Bifidobacterium longum subsp. longum LBMB322020 strain having excellent body fat-reducing, blood sugar-improving, and muscle function-strengthening activity, and composition for preventing, alleviating, or treating metabolic diseases comprising same

Abstract

The present invention relates to an LBMB322020 strain having excellent body fat-reducing, blood sugar-reducing, and muscle function-strengthening activity, and a composition for preventing, alleviating, or treating metabolic diseases, wherein the composition includes the LBMB322020 strain. The present invention not only exhibits the excellent effects of reducing body weight and improving metabolic indicators in blood in obesity induced by a high fat and / or high carbohydrate diet, but also exhibits excellent improvement effects, due to regulation of related gene expression, for metabolic diseases, such as diabetes, fatty liver, and dyslipidemia, muscle function disorder, and inflammatory bowel disease caused by obesity induction, and thus can be usefully used for preventing, alleviating, or treating metabolic diseases such as obesity and hyperglycemia.

Description

Bifidobacterium longum subspecies longum LBMB322020 strain having excellent activity for reducing body fat, improving blood sugar, and enhancing muscle function, and a composition for preventing, improving, or treating metabolic diseases containing the same

[0001] The present invention relates to a strain of Bifidobacterium longum subspecies longum LBMB322020 with excellent activity for reducing body fat, improving blood sugar, and enhancing muscle function, and a composition for preventing, improving, or treating metabolic diseases containing the same.

[0002] Obesity is defined as an abnormality in energy metabolism caused by an imbalance between energy intake and expenditure, resulting in the excessive accumulation of triglycerides in fat cells. Obesity is a chronic disease posing a global problem, and associations with various conditions such as type 2 diabetes, cardiovascular disease, osteoarthritis, certain cancers, sleep apnea, asthma, and non-alcoholic fatty liver disease have been reported. To treat such obesity, various anti-obesity drugs have been developed. Obesity treatments developed to date are broadly classified into appetite suppressants and lipolysis inhibitors; recently, an anti-obesity drug belonging to the GLP-1 receptor agonist class received FDA approval.

[0003] While appetite suppressants offer the advantage of excellent weight loss efficacy, they operate by acting on the central nervous system to reduce food intake by suppressing appetite. Consequently, long-term use presents problems such as reduced effectiveness due to tolerance or the induction of serious side effects. Lipolysis inhibitors exert anti-obesity effects through a mechanism that reduces the absorption of triglycerides and cholesterol while promoting their excretion by inducing the inactivation of pancreatic lipase—a pancreatic lipase responsible for breaking down triglycerides—through irreversible binding. However, despite these benefits, they cause side effects such as abdominal pain, diarrhea, and inhibition of fat-soluble vitamin absorption, and severe liver damage has been reported with long-term use. Furthermore, GLP-1 receptor agonists pose a problem due to gastrointestinal side effects such as indigestion, flatulence, diarrhea, nausea, or vomiting, and, most seriously, can be associated with pancreatitis.

[0004] Due to such side effects, there is a very high social demand for obesity treatments that can effectively treat obesity without side effects. Consequently, various studies are being conducted worldwide to develop obesity treatments that can cure obesity without side effects, but no such treatment has been reported to date.

[0005] Meanwhile, lactic acid bacteria play a role in coexisting in the human digestive system, breaking down fiber and complex proteins to convert them into important nutrients. Thus, live microorganisms that improve the host's intestinal microbial environment within the gastrointestinal tract of animals, including humans, and thereby have a beneficial effect on the host's health are collectively referred to as probiotics. Although research on the anti-obesity functionality utilizing such probiotics has been conducted, no commercially successful strains based on sufficient anti-obesity efficacy have yet been reported. Furthermore, no strains are known to possess improvement effects not only on obesity but also on various metabolic diseases such as hyperglycemia.

[0006] Accordingly, the inventors conducted research to develop a strain that possesses not only an anti-obesity effect but also an improvement effect on various metabolic diseases, and can be effectively utilized for the improvement of obesity and various metabolic diseases associated with obesity, thereby completing the present invention.

[0007] One objective of the present invention is to provide a strain of Bifidobacterium longum subsp. longum (accession number: KCTC 16211BP) which has excellent activity for reducing body fat, improving blood sugar, and enhancing muscle function.

[0008] Another objective of the present invention is to provide a food composition for preventing or improving metabolic diseases comprising the strain, its culture, its lysate, its extract, or its dead cells as an active ingredient.

[0009] Another objective of the present invention is to provide a pharmaceutical composition for the prevention or treatment of metabolic diseases comprising the strain, its culture, its lysate, its extract, or its dead cells as an active ingredient.

[0010] Another object of the present invention is to provide a method for preventing or treating a metabolic disease comprising the step of administering the strain, its culture, its lysate, its extract, or its dead cells to a subject.

[0011] One aspect of the present invention provides a strain of Bifidobacterium longum subsp. longum (accession number: KCTC 16211BP) which has excellent activity for reducing body fat, improving blood sugar, and enhancing muscle function.

[0012] Another aspect of the present invention provides a food composition for preventing or improving metabolic diseases comprising the strain, its culture, its lysate, its extract, or its dead cells as an active ingredient.

[0013] According to one embodiment of the present invention, the metabolic disease may be obesity or hyperglycemia.

[0014] According to one embodiment of the present invention, the obesity may be accompanied by one or more diseases selected from the group consisting of diabetes, fatty liver, dyslipidemia, muscle damage caused by a high-fat or high-carbohydrate diet, and inflammatory bowel disease.

[0015] Another aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of metabolic diseases comprising the strain, its culture, its lysate, its extract, or its dead cells as an active ingredient.

[0016] According to one embodiment of the present invention, the strain can be administered orally.

[0017] According to one embodiment of the present invention, the metabolic disease may be obesity or hyperglycemia.

[0018] According to one embodiment of the present invention, the obesity may be accompanied by one or more diseases selected from the group consisting of diabetes, fatty liver, dyslipidemia, muscle damage caused by a high-fat or high-carbohydrate diet, and inflammatory bowel disease.

[0019] Another aspect of the present invention provides a method for preventing or treating a metabolic disease, comprising the step of administering the strain, its culture, its lysate, its extract, or its dead cells to a subject.

[0020] According to the Bifidobacterium longum subspecies longum LBMB322020 strain, which exhibits excellent activity for reducing body fat, improving blood sugar, and enhancing muscle function, and the composition for preventing, improving, or treating metabolic diseases containing the same, not only does it show excellent weight loss and improvement effects on metabolic indicators in the blood in obesity induced by a high-fat and / or high-carbohydrate diet, but it can also show excellent improvement effects on metabolic diseases such as diabetes, fatty liver, and dyslipidemia caused by obesity, as well as muscle function and inflammatory bowel disease, through the regulation of related gene expression, so it can be usefully utilized for the prevention, improvement, or treatment of metabolic diseases such as obesity and hyperglycemia.

[0021] Figure 1 is a graph showing the effects of dead cells of the Bifidobacterium longum subspecies longum LBMB322020 strain on lipid metabolism, insulin signaling, dietary regulation, and IL-22 gene expression in differentiated preadipocytes.

[0022] Figure 2 is a graph showing the effects of the Bifidobacterium longum subspecies longum LBMB322020 strain on body weight, food intake, visceral fat weight, and white adipose tissue weight in an animal model of high-fat diet-induced obesity.

[0023] Figure 3 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the serum concentrations of ALT (alanine aminotransferase) and AST (Aspartate aminotransferase), which are blood indicators in an animal model of obesity induced by a high-fat diet.

[0024] Figure 4 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the expression levels of Ampk, Akt2, Irs2, Pgc1a, Ucp1, and Cpt1 in liver tissue and liver tissue of an animal model of high-fat diet-induced obesity.

[0025] Figure 5 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the expression levels of Akt2, Pgc1α, Ucp1, Pparγ, Srebpf1c, and Adiponectin in white adipose tissue and white adipose tissue of an animal model of high-fat diet-induced obesity.

[0026] Figure 6 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the expression levels of Zo-1, Ocludin, Gpr43, and Il-22 in the small intestine tissue and small intestine tissue of an animal model of high-fat diet-induced obesity.

[0027] Figure 7 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the expression levels of Ampk, Pgc1a in liver tissue and Pgc1a in white adipose tissue of an animal model of high-fat diet-induced obesity.

[0028] Figure 8 is a graph showing the effects of the Bifidobacterium longum subspecies longum LBMB322020 strain on body weight and dietary intake in an animal model of obesity induced by a high-fat and high-carbohydrate diet.

[0029] Figure 9 is a graph showing the liver weight, epididymal adipose tissue (Epi), visceral fat (Vis) weight, white adipose tissue (WAT) weight, brown adipose tissue (BAT) weight, and the ratio of brown adipose tissue to white adipose tissue in an animal model of obesity induced by a high-fat and high-carbohydrate diet using the Bifidobacterium longum subspecies longum LBMB322020 strain.

[0030] Figure 10 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the serum concentrations of triglycerides (TG), total cholesterol (TC), ALT, AST, glucose, HDL, LDL, and GLP-1, and the glycated hemoglobin (HbA1c) content of blood indicators in an animal model of obesity induced by a high-fat and high-carbohydrate diet.

[0031] Figure 11 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the expression levels of Ampk, Pparα, Cpt1, Pparγ, and Il-22 in liver tissue of animal models induced by high-fat and high-carbohydrate diets.

[0032] Figure 12 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the expression levels of Ampk and Akt2 in white adipose tissue of animal models induced by high-fat and high-carbohydrate diets.

[0033] Figure 13 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the expression levels of Pgc1α, Ampk, and Ucp1 in brown adipose tissue of animal models induced by high-fat and high-carbohydrate diets.

[0034] Figure 14 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the expression levels of Zo-1 and Ocludin in small intestine tissues of animal models induced by high-fat and high-carbohydrate diets.

[0035] Figure 15 is a graph showing the effect of the Bifidobacterium longum subspecies longum LBMB322020 strain on the expression levels of Ampk and Pgc1a in the liver, brown adipose tissue, and white adipose tissue of an animal model of obesity induced by a high-fat and high-carbohydrate diet.

[0036] One aspect of the present invention provides a strain of Bifidobacterium longum subsp. longum (accession number: KCTC 16211BP) which has excellent activity for reducing body fat, improving blood sugar, and enhancing muscle function.

[0037] The Bifidobacterium longum subspecies longum LBMB322020 strain according to the present invention was isolated from the feces of Korean infants and was deposited at the National Institute of Biological Resources of the Korea Research Institute of Biotechnology and Bioengineering on December 20, 2024 (Accession No.: KCTC 16211BP).

[0038] The Bifidobacterium longum subspecies longum LBMB322020 strain of the present invention is an anaerobic bacterium and is a rod-shaped Gram-positive strain. Lactic acid bacteria of the genus Bifidobacterium are widely found in the human intestine and are known to play an important role in maintaining gastrointestinal health, and the Bifidobacterium longum subspecies longum LBMB322020 strain of the present invention also possesses the general intestinal regulating effect and immune-enhancing effect of lactic acid bacteria.

[0039] The Bifidobacterium longum subspecies longum LBMB322020 strain of the present invention can survive even in a low pH environment and can survive to the intestines even when ingested orally.

[0040] When the Bifidobacterium longum subspecies longum LBMB322020 strain of the present invention is included in a food composition or a pharmaceutical composition, it may exist as a live cell or a dead cell, or it may exist in a dried or freeze-dried form. Forms of lactic acid bacteria suitable for inclusion in various compositions and formulation methods are well known to those skilled in the art. For example, the Bifidobacterium longum subspecies longum LBMB322020 strain may be formulated in the form of a culture obtained by culturing in a known liquid or solid medium, a fermented product obtained by culturing the strain together with additional components, an extract obtained by extracting the strain with an organic solvent, or a lysate (or lysate) obtained by lysing, crushing, or homogenizing the cell membrane of the strain.

[0041]

[0042] Another aspect of the present invention provides a food composition for preventing or improving metabolic diseases comprising the strain, its culture, its lysate, its extract, or its dead cells as an active ingredient.

[0043] The food composition of the present invention may be prepared as a health functional food in the form of, for example, tablets or capsules, or as a food in the form of a beverage, seasoning, bar, fermented milk, etc. In this case, the food composition of the present invention may include ingredients that are typically added during the manufacture of health functional foods or food, and may include, for example, proteins, carbohydrates, fats, nutrients, seasonings, and flavorings. Examples of carbohydrates may be monosaccharides, e.g., glucose, fructose, etc.; disaccharides, e.g., maltose, sucrose, oligosaccharides, etc.; and polysaccharides, such as conventional sugars like dextrin, cyclodextrin, etc., and sugar alcohols such as xylitol, sorbitol, erythritol, etc. As flavorings, natural flavorings [taumatin, stevia extract (e.g., rebaudioside A, glycyrrhizin, etc.)] and synthetic flavorings (saccharin, aspartame, etc.) may be used.

[0044] For example, when the food composition of the present invention is manufactured as a drink, in addition to the composition of the present invention, citric acid, liquid fructose, sugar, glucose, acetic acid, malic acid, fruit juice, Eucommia ulmoides extract, jujube extract and / or licorice extract may be additionally included.

[0045] In addition, the food composition of the present invention may contain various nutritional agents, vitamins, minerals (electrolytes), flavoring agents such as synthetic flavoring agents and natural flavoring agents, coloring agents and thickening agents (cheese, chocolate, etc.), pectic acid and its salts, alginic acid and its salts, organic acids, protective colloidal thickeners, pH adjusters, stabilizers, preservatives, glycerin, alcohol, carbonating agents used in carbonated beverages, etc.

[0046] Additionally, when the food composition of the present invention is formulated in the form of tablets or capsules, the strain of the present invention, its culture, its lysate, its extract, or its dead cells may be bound to an oral, non-toxic, pharmaceutically acceptable inert carrier such as ethanol, glycerol, water, etc. Additionally, if desired or necessary, suitable binders, lubricants, disintegrants, and colorants may also be included in the mixture. Suitable binders may be, for example, natural sugars such as starch, gelatin, glucose, or beta-lactose; corn sweeteners; natural and synthetic gums such as acacia, trackercanth, or sodium oleate; sodium stearate; magnesium stearate; sodium benzoate; sodium acetate; sodium chloride, etc. Disintegrants may be starch, methylcellulose, agar, bentonite, xanthan gum, etc. In addition, diluents, dispersants, surfactants, binders, and / or lubricants may be additionally added.

[0047] These ingredients may be used independently or in combination, and the proportion of these additives may be selected in the range of 0 to about 20 parts by weight per 100 parts by weight of the health functional food of the present invention, but is not limited thereto.

[0048] According to one embodiment of the present invention, the culture may be cultured under anaerobic conditions.

[0049] According to one embodiment of the present invention, the metabolic disease may be obesity or hyperglycemia.

[0050] According to one embodiment of the present invention, the obesity may be accompanied by one or more diseases selected from the group consisting of diabetes, fatty liver, dyslipidemia, muscle damage caused by a high-fat or high-carbohydrate diet, and inflammatory bowel disease.

[0051] The Bifidobacterium longum subspecies longum LBMB322020 strain of the present invention exhibits excellent improvement effects through the regulation of related gene expression for metabolic diseases such as diabetes, fatty liver, muscle damage caused by a high-fat or high-carbohydrate diet and / or dyslipidemia caused by obesity induction, and inflammatory bowel disease; therefore, it can be usefully utilized for the prevention or improvement of obesity or hyperglycemia accompanied by diabetes, fatty liver, muscle damage caused by a high-fat or high-carbohydrate diet, dyslipidemia and / or inflammatory bowel disease.

[0052]

[0053] Another aspect of the present invention provides a pharmaceutical composition for the prevention or treatment of metabolic diseases comprising the strain, its culture, its lysate, its extract, or its dead cells as an active ingredient.

[0054] The composition of the present invention may include a pharmaceutically acceptable carrier. The pharmaceutically acceptable carrier included in the composition of the present invention is one commonly used in the manufacture of pharmaceuticals and includes, but is not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, starch, acacia gum, calcium phosphate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, methyl cellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and mineral oil. In addition to the above components, the pharmaceutical composition of the present invention may further include lubricants, humectants, sweeteners, flavorings, emulsifiers, suspending agents, preservatives, etc. Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington: the science and practice of pharmacy 22nd edition (2013).

[0055] A pharmaceutical composition according to one embodiment of the present invention may be administered together with a substance that exhibits activity against one or more metabolic diseases.

[0056] In addition, a pharmaceutical composition according to one embodiment of the present invention may be used alone or in combination with methods using procedures, hormone therapy, drug therapy and / or biological response modulators for the prevention or treatment of metabolic diseases.

[0057] The composition of the present invention may include various bases and / or additives that are necessary and appropriate for the formulation of the formulation, and may be prepared by further including known compounds such as nonionic surfactants, silicone polymers, extender pigments, fragrances, preservatives, fungicides, oxidation stabilizers, organic solvents, ionic or nonionic thickeners, emollients, antioxidants, free radical destroyers, opacifiers, stabilizers, emollients, silicones, α-hydroxy acids, defoaming agents, moisturizers, vitamins, insect repellents, fragrances, preservatives, surfactants, anti-inflammatory agents, substance P antagonists, fillers, polymers, propellants, basicizing or acidifying agents, or coloring agents, to the extent that the effect is not reduced.

[0058] Suitable dosages of the composition of the present invention may be prescribed in various ways depending on factors such as the formulation method, mode of administration, age, body weight, sex, pathological condition, food, time of administration, route of administration, excretion rate, and response sensitivity. The dosage of the composition of the present invention may be 0.001 to 1000 mg / kg based on an adult.

[0059] According to one embodiment of the present invention, the route of administration of the composition may be oral administration, intravenous administration, intraperitoneal administration, intramuscular administration, subcutaneous administration, intradermal administration, local administration, nasal administration, pulmonary administration, or rectal administration.

[0060] The composition of the present invention may be administered orally or parenterally.

[0061] According to one embodiment of the present invention, the strain can be administered orally.

[0062] The composition of the present invention may be administered in various formulations when administered orally, such as tablets, pills, hard / soft capsules, liquids, suspensions, emulsifiers, syrups, granules, elixirs, troches, etc., and may further include various excipients, such as humectants, sweeteners, flavorings, preservatives, etc. Specifically, when the composition of the present invention is formulated into an oral administration formulation, it may further include suitable carriers, excipients, and diluents commonly used in its manufacture. The above carrier, excipient, and diluent may include, but are not limited to, lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, and / or mineral oil. Additionally, it may be prepared by including diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants that are commonly used in formulations, and may further include a lubricant such as magnesium stearate or talc in addition to the above excipients.

[0063] The composition of the present invention may be administered parenterally, and may be administered, for example, by subcutaneous injection, intravenous injection, or intramuscular injection, but is not limited thereto.

[0064] Formulation into a parenteral administration formulation may, for example, be prepared by mixing the composition of the present invention with water together with a stabilizer or a buffer to form a solution or suspension, and then preparing the composition in ampoule or vial units. Additionally, the composition may be sterile and may further include adjuvants such as preservatives, stabilizers, hydrating agents or emulsification promoters, salts and buffers for osmotic pressure regulation, and other therapeutically useful substances, and may be formulated by conventional methods.

[0065] These compositions may be presented in unit-dose (single dose) or multi-dose (multiple doses) containers, e.g., sealed ampoules and vials, and may be stored under freeze-drying conditions requiring only the addition of a sterile liquid carrier, e.g., water for injection, immediately before use. Ready-to-use preparations and suspensions may be prepared from sterile powders, granules, and tablets.

[0066] According to one embodiment of the present invention, the metabolic disease may be obesity or hyperglycemia.

[0067] According to one embodiment of the present invention, the obesity may be accompanied by one or more diseases selected from the group consisting of diabetes, fatty liver, dyslipidemia, muscle damage caused by a high-fat or high-carbohydrate diet, and inflammatory bowel disease.

[0068] According to one embodiment of the present invention, the composition comprises 5×10 strains 3 Up to 5×10 12 It may contain CFUs / mL.

[0069] The amount of the Bifidobacterium longum subspecies longum LBMB322020 strain included in the composition according to the present invention is 5×10 based on a single administration 3 Up to 5×10 12 It can be CFUs / mL, for example, 5×10 3 Up to 5×10 8 CFUs / mL, 5×10 4 Up to 5×10 9 It may be in CFUs / mL. When administering the strain, it is preferable to administer it in a live state, but it may be administered in a killed or attenuated state prior to ingestion. Additionally, when preparing using culture supernatants, an additional sterilization process through heat treatment may be performed. The amount of strain required to achieve minimum efficacy and the daily intake level may vary depending on the physical or health condition of the ingestor.

[0070] Another aspect of the present invention provides a method for preventing or treating a metabolic disease, comprising the step of administering the strain, its culture, its lysate, its extract, or its dead cells to a subject.

[0071] The strain, culture thereof, lysate thereof, extract thereof, or inactivated cell thereof of the present invention may be administered orally as intended, in an amount effective for the treatment or prevention of an individual or patient. It should be understood that the dosage for a specific individual or patient should be determined based on various relevant factors such as the patient's body weight, age, race, gender, health status, diet, time of administration, method of administration, and severity of the disease, and may be appropriately adjusted by a professional. For example, a physician may start the dosage of the strain, culture thereof, lysate thereof, extract thereof, or inactivated cell thereof of the present invention at a level lower than that required to achieve the desired therapeutic effect, and gradually increase the dosage until the desired effect is achieved, and may easily determine and prescribe the dosage as needed.

[0072] The present invention will be explained in more detail below through one or more embodiments. However, these embodiments are intended to illustrate the invention and the scope of the invention is not limited to these embodiments.

[0073]

[0074] Example 1. Isolation and identification of human-derived probiotic strains

[0075] Human-derived probiotic strains were isolated and identified to select strains with excellent activity in reducing body fat and blood sugar.

[0076] Specifically, probiotic strains were isolated from the feces of Korean infants, cultured in an anaerobic chamber using BSM broth (Bifidus selective medium) supplemented with BMS supplement medium as a selective medium, and the strains were isolated.

[0077] As a result of analyzing the 27F-1492R sequence of the isolated strain (Table 1), the isolated strain was identified as Bifidobacterium longum subsp. longum; the strain was named Bifidobacterium longum subsp. longum LBMB322020 and deposited at the National Center for Biological Resources of the Korea Research Institute of Biotechnology and Bioengineering (KCTC 16211BP).

[0078]

[0079] Primer Name Nucleic Acid Sequence (5'→3') Sequence Number 27FAGAGTTTGATCMTGGCTCAG Sequence Number 11492RTACGGYTACCTTGTTACGACTT Sequence Number 2

[0080]

[0081] Example 2. Preparation of an inactivated strain of Bifidobacterium longum subspecies longum LBMB322020

[0082] In order to evaluate the body fat reduction, blood sugar improvement, and muscle function enhancement activities of the Bifidobacterium longum subspecies longum LBMB322020 strain isolated and identified in Example 1, it was prepared as a dead cell.

[0083] Specifically, the strain *Bifidobacterium longum* subspecies *longum* LBMB322020* was anaerobically cultured in BSM broth for 24 hours, followed by centrifugation at 4,500 rpm for 10 minutes at 4°C to remove the supernatant and isolate the cells. Subsequently, the washing and centrifugation processes were repeated twice using PBS (phosphate buffered saline, Welegen, Korea), after which the washed cells were incubated in an 80°C water bath for 30 minutes to kill the bacteria. Finally, the number of killed colonies was measured using TCC (Total Count Colony), and 1×10⁶ 11 It was prepared at a concentration of CFU / mL.

[0084]

[0085] Example 3. Confirmation of the body fat and blood glucose reduction effects of the Bifidobacterium longum subspecies longum LBMB322020 strain through gene expression analysis of differentiated preadipocytes

[0086] To confirm the body fat and blood glucose reduction effects of the Bifidobacterium longum subspecies longum LBMB322020 strain, differentiated preadipocytes were treated with dead cells of the Bifidobacterium longum subspecies longum LBMB322020 strain prepared in Example 2, and then the expression rates of genes related to lipid metabolism, insulin signaling, dietary regulation, and the IL-22 pathway were analyzed.

[0087] Specifically, 3T3-L1 preadipocytes purchased from KCTC were prepared by inoculating them into a basal medium supplemented with heat-treated 10% BCS (Bovine calf serum, Gibco, USA) and 100 μg / mL penicillin / streptomycin (Antibiotic-antimycotic, Gibco, 15240062) in DMEM (Dulbecco's modified Eagle's medium, Hyclone, USA, SH30243.01) and culturing in a CO2 incubator at 37°C. Subsequently, the prepared 3T3-L1 preadipocytes were cultured at a rate of 1 × 10⁶ 5Cells were distributed into a 48-well plate at a cell / well concentration and differentiation was induced.

[0088] To induce differentiation of 3T3-L1 preadipocytes, a differentiation medium was used in which differentiation-inducing substances—1 μM dexamethasone (Sigma-Aldrich, USA, D4902), 0.5 mM 3-isobutyl-1-methylxanthine (Sigma-Aldrich, USA, I5879), and 10 μg / mL insulin (Sigma-Aldrich, USA, I0516)—were added to the above basal medium. When replacing the basal medium with the differentiation medium, 1 × 10⁶ dead cells of the Bifidobacterium longum subspecies longum LBMB322020 strain were used. 9 They were treated together at a concentration of CFUs / mL and cultured in a CO2 incubator for 72 hours. After 3 days, the differentiation medium was replaced with a post-differentiation medium prepared by adding 10% BCS and 10 μg / mL insulin to DMEM, and cultured for 6 days, during which the post-differentiation medium was replaced every 48 hours.

[0089] After treating 3T3-L1 preadipocytes with inactivated cells of the Bifidobacterium longum subspecies longum LBMB322020 strain, differentiation was induced over a total of 9 days. Subsequently, the supernatant was removed, and RNA was isolated using Trizol Reagent (15596018, Invitrogen, USA). The concentration of the isolated RNA was measured using a Multiskan™ SkyHigh microplate reader (Thermo Scientific, USA). Additionally, cDNA was synthesized from the isolated RNA using a cDNA synthesis kit (FSQ-101, TOYOBO, Japan), and then qRT-PCR was performed using the primers in Table 2 according to the protocol of SYBR Green Master Mix (DYRT1202, Dynebio, Korea) (Fig. 3).

[0090]

[0091] Primer Name Nucleic Acid Sequence (5'→3') Sequence Number GAPDHforwardCAAGTTCAACGGCACAGTCAAGG Sequence Number 3 reverseACATACTCAGCACCAGCATCACC Sequence Number 4PPARγforwardCCTGAACATCGAGTGTCGAATAT Sequence Number 5 reverseGGTCTTCTTCTGAATCTTGCAGCT Sequence Number 6PGC1aforwardAAGTGTGGAACTCTCTGGAACTG Sequence Number 7 reverseGGGTTATCTTGGTTGGCTTTATG Sequence Number 8SREBPF1CforwardTAGTCCGAAGCCGGGTGGGCCGCGCCAT Sequence Number 9 reverseGATGTCGTTCAAAACCGCTGTGTGTCCAGTTC Sequence Number 10CPT1forwardATCTGGATGGCTATGGTCAAGGTC Sequence Number 11 reverseGTGCTGTCATGCGTTGGAAGTC Sequence Number 12UCP1forwardAGATCTTCTCAGCCGGAGTTT Sequence No. 13reverseCTGTACAGTTTCGGCAATCCT Sequence No. 14PPARαforwardCCTGAACATCGAGTGTCGAGCA Sequence No. 15reverseGGTCTTCTTCTGAATCTTGCAGCT Sequence No. 16LeptinforwardCTCCAAGGTTGTCCAGGGTT Sequence No. 17reverseAAAACTCCCCACAGAATGGG Sequence No. 18AdiponectinforwardGCACTGGCAAGTTCTACTGCAA Sequence No. 19reverseGTAGGTGAAGAGAACGGCCTTGT Sequence No. 20GLP1RforwardATCTGGATGGCTATGGTCAAGGTC Sequence No. 21reverseTTGTAGCACACTACTGGCCC Sequence No. 22IL-6forwardAGTTGCCTTCTTGGGACTGA Sequence No. 23 reverseCAGAATTGCCATTGCACAAC Sequence No. 24 IL-1β forwardTGGACCTTCCAGGATGAGGACA Sequence No. 25 reverseGTTCATCTCGGAGCCTGTAGTG Sequence No. 26 TNFα forwardGGTGCCTATGTCTCAGCCTCTT Sequence No.27reverseGCCATAGAACTGATGAGAGGGAG Sequence No. 28IL-22forwardCGATCTCTGATGGCTGTCCT Sequence No. 29reverseACGCAAGCATTTCTCAGAGA Sequence No. 30IL-22RforwardGCTCGCTGCAGCACACTACCA Sequence No. 31reverseTCTGTGTCGGGAGTCAGGCCA Sequence No. 32ZO-1forwardCCCCTCTGTCCAGCTCTTC Sequence No. 33reverseCACCGGAGTGATGGTTTTCT Sequence No. 34OcclaudinforwardCCTCCAATGGCAAAGTGAAT Sequence No. 35reverseCTCCCCACCTGTCGTGTAGT Sequence No. 36Muc2forwardATGCCCACCTCCTCAAAGAC Sequence No. 37reverseGTAGTTTCCGTTGGAACAGTGAA Sequence No. 38Reg3rforwardGCTCCTATTGCTATGCCTTGTTTAG Sequence No. 39reverseCATGGAGGACAGGAAGGAAGC Sequence No. 40Akt2forwardACGTGGTGAATACATCAAGACC Sequence No. 41reverseACCCAATGAAAGATCCATCACTC Sequence No. 42AMPKforwardAAGATCGGACATACGTCCTG Sequence No. 43reverseTGCCACTTTATGGCCTGTCAA Sequence No. 44IRS2forwardTCTACACCCGAGACGAACACT Sequence No. 45reverseTGGGCCTTTGCCCGATTATG Sequence No. 46

[0092]

[0093] As a result, it was confirmed that the expression of the lipid synthesis factor Srebpf1c was significantly decreased, while the expression of the lipid oxidation and thermogenesis factors Pgc1α, Pparα, Cpt1, and Ucp1 was significantly increased. In addition, it was confirmed that the expression of insulin signaling-related genes Ampk and Glp1r increased, and the expression of the dietary regulation-related gene Adiponectin and the IL-22 pathway-related gene Il-22 significantly increased (Fig. 1).

[0094] Through these results, it was confirmed that the Bifidobacterium longum subspecies longum LBMB322020 strain can be used for anti-obesity purposes because it can inhibit fat accumulation in adipocytes by inhibiting fat synthesis factors and activating thermogenesis and fatty acid oxidation factors. In addition, it was confirmed that the Bifidobacterium longum subspecies longum LBMB322020 strain can be used for the prevention or treatment of metabolic diseases such as diabetes, fatty liver, obesity, and dyslipidemia because it can activate the expression of insulin signaling-related genes, diet regulation genes, and IL-22.

[0095]

[0096] Example 4. Confirmation of the body fat reduction effect of the Bifidobacterium longum subspecies longum LBMB322020 strain in a high-fat diet animal model

[0097] 4-1. Animal Models and Experimental Design

[0098] 5-week-old C57BL / 6J male animals were used for the experiment, and the experimental groups were established as a normal diet group (ND), a 60% high-fat diet group (HFD), and a probiotics-treated group (HFD-treated with probiotics group). A 60% high-fat diet (Saeronbio Inc., D12492) was used for the high-fat diet, and for the probiotics-treated group, 1 × 10⁶ inactivated cells of the Bifidobacterium longum subspecies longum LBMB322020 strain prepared in Example 2 were administered daily along with the high-fat diet. 9 It was administered orally at a dose of CFUs / 200 µl.

[0099] During the 8-week experiment, body weight was measured once a week and food intake was measured twice a week. Once the 8-week experiment was completed, the experimental animals were allowed to fast for 18 hours, after which blood was collected, dissected, and used in the experiment.

[0100]

[0101] 4-2. Analysis of Hepatotoxicity Markers in Blood

[0102] The blood obtained in Example 4-1 was centrifuged (LABOGENE, USA) at 10,000 rpm for 15 minutes using a heparin-coated tube (BD, USA), and the serum was separated and dispensed, then stored at -80°C. Afterwards, ALT (alanine aminotransferase) and AST (aspartate aminotransferase), which are indicators of hepatotoxicity, were analyzed from the stored serum using HITACHI (7180, Japan).

[0103]

[0104] 4-3. Histological Analysis

[0105] The liver, epididymal fat (white fat), and small intestine tissues of the experimental animal obtained by dissection in Example 4-1 were fixed in 4% paraformaldehyde and subjected to a sectioning process. Afterward, each tissue was stained with H&E (haematoxylin and eosin) and observed under a microscope. In the white fat, the size of the adipocytes and the number of CLS (crown-like structures) were confirmed, and in the small intestine tissue, tight junction proteins and villi were additionally observed.

[0106]

[0107] 4-4. Measurement of gene expression levels related to insulin signaling, lipid metabolism, appetite-regulating hormones, IL-22 signaling, and inflammation

[0108] RNA was isolated from the liver and epididymal adipose tissues of the experimental animals obtained by dissection in Example 4-1 using Trizol reagent (15596018, Invitrogen, USA), and the concentration of the isolated RNA was measured using a Multiskan spectrophotometer (USA). In addition, cDNA was synthesized from the isolated RNA using a synthesis kit (FSQ-101, TOYOBO, Japan), and qRT-PCR was performed using the primers in Table 2 according to the protocol of SYBR Green Master Mix (Dyne) to measure the expression levels of genes related to insulin signaling, lipid metabolism, appetite-regulating hormones, IL-22 signaling, and inflammation.

[0109]

[0110] 4-5. Intestinal biopsy, measurement of tight junction protein and IL-22 signaling-related gene expression levels

[0111] RNA was isolated from the small intestine (ileum) tissue of the experimental animal obtained by dissection in Example 4-1 using Trizol reagent (15596018, Invitrogen, USA), and the concentration of the isolated RNA was measured using a Multiskan spectrophotometer (USA). In addition, cDNA was synthesized from the isolated RNA using a synthesis kit (FSQ-101, TOYOBO, Japan), and qRT-PCR was performed using the primers in Table 2 according to the protocol of SYBR Green Master Mix (Dyne) to measure the expression levels of tight junction proteins and IL-22 signaling-related genes.

[0112]

[0113] 4-6. Measurement of Muscle Function-Related Gene Expression Levels

[0114] A high-fat diet causes hypertrophy and enlargement of fat cells and increases the secretion of inflammatory cytokines due to an increase in macrophages, leading to insulin resistance, fibrosis, arthritis, and decreased muscle function.

[0115] Accordingly, RNA was isolated from the liver and white adipose tissue of the experimental animal obtained by dissection in Example 4-1 using Trizol reagent (15596018, Invitrogen, USA), and the concentration of the isolated RNA was measured using a Multiskan spectrophotometer (USA). In addition, cDNA was synthesized from the isolated RNA using a synthesis kit (FSQ-101, TOYOBO, Japan), and the expression levels of muscle function-related genes were measured by performing qRT-PCR using the primers in Table 2 according to the protocol of SYBR Green Master Mix (Dyne).

[0116]

[0117] 4-7. Confirmation of the effect of administration on body weight and food intake reduction following the administration of Bifidobacterium longum subspecies longum LBMB322020 strain

[0118] As a result of measuring the body weight of the experimental animals according to Example 4-1, it was found that at week 8, the body weight of the high-fat diet group (40.39±1.18g) was significantly increased compared to the body weight of the regular diet group (27.26±0.31g), whereas the body weight of the strain-administered group (33.78±1.04g) was significantly decreased compared to the body weight of the high-fat diet group. In particular, regarding the weight of visceral fat and white adipose tissue, it was confirmed that the high-fat diet group (3.91±0.38g and 6.01±0.69g) and the high-fat diet group, respectively, were significantly increased compared to the regular diet group (0.65±0.07g and 0.84±0.07g). On the other hand, it was confirmed that the weight of visceral fat (2.53±0.10g) and white fat (3.66±0.19g) in the strain-administered group was significantly reduced compared to the high-fat diet group (Fig. 2).

[0119] Meanwhile, after measuring the food intake of the experimental animals according to Example 4-1 and summing the food intake over a total of 8 weeks, it was confirmed that the total feed intake significantly increased in the normal diet group (28.09±0.74g) compared to the high-fat diet group (24.39±0.47g). On the other hand, it was confirmed that the food intake of the strain administration group (22.76±0.04g) significantly decreased compared to the high-fat diet group (Fig. 2).

[0120]

[0121] 4-8. Confirmation of Improvement in Blood Hepatotoxicity Indicators Following Administration of Bifidobacterium longum subspecies longum LBMB322020 Strain

[0122] As a result of analyzing hepatotoxicity indicators in the blood according to Example 4-2, it was confirmed that the hepatotoxicity indicators ALT and AST were reduced (Fig. 3).

[0123]

[0124] 4-9. Confirmation of Hepatic Fat Reduction Effect Following Administration of Bifidobacterium longum subspecies longum LBMB322020 Strain

[0125] As a result of examining liver tissue according to Example 4-3, it was found that the size and number of fat cells in the liver tissue decreased in the strain-administered group compared to the high-fat diet group, which was confirmed to be consistent with the decreasing trend of ALT and AST identified in Example 4-8. In addition, as a result of analyzing the expression of genes related to heat-generating factors and insulin signaling in the liver tissue according to Example 4-4, it was confirmed that the expression of the corresponding genes significantly increased (Fig. 4).

[0126] Through these results, it was confirmed that fatty liver can be improved by administering the Bifidobacterium longum subspecies longum LBMB322020 strain.

[0127]

[0128] 4-10. Confirmation of White Fat Reduction Effect Following Administration of Bifidobacterium longum subspecies longum LBMB322020 Strain

[0129] As a result of observing white fat according to Example 4-3, it was confirmed that the size of adipocytes and the number of CLS decreased in the strain-administered group compared to the high-fat diet group. This was confirmed to be due to a decrease in macrophage infiltration. In addition, as a result of analyzing the expression of genes related to thermogenesis factors in white fat according to Example 4-4, it was confirmed that the expression of lipogenesis factors was suppressed (Fig. 5).

[0130] Through these results, it was confirmed that when the Bifidobacterium longum subspecies longum LBMB322020 strain was administered, the expression of thermogenesis factors in white fat increased, leading to a decrease in fat size and ultimately a weight loss effect.

[0131]

[0132] 4-11. Effects of Administration of Bifidobacterium longum subspecies longum LBMB322020 Strain: Confirmation of Increased Tight Junctions in the Small Intestine

[0133] As a result of observing the small intestine tissue according to Example 4-3, it was observed that the distance between tight junction proteins in the small intestine of the high-fat diet group increased compared to the normal diet group, and macrophage infiltration occurred. On the other hand, it was confirmed that these symptoms improved in the strain administration group compared to the high-fat diet group. In addition, as a result of analyzing the expression of tight junction protein-related genes and IL-22 signaling-related genes according to Example 4-5, it was confirmed that the expression of tight junction protein-related genes Zo-1 and Occludin and the expression of IL-22 signaling-related genes Gpr43 and Il-22 significantly increased in the strain administration group compared to the high-fat diet group (Fig. 6).

[0134] Through these results, it was confirmed that a weight loss effect may occur as the expression of GLP-1, which is associated with tight junction proteins, increases following the repair of tight junction proteins.

[0135]

[0136] 4-12. Confirmation of the effect of administration of Bifidobacterium longum subspecies longum LBMB322020 strain on increasing expression of muscle function-related genes

[0137] As a result of analyzing the effect of increasing the expression of muscle function-related genes according to Example 4-6 in liver and white adipose tissues obtained according to Example 4-3, it was confirmed that the expression of Ampk and Pgc1α, genes related to muscle function enhancement, was significantly reduced in the high-fat diet group compared to the normal diet group. On the other hand, it was confirmed that the expression of genes related to muscle function enhancement was significantly increased in the strain administration group compared to the high-fat diet group (Fig. 7).

[0138] Through these results, it was confirmed that the Bifidobacterium longum subspecies longum LBMB322020 strain can enhance muscle function along with weight loss, and thus can be effectively applied to weight loss without muscle loss in cases of obesity induced by a high-fat diet.

[0139]

[0140] Example 5. Confirmation of the blood glucose-lowering effect of the Bifidobacterium longum subspecies LBMB322020 strain in animal models of high-fat and high-carbohydrate diets

[0141] 5-1. Animal Models and Experimental Design

[0142] 5-week-old C57BL / 6J male animals were used for the experiment, and the experimental groups were established as a normal diet group (ND), a 45% high-fat and 35% high-sucrose diet group (HFHS), and a strain-treated group administered with a high-fat diet (HFD-treated with probiotics group). A 45% high-fat and 35% high-sucrose diet (Saeronbio Inc., D12492) was used for the high-fat and high-carbohydrate diets, and for the strain-treated group, 1 × 10⁶ inactivated cells of the Bifidobacterium longum subspecies longum LBMB322020 strain prepared in Example 2 were administered daily along with the high-fat diet. 9 It was administered orally at a dose of CFUs / 200 µl.

[0143] During the 8-week experiment, body weight was measured once a week and food intake was measured twice a week. Once the 8-week experiment was completed, the experimental animals were allowed to fast for 18 hours, after which blood was collected, dissected, and used in the experiment.

[0144]

[0145] 5-2. Metabolic Indicator Analysis

[0146] The blood glucose control function following the administration of Bifidobacterium longum subspecies longum LBMB322020 was confirmed through the analysis of metabolic indicators.

[0147] Specifically, the blood obtained in Example 4-1 was centrifuged at 10,000 rpm for 15 minutes using an SST tube (BD, USA) to separate and dispense the serum, which was then stored at -80°C. Subsequently, total glycerides (TG), total cholesterol (TC), HDL (High-density lipoprotein), and LDL (Low-density lipoprotein), as well as hepatotoxicity indicators ALT (alanine aminotransferase) and AST (Aspartate aminotransferase), were analyzed from the stored serum using a HITACHI (7180, Japan). In addition, serum insulin (insulin, 90080, Crystalchem, USA), GLP-1 (Glucagone-like peptide-1, 81508, Crystalchem, USA) and glycated hemoglobin (HbA1c, 80310, Crystalchem, USA) were analyzed using the ELISA (Enzyme-linked immunosorbent assay) method according to the Crystalchem ​​manual.

[0148]

[0149] 5-3. Measurement of expression levels of genes related to insulin signaling, lipid metabolism, appetite-regulating hormones, IL-22 signaling, and inflammation

[0150] RNA was isolated from the liver and epididymal adipose tissues of the experimental animals obtained by dissection in Example 5-1 using Trizol reagent (15596018, Invitrogen, USA), and the concentration of the isolated RNA was measured using a Multiskan spectrophotometer (USA). In addition, cDNA was synthesized from the isolated RNA using a synthesis kit (FSQ-101, TOYOBO, Japan), and qRT-PCR was performed using the primers in Table 2 according to the protocol of SYBR Green Master Mix (Dyne) to measure the expression levels of genes related to insulin signaling, lipid metabolism, appetite-regulating hormones, IL-22 signaling, and inflammation.

[0151]

[0152] 5-4. Intestinal biopsy, measurement of tight junction protein and IL-22 signaling-related gene expression levels

[0153] RNA was isolated from the small intestine (ileum) tissue of the experimental animal obtained by dissection in Example 4-1 using Trizol reagent (15596018, Invitrogen, USA), and the concentration of the isolated RNA was measured using a Multiskan spectrophotometer (USA). In addition, cDNA was synthesized from the isolated RNA using a synthesis kit (FSQ-101, TOYOBO, Japan), and qRT-PCR was performed using the primers in Table 2 according to the protocol of SYBR Green Master Mix (Dyne) to measure the expression levels of tight junction proteins and IL-22 signaling-related genes.

[0154]

[0155] 5-5. Measurement of Muscle Function-Related Gene Expression Levels

[0156] RNA was isolated from the liver, brown adipose tissue, and white adipose tissue of the experimental animal obtained by dissection in Example 5-1 using Trizol reagent (15596018, Invitrogen, USA), and the concentration of the isolated RNA was measured using a Multiskan spectrophotometer (USA). In addition, cDNA was synthesized from the isolated RNA using a synthesis kit (FSQ-101, TOYOBO, Japan), and the expression levels of muscle function-related genes were measured by performing qRT-PCR using the primers in Table 2 according to the protocol of SYBR Green Master Mix (Dyne).

[0157]

[0158] 5-6. Confirmation of the effect of administration on body weight and food intake reduction following the administration of the Bifidobacterium longum subspecies longum LBMB322020 strain

[0159] As a result of measuring the body weight of the experimental animals according to Example 5-1, it was found that at week 8, the body weight of the high-fat, high-carbohydrate diet group (36.91±1.09g) was significantly increased compared to the body weight of the normal diet group (28.09±0.93g), whereas the body weight of the strain administered group (32.21±0.92g) was significantly decreased compared to the body weight of the high-fat, high-carbohydrate diet group (Fig. 8). In particular, regarding the weight of visceral fat (Vis) and white adipose tissue (WAT), it was confirmed that the high-fat, high-carbohydrate diet group (2.33±0.30g and 3.15±0.42g), respectively, was significantly increased compared to the normal diet group (0.91±0.24g and 1.14±0.30g). On the other hand, it was confirmed that the weight of visceral fat (1.61±0.15g) and white fat (2.13±0.23g) in the strain-administered group was significantly reduced compared to the high-fat, high-carbohydrate diet group (Fig. 9).

[0160] Meanwhile, after measuring the food intake of the experimental animals according to Example 5-1 and summing the food intake for a total of 8 weeks, it was found that there was no difference in total feed intake between the normal diet group (27.85g) and the high-fat, high-carbohydrate diet group (27.35g), but the food intake was significantly reduced in the strain administration group (24.14g) compared to the high-fat, high-carbohydrate diet group (Fig. 8).

[0161]

[0162] 5-7. Confirmation of Improvement in Blood Metabolic Indicators Following Administration of Bifidobacterium longum subspecies longum LBMB322020 Strain

[0163] As a result of analyzing metabolic indicators in the blood according to Example 5-2, it was confirmed that TG, TC, and LDL significantly increased in the high-fat, high-carbohydrate diet group compared to the normal diet group, and that diabetes-related indicators such as fasting blood glucose and glycated hemoglobin (HbA1c) also significantly increased. In addition, it was confirmed that liver toxicity indicators such as ALT and AST significantly increased in the high-fat, high-carbohydrate diet group compared to the normal diet group. On the other hand, GLP-1, which is known to be associated with insulin secretion, was confirmed to have significantly decreased (Fig. 10).

[0164] On the other hand, compared to the high-fat, high-carbohydrate diet group, TG, TC, and ALT were significantly reduced in the strain administration group, and a tendency for fasting blood glucose, LDL, and HbA1c to decrease was confirmed, as well as a significant increase in GLP-1 (Fig. 10).

[0165]

[0166] 5-8. Confirmation of the effect of administration of Bifidobacterium longum subspecies longum LBMB322020 strain on improving expression levels of lipid metabolism-related genes in liver tissue

[0167] As a result of measuring the expression levels of lipid metabolism-related genes in liver tissue according to Example 5-3, it was confirmed that compared to the normal diet group, the expression of lipid synthesis factor (Pparγ) in the liver tissue of the high-fat, high-carbohydrate diet group was significantly increased, while the expression of lipid oxidation-related genes (Pparα, Cpt1) and IL-22 (Il-22) was significantly decreased. On the other hand, compared to the high-fat, high-carbohydrate diet group, it was confirmed that the expression of lipid synthesis factor decreased, and the expression of lipid oxidation-related genes and IL-22 significantly increased in the strain administration group (Fig. 11).

[0168]

[0169] 5-9. Confirmation of Improvement in Insulin Signaling-Related Gene Expression in White Adipose Tissue Following Administration of Bifidobacterium longum subspecies longum LBMB322020 Strain

[0170] As a result of measuring the expression levels of insulin signaling-related genes in white adipose tissue according to Example 5-3, it was confirmed that the expression of an insulin signaling-related factor (Akt2) in the adipose tissue of the high-fat, high-carbohydrate diet group was significantly reduced compared to the normal diet group. On the other hand, it was confirmed that the expression of the insulin signaling-related factor was significantly increased in the strain administration group compared to the high-fat, high-carbohydrate diet group (Fig. 12).

[0171]

[0172] 5-10. Confirmation of the effect of administration of Bifidobacterium longum subspecies longum LBMB322020 strain on the improvement of thermogenesis factor-related gene expression in brown adipose tissue

[0173] As a result of measuring the expression levels of genes related to thermogenesis in brown adipose tissue according to Example 5-3, it was confirmed that the expression of thermogenesis-related factor (Ucp1) in the brown adipose tissue of the high-fat, high-carbohydrate diet group was reduced compared to the normal diet group. On the other hand, it was confirmed that the expression of thermogenesis was significantly increased in the strain-administered group compared to the high-fat, high-carbohydrate diet group (Fig. 13).

[0174]

[0175] 5-11. Confirmation of Improvement in Tight Junction Protein-Related Gene Expression in Small Intestinal Tissue Following Administration of Bifidobacterium longum subspecies longum LBMB322020 Strain

[0176] As a result of measuring the expression levels of tight junction protein-related genes in small intestinal tissue according to Example 5-4, it was confirmed that the expression of tight junction protein-related genes Zo-1 and Occludin in the small intestinal tissue of the high-fat, high-carbohydrate diet group was decreased compared to the normal diet group. On the other hand, it was confirmed that the expression of tight junction protein-related genes was significantly increased in the strain administration group compared to the high-fat, high-carbohydrate diet group (Fig. 14).

[0177] Through these results, it was confirmed that the Bifidobacterium longum subspecies longum LBMB322020 strain can have a preventive or remedial effect on obesity accompanied by inflammatory bowel disease induced by a high-fat and high-carbohydrate diet.

[0178]

[0179] 5-12. Confirmation of Increased Gene Expression Related to Muscle Function Enhancement in Tissues Following Administration of Bifidobacterium longum subspecies longum LBMB322020 Strain

[0180] As a result of analyzing the effect of increasing the expression of muscle function-related genes according to Example 5-6 in liver, brown adipose tissue, and white adipose tissue obtained according to Example 5-3, it was confirmed that the expression of Ampk and Pgc1α, genes related to muscle function enhancement, was significantly reduced in the high-fat, high-carbohydrate diet group compared to the normal diet group. On the other hand, it was confirmed that the expression of genes related to muscle function enhancement was significantly increased in the strain administration group compared to the high-fat, high-carbohydrate diet group (Fig. 15).

[0181] Through these results, it was confirmed that the Bifidobacterium longum subspecies longum LBMB322020 strain can enhance muscle function along with weight loss, and thus can be effectively applied to weight loss without muscle loss in cases of obesity induced by a high-fat and high-carbohydrate diet.

[0182]

[0183] Example 6. Statistical Analysis

[0184] Statistical analysis of Examples 3 to 5 was performed using GraphPad software (Prism 10, USA). The results of Example 3 were expressed as mean ± standard deviation (SD), and the results of Examples 4 and 5 were expressed as mean ± standard error (SEM). All experimental results were analyzed using the Student t-test with GraphPad Prism, and in all analyses, p<0.05 was considered statistically significant.

[0185]

[0186] The present invention has been described above with reference to its embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of equivalents should be interpreted as being included in the invention.

[0187]

[0188] [Consignment Number]

[0189] Depository Name: Korea Research Institute of Biotechnology and Bioengineering Biological Resource Center (KCTC)

[0190] Trustee Number: KCTC16211BP

[0191] Date of Trust: 20241220

[0192]

[0193]

Claims

Bifidobacterium longum subsp. longum LBMB322020 (Accession No.: KCTC 16211BP) strain with excellent activity for reducing body fat, improving blood sugar, and enhancing muscle function. A food composition for preventing or improving metabolic diseases comprising the strain of claim 1, its culture, its lysate, its extract, or its dead cells as an active ingredient. A food composition for preventing or improving metabolic diseases, wherein, in claim 2, the metabolic disease is obesity or hyperglycemia. A food composition for preventing or improving metabolic diseases, wherein the obesity is accompanied by one or more diseases selected from the group consisting of diabetes, fatty liver, dyslipidemia, muscle damage caused by a high-fat or high-carbohydrate diet, and inflammatory bowel disease. A pharmaceutical composition for the prevention or treatment of metabolic diseases comprising the strain of claim 1, its culture, its lysate, its extract, or its dead cells as an active ingredient. In claim 5, the strain is a pharmaceutical composition for the prevention or treatment of metabolic diseases administered orally. A pharmaceutical composition for the prevention or treatment of a metabolic disease, wherein, in claim 5, the metabolic disease is obesity or hyperglycemia. A pharmaceutical composition for the prevention or treatment of metabolic diseases according to claim 7, wherein the obesity is accompanied by one or more diseases selected from the group consisting of diabetes, fatty liver, dyslipidemia, muscle damage caused by a high-fat or high-carbohydrate diet, and inflammatory bowel disease. A method for preventing or treating a metabolic disease comprising the step of administering the strain of claim 1, its culture, its lysate, its extract, or its dead cells to a subject.

Images