Method for producing chimeric antigen receptor-t cells with delayed differentiation

WO2026169033A1PCT designated stage Publication Date: 2026-08-13SEOUL NATIONAL UNIVERSITY R&DB FOUNDATION
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
WO · WO
Patent Type
Applications
Current Assignee / Owner
Filing Date
2026-02-05
Publication Date
2026-08-13

Smart Images

  • Figure KR2026002216_13082026_PF_FP_ABST
    Figure KR2026002216_13082026_PF_FP_ABST
Patent Text Reader

Abstract

The present specification discloses a method for producing differentiation-delayed CAR-T cells (TET2 KO CAR-T). According to the present method, CAR-T cells can maintain a less differentiated state even under repeated stimulation conditions through TET2 gene knockout and IL-21 stimulation, and naive / memory subtypes are increased, thereby enhancing the efficacy and persistence of a long-term immune response.
Need to check novelty before this filing date? Find Prior Art

Description

Method for producing delayed-differentiation chimeric antigen receptor-T cells

[0001] This specification relates to the field of cell therapy and immunotherapy, and more specifically, to a method for producing delayed-differentiation chimeric antigen receptor T cells (CAR-T cells) for the treatment of solid tumors, and an anticancer treatment method and composition using the same.

[0002] Adoptive Cell Therapy (ACT) is an innovative approach to cancer treatment that is attracting attention as a powerful therapeutic method targeting tumor cells expressing specific antigens. It is a technology that targets and eliminates cancer cells using genetically modified chimeric antigen receptor T cells (CAR-T cells). However, this treatment has only been proven effective in certain blood cancers, and there are limitations to its use as a therapeutic agent, particularly in solid tumors, due to the difficulty in maintaining and sustaining CAR-T cells in the body.

[0003] Currently approved CAR-T cell therapies are primarily effective against hematological cancers (e.g., acute lymphoblastic leukemia, non-Hodgkin lymphoma, etc.), but they have several limitations in treating solid tumors. The solid tumor environment includes problems such as an immunosuppressive tumor microenvironment (TME), low tumor invasiveness, rapid T cell differentiation and exhaustion, and difficulty in maintaining a sustained immune effect.

[0004] In particular, the premature differentiation and depletion of CAR-T cells are one of the major factors limiting treatment efficiency, and it is important to preserve memory function in a less differentiated state of CAR-T cells to maintain long-term anticancer activity. Conventional CAR-T cells undergo rapid differentiation and functional decline during treatment, which causes failure to completely eliminate tumors or increases the risk of recurrence.

[0005] To solve the aforementioned problems, the present inventors intend to provide a method for manufacturing CAR-T cells capable of long-term survival in a solid tumor environment and maintaining potent anticancer activity. The inventors [develop] CD8 + We focused on the TET enzyme, a key element in regulating T cell responses. The TET enzyme plays an important role in the differentiation process of T cells as an epigenetic regulator. The inventors analyzed the effect of TET gene deletion on the memory function of CAR-T cells and investigated the optimal combination of cytokine stimulation that can delay CAR-T cell differentiation and increase cell proliferation rates by binding with TET gene deletion.

[0006] The technical problems of this specification are not limited to those mentioned above, and other unmentioned technical problems will be clearly understood by a person skilled in the art from the description below.

[0007] A method for producing a population of delayed-differentiation CAR-T cells is disclosed, comprising the steps of: contacting a T cell population with a nucleic acid molecule encoding a Chimeric Antigen Receptor (CAR) targeting a solid tumor to produce a CAR-T cell population; knocking out the TET2 gene in the CAR-T cell population to produce a TET2 gene knocked-out CAR-T cell population (TET2 KO CAR-T); stimulating the TET2 gene knocked-out CAR-T cell population with IL-21; and harvesting the IL-21-stimulated TET2 KO CAR-T cell population.

[0008] In one embodiment, the step of generating the TET2 gene knockout CAR-T cell population may include the step of introducing a TET2-targeting ribonucleoprotein (RNP) into the CAR-T cells by electroporation.

[0009] In one embodiment, the ribonucleic protein targeting TET2 may include gRNA that induces TET2 deletion.

[0010] In one embodiment, prior to the IL-21 stimulating step, the method may further include a step of activating the TET2 gene knockout CAR-T cells using an anti-CD3 binding domain and a co-stimulating molecule binding domain.

[0011] In one embodiment, the step of stimulating the TET2 gene knockout CAR-T cell population with IL-21 may be performed by culturing in a cell medium containing IL21 for at least 3 days.

[0012] In one embodiment, the IL-21 may be added to the cell medium at a concentration of 20 ng / ml to 50 ng / ml, preferably about 20 ng / ml.

[0013] In one embodiment, the cell medium may be a cell medium further comprising IL-2, IL-15, IL-7, IL-6, LSD1 retardant, MALT1 retardant, or a combination thereof.

[0014] In one embodiment, the IL-21-stimulated TET2 gene-knockout CAR-T cell population harvested at the step of harvesting the CAR-T cell population may have a sum of the CD4+ T cell naive subtype and central memory subtype at least 55% of the total CD4+ T cells as a result of flow cytometry analysis, and a sum of the CD8+ T cell naive subtype and central memory subtype at least 60% of the total CD8+ T cells.

[0015] In one embodiment, the IL-21-stimulated TET2 gene knockout CAR-T cell population harvested at the step of harvesting the CAR-T cell population may have a T cell naive subtype and central memory subtype increased by about 10% or more, preferably about 12% or more, compared to a wild-time (WT) CAR-T cell population that was not TET2 gene knockout stimulated by IL-21 under the same conditions.

[0016] In one embodiment, the step of stimulating the CAR-T cell population with IL-21 and the step of harvesting the IL-21-stimulated CAR-T cell population may be repeated two or more times.

[0017] In one embodiment, the IL-21-stimulated TET2 gene-knockout CAR-T cell population harvested after the above repetition may have a CD8+ T cell naive subtype and central memory subtype of about 95% or more of the total CD8+ T cells as a result of flow cytometry analysis.

[0018] In one embodiment, the CAR may include an antigen binding domain, a membrane-transmitting domain, an intracellular signaling domain, and a reporter.

[0019] In one embodiment, the antigen binding domain may include a HER2-specific single-chain variable fragment (scFv).

[0020] In one embodiment, the CAR may have the amino acid sequence of SEQ ID NO. 2.

[0021] In one embodiment, a pharmaceutical composition for treating solid tumors is disclosed, comprising a population of CAR-T cells produced by the above method and a pharmaceutically acceptable carrier thereof.

[0022] In one embodiment, the solid tumor may be selected from one or more of mesothelioma, malignant pleural mesothelioma, non-small cell lung cancer, small cell lung cancer, squamous cell lung cancer, large cell lung cancer, lung adenocarcinoma, pancreatic cancer, pancreatic ductal adenocarcinoma, gastric cancer, esophageal cancer, colorectal cancer, rectal cancer, prostate cancer, liver cancer, biliary tract cancer, gallbladder cancer, kidney cancer, bladder cancer, melanoma, skin cancer, sarcoma, osteosarcoma, soft tissue sarcoma, ovarian cancer, cervical cancer, endometrial cancer, fallopian tube cancer, glioblastoma, brain tumor, neuroblastoma, head and neck cancer, laryngeal cancer, pharyngeal cancer, oral cancer, thyroid cancer, breast cancer, or thymoma, or metastasis thereof.

[0023] In one embodiment, a pharmaceutical composition for treating breast cancer is disclosed, comprising a population of delayed-differentiation CAR-T cells produced by the above method.

[0024] Specific details of other embodiments are included in the detailed description and drawings.

[0025] We confirmed that utilizing genetically modified CAR-T cells combined with TET gene deletion and IL-21 administration can significantly enhance anticancer activity by improving CAR-T cell viability and scalability while simultaneously promoting the proliferation of less differentiated subtypes. Although not strictly theoretical, TET2 gene deletion appears to help CAR-T cells maintain a less differentiated state, thereby improving long-term viability and memory function, while IL-21 administration appears to promote T cell activation and contribute to sustained proliferation and enhanced function. The integration at the epigenetic and transcriptional levels through TET2 enzyme inhibition via TET2 gene deletion and IL-21-mediated memory responses via IL-21 administration acts complementarily, allowing CAR-T cells to persist in vivo for a longer period even in solid tumor environments and exert a more potent anticancer effect. This effectively addresses the limitations of existing CAR-T therapies in solid tumors.

[0026] FIG. 1 is a schematic diagram illustrating the process of manufacturing CAR-T cells according to the present specification.

[0027] Figure 2 shows a schematic diagram of an exemplary CAR structure.

[0028] Figure 3 is a schematic diagram showing the TET2 gene knockout process of CAR-T cells.

[0029] Figure 4 shows the Westin blot results confirming TET2 protein expression in UTD (Untransduced) control, wild-type (WT) HER2-hCAR-T, and TET2-deficient HER2-hCAR-T cells constructed using two different types of gRNA.

[0030] Figure 5 shows the results of the cell number measurement experiment of TET2-deficient HER2-hCAR-T cells and WT HER2-hCAR-T cells (Figure 5(a)) and the results of the fold increase measurement experiment of TET2-deficient HER2-hCAR-T cells and WT HER2-hCAR-T cells (Figure 5(b)).

[0031] Figure 6 shows the experimental results of measuring the viability of UTD, WT HER2-hCAR-T, and TET2-deficient HER2-hCAR-T cells.

[0032] Figure 7 shows the CAR expression rates of UTD, WT HER2-hCAR-T, and TET2-deficient HER2-hCAR-T cells measured on day 7 of CAR-T cell generation, as shown in FACS plot (a) and bar graph (b).

[0033] Figure 8 shows a representative FACS plot showing the CAR expression rates of UTD, WT HER2-hCAR-T, and TET2-deficient HER2-hCAR-T cells.

[0034] Figure 9 shows a bar graph comparing the ratios of CD4+ and CD8+ T cells in UTD, WT CAR-T, and TET2-deficient CAR-T cells.

[0035] Figure 10 is a bar graph showing the frequencies of Naive (CD27+CD45RA+), Central Memory (CM, CD27+CD45RA-), Effector Memory (EM, CD27-CD45RA-), and Late Differentiated Effector Memory (EMRA, CD27-CD45RA+) subtypes in CD4+ (Fig. 10(a)) and CD8+ (Fig. 10(b)) T cells of UTD, WT CAR-T, and TET2-deficient CAR-T cells measured on day 7 of CAR-T cell generation.

[0036] Figure 11 shows the results of a cytotoxicity experiment in which real-time fluorescence intensity was measured after co-culturing UTD, WT CAR-T, and TET2-deficient CAR-T cells with fluorescently labeled target cells (SK-BR-3) for 3 days.

[0037] Figure 12 is a schematic diagram showing the experimental process to determine whether IL-21 stimulation promotes the naive / memory subtype of TET2-deficient HER2-hCAR-T cells.

[0038] Figure 13 shows the results of detecting TET2 KO HER2-hCAR-T cell subtypes by flow cytometry under various cytokine addition conditions.

[0039] Figure 14 shows the results of a bar graph comparing the frequencies of naive and central memory subtypes according to CD27+ expression in CD4+ T cells (Figure 14(a)) and CD8+ T cells (Figure 14(b)) under various cytokine supplementation conditions.

[0040] Figure 15 is a schematic diagram showing the process of a repetitive stimulation experiment to determine whether TET2-deficient HER2-hCAR-T cells are maintained in a less differentiated state during IL-21 repetitive stimulation.

[0041] Figure 16 shows the results of a flow cytometry (FACS) plot showing subtype changes in WT CAR-T (HER2-hCAR-T) and TET2-deficient CAR-T cells (TET2 KO HER2-hCAR-T) after repeated IL-21 stimulation for 12 days.

[0042] Figure 17 shows the results of subtype changes in two types of TET2-deficient CAR-T cells (TET2 KO HER2-hCAR-T) after repeated IL-2 stimulation and repeated IL-2 and IL-21 stimulation for 12 days, as shown in pie charts in Figures 17(a) and 17(b), respectively.

[0043] Figure 18 compares the ratios of CD4+ and CD8+ T cells in TET2-deficient CAR-T cells after repeated IL-2 stimulation and IL-2+IL-21 stimulation for 12 days, as shown in Figures 18(a) and 18(b), respectively.

[0044] Figure 19 shows the proliferation rates of UTD, WT CAR-T, and TET2-deficient CAR-T cells after performing IL-2 and IL-2 + IL-21 repeated stimulation a total of 4 times, as shown in Figure 19(a) and Figure 19(b), respectively.

[0045] Embodiments of this specification are described below with reference to the attached drawings so that those skilled in the art can easily implement them. However, this specification may be implemented in various different forms and is not limited to the embodiments described herein.

[0046] Throughout the specification and claims, when a part is described as "comprising" a certain component, this means that, unless specifically stated otherwise, it does not exclude other components but may include additional components.

[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which this specification pertains. Any method and material similar or identical to that described herein may also be used in the practice or testing of this specification, but preferred methods and materials are described hereafter. All publications mentioned herein are incorporated by reference to disclose and describe methods and / or materials in connection with the reference of such publications.

[0048] A method for producing a population of CAR-T cells with delayed differentiation is disclosed herein. In one embodiment, the method comprises the steps of: contacting a T cell population with a nucleic acid molecule encoding a Chimeric Antigen Receptor (CAR) targeting a solid tumor to generate a CAR-T cell population; knocking out the TET2 gene in the CAR-T cell population to generate a TET2 gene knockout CAR-T cell population (TET2 KO CAR-T); stimulating the TET2 gene knockout CAR-T cell population with IL-21; and harvesting the IL-21-stimulated CAR-T cell population. By providing a population of CAR-T cells with delayed differentiation through the method of the present specification, the viability and anticancer activity of CAR-T cells can be increased, and effective application is possible, particularly in the treatment of solid tumors.

[0049] As used herein, the term "approximately" includes a range of ±20% of the specified value with respect to a measurable value, and in certain cases, may include a deviation of ±10%, ±5%, ±1%, or ±0.1%.

[0050] Where a specific sequence, e.g., polypeptide, nucleic acid, or amino acid sequence is presented or mentioned in this specification, it includes a sequence that is substantially identical or similar to the specific sequence, e.g., a sequence having at least 85%, 90%, or 95% or more homology. The term “substantially identical” may include a sequence having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity with the reference sequence.

[0051] In this specification, the term “cytokine” includes the full length, fragment, or variant of a natural cytokine, including functional variants. The cytokine may include a sequence substantially identical to that of a natural cytokine, which includes having at least about 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% sequence identity with a specific sequence. Additionally, the cytokine may further include a receptor domain.

[0052] In this specification, the term "subject" is intended to include a living organism from which an immune response can be elicited, e.g., mammals, humans, etc.

[0053] In this specification, "Chimeric Antigen Receptor" and "CAR" refer to a recombinant polypeptide construct genetically modified to recognize a specific antigen and induce an immune response. A Chimeric Antigen Receptor is a synthetic protein composed of an antigen-recognizing site, an antigen-binding domain, a transmembrane domain, and an intracellular signaling domain, which is transduced into T cells to recognize cancer cell-specific antigens and enhance the activity of these immune cells against cancer cells. In one embodiment, the domains within the CAR polypeptide construct exist on the same polypeptide chain and include, for example, a chimeric fusion protein. In some embodiments, the domains within the CAR polypeptide construct are not adjacent to each other and exist on different polypeptide chains.

[0054] In one embodiment, the antigen recognition site may be a single-strand-based antibody analog such as scFv or sdAb, for example, a HER2-specific single-strand antibody variable region, and may be appropriately selected by a person skilled in the art depending on the target antigen and the target antigen receptor.

[0055] The transmembrane domain is not limited to any amino acid sequence that performs the function of fusing an extracellular binding portion and an intracellular co-stimulatory domain and / or signaling domain, and may be derived from one or more selected from the group consisting of, for example, CD28, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, and CD154, and may be derived from natural, synthetic, semi-synthetic, or recombinant sources.

[0056] In one embodiment, the antigen binding domain and the transmembrane domain of the chimeric antigen receptor may be connected by a hinge region. The hinge region is not limited as long as it functions to facilitate intracellular signal transduction through binding.

[0057] In this specification, the term "intracellular signaling domain" refers to a region that transmits intracellular signals inducing T cell activation and proliferation, and may include a primary signaling domain and / or a co-stimulatory molecule binding domain. The primary signaling domain may include a CD3-ζ signaling domain.

[0058] A co-stimulatory molecule binding domain refers to an intracellular signaling region that receives a signal from a co-stimulatory molecule within a CAR-T cell and transmits it into the cell. A co-stimulatory molecule includes a cell surface molecule or its ligand that specifically binds to a co-stimulatory ligand to mediate the co-stimulatory response of a T cell. Co-stimulatory molecules include, but are not limited to, OX40, CD2, CD27, CD28, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), 4-1BB (CD137), and LNKG2D and TNFR2, and may include other co-stimulatory receptors and ligands recognizable by a person skilled in the art. The co-stimulatory molecule binding domain may be a functional signaling domain derived from such co-stimulatory molecules, but is not limited thereto. In one embodiment, it may be derived from 4-1BB (CD137).

[0059] In one embodiment, the chimeric antigen receptor may additionally include a reporter. The reporter may be used for the identification of transduced cells and the functional evaluation of regulatory sequences. In one embodiment, the reporter may include luciferase, fluorescent protein, alkaline phosphatase, beta-lactamase, chloramphenicol acetyltransferase, beta-galactosidase, or a cell surface reporter. For example, a cell surface reporter may include the Low-Affinity Nerve Growth Factor Receptor (LNGFR).

[0060] The manufacturing method of this specification includes the step of generating a CAR-T cell population by contacting a T cell population with a nucleic acid molecule encoding a chimeric antigen receptor targeting a solid tumor. Such nucleic acid molecule is a DNA molecule or an RNA molecule, and in one embodiment, the nucleic acid molecule may be on a viral vector selected from a viral vector, e.g., a lentiviral vector, an adenoviral vector, or a retroviral vector. In another embodiment, the nucleic acid molecule may be on a nonviral vector or on a plasmid. If the nucleic acid molecule encoding the chimeric antigen receptor is on a viral vector, the method includes the step of translating it into a T cell population.

[0061] The manufacturing method disclosed herein includes the step of knocking out the TET2 gene in a CAR-T cell population to generate a TET2 gene knocked-out CAR-T cell population (TET2 KO CAR-T). In one embodiment, the step may be performed by introducing a ribonucleoprotein (RNP) targeting TET2 into CAR-T cells via electroporation using a CRISPR-Cas9 system. For example, an RNP containing the gRNA of SEQ ID NO. 3 or SEQ ID NO. 4 may be used as the gRNA targeting TET2, but is not limited thereto. In another embodiment, the step may be performed by contacting an shRNA targeting TET2 or a vector encoding the same.

[0062] In this specification, the step of stimulating a TET2 gene knockout CAR-T cell population with IL-21 may be performed by culturing the TET2 gene knockout CAR-T cell population in a cell medium containing IL-21. The culture may be carried out for a period of at least one day, preferably at least three days. In one embodiment, IL-21 is preferably in the cell medium at a range of 20 to 300 ng / ml, preferably 20 to 80 ng / ml, e.g., 20 to 80 ng / ml, 20 to 70 ng / ml, 20 to 60 ng / ml, 20 to 50 ng / ml, 20 to 40 ng / ml, 30 to 80 ng / ml, 30 to 70 ng / ml, 30 to 60 ng / ml, 30 to 50 ng / ml, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 29, 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, 150, It can be added to the medium at a concentration of 160, 170, 180, 190, 200, 210, 220, 230, 240, 250, 260, 270, 280, 290, or 300 ng / ml.

[0063] In one embodiment, a population of TET2 gene-knockout CAR-T cells may be stimulated by contacting another common gamma cytokine or enzyme inhibitor in addition to IL-21 stimulation. This may be performed simultaneously with or subsequently with IL-21 stimulation. In one embodiment, a population of TET2 gene-knockout CAR-T cells may be contacted with one or more additional cytokines selected from, for example, IL-2, IL-15, IL-7, and IL-6, in addition to IL-21. In one embodiment, a population of CAR-T cells may be contacted with one or more additional enzyme inhibitors selected from, for example, LSD1 retardants, MALT1 retardants, etc., in addition to IL-21, the types thereof may be selected by a person skilled in the art as needed and are not limited. Such contact may be performed by adding the common gamma cytokine or enzyme inhibitor to the cell medium and culturing.

[0064] In one embodiment, prior to the step of culturing a population of TET2 gene knockout CAR-T cells in a cell medium containing IL-21, the method may include the step of activating the TET2 gene knockout CAR-T cells using an anti-CD3 binding domain and a co-stimulatory molecule binding domain. For example, the co-stimulatory molecule binding domain may be, but is not limited to, a domain derived from OX40, CD2, CD27, CD28, CD40, CDS, ICAM-1, LFA-1 (CD11a / CD18), ICOS (CD278), 4-1BB (CD137), and LNKG2D and TNFR2.

[0065] In one embodiment, IL-21 stimulation may be repeated after harvesting the IL-21-stimulated TET2 KO CAR-T cell population. In one embodiment, the harvested IL-21-stimulated TET2 KO CAR-T cell population may be formulated in a cryopreservation medium or formulated for administration to a subject.

[0066] A CAR-T cell group prepared according to the method of this specification means that, when measured by the method described in the examples of this specification, the ratio of the naive subtype and central memory subtype of CD4+ T cells is 50% or more, preferably 55% or more, of the total CD4+ T cells, and the ratio of the naive subtype and memory subtype of CD8+ T cells is 60% or more, preferably 65% ​​or more, of the total CD8+ T cells.

[0067] A CAR-T cell population prepared according to the method of this specification may have a naive subtype and a central memory subtype of T cells increased by about 10 or more, preferably about 12 or more, compared to a wild-time (WT) CAR-T cell population that was not TET2 gene knockout when measured by the method described in the examples of this specification and stimulated with IL-21 under the same conditions.

[0068] As used herein, "naive subtype" refers to T cells that have not been exposed to an antigen and serve as precursors for memory cells. In one embodiment, the naive subtype expresses both CD45RA and CCR7 but does not express CD45RO. In one embodiment, the naive subtype expresses CD62L, CD27, CCR7, CD45RA, CD28, and CD127 and may be characterized by the absence of CD95 or CD45RO isoforms. In one embodiment, the T cell naive subtype expresses CD62L, IL-7 receptor-α, IL-6 receptor, and CD132 but does not express CD25, CD44, CD69, or CD45RO. In one embodiment, the naive T cells express CD45RA, CCR7, and CD62L but do not express CD95 or IL-2 receptor β. In the embodiments, the surface expression levels of the markers may be evaluated using flow cytometry.

[0069] The "Central Memory" subtype of T cells refers to a subset of T cells in humans that are CD45RO positive and express CCR7. In one embodiment, the T cell memory subtype expresses CD95. In one embodiment, the central memory T cells express IL-2R, IL-7R, and / or IL-15R. In one embodiment, the central memory T cells express CD45RO, CD95, IL-2 receptor β, CCR7, and CD62L. In some embodiments, the surface expression levels of the markers are evaluated using flow cytometry.

[0070] In one embodiment, the step of stimulating a CAR-T cell population with IL-21 may be repeated two or more times, preferably three or more times, and more preferably four or more times.

[0071] According to the manufacturing method of this specification, CAR-T cells with TET2 gene knockout via IL-21 stimulation (TET2 KO CAR-T cells) can maintain a less differentiated state even under repeated stimulation conditions. On the other hand, wild-type (WT) CAR-T cells with unknocked TET2 gene tended to differentiate rapidly. In particular, under IL-21 stimulation conditions, TET2 KO CAR-T cells maintained more naive and central memory subtypes, suggesting that this may be advantageous for maintaining an effective immune response over a long period.

[0072] In addition, it was confirmed that under culture conditions using IL-21, the cell proliferation rate increased and the ratio of CD4+ and CD8+ T cells was maintained stably. This means that IL-21 plays an important role in enhancing the long-term effects and persistence of TET2 KO CAR-T cells, and thus can provide CAR-T cells that can maintain function even in a solid tumor environment where repeated stimulation occurs.

[0073] Therefore, by improving the functional persistence of CAR-T cells and maintaining a less differentiated state through the method disclosed in this specification, it is possible to produce a population of CAR-T cells effective for anticancer treatment.

[0074] The present specification will be explained in detail below through examples.

[0075] However, the following examples are merely illustrative of this specification, and the contents of this specification are not limited to the following examples.

[0076] <Example 1> Production of TET2 knockout HER2-targeted CAR-T cells

[0077] Example 1-1: Production of CAR-expressing lentivirus

[0078] The scFv of the HER2-targeted CAR ORF cDNA was produced by commissioning DNA synthesis according to the previously disclosed sequence (US Patent US 20060275305 A1) (Integrated DNA Technologies). The sequences of the extracellular, transmembrane, and proximal domains of CD8 were extracted from the human CD8 ORF sequence (NM_001145873.1) in the NCBI database. The anti-HER2 scFv (clone 4D5), the human 4-1BB intracellular signaling domain, and the human CD3 zeta chain intracellular signaling domain were then linked to this ORF. Additionally, LNGFR, to be used as a reporter, was linked to this ORF via a T2A peptide sequence and synthesized via DNA synthesis (Integrated DNA Technologies) and PCR. A schematic diagram of the constructed CAR structure is shown in Figure 2. The CAR expression lentiviral vector pELPS was used, and a CAR ORF was constructed by attaching it to the 5' end of the EF1 promoter sequence of the pELPS vector using the NEBuilder® HiFi DNA Assembly system (New England Biolabs). The constructed vector was prepared by transfecting it into DH5α acceptor cells (competent cells) and amplifying it.

[0079] The sequence information of the domain and amino acid used in the manufacture of CAR according to the present embodiment is as described in Table 1 below.

[0080] 구분 HER2-41BBz-T2A-LNGFR서열서열번호 1cgaggacaccgagcgccagctccgcgagtgcacacgctgggccgacgccgagtgcgaggagatccctggccgttggattacacggtccacacccccagagggctcggacagcacagcccccagcacccaggagcctgaggcacctccagaacaagacctcatagccagcacggtggcaggtgtggtgaccacagtgatgggcagctcccagcccgtggtgacccgaggcaccaccgacaacctcatccctgtctattgctccatcctggctgctgtggttgtgggtcttgtggcctacatagccttcaagaggtga서열번호2MALPVTALLLPLALLLHAARPDIQMTQSPSSLSASVGDRVTITCRASQDVNTAVAWYQQKPGKAPKLLIYSASFLYSGVPSRFSGSRSGTDFTLTISSLQPEDFATYYCQQHYTTPPTFGQGTKVEIKRTGGGGSGGGGSGGGGSEVQLVESGGGLVQPGGSLRLSCAASGFNIKDTYIHWVRQAPGKGLEWVARIYPTNGYTRYADSVKGRFTISADTSKNTAYLQMNSLRAEDTAVYYCSRWGGDGFYAMDYWGQGTLVTVSSASTTTPAPRPPTPAPTIASQPLSLRPEACRPAAGGAVHTRGLDFACDIYIWAPLAGTCGVLLLSLVITLYCKRGRKKLLYIFKQPFMRPVQTTQEEDGCSCRFPEEEEGGCELRVKFSRSADAPAYQQGQNQLYNELNLGRREEYDVLDKRRGRDPEMGGKPRRKNPQEGLYNELQKDKMAEAYSEIGMKGERRRGKGHDGLYQGLSTATKDTYDALHMQALPPRGSGEGRGSLLTCGDVEENPGPMGAGATGRAMDGPRLLLLLLLGVSLGGAKEACPTGLYTHSGECCKACNLGEGVAQPCGANQTVCEPCLDSVTFSDVVSATEPCKPCTECVGLQSMSAPCVEADDAVCRCAYGYYQDETTGRCEACRVCEAGSGLVFSCQDKQNTVCEECPDGTYSDEANHVDPCLPCTVCEDTERQLRECTRWADAECEEIPGRWITRSTPPEGSDSTAPSTQEPEAPPEQDLIASTVAGVVTTVMGSSQPVVTRGTTDNLIPVYCSILAAVVVGLVAYIAFKR*

[0081] Examples 1-2: Production of CAR-expressing lentiviruses. Each lentiviral plasmid and packaging plasmid (pRSV.REV, pMDLg / p.RRE, pVSV-G) was transduced into Lenti-X cell lines (Takara) using Lipofectamin 2000 (Invitrogen). After 24 hours, the culture medium was replaced, and the culture supernatant containing the lentivirus secreted over the next 24-48 hours was harvested. Cell residues were removed using a 0.45 µm PES filter, and the supernatant was concentrated more than 50-fold using a Lenti-X Concentrator (Takara) to be used as a lentivirus concentrate for CAR-T cell production. The virus titer of the concentrate was determined by serially diluting a portion of the concentrate three times, infecting SUP-T1 cells with each dilution to check the level of CAR protein expression, and calculating the transduction unit based on this.

[0082] Examples 1-3: Production of CAR-T cells

[0083] Lymphocyte Separation Medium (LSM, Corning) from leukocytes obtained through leukapheresis from healthy individuals TMPeripheral blood mononuclear cells (PBMCs) were isolated using a meth. Subsequently, human pan-T cells contained within the isolated PBMCs were obtained by separating them using a negative separation system with the STEMCELL Human Pan-T Cells Isolation Kit (STEMCELL Technologies). The obtained T cells were activated by culturing them in a 24-well plate using Dynabeads Human T-Activator (Gibco) with a cell-to-bead ratio set to 1:3.

[0084] After 24 hours, CAR proteins were transfected into activated T cells by adding a CAR-expressing lentivirus at an MOI of 5. 48 hours after transfection, the cells were harvested and washed, and Dynabeads were removed using a magnet. Subsequently, TET2 deletion was induced by introducing ribonucleoprotein (RNP) into the cells via electroporation. Electroporation was performed using Lonza's 4D-Nucleofactor-X unit and the P3 Primary Cell 4D-Nucleofector. TM The procedure was performed using a kit. The TET2 deletion-inducing gRNA sequence information used is shown in Table 2 below.

[0085] Hs.Cas9.TET2.2.AChuman TET2crRNAGGATTGGGCCGTCTCATGTA Sequence No. 3Hs.Cas9.TET2.3.AChuman TET2crRNAGGCCCCTCGTTTTCACCAAG Sequence No. 4

[0086] After inducing TET2 deletion in CAR-T cells using the CRISPR-Cas9 system, the cells were cultured for 48 hours under conditions containing human IL-2 (23 ng / mL, PeproTech). Subsequently, cells were proliferated by performing subcultures with the addition of culture medium containing IL-2 (23 ng / mL) at intervals of 2 or 3 days, and were cultured for up to 10 days to be used as CAR-T cells. CAR protein expression on the cell surface was analyzed using a flow cytometer (FACS-Fortessa X-20, BD Biosciences) after staining CAR-T cells proliferated for 7 days following lentivirus transduction with a phycoerythrin (PE)-labeled anti-LNGFR antibody. In addition, cell subtypes were identified by flow cytometry after staining with anti-CD27-FITC, anti-CD45RA-PerCP-Cy5.5, anti-CD25-APC, anti-CD3-APC-Cy7, and anti-CD8-BV510 antibodies.

[0087] After the completion of culture, the cells were lysed with RIPA buffer and subjected to SDS-PAGE gel electrophoresis. The efficiency of TET2 deletion in CAR-T cells was confirmed by detecting TET2 protein using a Western blot with an anti-TET2 antibody (Cell Signaling Technologies). Figure 3 schematically illustrates the process of constructing TET2-deficient CAR-T cells. Additionally, Figure 4 shows the results of a Western blot confirming TET2 protein expression in a UTD (Untransduced) control, a wild-type (WT) HER2-hCAR (ntcRNA), and TET2-deficient HER2-hCAR-T cells (Hs.Cas9.TET2.2.AC and Hs.Cas9.TET2.3.AC) constructed using two different types of gRNA.

[0088] Examples 1-4: Confirmation of Cytotoxicity of TET2-Deficient CAR-T Cells

[0089] Cytotoxicity was measured by co-culturing fluorescently labeled target cells (SK-BR-3) and TET2-deficient CAR-T cells in 96-well plates at target cell (T) : TET2-deficient CAR-T cell (E) ratios of 1:1, 1:2, 1:4, and 1:8, respectively. Target cells were prepared by seeding 20,000 cells per well in 96-well black plates at least 18 hours prior to the start of co-culture, and subsequently, UTD, WT CAR-T, and two types of TET2-deficient CAR-T were co-cultured according to their respective ratios. During the co-culture period, the fluorescence intensity of the target cells was measured at intervals of 3 to 6 hours using Cellcyte X (CYTENA), a real-time fluorescence measuring instrument, and cytotoxicity resulting from co-culture with CAR-T cells was calculated and confirmed based on the hourly decrease in the measured fluorescence intensity.

[0090] The experimental results measured through Examples 1-4 are shown in Figures 5 to 11. Specifically, the experimental results for measuring the cell number of UTD, WT HER2-hCAR-T cells and TET2-deficient HER2-hCAR-T cells (Figure 5(a)) and the experimental results for measuring the fold increase of TET2-deficient HER2-hCAR-T cells and WT HER2-hCAR-T cells (Figure 5(b)) are shown in Figure 5, which indicates the degree of proliferation. In addition, the results for measuring the viability of each experimental group are shown in Figure 6, and the CAR expression rates of UTD, WT HER2-hCAR-T, and TET2-deficient HER2-hCAR-T cells measured on day 7 of CAR-T cell generation are compared and shown in Figure 7 as a FACS plot (Figure 7(a)) and a bar graph (Figure 7(b)).

[0091] A representative FACS plot showing the CAR expression rates of WT HER2-hCAR-T and TET2-deficient HER2-hCAR-T cells is shown in Fig. 8. Additionally, the proportions of CD4+ and CD8+ T cells in UTD, WT CAR-T, and TET2-deficient CAR-T cells are shown as a bar graph in Fig. 9. The frequencies of Naive (CD27+CD45RA+), Central Memory (CM, CD27+CD45RA-), Effector Memory (EM, CD27-CD45RA-), and Late Differentiated Effector Memory (EMRA, CD27-CD45RA+) cells in CD4+ (Fig. 10(a)) and CD8+ (Fig. 10(b)) T cells of UTD, WT CAR-T, and TET2-deficient CAR-T cells measured on day 7 of CAR-T cell generation are shown as a bar graph in Fig. 10. Figure 11 shows the results of a cytotoxicity experiment in which real-time fluorescence intensity was measured using Cellcyte X after co-culturing UTD, WT CAR-T, and TET2-deficient CAR-T cells with fluorescently labeled target cells (SK-BR-3) for 3 days. Figures 11(a) to 11(d) show cases where the ratio of target cells (T) to TET2-deficient CAR-T cells (E) was set to 1:1, 1:2, 1:4, and 1:8, respectively.

[0092] From the above experimental results, it can be confirmed that TET2 KO CAR-T cells exhibit proliferation and survival rates similar to WT CAR-T cells, and also maintain cytotoxic function against target cells.

[0093]

[0094] <Example 2> Enhancement of naive / memory subtypes in TET2-deficient CAR-T cells by IL-21 addition

[0095] Example 2-1: Measurement of Subtype Differentiation Efficiency of TET2-Deficient CAR-T Cells by Common Gamma Chain Cytokine

[0096] The same UTD, WT CAR-T, and TET2-deficient CAR-T cells used previously were activated using Dynabeads T Activator (Invitrogen) coated with anti-CD3 and anti-CD28 antibodies, respectively, and cultured for 5 days after treatment with common gamma chain cytokines (IL-2: 23 ng / ml, IL-7: 15 ng / ml, IL-15: 15 ng / ml, IL-21: 20 ng / ml), respectively. Subsequently, cell subtypes were identified by flow cytometry after staining with anti-CD27-FITC, anti-CD45RA-PerCP-Cy5.5, anti-CD25-APC, anti-CD3-APC-Cy7, and anti-CD8-BV510 antibodies, and the degree of cell differentiation was compared according to the presence of TET2 deficiency and the type of cytokine. The experimental procedure is schematically illustrated in Figure 12.

[0097] Figure 13 shows the results of detecting T cell subtypes under various common gamma chain cytokine conditions using flow cytometry. Specifically, the cell count ratios measured under four cytokine addition conditions were rhIL-2 (23 ng / ml) addition condition (Figure 13(a)), rhIL-21 (20 ng / ml) addition condition (Figure 13(b)), rhIL-7 (15 ng / ml) addition condition (Figure 13(c)), and rhIL-15 (15 ng / ml) addition condition (Figure 13(d)).

[0098] In addition, the results of comparing the frequencies of the naive subtype and central memory subtype according to CD27+ expression in CD4+ T cells (Fig. 14(a)) and CD8+ T cells (Fig. 14(b)) under each condition using a bar graph are shown in Fig. 14.

[0099] CD27+ T cells are cells that express the CD27 molecule, which belongs to the tumor necrosis factor / neurogeneic growth factor receptor (TNF / NGF-R) family. CD27 is known to be expressed in all naive CD4+ T cells and about 80% of CD4+ memory T cells. Therefore, the expression of CD27 can be used as an indicator of the functional status and differentiation stage of T cells, and the loss of CD27 is associated with the effector phenotype of CD4+ and CD8+ T cells.

[0100] Experimental results showed that under IL-21 stimulation conditions, the frequency of naive and memory subtypes in TET2-deficient CAR-T cells was particularly high (Fig. 13(b)). Although naive and central memory subtypes were also observed under IL-2 (Fig. 13(a)), IL-7 (Fig. 13(c)), and IL-15 (Fig. 13(d)) stimulation conditions, IL-21 stimulation showed the strongest effect in enhancing naive and central memory subtypes. These results suggest that IL-21 stimulation reinforces the less differentiated naive / central memory subtypes of TET2-deficient CAR-T cells, thereby increasing the potential for these cells to exert long-term anticancer effects.

[0101]

[0102] Example 2-2: Confirmation of Differentiation Delay in IL-21-Added TET2-Deficient CAR-T Caused by Continuous Stimulation

[0103] Fluorescence-labeled target cells (BT-474) were prepared by seeding 50,000 cells per well into a 96-well plate at least 18 hours prior to co-culture. The next day, after confirming that the target cells had adhered to the wells, the culture medium was removed. Then, 50,000 UTD, WT CAR-T, and TET2-deficient CAR-T cells per well were added to either a culture medium containing IL-2 (23 ng / ml) alone or a culture medium containing both IL-2 (23 ng / ml) and IL-21 (20 ng / ml), respectively, to perform co-culture. Co-culture was performed in at least 3 replicates. After 3 days, the co-cultured UTD or CAR-T cells were harvested, washed twice with DPBS, and the cell count and viability were confirmed and recorded using trypan blue staining. The recovered UTD, WT CAR-T, and TET2-deficient CAR-T cells were additionally co-cultured under the same conditions as the previously seeded target BT-474 cells to perform a total of four consecutive stimuli. The experimental procedure is schematically illustrated in Figure 15. After the completion of the fourth consecutive culture, a portion of the cells were stained with anti-CD27-FITC, anti-CD45RA-PerCP-Cy5.5, anti-CD25-APC, anti-CD3-APC-Cy7, and anti-CD8-BV510 antibodies, and the degree of cell differentiation according to the presence of TET2 deficiency and the type of cytokine was compared using flow cytometry.

[0104] Figures 16 to 19 show the results of an experiment on whether TET2-deficient HER2-hCAR-T cells were maintained in a less differentiated state during repeated IL-21 stimulation. Figure 16 shows the results of a flow cytometry (FACS) plot showing subtype changes in WT CAR-T and TET2-deficient CAR-T cells after repeated stimulation with rhIL-2 (23 ng / ml) or rhIL-2 and rhIL-21 (20 ng / ml) for 12 days, and these results are shown as a pie chart in Figure 17. The experimental results confirmed that TET2-deficient CAR-T cells maintained a less differentiated state better under the condition where IL-21 was added.

[0105] The ratio of CD4+ and CD8+ T cells in TET2-deficient CAR-T cells was compared after repeated stimulation with rhIL-2 (23 ng / ml) or both rhIL-2 and rhIL-21 (20 ng / ml) for 12 days, as shown in Figures 18(a) and 18(b), respectively.

[0106] As a result, both groups tended to maintain balanced ratios under the condition using IL-21.

[0107] In addition, Figures 19(a) and 19(b) show the results regarding the proliferation rates of UTD, WT CAR-T, and TET2-deficient CAR-T cells cultured for 3 days in each repeated stimulation round using IL-2 and IL-2+IL-21, respectively. The experimental results confirmed that a higher proliferation rate was observed under the condition where IL-21 was added.

[0108] Experimental results showed that IL-21 stimulation induced TET2-deficient CAR-T cells to remain in a less differentiated state even during repeated stimulation. In contrast, WT CAR-T cells were found to have differentiated rapidly. TET2-deficient CAR-T cells exhibited a higher retention of the naive / memory subtype under IL-21 stimulation conditions.

[0109] Experimental results confirmed that IL-21 stimulation induces TET2-deficient CAR-T cells to maintain a less differentiated state even under repeated stimulation conditions. In contrast, WT CAR-T cells underwent rapid differentiation. TET2-deficient CAR-T cells maintained a higher proportion of naive / central memory subtypes under IL-21 stimulation conditions, suggesting that this may contribute to maximizing CAR-T cell viability, scalability, and anticancer effects. Although not strictly theoretical, it is understood that TET2 gene deletion enhances the long-term viability and memory function of CAR-T cells, while IL-21 stimulation promotes T-cell activation and contributes to sustained proliferation and enhanced function. The combination of TET2 gene deletion and IL-21 stimulation acts complementarily, enabling CAR-T cells to persist for a long time and exert potent anticancer activity even in solid tumor environments. This presents a new strategy to overcome the limitations of existing CAR-T therapies in solid tumors.

[0110] In addition, it was confirmed that under culture conditions containing IL-21, the cell proliferation rate increased and the ratio of CD4+ and CD8+ T cells was maintained stably. These results indicate that IL-21 plays an important role in enhancing the long-term effects and persistence of TET2-deficient CAR-T cells and is useful for maintaining CAR-T cell function even in solid tumor environments where repetitive stimulation occurs.

[0111] Through the method of this specification, the functional persistence of TET2-deficient CAR-T cells can be enhanced, and by maintaining a less differentiated state, more effective anticancer treatment can be provided. The present manufacturing method can optimize the regulation of T cell differentiation using IL-21 stimulation and ensure sustained and potent anticancer activity.

[0112] Although embodiments and examples of the present specification have been described above with reference to the attached drawings, the present specification is not limited to the above embodiments and examples and can be manufactured in various different forms. A person skilled in the art to which the present specification pertains will understand that it can be implemented in other specific forms without changing the technical concept or essential features of the present specification. Therefore, the embodiments described above should be understood as illustrative in all respects and not restrictive.

Claims

1. A step of generating a CAR-T cell population by contacting a T cell population with a nucleic acid molecule encoding a Chimeric Antigen Receptor (CAR) that targets solid tumors; A step of generating a TET2 gene knockout CAR-T cell population (TET2 KO CAR-T) by knocking out the TET2 gene from the above CAR-T cell population; Step of stimulating a TET2 gene-knockout CAR-T cell population with IL-21; and Step of harvesting IL-21-stimulated TET2 KO CAR-T cell populations A method for producing a population of delayed-differentiation CAR-T cells including 2. A method for producing a population of delayed-differentiation CAR-T cells according to claim 1, wherein the step of producing a TET2 gene knockout CAR-T cell population comprises the step of introducing a TET2-targeting ribonucleoprotein (RNP) into CAR-T cells by electroporation.

3. A method for producing a population of CAR-T cells with delayed differentiation, wherein, in paragraph 2, the ribonucleic protein targeting TET2 comprises gRNA that induces TET2 deletion.

4. A method for producing a population of delayed-differentiation CAR-T cells according to claim 1, further comprising, prior to the step of stimulating IL-21, a step of activating the TET2 gene knockout CAR-T cells using an anti-CD3 binding domain and a co-stimulatory molecule binding domain.

5. A method for producing a CAR-T cell population with delayed differentiation according to claim 1, wherein the step of stimulating the TET2 gene knockout CAR-T cell population with IL-21 is performed by culturing in a cell medium containing IL21 for at least 3 days.

6. A method for preparing a population of delayed-differentiation CAR-T cells according to claim 1, wherein the IL-21 is added to a cell medium at a concentration of 20 ng / ml to 50 ng / ml.

7. A method for preparing a population of CAR-T cells with delayed differentiation according to claim 5, wherein the cell medium further comprises IL-2, IL-15, IL-7, IL-6, LSD1 retardant, MALT1 retardant, or a combination thereof.

8. In Paragraph 1, A method for producing a delayed-differentiation CAR-T cell population in which, based on flow cytometry analysis results, the IL-21-stimulated TET2 gene-knockout CAR-T cell population harvested in the step of harvesting the above CAR-T cell population has a sum of the CD4+ T cell naive subtype and central memory subtype of 55% or more of the total CD4+ T cells and a sum of the CD8+ T cell naive subtype and central memory subtype of 60% or more of the total CD8+ T cells.

9. In Paragraph 1, A method for producing a delayed-differentiation CAR-T cell population, wherein the IL-21-stimulated TET2 gene knockout CAR-T cell population harvested at the step of harvesting the above CAR-T cell population has a 12% or greater increase in the naive subtype and central memory subtype of T cells compared to a wild-time (WT) CAR-T cell population that is not TET2 gene knockout and is IL-21-stimulated under the same conditions.

10. A method for producing a CAR-T cell population with delayed differentiation according to claim 1, wherein the step of stimulating the CAR-T cell population with IL-21 and the step of harvesting the IL-21-stimulated CAR-T cell population are repeated two or more times.

11. In Paragraph 10, A method for producing a delayed-differentiation CAR-T cell population in which the IL-21-stimulated TET2 gene-knockout CAR-T cell population harvested after the above repetition results in 95% or more of the total CD8+ T cells being CD8+ T cells as a result of flow cytometry analysis.

12. A method for producing a population of delayed-differentiation CAR-T cells according to claim 1, wherein the CAR comprises an antigen-binding domain, a transmembrane domain, an intracellular signaling domain, and a reporter.

13. A method for producing a population of delayed-differentiation CAR-T cells according to claim 12, wherein the antigen-binding domain comprises a HER2-specific single-chain variable fragment (scFv).

14. A method for producing a population of delayed-differentiation CAR-T cells according to claim 12, wherein the CAR has the amino acid sequence of SEQ ID NO.

2.

15. A pharmaceutical composition for treating solid tumors comprising a CAR-T cell population prepared by the method of any one of claims 1 to 14 and a pharmaceutically acceptable carrier thereof.

16. A pharmaceutical composition according to claim 15, wherein the solid tumor is selected from one or more of mesothelioma, malignant pleural mesothelioma, non-small cell lung cancer, small cell lung cancer, squamous cell lung cancer, large cell lung cancer, lung adenocarcinoma, pancreatic cancer, pancreatic ductal adenocarcinoma, gastric cancer, esophageal cancer, colorectal cancer, rectal cancer, prostate cancer, liver cancer, biliary tract cancer, gallbladder cancer, kidney cancer, bladder cancer, melanoma, skin cancer, sarcoma, osteosarcoma, soft tissue sarcoma, ovarian cancer, cervical cancer, endometrial cancer, fallopian tube cancer, glioblastoma, brain tumor, neuroblastoma, head and neck cancer, laryngeal cancer, pharyngeal cancer, oral cancer, thyroid cancer, breast cancer, or thymoma, or metastasis thereof.

17. A pharmaceutical composition for treating breast cancer comprising a population of delayed-differentiation CAR-T cells prepared by the method of claim 13.