Compositions and methods for treating diabetes

Abstract

Provided herein are compositions and methods for treating diabetes (e.g., Type I diabetes and type II diabetes). In particular, provided herein are glucose sensing and insulin secreting cells and uses thereof in the treatment of diabetes.

Description

[0001] UAZ-44096.601

[0002] COMPOSITIONS AND METHODS FOR TREATING DIABETES

[0003] STATEMENT OF RELATED APPLICATIONS

[0004] This application claims priority to provisional application 63 / 754,077, filed February 5, 2025, which is herein incorporated by reference in its entirety.

[0005] SEQUENCE LISTING

[0006] The text of the computer readable sequence listing filed herewith, titled “UAZ-44096-601_SQL.xml”, created February 3, 2026, having a file size of 10,279 bytes, is hereby incorporated by reference in its entirety.

[0007] FIELD

[0008] Provided herein are compositions and methods for treating diabetes (e.g., Type I diabetes and type II diabetes). In particular, provided herein are glucose sensing and insulin secreting cells and uses thereof in the treatment of diabetes.

[0009] BACKGROUND

[0010] Diabetes Mellitus (DM) is a group of common metabolic disorders associated with hyperglycemia. Based on the recent statistics from CDC, 37.3 million Americans (11.3% of the US population) have DM. Moreover, 96 million Americans are prediabetic. Similarly, several pets suffer from diabetes and insulin is prescribed to treat the diabetes.

[0011] Unfortunately, there is no curative treatment for DM in humans or pets, and the chronic management cost, in humans, for 2017 was $327 billion in direct medical costs and $90 billion in reduced productivity (American Diabetes A. Economic Costs of Diabetes in the U. S. in 2017. Diabetes Care. 2018;41(5):917-28. Epub 2018 / 03 / 24. doi: 10.2337 / dcil8-0007). The major cause of pathological manifestations of DM is hyperglycemia, and insulin therapy is required at some point for both Type 1 and Type 2 DM. Thus, there is a huge population of patients with DM who are dependent on insulin to control their blood sugar. In recent years, there has been an astronomical increase in the cost of insulin (Rajkumar SV. The High Cost of Insulin in the United States: An Urgent Call to Action. Mayo Clin Proc. 2020:95(l):22-8. Epub 2020 / 01 / 07. doi: 10.1016 / j.mayocp.2019.11.013; Conner F, PriesterUAZ-44096.601

[0012] provenance, potential for teratogenicity (especially in instances of immunosuppression), and cost of goods for a marginal biomass of cells. Even if successful, such therapeutic modalities have cost, scale, and safety limitations. These scalability limitations and safety risks associated with stem cell derived material limit clinical use to populations with a high-risk threshold (e.g., type 1 diabetics with frequent hypoglycemic events). A technology that can create optionality with respect to source cellular material (e.g., alternatives to allogeneic -cells, or stem cell derived 0-cells) has potential to enable different cell source material. To increase insulin yield per unit of cell biomass can be utilized in next generation modalities necessary for expanded use of cell therapy in large populations of diabetics. Currently used cell materials need to improve insulin yield by orders of magnitude to be commercially viable. New technologies like those described herein aid in bringing scalable formats of cell therapy to larger populations like the broader type 1 and type II population or companion animals with diabetes.

[0013] Accordingly, in some embodiments, provided herein is a composition comprising: a) a first nucleic acid construct comprising a gene encoding a proinsulin gene comprising a plurality of furin cleavage sites operably linked to a first promoter; and b) a second nucleic acid comprising a furin gene operably linked to a second promoter under the control of a glucose regulatory element.

[0014] The present disclosure is not limited to a particular proinsulin gene. In some embodiments, the proinsulin gene is human proinsulin (e.g., encoding a proinsulin polypeptide with a His to Asp mutation at position BIO). In some embodiments, the proinsulin gene comprises A158G and T257G mutations. An exemplary proinsulin gene has the nucleic acid sequence of SEQ ID NO: 1. The present disclosure is not limited to human proinsulin. In some embodiments, the proinsulin gene is a proinsulin gene from another animal (e.g., comprising a plurality of furin cleavage sites).

[0015] The present disclosure is further not limited to a particular glucose regulatory element. For example, in some embodiments, the glucose regulatory element comprises a concatemer of three or more glucose response elements. An exemplary glucose response element has the nucleic acid sequence of SEQ ID NO: 3.

[0016] Any number of first and second promoters are specifically contemplated by the present disclosure. Both constitutive and inducible promoters find use in the compositions and methods described herein. The first and second promoters can be the same or different. Examples include but are not limited to embodiments where the second promoter is aUAZ-44096.601

[0017] thymidine kinase minimal promoter (e.g., having the nucleic acid sequence of SEQ ID NOs: 4 or 5) and the embodiments where the first promoter is a cytomegalovirus (CMV) promoter In some embodiments, the first and / or second nucleic acid constructs are on one or more vectors.

[0018] Also provided is a cell comprising the composition of any one of the preceding claims. The cell can be in vitro, ex vivo, or in vivo. In some embodiments, the cell is a somatic cell (e.g., an autologous or allogenic cell). In some embodiments, the cell secretes insulin in response to increases in blood glucose concentrations.

[0019] Further provided is a pharmaceutical composition comprising a cell described herein. In some embodiments, the composition is a hydrogel (e.g., Matrigel and / or a PGLA-PEG-PGLA Laponite hydrogel).

[0020] Additionally provided is a method of producing insulin in a subject, comprising: transplanting a cell or pharmaceutical composition described herein into a subject in need thereof. The present disclosure is not limited to a particular location in the subject for transplanting the cell or pharmaceutical composition. Examples include but are not limited to subcutaneously or in the omentum. In some embodiments, the subject has Type I diabetes or Type II diabetes. The present disclosure is not limited to particular subjects. Examples include but are not limited to humans and non-human mammals (e.g., companion animals).

[0021] Other embodiments provide the use of a cell or pharmaceutical composition described herein 1 to treat Type I diabetes or Type II diabetes in a subject.

[0022] Additional embodiments are described herein.

[0023] DESCRIPTION OF THE FIGURES

[0024] Fig. 1 shows exemplary constructs of embodiments of the present disclosure, la. lentiviral construct 1. Furin- modified Proinsulin, lb. Human proinsulin with furin modified cleavage sites. 1c. Human proinsulin with furin modified cleavage sites and luciferase expression.

[0025] Fig. 2 shows exemplary constructs of embodiments of the present disclosure. 2a. lentiviral construct 2. GIRE-hFurin 2b. GIRE with TKTSC_5’UTR promoter 2c. GIRE with TKTSC_+8 Promoter.

[0026] Fig. 3 shows expression (luciferase reporter) from the GIRE promoter construct in response to glucose in rat (3a) and human fibroblast (3b) cells.UAZ-44096.601

[0027] Fig. 4 shows expression of GIRE-hFurin and Furin-modified Proinsulin vectors in eukaryotic cells. Human furin mRNA expression in rat fibroblasts. 4a. Human furin protein expression in human fibroblast cells. 4b. Modified pro-insulin expression in rat fibroblast.

[0028] DEFINITIONS

[0029] To facilitate an understanding of the present technology, a number of terms and phrases are defined below. Additional definitions are set forth throughout the detailed description.

[0030] Throughout the specification and claims, the following terms take the meanings explicitly associated herein, unless the context clearly dictates otherwise. The phrase “in one embodiment” as used herein does not necessarily refer to the same embodiment, though it may. Furthermore, the phrase “in another embodiment” as used herein does not necessarily refer to a different embodiment, although it may. Thus, as described below, various embodiments of the invention may be readily combined, without departing from the scope or spirit of the invention.

[0031] In addition, as used herein, the term “or” is an inclusive “or” operator and is equivalent to the term “and / or” unless the context clearly dictates otherwise. The term “based on” is not exclusive and allows for being based on additional factors not described, unless the context clearly dictates otherwise. In addition, throughout the specification, the meaning of “a”, “an”, and “the” include plural references. The meaning of “in” includes “in” and “on.” As used herein, the term “treatment” is defined as the application or administration of a therapeutic agent described herein (e.g., composition described herein) to a patient, or application or administration of the therapeutic agent to an isolated tissue or cell line from a patient, who has a disease, a symptom of disease or a predisposition toward a disease, with the purpose to cure, heal, alleviate, relieve, alter, remedy, ameliorate, improve or affect the disease, the symptoms of disease, or the predisposition toward disease.

[0032] The term “administration” and variants thereof (e.g., “administering” a composition) in reference to cells or a compound means providing the cells or compound or a prodrug of the compound to the individual in need of treatment or prophylaxis. When cells or a compound of the technology or a prodrug thereof is provided in combination with one or more other active agents, “administration" and its variants are each understood to include provision of the compound or prodrug and other agents at the same time or at different times. When the agents of a combination are administered at the same time, they can beUAZ-44096.601

[0033] administered together in a single composition, or they can be administered separately. As used herein, the term “composition” is intended to encompass a product comprising the specified ingredients in the specified amounts, as well as any product that results, directly or indirectly, from combining the specified ingredients in the specified amounts.

[0034] By “pharmaceutically acceptable” is meant that the ingredients of the pharmaceutical composition are compatible with each other and not deleterious to the recipient thereof.

[0035] The term “subject” as used herein refers to an animal, preferably a mammal, most preferably a human, who has been the object of treatment, observation, or experiment.

[0036] The term “effective amount” as used herein means that amount of an agent (e.g., composition described herein) that elicits the biological or medicinal response in a cell, tissue, organ, system, animal, or human that is being sought by a researcher, veterinarian, medical doctor, or other clinician. In some embodiments, the effective amount is a “therapeutically effective amount” for the alleviation of the symptoms of the disease or condition being treated. In some embodiments, the effective amount is a “prophylactically effective amount” for prophylaxis of the symptoms of the disease or condition being prevented.

[0037] A cell is said to be “genetically altered” when a polynucleotide has been transferred into the cell by any suitable means of artificial manipulation, or where the cell is a progeny of the originally altered cell that has inherited the polynucleotide. The polynucleotide will often comprise a sequence encoding a protein of interest, which enables the cell to express the protein at an elevated level. The genetic alteration is said to be “inheritable” if progeny of the altered cell has the same alteration.

[0038] As used herein, the term “allogenic” as in an “allogenic cell” refers to a cell from an individual different than the subject receiving the cell but of the same species. For example, a human cell from individual one or from a cell line is allogenic to individual 2.

[0039] As used herein, the term “autologous” as in an “autologous cell” refers to a cell from the same individual receiving the cell. In some embodiments, autologous cells are isolated from a subject, engineered (e.g., with a construct(s) described herein) ex vivo, and implanted into the same individual.

[0040] DETAILED DESCRIPTION

[0041] Provided herein are compositions and methods for treating diabetes (e.g., Type I diabetes and type II diabetes). In particular, provided herein are glucose sensing and insulinUAZ-44096.601

[0042] secreting cells and uses thereof in the treatment of diabetes and methods of generating such cells.

[0043] Cell-therapy treatment for subjects with diabetes mellitus typically utilizes a P-cells or progenitor cell derive P-cells that can synthesize and secrete functionally active insulin in response to physiologically relevant changes in blood glucose concentrations.

[0044] Current approaches with primary P-cells or insulin-producing stem cell technologies have failed to overcome challenges surrounding the generation, delivery, and engraftment of durable cells with long-standing insulin secretion capabilities. The compositions and methods described herein create durable glucose-responsive insulin producing cells that are suitable for macro-encapsulation as an autologous or allogenic strategy for treating diabetes mellitus in humans and companion animals.

[0045] To generate surrogate P-cells that release insulin in response to physiological increases in blood glucose concentrations, a series of genetic modifications was utilized to transform non-P-cells into glucose-responsive, insulin- secreting cells. In experiments described herein, to create surrogate P-cells, expression system modalities were used to integrate a synthetic proinsulin gene and glucose-responsive Furin gene into somatic cells, which can be deployed in various systems. These transformed surrogate P-cells find use, for example, for cell therapy approaches in macro- or microencapsulation devices to treat subjects with diabetes mellitus.

[0046] To modify autologous and allogeneic somatic cells, two gene constructs were generated to elicit glucose responsive insulin releases. These constructs are exemplary, non limiting examples of constructs suitable for use in the compositions and methods of the present disclosure. Construct 1 contains human proinsulin that was engineered to be a substrate for the calcium-dependent endopeptidase Furin and His to Asp mutation at position BIO. The cytomegalovirus (CMV) promoter is used to drive proinsulin gene expression. Construct 2 contains three concatemerized glucose-inducible regulatory elements ahead of the thymidine kinase minimal promoter to regulate the expression of the human Furin gene. Both constructs deliver mammalian antibiotic enabled (puromycin or blasticidin) selection of a stable cell line that incorporates both vectors. The procedure to achieve a stable insulin producing cell population includes a series of transductions (or concurrent transductions) followed by antibiotic selection. In some embodiments, a single construct comprising both construct 1 and construct 2 is utilized (e.g., to improve efficiency and streamline surrogate P-cell production from autologous and allogenic cells).UAZ-44096.601

[0047] Accordingly, in some embodiments, provided herein is a composition comprising: a) a first nucleic acid construct comprising a gene encoding a proinsulin gene comprising a plurality of furin cleavage sites operably linked to a first promoter; and b) a second nucleic acid comprising a furin gene operably linked to a second promoter under the control of a glucose regulatory element.

[0048] The present disclosure is not limited to a particular proinsulin gene. In some embodiments, the proinsulin gene is human proinsulin (e.g., encoding a proinsulin polypeptide with a His to Asp mutation at position BIO). In some embodiments, the proinsulin gene comprises A158G and T257G mutations. An exemplary proinsulin gene has the nucleic acid sequence of SEQ ID NO:1.

[0049] In some embodiments, the insulin gene comprises one or more additional variations designed to altered the pharmacokinetics of insulin in vivo. Examples include but are not limited to, Insulin Glargine (A21Gly, B31Arg, B32Arg), Lispro (B28Lys, B29Pro), Aspart (B28Asp), and Glulisine (B3Lys, B29Glu).

[0050] The present disclosure is not limited to human proinsulin. In some embodiments, the proinsulin gene is a proinsulin gene from another animal (e.g., comprising a plurality of furin cleavage sites).

[0051] In some embodiments, additional mutations in the insulin gene that generate variant insulin peptides are contemplated. Mutations contemplated can include substitutions, additions, and deletions, or any combination thereof. In some embodiments, the mutation converts the mutated amino acid to another amino acid (e.g., glycine, serine, threonine, cysteine, valine, leucine, isoleucine, methionine, proline, phenylalanine, tyrosine, tryptophan, aspartic acid, glutamic acid, asparagines, glutamine, histidine, lysine, or arginine). In some embodiments, the mutation converts the mutated amino acid to a non-natural amino acid (e.g., selenomethionine) or an amino acid mimics (e.g., phosphomimics). The mutation can be a conservative mutation. For example, the mutation converts the mutated amino acid to amino acids that resemble the size, shape, charge, polarity, conformation, and / or rotamers of the mutated amino acids (e.g., cysteine / serine mutation, lysine / asparagine mutation, histidine / phenylalanine mutation). The mutation can cause a shift in reading frame and / or the creation of a premature stop codon.

[0052] In some embodiments, a variant proinsulin gene encodes an insulin peptide that is at least 80% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to wild type human insulin or variant thereof described herein.UAZ-44096.601

[0053] The present disclosure is further not limited to a particular glucose regulatory element. For example, in some embodiments, the glucose regulatory element comprises a concatemer of three or more glucose response elements. An exemplary glucose response element has the nucleic acid sequence of SEQ ID NO: 3. In some embodiments, the glucose response element is at least 80% (e.g., 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100%) identical to SEQ ID NO: 3.

[0054] Any number of first and second promoters are specifically contemplated by the present disclosure. Both constitutive and inducible promoters find use in the compositions and methods described herein. The first and second promoters can be the same or different. Examples include but are not limited to embodiments where the second promoter is a thymidine kinase minimal promoter (e.g., having the nucleic acid sequence of SEQ ID NOs: 4 or 5) and the embodiments where the first promoter is a cytomegalovirus (CMV) promoter In some embodiments, the first and / or second nucleic acid constructs are on one or more (e.g., two) vectors.

[0055] In some embodiments, vectors further include one or more antibiotic resistance genes to aid in selection.

[0056] In some embodiments, constructs and / or vectors further comprise the addition of the hPEST or CL1 domain in the hFurin gene to increase protein degradation and tighten the duration of insulin secretion responsiveness and reduce latency to insulin “shutoff” in vivo and a safety feature to limit off target toxicities of Furin activity.

[0057] Also provided is a cell comprising the composition of any one of the preceding claims. The cell can be in vitro, ex vivo, or in vivo. In some embodiments, the cell is a somatic cell (e.g., an autologous or allogenic cell). In some embodiments, the cell secretes insulin in response to increases in blood glucose concentrations.

[0058] Further provided is a pharmaceutical composition comprising a cell described herein. In some embodiments, the composition is a hydrogel (e.g., Matrigel and / or a PGLA-PEG-PGLA Laponite hydrogel).

[0059] Additional encapsulation methods are specifically contemplated, in some embodiments, cells or cell clusters are encapsulated for transplantation into a subject.

[0060] Encapsulation techniques are generally classified as microencapsulation, involving small spherical vehicles, and macroencapsulation, involving larger flat-sheet and hollow-fiber membranes (Uludag, H. et al. Technology of mammalian cell encapsulation. Adv Drug Deliv Rev. 2000; 42: 29-64, herein incorporated by reference in its entirety).UAZ-44096.601

[0061] Methods of preparing microcapsules include those disclosed by Lu M Z, et al.

[0062] Biotechnol Bioeng. 2000, 70: 479-83; Chang T M and Prakash S, Mol Biotechnol. 2001, 17: 249-60; and Lu M Z, et al., J. MicroencapsuL 2000, 17: 245-51.; herein incorporated by reference in their entireties. For example, microcapsules may be prepared by complexing modified collagen with a ter-polymer shell of 2-hydroxyethyl methylacrylate (HEMA), methacrylic acid (MAA) and methyl methacrylate (MMA), resulting in a capsule thickness of 2-5 pm. Such microcapsules can be further encapsulated with additional 2-5 pm ter-polymer shells in order to impart a negatively charged smooth surface and to minimize plasma protein absorption (Chia, S. M. et al. Multi-layered microcapsules for cell encapsulation Biomaterials. 2002 23: 849-56; herein incorporated by reference in its entirety). In some embodiments, microcapsules are based on alginate, a marine polysaccharide (Sambanis, Diabetes Technol. Ther. 2003, 5: 665-8; herein incorporated by reference in its entirety) or its derivatives. For example, microcapsules can be prepared by the polyelectrolyte complexation between the polyanions sodium alginate and sodium cellulose sulphate with the polycation poly(methylene-co-guanidine) hydrochloride in the presence of calcium chloride.

[0063] In some embodiments, cells are microencapsulated for transplantation into a subject (e.g., to prevent immune destruction of the cells). Microencapsulation of cells provides local protection of implanted / transplanted cells from immune attack (e.g., along with or without the use of systemic immune suppressive drugs). In some embodiments, cells and / or cell clusters are microencapsulated in a polymeric, hydrogel, or other suitable material, including but not limited to: poly(orthoesters), poly(anhydrides), poly(phosphoesters), poly(phosphazenes), polysaccharides, polyesters, poly(lactic acid), poly(L-lysine), poly(glycolic acid), poly(lactic-co-glycolic acid), poly(lactic acid-co-lysine), poly(lactic acid-graft-lysine), polyanhydrides, poly(fatty acid dimer), poly(fumaric acid), poly(sebacic acid), poly(carboxyphenoxy propane), poly(carboxyphenoxy hexane), poly(anhydride-co-imides), poly(amides), poly(ortho esters), poly(iminocarbonates), poly(urethanes), poly(organophasphazenes), poly(phosphates), poly(ethylene vinyl acetate), poly(caprolactone), poly(carbonates), poly(amino acids), poly(acrylates), polyacetals, poly(cyanoacrylates), poly (styrenes), poly(vinyl chloride), poly(vinyl fluoride), poly(vinyl imidazole), chlorosulfonated polyolefins, polyethylene oxide, polystyrene, polysaccharides, alginate, hydroxypropyl cellulose (HPC), N-isopropylacrylamide (NIP A), polyethylene glycol, polyvinyl alcohol (PVA), polyethylenimine, chitosan (CS), chitin, dextran sulfate, heparin, chondroitin sulfate, gelatin, etc., and their derivatives, co-polymers, and mixturesUAZ-44096.601

[0064] thereof. In some embodiments, cells are microencapsulated in an encapsulant comprising or consisting of alginate. Cells may be embedded in a material or within a particle (e.g., nanoparticle, microparticle, etc.) or other structure (e.g., matrix, nanotube, vesicle, globule, etc.). In some embodiments, microencapsulating structures are modified with immune-modulating or immunosuppressive compounds to reduce or prevent immune response to encapsulated cells. For example, pancreatic lineage cells are encapsulated within an encapsulant material (e.g., alginate hydrogel) that has been modified by attachment of an immune-modulating agent (e.g., the immune modulating chemokine, CXCL12 (also known as SDF-1). In some embodiments, such an immune modulating agent is a T-cell chemorepellent and / or a pro-survival factor.

[0065] In some embodiments, cells are macroencapsulated for transplantation into a subject. Macroencapsulation of cells, for example, within a permeable or semi-permeable chamber, provides local protection of implanted / transplanted cells from immune attack (e.g., along with or without the use of systemic immune suppressive drugs), prevents spread of cells to other tissues or areas of the body, and / or allows for efficient removal of cells. Suitable devices for macroencapsulation include those described in, for example, U. S. Pat. No.

[0066] 5,914,262; Uludag, et al., Advanced Drug Delivery Reviews, 2000, pp. 29-64, vol. 42, herein incorporated by reference in their entireties.

[0067] Other encapsulation (micro or macro) devices and methods may find use in embodiments described herein. For example, methods and devices described in U. S. Pub No.

[0068] 20130209421, U. S. Pat. No. 8,785,185, each of which are herein incorporated by reference in their entireties, are within the scope of embodiments described herein.

[0069] The compositions described herein find use in a variety of research, commercial, clinical, and therapeutic applications.

[0070] For example, in some embodiments, methods of producing insulin in a subject are provided. In some embodiments, the methods comprise transplanting a cell or pharmaceutical composition described herein into a subject in need thereof. In some embodiments, the cell is a somatic cell.

[0071] In some embodiments, the cell is an autologous or allogenic cell engineered to express the constructs described herein. In some embodiments, allogenic cells (e.g., species specific) comprise a disruption in the endogenous furin gene to increase responsiveness.

[0072] The present disclosure is not limited to a particular location in the subject for transplanting the cell or pharmaceutical composition. Cells may be implanted into anUAZ-44096.601

[0073] appropriate site in a recipient. Suitable implantation sites may include, for example, the liver, natural pancreas, renal subcapsular space, omentum, peritoneum, subserosal space, intestine, stomach, or a subcutaneous pocket.

[0074] In some embodiments, the subject has Type I diabetes or Type II diabetes.

[0075] The present disclosure is not limited to particular subjects. Examples include but are not limited to humans and non-human mammals (e.g., companion animals).

[0076] In some embodiments, the cells described herein find use in species specific insulin manufacturing in cell systems or bioreactors to lower cross reactivity within the target species. In some embodiments, the technology is used with alternative genetic modifying technologies (CRISPR; AAVs, or other gene targeting systems).

[0077] In some embodiments, the cells are used in companion animals with diabetes. No cell therapy application is available for pets and limited technology for diabetic treatment of companion animals is available yet people managing cat or dog diabetes spend hundreds of dollars per month on insulin and glucose sensing equipment. For dogs, Vetsulin is a very popular choice and monthly costs ranges from 50-200$ / month. However, owners must administer insulin via syringe twice daily and monitor blood glucose, which has additional costs, inflicts pain on pets, and requires significant time and effort from pet owners.

[0078] Cats similarly require insulin injections and currently are managed with long-acting insulins such as ProZinc and Lantus (as they are not as efficacious in dogs). Cats also require glucose monitoring with CGMs designed for human patients (such as DexCom) that cost hundreds of dollars a month and are not well designed to be worn on cats.

[0079] There is substantial commercial opportunity for a cell that produces insulin that can be implanted by a veterinarian so pet owners do not have the financial and emotional burden of daily management. Other benefits include pet shelters where intensive daily management is unrealistic. Cell sourced insulin would reduce pain and improve quality of life for pets and their human companions.

[0080] In some embodiments, cells are used in drug testing applications. For example, in some embodiments, drugs or biological agents are tested. Indications for drug testing include any compound or biological agent in the pharmaceutical discovery and development stages, or drugs approved by drug regulatory agencies, like the US Federal Drug Agency.

[0081] In some embodiments, drug testing applications determine the effects of new chemical entities on insulin production.UAZ-44096.601

[0082] Embodiments of the present disclosure provide kits comprising the cells described herein. For example, in some embodiments, kits comprise cells (e.g., glucose sensing and insulin-producing cells described herein). In some embodiments, kits further comprise reagents for use of cells (e.g., buffers, test compounds, controls, etc.).

[0083] EXAMPLES

[0084] Unless specified otherwise, the following experimental techniques were used in the Examples.

[0085] Example 1

[0086] A synthetic glucose responsive promoter that stimulates gene expression in response to increasing glucose concentrations within a normal physiological range was engineered. Exemplary sequences are shown in Table 1 and described in FIGs. 1-2. The glucose-inducible gene promoter was synthesized and cloned into the pGL3 Basic Plasmid (Promega) for testing purposes only. Fetal rat fibroblast cells (Rat2; CRL-1764 from ATCC) and human fibroblast cells (Hs590. We; CRL-7353 from ATCC) were transient transfected with the GIRE-Luciferase constructs (GIRE-TKTSC-5’UTR or GIRE-TKTSC-+8). Following the transfection (~6 hours), cells were cultured in various glucose concentrations (1.5-20 mmol / 1) for an additional 24 hours and then lysed to measure luciferase activity. Transfection efficiency was determined with the co-transfection of pGL4 SV40 / Renilla Luciferase (pGL4.73; Promega). The fold-induction was calculated by dividing GIRE constructs by TKTSC_5’UTR (minimal promoter only) and subtracting the fold expression for 1.5mM glucose to resolve the glucose responsiveness.

[0087] The results (FIGs. 3-4) show that the GIRE elements stimulate gene expression in a glucose dependent fashion whereas the TKTSC_5UTR (minimal) promoter did not respond to increasing glucose concentrations (FIG. 3). These data show that two established, non-tumorigenic fibroblast cell lines that are well suited for macro-encapsulation devices and with no additional modifications is responsive to physiological changes in glucose concentrations.

[0088] Table 1

[0089] Human Proinsulin with the atggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggg Furin cleave of calcium-dependent gacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcagacct proinsulin to insulin ggtggaagctctctacctagtgtgcggggaacgacttcttctacacaccс

[0090] endopeptidase Furin and aggaccaagcgggaggcagaggacctgcaggtggggcaggtggagctgg causes cells to secrete His to Asp mutation at gcgggggccctggtgcaggcagcctgcagcccttggccctggaggggtccc mature insulin; alsoUAZ-44096.601

[0091] position B10 (Figure 1b; ggcagaagcgtggcattgtggaacaatgctgtaccagcatctgctccctcta provides a safety feature SEQ ID NO: 1) ccagctggagaactactgcaactag because proinsulin has minimal functional activity

[0092] Human Proinsulin with the atggccctgtggatgcgcctcctgcccctgctggcgctgctggccctctggg Inclusion of the calcium-dependent gacctgacccagccgcagcctttgtgaaccaacacctgtgcggctcagacct luciferase gene provides ggtggaagctctctacctagtgtgcggggaacgaggcttcttctacacaccс endopeptidase Furin and aggaccaagcgggaggcagaggacctgcaggtggggcaggtggagctgg a monitoring system for His to Asp mutation at gcgggggccctggatccaagcccaccgagaacaacgaagacttcaacatc insulin cleavage and position B10 plus luciferase gtggccgtggccagcaacttcgcgaccacggatctcgatgctgaccgcggg release

[0093] gene in the c-peptide aagttgcccggcaagaagctgccgctggaggtgctcaaagagatcgaagc caatgcccggaaagctggctgcaccaggggctgtctgatctgcctgtcccac

[0094] (Figure lc; SEQ ID NO: 2)

[0095] atcaagtgcacgcccaagatgaagaagttcatcccaggacgctgccacacc tacgaaggcgacaaagagtccgcacagggcggcataggcgaggcgatcgt cgacattcctgagattcctgggttcaaggacttggagcccatcgagcagttca tcgcacaggtcgatctgtgtgtggactgcacaactggctgcctcaaagggct tgccaacgtgcagtgttctgacctgctcaagaagtggctgccgcaacgctgt gcgacctttgccagcaagatccagggccaggtggacaagatcaagggggc cggtggtgacgaattcggtgcaggcagcctgcagcccttggccctggaggg gtcccggcagaagcgtggcattgtggaacaatgctgtaccagcatctgctcc

[0096] ctctaccagctggagaactactgcaactag

[0097] G IRE concatemerized ggCCgCCAgTTCTCACgTggTggCCACgTgCTTgggCACgCCAg Promotes glucose promoter elements (Figure TTCTCACgTggTggCCACgTgCTTgggCACgCCAgTTCTCACgT responsive gene ggTggCCACgTgCTTggg

[0098] 2b & c; SEQ ID NO: 3) expression TKTSC_5UTR (Figure 2b; GCGTCTTGTCATTGGCGAATTCGAACACGCAGATGCAGTC Minimal promoter with SEQ ID NO: 4) GGGGCGGCGCGGTCCCAGGTCCACTTCGCATATTAAGGTG full length UTR; modify ACGCGTGTGGCCTCGAACACCGAGCGACCCTGCAGCGAC CCGCTTA basal expression TKTSC_+8 (Figure 2c; SEQ CTCGAGggCCgCCAgTTCTCACgTggTggCCACgTgCTTgggCA Minimal promoter with ID NO: 5) CgCCAgTTCTCACgTggTggCCACgTgCTTgggCACgCCAgTTC truncated length UTR;

[0099] TCACgTggTggCCACgTgCTTgggCACTGCGTCTTGTCATTGG CGAATTCGAACACGCAGATGCAGTCGGGGCGGCGCGGTC modify basal expression CCAGGTCCACTTCGCATATTAAGGTGACGCGTGTGGCCTC GAACACCGATTAA

[0100] Human Furin sequence atggagctgaggccctggttgctatgggtggtagcagcaacaggaaccttg Paired Basic Amino Acid Previous HGNC Symbols for gtcctgctagcagctgatgctcagggccagaaggtcttcaccaacacgtggg cleaving Enzyme ctgtgcgcatccctggaggcccagcggtggccaacagtgtggcacggaagc

[0101] FURIN Gene: atgggttcctcaa cctgggccagatcttcgggga ctatta cca cttctggcat

[0102] PCSK3, FUR, & PACE; SEQ ID cgaggagtgacgaagcggtccctgtcgcctcaccgcccgcggcacagccgg

[0103] NO: 6 ctgcagagggagcctcaagtacagtggctggaacagcaggtggcaaagcg acggactaaacgggacgtgtaccaggagcccacagaccccaagtttcctca gcagtggtacctgtctggtgtcactcagcgggacctgaatgtgaaggcggcc tgggcgcagggctacacagggcacggcattgtggtctccattctggacgatg gcatcgagaagaaccacccggacttggcaggcaattatgatcctggggcca

[0104] gttttgatgtca atga ccagga ccctga cccccagcctcggta ca ca caga t gaatgacaacaggcacggcacacggtgtgcgggggaagtggctgcggtgg ccaacaacggtgtctgtggtgtaggtgtggcctacaacgcccgcattggagg ggtgcgcatgctggatggcgaggtgacagatgcagtggaggcacgctcgct gggcctgaaccccaaccacatccacatctacagtgccagctggggccccga ggatgacggcaagacagtggatgggccagcccgcctcgccgaggaggcct tcttccgtggggttagccagggccgaggggggctgggctccatctttgtctgg gcctcggggaacgggggccgggaacatgacagctgcaactgcgacggcta caccaacagtatctacacgctgtccatcagcagcgccacgcagtttggcaac gtgccgtggtacagcgaggcctgctcgtccacactggccacgacctacagc agtggcaaccagaatgagaagcagatcgtgacgactgacttgcggcagaa gtgcacggagtctcacacgggcacctcagcctctgcccccttagcagccggc atcattgctctcaccctggaggccaataagaacctcacatggcgggacatgc

[0105] aacacctggtggtacagacctcgaagccagcccacctcaatgccaacgact

[0106]

[0107] gggccaccaatggtgtgggccggaaagtgagccactcatatggctacgggcUAZ-44096.601

[0108] ttttggacgcaggcgccatggtggccctggcccagaattggaccacagtggc cccccagcggaagtgcatcatcgacatcctcaccgagcccaaagacatcgg gaaacggctcgaggtgcggaagaccgtgaccgcgtgcctgggcgagccca accacatcactcggctggagcacgctcaggcgcggctcaccctgtcctataa tcgccgtggcgacctggccatccacctggtcagccccatgggcacccgctcc accctgctggcagccaggccacatgactactccgcagatgggtttaatgact gggccttcatgacaactcattcctgggatgaggatccctctggcgagtgggt cctagagattgaaaacaccagcgaagccaacaactatgggacgctgacca agttca ccctcgta ctctatggca ccgcccctgaggggctgcccgta cctcca ga a agcagtggctgca aga ccctca cgtccagtcaggcctgtgtggtgtgc gaggaaggcttctccctgcaccagaagagctgtgtccagcactgccctccag ggttcgccccccaagtcctcgatacgcactatagcaccgagaatgacgtgga gaccatccgggccagcgtctgcgccccctgccacgcctcatgtgccacatgc caggggccggccctgacagactgcctcagctgccccagccacgcctccttg gaccctgtggagcagacttgctcccggcaaagccagagcagccgagagtcc ccgccacagcagcagccacctcggctgcccccggaggtggaggcggggca acggctgcgggcagggctgctgccctcacacctgcctgaggtggtggccgg cctcagctgcgccttcatcgtgctggtcttcgtcactgtcttcctggtcctgcag ctgcgctctggctttagttttcggggggtgaaggtgtacaccatggaccgtgg cctcatctcctacaaggggctgccccctgaagcctggcaggaggagtgccc gtctgactcagaagaggacgagggccggggcgagaggaccgcctttatca

[0109]

[0110] aagaccagagcgccctctga

[0111] All publications and patents mentioned in the above specification are herein incorporated by reference in their entirety for all purposes. Various modifications and variations of the described compositions, methods, and uses of the technology will be apparent to those skilled in the art without departing from the scope and spirit of the technology as described. Although the technology has been described in connection with specific exemplary embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the invention that are obvious to those skilled in the art are intended to be within the scope of the following claims.

Claims

UAZ-44096.601CLAIMSWe claim:

1. A composition comprisinga) a first nucleic acid construct comprising a gene encoding a proinsulin gene comprising a plurality of furin cleavage sites operably linked to a first promoter; andb) a second nucleic acid comprising a furin gene operably linked to a second promoter under the control of a glucose regulatory element.

2. The composition of claim 1, wherein said proinsulin gene encodes a proinsulin polypeptide with a His to Asp mutation at position BIO.

3. The composition of claim 1 or 2, wherein said proinsulin gene comprises A158G and T257G mutations.

4. The composition of any one of the preceding claims, wherein said proinsulin gene is human proinsulin.

5. The composition of any one of the preceding claims, wherein said proinsulin gene has a nucleic acid sequence of SEQ ID NO: 1.

6. The composition of any one of the preceding claims, wherein said glucose regulatory element comprises a concatemer of three or more glucose response elements.

7. The composition of claim 6, wherein said glucose response element has a nucleic acid sequence of SEQ ID NO: 3.

8. The composition of any one of the preceding claims, wherein said second promoter is a thymidine kinase minimal promoter.UAZ-44096.6019. The composition of any one of the preceding claims, wherein said second promoter has a nucleic acid sequence of SEQ ID NOs: 4 or 5.

10. The composition of any one of the preceding claims, said first promoter and said second promoter are independently constitutive or inducible promoters.

11. The composition of any one of the preceding claims, wherein said first promoter and said second promoter are the same or different.

12. The composition of any one of the preceding claims, wherein said first promoter is a cytomegalovirus (CMV) promoter13. The composition of any one of the preceding claims, wherein said first promoter and said second promoter are independently constitutive or inducible promoters.

14. The composition of any of the preceding claims, wherein said first and / or second nucleic acid construct are on a vector.

15. A cell comprising the composition of any one of the preceding claims.

16. The cell of claim 15, wherein said cell is a somatic cell.

17. The cell of any one of claims 15 or 16, wherein said cell is autologous or allogenic.

18. The cell of any one of claims 15 to 17, wherein said cell secretes insulin in response to increases in blood glucose concentrations.

19. The cell of any one of claims 15 to 18, wherein said cell is in vitro, ex vivo, or in vivo.

20. A pharmaceutical composition comprising the cell of any one of claims 16 to 19.

21. The composition of claim 20, wherein said composition is a hydrogel.UAZ-44096.60122. The composition of claim 21, wherein said hydrogel is selected from the group consisting of Matrigel and a PGLA-PEG-PGLA Laponite hydrogel.

23. A method of producing insulin in a subject, comprising:transplanting the cell of any one of claims 16 to 19 or the pharmaceutical composition of claim 21 or 21 into a subject in need thereof.

24. The method of claim 23, wherein said cell or pharmaceutical composition are transplanted subcutaneously or in the omentum.

25. The method of any one of claims 23 to 24, wherein said subject has Type I diabetes or Type II diabetes.

26. The method of any one of claims 23 to 25, wherein said subject is a human.

27. The method of any one of claims 23 to 25, wherein said subject is a non-human mammal.

28. The use of the cell of any one of claims 16 to 19 or the pharmaceutical composition of any one of claims 20 to 23 to treat Type I diabetes or Type II diabetes in a subject.

Images