Alzheimer's disease model mouse and preparation method therefor

WO2026168964A1PCT designated stage Publication Date: 2026-08-13UNIV OF SEOUL IND COOP FOUND +2
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-02-04
Publication Date
2026-08-13

Smart Images

  • Figure KR2026002067_13082026_PF_FP_ABST
    Figure KR2026002067_13082026_PF_FP_ABST
Patent Text Reader

Abstract

The present invention relates to an Alzheimer's disease model mouse and a preparation method therefor and, specifically, to a transformation vector comprising a sequence encoding at least one selected from the group consisting of a Mest gene expression inhibitor, a Mest protein activity inhibitor, and a Mest gene mutagen, and an Alzheimer's disease model mouse transformed using same. In the Alzheimer's disease model mouse of the present invention, inhibition of Mest expression in the cerebral cortex and hippocampus causes material transport defects in nerve cells, thereby inducing neurodegeneration and cognitive impairment. Since dementia is induced in the Alzheimer's disease model mouse of the present invention through a novel mechanism different from those of conventional Alzheimer's disease model animals, it may contribute to the verification and development of novel drugs whose efficacy could not be validated using conventional models.
Need to check novelty before this filing date? Find Prior Art

Description

Alzheimer's disease model mouse and method for manufacturing the same

[0001] The present invention claims the benefit of the filing date of Korean Patent Application No. 10-2025-0014420 filed with the Korean Intellectual Property Office on February 5, 2025, and the entire contents thereof are incorporated into the present invention.

[0002] The present invention relates to an Alzheimer's disease model mouse and a method for manufacturing the same.

[0003] Mest (Mesoderm-specific transcript) is an imprinting gene expressed only in paternal alleles. During developmental stages, Mest is primarily expressed in the mesoderm and mesoderm-derived tissues; after growth is complete, Mest mRNA expression is low in most tissues but relatively high in specific brain regions such as the hypothalamus, amygdala, and olfactory bulb, as well as in the lungs and motor neuron axons. Mest mRNA was first detected in the embryonic and extraembryonic mesoderms of mouse embryos during the gastrula stage. Lefebvre et al. (1998) reported that Mest-deficient mice exhibited growth retardation after birth, and that female mice deficient in Mest did not display normal maternal behaviors such as placentophagia or caring for their offspring after birth, suggesting that these effects were due to central nervous system or behavioral defects.

[0004] In developing mouse embryos, neurons migrate in two ways: one is radial migration and the other is tangential migration. However, Ji et al. (2017) reported that when the Mest gene was inhibited in developing mouse embryos, radial migration of neurons was inhibited and tangential migration was increased. Additionally, Mesman et al. (2017) reported that the Mest gene is essential for the development and maintenance of dopamine neurons in the substantia nigra of the midbrain, stating that in Mest-deficient mice, dopamine neurons were gradually lost, leading to decreased dopamine levels and reduced activity scores on the Climbing Test.

[0005] Meanwhile, Alzheimer's disease (AD) is the most common form of dementia and is a degenerative disease in which brain nerve cells gradually die as amyloid beta (Aβ) and tau proteins (τ) accumulate in the brain. The cause of Alzheimer's disease is not yet fully understood, and symptoms include short-term memory loss, language disorders, long-term memory loss, apraxia, agnosia, impaired judgment, and depression. Although the cause of Alzheimer's disease has not yet been identified, mutations in the APP gene, PS1 gene, and PS2 gene are known to cause familial Alzheimer's disease, and there is a hypothesis that abnormalities in cholinergic neurotransmitters, Aβ deposits, or tau proteins cause Alzheimer's disease.

[0006] Treatments for Alzheimer's disease that eliminate the underlying cause or inhibit disease progression have not yet been developed, and all treatments devised to date are merely symptomatic. Focus is placed on enhancing cholinergic neurotransmission using acetylcholinesterase inhibitors, and NMDA receptor blockers are also used. Additionally, antidepressants and antipsychotic drugs are used to treat psychiatric symptoms caused by dementia.

[0007] Antibody therapies such as recanemab and donanemab, which have recently received FDA approval, are effective in removing Aβ deposits accumulated in the brains of Alzheimer's dementia patients; however, they carry the potential for serious side effects such as cerebral edema, and their efficacy is limited to patients with early-stage disease. In clinical practice, cases are frequently reported where Aβ removal is clearly observed upon administration of these antibody therapies, but significant alleviation of clinical symptoms is not accompanied. Furthermore, despite being expensive drugs, the effect of delaying disease progression is known to last only about six months, necessitating a reassessment of their clinical utility.

[0008] Therefore, further research is needed to identify the causes of Alzheimer's disease or to find treatments, and to this end, it is necessary to secure Alzheimer's disease model animals that are as similar as possible to patients with Alzheimer's disease.

[0009] It has been revealed that Mest is associated with the neurodegeneration of Alzheimer's disease, and Prasad et al. (2021) reported that Mest expression is suppressed in the brains of Alzheimer's patients because the Mest gene promoter is hypermethylated. When Mest expression was suppressed in mouse hippocampal neurons, hyperphosphorylation was observed in the Ser199 and Thr231 residues of the tau protein, and it was confirmed that the expression of the tau protein itself increased.

[0010] Against this backdrop, the inventor of the present invention developed a new mouse model for Alzheimer's disease using shMest, and through this, aimed to contribute to the development of new drugs for dementia induced by a novel mechanism.

[0011]

[0012] The object of the present invention is to provide a transformation vector comprising a sequence encoding one or more selected from the group consisting of Mest gene expression inhibitors, Mest protein activity inhibitors, and Mest gene mutagenic agents.

[0013] Another objective of the present invention is to provide an Alzheimer's disease model mouse transformed with the above-mentioned transformation vector.

[0014] Another objective of the present invention is to provide a method for producing an Alzheimer's disease model animal, comprising the steps of: preparing the transformation vector; introducing the transformation vector into a fertilized egg or embryo in the pronuclear stage; and implanting the fertilized egg or embryo into a surrogate mother to induce development.

[0015]

[0016] One aspect of the present invention is a transformation vector comprising a sequence encoding one or more selected from the group consisting of a Mest gene expression inhibitor, a Mest protein activity inhibitor, and a Mest gene mutagenic agent.

[0017] The above Mest protein activity inhibitor is one that causes blocking of substrate binding of Mest protein, changes in the three-dimensional structure of Mest protein, post-translational modification, or protein degradation, and the above Mest protein activity inhibitor may be selected from the group consisting of peptides, peptide mimics, substrate analogs, aptamers, antibodies, and enzymes, but is not limited thereto.

[0018] The above-mentioned Mest gene mutagenic agent may be a ribonucleoprotein complex of a guide RNA and an endonuclease protein specific to the target base sequence of the Mest gene, but is not limited thereto.

[0019] Another aspect of the present invention is an Alzheimer's disease model animal transformed with a transformation vector comprising a sequence encoding one or more selected from the group consisting of a Mest gene expression inhibitor, a Mest protein activity inhibitor, and a Mest gene mutagenic agent.

[0020] Another aspect of the present invention is the step of (1) preparing a transformation vector comprising a sequence encoding one or more selected from the group consisting of a Mest gene expression inhibitor, a Mest protein activity inhibitor, and a Mest gene mutagenic agent;

[0021] (2) a step of introducing the above-mentioned transformation vector into a fertilized egg or embryo at the pronuclear stage; and

[0022] (3) A step of inducing development by implanting the above-mentioned fertilized egg or embryo into a surrogate mother; is a method for manufacturing an Alzheimer's disease model animal.

[0023]

[0024] The present invention relates to an Alzheimer's disease model mouse and a method for producing the same. Specifically, the Alzheimer's disease model mouse of the present invention is characterized by neurodegeneration induced by material transport defects in the dendrites and axons of neurons resulting from decreased Mest expression in neurons of the cerebral cortex and hippocampus. Similar to patients with Alzheimer's dementia, the Alzheimer's disease model mouse of the present invention exhibits increased expression and phosphorylation levels of tau protein, as well as anxiety symptoms and cognitive impairment.

[0025] Therefore, the Alzheimer's disease model mouse of the present invention is expected to contribute to the improvement of human health by enabling the verification of the efficacy of new drugs that could not be verified in existing model animals due to differences in developmental mechanisms, unlike existing Alzheimer's disease model animals, by enabling verification of the efficacy of new drugs.

[0026]

[0027] Figure 1 is a schematic diagram showing that the accumulation of amyloid beta leads to reduced Mest expression and neurofibrillary tangles.

[0028] Figure 2 shows the Western blot results for Mest expression in the cerebral cortex of 5X FAD transgenic mice.

[0029] Figure 3 shows the results of immunofluorescence analysis on Mest expression in the cerebral cortex of APP / PS1 transgenic mice.

[0030] Figure 4 shows the Western blot results for Mest expression after treating differentiated SH-SY5Y cells with amyloid beta.

[0031] Figure 5 shows the results of immunofluorescence analysis after transforming primary cerebral cortex neurons with the shMest gene, showing a decrease in Mest expression and induction of neurodegeneration.

[0032] Figure 6 shows the results of immunofluorescence analysis for Mest protein and MAP2 protein in primary cerebral cortex neurons.

[0033] Figure 7 shows candidate proteins expected to interact with Mest and the results of their co-immunoprecipitation analysis.

[0034] Figure 8 shows the results of an indirect immunofluorescence analysis of the binding of Mest and the kinesin complex proteins KIF5B, KIF5C, and COPG2.

[0035] Figure 9 shows the results of a proximity ligation analysis of the binding of Mest and the kinesin complex proteins KIF5B, KIF5C, and COPG2.

[0036] Figure 10 shows the results of Mest mRNA analysis by qRT-PCR after transducing AAV-U6-shMest into primary cerebral cortex neurons cultured on a solid medium.

[0037] Figure 11a shows the results of a proximity ligation analysis showing that the binding of Mest and KIF5B to both the cell body (Soma) and dendrites was reduced by shMest transformation in primary cerebral cortex neurons, and Figure 11b shows the results showing the inhibition of mitochondria migration distance and speed through dendrites by shMest transformation.

[0038] Figure 12 is a schematic diagram of a shMest transgenic mouse (CamKIIα-Cre;shMest) produced using the CamKIIα-Cre system.

[0039] Figure 13 shows the results of Western blot analysis by brain region of shMest transgenic mice.

[0040] Figure 14 shows the results of an immunofluorescence analysis showing neurodegeneration and tau protein phosphorylation in shMest transgenic mice.

[0041] Figure 15 is a Western blot result confirming changes in the expression and phosphorylation of tau protein in the cerebral cortex of shMest transgenic mice.

[0042] Figure 16 shows the results of an immunofluorescence analysis confirming changes in the phosphorylation of tau protein in shMest transgenic mice.

[0043] Figure 17 shows the results of behavioral experiments and cognitive memory measurement experiments on shMest transgenic mice.

[0044] Figure 18 shows the results of behavioral experiments and cognitive memory measurement experiments on transgenic mice into which shMest was introduced via AAV-CamK2a-Cre.

[0045] Figure 19 shows the results of immunofluorescence analysis, behavioral experiments, and cognitive memory measurement experiments showing increased tau protein phosphorylation in transgenic mice in which shMest was introduced into neurons of the medial prefrontal cortex (mPFC).

[0046] Figure 20 shows the RNA sequencing and qRT-PCR results for shMest transgenic mice.

[0047] Figure 21 shows the results of normalizing and comparing qRT-PCR results for shMest transgenic mice.

[0048] Figure 22 is a plasmid map containing the components of the pSico vector and the restriction enzyme cleavage site.

[0049] Figure 23 is a map of the pSico shMest1 vector plasmid in which the shMest1 gene is introduced into the pSico vector.

[0050] Figure 24 shows the results of electrophoresis after cleaving the pSico shMest1 vector with DraIII restriction enzyme.

[0051] Figure 25 shows the result of performing PCR using primers to confirm whether transformation occurred, and Figure 26 shows the shMest1-related region sequence amplified by PCR.

[0052] Figure 27 is sequencing data obtained from mice transformed with shMest1.

[0053]

[0054] One aspect of the present invention is a transformation vector comprising a sequence encoding one or more selected from the group consisting of a Mest gene expression inhibitor, a Mest protein activity inhibitor, and a Mest gene mutagenic agent.

[0055] The term "Mest gene" as used in this invention refers to the sequence encoding the Mest protein. The Mest (Mesoderm-specific transcript) protein is one of the imprinted genes expressed only in the paternal allele; during the developmental stage, it is primarily expressed in mesoderm tissues, but after reaching adulthood, it is primarily expressed in specific regions such as the hypothalamus, amygdala, and olfactory bulb. In humans, the Mest gene is located on chromosome 7, while in mice, it is located on chromosome 6.

[0056] The inventors of the present invention have confirmed that the Mest protein is a protein that interacts with the kinesin complex involved in material transport. In particular, it has been confirmed that the Mest protein binds to proteins such as KIF5B, KIF5C, KIFC, and COPG2. Furthermore, since Mest is a protein primarily expressed in neurons, it plays an important role in material transport in the dendrites and axons of neurons, and it has been confirmed that neurodegeneration may occur if Mest expression is not properly achieved. The Mest protein may include the amino acid sequence of SEQ ID NO. 5, but is not limited thereto.

[0057] The above Mest gene expression inhibitor may have the broadest meaning, including all substances capable of inhibiting expression by acting on one or more stages of the Mest protein expression process. Specifically, the above Mest gene expression inhibitor inhibits expression by binding complementarily to mRNA for the sequence of the Mest gene, a sequence complementary to the sequence of the Mest gene, or a fragment of the sequence of the Mest gene, and may be selected from the group consisting of antisense nucleotides, small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), antisense oligonucleotides (ASO), ribozymes, and deoxyribozymes, but is not limited thereto.

[0058] The above antisense nucleotide binds (hybridizes) to the complementary base sequence of DNA, immature mRNA, or mature mRNA as defined by Watson-Crick base pairs, thereby interfering with the flow of genetic information from DNA to protein.

[0059] The above siRNA may consist of a sense sequence selected within the nucleotide sequence of the mRNA of a gene encoding the Mest protein and an antisense sequence that binds complementarily to the sense sequence. The sense sequence may be selected to have a length of 15 to 30 mer, but is not limited thereto.

[0060] The term "short hairpin RNA (shRNA)" used in the present invention refers to a short double-stranded chain whose loop is cleaved by Dicer and which binds to RISC, similar to siRNA, to exhibit RNA interference (RNAi) phenomena. shRNA has a stem-loop structure, in which a long RNA of 19 to 29 nucleotides forms base pairs complementarily on both sides of a loop of 5 to 10 nucleotides to form a double-stranded stem. shRNA is synthesized by transcription within the cell via the RNA polymerase III (pol III) promoter, and subsequently, the loop of shRNA is cleaved by Dicer and acts with RISC, similar to siRNA.

[0061] The short hairpin RNA may contain the nucleotide sequence of SEQ ID NO. 1 or 2. In this case, when the short hairpin RNA is expressed in a mouse, the Mest mRNA level may be reduced to less than half (0.1 to 50% compared to the control group).

[0062] The above Mest protein activity inhibitor is one that causes blocking of substrate binding of Mest protein, changes in the three-dimensional structure of Mest protein, post-translational modification, or protein degradation, and the above Mest protein activity inhibitor may be selected from the group consisting of peptides, peptide mimics, substrate analogs, aptamers, antibodies, and enzymes, but is not limited thereto.

[0063] The above aptamer is a single-stranded DNA or RNA molecule, and can be obtained by isolating oligomers that bind with high affinity and selectivity to specific chemical or biological molecules through an evolutionary method using an oligonucleotide library called SELEX (systematic evolution of ligands by exponential enrichment). Aptamers can specifically bind to a target and modulate the activity of the target, for example, by blocking the function of the target through binding.

[0064] The above-mentioned Mest gene mutagenic agent may be a ribonucleoprotein complex of a guide RNA and an endonuclease protein specific to the target base sequence of the Mest gene, but is not limited thereto.

[0065] The term "target nucleotide sequence" as used in the present invention refers to a portion of DNA within the genome of an animal intended to induce a mutation, and may include both coding and non-coding regions. A person skilled in the art may select the target nucleotide sequence according to the desired mutation for the animal to be manufactured, depending on the purpose.

[0066] The term 'guide RNA' as used in the present invention refers to RNA specific to DNA encoding the base sequence of a target gene, and refers to a ribonucleic acid that binds wholly or partially complementarily to the target DNA base sequence to guide an endonuclease protein to the corresponding target DNA base sequence. The guide RNA refers to a dual RNA comprising two RNAs, namely crRNA (CRISPR RNA) and tracrRNA (trans-activating crRNA), as components; or a single-stranded guide RNA (sgRNA) form comprising a first region containing a sequence wholly or partially complementary to the base sequence within the target gene and a second region containing a sequence that interacts with the RNA-guide nuclease. However, any form capable of having activity at the target base sequence may be included within the scope of the present invention without limitation, and may be appropriately selected according to known techniques in the art, taking into account the type of endonuclease used together or the microorganism from which the endonuclease originates.

[0067] In addition, the guide RNA may be transcribed from a plasmid template, transcribed in vitro (e.g., oligonucleotide double strand), or synthesized guide RNA, but is not limited thereto.

[0068] The above endonuclease protein may be one or more selected from the group consisting of Cas9, Cpf1 (CRISPR from Prevotella and Francisella 1), TALEN (Transcription activator-like effector nuclease), ZFN (Zinc Finger Nuclease), or functional analogs thereof, and preferably may be Cas9, but is not limited thereto.

[0069] In addition, the above Cas9 may be one or more selected from the group consisting of Cas9 derived from Streptococcus pyogenes, Cas9 derived from Campylobacter jejuni, Cas9 derived from Streptococcus thermophilus or Streptococcus aureus, Cas9 derived from Neisseria meningitidis, Cas9 derived from Pasteurella multocida, Cas9 derived from Francisella novicida, etc., but is not limited thereto. Cas9 or its genetic information can be obtained from known databases such as GenBank of the NCBI (National Center for Biotechnology Information).

[0070] Cas9 is an RNA-guided DNA endonuclease enzyme that induces double-stranded DNA breaks. For Cas9 to accurately bind to a target sequence and cut a DNA strand, a short sequence of three bases known as a PAM (Protospacer Adjacent Motif) must be present next to the target sequence, and the Cas9 protein estimates and cuts between the third and fourth base pairs from the PAM sequence (NGG).

[0071] In the transformation vector according to the present invention, the guide RNA and the endonuclease protein can form a ribonucleoprotein complex and function as an RNA-Guided Engineered Nuclease (RGEN).

[0072] The above-mentioned transformation vector may further include a promoter.

[0073] The above promoter may be operablely connected to the above-mentioned coding sequence.

[0074] The above promoter may be connected to the coding sequence so as to be operable after additional manipulation. For example, if the promoter and the coding sequence are connected with two LoxP sites inserted between them, the Cre recombinase must be expressed to be operable.

[0075] The above promoter may be a promoter specifically expressed in neurons of the cerebral cortex. For example, the above promoter may be a CamKIIα promoter, an NSE promoter, a BAI1-AP4 promoter, or a Syn1 promoter, but is not limited thereto, and any promoter specifically expressed in neurons of the cerebral cortex known in the art may be selected by a person skilled in the art as needed.

[0076] The term "specifically expressed in" as used in this invention refers to a gene being expressed only in specific tissues or cells and not in other tissues or cells, or the amount of expression in specific tissues or cells being relatively higher than in other tissues or cells.

[0077] The above vector may be selected from the group consisting of plasmid vectors, bacteriophage vectors, phagemid vectors, cosmid vectors, and viral vectors, but is not limited thereto.

[0078] The term "vector" as used in the present invention refers to a means for expressing a target gene in a host cell. The vector may be constructed by manipulating plasmids commonly used in the art (e.g., pSC101, pGV1106, pACYC177, ColE1, pKT230, pME290, pBR322, pUC8 / 9, pUC6, pBD9, pHC79, pIJ61, pLAFR1, pHV14, pRadgro, pKM212 series, pGEX series, pET series, and pUC19, etc.), phages (e.g., λgt4λB, λ-Charon, λΔz1, and M13, etc.), or viruses (e.g., SV40, etc.), and may be constructed by manipulating, for example, pBI-sense or antisense GW vectors, but is not limited thereto. Preferably, the vector may be pSico.

[0079] Vectors can typically be constructed as vectors for cloning or vectors for expression. Vectors for expression may use conventional ones used in the art to express foreign proteins in plants, animals, or microorganisms, and can be constructed through various methods known in the art.

[0080] The above vector may be constructed using a prokaryotic cell or a eukaryotic cell as a host. For example, when the vector used is an expression vector and the prokaryotic cell is the host, it generally includes a potent promoter capable of proceeding transcription (e.g., pLλ promoter, CMV promoter, trp promoter, lac promoter, tac promoter, T7 promoter, etc.), a ribosome binding site for initiating translation, and a transcription / translation termination sequence. When the eukaryotic cell is the host, the replication origins included in the vector that operate in eukaryotic cells include, but are not limited to, f1 replication origins, SV40 replication origins, pMB1 replication origins, adeno replication origins, AAV replication origins, and BBV replication origins. In addition, promoters derived from the genome of mammalian cells (e.g., metallothionine promoters) or promoters derived from mammalian viruses (e.g., adenovirus late promoters, vaccinia virus 7.5K promoters, SV40 promoters, cytomegalovirus promoters, and HSV tk promoters) may be used and generally have a polyadenylation sequence as a transcription termination sequence.

[0081] A transformant can be produced by inserting the above vector into a host cell, and the transformant may be obtained by introducing the vector into a suitable host cell. Any host cell known in the art may be used as a cell capable of stably and continuously cloning or expressing the above expression vector.

[0082] When transforming into a eukaryotic cell to produce a recombinant microorganism, yeast (Saccharomyces cerevisiae), insect cells, plant cells, and animal cells may be used as host cells, such as Sp2 / 0, CHO (Chinese hamster ovary) K1, CHO DG44, PER.C6, W138, BHK, COS7, 293, HepG2, Huh7, 3T3, RIN, MDCK cell lines, but are not limited thereto.

[0083] To introduce a vector into a host cell, a delivery method widely known in the art may be used. For example, if the host cell is a prokaryotic cell, methods such as conjugation, the CaCl2 method, or electroporation may be used, and if the host cell is a eukaryotic cell, methods such as microinjection, viral vector method, Agrobacterium-mediated transformation, calcium phosphate precipitation method, electroporation, liposome-mediated transfection method, and gene bombardment may be used, but are not limited thereto.

[0084] As the above expression vector, a transient expression vector capable of temporarily expressing the foreign gene in an individual into which the foreign gene has been introduced, or an expression vector capable of permanently expressing the foreign gene in an individual into which the foreign gene has been introduced, may be used.

[0085] In summary, when transformation is performed on a specific individual using the transformation vector of the present invention, the expression of Mest in the individual is suppressed, the activity of the expressed Mest does not appear properly, or a mutated Mest is expressed.

[0086]

[0087] Another aspect of the present invention is an Alzheimer's disease model animal transformed with a transformation vector comprising a sequence encoding one or more selected from the group consisting of a Mest gene expression inhibitor, a Mest protein activity inhibitor, and a Mest gene mutagenic agent.

[0088] The descriptions of the above Mest gene expression inhibitor, Mest protein activity inhibitor, Mest gene mutagenic agent, and vector are the same as those described above.

[0089] The above animal may be a mammal, but is not limited thereto. Preferably, the above animal may be a mouse (Mus musculus).

[0090] The aforementioned Alzheimer's disease model animal may exhibit suppression of Mest gene expression or impaired function of Mest protein. Suppression of Mest gene expression or impaired function of Mest protein induces defects in substance transport within brain neurons, thereby leading to neurodegeneration; it also increases the expression and phosphorylation of tau protein, causing cognitive and behavioral disorders. Since these symptoms are consistent with those observed in Alzheimer's disease patients, they can be utilized as an Alzheimer's disease model animal.

[0091] The suppression of the expression of the Mest gene or the deterioration of the function of the Mest protein may occur specifically in neurons of the cerebral cortex. This can be achieved by using a promoter that is specifically expressed in neurons of the cerebral cortex. For example, this can be achieved by transforming shMest by operably linking it to the Syn1 promoter or the NSE promoter. As another example, if shMest is linked to the U6 promoter and transformed with a vector containing two loxP sequences between them, and then crossed with an animal having the CamKIIα-Cre gene, the Cre recombinase is specifically expressed in neurons of the cerebral cortex, making shMest operable.

[0092] Accordingly, the above transformation may be achieved by crossing an animal into which the transformation vector has been introduced with an animal having the CamKIIα-Cre gene, but is not limited thereto. In this case, the animal may preferably be a mouse.

[0093] The above introduction may be performed by microinjecting the transformation vector during the pronucleus stage of a fertilized egg, or by infecting a mouse embryo if the transformation vector is a viral vector, but is not limited thereto, and a person skilled in the art may appropriately select a method known in the art as necessary.

[0094]

[0095] Another aspect of the present invention is the step of (1) preparing a transformation vector comprising a sequence encoding one or more selected from the group consisting of a Mest gene expression inhibitor, a Mest protein activity inhibitor, and a Mest gene mutagenic agent;

[0096] (2) a step of introducing the above-mentioned transformation vector into a fertilized egg or embryo at the pronuclear stage; and

[0097] (3) A step of inducing development by implanting the above-mentioned fertilized egg or embryo into a surrogate mother; is a method for manufacturing an Alzheimer's disease model animal.

[0098] The descriptions of the above Mest gene expression inhibitor, Mest protein activity inhibitor, Mest gene mutagenic agent, vector, and Alzheimer's disease model animal are the same as those described above.

[0099] The above method for manufacturing an Alzheimer's disease model animal may further include the step of obtaining offspring by crossing an individual born after step (3) with an individual having the CamKIIα-Cre gene.

[0100]

[0101] One or more specific embodiments are described in more detail below through examples. However, these examples are intended to illustrate one or more specific embodiments and the scope of the present invention is not limited to these examples.

[0102]

[0103] Preparation Example. Production of shMest transgenic mice

[0104] The Cre-loxP system was utilized to construct transgenic mice in which shMest is specifically expressed in the cerebral cortex. The Cre-loxP system is a mechanism in which Cre recombinase is produced by the CamKIIα promoter, which specifically regulates gene expression in neurons such as the cerebral cortex and hippocampus. By recognizing the loxP sequence and removing the floxed gene between the loxP sequences, the U6 promoter comes into contact with the shMest sequence, thereby regulating the expression of shMest.

[0105] In the present invention, CamKIIα-Cre mice and floxed-shMest mice were crossed to construct the shMest transgenic mouse CamKIIα-cre;shMest (Fig. 11). The shMest1 sequence in Table 1 below was cloned using the pSico vector (Figs. 22 and 23). When the pSico shMest1 vector was treated with the restriction enzyme DraIII and subjected to electrophoresis, a 3,098 bp band and a 4,505 bp band were formed, and the shMest1 sequence was present in the 3,098 bp band (Fig. 24).

[0106] Subsequently, fragments of approximately 2.1 kb were isolated by cutting with restriction enzymes Xbal and SacII, and floxed-shMest mice were obtained by microinjecting them into the pronucleus of mouse fertilized eggs. The insertion of shMest1 was confirmed by whether a 431 bp band was formed when PCR was performed using the primers in Table 2 below (Figs. 25 and 26).

[0107] Three floxed-shMest mice were obtained as founder mice (Fig. 27), and five F1 mice (CamKIIα-cre;shMest) were obtained by crossing one of them with CamKIIα-Cre mice and used in the experiment of the following example.

[0108] SEQ ID NO.NameSeqeunce (5'→3')1shMest1_FTGCCA TTGGA TCCTA TAAAT TTCAA GAGAA TTTAT AGGAT CCAAT GGCTT TTTTC2shMest1_RGAAAA AAGCC ATTGG ATCCT ATAAA TTCTC TTGAA ATTTA TAGGA TCCAA TGGCA

[0109] SEQ ID NO.NameSeqeunce (5'→3')3shMest1 431bp-FCTACAACAGCCACAACGTCTA4shMest1 431bp-RGATCTCGTGAAGCGAGCTTAT

[0110]

[0111] Experimental Example 1. Western blot (Immunoblot)

[0112] Cell lysates were prepared by mixing 1 mM phenylmethylsulfonyl fluoride (PMSF), a protease inhibitor, and 1 μg / ml leupeptin into cell lysis buffer (composition: 50 mM Tris-HCl pH 7.4, 150 mM NaCl, 0.5% Triton X-100, 1 mM EDTA, 1 mM EGTA, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM sodium ortho-vanadate). The prepared lysate was centrifuged at 13,000 rpm for 10 minutes at 4°C to separate soluble proteins.

[0113] For brain tissue lysate, the lysate was prepared using the same buffer as the cell lysate, and soluble proteins were separated by centrifuging at 12,000g for 15 minutes at 4℃, followed by additional centrifugation at 12,000g for 10 minutes to separate the proteins.

[0114] A uniform amount of protein was mixed with 4X sample dye (composition: 200 mM Tris-HCl pH 6.8, 8% SDS, 0.05% bromophenol blue, 40% glycerol, and 200 mM β-mercaptoethanol), heated at 95°C for 10 minutes, separated by electrophoresis using 10% SDS-PAGE, and then transferred to a PVDF membrane.

[0115] The membrane was incubated overnight at 4°C with a solution diluted with the primary antibody and 5% BSA or 5% Skim milk. The next day, the membrane was washed 5 times with Tris-buffered saline containing 0.1% Tween-20 (0.1% TBS-T) and then incubated at room temperature for 1 hour with secondary antibodies conjugated with HRP (horseradish peroxidase) (Goat anti-mouse antibody, #115-035-003; and Goat anti-rabbit antibody, #111-035-003; Mouse anti-Rabbit IgG (Light chain specific) #211-032-171, Jackson Immunoresearch Laboratories, West Grove, PA, USA).

[0116] As primary antibodies, rabbit monoclonal antibodies anti-Mest (#ab151564), anti-Tau (phospho S199) (#ab4749), anti-Tau (phospho T231) (#ab151559), and KIF5B / C (ab167429) were purchased from Abcam and used. In addition, mouse monoclonal antibodies anti-Vinculin (#V9131), anti-β-actin (#A5441), and anti-FLAG (F1804) were purchased from Sigma, and anti-Tau XP (#46687S) rabbit polyclonal antibodies anti-clavicular Caspase-3 (Cleaved Caspase-3, Asp175) (#9661), anti-Caspase3 (#9662), and anti-PSD95 (#3450) were purchased from Cell Signaling Technology and used. NKHC2 (KIF5C) (sc-390951) and anti-GFP (sc-9996) antibodies were purchased from Santa Cruz, and CopG2 (PA5-90730) antibodies were purchased from ThermoFisher. Anti-Myc (G019, clone 9E10) was purchased from Applied Biological Materials (ABM).

[0117]

[0118] Experimental Example 2. Immunofluorescence analysis

[0119] Cerebral cortex tissues from wild-type controls and APP / PS1 mice were seeded into 12-well plates on glass coverslips coated with poly-D-lysine and laminin. Cells were fixed in PBS with 4% paraformaldehyde (PFA) for 10 minutes, and then permeabilized at room temperature for 20 minutes with a solution of 0.1% Triton X-100 dissolved in PBS. Afterward, the cells were washed three times with PBS and blocked for 1 hour at room temperature or overnight at 4°C with a solution of 5% (wt / vol) BSA (bovine serum albumin) added to PBS.

[0120] The blocked coverslips were incubated overnight at 4°C in a humidification chamber with the primary antibody diluted in 1% (wt / vol) BSA. Subsequently, they were washed three times with 1% BSA solution and incubated for 2 hours at room temperature with the secondary antibody Alexa-Fluor 488 or 546 (Invitrogen) diluted in 5% (wt / vol) BSA. After washing three times with 1% BSA, DAPI (Sigma, D9542) was added to each sample for nuclear staining and incubated at room temperature for 10 minutes.

[0121] Fluorescence images were taken using a confocal microscope (Carl Zeiss LSM 700).

[0122] The antibodies used are as follows: anti-Mest monoclonal (Proteintech, 60263-1-Ig), anti-Mest polyclonal (Proteintech, 11118-1-AP), MAP2 (Cell signaling technology, #4542), KIF5B / C (ab167429), NKHC2 (KIF5C) (sc-390951), CopG2 (PA5-90730).

[0123]

[0124] Experimental Example 3. Yeast Protein Hybrid Analysis (Yeast-Two Hybrid)

[0125] Mest (NM_008590) was cloned as a bait into pGBKT7 and pB2TK vectors. Inserts from the Human brain cDNA AD library were cloned into the pACT2 plasmid. Two yeast strains, PBN204 and AH109, ​​were used for the screening. After transforming each yeast strain with the Mest bait and the Human brain cDNA library, the transformed yeasts were identified using selection media (SD-LWHA for AH109, ​​SD-LWU for PBN204). Transformed colonies were selected by monitoring β-galactosidase activity based on the activity of LacZ and Gal4 reporters. Subsequent DNA sequencing analysis identified ZNF41, ZNF248, and DST in PBN204, and ZNF8, DST, MACF1, KIF5B, KIF5C, KIFC2, and WDR36 as candidates in AH109. (PanBioNet, Korea)

[0126]

[0127] Experimental Example 4. Co-Immunoprecipitation Analysis

[0128] Cells were lysed with the cell lysis buffer specified above, and the lysate was centrifuged at 15,000 g at 4°C for 10 minutes to remove insoluble substances. For immunoprecipitation, the lysate was reacted with the antibody specified below in a rotator at 4°C overnight, then mixed with Protein G-agarose and reacted for an additional 2 hours. Afterward, it was washed 5 times with cell lysis buffer, and the immunocomplex was separated by boiling with a loading dye (240 mM Tris / HCl, pH 6.8, 6% SDS, 30% glycerol, 16% 2-mercaptoethanol, 0.06% bromophenol blue) for 10 minutes.

[0129] The antibodies used are as follows: anti-FLAG (Sigma, F1804), anti-GFP (Invitrogen, A-11122), anti-Mest (11118-1-AP, Proteintech)

[0130]

[0131] Experimental Example 6. Proximity ligation assay (PLA)

[0132] Cells were fixed on coverslips with 4% paraformaldehyde (PFA in PBS) for 10 minutes, and then permeabilized at room temperature for 20 minutes with a solution of 0.1% Triton X-100 dissolved in PBS. After washing three times with PBS, the procedure was performed according to the manufacturer's protocol using a Duolink® In Situ Red Starter Kit Mouse / Rabbit (Sigma, DUO92101) or NAVENIfLEX Cell MR Red (Navinci, NV C_NC.MR.100).

[0133] The primary antibodies used are as follows: anti-Mest monoclonal (Proteintech, 60263-1-Ig), anti-Mest polyclonal (Proteintech, 11118-1-AP), KIF5B / C (ab167429), NKHC2 (KIF5C) (sc-390951), CopG2 (PA5-90730).

[0134] In the final nuclear staining process, DAPI (Sigma, D9542) was reacted at room temperature for 10 minutes. Then, according to the manufacturer's protocol, the coverslips were washed twice for 10 minutes each with washing buffer or 1X TBS, followed by a single wash for 1 minute with 0.01X washing buffer or 15 minutes with 0.1X TBS. After the reaction and staining were complete, the coverslips were air-dried and mounted onto a slide glass using mounting solution (SouthernBiotech, #0100-01).

[0135] Fluorescence images were taken using a confocal microscope (Carl Zeiss LSM 800).

[0136]

[0137] Experimental Example 7. Culture and transformation of primary cortical neurons

[0138] After sacrificing Sprague-Darley rats 18 days into pregnancy, separate the embryos and wash them in ice-cold HBSS. Separate the brains of each embryo and place them in ice-cold HBSS until the cortical regions are separated. Once the cortical regions are separated, divide them into 15ml tubes containing cold HBSS, transfer them to a clean bench, and resume the subsequent process.

[0139] After washing the previously separated tissue in a 15ml tube twice with cold HBSS, treat with a 0.05% trypsin solution diluted to 1 / 10 and incubate in a 37℃ CO2 incubator for 10 minutes. After removing the supernatant, wash twice with HBSS and remove the supernatant. Treat with a mixture of 2ml of Trypsin inhibitor (Sigma, T6522) and 80ul of DNaseI (Sigma, DN25) per tube, and incubate in a 37℃ CO2 incubator for 3 minutes. After washing twice with HBSS, perform one additional wash with cold plating media (Composition: Neurobasal media (Gibco, 21103049) 47.5 ml supplemented with 50x B27 supplement (Gibco, 17504044), L-glutamine (Gibco, 25030081), GlutaMax (Gibco, 35050061) and Penicillin / Streptomycin (Gibco, 15140122)). After washing, add pre-warmed plating media, convert the tissue into a cell suspension by pipetting, and filter through a 40 µm strainer (SPL, 93040).

[0140]

[0141] Experimental Example 8. RNA Sequencing and qRT-PCR Analysis

[0142] RNA sequencing was performed using RNA purified from the brain cortical region of WT or CamKIIa-cre;shMest mice.

[0143] The sample library was prepared using the Ultra RNA Library Prep Kit (#E7530, NEBNEXT, USA), Multiplex Oligos for Illumina (#E7335, NEBNEXT, USA), and poly(A) mRNA Magnetic Isolation Module (#E74900, NEBNEXT, USA), and the procedure was performed according to the manufacturer's protocol. The quality and concentration of the library were verified using the Agilent 2100 Bioanalyzer (Agilent Technologies, USA) and the associated high-sensitivity DNA kit (Agilent Technologies, USA).

[0144] The analysis of neuron-specific down-regulated genes due to the decrease in Mest was verified via qRT-PCR. Cortical regions were isolated from both WT (n=9) and CamKIIa-cre;shMest (n=5) mice, homogenized using TRI reagent (MRC, TR118, USA), and RNA was purified according to the manufacturer's protocol. After verifying the concentration of the purified RNA, cDNA was synthesized using ReverTra Ace™ qPCR RT Master Mix (Toyobo, FSQ-201, Japan) with equal amounts of RNA for all samples, following the manufacturer's protocol. For qRT-PCR analysis, experiments were performed using THUNDERBIRD® SYBR® qPCR Mix (Toyobo, QPS-201, Japan) according to the manufacturer's protocol, followed by analysis using a qPCR machine (Bio-Rad, CFX connect). Threshold cycle (Ct) values ​​were quantified by checking individual mRNA expression levels after normalization based on Gapdh.

[0145]

[0146] Example 1. Reduction of Mest expression due to amyloid beta accumulation

[0147] To investigate the correlation between Alzheimer's disease and the decrease in Mest expression, we examined Mest expression in the previously known Alzheimer's model mice, the 5X FAD transgenic mouse model and the APP / PS1 transgenic mouse model.

[0148] First, to confirm changes in Mest expression levels in the cerebral cortex of 5X FAD transgenic mice, a Western blot of mouse cerebral cortex tissue was performed. As a result, PSD95 expression was slightly decreased compared to the wild-type control, Cleaved-Cas3 (C-Cas3) expression was slightly increased, and Cas3 expression showed no significant difference, but Mest expression was significantly decreased in 5X FAD mice compared to the control (Fig. 2).

[0149] Next, immunofluorescence analysis was performed to compare the expression levels of Mest in the cerebral cortex of APP / PS1 transgenic mice with those of wild-type controls. As a result, it was confirmed that the expression of Mest in the APP / PS1 dementia model was also significantly reduced compared to wild-type controls (Fig. 3).

[0150] Based on these results, we hypothesized that the accumulation of amyloid beta reduces Mest expression, and to verify this, we conducted an experiment in which SH-SY5Y cells were treated with amyloid beta. After treating differentiated SH-SY5Y cells with amyloid beta, the amounts of Mest, T231-phosphorylated tau protein, S199-phosphorylated tau protein, and total tau protein were determined by Western blot. As a result, it was found that the expression of Mest decreased in a concentration-dependent manner with amyloid beta treatment, and the phosphorylation of tau protein increased (Fig. 4).

[0151] In summary, it is well known that the expression of amyloid beta (Aβ) is increased in Alzheimer's models, such as 5X FAD mice and APP / PS1 mice. Furthermore, it was confirmed that the expression of Mest decreased in these mouse models. When differentiated SH-SY5Y cells were treated with amyloid beta, Mest expression decreased and the phosphorylation of tau protein increased, confirming that this is consistent with the results from the mouse models. Therefore, it can be seen that the accumulation of amyloid beta found in patients with Alzheimer's disease leads to a decrease in the expression of the Mest gene.

[0152]

[0153] Example 2. Reduction in material transport in axons or dendrites due to decreased Mest expression

[0154] We wanted to investigate whether a decrease in the expression of the Mest protein in neurons could induce neuronal death observed in dementia patients. When primary cortical neurons cultured on a solid medium were transformed with the shMest gene using the Lenti-U6-shRNA vector, the dendrites of the shCrambled neurons, which did not reduce the expression of any genes, became significantly thinner and fragmentation was induced compared to the transformed neurons (control group), confirming that a decrease in the expression of the Mest protein induces neurodegeneration (Fig. 5).

[0155] Although Mest protein is known to be located mainly in the endoplasmic reticulum or Golgi apparatus within cells, immunofluorescence analysis was performed to confirm that it is also expressed in cerebral cortex neurons. As a result of analyzing Mest protein with Alexa Fluor 546 (red) and MAP2 protein with Alexa Fluor 488 (green), as shown in Figure 6, it was confirmed that Mest protein is highly expressed in the dendrites of primary cerebral cortex neurons and is co-localized with MAP2 protein, which is highly expressed in dendrites.

[0156] Meanwhile, to elucidate the reason why the decrease in Mest expression leads to neurodegeneration, a Yeast-Two Hybrid screening was performed to identify candidate proteins that interact with Mest. As a result, proteins such as WDR36, COPG2, GRB10, ZNF8, ZNF41, ZNF248, DST, MACF1, KIF5B, KIF5C, and KIFC2 were selected as candidate proteins, among which KIF5B, KIF5C, and KIFC were kinesin complex proteins involved in material transport (Fig. 7a).

[0157] Subsequently, co-immunoprecipitation experiments on Mest were performed to confirm that KIF5B, KIF5C, KIFC2, and COPG2 bind to Mest (Fig. 7b), and additionally, indirect immunofluorescence and proximity ligation (PLA) analyses were performed to confirm that KIF5B, KIF5C, and COPG2 bind to Mest (Figs. 8 and 9). This suggests that low expression of Mest in neurons may cause abnormalities in material transport.

[0158]

[0159] Example 3. Mitochondrial dysfunction due to loss of Mest function

[0160] To demonstrate that material transport defects caused by reduced Mest expression lead to neurodegeneration, primary cortical neurons cultured on solid media were transformed with the shMest gene using the AAV-U6-shRNA vector (Fig. 10a). Subsequently, qRT-PCR was performed to confirm changes in Mest expression in the cultured neurons, and it was confirmed that the expression of Mest mRNA in shMest-transformed cells decreased to less than half compared to the control group (Fig. 10b).

[0161] Subsequently, proximal ligation analysis (PLA) was performed on primary cerebral cortex neurons to identify intracellular binding sites for Mest and KIF5B, and immunofluorescence analysis was performed to label mitochondria as Mito-Trackers. As a result, the number of binding signals between Mest and KIF5B was significantly reduced in both the soma and dendrites of neurons transformed with shMest (Fig. 11a), and it was observed that the travel distance or speed of mitochondria through the dendrites was inhibited (Fig. 11b).

[0162] These results show that material transport defects caused by reduced Mest expression lead to neurodegeneration.

[0163]

[0164] Example 4. Development of an Alzheimer's disease model mouse based on a Mest-related mechanism

[0165] To develop an Alzheimer's disease model mouse based on a Mest-related mechanism, we sought to determine whether material transport abnormalities caused by reduced Mest expression increase the phosphorylation of tau protein and induce dementia symptoms. To this end, we constructed shMest transgenic mice that specifically reduce the expression of Mest in brain neurons (Fig. 12).

[0166] To confirm changes in Mest expression in different brain regions of the synthesized shMest transgenic mice, cells were collected from the cerebral cortex (Ctx), hippocampus (Hipp), olfactory bulb (Ob), and cerebellum (Cb) and Western blot was performed. CamKIIa-Cre mice were used as a control. As a result, while there were no significant differences in Mest expression in the olfactory bulb or cerebellum of the shMest transgenic mice, it was confirmed that Mest expression was significantly reduced in the cerebral cortex and hippocampus compared to the control group (Fig. 13). In other words, the synthesized shMest transgenic mouse is a mouse in which Mest expression is specifically reduced in the cerebral cortex and hippocampus.

[0167]

[0168] Example 5. Neurodegeneration in shMest transgenic mice

[0169] We intended to confirm whether neuronal degeneration occurred in the cerebral cortex of shMest transgenic mice using immunofluorescence. Phosphorylated tau protein was indicated in red, MAP2 protein in green, and nuclei in DAPI (blue). As a result, compared to wild-type mice, red increased significantly and green decreased significantly in shMest transgenic mice, indicating increased phosphorylation of tau protein and neurodegeneration (Fig. 14).

[0170]

[0171] Example 6. Increased Tau Protein Expression and Increased Tau Protein Phosphorylation in shMest Transgenic Mice

[0172] To determine whether shMest transgenic mice could serve as a model for Alzheimer's dementia, we investigated whether the increased expression and phosphorylation of tau protein observed in Alzheimer's patients were also present in shMest transgenic mice.

[0173] First, Western blot was performed on the cerebral cortex of shMest transgenic mice to confirm the expression of S199-phosphorylated tau protein, T231-phosphorylated tau protein, total tau protein, and Mest. As a result, it was confirmed that the expression of total tau protein increased in shMest transgenic mice compared to the control group (CamKIIa-Cre mice), and the phosphorylation of tau protein also increased (Fig. 15).

[0174] Next, immunofluorescence was performed to confirm changes in tau protein phosphorylation in the cerebral cortex of shMest transgenic mice. Phosphorylated tau protein was indicated in red, MAP2 protein in green, and the nucleus in DAPI (blue). As a result, it was confirmed that both T231-phosphorylated tau protein and S202 / T205-phosphorylated tau protein were increased in shMest transgenic mice compared to the wild type (Fig. 16).

[0175]

[0176] Example 7. Increase in anxiety levels and cognitive impairment in shMest transgenic mice

[0177] Behavioral experiments were conducted in a confined space to determine whether dementia-like anxiety levels and cognitive impairments appeared in shMest transgenic mice.

[0178] As a result, although the overall activity level of the shMest transgenic mice was similar to that of the control mice, it was confirmed that they exhibited symptoms of anxiety by staying mainly at the edges of the space, and cognitive impairment was clearly evident (Fig. 17). In addition, a cognitive memory capacity measurement experiment was performed. As a result, it was confirmed that the object recognition memory function of the shMest transgenic mice was reduced compared to the control mice.

[0179] Meanwhile, we sought to verify whether the same results would occur even if transgenic mice inhibiting Mest were produced using a method different from the above-described manufacturing example. Mice in which Mest expression was inhibited only in the entire brain tissue were produced by injecting AAV-CamK2a-Cre (PHP-eB) into the cerebral cortex of shMest floxed mice, and the same behavioral experiments and cognitive memory ability measurement experiments as above were performed. As a result, it was confirmed that the same cognitive impairment occurred (Fig. 18), demonstrating that the mice of the present invention can be utilized as dementia model mice.

[0180] Additionally, transgenic mice were constructed to inhibit Mest, a neuron-specific receptor in the medial prefrontal cortex (mPFC), to verify whether the same cognitive impairment and tau protein phosphorylation occurred. As a result, it was confirmed that tau protein phosphorylation increased in the medial prefrontal cortex, similar to the transgenic mice mentioned above. Furthermore, through object recognition memory experiments, it was confirmed that cognitive memory ability decreased compared to the control mice. Through this, it was confirmed that these mice are significant as a dementia model related to neurons in the medial prefrontal cortex (Fig. 19).

[0181]

[0182] Example 8. RNA sequencing and qRT-PCR on shMest transgenic mice

[0183] To identify genes specifically expressed in neurons whose expression decreases when Mest is reduced, the cerebral cortex of shMest transgenic mice was isolated and total mRNA was isolated. Subsequently, RNA sequencing and qRT-PCR were performed and compared with the results of wild-type mice.

[0184] RNA sequencing results showed that among the genes whose expression was reduced in shMest mice compared to wild-type neurons, there were transport vesicle-related genes such as Bdnf, Kctd16, Clvs2, ICA1, and Nptx1, and qRT-PCR for Nptx1 also confirmed that the expression of the Nptx1 gene was reduced (Figs. 20 and 21). Since Xiao et al. (2017) reported that the levels of Nptx1 were reduced in the brains of Alzheimer's disease patients, these results suggest that material transport defects caused by reduced Mest expression may induce neurodegeneration and lead to dementia.

[0185]

[0186] The present invention has been described above with reference to its preferred embodiments. Those skilled in the art will understand that the present invention may be embodied in modified forms without departing from the essential characteristics of the invention. Therefore, the disclosed embodiments should be considered in an illustrative rather than a restrictive sense. The scope of the invention is defined by the claims, not by the foregoing description, and all variations within the scope of the claims should be interpreted as being included in the invention.

[0187]

[0188] Since the Alzheimer's disease model mouse of the present invention induces dementia through a novel mechanism different from existing Alzheimer's disease model animals, it can contribute to confirming and developing new drug efficacy that could not be verified with existing models.

Claims

1. A transformation vector comprising a sequence encoding one or more selected from the group consisting of Mest gene expression inhibitors, Mest protein activity inhibitors, and Mest gene mutagens.

2. A transformation vector according to claim 1, wherein the Mest gene expression inhibitor inhibits expression by binding complementarily to mRNA for the sequence of the Mest gene, a sequence complementary to the sequence of the Mest gene, or a fragment of the sequence of the Mest gene, and is selected from the group consisting of antisense nucleotides, small interfering RNA (siRNA), short hairpin RNA (shRNA), microRNA (miRNA), antisense oligonucleotides (ASO), ribozymes, and deoxyribozymes.

3. A transformation vector according to paragraph 2, wherein the Mest gene expression inhibitor is a short hairpin RNA.

4. A transformation vector according to paragraph 3, wherein the short hairpin RNA comprises the nucleotide sequence of SEQ ID NO. 1 or 2.

5. A transformation vector according to claim 1, wherein the Mest protein activity inhibitor causes blocking of substrate binding of the Mest protein, a three-dimensional structural change of the Mest protein, post-translational modification, or proteolysis, and the Mest protein activity inhibitor is selected from the group consisting of peptides, peptide mimics, substrate analogs, aptamers, antibodies, and enzymes.

6. A transformation vector according to claim 1, wherein the Mest gene mutagenic agent is a complex (ribonucleoprotein) of a guide RNA and an endonuclease protein specific to the target base sequence of the Mest gene.

7. In paragraph 1, the transformation vector further comprises a promoter specifically expressed in neurons of the cerebral cortex, and A transformation vector in which the promoter is operably linked to the coding sequence.

8. A transformation vector according to claim 7, wherein the promoter is a CamKIIα promoter, NSE promoter, or Syn1 promoter.

9. A transformation vector according to claim 1, wherein the vector is selected from the group consisting of plasmid vectors, bacteriophage vectors, phagemid vectors, cosmid vectors, and virus vectors.

10. An Alzheimer's disease model mouse transformed with a transformation vector according to any one of claims 1 to 9.

11. In paragraph 10, the Alzheimer's disease model mouse is an Alzheimer's disease model mouse in which suppression of the expression of the Mest gene or a decrease in the function of the Mest protein is exhibited.

12. An Alzheimer's disease model mouse according to claim 11, wherein the inhibition of expression of the Mest gene or the deterioration of function of the Mest protein is specifically observed in neurons of the cerebral cortex.

13. An Alzheimer's disease model mouse according to claim 10, wherein the transformation is achieved by crossing a mouse into which the transformation vector has been introduced with a CamKIIα-Cre mouse.

14. An Alzheimer's disease model mouse according to claim 13, wherein the introduction is performed by microinjecting the transformation vector into the pronucleus of a fertilized egg.

15. (1) A step of preparing a transformation vector according to any one of claims 1 to 9; (2) a step of introducing the above-mentioned transformation vector into a fertilized egg or embryo at the pronuclear stage; and (3) A method for producing an Alzheimer's disease model animal, comprising the step of inducing development by implanting the above-mentioned fertilized egg or embryo into a surrogate mother.