Compositions and methods of using RUNX3-targeted mirna
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2025-10-21
- Publication Date
- 2026-08-13
Smart Images

Figure US2025051853_13082026_PF_FP_ABST
Abstract
Description
ATTORNEY DOCKET NO. 37759.0680P1COMPOSITIONS AND METHODS OF USING RUNX3- TARGETED miRNA CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application claims the benefit of U.S. Provisional Patent Application No.63 / 755,017, filed on February 6, 2025, each of which is incorporated by reference herein in its entirety7.STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH
[0002] This invention was made with government support under I01-BX004708 awarded by Veterans Affairs. The government has certain rights in the invention.REFERENCE TO SEQUENCE LISTING
[0003] The Sequence Listing submitted October 21, 2025 as a text file named “37759.0680P1. xml,” created on October 21, 2025, and having a size of 7,067 bytes is hereby incorporated by reference pursuant to 37 C.F.R. § 1.52(e)(5).BACKGROUND
[0004] Fractures pose a substantial health concern in the United States, with over 6.2 million incidents occurring annually, disproportionately affecting patients' quality7of life, and causing significant financial burden.
[0005] Fractures are currently treated in different ways and while some can be treated in a cast, brace, or splint, others require surgery to repair the fracture with plates, screws, nails or pins. Most fractures heal in 6-8 weeks, but this varies tremendously from bone to bone and in each person based on many of the factors discussed above. Hand and wrist fractures often heal in 4-6 weeks whereas a tibia fracture may take 20 weeks or more.
[0006] Aspiration for ideal fracture healing necessitates a comprehensive knowledge and understanding of all the factors that directly or indirectly influence the healing process. The main pillars of fracture healing are a good biological environment with adequate blood supply and a good mechanical environment with adequate stability.
[0007] Developing innovative and cost-effective strategies to improve fracture healing and hasten recovery is needed.BRIEF SUMMARY
[0008] Disclosed are methods of repairing bone fractures comprising administering a composition comprising a nucleic acid sequence to a subject having a bone fracture, wherein theATTORNEY DOCKET NO. 37759.0680P1nucleic acid sequence comprises a Runx family transcription factor 3 (Runx3)-targeting miRNA.
[0009] Disclosed are methods of promoting the transition from cartilaginous to bony callus comprising administering a composition comprising a nucleic acid sequence to a site comprising a bone fracture, wherein the nucleic acid sequence comprises a Runx3-targeting miRNA.
[0010] Disclosed are methods of decreasing Runx3 expression comprising administering a composition comprising a nucleic acid sequence to a site comprising a bone fracture, wherein the nucleic acid sequence comprises a Runx3 -targeting miRNA.
[0011] Additional advantages of the disclosed method and compositions will be set forth in part in the description which follows, and in part will be understood from the description, or may be learned by practice of the disclosed method and compositions. The advantages of the disclosed method and compositions will be realized and attained by means of the elements and combinations particularly pointed out in the appended claims. It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the invention as claimed.BRIEF DESCRIPTION OF THE DRAWINGS
[0012] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate several embodiments of the disclosed method and compositions and together with the description, serve to explain the principles of the disclosed method and compositions.
[0013] FIGS. 1A-1C shows conditional deletion of Runx3 in chondrogenic precursor cells accelerates fracture healing in mice. FIG. 1 A. mCT analysis of fracture callus at days 14 and 21 post-fracture showing increased bone volume in male and female Runx3 cKO mice. FIG. IB. Safranin O / Fast green staining of histologic sections of fracture callus showing reduced cartilage (red) and increased bone (green) in Runx3 cKO mice. FIG. 1C. Static histomorphometric analysis quantifying callus cartilage and bone.
[0014] FIGS. 2A-2C shows that Runx3 -targeted miR promotes fracture callus bone formation. FIG. 2A. mCT analysis of fracture callus at day 21 post-fracture showing increased bone volume Runx3 -targeted miR (miR-194-5p) injected callus. FIG. 2B. Safranin O / Fast green staining of histologic sections of fracture callus showing increased bone (green) in (miR-194-5p) injected callus. FIG. 2C. Static histomorphometric analysis quantifying callus bone.
[0015] FIGS. 3A-3C show lineage tracing studies showing earlier trans-differentiation of Runx3-deleted fracture callus chondrocytes to osteoblasts . FIG. 3A. Immunofluorescent staining showing comparable number of GFP-positive, Col X-positive cells in control and Runx3 cKO mice at day 10. By day 14 post-fracture, GFP-positive, Col X-positive cells remainATTORNEY DOCKET NO. 37759.0680P1in control mice but are essentially gone in Runx3 cKO mice. FIG. 3B. Immunofluorescent staining showing increased number of GFP-positive, Sp7-positive cells in Runx3 cKO compared to control mice at day 10 post fracture, and comparable numbers of these cells at day 14. FIG.3C. Quantification of cell numbers based on panels A and B.
[0016] FIG. 4 shows miR194-5p treatment increases fracture callus bone development. Top: mCT analysis showing increased % bone in fracture callus (BV / TV) of miR194-5p-treated mice, 21 days post- fracture. Bottom: Static histomorphometry of miR-treated fracture calluses showing increased % bone.DETAILED DESCRIPTION
[0017] The disclosed method and compositions may be understood more readily by reference to the following detailed description of particular embodiments and the Example included therein and to the Figures and their previous and following description.
[0018] It is to be understood that the disclosed method and compositions are not limited to specific synthetic methods, specific analytical techniques, or to particular reagents unless otherwise specified, and, as such, may vary. It is also to be understood that the terminology7used herein is for the purpose of describing particular embodiments only and is not intended to be limiting.
[0019] Disclosed are materials, compositions, and components that can be used for, can be used in conjunction with, can be used in preparation for, or are products of the disclosed method and compositions. These and other materials are disclosed herein, and it is understood that when combinations, subsets, interactions, groups, etc. of these materials are disclosed that while specific reference of each various individual and collective combinations and permutation of these compounds may not be explicitly disclosed, each is specifically contemplated and described herein. For example, if a peptide is disclosed and discussed and a number of modifications that can be made to a number of molecules including the amino acids are discussed, each and every combination and permutation of the peptide and the modifications that are possible are specifically contemplated unless specifically indicated to the contrary. Thus, if a class of molecules A, B, and C are disclosed as well as a class of molecules D, E, and F and an example of a combination molecule, A-D is disclosed, then even if each is not individually recited, each is individually and collectively contemplated. Thus, is this example, each of the combinations A-E, A-F, B-D, B-E, B-F, C-D, C-E, and C-F are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. Likewise, any subset or combination of these is also specificallyATTORNEY DOCKET NO. 37759.0680P1contemplated and disclosed. Thus, for example, the sub-group of A-E, B-F, and C-E are specifically contemplated and should be considered disclosed from disclosure of A, B, and C; D, E, and F; and the example combination A-D. This concept applies to all aspects of this application including, but not limited to. steps in methods of making and using the disclosed compositions. Thus, if there are a variety of additional steps that can be performed it is understood that each of these additional steps can be performed with any specific embodiment or combination of embodiments of the disclosed methods, and that each such combination is specifically contemplated and should be considered disclosed.A. Definitions
[0020] It is understood that the disclosed method and compositions are not limited to the particular methodology, protocols, and reagents described as these may vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to limit the scope of the present invention which will be limited only by the appended claims.
[0021] It must be noted that as used herein and in the appended claims, the singular forms "a ", "an", and "the" include plural reference unless the context clearly dictates otherwise. Thus, for example, reference to "a miRNA" or “a Runx3 -targeting miRNA” includes a plurality' of such miRNAs, reference to "the cell” is a reference to one or more cells and equivalents thereof known to those skilled in the art, and so forth.
[0022] As used herein, an ‘‘RNAi agent” (also referred to as an “RNAi trigger”) means a composition that contains an RNA or RNA-like (e.g., chemically modified RNA) oligonucleotide molecule that is capable of degrading or inhibiting (e.g., degrades or inhibits under appropriate conditions) translation of messenger RNA (mRNA) transcripts of a target mRNA in a sequence specific manner. As used herein, RNAi agents may operate through the RNA interference mechanism (i.e., inducing RNA interference through interaction with the RNA interference pathway machinery (RNA-induced silencing complex or RISC) of mammalian cells), or by any alternative mechanism(s) or pathway(s). While it is believed that RNAi agents, as that term is used herein, operate primarily through the RNA interference mechanism, the disclosed RNAi agents are not bound by or limited to any particular pathway or mechanism of action. RNAi agents disclosed herein are comprised of a sense strand and an antisense strand, and include, but are not limited to: short (or small) interfering RNAs (siRNAs), double stranded RNAs (dsRNA), micro RNAs (miRNAs), short hairpin RNAs (shRNA), and dicer substrates. The antisense strand of the RNAi agents described herein is at least partially complementary' to the mRNA being targeted (i.e. Runx3 mRNA). RNAi agents can include oneATTORNEY DOCKET NO. 37759.0680P1or more modified nucleotides and / or one or more non-phosphodi ester linkages.
[0023] As used herein, and unless otherwise indicated, the term “complementary,” when used to describe a first nucleobase or nucleotide sequence (e.g., RNAi agent sense strand or targeted mRNA) in relation to a second nucleobase or nucleotide sequence (e.g., RNAi agent antisense strand or a single-stranded antisense oligonucleotide), means the abi 1 i ty of an oligonucleotide or polynucleotide including the first nucleotide sequence to hybridize (form base pair hydrogen bonds under mammalian physiological conditions (or otherwise suitable in vivo or in vitro conditions)) and form a duplex or double helical structure under certain standard conditions with an oligonucleotide that includes the second nucleotide sequence. The person of ordinary skill in the art would be able to select the set of conditions most appropriate for a hybridization test. Complementary sequences include Watson-Crick base pairs or non-Watson-Crick base pairs and include natural or modified nucleotides or nucleotide mimics, at least to the extent that the above hybridization requirements are fulfilled. Sequence identity or complementarity is independent of modification.
[0024] As used herein, “perfectly complementary” or “fully complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, all (100%) of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
[0025] As used herein, “partially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 70%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
[0026] As used herein, “substantially complementary” means that in a hybridized pair of nucleobase or nucleotide sequence molecules, at least 85%, but not all, of the bases in a contiguous sequence of a first oligonucleotide will hybridize with the same number of bases in a contiguous sequence of a second oligonucleotide. The contiguous sequence may comprise all or a part of a first or second nucleotide sequence.
[0027] As used herein, the terms “complementary,” “fully complementary,” “partially complementary,” and “substantially complementary” are used with respect to the nucleobase or nucleotide matching between the sense strand and the antisense strand of an RNAi agent, or between the antisense strand of an RNAi agent and a sequence of a Runx3 mRNA.
[0028] The word “or” as used herein means any one member of a particular list and alsoATTORNEY DOCKET NO. 37759.0680P1includes any combination of members of that list.
[0029] As used herein, the term "therapeutically effective amount" means an amount of a therapeutic, prophylactic, and / or diagnostic agent (e.g. miRNA or a Runx3 -targeting miRNA) that is sufficient, when administered to a subject suffering from or susceptible to a disease, disorder, and / or condition, to treat, alleviate, ameliorate, relieve, alleviate symptoms of, prevent, delay onset of, inhibit progression of, reduce severity of, and / or reduce incidence of the disease, disorder, and / or condition.
[0030] As used herein, the term "treating" refers to partially or completely alleviating, ameliorating, relieving, delaying onset of, inhibiting progression of, reducing severity of, and / or reducing incidence of one or more symptoms or features of a particular disease, disorder, and / or condition. For example, "treating" bone fractures may refer to ameliorating or relieving pain from a fracture or accelerating fracture healing. Treatment may be administered to a subject who does not exhibit signs of a disease, disorder, and / or condition and / or to a subject who exhibits only early signs of a disease, disorder, and / or condition for the purpose of decreasing the risk of developing pathology associated with the disease, disorder, and / or condition.
[0031] As used herein, the terms “administering” and “administration” refer to any method of providing a disclosed composition of the invention or a Runx3-targeting miRNA to a subject. Such methods are well known to those skilled in the art and include, but are not limited to: oral administration, transdermal administration, administration by inhalation, nasal administration, topical administration, intravaginal administration, ophthalmic administration, intraaural administration, intracerebral administration, rectal administration, sublingual administration, buccal administration, and parenteral administration, including injectable such as intravenous administration, intra-arterial administration, intramuscular administration, and subcutaneous administration. Administration can be continuous or intermittent. In various aspects, a preparation can be administered therapeutically; that is, administered to treat an existing disease or condition. In further various aspects, a preparation can be administered prophylactically; that is, administered for prevention of a disease or condition. In some aspects, the skilled person can determine an efficacious dose, an efficacious schedule, or an efficacious route of administration for a disclosed composition or a disclosed Runx3 -targeting miRNAso as to treat a subject.
[0032] As used herein, “subject” refers to the target of administration, e.g. an animal. Thus the subject of the disclosed methods can be a vertebrate, such as a mammal. For example, the subject can be a human. The term does not denote a particular age or sex. Subject can be used interchangeably with “individual” or “patient”.
[0033] As used herein, “specifically binds” refers to binding to a specific target. ForATTORNEY DOCKET NO. 37759.0680P1example, the disclosed nucleic acid sequences can specifically bind to Runx3 mRNA which is the target of the nucleic acid sequences. In some aspects, binding to other sites, besides the target site, can be referred to non-specific binding.
[0034] Ranges may be expressed herein as from "about" one particular value, and / or to "about" another particular value. When such a range is expressed, also specifically contemplated and considered disclosed is the range from the one particular value and / or to the other particular value unless the context specifically indicates otherwise. Similarly, when values are expressed as approximations, by use of the antecedent “about,” it will be understood that the particular value forms another, specifically contemplated embodiment that should be considered disclosed unless the context specifically indicates otherwise. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint unless the context specifically indicates otherwise. Finally, it should be understood that all of the individual values and sub-ranges of values contained within an explicitly disclosed range are also specifically contemplated and should be considered disclosed unless the context specifically indicates otherwise. The foregoing applies regardless of whether in particular cases some or all of these embodiments are explicitly disclosed.
[0035] Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of skill in the art to which the disclosed method and compositions belong. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present method and compositions, the particularly useful methods, devices, and materials are as described. Publications cited herein and the material for which they are cited are hereby specifically incorporated by reference. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such disclosure by virtue of prior invention. No admission is made that any reference constitutes prior art. The discussion of references states what their authors assert, and applicants reserve the right to challenge the accuracy and pertinency of the cited documents. It will be clearly understood that, although a number of publications are referred to herein, such reference does not constitute an admission that any of these documents forms part of the common general knowledge in the art.
[0036] Throughout the description and claims of this specification, the word “comprise” and variations of the word, such as “comprising” and “comprises.” means “including but not limited to,” and is not intended to exclude, for example, other additives, components, integers or steps. In particular, in methods stated as comprising one or more steps or operations it is specifically contemplated that each step comprises what is listed (unless that step includes a limiting termATTORNEY DOCKET NO. 37759.0680P1such as “consisting of”), meaning that each step is not intended to exclude, for example, other additives, components, integers or steps that are not listed in the step.B. Methods
[0037] Disclosed are methods that involve targeting Runx3 in order to block or inhibit Runx3 expression or activity.
[0038] In some aspects, targeting Runx3 comprises administering a Runx3 -targeting miRNA. In some aspects, a Runx3 -targeting miRNA can regulate Runx3 gene expression by binding to Runx3 mRNA and preventing or reducing production of the RUNX3 protein. In some aspects, a Runx3 -targeting miRNA results in degradation of the Runx3 mRNA or translational repression of Runx3 mRNA.1. Repairing bone fractures
[0039] A bone fracture is the medical definition for a broken bone. Bone fracture healing is an intricate and fluent regenerative process that aims at restoring the damaged bone to its preinjury state and cellular composition. Fracture healing starts with an anabolic phase where there is recruitment and differentiation of stem cells with subsequent increases in the skeletal and vascular tissue volume. A cartilaginous callus forms at the fracture site, whereas at the periphery' of this callus, the periosteum swells, and the primary' bone formation starts. Simultaneously with cartilaginous callus formation, the cells involved in angiogenesis are recruited and differentiated in the nearby muscle mass. With further progression of chondrocyte differentiation, the extracellular matrix is mineralized, and the chondrocytes undergo apoptosis. This is followed by a catabolic phase where cartilage resorption ensues, resulting in tissue and callus volume reduction.
[0040] In some aspects, repairing a bone fracture can comprise the stages of inflammation and / or hematoma formation, soft callus formation, hard callus formation, and bone remodeling. The disclosed methods of repairing bone fractures can alter / affect one or more of these stages but primarily affect the soft callus formation to hard callus formation stages.
[0041] RUNX family transcription factor 3 (Runx3) is a gene that encodes a member of the runt domain-containing family' of transcription factors. A heterodimer of this protein and a beta subunit forms a complex that binds to the core DNA sequence 5'-PYGPYGGT-3’ found in a number of enhancers and promoters, and can either activate or suppress transcription. It also interacts with other transcription factors. It functions as a tumor suppressor, and the gene is frequently deleted or transcriptionally silenced in cancer. Alternative splicing results in multiple transcript variants.
[0042] Disclosed are methods of repairing bone fractures comprising administering aATTORNEY DOCKET NO. 37759.0680P1therapeutically effective amount of a composition that blocks or inhibits Runx3 mRNA expression and / or protein activity.
[0043] Disclosed are methods of repairing bone fractures comprising administering a therapeutically effective amount of a composition comprising a nucleic acid sequence to a subject having a bone fracture, wherein the nucleic acid sequence comprises a Runx3 -targeting miRNA.
[0044] In some aspects, the Runx3 -targeting miRNA is miR-194-5p. In some aspects, miR-194-5p has the sequence of any one of the sequences of Table 1. In some aspects, miR-194-5p has the sequence of UGUAACAGC AACUCC AUGUGGA (SEQ ID NO: 1).
[0045] In some aspects, the Runx3 -targeting miRNA is mIR-130a-3p, miR-301a-3p and miR495-3p.
[0046] In some aspects, the targeting of Runx3 occurs in immune cells including, but not limited to macrophages, dendritic cells, and T cells, as well as in gastrointestinal epithelial cells. In some aspects, the targeting of Runx3 occurs in mesenchymal stem cells, chondrogemc precursor cells, osteoblasts, and / or chondrocytes.
[0047] In some aspects, after administering a therapeutically effective amount of the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity there is an increase in fracture callus at the bone fracture. In some aspects, a fracture callus is the tissue that forms around the ends of broken bone fragments. In some aspects, a fracture callus can be a soft callus or a hard callus. Thus, in some aspects, the increase in fracture callus at the bone fracture is an increase in hard callus and / or soft callus. In some aspects, the increase in fracture callus at the bone fracture is an increase in hard callus as the methods of administering a composition comprising a nucleic acid sequence comprising a Runx3-targeting miRNA decreases Runx3 which can result in a decrease in cartilage or soft callus at the bone fracture and / or an increase in callus bone formation. Thus, in some aspects, administering a therapeutically effective amount of the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity promotes callus bone formation at the bone fracture.
[0048] In some aspects, after administering a therapeutically effective amount of the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity there is an increase in bone volume at the bone fracture. In some aspects, the increase in bone volume is due to the presence of increased hard callus.
[0049] In some aspects, after administering a therapeutically effective amount of the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity there is a decrease in cartilage at the bone fracture.ATTORNEY DOCKET NO. 37759.0680P1
[0050] In some aspects, the decrease in cartilage is due to the presence of increased hard callus which replaces the soft callus (e.g., cartilage) thereby resulting in a decrease in cartilage.
[0051] In some aspects, after administering a therapeutically effective amount of the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity there is an increase in transdifferentiation of chondrocytes to osteoblasts. In some aspects, the transdifferentiation of chondrocytes to osteoblasts can occur during the progression of a soft callus to a hard callus.
[0052] In some aspects, after administering a therapeutically effective amount of the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity there is an increase in Sp7+ cells. In some aspects, Sp7+ cells are osteoblast lineage cells, thus they can mature into bone-forming cells that repair fractures. Thus, an increase in Sp7+ cells is ideal for repairing a bone fracture.
[0053] In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can be administered at a site of the bone fracture. In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can be administered systemically. In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can be targeted to a site of the bone fracture.
[0054] In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can comprise a vector, wherein the vector comprises a Runx3 -targeting miRNA. In some aspects, any one or more of the vectors disclosed here can be used in the methods disclosed herein.
[0055] In some aspects, distinct from bone maintenance, fracture healing involves a process of endochondral ossification, whereby a temporary cartilaginous callus forms around the fracture site and is gradually converted to bone, bridging the broken cortical bone. In some aspects, Runx3 inhibition can promote fracture healing by hastening the transdifferentiation of callus chondrocytes to osteoblasts, a function different from its role in skeletal homeostasis.2. Promoting the transition from cartilaginous to bony callus
[0056] Disclosed are methods of promoting the transition from cartilaginous to bony callus comprising administering a therapeutically effective amount of a composition that blocks or inhibits Runx3 mRNA expression and / or protein activity.
[0057] Disclosed are methods of promoting the transition from cartilaginous to bony callus comprising administering a therapeutically effective amount of a composition that blocks or inhibits Runx3 mRNA expression and / or protein activity comprising a nucleic acid sequence to a site comprising a bone fracture, wherein the nucleic acid sequence comprises a Runx3-ATTORNEY DOCKET NO. 37759.0680P1targeting miRNA. As described herein, the stages of bone repair / healing involve a progression from soft callus (e.g. cartilage) to hard callus (e.g. bone). In some aspects, inhibiting or blocking Runx3 expression or activity can promote the transition from cartilaginous to bony callus.
[0058] In some aspects, the Runx3 -targeting miRNA is miR-194-5p. In some aspects, miR-194-5p has the sequence of any one of the sequences of Table 1. In some aspects, miR-194-5p has the sequence of UGUAACAGCAACUCCAUGUGGA (SEQ ID NO: 1).
[0059] In some aspects, the Runx3 -targeting miRNA is mIR-130a-3p, miR-301a-3p and miR495-3p.
[0060] In some aspects, the transition from cartilaginous to bony callus accelerates secondary fracture healing. In some aspects, second fracture healing is a process where a fractured bone heals through the formation of a callus, a bridge of new bone tissue, and subsequent remodeling.
[0061] In some aspects, after administering a therapeutically effective amount of the composition comprising the nucleic acid sequence comprises a Runx3 -targeting miRNA there is an increase in transdifferentiation of chondrocytes to osteoblasts. In some aspects, the trans differentiation of chondrocytes to osteoblasts can occur during the progression of a soft callus to a hard callus.
[0062] In some aspects, after administering a therapeutically effective amount of the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity, wherein the composition comprises the nucleic acid sequence comprising a Runx3 -targeting miRNA there is an increase in Sp7+ cells. In some aspects, Sp7+ cells are osteoblast lineage cells, thus they can mature into bone-forming cells that repair fractures. Thus, an increase in Sp7+ cells is ideal for repairing a bone fracture.
[0063] In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can be administered at a site comprising a bone fracture. In some aspects, the composition can be administered systemically. In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can be targeted to a site comprising a bone fracture.
[0064] In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can comprise a vector, wherein the vector comprises the Runx3 -targeting miRNA. In some aspects, any one or more of the vectors disclosed here can be used.3. Decreasing Runx3 expression
[0065] Disclosed are methods of decreasing Runx3 expression comprising administering aATTORNEY DOCKET NO. 37759.0680P1therapeutically effective amount of a composition that blocks or inhibits Runx3 mRNA expression and / or protein activity.
[0066] Disclosed are methods of decreasing Runx3 expression comprising administering a therapeutically effective amount of a composition comprising a nucleic acid sequence to a site comprising a bone fracture, wherein the nucleic acid sequence comprises a Runx3 -targeting miRNA.
[0067] In some aspects, the decrease of Runx3 expression occurs in mesenchymal stem cells, chondrogenic precursor cells, chondrocytes, or immune cells.
[0068] In some aspects, the Runx3 -targeting miRNA is miR-194-5p. In some aspects. miR-194-5p has the sequence of any one of the sequences of Table 1. In some aspects, miR-194-5p has the sequence of UGUAACAGCAACUCCAUGUGGA (SEQ ID NO: 1).
[0069] In some aspects, the Runx3 -targeting miRNA is mIR-130a-3p, miR-301a-3p and miR495-3p.
[0070] In some aspects, after administering a therapeutically effective amount of the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity there is an increase in transdifferentiation of chondrocytes to osteoblasts. In some aspects, thetrans differentiation of chondrocytes to osteoblasts can occur during the progression of a soft callus to a hard callus.
[0071] In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can be administered at a site comprising a bone fracture. In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can be administered systemically. In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can be targeted to a site comprising a bone fracture.
[0072] In some aspects, the composition that blocks or inhibits Runx3 mRNA expression and / or protein activity can comprise a vector, wherein the vector comprises the Runx3 -targeting miRNA. In some aspects, any one or more of the vectors disclosed here can be used.C. Nucleic Acid Sequences
[0073] Disclosed are nucleic acid sequences comprising a miRNA that targets and / or specifically binds to Runx3 mRNA (a Runx3 -targeting miRNA). In some aspects, disclosed are nucleic acid sequences comprising an agonist or mimic of a miRNA that targets Runx3.
[0074] In some aspects, a Runx3 -targeting miRNA is any nucleic acid sequence that specifically binds to Runx3 mRNA. Thus, in some aspects, a Runx3 -targeting miRNA is complementary to Runx3 mRNA. In some aspects, at least 70, 80, 90, 95, or 99% of a Runx3-targeting miRNA is complementary to Runx3 mRNA.ATTORNEY DOCKET NO. 37759.0680P1
[0075] Disclosed are microRNAs (miRNAs) that target the Runx3 gene or mimics thereof.
[0076] In some aspects, these microRNAs can be called a “Runx3 -targeting miRNA” or a “Runx3 -targeting miR”. In some aspects, "microRNA," "miRNA," and "miR" all refer to the same thing: small, non-coding RNA molecules that play a crucial role in regulating gene expression (e.g. ofRunx3).
[0077] MicroRNAs (miRNAs or MiRs) are a class of small (e g., about 20 nucleotides in length), conserved non-coding RNAs that regulate mRNA degradation and translation, at least in part through binding to the 3'UTR of target genes. In some aspects, the miR can be miR-194-5p and the target gene can be Runx3. In some aspects, the miR can be a variant of miR-194-5p. In some aspects, the term “miR-194-5p” can also include fragments of the miR-194-5p molecule. As used herein, the term “fragment” refers to a portion of the full-length miR-194-5p. The size of the fragment can vary and must include a functional fragment, that is, the fragment must be able to modulate the expression of the Runx3 gene. In some aspects, the fragment can comprise at least the sequence UGUAACAGCAACUCCAUGUGGA (SEQ ID NO: 1).
[0078] In some aspects, miR-194-5p can be one or more of the sequences in Table 1.Table 1. miR-194-5p sequencesATTORNEY DOCKET NO. 37759.0680P1
[0079] In some aspects, disclosed are the primary microRNA (pri-miRNA) or variants thereof. In some aspects, the sequence of the pri-miRNA can comprise a pre-miRNA, miRNA and / or miRNA*. The disclosed pri-miRNAs comprise a sequence that targets Runx3.
[0080] In some aspects, disclosed are pre-miRNAs or variants thereof. The disclosed pre-miRNAs comprise a sequence that targets Runx3.
[0081] In some aspects, the disclosed nucleic acid sequences comprise a gene coding for a miRNA. In some aspects, a gene coding for a miRNA may be transcribed leading to production of an miRNA precursor known as the pri-miRNA. The pri-miRNA may be part of a polycistronic RNA comprising multiple pri-miRNAs. The pri-miRNA may form a hairpin with a stem and loop. In some aspects, the stem may comprise mismatched bases.ATTORNEY DOCKET NO. 37759.0680P1
[0082] In some aspects, the hairpin structure of the pri-miRNA may be recognized by Drosha, which is an RNase III endonuclease. Drosha may recognize terminal loops in the pri-miRNA and cleave approximately two helical turns into the stem to produce a 60-70 nt precursor known as the pre-miRNA. Drosha may cleave the pri-miRNA with a staggered cut typical of RNase III endonucleases yielding a pre-miRNA stem loop with a 5' phosphate and ~2 nucleotide 3' overhang. Approximately one helical turn of stem (~10 nucleotides) extending beyond the Drosha cleavage site may be essential for efficient processing. The pre-miRNA may then be actively transported from the nucleus to the cytoplasm by Ran-GTP and the export receptor Ex-portin-5.
[0083] In some aspects, the pre-miRNA may be recognized by Dicer, which is also an RNase III endonuclease. Dicer may recognize the double-stranded stem of the pre-miRNA. Dicer may also recognize the 5' phosphate and 3' overhang at the base of the stem loop. Dicer may cleave off the terminal loop two helical turns away from the base of the stem loop leaving an additional 5' phosphate and ~2 nucleotide 3' overhang. The resulting siRNA-like duplex, which may comprise mismatches, comprises the mature miRNA and a similar-sized fragment known as the miRNA*. The miRNA and miRNA* may be derived from opposing arms of the pri-miRNA and pre-miRNA. miRNA* sequences may be found in libraries of cloned miRNAs but typically at lower frequency than the miRNAs.
[0084] In some aspects, although initially present as a double-stranded species with miRNA*, the miRNA may eventually become incorporated as single-stranded RNA into a ribonucleoprotein complex known as the RNA-induced silencing complex (RISC). Various proteins can form the RISC, which can lead to variability in specificity for miRNA / miRNA* duplexes, binding site of the target gene, activity of miRNA (repress or activate), which strand of the miRNA / miRNA* duplex is loaded into the RISC.
[0085] In some aspects, when the miRNA strand of the miRNA:miRNA* duplex is loaded into the RISC, the miRNA* may be removed and degraded. The strand of the miRNA:miRNA* duplex that is loaded into the RISC may be the strand whose 5' end is less tightly paired. In cases where both ends of the miRNA: miRNA* have roughly equivalent 5' pairing, both miRNA and miRNA* may have gene silencing activity.
[0086] In some aspects, the RISC may identify target nucleic acids based on high levels of complementarity between the miRNA and the mRNA, especially by nucleotides 2-8 of the miRNA. Only one case has been reported in animals where the interaction between the miRNA and its target was along the entire length of the miRNA. This was shown for mir-196 and Hox B8 and it was further shown that mir-196 mediates the cleavage of the Hox B8 mRNA (Yekta etATTORNEY DOCKET NO. 37759.0680P1al 2004, Science 304-594). Otherwise, such interactions are known only in plants (Bartel & Bartel 2003, Plant Physiol 132-709).
[0087] A number of studies have looked at the base-pairing requirement betw een miRNA and its mRNA target for achieving efficient inhibition of translation (reviewed by Bartel 2004. Cell 116-281). In mammalian cells, the first 8 nucleotides of the miRNA may be important (Doench & Sharp 2004 GenesDev 2004-504). However, other parts of the microRNA may also participate in mRNA binding. Moreover, sufficient base pairing at the 3' can compensate for insufficient pairing at the 5' (Brennecke et al., 2005 PLoS 3-e85). Computation studies, analyzing miRNA binding on whole genomes have suggested a specific role for bases 2-7 at the 5' of the miRNA in target binding but the role of the first nucleotide, found usually to be “A” was also recognized (Lewis et al. 2005 Cell 120-15). Similarly, nucleotides 1-7 or 2-8 w ere used to identify and validate targets by Krek et al (2005, Nat Genet 37-495).
[0088] In some aspects, the target sites in the mRNA may be in the 5' UTR, the 3' UTR or in the coding region. Interestingly, multiple miRNAs may regulate the same mRNA target by recognizing the same or multiple sites. The presence of multiple miRNA complementarity sites in most genetically identified targets may indicate that the cooperative action of multiple RISCs provides the most efficient translational inhibition.
[0089] In some aspects, miRNAs may direct the RISC to downregulate gene expression by either of tw o mechanisms: mRNA cleavage or translational repression. The miRNA may specify’ cleavage of the mRNA if the mRNA has a certain degree of complementarity to the miRNA. When a miRNA guides cleavage, the cut may be between the nucleotides pairing to residues 10 and 11 of the miRNA. Alternatively, the miRNA may repress translation if the miRNA does not have the requisite degree of complementarity to the miRNA. Translational repression may be more prevalent in animals since animals may have a lower degree of complementarity.
[0090] In some aspects, there may be variability in the 5' and 3' ends of any pair of miRNA and miRNA*. This variability may be due to variability in the enzymatic processing of Drosha and Dicer with respect to the site of cleavage. Variability at the 5' and 3' ends of miRNA and miRNA* may also be due to mismatches in the stem structures of the pri-miRNA and pre-miRNA. The mismatches of the stem strands may lead to a population of different hairpin structures. Variability in the stem structures may also lead to variability in the products of cleavage by Drosha and Dicer.
[0091] In some aspects, any of the disclosed nucleic acid sequences can have a length of 10 to 100 nucleotides. In some aspects, the nucleic acid sequence can have a length of at least 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 35, 40, 45, 50, 60, 70,ATTORNEY DOCKET NO. 37759.0680P180 or 90 nucleotides. In some aspects, the nucleic acid sequence can be synthesized or expressed in a cell (in vitro or in vivo) using a synthetic gene. In some aspects, the nucleic acid can be synthesized as a single strand molecule and hybridized to a substantially complementary nucleic acid to form a duplex, which is considered a nucleic acid sequence of the invention. The nucleic acid sequence can be introduced to a cell, tissue or organ in a single- or double-stranded form or capable of being expressed by a synthetic gene using methods well known to those skilled in the art, including as described in U.S. Pat. No. 6,506,559 which is incorporated by reference.
[0092] In some aspects, a synthetic gene comprises a nucleic acid sequence of the invention operably linked to a transcriptional and / or translational regulatory’ sequences. In some aspects, the synthetic gene can be capable of modifying the expression of a target gene with a binding site for the nucleic acid of the invention. Expression of the target gene can be modified in a cell, tissue or organ. In some aspects, the synthetic gene can be synthesized or derived from naturally-occurring genes by standard recombinant techniques. In some aspects, the synthetic gene can also comprise terminators at the 3'-end of the transcriptional unit of the synthetic gene sequence. In some aspects, the synthetic gene may also comprise a selectable marker.D. Vectors
[0093] Disclosed are vectors comprising a nucleic acid sequence as disclosed herein. In some aspects, the nucleic acid sequence comprises a Runx3 -targeting miRNA.i. Viral and Non- Viral Vectors
[0094] In some aspects, the delivery7vehicle or vector used to deliver miRNA to a cell or subject can be viral or non- viral. Examples of non-viral vectors include, but are not limited to. plasmids, liposomes, microcapsules, nanoparticles, lipid nanoparticles (LNPs), polymers, cationic peptides, highly branched poly([3-amino ester) (HPAE), single-chain cyclic polymer (SCKP), poly(amidoamine) (PAMAM) dendrimers, and polyethyleneimine (PEI).
[0095] In some cases, the vector can comprise a viral vector, a liposome, a nanoparticle, an exosome, an extracellular vesicle, or any combination thereof. In some cases, a viral vector can comprise an adenoviral vector, an adeno-associated viral vector (AAV), a lentiviral vector, a retroviral vector, a portion of any of these, or any combination thereof. In some cases, a nanoparticle vector can comprise a polymeric-based nanoparticle, an aminolipid based nanoparticle, a metallic nanoparticle (such as gold-based nanoparticle), a portion of any of these, or any combination thereof. In some cases, a vector can comprise an AAV vector. A vector can be modified to include a modified VP1 protein (such as an AAV vector modified to include a VP1 protein). An AAV can comprise a serotype — such as an AAV1 serotype, an AAV2 seroty pe, AAV3 serotype, an AAV4 seroty pe, AAV5 seroty pe, an AAV6 seroty pe, AAV7ATTORNEY DOCKET NO. 37759.0680P1serotype, an AAV8 serotype, an AAV9 serotype, a derivative of any of these, or any combination thereof
[0096] There are a number of compositions and methods which can be used to deliver the disclosed nucleic acids to cells, either in vitro or in vivo. These methods and compositions can largely be broken down into two classes: viral based delivery systems and non-viral based delivery systems. For example, the nucleic acids can be delivered through a number of direct delivery systems such as, electroporation, lipofection, calcium phosphate precipitation, plasmids, viral vectors, viral nucleic acids, phage nucleic acids, phages, cosmids, or via transfer of genetic material in cells or carriers such as cationic liposomes. Appropriate means for transfection, including viral vectors, chemical transfectants, or physico-mechanical methods such as electroporation and direct diffusion of DNA, are described by, for example, Wolff, J. A., etal., Science, 247, 1465-1468, (1990); and Wolff, J. A. Nature, 352, 815-818, (1991). Such methods are well know n in the art and readily adaptable for use with the compositions and methods described herein. In certain cases, the methods will be modified to specifically function with large DNA molecules. Further, these methods can be used to target certain diseases and cell populations by using the targeting characteristics of the carrier.
[0097] Expression vectors can be any nucleotide construction used to deliver genes or gene fragments into cells (e.g., a plasmid), or as part of a general strategy to deliver genes or gene fragments, e.g., as part of recombinant retrovirus or adenovirus (Ram et al. Cancer Res. 53:83-88, (1993)). For example, disclosed herein are expression vectors comprising a nucleic acid sequence, wherein the nucleic acid sequence comprises a Runx3 -targeting miRNA.
[0098] The “control elements” present in an expression vector are those non-translated regions of the vector-enhancers, promoters, 5’ and 3’ untranslated regions-which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including constitutive and inducible promoters, may be used. For example, when cloning in bacterial systems, inducible promoters such as the hybrid lacZ promoter of the pBLUESCRIPT phagemid (Stratagene, La Jolla, Calif.) or pSPORTl plasmid (Gibco BRL, Gaithersburg, Md.) and the like may be used. If it is necessary to generate a cell line that contains multiple copies of the sequence encoding a polypeptide, vectors based on SV40 or EBV may be advantageously used with an appropriate selectable marker.
[0099] Enhancer generally refers to a sequence of DNA that functions at no fixed distance from the transcription start site and can be either 5’ (Laimins, L. et al., Proc. Natl. Acad. Sci. 78:ATTORNEY DOCKET NO. 37759.0680P1993 (1981)) or 3’ (Lusky, M.L., et al., Mol. Cell Bio. 3: 1108 (1983)) to the transcription unit. Furthermore, enhancers can be within an intron (Banerji, J.L. et al., Cell 33: 729 (1983)) as well as within the coding sequence itself (Osborne, T.F., et al.. Mol. Cell Bio. 4: 1293 (1984)). They are usually between 10 and 300 bp in length, and they function in cis. Enhancers function to increase transcription from nearby promoters. Enhancers also often contain response elements that mediate the regulation of transcription. Promoters can also contain response elements that mediate the regulation of transcription. Enhancers often determine the regulation of expression of a gene. While many enhancer sequences are now known from mammalian genes (globin, elastase, albumin, a-fetoprotein and insulin), typically one will use an enhancer from a eukaryotic cell virus for general expression. Preferred examples are the SV40 enhancer on the late side of the replication origin (bp 100-270), the cytomegalovirus early promoter enhancer, the polyoma enhancer on the late side of the replication origin, and adenovirus enhancers.
[0100] The promoter or enhancer may be specifically activated either by light or specific chemical events which trigger their function. Systems can be regulated by reagents such as tetracycline and dexamethasone. There are also ways to enhance viral vector gene expression by exposure to irradiation, such as gamma irradiation, or alkylating chemotherapy drugs.
[0101] Optionally, the promoter or enhancer region can act as a constitutive promoter or enhancer to maximize expression of the polynucleotides of the invention. In certain constructs the promoter or enhancer region be active in all eukaryotic cell types, even if it is only expressed in a particular type of cell at a particular time.
[0102] Expression vectors used in eukaryotic host cells (yeast, fungi, insect, plant, animal, human or nucleated cells) may also contain sequences necessary for the termination of transcription which may affect mRNA expression. These regions are transcribed aspoly adenylated segments in the untranslated portion of the mRNA encoding tissue factor protein. The 3’ untranslated regions also include transcription termination sites. It is preferred that the transcription unit also contains a polyadenylation region. One benefit of this region is that it increases the likelihood that the transcribed unit will be processed and transported like mRNA. The identification and use of poly adenylation signals in expression constructs is well established. It is preferred that homologous polyadenylation signals be used in the transgene constructs. In certain transcription units, the polyadenylation region is derived from the SV40 early polyadenylation signal and consists of about 400 bases.
[0103] The expression vectors can include a nucleic acid sequence encoding a marker product. This marker product can be used to determine if the gene has been delivered to the cell and once delivered is being expressed. Marker genes can include, but are not limited to the E.ATTORNEY DOCKET NO. 37759.0680P1coll lacZ gene, which encodes B-galactosidase. and the gene encoding the green fluorescent protein.
[0104] In some aspects, the marker may be a selectable marker. Examples of suitable selectable markers for mammalian cells are dihydrofolate reductase (DHFR). thymidine kinase, neomycin, neomycin analog G418, hydromycin, and puromycin. When such selectable markers are successfully transferred into a mammalian host cell, the transformed mammalian host cell can survive if placed under selective pressure. There are two widely used distinct categories of selective regimes. The first category is based on a cell’s metabolism and the use of a mutant cell line which lacks the ability to grow independent of a supplemented media. Two examples are CHO DHFR-cells and mouse LTK-cells. These cells lack the ability to grow without the addition of such nutrients as thymidine or hypoxanthine. Because these cells lack certain genes necessary for a complete nucleotide synthesis pathway, they cannot survive unless the missing nucleotides are provided in a supplemented media. An alternative to supplementing the media is to introduce an intact DHFR or TK gene into cells lacking the respective genes, thus altering their growth requirements. Individual cells which were not transformed with the DHFR or TK gene will not be capable of survival in non-supplemented media.
[0105] Another type of selection that can be used with the composition and methods disclosed herein is dominant selection which refers to a selection scheme used in any cell type and does not require the use of a mutant cell line. These schemes typically use a drug to arrest growth of a host cell. Those cells which have a novel gene would express a protein conveying drug resistance and w ould survive the selection. Examples of such dominant selection use the drugs neomycin, (Southern P. and Berg. P., J. Molec. Appl. Genet. 1: 327 (1982)). mycophenolic acid, (Mulligan, R.C. and Berg, P. Science 209: 1422 (1980)) or hygromycin, (Sugden, B. et al., Mol. Cell. Biol. 5: 410-413 (1985)). The three examples employ bacterial genes under eukary otic control to convey resistance to the appropriate drug G418 or neomycin (geneticin), xgpt (mycophenolic acid) or hygromycin, respectively. Others include the neomycin analog G418 and puramycin.
[0106] As used herein, plasmid (e.g., non-viral vectors) or viral vectors are agents that transport the disclosed nucleic acids, such as a nucleic acid sequence capable of encoding SMYD1 into the cell without degradation and include a promoter yielding expression of the gene in the cells into which it is delivered. In some aspects, the nucleic acid sequences disclosed herein are derived from either a virus or a retrovirus. Viral vectors are, for example, Adenovirus, Adeno-associated virus, Herpes virus, Lentivirus, Vaccinia virus, Polio virus, AIDS virus, neuronal trophic virus, Sindbis and other RNA viruses, including these viruses with theATTORNEY DOCKET NO. 37759.0680P1HIV backbone. Also preferred are any viral families which share the properties of these viruses which make them suitable for use as vectors. Retroviruses include Murine Maloney Leukemia virus, MMLV, and retroviruses that express the desirable properties of MMLV as a vector. Retroviral vectors are able to carry a larger genetic payload, i.e., a transgene or marker gene, than other viral vectors, and for this reason are a commonly used vector. However, they are not as useful in non-proliferating cells. Adenovirus vectors are relatively stable and easy to work with, have high titers, and can be delivered in aerosol formulation, and can transfect nondividing cells. Pox viral vectors are large and have several sites for inserting genes, they are thermostable and can be stored at room temperature. A preferred embodiment is a viral vector which has been engineered so as to suppress the immune response of the host organism, elicited by the viral antigens. Preferred vectors of this type will carry coding regions for Interleukin 8 or 10.
[0107] Viral vectors can have higher transaction abilities (i.e., ability to introduce genes) than chemical or physical methods of introducing genes into cells. Typically, viral vectors contain, nonstructural early genes, structural late genes, an RNA polymerase III transcript, inverted terminal repeats necessary7for replication and encapsidation, and promoters to control the transcription and replication of the viral genome. When engineered as vectors, viruses typically have one or more of the early genes removed and a gene or gene / promoter cassette is inserted into the viral genome in place of the removed viral DNA. Constructs of this type can carry up to about 8 kb of foreign genetic material. The necessary functions of the removed early genes are ty pically supplied by cell lines which have been engineered to express the gene products of the early genes in trans.
[0108] Retroviral vectors, in general, are described by Verma, I.M., Retroviral vectors for gene transfer. In Microbiology, Amer. Soc. for Microbiology, pp. 229-232, Washington, (1985), which is hereby incorporated by reference in its entirety. Examples of methods for using retroviral vectors for gene therapy are described in U.S. Patent Nos. 4,868,116 and 4,980,286; PCT applications WO 90 / 02806 and WO 89 / 07136; and Mulligan, (Science 260:926-932 (1993)); the teachings of which are incorporated herein by reference in their entirety for their teaching of methods for using retroviral vectors for gene therapy.
[0109] A retrovirus is essentially a package which has packed into it nucleic acid cargo. The nucleic acid cargo carries with it a packaging signal, yvhich ensures that the replicated daughter molecules will be efficiently packaged within the package coat. In addition to the package signal, there are a number of molecules yvhich are needed in cis, for the replication, and packaging of the replicated virus. Typically a retroviral genome contains the gag, pol, and envATTORNEY DOCKET NO. 37759.0680P1genes which are involved in the making of the protein coat. It is the gag, pol, and env genes which are typically replaced by the foreign DNA that it is to be transferred to the target cell. Retrovirus vectors ty pically contain a packaging signal for incorporation into the package coat, a sequence which signals the start of the gag transcription unit, elements necessary for reverse transcription, including a primer binding site to bind the tRNA primer of reverse transcription, terminal repeat sequences that guide the switch of RNA strands during DNA synthesis, a purine rich sequence 5' to the 3' LTR that serves as the priming site for the synthesis of the second strand of DNA synthesis, and specific sequences near the ends of the LTRs that enable the insertion of the DNA state of the retrovirus to insert into the host genome. This amount of nucleic acid is sufficient for the delivery of a one to many genes depending on the size of each transcript. It is preferable to include either positive or negative selectable markers along with other genes in the insert.
[0110] Since the replication machinery and packaging proteins in most retroviral vectors have been removed (gag, pol, and env), the vectors are typically generated by placing them into a packaging cell line. A packaging cell line is a cell line which has been transfected or transformed with a retrovirus that contains the replication and packaging machinery but lacks any packaging signal. When the vector carrying the DNA of choice is transfected into these cell lines, the vector containing the gene of interest is replicated and packaged into new retroviral particles, by the machinery provided in cis by the helper cell. The genomes for the machinery are not packaged because they lack the necessary signals.
[0111] The construction of replication-defective adenoviruses has been described (Berkner etal., J. Virology’ 61:1213-1220 (1987); Massie etal.. Mol. Cell. Biol. 6:2872-2883 (1986); Haj-Ahmad etal., J. Virology 57:267-274 (1986); Davidson etn / ., J. Virology 61:1226-1239 (1987); Zhang “Generation and identification of recombinant adenovirus by liposome-mediated transfection and PCR analysis'’ BioTechniques 15:868-872 (1993)). The benefit of the use of these viruses as vectors is that they are limited in the extent to which they can spread to other cell types, since they can replicate within an initial infected cell but are unable to form new infectious viral particles. Recombinant adenoviruses have been shown to achieve high efficiency gene transfer after direct, in vivo delivery’ to airway’ epithelium, hepatocytes, vascular endothelium, CNS parenchyma and a number of other tissue sites (Morsy, J. Clin. Invest.92:1580-1586 (1993); Kirshenbaum, J. Clin. Invest. 92:381-387 (1993); Roessler, J. Clin. Invest.92:1085-1092 (1993); Moullier, Nature Genetics 4:154-159 (1993); La Salle, Science 259:988-990 (1993); Gomez-Foix, J. Biol. Chem. 267:25129-25134 (1992); Rich, Human Gene Therapy 4:461-476 (1993); Zabner, Nature Genetics 6:75-83 (1994); Guzman, Circulation ResearchATTORNEY DOCKET NO. 37759.0680P173:1201-1207 (1993); Bout Human Gene Therapy 5:3-10 (1994); Zabner, Cell 75:207-216 (1993); Caillaud, Eur. J. Neuroscience 5:1287-1291 (1993); and Ragot, J. Gen. Virology 74:501-507 (1993)) the teachings of which are incorporated herein by reference in their entirety7for their teaching of methods for using retroviral vectors for gene therapy. Recombinant adenoviruses achieve gene transduction by binding to specific cell surface receptors, after which the virus is internalized by receptor-mediated endocytosis, in the same manner as wild type or replication-defective adenovirus (Chardonnet and Dales, Virology 40:462-477 (1970); Brown and Burlingham, J. Virology 12:386-396 (1973); Svensson and Persson, J. Virology 55:442-449 (1985); Seth, etal., J. Virol. 51:650-655 (1984); Seth, etal.. Mol. Cell. Biol., 4:1528-1533 (1984); Varga etal., J. Virology 65:6061-6070 (1991); Wickham et al. , Cell 73:309-319 (1993)).
[0112] A viral vector can be one based on an adenovirus which has had the El gene removed and these virons are generated in a cell line such as the human 293 cell line.Optionally, both the El and E3 genes are removed from the adenovirus genome.
[0113] Another type of viral vector that can be used to introduce the polynucleotides of the invention into a cell is based on an adeno-associated virus (AAV). This defective parvovirus is a preferred vector because it can infect many cell types and is nonpathogenic to humans. AAV type vectors can transport about 4 to 5 kb and wild type AAV is known to stably insert into chromosome 19. Vectors which contain this site specific integration property are preferred. An especially preferred embodiment of this ty pe of vector is the P4.1 C vector produced by Avigen, San Francisco, CA, which can contain the herpes simplex virus thymidine kinase gene. HSV-tk, or a marker gene, such as the gene encoding the green fluorescent protein, GFP.
[0114] In another type of AAV virus, the AAV contains a pair of inverted terminal repeats (ITRs) which flank at least one cassette containing a promoter which directs cell-specific expression operably linked to a heterologous gene. Heterologous in this context refers to any nucleotide sequence or gene which is not native to the AAV or Bl 9 parvovirus. Typically the AAV and Bl 9 coding regions have been deleted, resulting in a safe, noncytotoxic vector. The AAV ITRs, or modifications thereof, confer infectivity and site-specific integration, but not cytotoxicity7, and the promoter directs cell-specific expression. United States Patent No.6,261,834 is herein incorporated by reference in its entirety for material related to the AAV vector. In some aspects, the AAV vector can be any one of AAV1-9.
[0115] The inserted genes in viral and retroviral vectors usually contain promoters, or enhancers to help control the expression of the desired gene product. A promoter is generally a sequence or sequences of DNA that function when in a relatively fixed location in regard to theATTORNEY DOCKET NO. 37759.0680P1transcription start site. A promoter contains core elements required for basic interaction of RNA polymerase and transcription factors, and may contain upstream elements and response elements.
[0116] Other useful systems include, for example, replicating and host-restricted nonreplicating vaccinia virus vectors. In addition, the disclosed nucleic acid sequences can be delivered to a target cell in a non-nucleic acid based system. For example, the disclosed polynucleotides can be delivered through electroporation, or through lipofection, or through calcium phosphate precipitation. The delivery' mechanism chosen will depend in part on the type of cell targeted and whether the delivery is occurring for example In vivo or in vitro.
[0117] Thus, the compositions can comprise, in addition to the disclosed expression vectors, lipids such as liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes. Liposomes can further comprise proteins to facilitate targeting a particular cell, if desired. Administration of a composition comprising a nucleic acid sequences, nucleic acid constructs, or vectors and a cationic liposome can be administered to the blood, to a target organ, or inhaled into the respiratory' tract to target cells of the respiratory' tract. For example, a composition comprising a nucleic acid sequences, nucleic acid constructs, or vectors described herein and a cationic liposome can be administered to a subjects lung cells. Regarding liposomes, see. e.g., Brigham et al. Am. J. Resp. Cell. Mol. Biol. 1:95-100 (1989); Feigner et al. Proc. Natl. Acad. Sci USA 84:7413-7417 (1987); U.S. Patent No. 4,897,355. Furthermore, the compound can be administered as a component of a microcapsule that can be targeted to specific cell ty pes, such as macrophages, or where the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dosage.E. Compositions
[0118] Disclosed are compositions comprising any of the miRNAs or RNAi agents described herein. Disclosed are compositions comprising a nucleic acid sequence, wherein the nucleic acid sequence comprises a Runx3 -targeting miRNA. Thus, in some instances, disclosed are compositions comprising a Runx3 -targeting miRNA.
[0119] In some instances, the compositions can further comprise a pharmaceutically acceptable carrier. By ‘‘pharmaceutically acceptable” is meant a material or carrier that would be selected to minimize any degradation of the active ingredient and to minimize any adverse side effects in the subject, as would be well known to one of skill in the art. Thus, also disclosed are pharmaceutical compositions comprising a Runx3 -targeting miRNA and a pharmaceutically acceptable carrier.ATTORNEY DOCKET NO. 37759.0680P1
[0120] Preparations of parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
[0121] The disclosed miRNAs can be formulated and / or administered in or with a pharmaceutically acceptable carrier. As used herein, the term “pharmaceutically acceptable carrier” refers to sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions, as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use. Examples of suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil) and injectable organic esters such as ethyl oleate. Proper fluidity can be maintained, for example, by the use of coating materials such as lecithin, by the maintenance of the required particle size in the case of dispersions and by the use of surfactants. These compositions can also contain adjuvants such as preservatives, wetting agents, emulsifying agents and dispersing agents. Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents such as paraben, chlorobutanol, phenol, sorbic acid and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents, such as aluminum monostearate and gelatin, which delay absorption.Injectable depot forms are made by forming microencapsule matrices of the drug (e.g. peptide) in biodegradable polymers such as polylactide-poly glycolide, poly(orthoesters) and poly(anhydrides). Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions that are compatible with body tissues. The injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable media just prior to use. Suitable inert carriers can include sugars such as lactose. Desirably, atATTORNEY DOCKET NO. 37759.0680P1least 95% by weight of the particles of the active ingredient have an effective particle size in the range of 0.01 to 10 micrometers.
[0122] Thus, the compositions disclosed herein can comprise lipids such as liposomes, such as cationic liposomes (e.g., DOTMA, DOPE, DC-cholesterol) or anionic liposomes. Liposomes can further comprise proteins to facilitate targeting a particular cell, if desired. Administration of a composition comprising a peptide and a cationic liposome can be administered to the blood, to a target organ, or inhaled into the respiratory tract to target cells of the respiratory tract. For example, a composition comprising a peptide or nucleic acid sequence described herein and a cationic liposome can be administered to a subject's lung cells. Regarding liposomes, see, e.g.. Brigham et al. Am. J. Resp. Cell. Mol. Biol. 1:95 100 (1989); Feigner et al. Proc. Natl. Acad. Sci USA 84:7413 7417 (1987); U.S. Patent No. 4,897,355. Furthermore, the compound can be administered as a component of a microcapsule that can be targeted to specific cell types, such as macrophages, or where the diffusion of the compound or delivery of the compound from the microcapsule is designed for a specific rate or dosage.
[0123] In some instances, disclosed are pharmaceutical compositions comprising any of the disclosed miRNAs described herein and a pharmaceutically acceptable carrier, buffer, or diluent. In various aspects, the miRNA of the pharmaceutical composition is encapsulated in a delivery vehicle. In a further aspect, the delivery vehicle is a liposome, a microcapsule, or a nanoparticle. In a still further aspect, the delivery vehicle is PEG-ylated.
[0124] In the methods described herein, delivery of the compositions to cells can be via a variety of mechanisms. As defined above, disclosed herein are compositions comprising any one or more of the peptides described herein and can also include a carrier such as a pharmaceutically acceptable carrier. For example, disclosed are pharmaceutical compositions, comprising the peptides disclosed herein, and a pharmaceutically acceptable carrier. In one aspect, disclosed are pharmaceutical compositions comprising the disclosed peptides. That is, a pharmaceutical composition can be provided comprising a therapeutically effective amount of at least one disclosed peptide or at least one product of a disclosed method and a pharmaceutically acceptable carrier.
[0125] In certain aspects, the disclosed pharmaceutical compositions comprise the disclosed miRNAs as an active ingredient, a pharmaceutically acceptable carrier, and, optionally, other therapeutic ingredients or adjuvants. The instant compositions include those suitable for nasal, oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for which the active ingredient is beingATTORNEY DOCKET NO. 37759.0680P1administered. The pharmaceutical compositions can be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.
[0126] In practice, the miRNAs described herein can be combined as the active ingredient in intimate admixture with a pharmaceutical carrier according to conventional pharmaceutical compounding techniques. The carrier can take a wide variety of forms depending on the form of preparation desired for administration, e.g., oral or parenteral (including intravenous). Thus, the pharmaceutical compositions of the present invention can be presented as discrete units suitable for oral administration such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient. Further, the compositions can be presented as a powder, as granules, as a solution, as a suspension in an aqueous liquid, as a non-aqueous liquid, as an oil-in-water emulsion or as a water-in-oil liquid emulsion. In addition to the common dosage forms set out above, the compounds of the invention, and / or pharmaceutically acceptable salt(s) thereof, can also be administered by controlled release means and / or delivery devices. The compositions can be prepared by any of the methods of pharmacy. In general, such methods include a step of bringing into association the active ingredient with the carrier that constitutes one or more necessary ingredients. In general, the compositions are prepared by uniformly and intimately admixing the active ingredient with liquid carriers or finely divided solid carriers or both. The product can then be conveniently shaped into the desired presentation.
[0127] The pharmaceutical carrier employed can be, for example, a solid, liquid, or gas. Examples of solid carriers include lactose, terra alba, sucrose, talc, gelatin, agar, pectin, acacia, magnesium stearate, and stearic acid. Examples of liquid carriers are sugar syrup, peanut oil, olive oil, and water. Examples of gaseous carriers include carbon dioxide and nitrogen. Other examples of carriers include dimyristoylphosphatidyl (DMPC), phosphate buffered saline or a multivesicular liposome. For example, PG:PC:Cholesterol:peptide or PC:peptide can be used as carriers in this invention. Other suitable pharmaceutically acceptable carriers and their formulations are described in Remington: The Science and Practice of Pharmacy (19th ed.) ed. A.R. Gennaro, Mack Publishing Company, Easton, PA 1995. Typically, an appropnate amount of pharmaceutically-acceptable salt is used in the formulation to render the formulation isotonic. Other examples of the pharmaceutically-acceptable carrier include, but are not limited to, saline, Ringer's solution and dextrose solution. The pH of the solution can be from about 5 to about 8, or from about 7 to about 7.5. Further carriers include sustained release preparations such as semi-permeable matrices of solid hydrophobic polymers containing the composition, which matrices are in the form of shaped articles, e.g., films, stents (which are implanted in vessels during an angioplasty' procedure), liposomes or microparticles. It will be apparent to thoseATTORNEY DOCKET NO. 37759.0680P1persons skilled in the art that certain carriers may be more preferable depending upon, for instance, the route of administration and concentration of composition being administered. These most ty pically would be standard carriers for administration of drugs to humans, including solutions such as sterile water, saline, and buffered solutions at physiological pH.
[0128] In order to enhance the solubility and / or the stability of the disclosed peptides in pharmaceutical compositions, it can be advantageous to employ a-, (3- or y-cyclodextrins or their derivatives, in particular hydroxyalkyl substituted cyclodextrins, e.g. 2-hydroxypropyl-P-cyclodextrin or sulfobutyl-P-cyclodextrin. Also, co-solvents such as alcohols may improve the solubility and / or the stability of the compounds according to the invention in pharmaceutical compositions.
[0129] Pharmaceutical compositions can also include carriers, thickeners, diluents, buffers, preservatives and the like, as long as the intended activity of the polypeptide, peptide, nucleic acid, vector of the invention is not compromised. Pharmaceutical compositions may also include one or more active ingredients (in addition to the composition of the invention) such as antimicrobial agents, anti-inflammatory agents, anesthetics, and the like. The pharmaceutical composition may be administered in a number of ways depending on whether local or systemic treatment is desired, and on the area to be treated.
[0130] Because of the ease in administration, oral administration can be used, and tablets and capsules represent the most advantageous oral dosage unit forms in which case solid pharmaceutical carriers are obviously employed. In preparing the compositions for oral dosage form, any convenient pharmaceutical media can be employed. For example, water, glycols, oils, alcohols, flavoring agents, preservatives, coloring agents and the like can be used to form oral liquid preparations such as suspensions, elixirs and solutions; while carriers such as starches, sugars, microcrystalline cellulose, diluents, granulating agents, lubricants, binders, disintegrating agents, and the like can be used to form oral solid preparations such as powders, capsules and tablets. Because of their ease of administration, tablets and capsules are the preferred oral dosage units whereby solid pharmaceutical carriers are employed. Optionally, tablets can be coated by¬ standard aqueous or nonaqueous techniques.
[0131] Compositions for oral administration include powders or granules, suspensions or solutions in water or non-aqueous media, capsules, sachets, or tablets. Thickeners, flavorings, diluents, emulsifiers, dispersing aids, or binders may be desirable. Some of the compositions may potentially be administered as a pharmaceutically acceptable acid- or base- addition salt, formed by reaction with inorganic acids such as hydrochloric acid, hydrobromic acid, perchloric acid, nitric acid, thiocyanic acid, sulfuric acid, and phosphoric acid, and organic acids such asATTORNEY DOCKET NO. 37759.0680P1formic acid, acetic acid, propionic acid, glycolic acid, lactic acid, pyruvic acid, oxalic acid, malonic acid, succinic acid, maleic acid, and fumaric acid, or by reaction with an inorganic base such as sodium hydroxide, ammonium hydroxide, potassium hydroxide, and organic bases such as mon-, di-, trialkyl and aryl amines and substituted ethanolamines.
[0132] A tablet containing the compositions of the present invention can be prepared by compression or molding, optionally with one or more accessory ingredients or adjuvants.Compressed tablets can be prepared by compressing, in a suitable machine, the active ingredient in a free-flowing form such as powder or granules, optionally mixed with a binder, lubricant, inert diluent, surface active or dispersing agent. Molded tablets can be made by molding in a suitable machine, a mixture of the powdered compound moistened with an inert liquid diluent.
[0133] The pharmaceutical compositions of the present invention comprise a disclosed miRNA as an active ingredient, a pharmaceutically acceptable carrier, and optionally one or more additional therapeutic agents or adjuvants. The instant compositions include compositions suitable for oral, rectal, topical, and parenteral (including subcutaneous, intramuscular, and intravenous) administration, although the most suitable route in any given case will depend on the particular host, and nature and severity of the conditions for w hich the active ingredient is being administered. The pharmaceutical compositions can be conveniently presented in unit dosage form and prepared by any of the methods well known in the art of pharmacy.
[0134] Preparations of parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous earners include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer’s dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer's dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
[0135] Pharmaceutical compositions of the present invention suitable for injectable use include sterile aqueous solutions or dispersions. Furthermore, the compositions can be in the form of sterile powders for the extemporaneous preparation of such sterile injectable solutions or dispersions. Typically, the final injectable form should be sterile and should be effectively fluid for easy syringability’. The pharmaceutical compositions should be stable under the conditions of manufacture and storage; thus, preferably should be preserved against the contaminating action of microorganisms such as bacteria and fungi. The carrier can be a solvent or dispersion mediumATTORNEY DOCKET NO. 37759.0680P1containing, for example, water, ethanol, polyol (e.g., glycerol, propylene glycol and liquid polyethylene glycol), vegetable oils, and suitable mixtures thereof.
[0136] Injectable solutions, for example, can be prepared in which the carrier comprises saline solution, glucose solution or a mixture of saline and glucose solution. Injectable suspensions may also be prepared in which case appropriate liquid carriers, suspending agents and the like may be employed. Also included are solid form preparations that are intended to be converted, shortly before use, to liquid form preparations.
[0137] Preparations of parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate. Aqueous carriers include water, alcoholic / aqueous solutions, emulsions or suspensions, including saline and buffered media. Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride, lactated Ringer’s, or fixed oils. Intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers (such as those based on Ringer’s dextrose), and the like. Preservatives and other additives may also be present such as, for example, antimicrobials, anti-oxidants, chelating agents, and inert gases and the like.
[0138] Pharmaceutical compositions of the present invention can be in a form suitable for topical use such as, for example, an aerosol, cream, ointment, lotion, dusting powder, mouth washes, gargles, and the like. Further, the compositions can be in a form suitable for use in transdermal devices. These formulations can be prepared, utilizing a compound of the invention, or pharmaceutically acceptable salts thereof, via conventional processing methods. As an example, a cream or ointment is prepared by mixing hydrophilic material and water, together with about 5 wt% to about 10 wt% of the compound, to produce a cream or ointment having a desired consistency.
[0139] In the compositions suitable for percutaneous administration, the carrier optionally comprises a penetration enhancing agent and / or a suitable wetting agent, optionally combined with suitable additives of any nature in minor proportions, which additives do not introduce a significant deleterious effect on the skin. Said additives may facilitate the administration to the skin and / or may be helpful for preparing the desired compositions. These compositions may be administered in various ways, e.g., as a transdermal patch, as a spot on, as an ointment.
[0140] Pharmaceutical compositions of this invention can be in a form suitable for rectal administration wherein the carrier is a solid. It is preferable that the mixture forms unit dose suppositories. Suitable carriers include cocoa butter and other materials commonly used in the art. The suppositories can be conveniently formed by first admixing the composition with theATTORNEY DOCKET NO. 37759.0680P1softened or melted carrier(s) followed by chilling and shaping in molds.
[0141] Formulations for optical administration may include ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders. Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be desirable.
[0142] In addition to the aforementioned carrier ingredients, the pharmaceutical formulations described above can include, as appropriate, one or more additional carrier ingredients such as diluents, buffers, flavoring agents, binders, surface-active agents, thickeners, lubricants, preservatives (including anti-oxidants) and the like. Furthermore, other adjuvants can be included to render the formulation isotonic with the blood of the intended recipient.Compositions containing a disclosed peptide, and / or pharmaceutically acceptable salts thereof, can also be prepared in powder or liquid concentrate form.
[0143] The exact dosage and frequency of administration depends on the particular disclosed peptide, a product of a disclosed method of making, a pharmaceutically acceptable salt, solvate, or polymorph thereof, a hydrate thereof, a solvate thereof, a polymorph thereof, or a stereochemically isomeric form thereof; the particular condition being treated and the severity of the condition being treated; various factors specific to the medical history' of the subject to whom the dosage is administered such as the age; weight, sex, extent of disorder and general physical condition of the particular subject, as well as other medication the individual may be taking; as is well known to those skilled in the art. Furthermore, it is evident that said effective daily amount may be lowered or increased depending on the response of the treated subject and / or depending on the evaluation of the physician prescribing the compositions.
[0144] Depending on the mode of administration, the pharmaceutical composition will comprise from 0.05 to 99 % by weight, preferably from 0.1 to 70 % by weight, more preferably from 0.1 to 50 % by weight of the active ingredient, and, from 1 to 99.95 % by weight, preferably from 30 to 99.9 % by weight, more preferably from 50 to 99.9 % by weight of a pharmaceutically acceptable carrier, all percentages being based on the total weight of the composition.F. Kits
[0145] The compositions and materials described above as well as other materials can be packaged together in any suitable combination as a kit useful for performing, or aiding in the performance of, the disclosed method. It is useful if the kit components in a given kit are designed and adapted for use together in the disclosed method. For example disclosed are kits comnprising one or more of the disclosed nucleic acid sequences, vectors, or compositions.ATTORNEY DOCKET NO. 37759.0680P1ExamplesA. Example 1
[0146] Fractures pose a substantial health concern in the United States, with over 6.2 million incidents occurring annually, disproportionately affecting patients' quality’ of life, and causing significant financial burden. Developing innovative and cost-effective strategies to improve fracture healing and hasten recovery is crucial. Secondary bone healing, involving endochondral ossification, is the primary method of regeneration for bone fractures treated with non-operative cast immobilization or intramedullary nailing. This Example was set to determine that repression of RUNX3 promotes the transition from cartilaginous to bony callus to accelerate secondary fracture healing. To test this, genetically modified mice were used to conditionally delete Runx3 in periosteal mesenchymal stem cells (MSCs) and chondrogenic precursors to determine its contribution to secondary’ fracture healing.1. Methods:
[0147] Runx3 was conditionally deleted in periosteum by treating Prxl-Cr^RT;Runx3f0Xf0Xmice with tamoxifen (2mg / 10g body yveight, IP) at 1 and 3 days post-fracture, when peak mesenchymal progenitor activation occurs. Runx3 was deleted in chondrogenic precursor cells by treating Acan-Cre^^unxSf1^^ mice with tamoxifen at 5 and 7 days post-fracture, during the onset of callus chondrogenesis. Unilateral mid-diaphyseal femoral fractures were induced by three-point bending after percutaneous intramedullary pinning in 12-week-old mice. Fracture healing yvas assessed by X-radiography, micro-computed tomography (pCT), static histomorphometric analysis, and biomechanical (torsional) testing. To test the therapeutic effects of Runx3 inhibition post-fracture, miRNA targeting Runx3 or negative control miRNA was injected on days 2, 5 and 7 post-fracture and assessed callus bone and cartilage percent on days 14 and 21. To further investigate the role of Runx3 in regulating chondro-osteogenic trans differentiation, lineage tracing experiments were performed by crossing Acan-CreER1; Runx3F / F(Runx3 cKO) and Acan-CreERT, Runx3+ / +control mice with the ROSAmT / mGtransgene to determine the fate of aggrecan-positive chondrocytes within the fracture callus.2. Results:
[0148] Tamoxifen-induced knockdown oiRunx3 in periosteum of Prxl-CreERT;Runx3fox / foxmice was confirmed at 5 days post-fracture by quantitative PCR. Similarly, knockdown of Runx3 in callus cartilage of Acan-('reEI<El unx3 'x'xmice was confirmed at 8 days postfracture by qPCR. pCT analysis revealed significantly increased % callus bone (BV / TV) at days 14 and 21 post-fracture in male and female mutants from both lines relative to controls (FigureATTORNEY DOCKET NO. 37759.0680P11). Consistent with these data, increased BV / TV was observed by histomorphometric analysis in Prxl-CreERT;Runx3 °^oxmice at day 21 post-fracture and in Acan-CreERI; Runx3fox / oxmice at days 7, 14 and 21 post-fracture (Figure 2). % callus cartilage was also reduced early in fracture healing in both genotypes, compared to controls. Furthermore, mechanical testing of femurs indicated increased strength of healed bones from Prxl-CreERT:Runx3f0X / f0XandAcaw-Cre^1;Runx3fox'foxmice. These results support the idea that deletion of Runx3 post-fracture in the periosteum promotes fracture healing and specifically, Runx3 deletion within chondrogenic precursors is sufficient to accelerate healing. Moreover, injection of miRNA targeting Runx3 in fracture callus significantly increased callus bone percentage at 14 days post- fracture when compared to control miRNA. (FIG. 4).3. Discussion:
[0149] It was demonstrated that constitutive periosteal deletion of Runx3 in 3 -month-old mice accelerated fracture healing by decreasing callus cartilage at day 7 post-fracture and increasing bone callus composition at 21 days post-fracture, as determined by pCT and histomorphometric analyses. In the present study, similar effects of Runx3 deletion in periosteum were observed using an inducible Cre line, post fracture, and specifically targeting Runx3 in chondrogenic precursors promotes callus bone formation. Precisely how RUNX3 functions within callus chondrocytes to affect the healing process is unclear, however based on the phenotypic analysis of Acan-CreERT;Runx3fox / foxmice and preliminary lineage tracing studies, Runx3 deletion in these cells can promote the early trans-differentiation of callus chondrocytes into osteoblasts. Importantly, these experiments using miRNA targeting Runx3 within the fracture callus demonstrate the feasibility Runx3 inhibition as a therapeutic strategy to promote fracture healing.
[0150] Conditional deletion of Runx3 in aggrecan-expressing chondrogenic precursors promotes fracture healing by decreasing callus cartilage and increasing callus bone formation.
[0151] Lineage tracing studies in Runx3 cKO mice indicates that Runx3-deleted chondrocytes undergo an accelerated transition to osteoblasts.
[0152] Consistent with the genetic studies, injection of a Runx3 -targeting mIR into the fracture callus promotes bone formation, demonstrating the potential of Runx3 as a target for therapeutic intervention to improve fracture healing.
[0153] Those skilled in the art will recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the method and compositions described herein. Such equivalents are intended to be encompassed by the following claims.
Claims
ATTORNEY DOCKET NO. 37759.0680P1CLAIMSWe claim:
1. A method of repairing bone fractures comprising administering a therapeutically effective amount of a composition comprising a nucleic acid sequence to a subject having a bone fracture, wherein the nucleic acid sequence comprises a Runx3-targeting miRNA.
2. The method of claim 1, wherein the Runx3 -targeting miRNA is miR-194-5p.
3. The method of claim 2. wherein miR-194-5p comprises the nucleic acid sequence of UGUAACAGCAACUCCAUGUGGA (SEQ ID NO:1).
4. The method of any one of claims 1-2, wherein, after administering the composition, there is an increase in fracture callus at the bone fracture.
5. The method of any one of claims 1-3, wherein, after administering the composition, there is an increase in bone volume at the bone fracture.
6. The method of any one of claims 1-4, wherein, after administering the composition, there is a decrease in cartilage at the bone fracture.
7. The method of any one of claims 1-5, wherein, after administering the composition, there is an increase in transdifferentiation of chondrocytes to osteoblasts.
8. The method of any one of claims 1-7, wherein the composition is administered at a site of the bone fracture.
9. A method of promoting the transition from cartilaginous to bony callus comprising administering a therapeutically effective amount of a composition comprising a nucleic acid sequence, wherein the nucleic acid sequence comprises a Runx3 -targeting miRNA.
10. The method of claim 9, wherein the Runx3 -targeting miRNA is miR-194-5p.
11. The method of claim 10, wherein miR-194-5p comprises the nucleic acid sequence of UGUAACAGCAACUCCAUGUGGA (SEQ ID NO: 1).
12. The method of any one of claims 9-11, w herein the transition accelerates secondary' fracture healing.ATTORNEY DOCKET NO. 37759.0680P113. The method of any one of claims 9-12. wherein, after administering the composition, there is an increase in transdifferentiation of chondrocytes to osteoblasts.
14. The method of any one of claims 9-13, wherein, after administering the composition, there is an increase in Sp7 positive cells.
15. The method of any one of claims 9-14, wherein the composition is administered at a site of the bone fracture.
16. A method of decreasing Runx3 expression comprising administering a therapeutically effective amount of a composition comprising a nucleic acid sequence, wherein the nucleic acid sequence comprises a Runx3 -targeting miRNA.
17. The method of claim 16, wherein the decrease of Runx3 expression occurs in chondrogenic precursor cells or chondrocytes.
18. The method of any one of claims 14-15. wherein the Runx3 -targeting miRNA is miR-194-5p.
19. The method of claim 18, wherein miR-194-5p comprises the nucleic acid sequence of UGUAACAGCAACUCCAUGUGGA (SEQ ID NO: 1).
20. The method of any one of claims 16-19, wherein, after administering the composition, there is an increase in transdifferentiation of chondrocytes to osteoblasts.