GPR65 biomarker and methods of using the same in chimeric antigen receptor cell therapy

Abstract

Disclosed are methods of treating cancer and identi fying a subj ect who is likely to respond to or benefit from an anti- CD19 CAR-expressing cell therapy based upon the expression of GPR65. Also provided are methods of selecting an anti-cancer therapy comprising an anti-CD19 CAR-expressing cell therapy in combination with a GPR65 agonist and / or VEGF antagonist and increasing the therapeutic efficacy of aann anti-CD19 CAR- expressing cell therapy by increasing expression and / or function of GPR65 and / or decreasing expression and / or function of VEGF.

Description

SJ0122WO PATENT GPR65 BIOMARKER AND METHODS OF USING THE SAME IN CHIMERIC ANTIGEN RECEPTOR CELL THERAPYREFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of priority from U. S. Provisional Application Serial Number 63 / 753, 510, filed February 4, 2025, the content of which is incorporated herein by reference in its entirety.REFERENCE TO AN ELECTRONIC SEQUENCE LISTING

[0002] The contents of the electronic sequence listing (name: SJ0122WO_ST26. xml; size: 17, 147 bytes; and date of creation: January 27, 2026) is herein incorporated by reference in its entirety.FEDERALLY SPONSORED RESEARCH AND DEVELOPMENT

[0003] This invention was made with government support under grant nos. GM134382 and CA264610 awarded by the National Institutes of Health. The government has certain rights in this invention.BACKGROUND OF THE INVENTION

[0004] Adoptively transferred T lymphocytes engineered to express chimeric antigen receptors (CARs) targeting CD19 are curative for some patients with relapsed or refractory B cell acute lymphoblastic leukemia (B-ALL). Many patients, however, relapse or fail to respond after treatment. Identifying mechanisms underlying therapeutic resistance to CAR-T cell therapy is a necessary prelude to developing more effective approaches.

[0005] Preclinical and clinical studies seeking to augment CAR-T cell effectiveness have largely focused on CAR-T cell function. CAR-T cell exhaustion and the absence of long-termSJ0122WO PATENT

[0006] memory are associated with poor outcomes. Manipulations diminishing exhaustion and enhancing CAR-T cell memory can increase CAR-T cell effectiveness. The age and phenotype of patient-derived T cells used for CAR-T cell production and the quality and strength of signaling by CAR costimulatory domains influence these properties, and insights here have been incorporated into CAR designs and manufacturing paradigms.

[0007] Tumor features, including tumor heterogeneity may also foster CAR-T cell resistance and poorer clinical outcomes. Most prominently, the outgrowth of CD19-negative or lineage-switched tumors is a common mechanism of CD19-specific CAR-T resistance. However, tumors retaining CAR ligand may also be resistant, and this is less studied. Tumor cells may alter CAR-T cell responses by promoting changes in the host immune system and tumor microenvironment (TME). Such TME changes are observed to mediate resistance in solid tumors, but undefined and challenging to study in hematological malignancies like B-ALL, in part due to the common use of immunodeficient mice or human-mouse graft systems that disrupt normal cellular interactions.

[0008] Accordingly, new approaches to overcome tumor resistance to CAR-expressing cell therapy are needed. The present invention meets this need in the art.SUMMARY OF THE INVENTION

[0009] This invention provides a method of treating cancer, comprising determining an expression level of GPR65 (G-protein coupled receptor 65) in a biological sample obtained from a subject having, suspected of having, or at risk of having a cancer, identifying the subject as likely being responsive to an anti-CD19 CAR-expressing cell therapy if the expressionSJ0122WO PATENT level of GPR65 in the sample is increased or equivalent to a reference expression level of GPR65; and administering a therapeutically effective amount of the anti-CD19 CAR- expressing cell therapy to the subject.

[0010] Also provided is a method of identifying a subject who is likely to respond to or benefit from an anti-CD19 CAR- expressing cell therapy, comprising determining an expression level of GPR65 in a biological sample obtained from the patient, comparing the expression level of GPR65 in the sample with a reference level, and identifying the subject as being likely to respond to or benefit from treatment with the anti- CD19 CAR-expressing cell therapy based on the expression level of GPR65 in the biological sample relative to the reference level.

[0011] Further provided is a method of selecting an anticancer therapy comprising an anti-CD19 CAR-expressing cell therapy in combination with a GPR65 agonist and / or a VEGF antagonist for a subject having, suspected of having, or at risk of having a cancer, comprising determining an expression level of GPR65 in a biological sample obtained from the subject, comparing the expression level of GPR65 in the biological sample with a reference level and selecting an anti-cancer therapy comprising an anti-CD19 CAR-expressing cell therapy in combination with a GPR65 agonist and / or a VEGF antagonist for the subject based on the expression level of GPR65 in the biological sample relative to the reference level.

[0012] A method of increasing the therapeutic efficacy of an anti-CD19 CAR-expressing cell therapy is also provided, wherein the method comprises increasing expression and / or function of GPR65 and / or decreasing the expression and / or function of VEGF in a subject receiving an anti-CD19 CAR-SJ0122WO PATENT expressing cell therapy, thereby increasing the therapeutic efficacy of an anti-CD19 CAR-expressing cell therapy.BRIEF DESCRIPTION OF DRAWINGS

[0013] FIG. 1. Receiver operator characteristic (ROC) curve plot for evaluation of GPR65 activity and expression demonstrating predictive power for CAR-T therapy response in patients.

[0014] FIG. 2. Boxplot of GPR65 activity calculated using the NetBID2 algorithm using RNA-seq profiles of adult B-ALL patients treated with blinatumomab. Responders (N=19) are patients who achieved complete remission by morphology using standard International Working Group criteria, and Non¬ Responders (N=20) are patients who did not respond to blinatumomab therapy and had no evidence of CD19 antigen loss. P-value was estimated using Wilcoxon rank-sum test. Boxplot shows summary of the data in terms of the minimum, maximum, sample median, and the first and third quartiles.

[0015] FIG. 3. qRT-PCR analysis showing relative Gpr65 levels in m. PR and m. CR tumor cells. Representative of three experiments. Statistical significance calculated using unpaired t test. All error bars represent mean ± SEM. ****p < 0.0001.

[0016] FIG. 4. Kaplan-Meier survival curves. Statistical significance was calculated using log-rank (Mantel-Cox) test. Pooled from two experiments, n=10 mice per group. m. CR, complete response tumors; VEGFA KO, m. CR tumor cells with VEGFA knockout; GPR65 KO, m. CR tumor cells with GPR65 knockout, DKO, m. CR tumor cells with GPR65 and VEGFA double knockout.

[0017] FIG. 5. Kaplan-Meier survival curves. Statistical significance was calculated using log-rank (Mantel-Cox) test.SJ0122WO PATENT m. CR, complete response tumors; GPR65 KO, m. CR tumor cells with GPR65 knockout.DETAILED DESCRIPTION OF THE INVENTION

[0018] Chimeric antigen receptor (CAR) -expressing cell therapies can be curative for CD19+hematological malignancies. However, such therapies are often limited by frequent patient relapse and response failures. It has now been found that the G-protein coupled receptor 65 (GPR65, TDAG8), alone or in combination with a diagnostic panel composed of 39 genes, is a tumor-specific determinant of responsiveness to CAR-expressing cell therapy. In patients and an immune competent mouse model of B cell acute lymphoblastic leukemia (B-ALL) CAR-expressing cell therapy, low GPR65 is associated with anti-CD19+CAR resistance. GPR65 knockout (GPR65 KO) tumors are likewise resistant to CAR-expressing cell therapy in mice. Single-cell network analyses reveal that GPR65 deficiency remodels tumor interactions with host macrophages, partially through increases in tumor VEGFA. This leads to increased macrophage numbers and preferential M2 macrophage polarization. Either depletion of host macrophages or deletion of VEGFA from GPR65 KO tumors restores responsiveness to CAR-expressing cell treatment. Anti-VEGFA therapy in combination with CAR-expressing cell administration also prolongs the survival of GPR65 KO tumor-bearing mice. These results demonstrate the dramatic influence of tumor gene expression on the tumor microenvironment, its influence on CAR-expressing cell responsiveness, and supports new approaches to identify and overcome CAR-expressing cell resistance in B-ALL. Accordingly, this invention provides methods for identifying and treating subjects who are likely to respond to or benefit from a CD19 CAR-expressing cellSJ0122WO PATENT therapy, and a method of selecting an anti-cancer therapy comprising an anti~CD19 CAR-expressing cell therapy and a GRP65 agonist and / or VEGF antagonist based at least, in part, on the expression of GPR65.

[0019] As used herein, the terms "individual, " "patient, " or "subject" are used interchangeably and refer to any single animal, more preferably a mammal (including such non-human animals as, for example, dogs, cats, horses, rabbits, zoo animals, cows, pigs, sheep, and non-human primates) for which treatment is desired. In some aspects, the subject herein is a human. The subject may be a "cancer patient," i. e., one who is suffering from cancer, suspected of having cancer, at risk of having cancer, or suffering from one or more symptoms of cancer. A subject having cancer may include a subject that exhibits one or more signs of cancer, e. g., the presence of a tumor or tumor cells. A subject suspected of having cancer may include a subject whereby a clinician believes there is a likelihood the subject has cancer, e. g., the subject exhibits one or more symptoms of cancer. A subject at risk of having cancer may include a subject that would be considered to have some increased probability of developing cancer, e. g., predisposition to cancer or exposure to a known carcinogen.

[0020] The terms "cancer" and "cancerous" refer to or describe the physiological condition in mammals that is typically characterized by unregulated cell growth. Included in this definition are benign and malignant cancers as well as dormant tumors or micrometastases. A "resistant" or "refractory" cancer is one which progresses even though an anti-tumor agent, such as a CAR-expressing cell therapy, is being administered to the cancer patient. " Relapsed, " as used herein, refers to the return of a disease (e. g., cancer) or the signs and symptoms of a disease such as cancer after aSJ0122WO PATENT period of improvement, e. g., after prior treatment of a therapy, e. g., cancer therapy.

[0021] As used herein, " G-protein coupled receptor 65," " GPR65, " " T-cell death-associated gene 8 protein, " " TDAG8," or " Psychosine receptor" refers to the protein identified under NCBI Gene ID 8477, which is a receptor for the glycosphingolipid psychosine (PSY) and several related glycosphingolipids. GPR65 plays a role in immune response by maintaining lysosome function and supporting phagocytosis-mediated intracellular bacteria clearance. The nucleotide and amino acid sequences of human GPR65 are known under, e. g., GENBANK Accession Nos. NM_003608 and NP_003599, respectively.

[0022] As used herein, the term " CD19" refers to the Cluster of Differentiation 19 protein, which is an antigenic determinant detectable on leukemia precursor cells. The human and murine amino acid and nucleic acid sequences are known in the art and include, e. g., the human CD19 protein sequence provided under UniProt / Swiss-Prot Accession No. P15391 and the human CD19 nucleotide sequence provided under Accession No. NM_001178098. As used herein, " CD19" includes proteins comprising mutations, e. g., point mutations, fragments, insertions, deletions and splice variants of full length wildtype CD19. CD19 is expressed on most B lineage cancers, including, e. g., acute lymphoblastic leukemia, chronic lymphocyte leukemia and non-Hodgkin lymphoma.

[0023] In one aspect is provided a method of identifying a subject who is likely to respond to or benefit from an anti- CD19 CAR-expressing cell therapy by determining an expression level of GPR65 in a biological sample obtained from the patient, comparing the expression level of GPR65 in the sample with a reference level, and identifying the subject as being likely to respond to or benefit from treatment with the anti-SJ0122WO PATENT CD19 CAR-expressing cell therapy based on the expression level of GPR65 in the biological sample relative to the reference level. In some aspects, the subject has, is suspected of having, or is at risk of having, a cancer, e. g., a CD19+hematological malignancy. In some aspects, an increase or equivalent expression level of GPR65 in the biological sample relative to the reference level identifies the subject as being likely to respond to or benefit from treatment with the anti-CD19 CAR-expressing cell therapy. In other aspects, a lower or decreased expression level of GPR65 in the biological sample relative to the reference level identifies the subject as being unlikely to respond to or benefit from treatment with the anti-CD19 CAR-expressing cell therapy.

[0024] A term "likely to respond, " "responsive, " "benefit," or "benefiting from, " with respect to a treatment, refers to any kind of improvement or positive response effect and specifically includes clinical benefit, such as alleviation or amelioration of one or more symptoms; diminishment of extent of disease; stabilized (i. e., not worsening) state of disease; preventing spread of disease; delay or slowing of disease progression; amelioration or palliation of the disease state; remission (whether partial or total); a reduction in tumor size; inhibition (i. e., reduction, slowing down, or complete stopping) of cancer cell infiltration into adjacent peripheral organs and / or tissues; an increase in the length of survival, including overall survival and progression-free survival; and / or decreased mortality at a given point of time following treatment.

[0025] The term " Chimeric Antigen Receptor" or alternatively a " CAR" refers to a recombinant polypeptide construct comprising at least an extracellular antigen binding domain, a transmembrane domain and a cytoplasmic signaling domainSJ0122WO PATENT (also referred to as "an intracellular signaling domain") comprising a functional signaling domain derived from a stimulatory molecule. In some aspects, the domains in the CAR polypeptide construct are in the same polypeptide chain, e. g., comprise a chimeric fusion protein. In some aspects, the domains in the CAR polypeptide construct are not contiguous with each other, e. g., are in different polypeptide chains.

[0026] In one aspect, the CAR is an anti-CD19 CAR. An anti-CD19 CAR refers to a CAR, wherein the antigen binding domain recognizes and binds an antigen within the extracellular domain of the CD19 protein. In one aspect, the CD19 protein is expressed on a cancer cell. Examples of suitable antigen binding domains that bind to CD19 include the FMC63 scFv fragment described in Nicholson et al. ( (1997 ) Mol. Immun.34(16-17):1157-1165); an antigen binding domain (e. g., a humanized antigen binding domain) according to Table 3 of WO 2014 / 153270; or the anti-CD19 scFv described in WO 2012 / 079000.

[0027] With respect to the transmembrane domain, a CAR may be designed to include a transmembrane domain that is attached to the extracellular domain of the CAR. The transmembrane domain may be derived either from a natural or from a recombinant source. Where the source is natural, the domain may be derived from any membrane-bound or transmembrane protein. In one aspect, the transmembrane domain is capable of signaling to the intracellular domain (s) whenever the CAR is bound to a target. A transmembrane domain of particular use herein may include at least the transmembrane region (s) of, e. g., the alpha, beta or zeta chain of the T-cell receptor, CD28, CD27, CD3 epsilon, CD45, CD4, CD5, CD8, CD9, CD16, CD22, CD33, CD37, CD64, CD80, CD86, CD134, CD137, CD154. In some aspects, a transmembrane domain may include at least theSJ0122WO PATENT transmembrane region (s) of, e.g., KIR2DS2, 0X40, CD2, CD27, LFA-1 (CDlla, CD18), ICOS (CD278), 4-1BB (CD137), GITR, CD40, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1), NKp44, NKp30, NKp46, CD160, CD19, IL2R beta, IL2R gamma, IL7R a, ITGA1, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CDlld, ITGAE, CD103, ITGAL, CDlla, LFA-1, ITGAM, CDllb, ITGAX, CDllc, ITGB1, CD29, ITGB2, CD18, LFA-1, ITGB7, TNFR2, DNAM1 (CD226), SLAMF4 (CD244, 2B4), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9 (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), SLAMF6 (NTB-A, LylO8), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, PAG / Cbp, NKG2D, NKG2C.

[0028] A cytoplasmic signaling domain or region of the CAR including an intracellular signaling domain is responsible for activation of at least one of the normal effector functions of the immune cell in which the CAR has been introduced. Examples of intracellular signaling domains for use in a CAR described herein include the cytoplasmic sequences of the T cell receptor (TCR) and co-receptors that act in concert to initiate signal transduction following antigen receptor engagement, as well as any derivative or variant of these sequences and any recombinant sequence that has the same functional capability. Primary intracellular signaling domains that act in a stimulatory manner may contain signaling motifs which are known as immunoreceptor tyrosine-based activation motifs or ITAMs. Examples of ITAM containing primary intracellular signaling domains that are of particular use in the invention include those of TCR zeta, FcR gamma, FcR beta, CD3 gamma, CD3 delta, CD3 epsilon, CD5, CD22, CD79a, CD79b, CD278 (also known as " ICOS"), FCERI, DAP10, DAP12, and CD66d. In one aspect, a CAR herein may comprise an intracellular signaling domain, e. g., a primary signaling domain of CD3-zeta, e. g., a CD3-zeta sequence.SJ0122WO PATENT

[0029] The intracellular signaling domain of a CAR herein may comprise the CD3-zeta signaling domain by itself or it may be combined with any other desired intracellular signaling domain (s) useful in the context of a CAR. For example, the intracellular signaling domain of the CAR may comprise a CD3 zeta chain portion and a costimulatory signaling domain. The costimulatory signaling domain refers to a portion of the CAR comprising the intracellular domain of a costimulatory molecule. In one aspect, the intracellular domain may be designed to comprise the signaling domain of CD3-zeta and the signaling domain of CD28. In one aspect, the intracellular domain may be designed to comprise the signaling domain of CD3-zeta and the signaling domain of ICOS.

[0030] A costimulatory molecule may be a cell surface molecule other than an antigen receptor or its ligands that is required for an efficient response of lymphocytes to an antigen. Examples of such molecules include CD2'7, CD28, 4-1BB (CD137), 0X40, CD30, CD40, PD-1, ICOS, lymphocyte function-associated antigen-1 (LFA-1), CD2, CD7, LIGHT, NKG2C, B7-H3, and a ligand that specifically binds with CD83, and the like. For example, CD27 costimulation has been demonstrated to enhance expansion, effector function, and survival of human CAR T cells in vi tro and augment human T cell persistence and antitumor activity in vivo (Song et al. (2012 ) Blood 119 (3): 696-706). Further examples of such costimulatory molecules include CDS, ICAM-1, GITR, BAFFR, HVEM (LIGHTR), SLAMF7, NKp80 (KLRF1 ), NKp30, NKp44, NKp46, CD160, CD19, CD4, CDSalpha, CD8beta, IL2R beta, IL2R gamma, IL7R alpha, ITGA4, VLA1, CD49a, ITGA4, IA4, CD49D, ITGA6, VLA-6, CD49f, ITGAD, CDlld, ITGAE, CD103, ITGAL, CDlla, LFA-1, ITGAM, CDllb, ITGAX, CDllc, ITGB1, CD29, ITGB2, CD18, LFA-1, TTGB7, TNFR2, TRANCE / RANKL, DNAM1 (CD226), SLAMF4 (CD244, 2B4 ), CD84, CD96 (Tactile), CEACAM1, CRTAM, Ly9SJ0122WO PATENT (CD229), CD160 (BY55), PSGL1, CD100 (SEMA4D), CD69, SLAMF6 (NTB-A, LylOS), SLAM (SLAMF1, CD150, IPO-3), BLAME (SLAMF8), SELPLG (CD162), LTBR, LAT, GADS, SLP-76, NKG2D, NKG2C and PAG / Cbp.

[0031] Examples of anti-CD19 CARs of use in the methods herein are known in the art and include, but are not limited to, those described in WO 2012 / 079000; WO 2014 / 153270; WO 2019 / 099639; US7,446,190; US 8, 399, 645; US 11, 034, 763,; Xu et al. (2012) Leak. Lymphoma. 54 (2 ): 255-260 (2012 ); Cruz et al. (2013) Blood 122 (17 ): 2965-2973; Brentjens et al. (2011) Blood 118(18):4817-4828; Kochenderfer et al. (2010) Blood 116(20):4099-102; or Kochenderfer et al. (2013) Blood 122 (25): 4129-39.

[0032] A " CAR-expressing cell" refers to an immune cell (e. g., an immune effector cell or a population thereof) that expresses a CAR molecule that targets a cancer-associated antigen or tumor antigen as described herein. In some aspects, the tumor antigen is CD19 and the CAR-expressing cell expresses an anti~CD19 CAR, i. e., an anti-CD19 CAR-expressing cell. In some aspects, the immune cell expressing an anti-CD19 CAR is a T cell, e. g., an alpha / beta T cell and gamma / delta T cell; a B cell; a natural killer (NK) cell; a natural killer T (NKT) cell; a mast cell, or a myeloid-derived phagocyte. In one aspect, an anti-CD19 CAR-expressing cell is an anti-CD19 CAR T cell.

[0033] To identify a subject who is likely to respond to or benefit from an anti-CD19 CAR-expressing cell therapy, an expression level of a biomarker, e. g., GPR65, is determined in a biological sample obtained from the subject. As used herein a "biological sample" refers to a collection of similar fluids, cells, or tissues isolated from a subject, as well as fluids, cells, or tissues present within a subject. ExemplarySJ0122WO PATENT samples are biological fluids such as blood, serum and serosal fluids, plasma, lymph, urine, saliva, cystic fluid, tear drops, feces, sputum, mucosal secretions of the secretory tissues and organs, vaginal secretions, ascites fluids, fluids of the pleural, pericardial, peritoneal, abdominal and other body cavities, fluids collected by bronchial lavage, synovial fluid, liquid solutions contacted with a subject or biological source, for example, cell and organ culture medium including cell or organ conditioned medium, lavage fluids and the like, tissue biopsies, tumor tissue biopsies, tumor tissue samples, fine needle aspirations, surgically resected tissue, organ cultures or cell cultures. In some aspects, the biological sample is a tumor sample, e. g., a tumor tissue sample, primary tumor sample, cellular extract of a tumor sample, and the like.

[0034] The terms "level of expression" or "expression level" in general are used interchangeably and generally refer to the amount of a biomarker in a biological sample. " Expression" may refer to transcription into a polynucleotide, translation into a polypeptide, or even polynucleotide and / or polypeptide modifications (e. g., posttranslational modification of a polypeptide). Fragments of the transcribed polynucleotide, the translated polypeptide, or polynucleotide and / or polypeptide modifications (e. g., posttranslational modification of a polypeptide) shall also be regarded as expressed whether they originate from a transcript generated by alternative splicing or a degraded transcript, or from a post-translational processing of the polypeptide, e. g., by proteolysis.

[0035] The "amount" or "level" of a biomarker may be assessed qualitatively and / or quantitatively by methods known to one skilled in the art and also disclosed herein. An expression level of any of the biomarkers described herein may be basedSJ0122WO PATENT on any suitable criterion known in the art, including but not limited to, DNA, mRNA, cDNA, proteins, and / or protein fragments. Methodologies for measuring biomarkers may include, e. g., immunohistochemistry (" IHC"), western blot analysis, immunoprecipitation, molecular binding assays, ELISA, ELIFA, fluorescence-activated cell sorting (" FACS"), MassARRAY, proteomics, biochemical enzymatic activity assays, in situ hybridization, fluorescence in situ hybridization (FISH), Southern analysis, northern analysis, whole genome sequencing, polymerase chain reaction (PCR), including quantitative PCR (qPCR), quantitative real-time PCR (qRT-PCR) and other amplification type detection methods, such as, for example, branched DNA, SISBA, TMA and the like, RNA-Seq, microarray analysis, gene expression profiling, whole-genome sequencing (WGS), and / or serial analysis of gene expression (" SAGE"), as well as any one of the wide variety of assays that can be performed by protein, gene, and / or tissue array analysis. Typical protocols for evaluating the status of genes and gene products are found, for example, in Ausubel et al. eds. (1995) Current Protocols In Molecular Biology). Multiplexed immunoassays such as those available from Rules Based Medicine or Meso Scale Discovery (" MSD") may also be used.

[0036] In some aspects, the level of expression of GPR65 is determined by PCR. In some aspects, GPR65 expression is determined by PCR using a forward primer having the nucleotide sequence GCATTGCCGTTGATCGGTATT (SEQ ID NO: 1) and reverse primer having the nucleotide sequence CGTCCTGAACAAGTTGAGGTT (SEQ ID NO: 2), which generates an amplicon of 245 bp in length and / or a forward primer having the nucleotide sequence TGATCTGCAACCGGAAAGTCT (SEQ ID NO: 3) and reverse primer having the nucleotide sequence TCAGCAACATCACATGAAAGGG (SEQ ID NO: 4 ), which generates an amplicon of 144 bp in length.SJ0122WO PATENT

[0037] Subsequent to determining the level of expression of a biomarker, e. g., GRP65, in a biological sample, the level of expression of the biomarker may be compared with a reference level. In the context of a sample, cell, tissue or level, a "reference" refers to a sample, cell, tissue, or level that is used for comparison purposes. In one aspect, a reference sample, reference cell, reference tissue, or reference level is obtained from a healthy and / or non-diseased part of the body ( e. g., tissue or cells) of the same patient or individual. For example, the reference sample, reference cell or reference tissue may be healthy and / or non-diseased cells or tissue adjacent to the diseased cells or tissue (e. g., cells or tissue adjacent to a tumor). Similarly, a reference level may be an expression level of a biomarker obtained from healthy and / or non-diseased cells or tissues. In one aspect, a reference sample or level is obtained from an untreated tissue and / or cell of the body of the same patient or individual. In another aspect, a reference sample, reference cell, reference tissue, or reference level is obtained from a healthy and / or nondiseased part of the body (e. g., tissues or cells) of an individual who is not the patient or individual. In a further aspect, a reference sample, reference cell, reference tissue, or reference level is obtained from an untreated tissue and / or cell of the body of an individual who is not the patient or individual. In some aspects, a reference sample, cell, tissue, or level is from a subject that has responded to or benefited from an anti-CD19 CAR-expressing cell therapy. In some aspects, the level of expression of a biomarker may be compared with a reference level of expression of a housekeeping gene, e. g., GAPDH. In some aspects, a reference level is generated by collecting RT-PCR data of responders and non-responders toSJ0122WO PATENT an anti-CD19 CAR-expressing cell therapy to generate a GPR65 expression reference and cutoff.

[0038] The identification of a subject who is likely to respond to, likely being responsive to, or benefit from an anti-CD19 CAR~expressing cell therapy is based on the expression level of GPR65 in the biological sample relative to the reference level. The phrase "based on" when used herein means that the information about one or more biomarkers is used to inform a treatment decision, information provided on a package insert, or marketing / promotional guidance, etc. In some aspects, the expression level of a biomarker is increased relative to a reference level. In some aspects, the expression level of a biomarker is decreased relative to a reference level. In some aspects, the expression level of a biomarker is equivalent to a reference level.

[0039] " Increased expression," "increased expression level," or grammatical variations thereof, refers to an increased expression or increased levels of a biomarker in an individual relative to a reference level. In some aspects, an increase may be at least about 1.1-fold, about 1.2-fold, about 1.3- fold, about 1.4-fold, about 1.5-fold, about 1. 6-fold, about 1. 7-fold, about 1. 8-fold, about 1.9-fold, about 2-fold, about 2. 1-fold, about 2.2-fold, about 2.3-fold, about 2. 4-fold, about 2. 5-fold, about 3-fold, about 3.5-fold, about 4-fold, about 4.5-fold, about 5-fold, about 5.5-fold, about 6-fold, about 6. 5-fold, about 7-fold, about 7.5-fold, about 8-fold, about 8.5-fold, about 9-fold, about 9.5-fold, about 10-fold, about 11-fold, about 12-fold, about 13-fold, about 14-fold, about 15-fold, about 16-fold, about 17-fold, about 18-fold, about 19-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 500-fold, about 1, 000-fold or greater.SJ0122WO PATENT

[0040] " Decreased expression, " "decreased expression level," "reduced level, " "lower expression, " or grammatical variations thereof, refers to a decrease expression or decreased levels of a biomarker in an individual relative to a reference level, such as an individual or individuals who are not suffering from the disease or disorder (e. g., cancer) or the level of a biomarker in healthy and / or non-diseased cells or tissues. In some aspects, a decrease may be at least about 1.1-fold, about 1.2-fold, about 1.3-fold, about 1.4-fold, about 1.5-fold, about 1. 6-fold, about 1.7-fold, about 1.8-fold, about 1. 9- fold, about 2-fold, about 2.1-fold, about 2.2-fold, about 2.3-fold, about 2. 4-fold, about 2.5-fold, about 3-fold, about 3.5-fold, about 4-fold, about 4.5-fold, about 5-fold, about 5.5- fold, about 6-fold, about 6.5-fold, about 7-fold, about 7. 5- fold, about 8-fold, about 8.5-fold, about 9-fold, about 9.5-fold, about 10-fold, about 11-fold, about 12-fold, about 13- fold, about 14-fold, about 15-fold, about 16-fold, about 17-fold, about 18-fold, about 19-fold, about 20-fold, about 30-fold, about 40-fold, about 50-fold, about 100-fold, about 500-fold, about 1, 000-fold or greater.

[0041] An "equivalent expression level" or "equivalent, level" refers to levels of a biomarker in a sample from a subject that are statistically indistinguishable from a reference level.

[0042] In some aspects, a method of identifying a subject who is likely to respond to, likely being responsive to, or benefit from an anti-CD19 CAR-expressing cell therapy may further include determining the expression level of one or more (e. g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39) of the biomarker genes of Table 1 and comparing the expression level of the one or more (e. g., 1,SJ0122WO PATENT 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39) of the biomarker genes of Table 1 with a reference level, thereby identifying the subject as likely to respond to or benefit from treatment with the anti-CD19 CAR-expressing cell therapy.TABLE 1Gene NCBI Gene Symbol Gene Name ID GAA Alpha glycosidase 2548 DOCK9 Dedicator Of Cytokinesis 9 23348 IL2RA Interleukin 2 Receptor Subunit 3559 AlphaIL27RA Interleukin 27 Receptor Subunit 9466 AlphaCITED2 Cbp / P300 Interacting Transactivator 10370 With Glu / Asp Rich Carboxy-TerminalDomain 2PCYOX1L Prenylcysteine Oxidase 1 Like 78991 ALDH3B1 Aldehyde Dehydrogenase 3 FamilyMember BlNEFH Neurofilament Heavy Chain 4744 APOE Apolipoprotein E 348 MORC2 MORC Family CW-Type Zinc Finger 2 22880 RGS12 Regulator Of G Protein Signaling 12 6002 FADS3 Fatty Acid Desaturase 3 3995 CDK13 Cyclin Dependent Kinase 13 8621 MEX3B Mex-3 RNA Binding Family Member B 84206 ABCC1 ATP Binding Cassette Subfamily C 4363 Member 1ZNF428 Zinc Finger Protein 428 126299 RIOK1 RIO Kinase 1 83732 UQCRFS1 Ubiquinol-Cytochrome C Reductase, 7386 Rieske Iron-Sulfur Polypeptide 1GMDS GDP-Mannose 4,6-Dehydratase 2762 CERK Ceramide Kinase 64781 CHD7 Chromodomain Helicase DNA Binding 55636 Protein 7ZNF423 Zinc Finger Protein 423 23090 BPNT1 3 ' (2 ' ), 5 ' -Bisphosphate 10380 Nucleotidase 1DAB2IP DAB2 Interacting Protein 153090 TAF1B TATA-Box Binding Protein Associated 9014Factor, RNA Polymerase I Subunit BSJ0122WO PATENT MMP14 Matrix Metallopeptidase 14 4323 RBPMS RNA Binding Protein, MRNA 11030 Processing FactorSTMN1 Stathmin 1 3925 SOX4 SRY-Box Transcription Factor 4 6659 ATP1B3 ATPase Na+ / K+ Transporting Subunit 483Beta 3ACVR1 Activin A Receptor Type 1 90 NEURL1B Neuralized E3 Ubiquitin Protein 54492 Ligase IBRALA RAS Like Proto-Oncogene A 5898 MYO10 Myosin X 4651 TRIM27 Tripartite Motif Containing 27 5987 RAG2 Recombination Activating 2 5897 PIK3R3 Phosphoinositide-3-Kinase 8503 Regulatory Subunit 3IGF2BP3 Insulin Like Growth Factor 2 MRNA 10643 Binding Protein 3NT5DC2 5'-Nucleotidase Domain Containing 2 64943

[0043] In some aspects, an increase or equivalent expression level of one or more of GAA, DOCK9, IL2RA, IL27RA, CITED2, PCYOX1L, ALDH3B1, NEFH, and / or APOE in the biological sample relative to the reference level identifies the subject as being likely to respond to, likely being responsive to, or likely to benefit from treatment with the anti-CD19 CAR- expressing cell therapy. In some aspects, a decrease or lower expression level of one or more of MORC2, RGS12, FADS3, CDK13, MEX3B, ABCC1, ZNF428, RIOK1, UQCRFS1, GMDS, CERK, CHD7, ZNF423, BPNT1, DAB2IP, TAF1B, MMP14, RBPMS, STMN1, SOX, ATP1B3, ACVR1, NEURL1B, RALA, MYO10, TRIM27, RAG2, PIK3R3, IGF2BP3, and / or NT5DC2 in the biological sample relative to the reference level identifies the subject as being likely to respond to, likely being responsive to, or likely benefit from treatment with the anti-CD19 CAR-expressing cell therapy. In some aspects, a decrease or lower expression level of one or more of GAA, DOCK9, IL2RA, IL27RA, CITED2, PCYOX1L, ALDH3B1, NEFH, and / or APOE in the biological sample relative to theSJ0122WO PATENT reference level identifies the subject as being unlikely to respond to, likely being responsive to, or likely to benefit from treatment with the anti-CD19 CAR-expressing cell therapy. In some aspects, an increase or equivalent expression level of one or more of MORC2, RGS12, FADS3, CDK13, MEX3B, ABCC1, ZNF428, RIOK1, UQCRFS1, GMDS, CERK, CHD7, ZNF423, BPNT1, DAB2IP, TAF1B, MMP14, RBPMS, STMN1, SOX4, ATP1B3, ACVR1, NEURL1B, RALA, MYO10, TRIM27, RAG2, PIK3R3, IGF2BP3, and / or NT5DC2 in the biological sample relative to the reference level identifies the subject as being unlikely to respond to, likely being responsive to, or likely to benefit from treatment with the anti-CD19 CAR-expressing cell therapy.

[0044] In another aspect is provided a method of treating cancer, e. g., a CD19+hematologic malignancy, by determining the expression level of GPR65 in a biological sample obtained from a subject having, suspected of having, or at risk of having a cancer, identifying the subject as likely being responsive to an anti-CD19 CAR-expressing cell therapy if the expression level of GPR65 in the sample is increased or equivalent to a reference expression level of GPR65; and administering a therapeutically effective amount of the anti- CD19 CAR-expressing cell therapy to the subject.

[0045] As used herein, "treatment, " and grammatical variations thereof such as "treat" or "treating," refers to clinical intervention in an attempt to alter the natural course of the individual being treated, and may be performed either for prophylaxis or during the course of clinical pathology. Desirable effects of treatment include, but are not limited to, preventing occurrence or recurrence of disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression,SJ0122WO PATENT amelioration or palliation of the disease state, and remission or improved prognosis.

[0046] A "therapeutically effective amount" refers to an amount of a therapeutic agent to treat or prevent a disease or disorder in a mammal. In the case of cancers, the therapeutically effective amount of the therapeutic agent may reduce the number of cancer cells; reduce the primary tumor size; inhibit (i. e., slow to some extent and preferably stop) cancer cell infiltration into peripheral organs; inhibit (i. e., slow to some extent and preferably stop) tumor metastasis; inhibit, to some extent, tumor growth; and / or relieve to some extent one or more of the symptoms associated with the disorder. For cancer therapy, efficacy in vivo may, for example, be measured by assessing the duration of survival, time to disease progression (TTP), response rates (e. g., complete response (CR) and partial response (PR) ), duration of response, and / or quality of life.

[0047] An anti-CD19 CAR-expressing cell therapy may be administered to a subject in need thereof by any suitable means conventionally used in the art for administering CAR- expressing cell therapies. Administration may include the placement (e. g., transplantation) of the CAR-expressing cells into a subject by a method or route that results in at least partial localization of the CAR-expressing cells at a desired site, such as a tumor site, such that a desired effect (s) may be produced. In some aspects, a therapeutically effective amount of the anti-CD19 CAR-expressing cells may be administered via a systemic route of administration. In some aspects, a systemic route of administration may refer to the administration of a population of cells other than directly into a target site, tissue, or organ, such that it enters, instead, the subject ’ s circulatory system and thus, is subjectSJ0122WO PATENT to metabolism and other like processes. Suitable modes of administration include injection, infusion, instillation, or ingestion. Injection includes, without limitation, intravenous, intramuscular, intra-arterial, intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebrospinal, and intrasternal injection and infusion. The route may be intravenous.

[0048] Doses of immune cells such as NK and / or T cells may be readily determined for a given subject based on their body mass, disease type and state, and desired aggressiveness of treatment, but range, depending on the embodiments, from about 105cells per kg to about 1012cells per kg (e. g., 105-107, 107-1010, 1010-1012and overlapping ranges therein). In one aspect, a dose escalation regimen is used. In several aspects, a range of immune cells such as NK and / or T cells may be administered, for example between about 1×106cells / kg to about 1×108cells / kg. In aspects, the dosage ranges from about 2×105cells / kg to about 2×108cells / kg, including about 2×106and 2×107cells / kg.

[0049] In some aspects, a method of treating cancer, e. g., a CD19+hematologic malignancy, may further include determining the expression level of one or more (e. g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39) of the biomarker genes of Table 1, and comparing the expression level of the one or more (e. g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39) of the biomarker genes of Table 1 with a reference level, wherein an increase or equivalent level of expressionSJ0122WO PATENT of one or more of GAA, DOCK9, IL2RA, IL27RA, CITED2, PCYOX1L, ALDH3B1, NEFH, and / or APOE, and / or decrease or lower level of expression of one or more of MORC2, RGS12, FADS3, CDK13, MEX3B, ABCCl, ZNF428, RIOK1, UQCRFS1, GMDS, CERK, CHD7, ZNF423, BPNT1, DAB2IP, TAF1B, MMP14, RBPMS, STMN1, SOX, ATP1B3, ACVR1, NEURL1B, RALA, MYOIO, TRIM27, RAG2, PIK3R3, IGF2BP3, and / or NT5DC2 in the biological sample relative to the reference level identifies the patient as one who would benefit from an anti-CD19 CAR-expressing cell therapy.

[0050] In another aspect is provided a method of selecting an anti-cancer therapy comprising an anti-CD19 CAR-expressing cell therapy in combination with a GPR65 agonist and / or VEGF (vascular endothelial growth factor) antagonist for a subject having, suspected of having, or at risk of having a cancer, e. g., a CD19+ hematologic malignancy, by determining the expression level of GPR65 in a biological sample obtained from the subject, comparing the expression level of GPR65 in the biological sample with a reference level and selecting an anti-cancer therapy comprising an anti-CD19 CAR-expressing cell therapy in combination with a GPR65 agonist and / or VEGF antagonist for the subject based on the expression level of GPR65 in the biological sample relative to the reference level. In some aspects, a lower or decreased expression level of GPR65 in the biological sample relative to the reference level is used as a basis for selecting and administering to the subject the anti-cancer' therapy.

[0051] In some aspects, a method of selecting an anti-cancer therapy comprising an anti-CD19 CAR-expressing cell therapy in combination with a GPR65 agonist and / or VEGF antagonist may further include determining the expression level of one or more (e. g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31,SJ0122WO PATENT 32, 33, 34, 35, 36, 37, 38, or 39) of the biomarker genes of Table 1, and comparing the expression level of the one or more (e. g., 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, or 39) of the biomarker genes of Table 1 with a reference level, wherein an decrease or lower level of expression of one or more of GAA, DOCK9, IL2RA, IL27RA, CITED2, PCYOX1L, ALDH3B1, NEFH, and / or APOE, and / or increase or higher level of expression of one or more of MORC2, RGS12, FADS3, CDK13, MEX3B, ABCC1, ZNF428, RIOK1, UQCRFS1, GMDS, CERK, CHD7, ZNF423, BPNT1, DAB2IP, TAF1B, MMP14, RBPMS, STMN1, SOX4, ATP1B3, ACVR1, NEURL1B, RALA, MYO10, TRIM27, RAG2, PIK3R3, IGF2BP3, and / or NT5DC2 in the biological sample relative to the reference level is used to select the anticancer therapy.

[0052] In a further aspect is provided a method of increasing the therapeutic efficacy of an anti-CD19 CAR~expressing cell therapy by increasing expression and / or function of GPR65 and / or decreasing expression and / or function of VEGF in a subject receiving an anti-CD19 CAR-expressing cell therapy thereby increasing the therapeutic efficacy of an anti-CD19 CAR-expressing cell therapy. In some aspects, the subject has a cancer that is refractory to anti-CD19 CAR-expressing cell therapy. In some aspects, a tumor cell of the subject has a lower or decreased expression level of GPR65 relative to a reference level of GPR65 expression. In some aspects, the subject has been identified as being unlikely to respond to or benefit from treatment with the anti-CD19 CAR-expressing cell therapy. In some aspects, the subject has a cancer that has relapsed after treatment with an anti-CD19 CAR-expressing cell therapy. In some aspects, the subject has a CD19+hematologic malignancy. Increased therapeutic efficacy of anSJ0122WO PATENT anti-CD19 CAR-expressing cell therapy may be evidenced by an increase in the killing of cancer cells to which it binds as compared to killing of the cancer when the anti~CD19 CAR- expressing cell therapy is administered in the absence of increased expression and / or function of GPR65.

[0053] In some aspects, the expression and / or function of GPR65 may be increased using an agonist of GPR56 activity or expression. In some aspects, an agonist of GPR65 expression or activity comprises a complete agonist or a partial agonist. In some aspects, an agonist of GPR56 expression may be a GPR65 nucleic acid or GPR65 polypeptide. In some aspects, a GPR65 nucleic acid or GPR65 polypeptide may be administered to a subject to effectively increase the level of GPR56. In some aspects, the GPR65 polypeptide comprises a human GPR65 protein (huGPR65), or a homolog thereof. In some aspects, the GPR65 polypeptide comprises a recombinant GPR65 polypeptide. In some aspects, the recombinant human GPR65 comprises the amino acid sequence:1 MNSTCIEEQH DLDHYLFPIV YIFVIIVSIP ANIGSLCVSF LQAKKESELG IYLFSLSLSD61 LLYALTLPLW IDYTWNKDNW TFSPALCKGS AFLMYMNFYS STAFLTCIAV DRYLAWYPL121 KFFFLRTRRF ALMVSLSIWI LETIFNAVML WEDETVVEYC DAEKSNFTLC YDKYPLEKWQ181 INLNLFRTCT GYAIPLVTIL ICNRKVYQ V RHNKATENKE KKRIIKLLVS ITVTFVLCFT241 PFHVMLLIRC ILEHAVNFED HSNSGKRTYT MYRITVALTS LNCVADPILY CFVTETGRYD301 MWNILKFCTG RCNTSQRQRK RILSVSTKDT MELEVLE (SEQ ID NO: 5)In some embodiments, the huGPR65 comprises an amino acid sequence having about 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91%, or 90% sequence identity to SEQ ID NO: 5.

[0054] In some instances, the GPR65 polypeptide may be truncated. In some aspects, the truncation may be an N-terminal deletion. In other aspects, the truncation may be a C-terminal deletion. In additional aspects, the truncationSJ0122WO PATENT comprises both N-terminal and C-terminal deletions. For example, the truncation may be a deletion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, or more residues from either the N-terminus or the C-terminus, or both termini. In some cases, the GPR65 polypeptide may comprise an N-terminal deletion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 20, or more residues. In some cases, the GPR65 polypeptide may comprise an N-terminal deletion of at least or about 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 residues.

[0055] In some aspects, a GPR65 polypeptide has an enhanced plasma half-life. In some instances, the plasma half-life may comprise at least 30 minutes, 45 minutes, 60 minutes, 75 minutes, or 90 minutes, 2 hours, 3 hours, 4 hours, 5 hours, 6 hours, 7 hours, 8 hours, 9 hours, 10 hours, 11 hours, 12 hours, 18 hours, 24 hours, 36 hours, 48 hours, 3 days, 4 days, 5 days, 6 days, 7 days, 10 days, 12 days, 14 days, 21 days, 28 days, 30 days, or longer than the plasma half-life of the wild-type GPR65 protein. In some aspects, the GPR65 polypeptide may be a conjugate comprising the GPR65 polypeptide and a conjugating moiety. In some aspects, the conjugating moiety may comprise a polymer comprising Polyethylene glycol (PEG).

[0056] In some aspects, the GPR65 polypeptide may be fused with a second polypeptide. In some aspects, the second polypeptide may comprise a polypeptide with a long plasma half-life relative to the plasma half-life of the GPR65 polypeptide. In some aspects, the second polypeptide may comprise an antibody or antibody fragment. In some aspects, the antibody or antibody fragment may comprise an IgGl, IgG2, IgG4, IgG3, or IgE. In some aspects, the IgG may be an Fc. In some aspects, the IgG Fc may be human. In some aspects, theSJ0122WO PATENT long plasma half-life polypeptide may comprise HSA, transferrin, IgA monomer, Retinol-binding protein, Factor H, Factor XIII, C-reactive protein, Factor IX, Fibrinogen, IFN-alpha, Pentameric IgM, IF-2, or Thyroglobulin.

[0057] In some aspects, an agonist of GPR65 activity may be an allosteric agonist. In some aspects, a GPR65 agonist may be BTB09089 (CAS No. 245728-44-3; (3- [ (2, 4-dichlorobenzyl) thio] -1, 6-dimethyl~5, 6-dihydro-lH-pyridazino [4, 5-e] [1, 3, ] thiadiazin-5-one).BTB09089

[0058] In some aspects, a GPR65 agonist may be ZINC13684400 (CAS No. 455310-36-8 ), which has been shown to have a potency of 500 nM. See, e. g., Huang et al. (2015) Nature 527 (7579): 477-483.ZINC13684400

[0059] In some aspects, the expression and / or function of VEGF may be decreased using an antagonist of VEGF activity or expression, e. g., VEGFA activity or expression. A " VEGF antagonist" refers to a molecule capable of neutralizing, blocking, inhibiting, abrogating, reducing or interfering with VEGF activities including its binding to one or more VEGF receptors. VEGF antagonists include anti-VEGF antibodies and antigen-binding fragments thereof, receptor molecules and derivatives which bind specifically to VEGF therebySJ0122WO PATENT sequestering its binding to one or more receptors, anti-VEGF receptor antibodies and VEGF receptor antagonists such as small molecule inhibitors of the VEGFR tyrosine kinases.

[0060] Examples of VEGF antagonists include, but are not limited to, anti-VEGFR2 antibodies and related molecules (e. g., ramucirumab, tanibirumab, af libercept), anti-VEGFRl antibodies and related molecules (e. g., icrucumab, aflibercept (VEGF Trap-Eye; EYLEA®), and ziv~af libercept (VEGF Trap; ZALTRAP®) ), bispecific VEGF antibodies (e. g., MP-0250, vanucizumab (VEGF-ANG2), and bispecific antibodies disclosed in US 2001 / 0236388 ), bispecific antibodies including combinations of two of anti-VEGF, anti-VEGFRl, and anti-VEGFR2 arms, anti-VEGFA antibodies (e. g., bevacizumab, sevacizumab), anti-VEGFB antibodies, anti-VEGFC antibodies (e. g., VGX-100), anti-VEGFD antibodies, a single chain (e. g., VL-VH) anti-VEGF antibody such as brolucizumab (RTH258), and nonpeptide small molecule VEGF antagonists (e. g., pazopanib, axitinib, vandetanib, stivarga, cabozantinib, lenvatinib, nintedanib, orantinib, telatinib, dovitinig, cediranib, motesanib, sulfatinib, apatinib, foretinib, famitinib, and tivozanib) and VEGF-1 / VEGF-2 / VEGF-3 receptor antagonists such as f uquintinib.

[0061] In some aspects, a cancer of any one of the methods herein is a hematological cancer or hematologic malignancy. In one aspect, the hematological cancer is a leukemia or a lymphoma. In some aspects, a cancer herein expresses CD19. In some aspects, a cancer herein is a CD19+hematologic malignancy. In some aspects, a cancer or malignancy herein may include, e. g., one or more acute leukemias including but not limited to, e. g., B-cell acute Lymphoid Leukemia (BALL), T- cell acute Lymphoid Leukemia (TALL), acute lymphoid leukemia (ALL); one or more chronic leukemias including but not limitedSJ0122WO PATENT to, e. g., chronic myelogenous leukemia (CML), Chronic. Lymphoid Leukemia (CLL). Additional cancers or hematologic conditions associated with expression of CD19 may include, e. g., B cell prolymphocytic leukemia, blastic plasmacytoid dendritic cell neoplasm, Burkitt ' s lymphoma, diffuse large B cell lymphoma, Follicular lymphoma, Hairy cell leukemia, small cell- or a large cell-follicular lymphoma, malignant lymphoproliferative conditions, MALT lymphoma, mantle cell lymphoma (MCL), Marginal zone lymphoma, multiple myeloma, myelodysplasia and myelodysplastic syndrome, non-Hodg in lymphoma, Hodgkin lymphoma, plasmablastic lymphoma, plasmacytoid dendritic cell neoplasm, Waldenstrom macroglobulinemia, and "preleukemia, " which are a diverse collection of hematological conditions united by ineffective production (or dysplasia) of myeloid blood cells, and the like.

[0062] In any one of the therapeutic methods herein, the anti- CD19 CAR-expressing cell therapy and a GPR65 agonist and / or VEGF antagonist may be administered sequentially or concurrently. In some aspects, a GPR65 agonist and / or VEGF antagonist is administered prior to the anti-CD19 CAR- expressing cell therapy.

[0063] In some aspects, an anti~CD19 CAR-expressing cell therapy and / or GPR65 agonist and / or VEGF antagonist may administered in combination with an additional therapeutic agent. In some aspects, the additional therapeutic agent may be an immunotherapy agent, a cytotoxic agent, a growth inhibitory agent, a radiation therapy agent, an anti-angiogenic agent, or a combination thereof.

[0064] To facilitate carrying out one or more of the methods herein, the disclosure also provides a kit or article of manufacture (e. g., a package or container) comprising at least one reagent, e. g., a medicament for treatment of a cancerSJ0122WO PATENT (e. g., a CD19+hematologic malignancy), or a binding agent and / or an oligonucleotide for specifically detecting a biomarker described herein. In some aspects, the manufacture or kit is promoted, distributed, or sold as a unit for performing the methods described herein.

[0065] In one aspect, a kit or article of manufacture comprises at least one oligonucleotide (e. g., a primer or probe) for determining an expression level of one or more the biomarkers described herein. In some aspects, a kit or article of manufacture comprises at least one set of primers for amplifying and determining an expression level of GPR65. In some aspects, a kit or article of manufacture comprises a set of primers (a ) having the nucleotide sequences of SEQ ID NO: 1 and SEQ ID NO: 2; (b) having the nucleotide sequences of SEQ ID NO: 3 and SEQ ID NO: 4; or (c) a combination of (a) and (b). In some aspects, an oligonucleotide of the kit or article of manufacture may include a label or barcode to facilitate detection.

[0066] In another aspect, a kit or article of manufacture comprises at least one antibody for determining an expression level of one or more of the biomarkers described herein. In some aspects, a kit or article of manufacture comprises at least one antibody that specifically binds to GPR65. In some aspects, a kit or article of manufacture comprises a first antibody that specifically binds to GPR65 and a second antibody that specifically binds to the first antibody. In some aspects, one or both of the antibody that specifically binds to GPR65 or the second antibody may include a label to facilitate detection.

[0067] The word "label" when used herein refers to a compound or composition that is conjugated or fused directly or indirectly to a reagent such as an oligonucleotide or anSJ0122WO PATENT antibody and facilitates detection of the reagent to which it is conjugated or fused. The label may itself be detectable (e. g., radioisotope labels or fluorescent labels) or, in the case of an enzymatic label, may catalyze chemical alteration of a substrate compound or composition which is detectable. The term is intended to encompass direct labeling of an oligonucleotide or antibody by coupling ( i. e., physically linking) a detectable substance to the oligonucleotide or antibody, as well as indirect labeling of the oligonucleotide or antibody by reactivity with another reagent that is directly labeled. Examples of indirect labeling include detection of a primary antibody using a fluorescently-labeled secondary antibody and end-labeling of a DNA probe with biotin such that it can be detected with fluorescently-labeled streptavidin.

[0068] In another aspect, a kit or article of manufacture comprises a GPR65 agonist and / or VEGF antagonist and a CD19 CAR-expressing cell or construct for expressing a CD19 CAR in an immune cell as described herein.

[0069] The following non-limiting examples are provided to further illustrate the present invention.Example 1: Materials and Methods

[0070] Mice. C57BL / 6 mice were obtained from The Jackson Laboratory (strain 000664 ). Human CD19 CAR-transgenic (CAR- Tg) mice were generated as previously described (Zheng et al. (2021) Blood 138 (2 ): 122-35). All studies used 8- to 12-week- old female mice housed in an American Association for Accreditation of Laboratory Animal Care (AAALAC) -accredited facility. Experimental protocols were approved by the SJCRH Animal Care and Use Committee in accordance with National Institutes of Health (NIH) guidelines.SJ0122WO PATENT

[0071] Cell Lines. C56BL / 6J luciferase-expressing Arf- / -BCR-ABL1+Ph+progenitor B-ALL cells were transduced with MSCV-hCD19-IRES-RFP and cloned as previously described to isolate m. PR and m. CR clones (Zheng et al. (2021) Blood 138 (2): 122-35; Churchman et al. (2016) JCI Insight 1 (4): e86082). In brief, bone marrow cells from Arf’ ' CD45. 1 host were transduced with BCR-ABLl-luc and injected retro-orbitally to CD45.2 host and monitored for disease progression. Animals that developed the disease were sacrificed and CD45.2+CD19+cells were sorted, confirmed for BCR-ABLl-luc expression and transduced with MSCV-hCD19-IRES-RFP and RFP (red fluorescent protein) sorted for single clones. Cells were cultured at 37 °C in 8% CO2and RPMI medium with 100 U / ml Pen / Strep, 100 pg / ml sodium pyruvate, IX MEM NEAA, IX GlutaMax™, 10 mM HEPES, and 1 mM p-mercaptoethanol (all from Gibco) and 10% fetal bovine serum ( FBS, Biowest). GPR65 knock-out (KO), VEGFA KO, and FOXO1 KO cell lines were generated using CRISPR-Cas9. Gene knockout was performed by electroporation with ribonucleoprotein (RNP) complex. RNP complex was prepared by mixing 450 pmol (in 9 µl volume) of pre-complexed gRNA / tracrRNA duplex and 180 pmol (in 6 µl volume) of Cas9 protein (UC Berkely) for 10 minutes at room temperature. For clones generated with more than one gRNA, equimolar concentrations of each were combined to total 450 pmol. Cells were resuspended at 0.5x106cells per 20 µl of P4 primary cell nucleofection solution (Lonza) and 5 pl of RNP complex was added. The cell / RNP mixture was incubated for 2 minutes at room temperature, electroporated (4D-Nucleofector Core Unit, Program DI-100, Lonza) and transferred to pre-warmed RPMI media. gRNA sequences were: GPR65 gl: 5' -AGACTATTACTGCTAGAAGT- 3' (SEQ ID N0: 6); GPR65 g2: 5' -TCATCCATGCATTTAGAGAG-3' (SEQ ID NO: 7); GPR65 g3: 5' -ACATTGTATGACTCCTATGT-3' (SEQ ID NO: 8 );SJ0122WO PATENT GPR65 g4: 5' -ACTGTTCGTCTTTAAATCAG-3' (SEQ ID NO: 9 ); GPR65 g5: 5' -GGAACAAATAGTGTTCGAGG-3' (SEQ ID NO: 10); VEGFA gl: 5' - GAAGATGTACTCTATCTCGT-3' (SEQ ID NO: 11); VEGFA g2: 5' - ATTCACATCTGCTGTGCTGT-3' (SEQ ID NO: 12 ); Foxol gl: 5' -CCAGGCTCGCCGCGGCGTCGNGG-3' (SEQ ID NO: 13); Foxol g2: 5' - GGCCGCCAACCCCGACGCCGNGG-3' (SEQ ID NO: 14 ).

[0072] CAR-T Cells. T cells were enriched from the spleen and lymph nodes of CD19 CAR-Tg mice by magnetic-activated cell sorting (MACS) using the Pan T cell Isolation kit (Miltenyi) and resuspended in complete RPMI medium with 10% FBS, activated with 5 pg / ml plate-bound anti-mouse CD3 (clone) and CD28 (clone) and 20 U / ml recombinant human interleukin 2 (rhIL-2; PeproTech) for 2 days at 37 °C in 5% CO2. Cells were transferred to new plates and cultured in 20 U / ml rhIL-2, 5 ng / ml recombinant human interleukin 7 (rhIL-7; Peprotech) and 25 ng / ml recombinant human interleukin 15 (rhIL-15; Peprotech) for 4-5 days prior to experimental use.

[0073] In Vivo Survival, Imaging, and Analysis. Mice were injected with 1x106luciferase-expressing hCD19+B-ALL tumor cells (i. v. ) followed 7 days later with 10x106of activated CAR-T cells or phosphate-buf fered saline (PBS) (retro-orbital). For survival experiments, tumor growth was monitored by bioluminescence imaging. Mice received 200 µl of 15 µg / ml D-luciferin (PerkinElmer) i. p. and images were acquired after 5 minutes using a Xenogen IVIS-200 (PerkinElmer). For other- experiments, mice were sacrificed at pre-determined time points and organs harvested and processed into single cell suspensions for analysis. Macrophage depletion experiments used the same protocol, except beginning five days after tumor injection mice received a depleting dose of 400 mg of either αCSF1R (clone AFS98, Bioxcell) or rat IgG2a isotype control (clone 2A3, Bioxcell) by i. p. injection, followed bySJ0122WO PATENT maintenance doses of 100 mg three times per week for 28 days. For CAR-T cell re-transfer experiments, mice received 1x106m.CR tumor cells (i. v. ) followed 7 days later with 2x106CAR- T cells, either freshly expanded or sorted from the spleens of mice with m. CR or GPR65 KO tumors three days after treatment. VEGFA neutralization experiments used the same protocol. The treatment consisted of four rounds on days 3, 6, 8 and 10 after tumor injection, with mice receiving 5 mg / kg of either VEGFA neutralizing antibodies (clone 2G11-2A05, Biolegend) or control antibodies (clone 2A3, Bioxcell) by intraperitoneal (i. p. ) injection.

[0074] Flow Cytometry. For surface staining, single cell suspensions were incubated with Ghost-dye™ BV510 or Ghost-dye™ Red 710 in PBS to stain dead cells. Samples were washed and incubated in PBS with 2% FBS and the following fluorochrome-conjugated anti-mouse antibodies: CD3 (145-2C11), CD8 (53-6.7), CD19, B220, NK1.1, Ly6G, Ly6C, Terll9, CDllb (MI / 70), F4 / 80 (BM8), Thyl. l (OX-7), CD45 (30-F11), PD-1 (29F. 1A12), Lag3 (C9B7W), CD69 (H1.2F3), CD25 (PC61), CD44 (IM7), CD62L (MEL-14 ), Anti-human CD19 (HIB19) was used to stain tumor cell hCD19 antigen. For intracellular staining, cells were cultured for 4-6 hours in complete RPMI with Cell Stimulation Cocktail (ebioscience), surface stained, fixed, permeabilized and stained with the following fluorochrome-conjugated anti-mouse antibodies: IFNγ (XMG1.2), TNFα (MP6-XT22), IL-2 (JES6-5H4 ), Granzyme B (GB11), For intranuclear staining, cells were surface stained, followed by fixation and permeabilization with the Foxp3 / Transcription factor staining buffer set (ebioscience) and stained for Bcl2. Samples were analyzed on a BD LSRFortessa (BD) and sorted using a FACS Aria (BD). Analyses were performed using FlowJo software (BD).SJ0122WO PATENT

[0075] Bulk Rna-Sequencing. RNA was isolated from in vitro cell cultures or sorted cells using the RNeasy plus mini kit (QIAgen). Three biological replicates were submitted for RNA-sequencing. For total RNA-seq, library construction from RNA used Illumina TrueSeq™ stranded mRNA library prep kit and sequencing was performed using the HiSeq™ or NovaSeq™ platforms (2×101-bp paired-end reads). Analyses were performed using previously established procedures (Gocho et al. (2021) Nat. Cancer 2 (3): 284-99). Gene expression was quantified as fragments per kilobase of transcript per million (FPKM) mapped reads using RSEM V.1.2.28PP with the GRCm38. p6 and annotation file (Gencode v.30).

[0076] Cross Species Integration, Gene Ranking, and CAR-T Response Signature Generation Using RNA-seq Data of Patient B-ALL and Mouse B-ALL Samples Treated With CAR-T. Human and mouse B-ALL tumor RNA-seq data was log2CPM normalized followed by differential expression analysis using NetBID2 function getDE. limma.2G, comparing h. CR vs h. NR for human and m. CR vs m. PR for mouse. Two results were merged to only keep genes overlapped in both species. To define integration anchors, genes were first filtered using abs (Z-Score) > 1.96, then only those genes with directional consistence across both human and mouse (sign of log2FC same in both human and mouse) were kept. Final feature numbers were made equal for both human and mouse using minimum (length(human, mouse)) ranked by abs(log2FC). Two-tailed Fisher' s Exact test was performed to test the statistical significance of overlap between mouse and human anchor features. Human and mouse log2CPM normalized matrix of anchor features were Z-scaled and merged and PCA analysis was performed using R package PCAtools (v.3.18 ) to jointly visualize human and mouse B-ALL tumors. PCI score was used as CAR-T therapy response score to perform receiver operatorSJ0122WO PATENT characteristic (ROC) analysis for evaluation of the CAR-T therapy response score to predict the response of B-ALL patients and mouse to CAR-T cell therapy using R package pROC (v. 1.18. 5). Final gene ranking between human and mouse responders vs non responders was derived by combining Z-Scores using Stouffer Method. Alternatively, NetBID2 analysis was performed as described (Gocho et al. (2021) Nat. Cancer 2(3):284-99). Briefly, 27 B-ALL samples from GSE130663 (h.NR=8, h. CR=19) and 39 adult B-ALL samples (responders = 19, non-responders = 20) from European Genome Phenome Archive (accession EGAS00001004027) were analyzed using NetBID2 (v.2.0.3). GPR65 regulon (50 genes) was constructed by SJARACNe (v. 0.2.1) using B-ALL specific RNA-seq profiles (N-1, 988 ) from B-ALL patients (Gu et al. (2019) Nat. Genet.51 (2): 296-307 ). The 'cal. Activity' function (method of 'weightedmean' ) in NetBID2 was employed to infer the activity of GPR65 for each patient. Statistical significance was evaluated using Wilcoxon Rank Sum Test comparing responder and non responder groups. Receiver operator characteristic (ROC) analysis of GPR65 activity and expression was performed as before.

[0077] Single Cell RNA-Sequencing. Harvested splenocytes were stained and sorted to isolate m. CR or GPR65 KO tumor cells (RFP+), and host immune cells (RFP-Thy1.1-CD45.2+) from mice with m. CR or GPR65 KO tumors prior to or 4 days after CAR-T treatment. Tumor and host cells from CAR-T-untreated mice were mixed at a 1: 1 ratio and analyzed together. Tumor and host cells from treated mice were run independently. Each sample contained a total of 200, 000 cells. Cells were counted using AO / PI stain (Luna-FL™ Cell Counter, Logos Biosystems), and 6000 cells targeted from each sample using the 10X Chromium Next GEM Single Cell 5' Reagent kits v2 (Dual Index). CellsSJ0122WO PATENT were partitioned into droplets and barcoded using the Chromium Controller using Chip K. Reverse transcription, cDNA amplification, T cell receptor (TCR) amplification, fragmentation, adapter, and sample index ligation were all performed following the 10X CG000331 Rev C protocol. cDNA and libraries were quantified using the High Sense DNA chip on the Agilent Bioanalyzer. Libraries were pooled and sequenced on a NovaSeq™ 6000 using paired end reads with following configuration; Read 1: 26 nucleotides, Index 1: 10 nucleotides, Index 2: 10 nucleotides and Read 2; 90 nucleotides. Cell Ranger (v. 6.0.0) Single-Cell software suite (10X Genomics) was used to process raw Illumina NovaSeq™ 6000 sequencing data. Demultiplexing, alignment (GRCm38.p6) and barcode processing generated gene-cell matrices used for downstream analysis. Cells with low or high unique molecular identifier (UMI) counts were filtered, as well as those with high mitochondria gene reads (>7.5%). The tumor immune microenvironment (TME) was annotated using known markers from literature, and plasma cells were removed from all downstream analyses. Tumor cells were annotated by hCD19 transgene expression.

[0078] Single-Cell RNA-seq After Enrichment of F4 / 80* Macrophages. Splenocytes were harvested from GPR65 KO or m. CR tumor bearing mice on day 7 or day 11, before and after CAR-T cell treatment, and enriched for macrophages using F4 / 80 staining by fluorescence-activated cell sorting (FACS). Macrophages, non-macrophage immune cells and RFP expressing tumor cells were isolated and mixed at a ratio of 3:2:1 (RFP neg CD45.2+F4 / 80+Macrophages: RFP neg Thy1.1 neg F4 / 80 neg CD45.2+TME: RFP+tumor cells). Cells were counted using AO / PI stain on Luna-FL™ Cell Counter, (Logos Biosystems). Tumor and host cells from individual treated and untreated mice wereSJ0122WO PATENT fixed separately using the 10X Genomics CG000478 Demonstrated Protocol Cell & Nuclei Fixation Chromium Fixed RNA Profiling Rev B. After fixation, individual samples were counted and barcoded with unique sample barcodes during probe hybridization. Uniquely barcoded samples were counted using Trypan Blue stain and then pooled in equal numbers following 10X Genomics CG000565 Chromium Fixed RNA Profiling Multiplexed Samples Pooling Workbook Rev B, washed and 8000 cells were targeted from each sample to be partitioned into GEMS on Chip Q using the 10X Genomics Chromium Fixed RNA Profiling kit. Partitioned cells underwent barcoding, reverse transcription, cDNA amplification and sample index ligation following the 10X Genomics CG000527 Chromium Fixed RNA Profiling Multiplexed Samples User Guide Rev D. Libraries were quantified using D5000 kit on Agilent Tape station and Illumina MiSeq™ platform. Quantified libraries were then sequenced using an S2 flow cell on the Illumina NovaSeq™ 6000.

[0079] Clustering Analysis, Differential Expression, Gene Set Enrichment Analysis (GSEA), and Data Visualization. Clustering analysis was performed with scMINER (v. 0. 1.0). In brief, MICA was initiated with mode "ge" and parameter "ar=4.0" using scMINER (v. 0.1.0). Sub-clustering of mouse macrophages was performed using the first 10 principal components and a Louvain resolution of 0.2 after sub-setting host cells positive for macrophages markers Adgrel and Cd68. Differential expression analysis between GPR65 KO vs m. CR tumor derived mouse macrophages and CD19+Relapse vs h. CR patient bone marrow derived macrophages was performed using the FindMarkers ( ) function in Seurat (v.4.3.0). GSEA analysis of mouse and human macrophages was performed using C7 gene sets from MsigDB (v.7.5.1) using NetBID2 functions cal. Activity. GS () and getDE. limma. 2G ( ), respectively. Human bone marrow single-cellSJ0122WO PATENT RNA-seq data was downloaded from European Genome-phenome Archive Accession Number: EGAD00001010018 and macrophages were annotated from three responders and two CD19+relapse patients using CD14 and CD68 expression followed by scMINER and GSEA analysis as described above.

[0080] Cell-Cell Communication Analysis. For cell-cell communication analysis between m. CR or GPR65 KO tumors and host macrophages, LIANA (v. 0.1. 12) was used to perform CellChat analysis on the Ensemble mouse ligand-receptor database using the function liana_wrap ( ) with method='call_cellchat',resource='MouseConcensus' for m. CR and GPR65 KO tumors separately. The computeCommunProb ( ) function was used with the default parameter to quantify ligand-receptor interaction probability. Communication gain in GPR65 KO tumors was defined using the setdiff () function on ligand-receptor pairing between GPR65 KO and m. CR groups after filtering statistically significant cell-cell communication using p<0.05. Finally, cell-cell communication between m. CR and GPR65 KO tumors was visualized using chordDiagramFromDataFrame ( ) function from R package circlize (v. 0.4. 15).

[0081] Hidden Driver Analysis From scRNA-seq Data. A CAR-T cell treatment specific m. CR tumor transcription factor interactome was reconstructed using SJARACNe (v. 0.2.1) using the parameters "-n = 100" and "-pc = 0.01" from gene expression profiles of 2, 726 m. CR tumor cells. The resulting interactome contained 13, 773 nodes and 294, 367 edges. To identify hidden drivers of GPR65 KO tumors, the activity of 1035 transcription factors from the SJARACNe generated interactome was calculated using the NetBID2 function cal. activity ( ), es.method="weightedmean" for GPR65 KO tumor cells (N=1389) and m. CR tumor cells (N=2726), followed by differential activitySJ0122WO PATENT (DA) and differential expression (DE) analysis using NetBID2 function getDE. limma. 2G ( ) using the activity matrix (calculated above) or log2. CPM normalized single-cell RNA-seq expression matrix. The drivers were ranked by average activity, and the top hidden drivers comparing GPR65 KO vs. m. CR tumors were filtered using Z-score DA > 1.96 and Z-score DE < 0.

[0082] Quantitative Real-Time PCR, RNA was isolated from in vitro cell cultures in triplicate using the RNeasy plus mini kit. (QIAgen) and subjected to cDNA synthesis with the High-Capacity cDNA Reverse Transcription Kit (ThermoFisher) according to manufacturer instructions. Quantitative real¬ time PCR using SYBR™ Green master mix (ThermoFisher) was performed on a Quantstudio 7 Pro system (Thermo Fisher). Relative gene expression was calculated using the 2-ΔΔCT method with 18S RNA as the reference gene. Primer sequences were as follows: Gpr65 F: 5' -ATGGCGATGAACAGCATGTG-3' (SEQ ID NO: 15); Gpr65 R: 5'-ACGCATAAAGATCCGATGTTGG-3' (SEQ ID NO: 16); VEGFA F: 5'-GCACATAGAGAGAATGAGCTTCC-3' (SEQ ID NO: 17 ); VEGFA R: 5'- CTCCGCTCTGAACAAGGCT-3' (SEQ ID NO: 18 ).

[0083] Immunoblotting. Cells were lysed in NP-40 lysis buffer (Research Products International), whole cell lysate protein concentrations were determined by BCA assay (ThermoFisher), and 20 pg of protein subjected to SDS-PAGE. Gels were transferred to PVDF membranes and immunoblotted with primary antibodies against mouse pCREB (Abcam), total CREB (Cell Signaling), VEGFA (proteintech), Actin (Millipore Sigma), and FOXO1 (Cell Signaling). Luminata Crescendo Western HRP substrate (Millipore) was added to immunoblots and chemiluminescence detected with a ChemDoc Touch Imaging System (Biorad). For phospho-protein immunoblots, phosphorylated protein was detected first, and blots stripped with RestoreSJ0122WO PATENT Plus western blot stripping buffer (ThermoFisher) prior to total protein detection.

[0084] Cyclic-AMP Assay, m. PR, m. CR, or GPR65 KO tumor cells (2xl06) from in vitro culture were analyzed with the cAMP Direct Immunoassay kit (Abeam) per the manufacturer' s protocol in triplicate.

[0085] In Vitro Tumor Cell Expansion Assay. m. CR or GPR65 KO tumor cells were seeded in triplicate in a 96-well plate at 5xl03cells / well. Cells were counted manually using a hemocytometer, and total number of live cells per well was calculated over 6 days of culture.

[0086] Data Availability. Patient B-ALL RNA-seq data was downloaded from the European Genome-phenome Archive (EGA) under accession number EGAS00001003266. Bulk bone marrow RNA-seq profiles of 27 patients ( 19 responders and 8 nonresponders) B-ALL tumors were downloaded from GSE130663. Bulk RNA-seq of 39 adult B-ALL samples (19 responders and 20 non¬ responders) were downloaded from European Genome Phenome Archive (EGA) under accession EGAS00001004027. scRNA-seq of unsorted bone marrow from 5 patients (3 responders and 2 CD19* relapse) was downloaded from the EGA under accession number EGAD00001010018.Example 2: B-ALL GPCR signaling predicts preclinical responses to CAR-T cell therapy

[0087] Novel tumor-intrinsic determinants of tumor resistance to CAR-T cell therapy were sought using an immune competent, model of B-ALL in which human (h) CD19-transduced, mouse BCR1- ABL+pre-B ALL tumor clones were transferred into unconditioned C56BL / 6 mice (Zheng et al. (2021) Blood 138 (2): 122-35; Churchman et al. (2016) JCI Insight 1 (4 ): e86082). Following tumor engraftment, the mice were treated with activated CAR-TSJ0122WO PATENT cells isolated from CD19-CAR transgenic mice (Zheng et al, (2021) Blood 138 (2): 122-35).

[0088] Two separately-derived BCR1-ABL+ hCD19+B-ALL clones demonstrated distinct responses to CAR-T cell treatment: partial response (m. PR) and complete response (m. CR). m. CR tumors grew aggressively but responded completely to CAR-T cell treatment, with little relapse; however, m. PR tumors exhibited slow growth and initial response to CAR-T cell treatment but relapsed and succumbed to the tumor. Although both tumor types initially expressed high levels of hCD19, the relapsed m. PR tumors lost hCD19 expression.

[0089] Comparative analysis of the m. PR and m. CR tumor cells at baseline by RNA-seq identified the G-protein coupled receptor (GPCR) Gpr65 ( Tdag8) among the top upregulated genes in CR tumors. Indeed, GPCR signaling, and the pathways associated with it (GPCR ligand binding, G-protein coupled receptor signaling, GPCR downstream signaling, G-alpha signaling events, and CREB signaling via PKC and MAPK) were among the pathways identified as enriched in m. CR compared with m. PR tumor cells by functional enrichment analysis. GPR65 promotes cAMP formation, which mediates activation of the transcription factor CREB (Ishii et al. (2005) J. Biol. Chem.280 ( 10 ): 9083-7; Zhang et al, (2020) Exp. Hematol. Oncol.9 (1): 32; Jin et al. (2014 ) J. Neurochem. 129 (4 ): 683-95). Consistently, m. CR tumors had increased cytosolic cAMP and CREB S133 phosphorylation relative to m. PR cells.Example 3: Cross-species integrative analysis ranks GPR65 as the top CAR-T response driver in B-ALL

[0090] To determine the relevance of GPR65 in human tumor responses, data from a clinical trial of CD19 CAR-T treatment of B-ALL patients (Singh et al, (2020) Cancer Discov.SJ0122WO PATENT 10 (4 ): 552-67 ) and patients treated with blinatumomab (Zhao et al. (2021) Blood 137 (4 ): 471-484 ) were analyzed. These analyses profiled patient tumor samples and had a sufficient sample size in responder and non-responder groups to identify tumor¬ response correlates. In the CD19 CAR-T treatment cohort, 19 responders had durable (>1 year) complete responses (h. CR), and eight non-responders (h. NR) failed to respond and had no evidence of CD19 antigen loss. In the blinatumomab cohort, 19 patients responded, and 20 patients did not respond to blinatumomab engager therapy.

[0091] It was subsequently determined whether the m. PR and m. CR B-ALL clones mirrored the human patient tumors by selecting CAR-T response signature (CaRS) genes from both species and comparing responder and non-responder groups using a three-step strategy. Forty-one (7%) of human CaRS genes (266) and mouse CaRS genes (266) significantly overlapped (p=7.2x10-29), with Principal component analysis (PCA) distinguishing CAR-T therapy responders from non-responders in both species. Subsequent integrative analysis of differentially expressed genes in humans and mice ranked GPR65 as the top candidate gene linked with responders in both species. A heatmap showcasing shared genes within the CaRS confirmed that m. PR and m. CR B-ALL tumor cells parallel human patient tumor samples (Table 2 ).TABLE 2Gene expressionHuman Mouse Human Non- Mouse NonResponders Responders Responders Responders Gene (h. CR) (m. CR) (h. NR) (m. PR) GPR65 0.246 0. 913 -0.585 -0.913 GAA 0.296 0.911 -0.703 -0.911 DOCK9 0.308 0.912 -0.731 -0.912 IL2RA 0.239 0.911 -0.568 -0.911 IL27RA 0.264 0.902 -0.627 -0.902CITED2 0.252 0.897 -0.599 -0.897SJ0122WO PATENT PCYOX1L 0.258 0. 908 -0.613 -0.908 ALDH3B1 0.243 0.879 -0.578 -0.879 NEFH 0.282 0.841 -0.669 -0.841 APOE 0.260 0.752 -0.618 -0.752 M0RC2 -0.247 -0.853 0.586 0.853 RGS12 -0.245 -0.881 0.581 0.881 FADS3 -0.277 -0.852 0.657 0.852 CDK13 -0.253 -0.894 0.6 0.894 MEX3B -0.295 -0.887 0.701 0.887 ABCC1 -0.244 -0.894 0.579 0.894 ZNF428 -0.277 -0.89 0.657 0.89 RIOK1 -0.257 -0.899 0.61 0.899 UQCRFS1 -0.285 -0.897 0.676 0.897 GMDS -0.3 -0.908 0.713 0.908 CERK -0.244 -0.907 0.58 0.907 CHD7 -0.268 -0.902 0. 637 0.902 ZNF423 -0.306 -0.909 0.727 0.909 BPNT1 -0.314 -0.903 0.745 0.903 DAB2IP -0.272 -0.906 0.646 0.906 TAF1B -0.327 -0.907 0.776 0.907 MMP14 -0.242 -0.911 0.574 0.911 RBPMS -0.269 -0.908 0.638 0.908 STMN1 -0.329 -0.902 0.782 0.902 SOX4 -0.248 -0.909 0.589 0.909 ATP1B3 -0.388 -0.894 0.921 0.894 _ ACVR1 _ -0.35 _ _ -0.911 _ 0.83 0.911 _ NEURL1B -0.274 -0.91 0.651 0.91 RALA -0.277 -0.912 0.658 0.912 MYO10 -0.24 -0.911 0.569 0.911 TRIM27 -0.406 -0.905 0.965 0.905 RAG2 -0.249 -0.913 0.592 0.913 PIK3R3 -0.361 -0.91 0.857 0.91 IGF2BP3 -0.241 -0.913 0.572 0.913NT5DC2 -0.329 -0.912 0.782 0.912 downregulated.

[0092] Receiver operator characteristic (ROC) analysis using the shared genes within the CaRS indicated that the gene signatures derived from m. PR and m. CR B-ALL, together with h. CR and h. NR, stratified CD19 CAR-T therapy patients with 94% accuracy. Furthermore, consistent with the findings from Singh et al. ( (2020) Cancer Discov. 10 ( ): 552-67 ), downregulation of death receptor genes TNFRSF1B, CASP7, FADD, RIPK3, CASP8, RIPK1, TRADD, and BID was observed in m. PR tumors compared toSJ0122WO PATENT m. CR tumors, indicating that the impaired death receptor phenotype identified in human B-ALL tumors resistant to CAR-T cell therapy is conserved in the murine model.

[0093] To overcome the potential issues arising from small sample size and interpatient heterogeneity, a data-driven, network-based hidden driver inference algorithm (NetBID2 ) (Dong et al. (2023) Nat. Commun. 14 (1 ): 2581; Du et al. (2018 ) Nature 558 (7708 ): 141-5) was used to analyze the pre-treatment tumor RNA-seq dataset. First, the SJARACNe algorithm (Khatamian et al. (2019) Bioinformatics 35 (12): 2165-6) was used to reverse-engineer a gene-gene interactome specific to B-ALL from RNA-seq profiles of 1988 B-ALL patients. Next, the B-ALL specific interactome was superimposed on the bulk RNA- seq profiles of pre-treated B-ALL tumors in the CAR-T clinical study and the transcriptomic profiles were transformed into activity profiles of 1024 transcription factors (TFs) and 6349 signaling factors (SIGs ). As part of the B-ALL interactome, the GPR65 subnetwork (Table 3) composed of 50 regulon genes, including 30 positive and 20 negative targets.TABLE 3Positive Targets Negative targets ACSL4 LCP1 PPP2R5C ZNF618 VANGL2 PLP2 GALC EVI2B DGCR8 TMEM44 NKG7 ZBTB24 NXT2 EMX1 SCN11A CD1C CLEC4A CD86 PTPRF RHPN1 TLR1 TIMP1 RBM47 _ DMD MCF2L2 MS4A7 RNF13 HECW2 ZBED3 AP1B1 GPR18 MS4A4A ITGB2 PLEKHG4B PNPLA7 _ SLA AP1S2 EVI 2 A ’ S PATS2 GRAMDIB” C1orf162 IL2RG TLR7 CUX1 ZNF496PTPN22 P2RY10 LPXN CIAO3 SMARCA4

[0094] Functional enrichment highlighted the role of the GPR65 regulon in innate and adaptive immune responses. GSEA revealed that positive targets of GPR65 regulon were significantly enriched in responders and negative targets inSJ0122WO PATENT non-responders. GPR65 activity and expression were also significantly higher in tumors isolated from Responders (n==19) than in non-responders (n=8). Moreover, ROC analysis of GPR65 activity and expression demonstrates its predictive power for CAR-T therapy response in patients ( FIG. 1). In addition, similar upregulation of GPR65 expression and activity was observed in adult B-ALL patients responding to blinatumomab engager without the loss of CD19 expression (FIG. 2). These findings demonstrate that GPR65-dependent immunotherapy resistance extends to adult B-ALL and alternative immunotherapies. GPR65 expression was validated in the m. PR and m. CR B-ALL clones, with m. CR clones expressing significantly higher Gpr65 compared to m. PR clones (FIG. 3).Example 4: GPR65 KO tumors drive CAR-T resistance in vivo without reducing cognate antigen expression or CAR-T cell expansion

[0095] To further investigate the role of GPR65 in tumor responses to CAR-T cell therapy, Gpr65 was knocked out in the m. CR hCD19* B-ALL cell line. Four single guide RNAs (sgRNAs) were used to delete GPR65 exon 2 (GPR65 KOI). Alternatively, a single sgRNA was used to generate three clones (GPR65 K02, GPR65 KO3, and GPR65 KO 4, GPR65 KO pool) with insertions or deletions disrupting translation. GPR65 KOI was also transduced with GPR65-IRES-MSCV retrovirus to generate a clone with GPR65 overexpression (GPR65 KOI OE). Effective knockout and overexpression of GPR65 was confirmed through analysis of GPR65 mRNA expression, CREB phosphorylation and cAMP production.

[0096] GPR65 KO tumor responses to anti-CD19 CAR-T cell therapy were assessed. No difference in in vitro expansion was observed between m. CR and GPR65 KO cells. Further, hCD19SJ0122WO PATENT antigen expression on m. CR and GPR65 KO cells displayed no difference at both, basal level and 7 days after tumor injection. In the in vivo model, m. CR and GPR65 KO tumors showed similar growth rates, with similar tumor burden at the time of CAR-T cell treatment. However, unlike the complete regression seen with m. CR tumors, GPR65 KO tumors showed no response to CAR-T cell treatment or survival advantage relative to untreated mice. Similar results were observed after transferring the GPR65 KO pool and CAR-T cell treatment. In contrast, overexpression of GPR65 in GPR65 KO tumors rescued responsiveness to CAR-T cell treatment in vivo. These data indicated that GPR65 deficiency drives antigenindependent B-ALL tumor refractoriness to CAR-T cell therapy in vivo.

[0097] One established cause of CAR-T cell therapy failure is the inability of CAR-T cells to expand and persist in vivo (Maus & June (2016) Clin. Cancer Res. 22 (8): 1875-84 ). Therefore, tumor and CAR-T cell numbers were quantified in mice with no tumor, or m. CR or GPR65 KO tumors four days after CAR-T treatment. Mice with GPR65 KO tumors had a higher tumor burden in all organs examined than mice with m. CR tumors, and this was associated with increased tumor-associated morbidities and diminished survival. In addition, downregulation of 9 (RIPK1, FAS, TNFRSF9, RIPK3, TRADD, TNFRSF1B, TNFRSF1A, CASP7, and TNFRSF26) out of 15 detected death receptor genes was observed in GPR65 KO tumors compared to m. CR tumors. CAR-T cells in mice bearing GPR65 KO tumors were also present in greater or equal numbers compared with those in mice with m. CR tumors. These results indicated that the failure of GPR65 KO tumors to respond to treatment was not due to diminished CAR-T cell survival or expansion in tumor bearing-organs.SJ0122WO PATENTExample 5: Preserved effector function in CAR-T cells f om mice with GPR65 KO tumors

[0098] To evaluate exhaustion and effector function (Delgoffe et al. (2021 ) Cancer Cell 39 (7 ): 885-8 ) in the tumorinfiltrating CAR-T cells ex vivo (post re-stimulation with PMA and ionomycin), RNA-sequencing of isolated CAR-T cells from mice without tumors or bearing m. CR or GPR65 KO tumors was performed followed by differential expression and pathway analysis. Relative to tumor-free mice, CAR-T cells from mice with either m. CR or GPR65 KO tumors upregulated genes associated with exhaustion. However, no significant difference in the expression of these genes was seen in CAR-T from mice with the two tumor types (Table 4 ).TABLE 4Log2Fold Changem. CR vs. PGR65 KO vs. GPR65 KO vs. Gene No Tumor No Tumor m. CR IFNG 5.998957 5.237004 -0.76195 PRF1 4.059253 3.960101 -0.09915 GZMB -0.75831 -1.59716 -0.83884 GZMA -0.1879 -1.59451 -1.40661 TNF 0. 423421 -0.11867 -0.54209 CD274 -0.56066 -1.20073 -0.64007 ENTPD1 0.430671 0.100468 -0.3302 SLAMF6 1.380566 1.600482 0.219916 LAG3 1.149572 1.013626 -0.13595 PDCD1IG2 1.674292 2.16088 0.486588 HAVCR2 4.431774 3.905127 -0.52665 PDCD1 3.555331 4. 089245 0.533914 CX3CR1 4.399369 3.345791 -1.05358 TOX 4.972248 5.489268 0.517021 TCF7 -1.73554 -1.8113 -0.07576 TBX21 0.97929 0.348846 -0.63044 SELL -1.51519 -2.47969 -0.9645MKI67 0.30588 0.267499 -0.03838

[0099] GSEA analysis revealed enrichment of effector and CXCR5+signatures in CAR-T cells from GPR65 KO tumors,SJ0122WO PATENT previously described to be generated because of antigen persistence (Im et al. (2016) Nature 537 (7620): 417-21). Consistently, surface expression of the inhibitory receptors PD-1 and LAG3 were elevated, though they did not differ in CAR-T cells from the m. CR and GPR65 KO groups. These cells likewise showed simi lar effector and memory cell proportions based on CD44 and CD62L staining.

[0100] Relative to CAR-T cells from mice with m. CR tumors, CAR-T cells from GPR65 KO tumors showed equal or increased expression of IFNy, TNFa, IL-2, and Granzyme B, indicating preservation of functional potential despite their lack of therapeutic efficacy (Table 5). Similarly, CAR-T cells from GPR65 KO tumors showed elevated expression of activation markers CD25 and CD69 consistent with the increased tumor burden and antigen exposure.TABLE 5% of Cells Expressing Marker Cells IFNy TN Fa IL-2 Granzyme B No tumor - host CD8+2.4 22. 5 0.8 2.7 No tumor - CAR-T 40.1 85. 4 2.8 50.3 m. CR tumor - CAR-T 51.3 55. 6 7.9 56.2GPR65 KO tumor - CAR-T 66.3 93. 5 34.5 79. 1

[0101] To determine whether the CAR-T retained anti-tumor activity against m. PR, m. CR or GPR65 KO tumors in vi tro, coculture killing and repetitive stimulation assays were performed followed by measurement of surface expression of activation markers (CD25, CD69), terminal differentiation marker (KLRG1), and inhibitory markers (PD-1, TIM3, LAG3) by flow cytometry and secreted cytokines (IFNy, TNFa, GZMB) by ELISA. No differences were observed in in vitro antitumor activity of CAR-T cells against these different tumors. Subsequently, transferred CAR-T cells were isolated four days after treatment from m. CR or GPR65 KO tumor-bearing mice.SJ0122WO PATENT These T cells were then re-transferred into new mice with established m. CR tumors. Due to the limited numbers of isolated CAR-T cells, a reduced number (one fifth) of therapeutic cells was administered in these secondary transfers. An additional control group received the same number of fresh, in vitro-activated CAR-T cells. All groups of CAR-T cells equivalently reduced tumor burden and increased survival of the m. CR tumor-bearing recipients. Although all mice experienced relapse, likely due to decreased transferred CAR-T cell numbers, there was no significant difference in tumor burden or survival. To confirm the CAR T cells from GPR65 KO grafted mice retained functionality after treatment, a rechallenge experiment was performed in mice receiving m. CR tumors. This demonstrated preserved function of CAR T cells after tumor rechallenge.

[0102] The above results showed that CAR-T cells from GPR65 KO and m. CR tumors retained effector functionality despite their inability to clear the GPR65 KO tumors, and indicated that GPR65 KO tumor cells did not confer CAR-T resistance through down-regulation of CD19 expression or impairment of CAR-T cell expansion and function. Further, all tumors (m. PR, m. CR and GPR65 KO) were equally susceptible to CAR-T killing in vitro. This indicated that alterations in the TME may have mediated CAR-T resistance to GPR65 KO tumors, such that tumor cell rewiring of tumor-TME interactions leads to the local ineffectiveness of CAR-T cells.Example 6: scRNA-seq characterization of mouse CR and GPR65 KO tumors and THE

[0103] Single-cell RNA sequencing (scRNA-seq) was used to resolve potential tumor and TME mechanisms of CAR-T resistance. GPR65 KO or m. CR tumors (RFP+) and host immuneSJ0122WO PATENT cells (CD 5.2+Thyl. l" REP-) were isolated from the spleen of tumor-bearing mice prior to CAR-T cell treatment (day 7) and four days after treatment (day 11) and analyzed. InferCNV (Venteicher et al. (2017) Science 355 ( 6332): eaai8478; Tirosh et al. (2016) Science 352 (6282): 189-96; Patel et al. (2014 ) Science 344(6190):1396-401; Puram et al. (2017) Cell 171 (7): 1611-24) analysis was performed to annotate tumor cells and tumor cells were separated from the rest of the TME. Clustering of tumor cells revealed that GPR65 KO and m. CR tumors were distinct with further divergence after CAR-T cell treatment. Differential expression analysis of the tumors demonstrated several differences. GPR65 KO tumors expressed increased transcription factors of the AP-1 family (Fos and Fosb) and the anti~apoptotic marker Bcl2, known to promote tumor cell survival (Adams & Cory (2007 ) Oncogene 26 (9): 1324- 37; Milde-Langosch (2005) Eur. J. Cancer 41(16):2449-61; Kelly & Strasser (2011) Cell Death Differ. 18(9):1414-24; Huang et al. (2024) Cancer Cell 42 (4 ): 552-67 ). Cell surface genes Itga6 and Cd84, described to confer adhesion-mediated drug resistance and an immunosuppressive microenvironment (Gang et al. (2020) Blood 136 (2 ): 210-223; Lewinsky et al. (2021) JCI Insight 6 (4): el41683), were also upregulated by GPR65 KO tumors. GSEA analysis revealed that GPR65 KO tumors were enriched in gene signatures associated with G2M checkpoints, E2F targets, and MYC targets, also associated with proliferation and survival (Hanahan et al. (2011) Cell 144 (5) 1646-74 ). In addition, GPR65 KO tumors exhibited downregulation of genes associated with interferon and inflammatory responses, and this has been linked to immune evasion in solid malignancies (Larson et al. (2022) Nature 604(7906):563-70).SJ0122WO PATENT

[0104] Consistent with scRNA-seq analysis, BCL2 protein was increased in GPR65 KO tumors from CAR-T cell treated mice by flow cytometry and MYC was elevated at the protein level but not at mRNA. Despite these differences, GPR65 KO tumor cells remained equally susceptible to CAR-T cell mediated lysis in vitro as m. CR tumors, even at low ef f ector-to-target ratios, indicating that while scRNA-seq demonstrated non-identity with m. CR tumors, GPR65 KO tumors are not intrinsically resistant to CAR-T cell-mediated lysis.Example 7: Macrophage expansion and Ml to M2 switch is seen in humans and mice and confers CAJR-T resistance

[0105] To explore TME alterations, scRNA-seq data was examined for the composition of host immune cell populations. Differences in macrophage populations were particularly pronounced, with a 2.96-fold increase in CAR-T treated mice bearing GPR65 KO compared with m. CR tumors. This increase was confirmed by quantitative flow cytometry. Macrophages can potentially generate an immunosuppressive TME (DeNardo & Ruffell (2019) Nat. Rev. Immunol. 19 ( 6): 369-82 ), and this was further explored.

[0106] To validate these findings, F4 / 80+ macrophage before and after CAR-T treatment were enriched followed by scRNA-seq. An adaptive response was observed with expansion of the macrophage population induced by CAR-T treatment in both m. CR and GPR65 KO tumor engrafted mice. The GPR65 KO group experienced significantly higher macrophage burden. scRNA-seq revealed similar observation and further highlighted the presence of heterogeneity in macrophages from the TME of these tumors. In addition, macrophages from m. CR-engrafted mice expressed inflammatory cytokines such as Tnf and Illb, which were retained after CAR-T treatment, whereas macrophages fromSJ0122WO PATENT GPR65 KO engrafted mice expressed Chil3, a known marker of anti-inflammatory macrophages (Boutilier & Elsawa (2021 ) Int. J. Mol. Sci. 22 (13): 6995). To unbiasedly explore the macrophage state, GSEA analysis of macrophages was performed using Tnf-, If ng (Ml) - or 114 (M2) -stimulated macrophage gene signatures. Macrophages from m. CR-engrafted tumors displayed significant enrichment of an Ml-like phenotype, while macrophages from GPR65 KO engrafted tumors were enriched for an M2-like phenotype. To correlate these findings in patients undergoing CD19 CAR-T cell therapy, scRNA-seq profiles of unsorted bone marrow from three h. CR and two CD19+ relapse patients were analyzed (Anderson et al. (2023) Nat. Med.29 (7 ): 1700-9). A subset of human bone barrow macrophages were prepared using CD14 and CD68 and GSEA analysis was performed. Consistently, macrophages from h. CR patients displayed an Ml- like phenotype while macrophages from CD19+relapse patients' bone marrow were enriched for an M2-like phenotype. Tumor- associated macrophages are known to confer a M2 polarization state resulting in an immunosuppressive microenvironment (Mantovani et al. (2022 ) Trends Immunology 23 ( 11 ): 549-55; Solinas et al. (2009) J. Leukoc. Biol. 86 (5): 1065-73; Petty & Yang (2019) Cells 8 (12): 1526; Sun et al. (2022) J. Immunother. Cancer 10 (4 ): e003975). The results indicate that the expanded, M2-polarized macrophages may be a common mechanism of primary resistance to CAR-T cell therapy in both mouse and human tumors.

[0107] To determine the influence of the expanded and polarized macrophages present in GPR65 KO mice in vivo, macrophages were depleted with anti-CSFIR (CD115) antibody prior to CAR-T therapy. Macrophage but not tumor depletion was confirmed in spleen and bone marrow prior to CAR-T treatment. As expected, mice bearing GPR65 KO tumors that received theSJ0122WO PATENT isotype control antibody did not respond to CAR-T cell therapy and similarly treated m. CR mice attained complete remission. Macrophage-depleted mice with either m. CR or GPR65 KO tumors, however, responded equivalently and fully to CAR-T cell therapy; complete remission with no tumor relapse was seen, even after the depletion regimen was ended. Therefore, the expanded, M2-polarized macrophage pool in the GPR65 KO TME was necessary for CAR-T cell therapy resistance; eliminating macrophages restored CAR-T cell tumoricidal activity.Example 8: GPR65 KO derived VEGFA fosters CAR-T cell therapy resistance

[0108] To probe for the mechanism by which GPR65 KO tumors modify the host macrophage pool, cell-cell communication analysis was performed using the LIANA ensemble ligand-receptor database (Dimitrov et al. (2022) Nat. Commun.13 (1): 3224 ) and CellChat (Jin et al. (2021) Nat. Commun.12 (1): 1088). scRNA-seq data from CAR-T cell treated splenocytes was interrogated for ligand-receptor pairs in tumors, macrophages, and monocytes. GPR65 KO tumors displayed increased communications with host macrophages and monocytes compared with m. CR tumors. Although multiple ligand receptor channels were identified linking GPR65 KO tumors but absent in m. CR tumors, a particular gain was observed for Vegfa communication and expression.

[0109] Consistent with cell-cell communication results, in vivo Vegfa activity (defined using the NetBID2 algorithm (Dong et al. (2023) Nat. Commun. 14(1):2581) and Vegfa regulon derived from scRNA-seq of m. CR tumors using SJARACNe (Khatamian et al. (2019) Bioinformatics 35 ( 12): 2165-6) ) and expression were increased in GPR65 KO relative to m. CR tumors. Further, mice receiving GPR65 KO tumors had substantiallySJ0122WO PATENT increased serum concentrations of Vegfa compared to mice with m. CR tumors after CAR-T cell treatment. In vitro, increased Vegfa expression in GPR65 KO tumors was confirmed by western blot of cultured cell lysates.

[0110] To determine if Vegfa derived from GPR65 KO tumors contributes to CAR-T cell therapy resistance, VEGFA KO cell lines were generated from both m. CR and GPR65 KO cells. m. CR, VEGFA KO, GPR65 KO, or GPR65 VEGFA double knockout (DKO) tumors were engrafted into immunocompetent mice, followed by treatment with CAR-T cells. Mice receiving m. CR and VEGFA KO tumors showed complete responses to CAR-T cell therapy (FIG.4 ). As expected, CAR-T cells were unable to control GPR65 KO tumor cells. Although, the deletion of tumor VEGFA in DKO tumors restored CAR-T susceptibility and extended survival, the response was incomplete; after an initial remission, DKO tumors relapsed. Consistently, DKO tumors had fewer tumor cells and macrophage numbers compared with GPR65 KO tumors 4 days after treatment. Together, these results indicate a contribution of increased Vegfa expression from GPR65 KO tumors in CAR-T cell therapy resistance.Example 9: Anti -VEGFA sensitizes GPR65 KO tumors to CAR-T cell therapy

[0111] Anti-VEGFA antibodies are clinically available and widely used to treat several solid tumors (Hurwitz et al. (2006) Semin. Oncol. 33 (5 Suppl 10): S26-34; Hurwitz et al. (2004) N. Engl. J. Med. 350 (23): 2335-42; Lee et al. (2020) Exp. Mol. Med. 52 (9): 1475-85; Yi et al. (2019) Mol. Cancer 18 (1 ): 60). Considering that VEGFA deficiency in DKO tumors bestowed CAR-T cell susceptibility, it was further examined whether pharmacological inhibition of VEGFA would equivalently rescue CAR-T sensitivity in GPR65 KO tumors. Indeed, theSJ0122WO PATENT administration of CAR-T cells and anti-VEGFA antibody significantly prolonged survival and reduced GPR65 KO tumor burden compared with mice receiving isotype control (no anti- VEGFA) (FIG. 5). Mice bearing m. CR tumors treated with anti-VEGFA remained responsive to CAR-T therapy. Similar to the DKO tumors, the response of GPR65 KO tumors was incomplete, with mice ultimately succumbing to tumor. This indicates that anti- VEGFA blockade in combination with CAR-T cells is an effective strategy to diminish GPR65-associated resistance to CAR-T cell therapy.Example 10: GPR65 KO upregulates VEGFA in tumor cells via FOXO1 network

[0001] To unbiasedly understand how GPR65 signaling may induce tumor Vegfa expression, a CAR-T cell treatment-specific tumor cell interactome was constructed from scRNA-seq data of m. CR tumors using SJARACNe (Khatamian et al. (2019) Bioinformatics 35(12):2165-6)(52),, and differential activity and expression analysis was performed using NetBID2. (Dong et al. (2023) Nat. Commun. 14(1):2581). This identified Foxol among the top three transcription factors upregulated in GPR65 KO compared to m. CR tumor cells. Consistently, increased FOXO1 activity, though not mRNA expression, was identified in GPR65 KO cells. A heatmap of Foxol target genes inferred by SJARACNe further highlighted the increased Foxol activity in GPR65 KO tumors. Elevated FOXO1 was confirmed in GPR65 KO cells by immunoblot. Increased FOXO1 activity in GPR65 KO tumors may be associated with increased levels of VEGFA, as FOXO1 has been shown to induce VEGFA expression in some systems (Jeon et al. (2018 ) J. Pathol. 245 (3): 258-64 ). To confirm the role of FOXO1 in VEGFA expression, FOXO1 KO clones of m. CR and GPR65 KO tumors were generated and VEGFA levels were measuredSJ0122WO PATENT in culture lysates. VEGFA was, as expected, elevated in GPR65 KO compared to m. CR tumor cells, and was significantly diminished after FOXO1 KO. These findings support a role for FOXO1 in the elevated production of VEGFA by GPR65 KO cells.

Claims

SJ0122WO PATENT WHAT IS CLAIMED IS:

1. A method of treating cancer, comprising determining an expression level of GPR65 (G-protein coupled receptor 65) in a biological sample obtained from a subject having, suspected of having, or at risk of having a cancer,identifying the subject as likely being responsive to an anti-CD19 CAR-expressing cell therapy if the expression level of GPR65 in the sample is increased or equivalent to a reference expression level of GPR65; andadministering a therapeutically effective amount of the anti-CD19 CAR-expressing cell therapy to the subject.The method of claim 1, wherein the anti-CD19 CAR- expressing cell therapy is an anti-CD19 CAR T-cell therapy.

3. The method of claim 1, further comprising determining an expression level of one or more GAA, DOCK8, IL2RA, IL27RA, CITED2, PCYOX1L, ALDH3B1, NEFH, APOE, MORC2, RGS12, FADS3, CDK13, MEX3B, ABCC1, ZNF428, RIOK1, UQCRFS1, GMDS, CERK, CHD7, ZNF423, BPNT1, DAB2IP, TAF1B, MMP14, RBPMS, STMN1, SOX4, ATP1B3, ACVR1, NEURL1B, RALA, MYO10, TRIM27, RAG2, PIK3R3, IGF2BP3, and / or NT5DC2 in the biological sample.

4. A method of identifying a subject who is likely to respond to or benefit from an anti-CD19 CAR-expressing cell therapy, comprisingdetermining an expression level of GPR65 (G-protein coupled receptor 65) in a biological sample obtained from the patient,comparing the expression level of GPR65 in the sample with a reference level, andSJ0122WO PATENT identifying the subject as being likely to respond to or benefit from treatment with the anti~CD19 CAR-expressing cell therapy based on the expression level of GPR65 in the biological sample relative to the reference level.

5. The method of claim 4, wherein an increase or equivalent expression level of GPR65 in the biological sample relative to the reference level identifies the subject as being likely to respond to or benefit from treatment with the anti-CD19 CAR-expressing cell therapy.

6. The method of claim 4, further comprising determining an expression level of one or more GAA, DOCK8, IL2RA, IL27RA, CITED2, PCYOX1L, ALDH3B1, NEFH, APOE, MORC2, RGS12, FADS3, CDK13, MEX3B, ABCC1, ZNF428, RIOK1, UQCRFS1, GMDS, CERK, CHD7, ZNF423, BPNT1, DAB2IP, TAF1B, MMP14, RBPMS, STMN1, SOX4, ATP1B3, ACVR1, NEURL1B, RALA, MYO10, TRIM27, RAG2, PIK3R3, IGF2BP3, and / or NT5DC2 in the biological sample.

7. A method of selecting an anti-cancer therapy comprising an anti-CD19 CAR-expressing cell therapy in combination with a GPR65 (G-protein coupled receptor 65) agonist and / or VEGF (vascular endothelial growth factor) antagonist for a subject having, suspected of having, or at risk of having a cancer, comprisingdetermining an expression level of GPR65 in a biological sample obtained from the subject,comparing the expression level of GPR65 in the biological sample with a reference level andselecting an anti-cancer therapy comprising an anti-CD19 CAR-expressing cell therapy in combination with a GPR65 agonist and / or VEGF (vascular endothelial growth factor)SJ0122WO PATENT antagonist for the subject based on the expression level of GPR65 in the biological sample relative to the reference level.

8. The method of claim 7, wherein an increase or equivalent expression level of GPR65 in the biological sample relative to the reference level identifies the subject as being likely to respond to or benefit from treatment with the anti-cancer therapy.

9. A method of increasing the therapeutic efficacy of an anti-CD19 CAR-expressing cell therapy, comprising increasing expression and / or function of GPR65 (G-protein coupled receptor 65) and / or decreasing expression and / or function of VEGF (vascular endothelial growth factor) in a subject receiving an anti-CD19 CAR-expressing cell therapy, thereby increasing the therapeutic efficacy of an anti-CD19 CAR-expressing cell therapy.

10. The method of claim 9, wherein the subject has a cancer that is refractory to anti-CD19 CAR-expressing cell therapy.

11. The method of claim 10, wherein a tumor cell of the subject has a lower or decreased expression level of GPR65 relative to a reference level of GPR65 expression.

12. The method of claim 9, wherein the subject has been identified as being unlikely to respond to or benefit from treatment with the anti-CD19 CAR-expressing cell therapy.SJ0122WO PATENT 13. The method of claim 9, wherein the subject has a cancer that has relapsed after treatment with an anti-CD19 CAR-expressing cell therapy.

14. The method of claim 9, wherein the anti-CD19 CAR- expressing cell therapy is an anti-CD19 CAR T-cell therapy.

Images