in a subject's sample as described above.
[0072] Furthermore, by monitoring mephrine or ISLR levels in specimens from patients with inflammatory diseases who are receiving some form of therapeutic or prophylactic treatment, such as medication, it becomes possible to determine whether such treatment is effective as a therapeutic or prophylactic measure for inflammatory diseases. Thus, this disclosure provides a method for evaluating the effectiveness of therapeutic or prophylactic measures for inflammatory diseases.
[0073] [Test Kit] This disclosure provides a test kit for the diagnosis of inflammatory diseases, comprising a reagent for detecting mephrin or ISLR2, for example, a reagent for detecting mephrin protein, ISLR2 protein, ISLR mRNA, or ISLR2 mRNA.
[0074] Reagents for detecting mephrin or ISLR2 can be appropriately selected according to their detection principle. For example, reagents for detecting mephrin protein or ISLR2 protein are reagents commonly used in immunoassays, and include substances that can specifically bind to mephrin protein or ISLR2 protein (e.g., specific antibodies against mephrin protein or ISLR2 protein, or their antigen-binding fragments, aptamers, etc.), chromogenic substrates, etc. Reagents for detecting ISLR mRNA or ISLR2 mRNA include, for example, primer sets for amplifying ISLR mRNA, ISLR2 mRNA, or their reverse transcripts, probes, RNA extraction reagents, reverse transcriptases, DNA polymerases, etc.
[0075] Depending on the detection method, the test kit may further include additional reagents such as blocking solutions and washing solutions; equipment such as solid phase supports and reaction vessels; and instructions for use.
[0076] The test kit can be used to measure mephrine or ISLR2 levels in subject samples in the disease probability assessment method described above. Furthermore, the test kit can be used to select subjects for administration of the aforementioned pharmaceutical composition, for example, subjects with elevated mephrine levels, and is also useful as a companion diagnostic.
[0077] The present invention will be described in more detail by the following examples, but the present invention is not limited thereto.
[0078] [Materials and Methods] HEK 293T, human glioma cell line H4, and human dermal fibroblasts (HDF) for cell line assays were purchased from ATCC (Sumitomo Dainippon Pharma, Osaka, Japan) and CELLnTEc (Bern, Switzerland), respectively. Mouse embryonic fibroblasts (MEF cells) were isolated from C57BL / 6 mice and immortalized with Simian virus 40 (SV40) T antigen. All cell lines were cultured in antibiotic-free DMEM (Thermo Fisher Scientific, Waltham, MA) with 10% fetal bovine serum (Thermo Fisher Scientific) at 37°C and 5% CO2. Expi293 suspension cells for protein expression were cultured in Expi293 Expression Medium (Thermo Fisher Scientific) at 37°C and 5% CO2 with shaking at 130 rpm.
[0079] The following antibodies were used for antibody Western blotting, confocal microscopy, and immunohistochemistry: anti-mephrin antibody (HPA050811, Sigma), anti-p65 antibody (C-20, for Western blotting and confocal laser microscopy, Santa Cruz), anti-phosphorylated p65 antibody (SAB4500488, for immunohistochemistry, Sigma-Aldrich), anti-phosphorylated p65 antibody (Ser536 93H1, for Western blotting, Cell Signaling Technology), anti-FLAG M2 antibody (Sigma-Aldrich), anti-His tag antibody (#2365, Cell Signaling Technology), anti-phosphorylated PDGF Receptor β (Tyr1009) (42F9) rabbit monoclonal antibody (Cell Signaling Technology, #3124), anti-PDGF Receptor β antibody (#3169, Cell Signaling Technology) Jackson Immuno Research Laboratories (JACK IMMUNO Technology), peroxidase-labeled AffiniPure donkey anti-mouse IgG (H+L) antibody (715-035-150), peroxidase-labeled AffiniPure donkey anti-rabbit IgG (H+L) antibody (711-035-152), Jackson Immuno Research Laboratories, Alexa Fluor 488 goat anti-rabbit IgG (H+L) antibody (Invitrogen). Hoechst 33342 trihydrochloride trihydrate (Life Technologies) was used for nuclear staining.
[0080] Plasmid Preparation A human mephrin expression vector with a Flag tag was constructed according to the following method: Mephrin cDNA (encoding mature mephrin, consisting of amino acid sequences 19-428 of SEQ ID NO: 1) and pEF-BOS were treated with restriction enzymes and ligated at 16°C for 2 hours using ligation high buffer (version 2; Toyobo). The prepared vector was transfected into competent cells (Ecos DH5α; Nippon Gene) and incubated overnight at 37°C on a 100 mm diameter LB agar plate containing kanamycin (50 μg / mL). Colonies resulting from drug selection with kanamycin were picked and incubated overnight at 37°C in an incubator shaker (Eyla) in 100 mL of LB medium containing kanamycin (50 μg / mL). Plasmid DNA was extracted from the culture medium using the GenElute HP Plasmid Midiprep Kit (Sigma-Aldrich). The presence of the target fragment without unexpected mutations was confirmed by DNA sequencing using the BigDye Terminator kit, version 3.1 (Applied Biosystems).
[0081] - Stimulated cells were seeded into a 96-well plate (1 × 10⁻¹⁰ 4 Cells were cultured for 48 hours in Opti-MEM (Thermo Fisher Scientific, Waltham, MA). After 2 hours of serum starvation, the cells were stimulated for 3 hours with human IL-6 (30 ng / ml; R&D Systems) (or human soluble IL-6 receptor (30 ng / ml; R&D Systems) if the cells did not express the IL-6 receptor), human IL-17 (100 ng / mL; R&D Systems), human TNF-α (5 ng / ml unless otherwise specified; PeproTech), or recombinant human mephrine (100 ng / ml unless otherwise specified; Cat#:HRP-2936, LD Biopharma, Inc.), either alone or in combination.
[0082] • Gene Expression Analysis: The expression levels of target mRNA and internal control mRNA were quantified using the 7300 fast real-time PCR system (Applied Biosystems) and SYBR Green PCR master mix (Kapa Biosystems). For internal control mRNA, hypoxanthine phosphoribosyltransferase (HPRT) was used in mouse cell lines, and glycerol-3-phosphatase dehydrogenase (GAPDH) was used in human cell lines or human tissue samples. Total RNA was prepared from cells using the GenElute mammalian total RNA Kit and DNase I (Sigma-Aldrich). The PCR primer pairs used for real-time PCR are listed in Table 1. The real-time PCR conditions were 94°C, 15 seconds for 40 cycles, followed by 60°C, 60 seconds for 40 cycles. Relative mRNA expression levels were normalized to HPRT or GAPDH mRNA expression levels.
[0083] - Knockdown of Mephrin (shRNA) On day 1, MEF or HDF cells were cultured in 96-well flat-bottom plates (1000 cells per well) with 100 μL of DMEM containing 10% FBS. On day 2, the medium was replaced with DMEM containing 1 μL of shRNA-containing lentivirus, 10% FBS, and 8 μg / mL Polybrene. On day 3, 200 μL of DMEM containing 10% FBS and 5 μg / mL puromycin was added to each well. The shRNAs used are listed below: • MEF cell non-target shRNA (Sigma Mission SHC002V) Mouse mephrin shRNA-1 (TRCN0000099855, Sigma-Aldrich): Target sequence 5'- CCTGCCAATGTTCCGTCTTAA -3' (SEQ ID NO: 26) Mouse mephrin shRNA-2 (TRCN0000099856, Sigma-Aldrich): Target sequence 5'- CCACTTGCAGATCAATGACAA -3' (SEQ ID NO: 27) • HDF non-target shRNA (Sigma Mission SHC002V) Human mephrin shRNA-1 (shISLR sh#4): Target sequence 5'- AACTCAACCACAACCGCTT -3' (SEQ ID NO: 28) Human mephrin shRNA-2 (shISLR sh#2): Target sequence 5'- AGATCAACGAGAACCCCTT -3' (SEQ ID NO: 29)
[0084] - Luciferase reporter assay: Human mephrin cDNA (encoding mature mephrin consisting of amino acid sequences 19-428 of SEQ ID NO: 1) and a Flag tag were incorporated into a pEF-BOS vector to construct pEFBOS-Flag-Meflin. HEK293T cells, pre-transformed with pGL4.32[luc2P / NF-κB-RE / Hygro] (Promega), which has the firefly luciferase gene under the NFκB promoter, and the internal control, the sea urchin luciferase expression vector pGL4.32 (Promega), were transfected with either pEFBOS-Flag-Meflin or an empty vector using polyethyleneimine (PEI). After stimulating the cells with TNF-α (25 ng / ml) for 6 hours, they were harvested, and NF-κB promoter activity was evaluated by a luciferase reporter assay. The assay was performed using a Dual Luciferase Assay System (Promega) with a luminometer (GloMax®-Multi Detection System, Promega), and the luminescence intensity from the firefly luciferase reaction was corrected for the luminescence intensity from the sea urchin luciferase reaction.
[0085] - Cell drug treatment: HDF cells (approximately 80% confluent) were starved in Opti-MEM for 1 hour. Then, the cells were treated with the TNFR antagonist R-7050 (S6643, Selleck) or the PDGFR inhibitor Crenolanib (S2730, Selleck) for 1 hour, followed by stimulation with TNF-α (50 ng / ml), mephrine (300 ng / ml), or PDGFB (10 ng / ml) for 3 hours. Cells were lysed in RIPA buffer (50 mM Tris-HCl (pH 7.6), 150 mM NaCl, 1% Triton X-100, 0.5% Sodium Deoxycholate, 0.1% SDS) containing 1 / 100 volume of protease inhibitor and phosphatase inhibitor cocktails (Sigma-Aldrich). Subsequently, SDS-PAGE was performed, and proteins were transferred to polyvinylidene fluoride membranes (Merck Millipore). Immunoblotting was performed according to the manufacturer's protocol.
[0086] - Mephrin, TNFR, and TNF-α association assay (analysis by immunoblotting) Vectors were constructed by incorporating the full-length human mephrin, its N-terminal domain (positions 1-171 from the N-terminus), and its C-terminal domain (positions 239-428 from the N-terminus) cDNAs, along with a Flag tag, into a pEF-BOS vector. These vectors were then analyzed using 2 × 10⁻⁶ 6HEK293T cells from cells were transfected with PEI. After incubation for 48 hours, the cells were lysed in 500 μl of Buffer-B [20 mM Tris (pH 7.8), 100 mM KCl, 10% glycerol, 0.2% Triton X-100] containing 1 / 100 volume of protease inhibitor and phosphatase inhibitor cocktails (Sigma-Aldrich). The human TNF-α expression vector pD649-Hasp-TNF-Fc(DAPA)-AviTag-6xHis (156575, Addgene) and the human soluble TNFR expression vector pD649-Hasp-TNFR-Fc(DAPA)-AviTag-6xHis (156598, Addgene) were transfected into Expi293F suspension cells using the ExpiFectamine 293 Transfection Kit (Thermo Fisher Scientific). After 5 days of culture, the supernatant of these cells was collected and concentrated with Amicon Ultra 15 mL (UFC90102424). Furthermore, four plasmids (ΔCRD1, ΔCRD2, ΔCRD3, ΔCRD4) were prepared by deleting each CRD of TNFR from pD649-Hasp-TNFR-Fc(DAPA)-AviTag-6xHis, and the supernatants were prepared in the same manner. Cell lysates containing pre-clarified mephrine, supernatants containing TNFR or CRD-deleted TNFR, and supernatants containing TNF-α were incubated individually or in combination with anti-FLAG antibody-conjugated agarose beads (Sigma-Aldrich) at 4°C for 2 hours. After washing with Buffer-B, the immunoprecipitation was heated in SDS sample buffer at 95°C for 3 minutes and used for immunoblotting.
[0087] - Knockdown of Mephrin (siRNA, in vitro): 100 μl of serum-free Opti-MEM I medium and 6 pmol of siRNA double helix were placed in each well of a 24-well plate, followed by 1 μl of Lipofectamine RNAiMAX (Thermo Fisher Scientific). The mixture was gently mixed and incubated at room temperature for 15 minutes. HDF cells (4 × 10⁶) 4 500 μl of culture medium containing (cells) was added to each well, gently mixed, and incubated at 37°C and 5% CO2 for 48 hours. The final RNA concentration in each well was 10 nM. The siRNAs used were as follows: siRNA against human mephrine (1: sense strand sequence CUUCUAGACCUGCUCCAAAtt (SEQ ID NO: 30), 2: sense strand sequence GCAAAGCGGUUGAGGGAAAtt (SEQ ID NO: 31); Ambion), siRNA against human TNFRSF1A (Ambion 1: s14265, 2: s14266, 3: s14267), siRNA against human p65 (Ambion Silencer Select Validated siRNA: RELA s11915, Cat#4427038), and human non-targeted control siRNA (Ambion Silencer selected Negative Control #1 siRNA).
[0088] - Association assay of mephrin, TNFR, and TNF-α (analysis by biolayer interferometry (BLI)) The assay was performed at room temperature using the Octet K2 BLI system (Sartorius) in Tris-HCl buffer (50 mM Tris-HCl pH 8.0, 100 mM NaCl). First, the Octet HIS2 biosensor (Sartorius) was equilibrated in Tris-HCl buffer for at least 10 minutes. TNFR was immobilized on the sensor by immersing the HIS2 biosensor in a 50 nM TNFR (TNFR-SF1A-Fc(DAPA)-His×6 tag) solution for 60 seconds, and then the baseline was established by immersion in fresh Tris-HCl buffer for 120 seconds. Titration experiments were performed at 35°C with rotation at 1,000 g. The association of mephrin and TNFR was observed by immersing a TNFR-immobilized biosensor in a mephrin-containing solution in the presence of 500 ng / ml of TNF-α protein diluted in Tris-HCl buffer until equilibrium was reached, then immersing the biosensor in a fresh solution to dissociate it, and monitoring the dissociation rate. Association and dissociation under all different conditions were measured for 300 seconds at each step. Data analysis was performed on the buffer-subtracted data using the manufacturer's software, assuming a 1:1 binding model. Data acquisition was performed using Octet K2 data acquisition software.
[0089] Following the guidelines of the dermatitis model mouse paper (Kanemaru et al., Exp Dermatol 2015;24(6):436-42.; Morimura et al., J Dermatol Sci 2016;82(3):175-88.), an siRNA mixture (containing 2.8 μl of cream-based ointment (Johnson & Johnson) and 4.7 μl of 20 μM siRNA) was applied to the auricle of 6-week-old F759 mice (gp130F759 / F759 knock-in mice) (on days 0, 1, 2, and 3 of the study). The siRNAs used are as follows: • Control Dharmacon-001810-10-20 ON-TARGETplus Non-targeting Pool: Target sequences UGGUUUACAUGUCGACUAA (SEQ ID NO: 32), UGGUUUACAUGUUGUGUGA (SEQ ID NO: 33), UGGUUUACAUGUUUUCUGA (SEQ ID NO: 34), UGGUUUACAUGUUUUCCUA (SEQ ID NO: 35) • p65 (rela) Dharmacon-ON-TARGETplus SMARTpool siRNA pool from J-040776-05 to J-040776-08: Target sequences GCUCAAGAUCUGCCGAGUA (SEQ ID NO: 36), GGCAUGCGAUUCCGCUAUA (SEQ ID NO: 37), GGGAUGAGAUCUUCUUGCU (SEQ ID NO: 38), CCAGACCGCAGUAUCCAUA (SEQ ID NO: 39) • Meflin Dharmacon-ON-TARGETplus SMARTpool siRNA pool J-061610-09 to J-061610-12: Target sequences CUGCCAAUGUUCCGUCUUA (SEQ ID NO: 40), GAUGGACAGCAACGAGUUA (SEQ ID NO: 41), GCUGCUAUACGGUUGACAA (SEQ ID NO: 42), GUGCCGAAAGCUCUGUAAA (SEQ ID NO: 43). On days 1, 2, and 3 of the study, 2.5 μl of imiquimod (Beselna Cream 5%, Mochida Pharmaceutical), a Toll-like receptor 7 agonist, was applied to the same auricle to induce dermatitis. The degree of dermatitis was evaluated by measuring ear thickening using a microcaliper.
[0090] • Collagen antibody-induced arthritis model: Six-week-old Balb / C mice were intravenously administered a plasmid containing 75 μg of mouse mephrin cDNA (SEQ ID NO: 44) dissolved in 2,000 μL of PBS, and mephrin was expressed systemically by hydrodynamics. On the following day (day 1), arthritis was induced by intraperitoneal administration of 1.5 mg of anti-type II collagen antibody (Arthrogen-CIA antibody, Chondrex) or an isotype control. The severity of arthritis was determined on a scale of 0-3 (maximum 6 points) for each foot based on limitations in ankle joint mobility. The average value of 1 point for one ankle joint of each mouse was used. The mice were euthanized, and the entire ankle joint was dissected and examined. Mephrin in mouse serum was analyzed by Western blotting.
[0091] Immunohistochemical staining: Surgical specimens of rheumatoid arthritis and osteoarthritis (control) or joint specimens from arthritis models were embedded in paraffin and sectioned to a thickness of 5 μm. Sections were deparaffinized with xylene and dehydrated with ethanol. Antigen was recovered by heat using sodium citrate. Endogenous peroxidase activity was blocked with 3% H2O2. Processed sections were rinsed and blocked for 1 hour with goat serum in Tris-buffered saline - 0.1% tween (Vector Laboratories). Subsequently, sections were separated into anti-mephrin antibody and isotype control antibody. Each antibody was mixed at a ratio of 1 μl per 200 μl of blocking solution, and each was added to the sections for staining. The sections were incubated overnight at 4°C. After washing, secondary biotinylated anti-rabbit IgG antibody or anti-mouse IgG antibody (Vector Laboratories) was added. ImmPACT DAB Kit (Vector Laboratories) was used for antigen detection. The sections were also stained with hematoxylin and eosin. Quantitative analysis was performed using ImageJ software.
[0092] • Quantitative analysis of mephrin and ISLR2: Mephrin concentrations in serum and synovial fluid were measured using the ISLR ELISA Kit (antibodies-online.com), and ISLR2 concentrations were measured using the Human ISLR2 ELISA Kit (RayBiotech), according to the manufacturer's protocol.
[0093] Evaluation of anti-mephrin antibodies by BLI: Mephrin knockout mice were immunized with mephrin molecules, B cells were isolated, and anti-mephrin antibodies were prepared using standard methods. Experiments were then performed using the culture supernatant of hybridomas. First, anti-mephrin antibodies that significantly bound to mephrin molecules were selected using FACS with H4 cells that forcibly expressed mephrin molecules. Association assays of mephrin, TNFR, and TNF-α were then performed by BLI in the presence and absence of each anti-mephrin antibody.
[0094] • Statistical Analysis: Student's two-tailed t-test was used to analyze the differences between the two groups. One-way ANOVA using Dunnett's post hoc test was used for multiple comparisons. A p-value of less than 0.05 was considered statistically significant.
[0095] [Example 1. Enhancement of IL-6 Amplifier Activation by Mephrin] H4 cells were stimulated with 100, 200, or 300 ng / ml recombinant human mephrin, and the expression levels of IL-6 and CCL2 mRNA, which are indicators of IL-6 amplifier activation, were measured by real-time PCR. Mephrin increased the expression of IL-6 and CCL2 mRNA in a concentration-dependent manner (Figure 1). Furthermore, when HDF cells were stimulated with 100, 200, or 300 ng / ml recombinant human mephrin and IL-6, TNF-α, or IL-6+TNF-α, mephrin enhanced IL-6 amplifier activation induced by IL-6+TNF-α (Figure 2). Mephrin also enhanced IL-6 amplifier activation induced by IL-6+IL-17 in HDF cells (Figure 3).
[0096] When MEF cells treated with shRNA targeting mephrin were stimulated with IL-6, TNF-α (10 ng / ml), or IL-6 + TNF-α, mephrin expression levels decreased, and IL-6 mRNA expression levels also decreased during stimulation (Figure 4). Furthermore, in MEF cells treated with shRNA targeting mephrin, the expression level of CXCL1, an NF-κB target gene, also decreased, but no change was observed in STAT3 expression levels (Figure 5). Luciferase assays were performed using HEK293T cells transfected with 100 ng, 300 ng, or 1000 ng of human mephrin cDNA expression vector to evaluate NF-κB promoter activity. Forced expression of mephrin also improved NF-κB promoter activity (Figure 6). These results suggest that mephrin enhances IL-6 amplifier activation by activating the NF-κB pathway and is involved in inflammatory responses.
[0097] [Example 2. Involvement of TNF receptor in mephrin-induced enhancement of IL-6 amplifier activation] HDF cells were stimulated with TNF-α, mephrin, or PDGFB, and the cell lysates were subjected to immunoblotting to investigate the molecular mechanism of NF-κB pathway activation. Mephrin enhanced the phosphorylation of the NF-κB subunit p65 / RelA (Ser536), but this enhancement was suppressed in a concentration-dependent manner by the TNFR antagonist R-7050 (Figure 7, top). On the other hand, phosphorylation of platelet-derived growth factor receptor β (PDGFRB), which is known to be associated with mephrin, was not affected by mephrin (Figure 7, bottom).
[0098] Next, the association of mephrin, soluble TNFR, and TNF-α was analyzed using flag-tagged mephrin. Mephrin associated with both soluble TNFR and TNF-α, and the association between mephrin and soluble TNFR increased with the presence of TNF-α (Figure 8). Analysis of the association between soluble TNFR lacking any of CRD1-4 and the N-terminal and C-terminal domains of mephrin showed that the N-terminal domain of mephrin associated with CRD1 and CRD4 of TNFR (Figures 9 and 10). Furthermore, HDF cells transfected with siRNA against TNFR1 and p65, respectively, or with control siRNA, were stimulated with IL-6+TNF-α, or with mephrin (200 ng / ml) and IL-6+TNF-α. The increase in IL-6 mRNA upon IL-6+TNF-α stimulation by mephrin was suppressed by TNFR knockdown (Figure 11). Furthermore, the association of mephrin, soluble TNFR, and TNF-α was analyzed using the BLI method. The association of soluble TNFR and TNF-α increased in a mephrin concentration-dependent manner in the presence of mephrin (Figure 12). These results suggest that mephrin activates the NF-κB pathway via TNFR.
[0099] [Example 3. Effect of Mephrin Knockdown on Dermatitis] Imiquimod was applied to the auricle of mice to induce dermatitis, and the degree of dermatitis was evaluated by ear thickening after applying siRNA against mephrin. siRNA against mephrin, like siRNA against the NF-κB p65 subunit, suppressed the progression of imiquimod-induced dermatitis (Figure 13).
[0100] [Example 4. Effect of Mephrin Overexpression on Anti-Type II Collagen Antibody-Induced Arthritis] Mice into which mephrin cDNA was introduced by hydrodynamics were administered anti-type II collagen antibody to induce arthritis. Mephrin exacerbated arthritis (Figure 14, top). Serum mephrin concentration was elevated in mice into which mephrin cDNA was introduced, confirming systemic expression of mephrin (Figure 14, bottom).
[0101] Furthermore, immunohistochemical staining of synovial tissue showed that mephrin expression was elevated in synovial fibroblasts in mice treated with anti-type II collagen antibody compared to mice treated with control antibody (Figure 15).
[0102] [Example 5. Expression Analysis of Mephrin and ISLR2 in Patients with Inflammatory Diseases] Synovial tissue collected during surgery from patients with osteoarthritis (n = 11) and rheumatoid arthritis (n = 11) was immunostained, and mephrin expression was analyzed. Mephrin expression was increased in synovial fibroblasts of patients with rheumatoid arthritis (Figure 16). Mephrin in synovial fluid was also increased in patients with rheumatoid arthritis (Figure 17).
[0103] Figure 18 shows the results of quantifying mephrine and ISLR2 in serum from rheumatoid arthritis patients (disease activity low n = 14, moderate n = 4, severe n = 1, disease activity not evaluated n = 22) and healthy volunteers (n = 20), while Figure 19 shows the results of quantifying mephrine and ISLR2 in serum from SLE patients (n = 27) and healthy volunteers (n = 20). Disease activity in rheumatoid arthritis was assessed based on the Rheumatoid Arthritis Disease Activity Score DAS-28 and the Rheumatoid Arthritis Clinical Disease Activity Index. Serum mephrine concentrations were elevated in rheumatoid arthritis patients, particularly those with low disease activity, and in SLE patients compared to healthy volunteers. Figure 20 shows the results of adding 16 rheumatoid arthritis patients (disease activity not assessed), 16 SLE patients, and 6 healthy volunteers to the ISLR2 quantitative results shown in Figures 18 and 19 (total of rheumatoid arthritis patients n = 57, SLE patients n = 43, and healthy volunteers n = 26). Similar trends were observed as in Figures 18 and 19.
[0104] [Example 6. Acquisition and Activity Evaluation of Anti-Mephrin Antibodies] Antibody-producing hybridomas were obtained using the hybridoma method with human mature mephrin protein as the antigen. The culture supernatant of the hybridomas was analyzed by flow cytometry, and the association inhibitory activity of mephrin, soluble TNFR, and TNF-α was evaluated for 24 samples that showed binding affinity to mephrin using the BLI method. A total of 10 samples (culture supernatants of hybridomas No. 5H10, 5H4, 1E4, 1E7, 3G11, 4C1, 1D4, 1B3, 1B5, and 5G9) showed association inhibitory effects (Figure 21).
Claims
1. A pharmaceutical composition containing a mephrine inhibitor for the treatment or prevention of inflammatory diseases.
2. The pharmaceutical composition according to claim 1, wherein the mephrin inhibitor is a substance that can specifically bind to mephrin.
3. The pharmaceutical composition according to claim 2, wherein a substance that can specifically bind to mephrine inhibits the binding of mephrine to the TNF receptor.
4. The pharmaceutical composition according to claim 2, wherein a substance that can specifically bind to mephrine inhibits the binding of mephrine to TNF-α.
5. The pharmaceutical composition according to claim 1, wherein the mephrin inhibitor is a nucleic acid that suppresses the expression of mephrin.
6. The pharmaceutical composition according to claim 1, wherein the inflammatory disease is a disease that causes NF-κB-dependent inflammation.
7. The pharmaceutical composition according to claim 1, wherein the inflammatory disease is rheumatoid arthritis, systemic lupus erythematosus, or psoriasis.
8. A method for evaluating the inhibitory effect of a test substance on IL-6 amplifier activation enhancement, using the reduction of mephrine-induced enhancement of NF-κB signaling activation in non-immune cells expressing TNF receptors and positive for type I collagen, in the presence of STAT3-stimulating and NF-κB-stimulating factors.
9. The method according to claim 8, wherein the STAT3 stimulating factor includes IL-6.
10. The method according to claim 8, wherein the NF-κB stimulator comprises at least one of TNF-α and IL-17.
11. A method for evaluating the inhibitory effect of a test substance on IL-6 amplifier activation enhancement, using the reduction in binding affinity to mephrine, TNF-α, and TNF receptors as an indicator.
12. A method for evaluating the inhibitory effect of a test substance on enhancing IL-6 amplifier activation, using the suppression of mephrine expression as an indicator.
13. Use of mephrine or ISLR2 as a biomarker for inflammatory diseases.
14. The use according to claim 13, wherein the inflammatory disease is a disease that causes NF-κB-dependent inflammation.
15. The use according to claim 13, wherein the inflammatory disease is rheumatoid arthritis, systemic lupus erythematosus, or psoriasis.
16. A diagnostic test kit for inflammatory diseases, comprising a substance capable of specifically binding to the mephrin protein or ISLR2 protein.
17. A diagnostic test kit for inflammatory diseases comprising a primer set for amplifying the reverse transcript of ISLR mRNA or ISLR2 mRNA.
18. A diagnostic test kit for inflammatory diseases, comprising a probe for detecting the reverse transcript of ISLR mRNA or ISLR2 mRNA.