Pharmaceutical composition for preventing or treating inflammatory diseases such as rosacea or angiogenic diseases, comprising peptide

Abstract

A pharmaceutical composition according to one aspect may have an effect of preventing, ameliorating, or treating inflammatory diseases or angiogenic diseases, and specifically may exert therapeutic effects on diseases by inhibiting the expression or activity of inflammatory factors or angiogenesis-related factors. Accordingly, the pharmaceutical composition can be utilized as a drug for preventing, alleviating, or treating inflammatory diseases or angiogenic diseases.

Description

Pharmaceutical composition for the prevention or treatment of inflammatory or neovascular diseases, such as injections containing peptides

[0001] The present invention relates to a pharmaceutical composition for the prevention or treatment of inflammatory diseases or neovascular diseases, such as injections containing peptides.

[0002] This invention is the result of research conducted with the support of the University Technology Management Promotion (IP Star Scientist Support Type) research project:

[0003] Project ID: RS-2025-02310854

[0004] Ministry Name: Ministry of Science and ICT

[0005] Specialized Research Management Agency: Korea Institute of Science and Technology Commercialization

[0006] Research Project Name: Promotion of University Technology Management (IP Star Scientist Support Type)

[0007] Research Project Title: IP Advancement and Commercialization for the Promotion of Business Development of Skin Barrier Mechanism-Based Peptide Technology in Functional Cosmetics and Pharmaceutical Materials

[0008] Contribution rate: 100%

[0009] Organizing Institution: CHA University Industry-Academic Cooperation Foundation

[0010] Research Period: April 1, 2025 – December 31, 2026

[0011]

[0012] Rosacea is a chronic inflammatory skin disease that primarily affects the face, characterized by redness and vasodilation in the central facial areas such as the forehead, nose, cheeks, and chin. The main clinical characteristics of rosacea include persistent facial erythema, vasodilation, papules and pustules, rhinophyma, ocular rosacea, and paresthesia.

[0013] Persistent redness in the center of the face is the most common early symptom of rosacea, which may initially be temporary but gradually develop into a persistent condition. Vasodilation, where small blood vessels on the skin surface appear dilated, is primarily observed on the nose and cheeks. Acne-like papules and pustules appear mainly concentrated in the central part of the face. Some patients experience thickening and roughening of the skin, and if it occurs particularly on the nose, it can develop into hypertrophic rhinitis. It can also affect the eyes, causing dryness, irritation, and inflammation, and in severe cases, can lead to vision loss. Patients with rosacea may experience a stinging or burning sensation on the skin, and sudden episodes can be triggered by various irritants such as hot beverages, spicy foods, alcohol, stress, heat, or cold. Furthermore, while the skin is the body's largest organ and plays a crucial role in protecting the body from the external environment, skin conditions like rosacea can impair this protective function, leading to damage to the skin barrier and increased sensitivity.

[0014] The main characteristics of rosacea include skin inflammation and neovascularization. In the skin of patients suffering from rosacea, the innate immune response is excessively activated. In particular, the excessive production and activation of an antimicrobial peptide called cathelicidin found in the skin triggers an inflammatory response, manifesting symptoms such as red rashes. Additionally, Toll-like receptor 2 (TLR2) becomes excessively activated; since TLR2 plays a crucial role in immune cells recognizing and responding to pathogens, excessive activation of TLR2 can lead to an increase in inflammatory cytokines (e.g., IL-8, TNF-α, etc.). This inflammatory response occurs due to the activation of immune cells and the secretion of inflammatory cytokines, resulting in damage and dysfunction of skin cells. Due to this inflammation, the skin becomes red and is accompanied by stinging and burning sensations.

[0015] Angiogenesis refers to the process of forming new blood vessels, which can exacerbate flushing symptoms. In particular, vascular endothelial growth factor (VEGF) stimulates the formation of new blood vessels and increases the permeability of existing vessels, leading to erythema and telangiectasia. The formation of new blood vessels increases blood supply, further intensifying skin redness and flushing. This process, along with damage to the skin barrier, increases skin sensitivity and reactivity. Consequently, the skin reacts more sensitively to external stimuli, and inflammation and redness occur more easily.

[0016] Currently, many people worldwide suffer from rosacea, with estimates suggesting that approximately 10% of the population suffers from the condition. While women are more affected than men, the number of male patients is also on the rise. Studies indicate that individuals with lighter skin are more susceptible to rosacea, and patients experience significant psychological and physical distress due to persistent facial redness, itching, stinging, and acne-like symptoms. Current treatments include antibiotics, topical steroids, and laser therapy; however, these therapies can cause side effects with long-term use, and symptoms frequently recur due to their limited efficacy. Furthermore, existing treatments focus primarily on alleviating symptoms, limiting their ability to provide a fundamental cure. Patients require continuous treatment and management, which entails a significant financial burden. Therefore, there is a need to develop medications that minimize side effects and remain financially sustainable even with long-term use.

[0017] Recently, the development of cosmetic formulations using compounds exhibiting biological activity with protective and therapeutic functions has been rapidly expanding. In particular, many new cosmetic products are emerging that provide molecules with beneficial effects on the skin's biological functions, such as cell protection and immune modulation. Representative products among these are those utilizing biologically active peptides. The reasons for the recent extensive research and development of peptide-based therapeutics and cosmetics are as follows: First, peptides are composed of naturally occurring amino acid sequences, resulting in fewer side effects compared to chemical drugs. Second, they offer the advantage of acting precisely on desired target sites through their specific targeting capabilities. Third, peptide-based therapeutics and cosmetics carry minimal side effects and burden even with long-term use. Finally, they are skin-friendly as they are composed of components similar to those found in the skin, and their small molecular structure allows for rapid absorption, producing quick effects. Therefore, peptide-based therapeutics and cosmetics possess numerous advantages and potential, offering a new breakthrough in the treatment of skin conditions such as rosacea and flushing, and providing patients with more effective and safer treatment options.

[0018] Accordingly, there is a need to develop peptide materials that can effectively inhibit inflammation and angiogenesis in the skin, improve weakened skin barriers, and treat or prevent rosacea and rosacea.

[0019]

[0020] One aspect provides a pharmaceutical composition for the prevention or treatment of inflammatory or neovascular diseases comprising an oligopeptide having an amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide having an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times.

[0021] Another aspect is a polynucleotide encoding an oligopeptide consisting of the amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide consisting of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times; or

[0022] The present invention provides a pharmaceutical composition for the prevention or treatment of inflammatory or angiogenic diseases comprising an expression vector containing the above-mentioned polynucleotide.

[0023] Another aspect provides a cosmetic composition for the prevention or improvement of inflammatory or angiogenic diseases, comprising an oligopeptide having an amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide having an amino acid sequence having the amino acid sequence of SEQ ID NO. 1 repeated 2 to 5 times.

[0024] Another aspect is a polynucleotide encoding an oligopeptide consisting of the amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide consisting of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times; or

[0025] The present invention provides a cosmetic composition for the prevention or improvement of inflammatory or angiogenic diseases comprising an expression vector containing the above-mentioned polynucleotide.

[0026] Another aspect provides a method for preventing or treating an inflammatory disease or angiogenic disease, comprising the step of administering to an individual an oligopeptide composed of the amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide having an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times.

[0027] Another aspect provides the use of an oligopeptide composed of the amino acid sequence of SEQ ID NO. 1 for the manufacture of a drug for the prevention or treatment of inflammatory diseases or angiogenic diseases, an oligopeptide in which 2 or 3 amino acids are deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide composed of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times.

[0028] Another aspect is a polynucleotide encoding an oligopeptide consisting of the amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide consisting of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times; or

[0029] The present invention provides a method for preventing or treating inflammatory or angiogenic diseases, comprising the step of administering an expression vector containing the above-mentioned polynucleotide to an individual.

[0030] Another aspect is a polynucleotide encoding an oligopeptide comprising the amino acid sequence of SEQ ID NO. 1 for the manufacture of a drug for the prevention or treatment of an inflammatory disease or an angiogenic disease, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide comprising an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times; or

[0031] The purpose is to provide a use for an expression vector containing the above-mentioned polynucleotide.

[0032]

[0033] One aspect provides a pharmaceutical composition for the prevention or treatment of inflammatory or angiogenic diseases, comprising an oligopeptide having an amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide having an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times.

[0034] The amino acid sequence of SEQ ID NO. 1 above corresponds to AYDPGYK.

[0035] In one embodiment, the oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1 may be an oligopeptide consisting of the amino acid sequence of SEQ ID NO. 2 or an oligopeptide consisting of the amino acid sequence of SEQ ID NO. 3.

[0036] The amino acid sequence of SEQ ID NO. 2 above corresponds to PGYK.

[0037] The amino acid sequence of SEQ ID NO. 3 above corresponds to DPGTK.

[0038] In one embodiment, the oligopeptide composed of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times may be selected from the group consisting of an oligopeptide composed of an amino acid sequence of SEQ ID NO. 4, an oligopeptide composed of an amino acid sequence of SEQ ID NO. 5, an oligopeptide composed of an amino acid sequence of SEQ ID NO. 6, and an oligopeptide composed of an amino acid sequence of SEQ ID NO. 7. Specifically, the oligopeptide composed of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times may be an oligopeptide composed of an amino acid sequence of SEQ ID NO. 4 or an oligopeptide composed of an amino acid sequence of SEQ ID NO. 5.

[0039] The amino acid sequence of SEQ ID NO. 4 corresponds to AYDPGYKAYDPGYK, and the amino acid sequence of SEQ ID NO. 1 corresponds to an amino acid sequence that is repeated twice.

[0040] The amino acid sequence of SEQ ID NO. 5 above corresponds to AYDPGYKAYDPGYKAYDPGYK, and the amino acid sequence of SEQ ID NO. 1 above corresponds to an amino acid sequence that is repeated three times.

[0041] The above term "amino acid sequence" is interpreted to include sequences that exhibit substantial identity with the sequence listed in the sequence list, provided that variations having biologically equivalent activity are taken into account. The sequence exhibiting substantial identity means a sequence in which, when a reference sequence is aligned with any other sequence and the aligned sequence is analyzed using an algorithm commonly used in the art, there exists a substantial identity of 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% between the reference sequence and any other sequence.

[0042] The term "oligopeptide" above refers to a polymer formed by polymerizing 2 to 50 or 2 to 20 amino acids, and the term oligopeptide includes peptides, dipeptides, tripeptides, and polypeptides.

[0043] The above amino acid corresponds to a term including amino acid derivatives, that is, amino acids in which the amino acid structure has been chemically modified or functional groups have been substituted. The above amino acid derivatives may be, for example, amino acids substituted with esters, amides, azides, acyls, alkyls, phosphates, etc. within the side chains or backbones of the amino acid, and may be non-natural amino acids such as β-amino acids, D-amino acids, and α,α-dimethyl amino acids.

[0044] In one embodiment, the oligopeptide may further include 1 to 30, 1 to 15, 1 to 10, 2 to 30, 2 to 15, 2 to 10, 3 to 30, 3 to 15, or 3 to 10 amino acids at the N-terminus or C-terminus. Additionally, a tag for controlling affinity, solubility, activity, etc. may be further included at the N-terminus or C-terminus. The tag may be, for example, a FLAG, SUMO (small ubiquitin-like modifier), a GST tag, etc.

[0045] In one embodiment, the oligopeptide may have one or more, two or more, or three or more amino acids deleted or modified at the N-terminus, C-terminus, or within the oligopeptide.

[0046] The above term "deletion" means that one or more amino acids or nucleotides constituting an amino acid or nucleotide sequence are removed from the sequence.

[0047] The above term "modification" includes chemical modifications such as phosphorylation, acetylation, methylation, glycosylation, and ubiquitination of one or more amino acids or nucleotides constituting an amino acid or nucleotide sequence, and also includes substitution with other amino acids or nucleotides.

[0048] An oligopeptide composed of the amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide composed of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times, can inhibit the expression or activity of inflammatory factors or angiogenesis-related factors in vivo, and thereby may have a preventive, improving, or therapeutic effect on inflammatory diseases or angiogenic diseases.

[0049] In one embodiment, the inflammatory disease or angiogenic disease may be caused by an increase in the activity or expression of one or more selected from the group consisting of Interleukin-8, Interleukin-6, Interleukin-1beta, Tumor necrosis factor-α (TNF-α), Toll-like receptor 2 (TLR2), NF-κB inhibitor alpha (iκb α), Matrix Metalloproteinase-9 (MMP 9), Vascular Endothelial Growth Factor (VEGF), and Kallikrein-related peptidase 5 (KLK5).

[0050] In one embodiment, the inflammatory disease or angiogenic disease may be caused by an increase in one or more phosphorylations selected from the group consisting of NF-kappa-B inhibitor alpha (NF-κB inhibitor alpha; iκb α) and Kallikrein-related peptidase 5 (KLK5).

[0051] In one embodiment, the inflammatory disease or angiogenic disease may be one in which the activity of Vascular Endothelial Growth Factor (VEGF) is increased or overexpressed.

[0052] The above "increase in activity or expression" includes an increase in the transcription or translation of the target gene, or an increase in the amount of the polynucleotide or polypeptide encoded by the target gene through post-transcriptional or post-translational regulation, and includes the activation or increase of the function of the polypeptide through modification of the polypeptide.

[0053] In one embodiment, the inflammatory disease or angiogenic disease may be selected from the group consisting of rosacea, flushing, dermatitis, seborrheic dermatitis, pruritus, atopic dermatitis, dry eczema, urticaria, psoriasis, erythema, solid tumor, blood cancer, multiple myeloma, brain tumor, macular degeneration, retinopathy, glaucoma, macular degeneration, rheumatoid arthritis, psoriasis, rosacea, hemangioma, Kaposi's sarcoma, inflammatory bowel disease, lupus, endometriosis, bronchitis, hypertension, atherosclerosis, and ulcer.

[0054] Specifically, the solid tumor may be lung cancer, breast cancer, prostate cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, kidney cancer, bladder cancer, cervical cancer, ovarian cancer, esophageal cancer, head and neck cancer, melanoma, thyroid cancer, gallbladder cancer, pancreatic cancer, sarcoma, or testicular cancer, and the blood cancer may be leukemia, lymphoma, multiple myeloma, myelodysplastic syndrome, or myeloproliferative tumor.

[0055] If the above inflammatory disease or angiogenic disease is a solid tumor or blood cancer, the solid tumor or blood cancer may be a metastatic cancer. If the solid tumor or blood cancer is a metastatic cancer, the composition may inhibit the inflammatory response or angiogenesis to inhibit or treat the metastasis of the cancer.

[0056] In one embodiment, the inflammatory disease or angiogenic disease may be an inflammatory or angiogenic skin disease.

[0057] In one embodiment, the angiogenic disease may be a disease caused by excessive angiogenesis or a disease accompanied by excessive angiogenesis.

[0058] In one embodiment, the composition may contain the oligopeptide in an amount of 10 nM to 1000 μM, 10 nM to 100 μM, 10 nM to 10 μM, 100 nM to 1000 μM, 100 nM to 100 μM, 100 nM to 10 μM, 200 nM to 1000 μM, 200 nM to 100 μM, or 200 nM to 100 μM. If the composition contains the oligopeptide in an amount of less than 10 nM, the preventive or therapeutic effect against the inflammatory disease or angiogenic disease may be reduced.

[0059] The term "prevention" above refers to any act of inhibiting the course of a specific disease or delaying its onset by means of the above pharmaceutical composition.

[0060] The term "treatment" above refers to any act in which symptoms of a specific disease are improved or beneficially altered by the above pharmaceutical composition.

[0061] In one embodiment, the composition may be administered orally or parenterally according to the desired method. Parenteral administration may include intraperitoneal, rectal, subcutaneous, intravenous, intramuscular, or thoracic injection methods.

[0062] In one embodiment, the composition may be formulated and used in the form of oral formulations such as powders, granules, tablets, capsules, suspensions, emulsions, syrups, and aerosols, as well as external formulations, suppositories, and sterile injectable solutions.

[0063] In one embodiment, when formulating the above composition, it may be prepared using diluents or excipients such as fillers, extenders, binders, wetting agents, disintegrants, and surfactants. Solid dosage forms for oral administration include tablets, pills, powders, granules, capsules, etc., and these solid dosage forms may be prepared by mixing at least one excipient, for example, starch, calcium carbonate, sucrose or lactose, gelatin, etc., with the above composition. In addition to simple excipients, lubricants such as magnesium stearate and talc may also be used. Liquid dosage forms for oral administration include suspensions, liquid formulations, emulsions, syrups, etc., and may include various excipients, for example, wetting agents, sweeteners, flavoring agents, and preservatives, in addition to commonly used simple diluents such as water and liquid paraffin.

[0064] Preparations for parenteral administration include sterile aqueous solutions, liquids, non-aqueous solvents, suspensions, emulsions, lyophilized preparations, suppositories, and injectable preparations. Non-aqueous solvents and suspensions may include propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable esters such as ethyl oleate.

[0065] In one embodiment, carriers, excipients, and diluents that may be included in the composition include lactose, dextrose, sucrose, sorbitol, mannitol, xylitol, erythritol, maltitol, starch, acacia gum, alginate, gelatin, calcium phosphate, calcium silicate, cellulose, methyl cellulose, microcrystalline cellulose, polyvinylpyrrolidone, water, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate, or mineral oil.

[0066] In one embodiment, the composition may be administered in a pharmaceutically effective amount. The pharmaceutically effective amount and effective dosage of the composition may vary depending on the formulation method of the pharmaceutical composition, the mode of administration, the time of administration and / or the route of administration, etc. Furthermore, it may vary depending on various factors and similar factors well known in the pharmaceutical field, including the type and degree of response to be achieved by administering the composition, the type of individual to be administered, age, body weight, general health condition, symptoms or severity of disease, gender, diet, excretion, and the components of other compositions used simultaneously or at other times with the individual. A person skilled in the art can easily determine and prescribe a dosage effective for the intended treatment. The composition may be administered once a day or divided into several doses. Therefore, the dosage does not limit the scope of the present invention in any way. The dosage of the composition may be 1 μg / kg / day to 1,000 mg / kg / day.

[0067] In one embodiment, the composition may be administered once a day or divided into several doses. For example, it may be administered in a cycle of 6 days of administration followed by 1 day of rest, 5 days of administration followed by 2 days of rest, or 4 days of administration followed by 3 days of rest, based on a 7-day period, and more specifically, it may be administered in a cycle of 5 days of administration followed by 2 days of rest.

[0068] A pharmaceutical composition according to one aspect may have a preventive, improving, or therapeutic effect on inflammatory diseases or angiogenic diseases, and specifically may have a therapeutic effect on the disease by inhibiting the expression or activity of inflammatory factors or angiogenesis-related factors. Accordingly, the pharmaceutical composition may be utilized as a drug for the prevention, improvement, or treatment of inflammatory diseases or angiogenic diseases.

[0069]

[0070] In one embodiment, a peptide was synthesized by the FMOC solid-phase method using an automated synthesizer (PeptrEx-R48, Peptron, Daejeon, South Korea), and the synthesized peptide was purified and analyzed by reverse-phase high-speed liquid chromatography (reverse-phase HPLC) using a C18 analysis RP column (Shiseido capcell pak) (Prominence LC-20AB, Shimadzu, Japan), and identified using a mass spectrometer (HP 1100 Series LC / MSD, Hewlett-Packard, Roseville, USA) (see Example 1).

[0071] In another example, the cytotoxicity of LL-37 or AdhPep-11 was evaluated on HaCaT (skin keratinocytes). As a result, LL-37 showed no significant difference in cell viability compared to the control group (untreated with LL-37) up to 1 to 10 μM, but when treated at 20 μM, cell viability decreased significantly. From this, it was confirmed that LL-37 did not exhibit cytotoxicity against HaCaT cell lines in the concentration range of 1 to 10 μM. Meanwhile, in the case of AdhPep-11, it was confirmed that there was no significant difference in cell viability compared to AdhPep-11 even when treated at 1 nM to 100 μM. From this, it was confirmed that AdhPep-11 did not exhibit cytotoxicity against HaCaT cell lines in the range of 1 nM to 100 μM. Based on the above results, the LL-37 concentration in the following experiment was selected as 8 μM (see Example 2).

[0072] In another example, the amounts of injection-related inflammatory factors, angiogenesis-related cytokines, and secreted proteins were measured in HaCaT cell lines. As a result, the expression levels of the inflammatory cytokines TNF-α, IL-1β, IL-6, and IL-8 were significantly increased by LL-37 treatment compared to the control group, and it was confirmed that the expression levels decreased in the experimental group treated with LL-37 and AdhPep-11 simultaneously compared to the experimental group treated with LL-37 alone. Meanwhile, regarding the expression level of vascular endothelial growth factor (VEGF), it was confirmed that, similar to inflammatory cytokines, expression increased by LL-37 treatment alone compared to the control group, and that simultaneous treatment with LL-37 and AdhPep-11 could inhibit the increase in VEGF expression induced by LL-37 (see Example 3).

[0073] In another example, the expression of injection-related genes and angiogenesis-related genes in HaCaT cell lines was confirmed. As a result, compared to the control group not treated with LL-37, it was confirmed that the mRNA expression of inflammation-related genes TNF-α, IL-1β, and IL-8 was significantly increased in the experimental group treated with LL-37 alone, the mRNA expression of angiogenesis-related gene VEGF was significantly increased, and the mRNA expression of injection-related genes TLR2 and KLK5 was significantly increased. However, in the experimental group treated with LL-37 and AdhPep-11 simultaneously, it was confirmed that inflammation-related genes TNF-α, IL-1β, IL-8, angiogenesis-related gene VEGF, and injection-related genes TLR2 and KLK5 were all significantly reduced compared to the group treated with LL-37 alone when AdhPep-11 was treated at concentrations of 100, 300, and 500 nM (see Example 4).

[0074] In another example, injection marker proteins and inflammation-related factors were measured in HaCaT cell lines. As a result, it was confirmed that the amounts of the injection marker proteins TLR2, MMP9, and KLK5 significantly increased compared to the control group upon treatment with LL-37 alone, and that the phosphorylation of the inflammatory factors IκB-α, p65, and p50 significantly increased. However, in the experimental group treated with LL-37 and AdhPep-11 simultaneously, it was confirmed that the amounts of the injection marker proteins TLR2, MMP9, and KLK5 significantly decreased compared to the LL-37 alone treatment group, and the phosphorylation of the inflammatory factors IκB-α, p65, and p50 significantly decreased when AdhPep-11 was treated at a concentration of 100 or 300 nM (see Example 5).

[0075] In another example, the toxicity of LL-37 and AdhPep-11 was evaluated in human umbilical cord vein endothelial cell (HUVEC) lines. As a result, it was confirmed that while the viability of HUVEC cells with LL-37 at concentrations of 1 to 4 μM did not differ significantly from the control group (untreated with LL-37), cell viability decreased significantly compared to the control group at concentrations of 8 μM or higher. From this, it was confirmed that LL-37 does not exhibit cytotoxicity to HUVEC cells in the concentration range of 4 μM or lower. Meanwhile, in the case of AdhPep-11, it was confirmed that there was no significant difference in cell viability compared to AdhPep-11 even when treated at concentrations of 1 nM to 100 μM (see Example 6).

[0076] In another example, angiogenesis-related cytokines and secreted proteins in HUVEC cells injected with LL-37 were measured through an ELISA experiment. As a result, it was confirmed that the secretion levels of VEGF, IL-6, and IL-8 factors significantly increased with treatment with LL-37 compared to the control group, and in the experimental group treated with LL-37 and AdhPep-11 simultaneously, they decreased compared to the experimental group treated with LL-37 alone (see Example 7).

[0077] In another example, the expression of injection-induced angiogenesis-related proteins in HUVEC cells induced by LL-37 injection was measured via Western blot. As a result, it was confirmed that the amounts of CD31, TGF-β, and VEGF-A proteins, whose expression increases with the progression of angiogenesis, increased with LL-37 treatment alone compared to the control group. On the other hand, in the experimental group treated with LL-37 and AdhPep-11 simultaneously, it was confirmed that the amounts of CD31, TGF-β, and VEGF-A proteins were significantly reduced compared to the LL-37 treatment group in both cases where AdhPep-11 was treated at a concentration of 100 or 300 nM (see Example 8).

[0078] In another example, changes in cell migration in HUVEC cells induced by injection with LL-37 were measured using a scratch migration assay. As a result, it was confirmed that cell migration increased with LL-37 treatment alone, as the scratch space was significantly reduced compared to the control group. On the other hand, when AdhPep-11 and LL-37 were treated simultaneously, it was confirmed that cell migration was attenuated in both experimental groups treated with AdhPep-11 at concentrations of 100 nM or 300 nM compared to the LL-37 treatment group alone (see Example 9).

[0079] In another embodiment, as an experiment to evaluate angiogenic ability, the tube formation ability in HUVEC cells injected by LL-37 was measured using a tube formation assay. As a result, it was confirmed that tube formation significantly increased with LL-37 treatment compared to the control group, and that the formation of junctions and nodes also increased. On the other hand, when AdhPep-11 and LL-37 were treated simultaneously, it was confirmed that tube formation, junction formation, and node formation significantly decreased in both experimental groups treated with AdhPep-11 at concentrations of 100 nM or 300 nM compared to the group treated with LL-37 alone (see Example 10).

[0080] In another example, injection-related inflammatory factors, angiogenesis-related cytokines, and secreted proteins were measured in HaCaT cells induced by injection with LL-37 through ELISA experiments following treatment with AdhPep-11-1 and AdhPep-11-2, which are oligopeptides consisting of amino acid sequences in which AdhPep-11 is repeated two or three times. As a result, it was confirmed that oligopeptides with the amino acid sequence of AdhPep11 repeated two to three times could inhibit IL-8 and VEGF similarly to the AdhPep-11 peptide, thereby confirming that they can prevent or treat inflammatory or angiogenic diseases (see Example 11).

[0081] In another example, injection-related inflammatory factors and angiogenesis-related secreted proteins in HaCaT cells were measured via ELISA experiments on AdhPep-11-P (PGYK), in which 3 amino acids were deleted from the N-terminus of AdhPep-11, and AdhPep-11-D (DPGYK), in which 2 amino acids were deleted. As a result, it was confirmed that treatment with AdhPep-11-P had an inhibitory effect similar to that of treatment with AdhPep-11. Additionally, while the AdhPep-11-D treatment group showed a somewhat lower effect compared to AdhPep-11 treatment, it was confirmed that the effect was reduced compared to the group treated with LL-37 alone (see Example 12).

[0082]

[0083] Another aspect is a polynucleotide encoding an oligopeptide consisting of the amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide consisting of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times; or

[0084] A pharmaceutical composition for the prevention or treatment of inflammatory or angiogenic diseases is provided, comprising an expression vector containing the above-mentioned polynucleotide.

[0085] The above terms "amino acid sequence," "oligopeptide," "inflammatory disease," "angiogenic disease," "prevention," "treatment," "pharmaceutical composition," etc., are within the scope described above.

[0086] The term "polynucleotide" above refers to a polymer of deoxyribonucleotides or ribonucleotides existing in a single-strand or double-strand form, and the deoxyribonucleotides or ribonucleotides may include their analogs, for example, deoxyadenosine analogs, adenosine analogs, deoxycytidine analogs, guanosine derivatives, etc. Additionally, the term polynucleotide corresponds to a term including dinucleotides, trinucleotides, tetranucleotides, or oligonucleotides.

[0087] The polynucleotide encoding the above oligopeptide is interpreted to include polynucleotides exhibiting substantial identity. The term "substantial identity" is within the scope described above.

[0088] In one embodiment, the expression vector comprising the polynucleotide may comprise a promoter and a polynucleotide encoding the oligopeptide operably linked to the promoter.

[0089] The term "promoter" above refers to a specific base sequence on DNA that regulates the transcription of a target gene. The promoter is generally located around the transcription initiation region of the target gene, for example, tens to thousands of base pairs upstream of the transcription initiation region of the target gene.

[0090] The term "operably linked" above means that a polynucleotide sequence having promoter activity is functionally linked to said target gene to initiate and mediate the transcription of said target gene. Operable links can be produced using gene recombination techniques known in the art, and site-specific DNA cleavage and linkage can be produced using cleavage and linkage enzymes, etc., in the art.

[0091] The term "vector" above refers to a polynucleotide capable of introducing a target gene or a desired polynucleotide into a suitable host and expressing the target gene or the desired polynucleotide, comprising a promoter or a suitable gene expression regulatory sequence; and a target gene or a desired polynucleotide sequence operably linked thereto. Specifically, the vector may be a DNA vector, and may be, for example, a plasmid vector or a cosmid vector.

[0092] The above vector may further include one or more selected from the group consisting of a ribosome binding sequence (RBS), a spacer, a selection marker gene, and a replication origin.

[0093] A pharmaceutical composition according to another aspect may include a polynucleotide encoding the oligopeptide or an expression vector containing the polynucleotide, and may express an oligopeptide consisting of the amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide consisting of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times in target cells, etc. Accordingly, the pharmaceutical composition may be utilized as a drug for the prevention, improvement, or treatment of inflammatory diseases or angiogenic diseases by inhibiting the expression or activity of inflammatory factors or angiogenesis-related factors.

[0094]

[0095] Another aspect relates to a cosmetic composition for the prevention or improvement of inflammatory or neovascular diseases, comprising an oligopeptide having an amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide having an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times.

[0096] The above terms "amino acid sequence," "oligopeptide," "inflammatory disease," "angiogenic disease," "prevention," etc., are within the scope described above.

[0097] The term "improvement" above refers to any act that at least reduces parameters related to the state in which a disease is treated by the administration of the composition, such as the severity of symptoms.

[0098] In one embodiment, the cosmetic composition may be prepared in any formulation conventionally manufactured in the technical field to which the present invention belongs. For example, the composition may be formulated into a solution, suspension, emulsion, paste, gel, cream, lotion, powder, soap, surfactant-containing cleansing, oil, powder foundation, emulsion foundation, wax foundation, massage cream, essence, ampoule, skin adhesive type, spray, etc. Specifically, it can be manufactured in formulations such as serums, softening lotions or nourishing lotions, etc., lotions such as facial lotions, nourishing lotions, body lotions, etc., creams such as nourishing creams, moisturizing creams, eye creams, massage creams, etc., essences, cosmetic ointments, sprays, gels, packs, sunscreens, makeup bases, foundations such as liquid type, solid type or spray type, powders, makeup removers such as cleansing creams, cleansing lotions, and cleansing oils, cleansers such as cleansing foams, soaps, and body washes, liquid or gel formulations of mesotherapy that can be injected into the skin layer, and formulations mixed with hyaluronic acid gel.

[0099] In one embodiment, the cosmetic composition may be one or more formulations selected from the group consisting of serum, lotion, essence, paste, mask pack, patch, gel, cream, lotion, nourishing lotion, nourishing cream, moisturizing cream, massage cream, powder, foundation, makeup base, and spray.

[0100] The above cosmetic composition may further comprise any conventional cosmetic ingredient selected from additional ingredients commonly used in cosmetics, such as excipients, thickeners, dispersants, fragrances, fillers, preservatives, antiseptics, neutralizing agents, sweeteners, vitamins, free radical scavengers, metal ion chelating agents, functional ingredients, and mixtures thereof. A person skilled in the art may select any additional ingredient and / or the amount thereof so that the advantageous properties of the composition according to one aspect are not adversely affected or are substantially affected by the expected addition.

[0101] For example, the above excipients may include surfactants, emulsifiers, saponic acids, solvents, coloring agents, preservatives, antioxidants, antifoaming agents, antibacterial agents, anti-redeposition agents, enzymes, plant or mineral oils, fats, fluorescent substances, fungicides, hydrotropism-inducing substances, humectants, fragrances, preservatives, proteins, silicones, solubilizers, sugar derivatives, sunblocks, vitamins, plant extracts, waxes, fatty acids, higher alcohols, hydrocarbon oils, ester oils, triglycerides, vegetable oils, etc.

[0102] In one embodiment, the cosmetic composition may additionally include ingredients typically added to cosmetic compositions, such as purified water, surfactants, moisturizers, lower alcohols, chelating agents, disinfectants, preservatives, antioxidants, stabilizers, solubilizers, vitamins, pigments, and fragrances.

[0103] In addition, the above cosmetic composition may be appropriately formulated with ingredients commonly used in external skin preparations such as cosmetics or pharmaceuticals, for example, aqueous ingredients, oily ingredients, powder ingredients, alcohols, moisturizers, thickeners, UV absorbers, whitening agents, preservatives, antioxidants, surfactants, fragrances, colorants, various skin nutrients, or combinations thereof as needed. The above cosmetic composition may also appropriately incorporate metal chelating agents such as disodium edetate, trisodium edetate, sodium citrate, sodium polyphosphate, sodium metaphosphate, and gluconic acid; caffeine, tannin, bellapamil, licorice extract, glablidin, hot water extract of the fruit of Carin, various herbal medicines, pharmaceuticals such as tocopherol acetate, glycyrrhizic acid, tranexamic acid and its derivatives or salts thereof, vitamin C, magnesium ascorbate phosphate, ascorbate glucoside, arbutin, kojic acid, glucose, fructose, trehalose, etc.

[0104] In the case where the above cosmetic composition is a surfactant-containing cleansing formulation, it may further include aliphatic alcohol sulfate, aliphatic alcohol ether sulfate, sulfosuccinic acid monoester, isethionate, imidazolinium derivative, methyl taurate, sarcosinate, fatty acid amide ether sulfate, alkylamidobetaine, aliphatic alcohol, fatty acid glyceride, fatty acid diethanolamide, vegetable oil, linolin derivative, or ethoxylated glycerol fatty acid ester, etc., as a carrier component.

[0105] In addition, in one embodiment, when the cosmetic composition is in the form of a cream or gel, it may further include animal oil, vegetable oil, wax, paraffin, starch, cellulose derivative, polyethylene glycol, silicone, bentonite, silica, talc, or zinc oxide as a carrier component.

[0106] In addition, if the above cosmetic composition is in the form of a solution or emulsion, it may further include water, ethanol, isopropanol, ethyl carbonate, ethyl acetate, benzyl alcohol, propylene glycol, glycerol aliphatic ester, polyethylene glycol, or fatty acid ester of sorbitan as a solvent, solvating agent, or emulsifying agent.

[0107] In the case where the above cosmetic composition is in the form of a suspension, it may further include, as a carrier component, a liquid diluent such as water, ethanol, or propylene glycol, a suspending agent such as ethoxylated isostearyl alcohol, polyoxyethylene sorbitol ester, and polyoxyethylene sorbitan ester, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar, or tracanth.

[0108] In the case where the above cosmetic composition is in the form of a powder or spray, it may further include lactose, talc, silica, aluminum hydroxide, calcium silicate, or polyamide powder as a carrier component, and in particular, in the case of a spray formulation, it may further include a propellant such as chlorofluorohydrocarbon, propane / butane, or dimethyl ether.

[0109] In addition, in one embodiment, the cosmetic composition may further include an organic sunscreen and / or an inorganic sunscreen.

[0110] The above organic sunscreen may be ethylhexyl methoxycinnamate, bis-ethylhexyloxyphenol methoxyphenyl triazine, ethylhexyl salicylate, butyl methoxydibenzoyl methane, octocrylene, homosalate, isoamyl p-methoxycinnamate, diethylaminohydroxybenzoylhexyl benzoate, phenylbenzimidazole sulfonic acid, etc., and the above inorganic sunscreen may be titanium dioxide, zinc oxide, zinc oxide, etc.

[0111] The above-mentioned sunscreen may be included in an amount of 1 to 50 weight%, 5 to 45 weight%, 5 to 40 weight%, 10 to 30 weight%, or 15 to 25 weight% relative to the total weight of the cosmetic composition.

[0112] The above cosmetic composition may be used by applying it alone or in combination, or by applying it in combination with other cosmetic compositions other than the cosmetic composition according to one aspect. Furthermore, all ingredients included in the above cosmetic composition do not exceed the regulations set by each country. Additionally, the cosmetic composition according to one aspect may be used according to a standard method of use, and the frequency of use may be varied depending on the user's skin condition or preference.

[0113] A cosmetic composition according to another aspect may have a preventive or improving effect on inflammatory diseases or angiogenic diseases by including the above-mentioned oligopeptide, and specifically may inhibit the expression or activity of inflammatory factors or angiogenesis-related factors. Accordingly, the cosmetic composition may be utilized as a cosmetic for the prevention or improvement of inflammatory diseases or angiogenic diseases.

[0114]

[0115] Another aspect is a polynucleotide comprising an oligopeptide consisting of the amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide consisting of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times; or

[0116] A cosmetic composition for the prevention or improvement of inflammatory or angiogenic diseases is provided, comprising an expression vector containing the above-mentioned polynucleotide.

[0117] The above terms, such as "amino acid sequence," "oligopeptide," "polynucleotide," "vector," "inflammatory disease," "angiogenic disease," "prevention," "improvement," and "cosmetic composition," are within the scope described above.

[0118] A cosmetic composition according to another aspect may have a preventive or improving effect on inflammatory diseases or angiogenic diseases by including the above-mentioned oligopeptide, and specifically may inhibit the expression or activity of inflammatory factors or angiogenesis-related factors. Accordingly, the cosmetic composition may be utilized as a cosmetic for the prevention or improvement of inflammatory diseases or angiogenic diseases.

[0119]

[0120] Another aspect provides a method for preventing or treating an inflammatory disease or angiogenic disease, comprising the step of administering to an individual an oligopeptide composed of the amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide having an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times.

[0121]

[0122] Another aspect provides the use of an oligopeptide composed of the amino acid sequence of SEQ ID NO. 1 for the manufacture of a drug for the prevention or treatment of inflammatory diseases or angiogenic diseases, an oligopeptide in which 2 or 3 amino acids are deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide composed of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times.

[0123]

[0124] Another aspect is a polynucleotide encoding an oligopeptide consisting of the amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide consisting of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times; or

[0125] The present invention provides a method for preventing or treating inflammatory or angiogenic diseases, comprising the step of administering an expression vector containing the above-mentioned polynucleotide to an individual.

[0126]

[0127] Another aspect is a polynucleotide encoding an oligopeptide comprising the amino acid sequence of SEQ ID NO. 1 for the manufacture of a drug for the prevention or treatment of an inflammatory disease or an angiogenic disease, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide comprising an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times; or

[0128] The purpose is to provide a use for an expression vector containing the above-mentioned polynucleotide.

[0129]

[0130] A pharmaceutical composition according to one aspect may have a preventive, improving, or therapeutic effect on inflammatory diseases or angiogenic diseases, and specifically may have a therapeutic effect on the disease by inhibiting the expression or activity of inflammatory factors or angiogenesis-related factors. Accordingly, the pharmaceutical composition may be utilized as a drug for the prevention, improvement, or treatment of inflammatory diseases or angiogenic diseases.

[0131]

[0132] Figure 1 is a figure evaluating the cytotoxicity of Rosacea inducer LL-37 and therapeutic agent AdhPep-11 using skin keratinocytes (HaCaT).

[0133] Figure 2 shows the amount of secretion of inflammation-inducing cytokines and angiogenesis-inducing factors measured by ELISA after treating skin keratinocytes (HaCaT) with LL-37 and AdhPep-11 at different concentrations.

[0134] Figure 3 is a figure showing the results of RT-qPCR measuring the mRNA expression levels of inflammatory cytokines, angiogenic factors, and representative rosacea markers after treating skin keratinocytes (HaCaT) with LL-37 and AdhPep-11 at different concentrations.

[0135] Figure 4 shows the results of measuring TLR2-NFκB pathway proteins, a representative signaling pathway of Rosacea, by Western blot after treating skin keratinocytes (HaCaT) with LL-37 and AdhPep-11 at different concentrations.

[0136] Figure 5 is a figure evaluating the cytotoxicity of Rosacea-inducing agent LL-37 and therapeutic agent AdhPep-11 using vascular endothelial cells (HUVEC).

[0137] Figure 6 shows the amount of secretion of angiogenic factors measured by ELISA after treating vascular endothelial cells (HUVEC) with LL-37 and AdhPep-11 at different concentrations.

[0138] Figure 7 shows the results of Western blot analysis of proteins overexpressed in excessive angiogenesis of Rosacea after treating vascular endothelial cells (HUVEC) with LL-37 and AdhPep-11 at different concentrations.

[0139] Figure 8 shows the migration of vascular endothelial cells (HUVEC) after treating them with LL-37 and AdhPep-11 at different concentrations.

[0140] Figure 9 shows the tube-forming ability of vascular endothelial cells (HUVEC) after treating them with LL-37 and AdhPep-11 at different concentrations.

[0141] Figure 10 shows the amount of secretion of inflammatory cytokines and angiogenic factors measured by ELISA after treating skin keratinocytes (HaCaT) with LL-37 and AdhPep-11, AdhPep-11-1, or AdhPep-11-2 at 300 nM.

[0142] Figure 11 shows the amount of secretion of inflammation-causing cytokines and angiogenesis factors measured by ELISA after treating skin keratinocytes (HaCaT) with LL-37 and AdhPep-11, AdhPep-11-P or AdhPep-11-D at 100 nM and 300 nM.

[0143]

[0144] The present invention will be explained in more detail below through examples. However, these examples are intended to illustrate the invention and the scope of the invention is not limited to these examples.

[0145]

[0146] Examples

[0147] Example 1. Synthesis of Peptides

[0148] Peptides were synthesized using the FMOC solid-phase method with an automated synthesizer (PeptrEx-R48, Peptron, Daejeon, South Korea). The synthesized peptides were purified and analyzed using reverse-phase HPLC (Prominence LC-20AB, Shimadzu, Japan) with a C18 analysis RP column (Shiseido Capcell Pak), and identified using a mass spectrometer (HP 1100 Series LC / MSD, Hewlett-Packard, Roseville, USA). Meanwhile, peptides with the amino acid sequence of the identified peptide repeated two or three times were synthesized and purified using the same method, and peptides with two or three amino acids deleted from the N-terminus of the identified peptide's amino acid sequence were synthesized and purified using the same method. The amino acid sequences of the identified peptides are shown in Table 1 below.

[0149] Sequence Number Peptide Name Amino Acid Sequence (Sequence Length) 1AdhPep-11AYDPGYK (7AA) 2AdhPep-11-PPGYK (4AA) 3AdhPep-11-DDPGYK (5AA) 4AdhPep-11-1AYDPGYKAYDPGYK (14AA) 5AdhPep-11-2AYDPGYKAYDPGYKAYDPGYK (21AA)

[0150]

[0151] Example 2. Evaluation of the cytotoxicity of LL-37 or AdhPep-11 in HaCaT (skin keratinocytes)

[0152] A toxicity evaluation of AdhPep-11 of Example 1 and LL-37 (Selleckchem), known as an injection inducer, was conducted in the HaCaT cell line (Thermo Fisher Scientific), which is a human immortalized keratinocyte.

[0153] Specifically, cell culture of the HaCaT cell line was performed in DMEM (Dulbecco's Modified Eagle's Medium) (Welgene) supplemented with fetal bovine serum (FBS; Welgene) and penicillin-streptomycin (Gibco). 1.0 × 10⁶ 4 HaCaT cells were seeded into 96-well plates at a cell / well concentration and cultured in a CO2 incubator at 37°C for 24 hours. Subsequently, 1 μM to 20 μM of LL-37 (Selleckchem) and 1 nM to 10 μM of AdhPep-11 were added, respectively, and cultured in a CO2 incubator at 37°C for 24 hours. Afterward, WST-1 (water-soluble tetrazolium salt) was added at 10% of the culture medium, and the mixture was reacted in a CO2 incubator at 37°C for 1 hour and 30 minutes. Absorbance was measured at 450 nm using a microplate reader (Biotek).

[0154] As a result, there was no significant difference in cell viability between LL-37 and the control group (untreated with LL-37) at concentrations of 1 to 10 μM, but cell viability decreased significantly when treated at 20 μM. From this, it was confirmed that LL-37 did not exhibit cytotoxicity against HaCaT cell lines in the concentration range of 1 to 10 μM (Fig. 1).

[0155] Meanwhile, in the case of AdhPep-11, it was confirmed that there was no significant difference in cell viability compared to AdhPep-11 even when treated at concentrations ranging from 1 nM to 100 μM. From this, it was confirmed that AdhPep-11 does not exhibit cytotoxicity against HaCaT cell lines in the range of 1 nM to 100 μM (Fig. 1). Based on the above results, the concentration of LL-37 in the following experiment was selected as 8 μM.

[0156]

[0157] Example 3. Measurement of injection-related inflammatory factors and angiogenesis-related cytokines and secreted proteins in HaCaT cell lines

[0158] Through the ELISA experiment, injection-related inflammatory factors, angiogenesis-related cytokines, and secreted proteins in HaCaT cells were measured.

[0159] Specifically, HaCaT cells 1.0 x 10 5 Cells were dispensed into 6-well plates at cell / well concentrations and incubated in a 37°C CO2 incubator for 24 hours. Subsequently, AdhPep-11 was added at concentrations ranging from 0 nM to 1 μM, and the cells were incubated in a 37°C CO2 incubator for 2 hours. To induce injection, LL-37 was added at a concentration of 8 μM, and the cells were incubated in a 37°C CO2 incubator for 24 hours. Afterward, the culture medium was separated and centrifuged at 3000 rpm for 7 minutes. The concentrations of inflammatory cytokines TNF-α, IL-1β, IL-6, and IL-8, as well as the concentration of VEGF, an indicator protein of angiogenesis, were measured using an ELISA kit (R&D system). The ELISA assay was performed according to the method provided by the manufacturer.

[0160] As a result, the expression levels of inflammatory cytokines TNF-α, IL-1β, IL-6, and IL-8 were significantly increased by LL-37 treatment compared to the control group, and in the experimental group treated with LL-37 and AdhPep-11 simultaneously, it was confirmed that they decreased compared to the experimental group treated with LL-37 alone. In particular, in the experimental group treated with 100 nM or more of AdhPep-11, it was confirmed that they decreased significantly compared to the group treated with LL-37 alone (Fig. 2).

[0161] Meanwhile, regarding the expression level of vascular endothelial growth factor (VEGF), it was confirmed that, similar to inflammatory cytokines, LL-37 alone increased expression compared to the control group, and simultaneous treatment with LL-37 and AdhPep-11 could inhibit the increase in VEGF expression induced by LL-37. In particular, in the experimental group treated with 100 nM or more of AdhPep-11, it was confirmed that there was a significant decrease compared to the group treated with LL-37 alone (Fig. 2).

[0162] From this, it was confirmed that AdhPep-11 can treat rosacea by suppressing the inflammatory response in the rosacea skin environment induced by LL-37 and by inhibiting angiogenesis through the inhibition of the release of vascular endothelial growth factor.

[0163]

[0164] Example 4. Confirmation of expression of injection-related genes and angiogenesis-related genes in HaCaT cell lines

[0165] Changes in the expression of injection-related inflammatory factors, injection-related genes, and angiogenesis-related genes in HaCaT cells were confirmed through RT-PCR.

[0166] Specifically, HaCaT cells 1.0 x 10 5Cells were dispensed into 6-well plates at cell / well concentrations and incubated in a 37°C CO2 incubator for 24 hours. Subsequently, AdhPep-11 was added at concentrations of 100, 300, or 500 nM and incubated in a 37°C CO2 incubator for 2 hours. To induce injection, LL-37 was added at a concentration of 8 μm and incubated in a 37°C CO2 incubator for 24 hours. Afterward, the medium was removed, RNA was isolated from the cells using Trizol (Invitrogen), and dissolved in 0.1% diethyl pyrocarbonate (DEPC). The total dissolved RNA was quantified using a NanoDrop ND-1000 (NanoDrop Technologies Inc.), and the quantified RNA was synthesized into cDNA using SuperScript II reverse transcriptase (Invitrogen). Gene expression of the synthesized cDNA was analyzed using the BioRad CFX-96 thermal cycler real-time system (Bio-Rad). The genes used were TNF-α, IL-1β, IL-8, KLK5, VEGF, TLR2, IL-6, and GAPDH, and the primer sequences used are shown in Table 2 below.

[0167] Gene Primer Sequences TNF-α Sequence No. 8F (Forward): 5'- CTCTTCTGCCTGCTGCACTTTG-3' Sequence No. 9R (Reverse): 5'- ATGGGCTACAGGCTTGTCACTC-3' IL-1β Sequence No. 10F: 5'- CCACAGACCTTCCAGGAGAATG-3' Sequence No. 11R: 5'- GTGCAGTTCAGTGATCGTACAGG-3' IL-8 Sequence No. 12F: 5'- GAGAGTGATTGAGAGTGGACCAC-3' Sequence No. 13R: 5'- CACAACCCTCTGCACCCAGTTT-3' KLK5 Sequence No. 14F: 5'- CGTCCCACTAAAGATGTCAGACC-3' Sequence No. 15R: 5'- TCAAGCACTGGAGGACCTTAGG-3' VEGF Sequence No. 16F: 5'- TTGCCTTGCTGCTCTACCTCCA-3'Sequence No. 17R: 5'- GATGGCAGTAGCTGCGCTGATA-3'TLR2Sequence No. 18F: 5'- CTTCACTCAGGAGCAGCAAGCA -3'Sequence No. 19R: 5'- ACACCAGTGCTGTCCTGTGACA-3'IL-6Sequence No. 20F: 5'- AGACAGCCACTCACCTCTTCAG -3'Sequence No. 21R: 5'- TTCTGCCAGTGCCTCTTTGCTG -3'

[0168]

[0169] As a result, compared to the control group not treated with LL-37, it was confirmed that the mRNA expression of inflammation-related genes TNF-α, IL-1β, and IL-8 significantly increased in the experimental group treated with LL-37 alone, the mRNA expression of angiogenesis-related gene VEGF significantly increased, and the mRNA expression of injection-related genes TLR2 and KLK5 significantly increased. However, in the experimental group treated with LL-37 and AdhPep-11 simultaneously, it was confirmed that the inflammation-related genes TNF-α, IL-1β, and IL-8, the angiogenesis-related gene VEGF, and the injection-related genes TLR2 and KLK5 all significantly decreased compared to the group treated with LL-37 alone, in all cases where AdhPep-11 was treated at concentrations of 100, 300, and 500 nM (Fig. 3). Meanwhile, when AdhPep-11 alone was applied to cell lines at a concentration of 500 nM, it was confirmed that there was no significant difference in the expression of inflammation-related genes, angiogenesis-related genes, and injection-related genes compared to the control group (Fig. 3).

[0170] From this, it was confirmed that AdhPep-11 can prevent, alleviate, or treat rosacea by suppressing the expression of genes related to inflammation, angiogenesis, and rosacea induced by LL-37.

[0171]

[0172] Example 5. Measurement of injection marker proteins and inflammation-related factors in HaCaT cell lines

[0173] The expression of injection marker proteins and inflammation-related factors in HaCaT cells induced by LL-37 injection was measured via Western blot.

[0174] Specifically, HaCaT cells 1.0 x 10 5Cells were dispensed into 6-well plates at cell / well concentrations and cultured in a 37°C CO2 incubator for 24 hours. Subsequently, AdhPep-11 was treated at concentrations of 100, 300, or 500 nM and cultured in a 37°C CO2 incubator for 2 hours. Then, to induce injection, LL-37 was treated at a concentration of 8 μm and cultured in a 37°C CO2 incubator for 4 or 24 hours.

[0175] Subsequently, the culture medium was removed, and cells were lysed using Lipa buffer (BioSesang) to isolate proteins. The isolated proteins were quantified using the BCA quantification method and loaded onto SDS-PAGE. The loaded proteins were transferred to a membrane and reacted with a primary antibody against an injection marker protein or an inflammation-related factor at 4°C for 16 hours. Afterward, they were reacted with a secondary antibody at room temperature for 2 hours. Subsequently, the membrane was reacted with an ECL solution, and proteins were detected.

[0176] As a result, it was confirmed that the amounts of the injection marker proteins TLR2, MMP9, and KLK5 significantly increased compared to the control group upon treatment with LL-37 alone, and that the phosphorylation of the inflammatory factors IκB-α, p65, and p50 significantly increased. However, in the experimental group treated with LL-37 and AdhPep-11 simultaneously, it was confirmed that the amounts of the injection marker proteins TLR2, MMP9, and KLK5 significantly decreased compared to the LL-37 alone treatment group, and the phosphorylation of the inflammatory factors IκB-α, p65, and p50 significantly decreased when AdhPep-11 was treated at concentrations of 100 or 300 nM (Fig. 4). Meanwhile, when AdhPep-11 was treated alone to the cell line at a concentration of 300 nM, it was confirmed that there was no significant difference between the amounts of the injection marker proteins or the phosphorylated inflammatory factors and the control group (Fig. 4).

[0177] From this, it was confirmed that AdhPep-11 can inhibit the expression of injection marker proteins, the expression of inflammatory factors, and the phosphorylation of inflammatory factors induced by LL-37.

[0178]

[0179] Example 6. Evaluation of toxicity of LL-37 or AdhPep-11 in HUVEC cell lines

[0180] Toxicity evaluation of LL-37 and AdhPep-11 was conducted in human umbilical cord vein endothelial cell (HUVEC) cell lines.

[0181] Specifically, 1.0 × 10 4 HUVEC cells were seeded into each well of a 96-well plate at a cell / well concentration and cultured in a CO2 incubator at 37°C for 24 hours. Subsequently, LL-37 at concentrations of 0 to 20 μM and AdhPep-11 at concentrations of 1 nM to 10 μM were added, respectively, and cultured in a CO2 incubator at 37°C for 24 hours. Then, WST-1 (water-soluble tetrazolium salt) was added at 10% of the culture medium, and the mixture was reacted in a CO2 incubator at 37°C for 1 hour and 30 minutes. Absorbance was measured at 450 nm using a microplate reader (Biotek).

[0182] As a result, it was confirmed that there was no significant difference in the viability of HUVEC cells with LL-37 compared to the control group (untreated with LL-37) up to 1 to 4 μM, but at concentrations of 8 μM or higher, the cell viability decreased significantly compared to the control group. From this, it was confirmed that LL-37 does not exhibit cytotoxicity to HUVEC cells in the concentration range of 4 μM or lower (Fig. 5).

[0183] Meanwhile, in the case of AdhPep-11, it was confirmed that there was no significant difference in cell viability compared to AdhPep-11 even when treated at concentrations ranging from 1 nM to 100 μM. From this, it was confirmed that AdhPep-11 does not exhibit cytotoxicity to HUVEC cell lines in the range of 1 nM to 100 μM (Fig. 5). Based on the above results, the concentration of LL-37 for the following experiment on HUVEC cells was selected as 4 μM.

[0184]

[0185] Example 7. Measurement of angiogenesis-related cytokines and secreted proteins in HUVEC cell lines

[0186] Through ELISA experiments, angiogenesis-related cytokines and secreted proteins were measured in HUVEC cells injected with LL-37.

[0187] Specifically, HUVEC cells 1.0 x 10 5 Cells were dispensed into 6-well plates at cell / well concentrations and incubated in a 37°C CO2 incubator for 24 hours. Subsequently, AdhPep-11 was added at concentrations of 100 nM or 300 nM and incubated in a 37°C CO2 incubator for 2 hours. To induce injection, LL-37 was added at a concentration of 4 μM and incubated in a 37°C CO2 incubator for 24 hours. Afterward, the culture medium was separated, centrifuged at 3000 rpm for 7 minutes, and the secretion levels of angiogenesis-related factors VEGF, IL-6, and IL-8 were measured using an ELISA kit (R&D system). The ELISA assay was performed according to the method provided by the manufacturer.

[0188] As a result, it was confirmed that the secretion levels of VEGF, IL-6, and IL-8 factors significantly increased with treatment with LL-37 compared to the control group, and in the experimental group treated with LL-37 and AdhPep-11 simultaneously, it was confirmed that they decreased compared to the experimental group treated with LL-37 alone (Fig. 6). Meanwhile, when AdhPep-11 alone was treated to the cell line at a concentration of 300 nM, it was confirmed that there was no significant difference in the amount of angiogenesis-related factors compared to the control group (Fig. 6).

[0189] From this, it was confirmed that AdhPep-11 can prevent, alleviate, or treat excessive angiogenesis in rosacea-induced skin by inhibiting the secretion of angiogenic factors induced by LL-37.

[0190]

[0191] Example 8. Measurement of angiogenic proteins in HUVEC cell lines

[0192] The expression of injection-induced angiogenesis-related proteins in HUVEC cells induced by LL-37 injection was measured via Western blot.

[0193] Specifically, HUVEC cells 1.0 x 10 5 Cells were dispensed into 6-well plates at cell / well concentrations and cultured in a 37°C CO2 incubator for 24 hours. Subsequently, AdhPep-11 was treated at a concentration of 100 nM or 300 nM and cultured in a 37°C CO2 incubator for 2 hours. Then, to induce injection, LL-37 was treated at a concentration of 4 μm and cultured in a 37°C CO2 incubator for 4 hours or 24 hours.

[0194] Subsequently, the culture medium was removed, and cells were lysed using Lipa buffer (BioSesang) to isolate proteins. The isolated proteins were quantified using the BCA quantification method and loaded onto SDS-PAGE. The loaded proteins were transferred to a membrane and reacted with a primary antibody against an injection marker protein or an inflammation-related factor at 4°C for 16 hours. Afterward, they were reacted with a secondary antibody at room temperature for 2 hours. Subsequently, the membrane was reacted with an ECL solution, and proteins were detected.

[0195] As a result, it was confirmed that the amounts of CD31, TGF-β, and VEGF-A proteins, whose expression increases with the progression of angiogenesis, increased compared to the control group upon treatment with LL-37 alone. On the other hand, in the experimental group treated with LL-37 and AdhPep-11 simultaneously, it was confirmed that the amounts of CD31, TGF-β, and VEGF-A proteins significantly decreased compared to the LL-37 alone treatment group in both cases where AdhPep-11 was treated at a concentration of 100 or 300 nM (Fig. 7). Meanwhile, it was confirmed that when AdhPep-11 alone was treated to the cell line at a concentration of 300 nM, there was no significant difference in the amounts of angiogenesis-related proteins compared to the control group (Fig. 7).

[0196] From this, it was confirmed that AdhPep-11 can inhibit excessive angiogenesis induced by LL-37 in injections.

[0197]

[0198] Example 9. Measurement of cell migration in HUVEC cell lines

[0199] Changes in cell migration in HUVEC cells induced by LL-37 injection were measured through a scratch migration assay.

[0200] Specifically, HUVEC cells 2.0 x 10 5Cells were dispensed into 24-well plates at a cell / well concentration and cultured in a 37°C CO2 incubator for 24 hours. Subsequently, when the cell confluency reached 100%, a straight-line scratch was applied using a 100 μL pipette tip. Afterward, floating cells were removed by washing three times with DPBS, injection was induced by treatment with LL-37 at a concentration of 4 μM, and simultaneously treated with AdhPep-11 at a concentration of 100 nM or 300 nM, followed by incubation in a 37°C CO2 incubator for 16 hours. Afterward, the scratch area was photographed to evaluate the degree of cell migration, and the migration distance was quantified using Image J software.

[0201] As a result, it was confirmed that the scratch space was significantly reduced compared to the control group by LL-37 treatment alone, indicating an increase in cell migration. On the other hand, when AdhPep-11 and LL-37 were treated simultaneously, it was confirmed that cell migration was mitigated in both experimental groups treated with AdhPep-11 at concentrations of 100 nM or 300 nM compared to the LL-37 treatment group alone (Fig. 8).

[0202] From this, it was confirmed that AdhPep-11 can alleviate excessive cell migration in angiogenesis induced by LL-37, and accordingly, it was confirmed that AdhPep-11 is effective in the prevention, alleviation, or treatment of rosacea.

[0203]

[0204] Example 10. Measurement of tube-forming ability in HUVEC cell lines

[0205] As an experiment to evaluate angiogenic ability, the tube formation ability in HUVEC cells injected with LL-37 was measured through a tube formation assay.

[0206] Specifically, 50 μL of Geltrex (Thermo) was dispensed into each well of a 96-well plate and incubated at 37 °C. Subsequently, HUVEC cells were placed in each well at a volume of 2.0 × 10⁻¹⁰ 4 The tubes were dispensed. Subsequently, LL-37 at a concentration of 4 μM was treated, and simultaneously, AdhPep-11 at a concentration of 100 nM or 300 nM was treated, followed by incubation in a 37 ℃ CO2 incubator for 16 hours. The tubes formed after the reaction were observed under a microscope, and the number of nodes, master junctions, and tubes was quantified using Image J software.

[0207] As a result, it was confirmed that LL-37 treatment alone significantly increased tube formation compared to the control group, and increased junction and intersection formation. On the other hand, when AdhPep-11 and LL-37 were treated simultaneously, it was confirmed that in both experimental groups treated with AdhPep-11 at concentrations of 100 nM or 300 nM, tube formation, junction formation, and intersection formation were significantly reduced compared to the LL-37 treatment group (Fig. 9).

[0208] From this, it was confirmed that AdhPep-11 can inhibit angiogenesis induced by LL-37 and alleviate angiogenesis, a representative characteristic of rosacea, thereby being effective in preventing, alleviating, or treating skin redness.

[0209]

[0210] Example 11. Measurement of injection-related inflammatory factors and angiogenesis-related cytokines and secreted proteins in HaCaT cell lines following treatment with AdhPep-11-1 or AdhPep-11-2

[0211] Injection-related inflammatory factors, angiogenesis-related cytokines, and secreted proteins in HaCaT cells were measured through ELISA experiments.

[0212] Specifically, HaCaT cells 1.0 × 10 5 Cells were dispensed into a 6-well plate at a cell / well concentration and cultured in a 37°C CO2 incubator for 24 hours. Subsequently, AdhPep-11, AdhPep-11-1, or AdhPep-11-2 from Example 1 were each treated at a concentration of 300 nM and cultured in a 37°C CO2 incubator for 2 hours. Then, to induce injection, LL-37 at a concentration of 8 μM was treated and cultured in a 37°C CO2 incubator for 24 hours. Afterward, the culture medium was separated, centrifuged at 3000 rpm for 7 minutes, and the concentrations of the inflammatory cytokine IL-8 and the angiogenesis marker protein VEGF were measured using an ELISA kit (R&D system). The ELISA test was performed according to the method provided by the manufacturer.

[0213] As a result, the expression levels of IL-8 and VEGF were significantly increased by LL-37 treatment compared to the control group, and as confirmed in Example 2 above, it was confirmed that when AdhPep-11 was treated, the expression levels decreased compared to the experimental group treated with LL-37 alone. Meanwhile, when AdhPep-11-1 and AdhPep-11-2, which are peptides with the amino acid sequence of AdhPep-11 repeated 2 or 3 times, were treated, it was confirmed that they had VEGF and IL-8 inhibitory effects similar to those of the AdhPep-11 treatment group (Fig. 10).

[0214] From this, it was confirmed that an oligopeptide with the amino acid sequence of AdhPep11 repeated 2 to 3 times can inhibit IL-8 and VEGF similarly to the AdhPep-11 peptide, thereby confirming that it can prevent or treat inflammatory diseases or angiogenic diseases.

[0215]

[0216] Example 12. Measurement of injection-related inflammatory factors and angiogenesis-related cytokines and secreted proteins in HaCaT cell lines following treatment with AdhPep-11-P or AdhPep-11-D

[0217] Through ELISA experiments, the measurement of injection-related inflammatory factors and angiogenesis-related secreted proteins in HaCaT cells was performed in the same manner as in Example 11, except that 100 nM or 300 nM of AdhPep-11-P (sequence: PGYK) or AdhPep-11-D (sequence: DPGYK), respectively, was applied.

[0218] As a result, it was confirmed that treatment with AdhPep-11-P could suppress the secretion of VEGF and IL-8 to a level similar to that of the experimental group treated with AdhPep-11, in comparison to the increased secretion of VEGF and IL-8 caused by LL-37 treatment. In addition, it was confirmed that the amount of VEGF and IL-8 decreased when AdhPep-11-D was treated compared to when LL-37 was treated alone (Fig. 11).

[0219] Through this, it was confirmed that a peptide with 2 or 3 amino acids deleted from the N-terminus of AdhPep-11 can inhibit IL-8 and VEGF similarly to the AdhPep-11 peptide, thereby confirming that it can prevent or treat inflammatory diseases or angiogenic diseases.

Claims

1. A pharmaceutical composition for the prevention or treatment of inflammatory or angiogenic diseases, comprising an oligopeptide having an amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide having an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times.

2. A pharmaceutical composition according to claim 1, wherein the oligopeptide composed of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times is an oligopeptide composed of the amino acid sequence of SEQ ID NO. 4 or an oligopeptide composed of the amino acid sequence of SEQ ID NO.

5.

3. A pharmaceutical composition according to claim 1, wherein the inflammatory disease or angiogenic disease is caused by an increase in the activity or expression of one or more selected from the group consisting of Interleukin-8, Interleukin-6, Interleukin-1beta, Tumor necrosis factor-α (TNF-α), Toll-like receptor 2 (TLR2), NF-κB inhibitor alpha (iκb α), Matrix Metalloproteinase-9 (MMP 9), Vascular Endothelial Growth Factor (VEGF), and Kallikrein-related peptidase 5 (KLK5).

4. A pharmaceutical composition according to claim 1, wherein the inflammatory disease or neovascular disease is selected from the group consisting of rosacea, flushing, dermatitis, seborrheic dermatitis, pruritus, atopic dermatitis, dry eczema, urticaria, psoriasis, erythema, solid tumor, hematological cancer, multiple myeloma, brain tumor, macular degeneration, retinopathy, glaucoma, macular degeneration, rheumatoid arthritis, psoriasis, rosacea, hemangioma, Kaposi's sarcoma, inflammatory bowel disease, lupus, endometriosis, bronchitis, hypertension, atherosclerosis, and ulcer.

5. A pharmaceutical composition according to claim 1, wherein the inflammatory disease or angiogenic disease is selected from the group consisting of lung cancer, breast cancer, prostate cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, kidney cancer, bladder cancer, cervical cancer, ovarian cancer, esophageal cancer, head and neck cancer, melanoma, thyroid cancer, gallbladder cancer, pancreatic cancer, sarcoma, testicular cancer, leukemia, lymphoma, multiple myeloma, myelodysplastic syndrome, and myeloproliferative tumor.

6. A pharmaceutical composition according to claim 1, wherein the inflammatory disease or angiogenic disease is one in which the activity of Vascular Endothelial Growth Factor (VEGF) is increased or overexpressed.

7. A pharmaceutical composition according to claim 1, wherein the composition comprises the oligopeptide in an amount of 10 nM to 1000 μM.

8. A cosmetic composition for the prevention or improvement of inflammatory or angiogenic diseases, comprising an oligopeptide having an amino acid sequence of SEQ ID NO. 1, an oligopeptide having 2 or 3 amino acids deleted from the N-terminus of the amino acid sequence of SEQ ID NO. 1, or an oligopeptide having an amino acid sequence having the amino acid sequence of SEQ ID NO. 1 repeated 2 to 5 times.

9. A cosmetic composition according to claim 8, wherein the oligopeptide composed of an amino acid sequence in which the amino acid sequence of SEQ ID NO. 1 is repeated 2 to 5 times is an oligopeptide composed of the amino acid sequence of SEQ ID NO. 4 or an oligopeptide composed of the amino acid sequence of SEQ ID NO.

5.

10. The cosmetic composition of claim 8, wherein the cosmetic composition is one or more formulations selected from the group consisting of serum, lotion, essence, paste, mask pack, patch, gel, cream, lotion, nourishing lotion, nourishing cream, moisturizing cream, massage cream, powder, foundation, makeup base, and spray.

Images