Evolved bacteria for altering the intestinal microbiome in cystic fibrosis
Patent Information
- Authority / Receiving Office
- WO · WO
- Patent Type
- Applications
- Current Assignee / Owner
- Filing Date
- 2026-02-03
- Publication Date
- 2026-08-13
Smart Images

Figure US2026013726_13082026_PF_FP_ABST
Abstract
Description
EVOLVED BACTERIA FOR ALTERING THE INTESTINAL MICROBIOME IN CYSTIC FIBROSISCROSS REFERENCE TO RELATED APPLICATIONS
[0001] This patent application claims priority to U. S. Provisional Patent Application No. 63 / 753,628, filed on February 4, 2025, the contents of which are fully incorporated herein by reference.SEQUENCE LISTING
[0002] The computer-readable Sequence Listing submitted on February 3, 2026, and identified as follows: 5,080,978 bytes ST.26 XML document file named “Sequence_Listing.xml,” created February 3, 2026, is incorporated herein by reference in its entirety.FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0003] This invention was made with government support under R01 ES033988 awarded by the National Institutes of Health. The government has certain rights in the invention.TECHNICAL FIELD
[0004] The present disclosure relates to bacterial cells having increased viability in the gastrointestinal tract of a patient having cystic fibrosis (CF).BACKGROUND
[0005] Cystic fibrosis (CF) is an inherited genetic disorder wherein a chloride transport defect causes altered airway physiology, impairment of mucociliary clearance, and production of thick mucus at mucosal sites. Ref. (1-4). Clinical studies (Refs. (5-7), (8)) show early-life dysbiosis in the intestinal microflora for children with CF (cwCF), as assessed by analysis of stool. This dysbiosis includes depletion of the key immune-modulating microbe Bacteroides spp. and increase in Proteobacteria (particularly E. coli) for cwCF 0-1 years of age (Refs. (7, 8)), and persists during the key immune programming window of 0-3 years of age (Refs. (9, 10)), with recent findings from Dartmouth showing that cwCF have a microbiota which is delayed in the typical maturation process. Ref. (10). The mechanism(s) driving this dysbiosis have not been elucidated; such studies are difficult because it is challenging to unwind the specific factor(s) altered in the CF gut that might drive dysbiosis. Recent studies by Hajjar et al. indicate that the environment in the CF gut contributes to this dysbiosis because microbiota from non-CF micegavaged into gnotobiotic CF mice rapidly takes on features of the CF mouse intestinal microflora (Ref. (11)), supporting the idea that the intestinal environment contributes to the shaping of the microbiota in CF, and likely contributes to the loss of important microbes such as Bacteroides spp.
[0006] Using a combination of tissue culture, metabolic, genetic and mouse studies, it was recently shown that restoring Bacteroides spp. to stool from cwCF, gavaged into a CF mouse model, resulted in reduced inflammation in the serum and airway of these CF mice compared to control, and that the short chain fatty acid propionate drives this anti-inflammatory effect. Ref. (12). Furthermore, an in vitro medium we developed (called CF-MiPro) maintains CF-like microbial communities derived from the stool and intestine while driving healthy gut / stool communities to a CF-like state, which includes loss of Bacteroides spp. Ref. (13), also supports a role for the intestinal environment shaping the microbial community.
[0007] Gut microbiome dysbiosis is associated with poor health outcomes (e.g., diabetes, obesity, allergy) and higher susceptibility to infection and inflammation. Ref. (5). Recent studies indicate that next generation CF therapeutics are having little to no positive impact on the CF gut after ~3 months (Refs. (14, 15)), while contributing to an increasing burden of obesity linked to the changing intestinal microbiome. Refs. (16-19). A recent study showed that while generation CF therapeutics reduce the levels of E. coli after ~6 months, there is no restoration of Bacteroides spp. (Knoll, et al., Nat Commun 2025) Thus, there remains a lack of effective means to restore gut homeostasis in CF. Probiotics have been used in some circumstances to successfully treat intestinal dysbiosis. Ref. (20). The track record in CF has been less successful, but generic probiotic strains (not the specific species depleted in CF) have been used in clinical studies. Refs. (21, 22).SUMMARY
[0008] The present disclosure provides, in part, evolved bacterial cells, compositions comprising evolved bacterial cells, and methods of producing and using evolved bacterial cells. Compositions comprising the present evolved bacterial cells may be used, without limitation, to alter the intestinal microbiota, e.g., to modify, improve, or provide a beneficial microbiota, or to treat microbial infection or chronic colonization, pulmonary exacerbation, or other clinical outcomes associated with cystic fibrosis in a subject in need thereof.
[0009] As one aspect of the present disclosure, an isolated cell population is provided comprising evolved bacterial cells of the genera Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, and / or Veillonella. The evolved bacterial cells have increased viability in a gastrointestinal tract environment characteristic of a cystic fibrosis patient (“CF-GI tract”), as compared with an ancestral bacterial strain. In some embodiments, the evolved bacterial cells have at least one nonsynonymous mutation in a CF Adaptive Protein F (capF) gene. In some embodiments, the evolved bacterial cells are of the genera Phocaeicola or Bacteroides, for example, Phocaeicola vulgatus or Phocaeicola dorei or Bacteroides vulgatus or Bacteroides dorei. In some embodiments, the evolved bacterial cells are evolved from Phocaeicola dorei strain CFPLTA003 2B or from an ancestral bacterial cell having a genome sequence of GenBank accession number GCA 007896665.1 (SEQ ID NO: 1). In some embodiments, the evolved bacterial cells have at least one nonsynonymous mutation in a capF gene in Phocaeicola dorei strain CFPLTA003 2B or in a capF gene in the sequence of GenBank accession number GCA_007896665.1, such in one or more of the genes capFl, capF2, or capF3.
[0010] As another aspect of the present disclosure, a method of altering the intestinal microbiome in a subject is provided. The method comprises administering a composition comprising an isolated cell population, as described herein, to the subject and allowing the cells to alter the intestinal microbiome.
[0011] As another aspect of the present disclosure, a method is provided of generating an evolved bacterial cell having increased viability in a CF-GI tract. The method comprises culturing ancestral bacterial cells having insufficient viability in a CF-GI tract in a series of cell culture media. The series comprises differing concentrations of one or more of components characteristic of a CF-GI tract. The method also comprises isolating an evolved bacterial cell having increased viability in a CF-GI tract.
[0012] It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the claims.
[0013] The accompanying drawings, which are incorporated in and constitute a part of this specification, illustrate one (several) embodiment(s) and together with the description, serve to explain the principles described herein.BRIEF DESCRIPTION OF THE DRAWINGS
[0014] Figs. 1 A and IB show reduced viability of P. vulgatus in CF-Mipro. Fig. 1 A:Viability (logic CFU / ml, abbreviated “log” in the figure) after 24 hours of 11 clinical strains of P. vulgatus in MiPro and LowCF-MiPro. No viable bacteria were detected in MedCF-MiPro (not shown). The points are colored for each strain tested. Statistical comparisons were performed with growth in MiPro by Student’s T-test (p<0.0001). Fig. B: Viable counts of daily passaged 3-2B in MiPro (day 1-5) and LowCF-MiPro (day 6-10) (n=3).
[0015] Figs. 2A to 2C show adaptation of P. vulgatus CFPLTA3-2B to LowCF MiPro conditions. Fig. 2A: Viable counts (log10CFU / ml) of daily passaged cultures in increasing concentration of LowCF MiPro for 15 days (n=3). Fig. 2B: Viable counts (log10CFU / ml) of 3-2B and evolved populations in MiPro, LowCF-MiPro and MedCF-MiPro (n=9) at 24 hrs.Statistical comparisons were performed with growth in MiPro for specific strains / populations using Student’s T-test (bd: below detection). Fig. 2C: The Log10fold change in CFU comparing 3-2B with five evolved strains from each population in LowCF-MiPro (Δ log10CFU, X-axis) and the adjusted p-values (n=6, Y-axis). Statistical comparisons were performed with growth of 3-2B for each strain using Student’s T-test and adjusted for multiple comparisons using Holm-Bonferroni correction.
[0016] Figs. 3A to 3D illustrate sequence analysis of evolved strains. Fig. 3A: Sequence variants observed per strain colored by the type of variant. Fig. 3B: Base substitutions observed in evolved strains with their position on the genome and colored by gene name. Fig. 3C: Percent identity of each of the Cap proteins encoded by the three putative cap operons. Fig. 3D: Genomic structure of the putative cap operon. *: position of mutations.
[0017] Figs. 4A and 4B illustrate short-chain fatty acid profiles and CF mice colonization of the evolved strains. Fig. 4A: Chromatogram showing similar SCFA profiles of 3-2B (WT) and evolved strains (Lowl-7 and Lowl-9). There are no notable differences between the chromatographs. Fig. 4B: Establishment of the ancestral bacterial strain and evolved strains in CftrF508de / mice showing similar levels of colonization.
[0018] Fig. 5A: SNP -based phylogeny of the evolved isolates. The tree was visualized using iTOL and midpoint rooted. Fig. 5B: Domain prediction of capF genes using Phyre2 showing galactin, spore-coat, and DGR domains. Fig. 5C: ConSurf predicted the conservation of the mutated residues on the outer surface of the DGR domain showing variability. Teal-color inDGR are the mutated residues that denote the VR. Fig. 5D: Log-transformed read counts of cap operon genes in Mipro, LowCF-MiPro, and MedCF-MiPro conditions to assess their relative expression level.
[0019] Figs. 6A-6B show adaptation of P. vulgatus Lowl-7 and Lowl-9, respectively, to MedCF MiPro conditions. Viable counts (log10CFU / ml) of daily passaged cultures in increasing concentration of MedCF MiPro for 15 days (A) and 10 days (B) (n=3).
[0020] Figs. 7A-7D show that evolved strains have better tolerance to chenodeoxy cholic acid and deoxycholic acid. Fig. 7A: Growth of parent and evolved strains (Lowl-7 and Lowl-9) in MiPro supplemented with the specified constituent at the LowCF-MiPro concentration. The pairwise comparisons between parent and evolved strains were performed using Student’s T test and adjusted for multiple comparisons using Holm-Bonferroni correction (none are significant except for complete LowCF-MiPro). The color of the dot indicates the constituent tested (see legend), and the size of the dot indicates the -loglO p-values. Fig. 7B: CFU counts of parent and evolved trains in BHIS supplemented with increasing concentrations of bile salts (n=3). Fig. 7C: CFU counts of parent and evolved strains in BHISM (BHIS + 4g / L mucin) supplemented with increasing levels of bile salts (n=3). Fig. 7D: CFU counts of parent and evolved strains in BHISM containing 0.35 g / L of various bile salts (n=3). Primary bile salts (cholic acid, CA; and chenodeoxycholic acid, CDCA), conjugated bile acids (taurine (t) or glycine (g) conjugated CA and CDCA), and secondary bile acids (deoxycholic acid, DCA; lithocholic acid, LCA; and ursodeoxycholic acid, UDCA). Statistical comparisons were performed with growth of parent by Student’s T-test (p<0.05, *; p<0.01, **; p<0.001, ***).
[0021] Fig. 8 shows that the parent strain accumulates higher levels of deoxycholic acid compared to evolved strains. Internal bile levels of parent and evolved strains in pmoles per colony-forming unit. Four bile acids were detected out of the 21 bile acid panel assayed.Statistical comparisons were performed with the growth of parent by Student’s T-test (n=3).
[0022] Figs. 9A-9B shows that deoxycholic acid, not cholic acid, in bile salts is responsible for the different growth phenotypes of the parent and evolved strains. Fig. 9A: CFU counts of parent and evolved strains in BHIS containing increasing levels of cholic acid (n=3). Fig. 9B: CFU counts of parent and evolved strains in BHISM containing increasing levels of deoxycholic acid (n=3). Statistical comparisons were performed with the growth of parent by Student’s T-test.DETAILED DESCRIPTION
[0023] The present disclosure provides, in part, bacterial cells having increased viability in the gastrointestinal tract environment characteristic of a patient having cystic fibrosis (CF), and to compositions, methods of generating bacterial cells, and methods of using bacterial compositions. The compositions may be used, without limitation, to alter the intestinal microbiota (including modify, improve, or provide a beneficial microbiota), or to treat cystic fibrosis, or inflammation associated with CF, in a subject in need thereof.
[0024] The present disclosure provides evolved bacterial cells and isolated cell populations of P. vulgatus better adapted to the conditions relevant to the CF gut, and these strains retain the ability to produce the key immune-modulating SCFA propionate. The CF mouse model used here is a mild allele that does allow Bacteroides spp. to persist. Ref. (12). Sequencing analysis identified candidate SNPs that drive this phenotype. It is hypothesized is that the improved capF DGR domains in evolved strains have a better binding to bile acids and / or mucin, and thereby protect the strain from their toxic effects.I. Methods Of Generating Evolved Bacterial Cells
[0025] As one aspect of the present invention, methods are provided for generating evolved bacterial cells having increased viability in a gastrointestinal tract environment characteristic of a cystic fibrosis patient (“CF-GI tract”). The methods comprise culturing an ancestral bacterial cell having insufficient viability in a CF-GI tract in a series of in vitro cell culture media, wherein the series comprises serially adjusted concentrations of one or more of components characteristic of a CF-GI tract. The methods also comprise isolating a cultured bacterial cell having increased viability in a CF-GI tract. The methods also comprise generating isolated cell populations comprising such evolved bacterial cells.
[0026] In some embodiments, one or more of the ancestral bacterial cells are of the genera Phocaeicola or Bacteroides, such as Phocaeicola vulgatus or Phocaeicola dorei or Bacteroides vulgatus ox Bacteroides dorei, for example, Phocaeicola dorei strain CFPLTA003 2B. In some embodiments, one or more (or all) of the ancestral bacterial cells has a genome sequence with at least 80%, 85%, 90%, 95%, 98%, 99%, 99.9%, or 99.99% identity with a genome sequence of GenBank accession number GCA 007896665.1 (SEQ ID NO:1), which is incorporated hereinby reference. In some embodiments, one or more (or all) of the ancestral bacterial cells has the genome sequence of GenBank accession number GCA 007896665.1 (SEQ ID NO: 1).
[0027] In some embodiments, the present methods further comprising determining if one or more of the evolved bacterial cells has at least one nonsynonymous mutation in a capF gene, wherein said at least one nonsynonymous mutation is in comparison with a reference genome sequence, such as the genome sequence of one or more of the ancestral bacterial cells and / or the sequence of GenBank accession number GCA 007896665.1. In some embodiments, the method comprises determining if one or more of the evolved bacterial cells have at least one nonsynonymous mutation in a capFl gene annotated as BHANDH_05005 (SEQ ID NO:3), and / or at least one nonsynonymous mutation in a capF2 gene annotated as BHANDH_11500 (SEQ ID NO:4), and / or at least one nonsynonymous mutation in a capF3 gene annotated as BHANDH 12430 (SEQ ID NO:2), in GenBank accession number GCA 007896665.1, all of which are incorporated herein by reference,A. Bacterial Cells
[0028] The GI tract of patients with cystic fibrosis is altered relative to healthy persons. The CF-GI tract is characterized, in part, as having excess mucus, increased fat content, acidic pH, increased inflammation, increased antibiotic perturbation and the potential for increased oxygen availability.
[0029] Infants with CF had reduced levels of Bacteroides, a bacterial genus associated with immune modulation, as early as 6 weeks of life, and this significant reduction of Bacteroides spp. Refs. This dysbiosis includes depletion of the immune-modulating microbe Bacteroides spp. and increase in Proteobacteria (particularly E. coli) for cwCF 0-1 years of age (Ref. (7, 8)). The CF-GI tract can have decreased levels of Bifidobacterium, Bacteroides, Roseburia, and / or other genera relative to a healthy GI tract. See O’Toole et al. US Patent 11,351,208 B2.
[0030] In some embodiments of the present methods, bacterial cells having insufficient viability in a CF-GI tract are identified, such as by culturing the bacterial cells in an in vitro cell culture medium representative of a CF-GI tract. In some embodiments, the bacterial cells are of the genera Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, or Veillonella. In some embodiments, the bacterial cells are of the species Phocaeicola vulgatus ox Phocaeicola dorei.B. In Vitro Cell Culture Medium
[0031] The present methods employ one or more in vitro cell culture media for culturing bacterial cells having insufficient viability in a CF-GI tract. The cell culture media can have serially adjusted concentrations of one or more of components characteristic of a CF-GI tract. Table 1 sets forth some components of a medium representative of a healthy GI and of two media representative of a CF-GI tract. Ref. (13) describes these cell culture media in more detail.Table 1Component Healthy GI Tract1Low-CF-GI Tract2Median-CF-GI Tract3Fat (glycerol) 0 0.5% 1%Sodium nitrate 0 0.5 mM 1 mM Sodium sulfate 0.26 mM 0.76 mM 1.26 mM Sodium formate 0 0.5 mM 1 mM Hydrogen peroxide 0 1 uM 10 uM Antibiotic4(Bactrim) 0 1 uM 10 uM Mucin34 g / L 6 g / L 8 g / LBile salts60.5 g / L 1 g / L 2 g / LPH 7 6 61MiPro2Low-CF-MiPro3Median-CF-MiPro45:1 mix of sulfamethoxazole (Sigma-Aldrich CAS No: 723-46-6) and trimethoprim (CAS No: 738-70-5)5Stomach porcine mucin (Sigma-Aldrich CAS No: 84082-64-4)61:1 mix of cholic acid / deoxy cholic acid (RPI CAS No: 361-09-1; 302-95-4)
[0032] The features and respective concentrations in each medium (low, median) are as follows sulfate (0.5, 1 mM), a precursor of H2S, which is increased in cases of gut inflammation; nitrate (0.5, 1 mM), a by-product of the host inflammatory response; formate (0.5, 1 mM), a microbially-derived product increased in the inflamed gut; glycerol (0.5, 1%), a marker of increased fat; Bactrim (1, 10 uM), an antibiotic commonly prescribed to cwCF patients; H2O2(1, 10 uM), a measure of inflammation-derived oxidative stress; pH (6-7), to represent the general range of acidity in the CF and healthy colons; mucin (6, 8 g / L), to represent the thicker mucus layer secondary to CFTR dysfunction; and bile salts (1, 2 g / L), to represent the impaired uptake of bile salts in CF.C. Compositions Comprising Evolved Bacteria
[0033] Compositions of the present disclosure comprise one or more evolved bacterial cells as described herein. In some embodiments, the compositions comprise one or more evolved bacterial cells of the genera Phocaeicola, and / or one or more evolved bacterial cells of the genera Bacteroides, and / or one or more evolved bacterial cells of the genera Bifidobacterium, and / or one or more evolved bacterial cells of the family Roseburia, and / or one or more evolved bacterial cells of the genera Veillonella.
[0034] Phocaeicola vulgatus and Phocaeicola dorei (formerly called Bacteroides vulgatus) and Bacteroides dorei, respectively) are mutualistic anaerobic Gram-negative rod bacteria commonly found in the human gut microbiome. Phocaeicola is a genus of gram-negative, non- spore-forming, coccoid to rod-shaped cells with no flagella in the phylum Bacteroidota. In 2019, fourteen Bacteroides species (B. vulgatus, B. barnesiae, B. caecicola, B. caecigallinarum, B. chincillae, B. coprocola, B. coprophilus, B. dorei, B. gallinaceum, B. massiliensis, B. paurosaccharolyticus, B. plebeius, B. salanitronis, B. sartorii) were reclassified as the genus Phocaeicola. Ref. 31. It should be understood that references to such species as Bacteroides should be understood to refer to the Phocaeicola species.
[0035] In some embodiments, the present compositions include an isolated cell population of evolved bacterial cells of the genera / family Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, or Veillonella. In some embodiments, the present compositions comprise one or more (alternatively, 2 or more, 3 or more, 4 or more, 5 or more, 6 or more) isolated cell populations of evolved bacterial cells of the genera / family Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, or Veillonella.
[0036] In any of the embodiments described herein, the composition can comprise any combination of two, three, four, five six, seven, eight or nine evolved bacterial strains of the genera / family Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, or Veillonella.
[0037] In some embodiments, bacterial compositions as described herein include evolved bacterial strains of the genera Phocaeicola or Bacteroides.
[0038] In some embodiments, the present compositions include one or more evolved bacterial strains or isolated cell populations of the genera Phocaeicola and / or one or more evolved bacterial strains of the genera Bacteroides.
[0039] In some embodiments, the present compositions include one or more evolved bacterial cells of the genera Phocaeicola or Bacteroides.
[0040] In some embodiments, the present compositions include evolved bacteria of the species Phocaeicola vulgatus or Phocaeicola dorei, or evolved bacterial comprising an operational taxonomic unit (OTU) of the species Phocaeicola vulgatus or Phocaeicola dorei.
[0041] In some embodiments, the evolved bacterial cells are evolved from Phocaeicola dorei strain CFPLTA003 2B. In some embodiments, the evolved bacterial cells are evolved from an ancestral bacterial cell having a genome sequence of GenBank accession numberGCA 007896665.1 (SEQ ID NO:1). In some embodiments, the evolved bacterial cells have at least one nonsynonymous mutation in a capF gene in Phocaeicola dorei strain CFPLTA003 2B, such in one or more of the genes capFl, capF2, or capF3 (e.g., SEQ ID NOs: 3, 4 and 2, respectively). In some embodiments, the evolved bacterial cells have at least one nonsynonymous mutation in a capF gene in the sequence of GenBank accession number GCA 007896665.1, such in one or more of the genes capFl, capF2, or capF3. In some embodiments, the evolved bacterial cells have at least one nonsynonymous mutation in the capFl gene of strain CFPLTA003 2B (GCA 007896665.1). In some embodiments, the evolved bacterial cells have at least one nonsynonymous mutation in the capF2 gene of strain CFPLTA003 2B (GCA 007896665.1). In some embodiments, the evolved bacterial cells have at least one nonsynonymous mutation in the capF3 gene of strain CFPLTA003 2B (GCA_007896665.1). In some embodiments, the evolved bacterial cells have at least one nonsynonymous mutation in a capFl gene annotated as BHANDH_05005 in the CFPLTA003 2B genome (SEQ ID NO:3), and / or at least one nonsynonymous mutation in a capF2 gene annotated as BHANDH 11500 in the CFPLTA003 2B genome (SEQ ID NO:4), and / or at least one nonsynonymous mutation in a capF 3 gene annotated as BHANDH_12430 in the CFPLTA003 2B genome (SEQ ID NO:2). In some embodiments, the evolved bacterial cells are evolved from an ancestral bacterial cell having a genome sequence having at least 80%, 85%, 90%, 95%, 98%, 99%, 99.9%, or 99.99% identity with a genome sequence of GenBank accession number GCA_007896665.1.
[0042] In some embodiments, the present compositions include evolved bacteria as described herein. In some embodiments, bacteria as described herein include bacterial spores. In someembodiments, the bacterial compositions may be obtained from single bacterium or mixed bacteria having been evolved as described herein.
[0043] In some embodiments, the present compositions include human bacterial strains. In alternative embodiments, a bacterial composition as described herein includes bacterial strains not generally found in humans.
[0044] In some embodiments, the present compositions includes evolved bacteria capable of colonizing the gastrointestinal tract of a subject receiving the bacterial composition.
[0045] In some embodiments, the present compositions includes live evolved bacteria.
[0046] In some embodiments, the present compositions include substantially pure evolved bacteria of the genera / family Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, or Veillonella. By “substantially pure” or “isolated” is meant bacteria of the genera / family Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, or Veillonella that are separated from the components that naturally accompany it, or from unevolved bacteria, or from cell culture medium components. Typically, a composition as described herein is substantially pure when it is at least 50%, 60%, 70%, 75%, 80%, or 85%, or over 90%, 95%, or 99% by weight, of the total material in a sample. By “substantially pure” or “isolated” the present disclosure can be referring to the evolved bacteria that make up the culture (adding, for example, Bacteroides that is 95% pure) or it can refer to the entire composition (the composition is 95% pure, meaning 95% comes from the evolved bacteria when added together, and only 5% of components that naturally accompany the bacteria such as cell culture medium components).D. Microbiome treatment
[0047] Compositions comprising evolved bacterial cells, as described herein, can be used to alter the intestinal microbiota or to treat or protect against disease progression in cystic fibrosis, in particular, pulmonary exacerbation, or P. aeruginosa or other pathogenic microbial infection, in a subject in need thereof. Such other pathogenic microbial infections include, without limitation, airway infections with Staphylococcus aureus, Pseudomonas aeruginosa, Stenotrophomonas, Haemophilus influenzae, nontuberculous mycobacterium (including but not limited to Mycobacteria abcessus or Mycobacteria avium), Burkholderia cepacia complex, viral or fungal infection, or co-infections with multiple pathogens. In some embodiments, treating or protecting against disease progression in cystic fibrosis results in the prevention of pulmonary exacerbation or P. aeruginosa or other pathogenic microbial infection in the subject. In someembodiments, a bacterial composition, as described herein, is used to alter intestinal microbiota or to treat or protect against other pathogenic microbial infection associated with pulmonary exacerbation, in a subject in need thereof.
[0048] In some embodiments, a composition comprising evolved bacterial cells, as described herein, may be a therapeutic (including prophylactic) composition.
[0049] In some embodiments, a composition may be a therapeutic (including prophylactic) composition including one or more evolved bacteria of the genera / family Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, or Veillonella.
[0050] An “effective amount” of a composition, as used herein, includes an amount sufficient to colonize the gastrointestinal tract of a subject for a suitable period of time as determined, for example, by detecting the presence of one or more evolved bacteria of the genera / family Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, or Veillonella, or their metabolic byproducts associated with clinical outcomes (including, without limitation, propionate), in a sample, such as a fecal sample, from the subject at specific periods after administration.
[0051] In some embodiments, an effective amount includes a therapeutically effective amount. A “therapeutically effective amount” refers to an amount effective, at dosages and for periods of time necessary, to achieve the desired therapeutic result, such as treatment, prevention, or amelioration of cystic fibrosis, pulmonary exacerbation, or P. aeruginosa or other pathogenic microbial infection. A therapeutically effective amount of a bacterial composition may vary according to factors such as the disease state, age, sex, and weight of the subject, and the ability of the bacterial composition to elicit a desired response in the individual. Dosage regimens may be adjusted to provide the optimum therapeutic response. A therapeutically effective amount is also one in which any toxic or detrimental effects of the bacterial composition are outweighed by the therapeutically beneficial effects. Ultimately, the prescribers or researchers will decide the appropriate amount and dosage regimen. Such determinations are routine to one of ordinary skill in the art.
[0052] Conventional pharmaceutical or nutraceutical practice may be employed to provide suitable formulations or compositions to administer a bacterial composition, as described herein, to subjects suffering from or presymptomatic for cystic fibrosis, pulmonary exacerbation, P. aeruginosa infection, or any other CF-associated clinical outcomes. Any appropriate route ofadministration may be employed, for example, dermal, intranasal, inhalation aerosol, topical, gavage, rectal or oral administration.
[0053] The present compositions can be in a variety of forms. These forms include, e.g., lyophilized, liquid, semi-solid and solid dosage forms, such as liquid solutions, dispersions or suspensions, tablets, pills, powders, liposomes, and suppositories. The preferred form depends, in part, on the intended mode of administration and application. Administration includes oral administration, nasogastric administration, rectal administration, and other forms of administration to the gastrointestinal tract.
[0054] Compositions, as described herein, can be formulated as a nutraceutical composition, such as medical foods, nutritional or dietary supplements, food products or beverage products, and include a nutraceutically acceptable carrier. As used herein, a “nutraceutically acceptable carrier” refers to, and includes, any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. The compositions can include a nutraceutically acceptable salt, e.g., an acid addition salt or a base addition salt. In some embodiments, the nutraceutically acceptable carrier is suitable for pediatric use.
[0055] Compositions, as described herein, can be formulated as a pharmaceutical composition and include a pharmaceutically acceptable carrier. As used herein, a “pharmaceutically acceptable carrier” refers to, and includes, any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like that are physiologically compatible. In some embodiments, the pharmaceutically acceptable carrier is suitable for pediatric use.II. Methods Of Using Compositions Comprising Evolved Bacterial Cells
[0056] The present disclosure provides methods of altering the intestinal microbiome in a subject. The methods comprises administering a composition comprising evolved bacterial cells or isolated cell populations as described herein to the subject and allowing the cells to alter the intestinal microbiome. In some embodiments, the methods comprise reducing the risk of, severity of, or delaying at least one cystic fibrosis-associated outcome, such as pulmonary exacerbation or chronic pathogenic microbial infection or intestinal dysbiosis. In some embodiments, the methods comprise reducing systemic inflammation in the subject. In some embodiments, the methods comprise reversing intestinal dysbiosis, for example in a cysticfibrosis patient or a patient suffering from an inflammatory bowel disease (IBD) patient, such as an ulcerative colitis patient or a Crohn’s disease. In some embodiments, the methods include reducing inflammation in the subject and reducing proteobacteria, including but not limited to E. coli.
[0057] In some embodiments of the present methods, the subject administered a composition comprising evolved bacterial cells or isolated cell populations is a cystic fibrosis patient. In some embodiments, the subject administered a composition comprising evolved bacterial cells or isolated cell populations is an inflammatory bowel disease (IBD) patient, such as an ulcerative colitis patient or a Crohn’s disease patient. In some embodiments, the subject administered a composition comprising evolved bacterial cells or isolated cell populations has low abundance of one or more of Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, and / or Veillonella. In some embodiments, the subject administered a composition comprising evolved bacterial cells or isolated cell populations has low abundance of one or more of Phocaeicola and / or Bacteroides.
[0058] In some embodiments of the present methods, prior to said administering, a fecal sample from the subject has been tested to determine whether the subject has a decreased level of Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, and / or Veillonella relative to a healthy control population. In some embodiments, the composition is administered if the level of Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, and / or Veillonella relative to a healthy control population is about 50% or lower.
[0059] In some embodiments of the present methods, prior to said administering, a fecal sample from the patient has been tested to determine whether the patient has a decreased level of Phocaeicola vulgatus and / or Phocaeicola dorei and / or Bacteroides vulgatus and / or Bacteroides dorei relative to a healthy control population. In some embodiments, the composition is administered if the level of P. vulgatus and / or P. dorei and / or B. vulgatus and / or B. dorei relative to a healthy control population is about 50% or lower.
[0060] In some embodiments, the 16S rRNA sequencing or whole genome / metagenomics sequencing is used to determine the relative abundance of intestinal microbes in the fecal sample.
[0061] In some embodiments, knowing the profde of a patient’s microbiome helps physicians choose how aggressively to treat a patient’s CF and which treatments should beemployed. A patient who has a poorer microbiome profile is more susceptible to disease-associated difficulties and should be treated more aggressively.
[0062] Diagnostic approaches as outlined herein may be used herein, followed, when appropriate with treatments according to this application and / or conventional CF treatments.
[0063] Specifically, diagnostic microbiome testing allows a clinician to determine the need of treatment (including preventive therapies) for cystic fibrosis or cystic fibrosis-associated clinical outcomes. Conventional treatments, therapies, or lifestyle changes may be administered or prescribed to a subject in need thereof.
[0064] In some embodiments, the method for treating cystic fibrosis or cystic fibrosis-associated clinical outcomes may include (i) administering an effective amount of the bacterial composition to a subject prior to, during, or subsequent to treatment with compounds or compositions including pancreatic enzyme replacement, probiotics, prebiotics, antibiotics, antiinflammatory medications, mucus-thinning drugs, cystic fibrosis transmembrane conductance regulator (CFTR) function-improving medications, inhaled medications or bronchodilators; and / or (ii) prescribing physical therapy including postural drainage and chest physical therapy, and pulmonary rehabilitation to the subject.1. Pancreatic enzyme replacement
[0065] The majority of individuals with cystic fibrosis suffer from pancreatic insufficiency where the individuals suffer from a lack of digestive enzymes made by their pancreas. In some embodiments, medications for exocrine pancreatic insufficiency, or pancreatic enzyme replacement therapy (PERT), may be employed. Pancreatic enzyme replacement therapy (PERT) involves taking digestive enzymes that assist the digestion of fat, carbohydrates and proteins-pancreatic enzyme products (PEPs).
[0066] Pancreatic enzyme products (PEPs) generally contain a mixture of the digestive enzymes amylase, lipase, and protease. In some embodiments, the medications for pancreatic enzyme replacement include, without limitation, pancreatin, pancrelipase, or other pancreatic enzyme substitute. In some embodiments, the medications for pancreatic enzyme replacement include, without limitation, Creon®, Zenpep®, Pancreaze®, Ultresa®, Viokace®, Pertzye®, Nutrizym®, Pancrease®, and Pancrex®.2. Prebiotics
[0067] Various prebiotics to promote the growth of the bacterial compositions described herein may be used. A prebiotic is usually a nondigestible carbohydrate or a sugar alcohol which is not degraded or absorbed in the digestive tract. The prebiotic is selected according to the bacterial compositions such that it supports the growth of the bacteria. Suitable prebiotics may include, e.g., oligosaccharides, particularly inulin, fructooligosaccharide (FOS), galactooligosaccharide (GOS), palatinoseoligosaccharide, soybean oligosaccharide, gentiooligosaccharide, xylooligomers, non-degradable starch, lactosaccharose, lactulose, lactitol, maltitol, polydextrose, pectin, or the like.
[0068] In some embodiments, such prebiotics include, without limitation, extracts of Gum arabic, leeks, asparagus, artichoke, chicory root, onion, garlic, kale, wheat bran, banana, oats, barley, various legumes, or the like. In some embodiments, prebiotics may include herbs. In some embodiments, such prebiotics may be commercially available prebiotic supplements.3. Antibiotics
[0069] Various antibiotics may be used for the method for treating cystic fibrosis or cystic fibrosis-associated clinical outcomes as described herein. Such antibiotics may include, without limitation, penicillin (methicillin, oxacillin, naficillin, cabencillin, amoxicillin, clavulanic acid, cloxacillin, dicloxacillin, ticarcillin, piperacillin, mezlocillin, azlocillin, tazobactam); cephalosporins (cephalexin, cefdinir, cefprozil, ceflacor, cefuroxime, cefepime); sulfa antibiotics (sulfamethoxazole, trimethoprim); aminoglycosides (tobramycin, amikacin, gentamicin); erythromycin / sulfisoxazole; macrolides (erythromycin, clarithromycin, azithromycin); tetracyclines (tetracycline, doxycycline, minocycline, tigecycline); vancomycin; imipenem; meripenem; colistimethate); quinolones (ciprofloxacin, levofloxacin); aztreonam; linezolid. In some embodiments, one or more of Gentak, Cetraxal, Ciloxan, Cipro in D5W, Otiprio, Cipro XR (ciprofloxacin), Zithromax (azithromycin), AzaSite, Zmax, Zithromax TRI-PAK, Zithromax Z-Pak, Cayston, Azactam, Merrem, Fortaz, Tobi (tobramycin), Kitabis Pak, Bethkis, and Zosyn is used.4. Anti-inflammatory medications
[0070] Various anti-inflammatory medications to lessen the inflammatory responses (e.g., swelling in the airways of the lungs) may be employed for the method for treating cystic fibrosis or cystic fibrosis-associated clinical outcomes. Such anti-inflammatory medications may include,without limitation, corticosteroid, ibuprofen or other non-steroidal anti-inflammatory medications, anti-inflammatory cytokines, antibody or antigen binding fragment thereof to pro-inflammatory cytokine, antioxidants, protease inhibitors, membrane stabilizers. Further, such anti-inflammatory medications may include, without limitation, corticosteroid (fluticasone (Xhance®) or prednisone (Deltasone®, Rayos®, Prednisone Intensol)), ibuprofen, Anti-ICAM-1, anti-IL-8, anti-IL-17, IL-10, Interferon-y, p38 Mitogen-activated protein kinase inhibitors, al-Protease inhibitor, CXCR2 antagonist, cyclosporine-A, DHA, EPI-hNE4, glutathione, hydroxychloroquine, l-Arginine, LTB4 receptor antagonist (BIIL 284 BS), methotrexate, monocyte / neutrophil elastase inhibitor, montelukast, N-Acetylcysteine, omega-3-fatty acids, secretory leukoprotease inhibitor, Simvastatin, thiazolidinediones / pioglitazone, vitamins C, E, and P-carotene, and vitamin D.5. Mucus-thinning drugs
[0071] Various mucus-thinning drugs to improve airway function may be employed for the method for treating cystic fibrosis or cystic fibrosis-associated clinical outcomes. The mucusthinning drugs include, without limitations, hypertonic saline, dornase alfa (Pulmozyme®), and acetylcysteine (Acetadote®, NAC®, and Cetylev®).6. Medications that improve cystic fibrosis transmembrane conductance regulator (CFTR) function
[0072] Various medications that improve cystic fibrosis transmembrane conductance regulator (CFTR) function, the defective protein that causes cystic fibrosis, may be employed for the method for treating cystic fibrosis or cystic fibrosis-associated clinical outcomes. In some embodiments, such medications include, without limitation, at least one of ivacaftor, lumacaftor / ivacaftor (ORKAMBI®), tezacaftor / ivacaftor (SYMDEKO®), and elexacaftor / tezacaftor / ivacaftor (TRIKAFTA®), or newly developed therapies as they are developed. In some such embodiments, such medications include, without limitation, at least one of ivacaftor, lumacaftor / ivacaftor (ORKAMBI®), tezacaftor / ivacaftor (SYMDEKO®), and elexacaftor / tezacaftor / ivacaftor (TRIKAFTA®).7. Bronchodilator / Inhaled medications
[0073] Various inhaled medications may be employed for the method for treating cystic fibrosis or cystic fibrosis-associated clinical outcomes. In some embodiments, the inhaled medications include a bronchodilator that helps relax the muscles around the bronchial tubesmay be employed. Such inhaled medications include, without limitation, at least one of albuterol or levabuterol.
[0074] In some embodiments, the inhaled medications include one or more of the aforementioned probiotics and antibiotics (e.g., inhaled antipseudomonal antibiotics). In some embodiments, such inhaled medications include inhaled steroidal anti-inflammatory medications, such as beclomethasone dipropionate (Qvar®), budesonide (Pulmicort®), budesonide / formoterol (Symbicort®), fluticasone (Flovent®), fluticasone inhaled powder (Arnuity® Ellipta®), fluticasone / salmeterol (Advair®), mometasone (Asmanex®), and mometasone / formoterol (Dulera®).8. Physical therapies / other procedures
[0075] Various physical therapies and other medical procedures may be prescribed to the subject along with the administration of the or compositions described in the present disclosure for the methods for treating cystic fibrosis or cystic fibrosis-associated clinical outcomes in a subject in need thereof.
[0076] The physical therapy may include prescribing postural drainage, chest physical therapy, or pulmonary rehabilitation. The postural drainage may be performed by getting into positions that make it easier for mucus to drain from the lungs. The chest physical therapy may include, without limitation, at least one of vibrating vest and chest wall oscillation. The pulmonary rehabilitation may include, without limitation, at least one of physical exercise, breathing techniques, and nutritional counseling.III. Exemplary Embodiments
[0077] Embodiment Al. An isolated cell population comprising evolved bacterial cells of the genera Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, or Veillonella, wherein the evolved bacterial cells have increased viability in a gastrointestinal tract environment characteristic of a cystic fibrosis patient (“CF-GI tract”), as compared with an ancestral bacterial strain.
[0078] Embodiment A2. The isolated cell population of embodiment Al, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a CF Adaptive Protein F (capF) gene.
[0079] Embodiment A3. The isolated cell population of embodiment Al or A2, wherein the evolved bacterial cells are of the genera Phocaeicola or Bacteroides.
[0080] Embodiment A4. The isolated cell population of any of embodiments Al to A3, wherein the evolved bacterial cells are Phocaeicola vulgatus or Phocaeicola dorei or Bacteroides vulgatus or Bacteroides dorei.
[0081] Embodiment A5. The isolated cell population of any of embodiments Al to A4, wherein said at least one nonsynonymous mutation in said evolved bacterial cells is in comparison with a reference genome sequence of Phocaeicola vulgatus o Phocaeicola dorei or Bacteroides vulgatus or Bacteroides dorei.
[0082] Embodiment A6. The isolated cell population of embodiment A5, wherein the reference genome sequence is of P. vulgatus CFPLTA003-2B strain.
[0083] Embodiment A7. The isolated cell population of embodiment A6, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a capF gene in Phocaeicola dorei.
[0084] Embodiment A8. The isolated cell population of embodiment A7, wherein the Phocaeicola dorei is strain CFPLTA003 2B.
[0085] Embodiment A9. The isolated cell population of any of embodiments Al to A8, wherein the evolved bacterial cells are evolved from an ancestral bacterial cell having at least 80%, 85%, 90%, 95%, 98%, 99%, 99.9%, or 99.99% identity with the genome sequence of GenBank accession number GCA 007896665.1 (SEQ ID NO:1).
[0086] Embodiment A10. The isolated cell population of any of embodiments Al to A9, wherein the evolved bacterial cells have at least one nonsynonymous mutation in the capFl gene of Phocaeicola dorei strain CFPLTA003 2B (GenBank accession number GCA 007896665.1).
[0087] Embodiment Al 1. The isolated cell population of embodiment A10, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a capFl gene annotated as BHANDH 05005 in CFPLTA003-2B genome (SEQ ID NO: 3).
[0088] Embodiment A12. The isolated cell population of any of embodiments A l to Al 1, wherein the evolved bacterial cells have at least one nonsynonymous mutation in the capF2 gene of Phocaeicola dorei strain CFPLTA003 2B (GenBank accession number GCA 007896665.1).
[0089] Embodiment A13. The isolated cell population of embodiment A12, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a capF2 gene annotated as BHANDH 11500 in CFPLTA003-2B genome (SEQ ID NO:4).
[0090] Embodiment A14. The isolated cell population of any of embodiments Al to A13, wherein the evolved bacterial cells have at least one nonsynonymous mutation in the capF3 gene of Phocaeicola dorei strain CFPLTA003 2B (GenBank accession number GCA 007896665.1).
[0091] Embodiment A15. The isolated cell population of embodiment A14, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a capF3 gene annotated as BHANDH 12430 in CFPLTA003-2B genome (SEQ ID NO:2).
[0092] Embodiment A16. The isolated cell population of any of embodiments A2 to A15, wherein the one or more nonsynonymous mutations are selected from Table 3.
[0093] Embodiment A17. The isolated cell population of any of embodiments Al to A16, wherein said evolved bacterial cells produce short-chain fatty acids (SCFA).
[0094] Embodiment A18. The isolated cell population of embodiment A17, wherein said evolved bacterial strains produce SCFA at a level from about 80% to about 150%, or at least about 85%, or 90%, or 95%, of the ancestral bacterial strain.
[0095] Embodiment A19. The isolated cell population of embodiment A17 or A18, wherein the SCFA is propionate.
[0096] Embodiment A20. The isolated cell population of any of embodiments Al to Al 9, wherein said evolved bacterial cells produce riboflavin.
[0097] Embodiment A21. The isolated cell population of embodiment A20, wherein said evolved bacterial strains produce riboflavin at a level from about 80% to about 150%, or at least about 85%, or 90%, or 95%, of the ancestral bacterial strain.
[0098] Embodiment A22. The isolated cell population of any of embodiments Al to A21, wherein said evolved bacterial cells produce D-lactate and / or L-lactate.
[0099] Embodiment A23. The isolated cell population of embodiment A22, wherein said evolved bacterial strains produce D-lactate and / or L-lactate at a level from about 80% to about 150%, or at least about 85%, or 90%, or 95%, of the ancestral bacterial strain.
[0100] Embodiment A24. The isolated cell population of any of embodiments Al to A23, wherein the evolved bacterial cells have demonstrated capability to colonize a GI tract of a human patient or a mammalian model.
[0101] Embodiment A25. The isolated cell population of embodiment A24, wherein the evolved bacterial cells have demonstrated capability to colonize the GI tract in the presence of an antibiotic.
[0102] Embodiment A26. The isolated cell population of any of embodiments Al to A25, wherein the evolved bacterial cells have heightened tolerance to one or both of chenodeoxy cholic acid (CDCA) and deoxycholic acid (DCA).
[0103] Embodiment Bl. A composition comprising an isolated cell population according to any of embodiments Al to A25 in an effective amount to colonize a GI tract of a patient.
[0104] Embodiment B2. A composition comprising a therapeutically effective amount of an isolated cell population according to any of embodiments Al to A25.
[0105] Embodiment Cl. A method of altering the intestinal microbiome in a subject, the method comprising: administering a composition comprising the isolated cell population of any of embodiments Al to A25 or a composition of embodiment Bl or B2 to the subject and allowing the cells to alter the intestinal microbiome.
[0106] Embodiment C2. The method of embodiment Cl, wherein the method comprises reducing the risk of, severity of, or delaying at least one cystic fibrosis-associated outcome.
[0107] Embodiment C3. The method of embodiment C2, wherein the cystic fibrosis-associated outcome is pulmonary exacerbation.
[0108] Embodiment C4. The method of embodiment C2, wherein the cystic fibrosis-associated outcome is chronic pathogenic microbial infection.
[0109] Embodiment C5. The method of any of embodiments Cl to C4, wherein the method further comprises reducing systemic inflammation in the subject.
[0110] Embodiment C6. The method of embodiment Cl, wherein the subject is a cystic fibrosis patient.
[0111] Embodiment C7. The method of embodiment Cl, wherein the subject is an inflammatory bowel disease (IBD) patient.
[0112] Embodiment C8. The method of embodiment Cl, wherein the subject is an ulcerative colitis patient.
[0113] Embodiment C9. The method of embodiment Cl, wherein the subject is a Crohn’s disease patient.
[0114] Embodiment CIO. The method of embodiment Cl, wherein the subject has low abundance of one or more of Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, and / or Veillonella.
[0115] Embodiment Cl 1. The method of embodiment Cl, wherein the subject has low abundance of one or more of Phocaeicola and / or Bacteroides.
[0116] Embodiment C12. The method of to any of embodiments Cl to Cl 1, wherein the method further comprises reducing systemic inflammation in the subject.
[0117] Embodiment C13. The method of any of embodiments Cl to Cl 2, wherein, prior to said administering, a fecal sample from the subject has been tested to determine whether the subject has a decreased level of Phocaeicola and / or Bacteroides relative to a healthy control population.
[0118] Embodiment C14. The method of embodiment C13, wherein the composition is administered if the level of Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, and / or Veillonella relative to a healthy control population is about 50% or lower.
[0119] Embodiment C15. The method of embodiment C14, wherein the composition is administered if the level of Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, and / or Veillonella relative to a healthy control population is about 50% or lower.
[0120] Embodiment Cl 6. The method of any of embodiments Cl to Cl 5, wherein, prior to said administering, a fecal sample from the patient has been tested to determine whether the patient has a decreased level of Phocaeicola vulgatus and / or Phocaeicola dorei and / or Bacteroides vulgatus and / or Bacteroides dorei relative to a healthy control population.
[0121] Embodiment Cl 7. The method of embodiment Cl 6, wherein the composition is administered if the level of P. vulgatus and / or P. dorei and / or B. vulgatus and / or B. dorei relative to a healthy control population is about 50% or lower.
[0122] Embodiment Cl 8. The method of any of embodiments Cl to Cl 7, wherein the subject is a pediatric patient.
[0123] Embodiment C19. The method of embodiment C18, wherein the subject is 0 days old to 3 years old, 0 days old to 2 years old, 0 days old to 18 months old, 1 week old to 12 months old, 1 week old to 6 months old.
[0124] Embodiment DI. A method of generating an evolved bacterial cell having increased viability in a gastrointestinal tract environment characteristic of a cystic fibrosis patient (“CF-GI tract”), the method comprising: culturing ancestral bacterial cells having insufficient viability in a CF-GI tract in a series of cell culture media, wherein the series comprises differingconcentrations of one or more of components characteristic of a CF-GT tract: and isolating an evolved bacterial cell having increased viability in a CF-GI tract.[001251 Embodiment D2. The method of embodiment DI, wherein said one or more of components characteristic of a CF-GI tract is selected from the group consisting of: lipid (e.g., glycerol); sulfate; nitrate; formate; antibiotic (e.g., Bactrim); peroxide (e.g., H₂O₂); H₃O⁺ (e.g., lower pH); mucin; and bile salts.
[0126] Embodiment D3. The method of embodiment DI, wherein said one or more of components characteristic of a CF-GI tract is selected from the group consisting of bile salts, mucin and pH.
[0127] Embodiment D4. The method of embodiment D3, wherein the bile salts comprise a 1: 1 mixture of cholic acid and deoxycholic acid.
[0128] Embodiment D5. The method of embodiment DI, wherein the series of cell culture media comprises: sulfate at a concentration of from about 0.1 mM to about 1 mM; nitrate at a concentration of from about 0.1 mM to about 1 mM; formate at a concentration of from about 0.1 mM to about 1 mM; glycerol at a concentration of from about 0.1% to about 1%; an antibiotic at a concentration of from about 0.1 pM to about 10 pM; H₂O₂ at a concentration of from about 0.1 μM to about 10 μM; H₃O⁺ at a pH from about 5.5 to 7; mucin at a concentration of from about 1 g / L to about 8 g / L; and / or bile salts at a concentration of from about 0.1 g / L to about 2 g / L.
[0129] Embodiment D6. The method of any of embodiments DI to D5, wherein the series of cell culture media comprises serially increasing concentrations of each of said one or more components.
[0130] Embodiment D7. The method of any of embodiments DI to D6, wherein the series of cell culture media is prepared from a base cell culture medium, and the series differ in dilution of the base cell culture medium.
[0131] Embodiment D8. The method of embodiment D7, wherein the base cell culture medium is LowCF-MiPro.
[0132] Embodiment D9. The method of embodiment D7, wherein the base cell culture medium is MedCF-MiPro.
[0133] Embodiment D10. The method of any of embodiments DI to D9, wherein the bacterial cells are cultured in at least two conditioning periods.
[0134] Embodiment DI 1. The method of embodiment DIO, wherein each of the at least two conditioning periods is from 2 to 10 days, or from 3 to 7 days, or 5 days.
[0135] Embodiment DI 2. The method of embodiment D10 or DI 1, wherein the at least two conditioning periods comprise first and second conditioning periods.
[0136] Embodiment D13. The method of embodiment D12, wherein the bacterial cells are cultured in a mixture comprising from 10% to 50%, or about 25%, of a base cell culture medium during the first conditioning period.
[0137] Embodiment D 14. The method of embodiment DI 3, wherein the bacterial cells are cultured in a mixture comprising from 30% to 100%, or about 50%, of a base cell culture medium during the second conditioning period.
[0138] Embodiment D15. The method of embodiment DI 4, wherein the at least two conditioning periods further comprises a third conditioning period, and the bacterial cells are cultured in a mixture comprising from 75% to 100%, or about 100%, of a base cell culture medium during the third conditioning period.
[0139] Embodiment DI 6. The method of any of embodiments DI to DI 5, further comprising, prior to said culturing, determining that the ancestral bacterial cells have insufficient viability in a CF-GI tract.
[0140] Embodiment DI 7. The method of any of embodiments DI to DI 6, further comprising determining if the evolved bacterial cell produces short-chain fatty acids (SCFA).
[0141] Embodiment DI 8. The method of any of embodiments DI to DI 7, further comprising determining whether the evolved bacterial cell produces SCFA at a level from about 80% to about 150%, or at least 85%, or 90%, or 95%, of the ancestral bacterial cells.
[0142] Embodiment DI 9. The method of any of embodiments DI to D18, further comprising determining if the evolved bacterial cells produce riboflavin.
[0143] Embodiment D20. The method of any of embodiments D I to D I 9, further comprising determining if the evolved bacterial strains produce riboflavin at a level from about 80% to about 150%, or at least about 85%, or 90%, or 95%, of the ancestral bacterial strain.
[0144] Embodiment D21. The method of any of embodiments DI to D20, further comprising determining if the evolved bacterial cells produce D-lactate and / or L-lactate.
[0145] Embodiment D22. The method of any of embodiments DI to D21, further comprising determining if the evolved bacterial strains produce D-lactate and / or L-lactate at a level fromabout 80% to about 150%, or at least about 85%, or 90%, or 95%, of the ancestral bacterial strain.[001461 Embodiment D23. The method of any of embodiments DI to D22, further comprising expanding the evolved bacterial cell to produce an isolated cell population.
[0147] Embodiment D24. The method of any of embodiments DI to D23, wherein one or more of the ancestral bacterial cells has at least 80%, 85%, 90%, 95%, 98%, 99%, 99.9%, or 99.99% identity with the genome sequence of GenBank accession number GCA_007896665.1 (SEQ ID NO: 1).
[0148] Embodiment D25. The method of any of embodiments DI to D24, wherein one or more of the ancestral bacterial cells are of the genera Phocaeicola or Bacteroides.
[0149] Embodiment D26. The method of any of embodiments DI to D25, wherein one or more of the ancestral bacterial cells are Phocaeicola vulgatus or Phocaeicola dorei or Bacteroides vulgatus or Bacteroides dorei.
[0150] Embodiment D27. The method of any of embodiments D 1 to D26, wherein the ancestral bacterial cells comprise Phocaeicola dorei strain CFPLTA003 2B.
[0151] Embodiment D28. The method of any of embodiments DI to D27, wherein one or more of the ancestral bacterial cells has the genome sequence of GenBank accession number GCA 007896665.1 (SEQ ID NO: 1).
[0152] Embodiment D29. The method of any of embodiments DI to D28, further comprising determining if one or more of the evolved bacterial cells has at least one nonsynonymous mutation in a capF gene, wherein said at least one nonsynonymous mutation is in comparison with a reference genome sequence.
[0153] Embodiment D30. The method of claim D29, wherein the reference genome sequence is a genome sequence of one or more of the ancestral bacterial cells.
[0154] Embodiment D31. The method of claim D29 or D30, wherein the reference genome sequence is the sequence of GenBank accession number GCA 007896665.1.
[0155] Embodiment D32. The method of any of claims D29 to D31, wherein the method comprises determining if one or more of the evolved bacterial cells have at least one nonsynonymous mutation in a capFl gene annotated as BHANDH_05005 in GenBank accession number GCA_007896665.1 (SEQ ID NO:3).
[0156] Embodiment D33. The method of any of claims D29 to D32, wherein the method comprises determining if one or more of the evolved bacterial cells have at least one nonsynonymous mutation in a capF2 gene annotated as BHANDH 11500 in GenBank accession number GCA_007896665.1 (SEQ ID NO:4).
[0157] Embodiment D34. The method of any of claims D29 to D33, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a capF3 gene annotated as BHANDH 12430 in GenBank accession number GCA 007896665.1 (SEQ ID NO:2).
[0158] Embodiment D35. The method of any of embodiments D2 to D5, wherein the bile salts comprise one or more of cholic acid (CA), chenodeoxycholic acid (CDCA), taurine conjugated CA (tCA), glycine conjugated CA (gCA), taurine conjugated CDCA (tCDCA), glycine conjugated CDCA (gCDCA), deoxycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA).
[0159] Embodiment D36. The method of any of embodiments D2 to D5, wherein the bile salts comprise one or both of chenodeoxycholic acid (CDCA) and deoxycholic acid (DCA).IV. Definitions and Supporting Information
[0160] The terms “gut microbiota” or “gut microbiome” or “intestinal microbiota” or “intestinal microbiome” are used interchangeably and refer to the microorganisms that colonize the gastrointestinal tract of a human. As used herein, the terms “microbe” or “microorganism” encompass both prokaryotic organisms including bacteria and archaea, and eukaryotic organisms, including fungi, other single-celled eukaryotes, and viruses, present in mammalian microbiota.
[0161] By “modifying the intestinal microbiome”, “altering the intestinal microbiome”, “improving the gut microbiome” or “improving the intestinal microbiome” is meant any change, either increase or decrease, of the intestinal microbiota or microbiome in a subject. In some embodiments, modifying, altering, improving the intestinal microbiota includes increasing or decreasing the levels of specific bacteria, such as in the gastrointestinal tract of a subject. In some embodiments, modifying, altering, improving the intestinal microbiota includes increasing the levels of the bacteria described herein in the gastrointestinal tract of a subject.
[0162] By “increase,” “increasing”, “decrease” or “decreasing” is meant a change in the levels of specific bacteria in the gastrointestinal tract of a subject. An increase or decrease mayinclude a change of any value from 10% and 100%, or of any value from 30% and 60%, or over 100%, for example, a change of about 10%, 20% 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or more, when compared to a control. In some embodiments, the increase or decrease may be a change of about 1-fold, 2-fold, 5-fold, 10-fold, 100-fold, or more, when compared to a control.
[0163] Specific taxa and changes in microbiota discussed herein can be detected using various methods, including without limitation quantitative PCR (qPCR) or high-throughput sequencing (e.g., shotgun metagenome sequencing) methods which detect over- and under-represented genes in the total bacterial population (e.g., screening of microbial 16S ribosomal RNAs (16S rRNA)), or transcriptomic or proteomic studies that identify lost or gained microbial transcripts or proteins within total bacterial populations, or metabolomics, as previously described (e.g., Madan et al., mBio 2012; Hoen et al., J Pediatr, 2015; Filkins et al., J Bacteriol, 2012; Price et al., Microbiome, 2013; Gifford et al., J Cyst Fibros, 2014; Hampton et al., Microbiome, 2014).
[0164] As used herein, the term “ 16S rRNA sequencing” refers to the sequencing of 16S ribosomal RNA (rRNA) gene sequences by using primers such as universal primers and / or species-specific primers to identify the bacteria present in a sample. 16S rRNA genes contain both highly conserved sites and hypervariable regions that can provide species-specific signature sequences useful for identification of bacteria. Such universal primers are well known in the art.
[0165] As used herein, the term “operational taxonomic unit” or “OTU” refers to classification of microbes within the same, or different, OTUs using techniques, as described herein, or known in the art. OTU refers to a terminal leaf in a phylogenetic tree and is defined by a nucleic acid sequence, e.g., the entire genome, or a specific genetic sequence, and all sequences that share sequence identity to this nucleic acid sequence at the level of species. The specific genetic sequence may be the 16S rRNA sequence or a portion of the 16S rRNA sequence or it may be a functionally conserved housekeeping gene found broadly across the eubacterial kingdom. In 16S rRNA embodiments, OTUs that share >97% average nucleotide identity across the entire 16S rRNA or some variable region of the 16S rRNA are considered the same OTU.
[0166] As used herein, the term “ancestral bacterial strain” describes an individual from which individuals with similar, but different genotypes are derived. This can be the common ancestor of two phylogenetically related species or the starting clone of an experimentalevolution experiment. The term “ancestor” is used herein to refer to the initial stain used to seed the replicated populations of the evolution experiments.
[0167] As used herein, “cystic fibrosis-associated clinical outcomes” or “disease progression in cystic fibrosis” may include pulmonary exacerbation, inflammation in the GI tract, growth failure or diagnosis of failure to thrive, early all-cause hospitalization, nutritional malabsorption, gastrointestinal-related outcomes such as small bowel bacterial overgrowth, decreased absorption of essential fats, and / or disease-associated changes in body mass index (BMI).
[0168] As used herein, the term “pulmonary exacerbation” generally entails acute worsening of symptoms (e.g., increased cough, sputum production, shortness of breath) accompanied by an acute decrease in lung function and often resulting in therapeutic interventions including antibiotics and / or hospitalization.
[0169] The terms “treatment,” “treating” or “therapy” encompass prophylactic, palliative, therapeutic, and nutritional modalities of administration of the bacterial compositions described herein. Accordingly, treatment includes amelioration, alleviation, reversal, or complete elimination of one or more of the symptoms in a subject diagnosed with, or known to have, cystic fibrosis, or cystic fibrosis-associated clinical outcomes (as discussed in the definition of “cystic fibrosis-associated clinical outcomes” above including, but not limited to, inflammation in the GI tract), or be considered to derive benefit from the alteration of intestinal microbiota. Such treatment also includes treating gastrointestinal (GI) outcomes such as prevention of small bowel bacterial overgrowth, improvement in absorption of essential fats, decrease in growth failure.
[0170] In the context of the present application, a “treatment” is a procedure which alleviates or reduces the negative consequences of cystic fibrosis. Any treatments or potential treatments can be used in the context herein. A treatment is not necessarily curative, and may reduce the symptom or effect of cystic fibrosis by a certain percentage over an untreated subject. The percentage reduction or diminution can be from 10% up to 20, 30, 40, 50, 60, 70, 80, 90, 95, 99 or 100%. “Treatment” also includes methods or preventing, inhibiting the development, or reducing the risk of cystic fibrosis, unless otherwise stated. It will be appreciated that, although not precluded, treating cystic fibrosis or the risk of developing cystic fibrosis does not require that the disease or the risk be completely eliminated.
[0171] As used herein, “inhibiting the development of,” “reducing the risk of,” “prevent,” “preventing,” and the like refer to reducing the probability of developing a symptom, condition, or disorder in a patient who may not yet have a symptom, condition, or disorder, but may have a genetic predisposition to developing it. For example, “preventing” includes inhibiting or reducing the probability of developing inflammation, or any other cystic fibrosis-associated clinical outcomes. As used herein, “at risk,” “susceptible to,” or “having a genetic predisposition to,” refers to having a propensity to develop a symptom, condition, or disorder. For example, a patient may have been diagnosed as having cystic fibrosis, but may not yet have symptoms associated with inflammation.
[0172] As used herein “patient” or “subject” refers to any human being receiving or who may receive medical treatment. These terms also include mammals. Mammals include, but are not limited to, domesticated animals (e.g., cows, sheep, cats, dogs, and horses), primates (e.g., humans and non-human primates such as monkeys), rabbits, and rodents (e.g., mice and rats). In some embodiments, the subject is a patient. In some embodiments, the subject may be a human infant with a family history of cystic fibrosis. The subject may be an infant, such as a human infant one year old or less, or three months old or less. In some embodiments, the subject may be a human infant at any age from 1 day to 350 days old, such as 1 day, 10 days, 20 days, 30 days, 40 days, 50 days, 60 days, 70 days, 80 days, 90 days, 100 days, 110 days, 120 days, 130 days, 140 days, 150 days, 160 days, 170 days, 180 days, 190 days, 200 days, 210 days, 220 days, 230 days, 240 days, 250 days, 260 days, 270 days, 280 days, 290 days, 300 days, 310 days, 320 days, 330 days, 340 days, 350, 365 days old. In some embodiments, the subject may be a human infant of 0 days old to 3 years old, 0 days old to 2 years old, 0 days old to 18 months old, 1 week old to 12 months old, 1 week old to 6 months old.
[0173] The term “about” means a numeric value, including, for example, whole numbers, fractions, and percentages, whether or not explicitly indicated. The term “about” refers generally to a range of numerical values (e.g., ±5 to 10% of the recited range) that one of ordinary skill in the art would consider equivalent to the recited range (e.g., having the same function or result). When terms such as “at least” and “about” precede a list of numerical values or ranges, the terms modify all of the values or ranges provided in the list. In some instances, the term “about” may include numerical values that are rounded to the nearest significant figure.
[0174] As used herein “diagnosis” or “identifying a patient having” refers to a process of determining if an individual is afflicted with, or has a predisposition or is at risk to develop, a condition, disorder, or symptom, e.g., such as pulmonary exacerbation, cystic fibrosis-associated clinical outcomes, infection or colonization, and / or other condition, disorder, or symptom associated with worsening disease progression and / or earlier mortality.
[0175] Although certain embodiments and advantages have been described in detail, it should be understood that various changes, substitutions and alterations can be made herein without departing from the spirit and scope as defined in the appended claims.
[0176] Embodiments will be further illustrated in the following Examples which are given for illustration purposes only and are not intended to limit the application in any way.EXAMPLES
[0177] The following Materials and Methods were used in the examples which follow. Strains and Culturing
[0178] Phocaeicola vulgatus CFPLTA003-2B (3-2B or WT) was previously isolated from a healthy infant fecal sample. Ref. (12). The isolate has been regularly cultured in supplemented brain-heart infusion medium with 0.5 pg / ml hemin. The strains were incubated under anaerobic conditions (5% CO2, 5% H2, 90% N2) using anaerobic chamber (Coy Laboratory, Grass Lake, MI, USA) at 37° C unless specified otherwise. Viable counts were estimated by counting the colony forming units (CFU) using a microdilution method and selective plating on tryptic soy blood agar with 100 pg / ml gentamycin (BGM).CF-MiPro exposure assay
[0179] The single colony of the strains were inoculated into BHIS broth and incubated overnight. This inoculum culture was then OD adjusted to 0.05 and inoculated in 100 pl of MiPro, LowCF-MiPro and MedCF-MiPro with negative, uninoculated control for each media. The cultures were incubated anaerobically for 24 hours. CFUs were estimated from each condition at the end of incubation.Conditioning
[0180] Three colonies of strain 3-2B were inoculated in BHIS broth for use as inoculum in our experiments. The overnight cultures were OD-adjusted to 0.05 in BHIS and inoculated in 25% LowCF-MiPro and incubated anaerobically. Serial passages were performed every day with2% of 24-hour culture into fresh medium for 5 successive days. The medium strength was doubled every five days reaching 100% LowCF-MiPro conditions starting at day 11. The conditioning was stopped on day 15. For some studies, passaging was continued successively at 25%, 50% then 100% MedCF-MiPro, with 5 successive 1-day passages per medium condition. Aliquots of the cultures from each 5-day interval were stored as 10% glycerol stocks at -80°C. The populations on day 15 were streaked on BGM agar for single colony isolation (n=5). Each population and isolate were tested in CF-MiPro exposure assay to confirm their ability to grow in this medium. Similar conditioning was done for MedCF-MiPro.Whole genome sequencing
[0181] Genomes were sequenced at Seqcoast genomics (Portsmouth, NH) using Illumina NextSeq2000 producing 2X150bp paired-reads. The parent strain, 3-2B, was also sequenced with GridION platform using FLOW-MIN114 Spot-ON flow cell with a translocation speed of 400bps. The 3-2B genome was assembled as a hybrid using Unicycler. The annotation was performed using BAKTA and serves as the reference genome for all comparisons here. The short-read genomes were assembled using Spades. The reads of evolved isolates were aligned to the 3-2B genome using Breseq for identifying the sequence variations. Ref. (23). SNP-based phylogenic tree was created using the gdtools in Breseq and visualized using iTOL. Ref. (24). Structural predictions were performed using AlphaFold3 server (25). Multiple sequence alignment was performed using MAAFT. Ref. (26). Both of these were used on the ConSurf web server to predict the functional domain conservation. Ref. (27).Peptidase PCR and sequencing
[0182] A portion of the peptidase-encoding gene (FR998 04950) from base 660 to 1000 was amplified using 3-2B_pep_F (GATGTGGCCCCGCCATAC) (SEQ ID NO:5) and 3-2B_pep_R (TGCTGGAACCTGCATATTTGCT) (SEQ ID NO:6) primers. The PCR product was purified using QIAquick PCR purification kit (Qiagen) and Sanger sequenced using 3-2B_pep_F primer. The sequences were aligned to 3-2B reference genome using SnapGene to confirm the presence of single nucleotide polymorphisms (SNP).Estimation of short-chain fatty acids
[0183] To estimate short-chain fatty acids, 24-hour culture of 3-2B, Lowl-7, and Lowl-9 grown in BHIS broth was pelleted and the supernatant was filtered (0.2 pm). The filtrate was diluted 1:10 with molecular-grade water and analyzed on a Dionex Integrion HPIC System(ThermoFisher Scientific) fitted with Dionex TonPac AS11-HC Analytical column. A potassium hydroxide gradient was used for elution. A mix of acetate (0.25mM), propionate (0.27mM), succinate (0.85mM), and malonate (0.65mM) was processed similarly to serve as standards. CF mice establishment
[0184] C57BL / 6 CftrF508delmice [also called Cftrem1Cwrdeficient in the production of the CFTR protein were obtained from Case Western Reserve. Ref. (28). Mice were fed with ScottPharma LabDiet 5V75 ad libitum and on a 12 / 12 light cycle. Mice were housed in pairs (within same treatment condition only) when possible, or individually. Mice were treated with antibiotics for 21 days as previously described to suppress the endogenous intestinal microflora. Ref. (12). After antibiotic treatment, mice were orally gavaged with 10 pL of the ancestral bacterial strain or the evolved strain or a mix of both strains, per gram weight of mouse. Stool was regularly collected from mice and plated on BGM agar, which is selective for Bacteroides.Example 1
[0185] This example demonstrates that Phocaeicola vulgatus has a growth defect in CF-MiPro medium. A library of Phocaeicola vulgatus strains from stool and colonoscopy samples from healthy persons as well as persons with cystic fibrosis (pwCF) was created. The library is summarized in Table 2.Table 2Strain Source ConditionGP0067 Colonoscopy CFGP0068 Colonoscopy CFGP0081 Colonoscopy CFGP1008 Colonoscopy nonCFGP1018 Colonoscopy nonCFGP1019 Colonoscopy nonCFANK132K_1B Stool CFCFPLTA002_1B Stool nonCFCFPLTA003_2B Stool nonCFRH127O Stool CFTL139H Stool CF
[0186] This clinical isolate library was screened using the CF-MiPro exposure assay described above. The screened isolates showed a significant growth defect in LowCF-MiPro conditions compared to culturing in a MiPro cell medium (Fig. 1A).Example 2
[0187] This example demonstrates an embodiment of a method of generating an evolved bacterial cell having increased viability in a gastrointestinal tract environment characteristic of a cystic fibrosis patient (“CF-GI tract”).
[0188] A Phocaeicola vulgatus bacterial cell strain (CFPLTA003-2B, abbreviated 3-2B, a clinical isolate and the “wild type” or ancestral bacterial strain for this analysis) (SEQ ID NO: 1) was used for serial evolution in LowCF-MiPro and no viable growth was detected on day 5. The 3-2B bacterial cell strain was then used for serial evolution in MiPro for five days and these MiPro-adapted populations were transferred to LowCF-MiPro for five days. As illustrated in Fig. IB, the strain thrived during culture in MiPro for five days, but the viability significantly declined when the cells were was transferred to LowCF-MiPro and by Day 6 of the experiment (2 days in LowCF-Mipro) no viable cells could be detected.
[0189] Due to the reduced viability of P vulgatus in the 100% LowCF-MiPro environment, the strain was conditioned with a gradual increase in the percentage of the LowCF-MiPro medium. The strain was passaged for 15 days total over the course of this experiment, starting first with 25% LowCF-MiPro (with 75% MiPro) for 5 days of serial passaging, then doubling the strength of the medium every five days (i.e., 5 days at 50% LowCF-MiPro (with 50% MiPro), then 5 days at 100% LowCF-MiPro (Fig. 2A). The strain undergoing this passaging regime effectively adapted to the increasing LowCF-MiPro conditions and grew to a higher viable count with each passage over the first 10 days of the experiment. Starting day 11, the population was exposed to 100% Low-CF conditions and showed a gradual adaption reaching 7.94 log10CFU / ml by Day 15 (Fig. 2A).
[0190] The day- 15 populations were then assayed quantitatively in 100% CF-MiPro medium (Fig. 2B). A significantly higher viability in LowCF-MiPro was observed for the evolved populations compared to the parent population. While the ancestral population had higher than four log10CFU / ml decrease in viability when cultured in LowCF-MiPro compared to MiPro, theevolved population showed less than 0.5 log10CFU / ml decrease. There were no viable counts in MedCF-MiPro-exposed cultures for either parent or evolved populations.
[0191] Based on the successful growth in LowCF-MiPro, pure colonies were isolated from the 15 day evolved populations (n=5; populations=3) and assayed for final viable count after growth in LowCF-MiPro (Fig. 2C). The individual isolates demonstrate similar trend of higher tolerance to LowCF-MiPro. The final viable count of 3-2B in LowCF-MiPro was 3.95 log10CFU / ml after 24 hours of growth. The lowest tolerance among the evolved strains was for Low3-2 (5.35 log10CFU / ml) with the highest at 7.45 log10CFU / ml. Most of the evolved strains have significant growth advantage compared to 3-2B ancestral bacterial strain. The two highest performing strains Lowl-7 and Lowl-9 were used for subsequent analyses (Fig. 2C).Example 3
[0192] In this example, evolved bacterial strains generated in Example 2 were analyzed by whole genome sequencing analysis to identify conserved genomic variations.
[0193] A select set of high performing evolved strains were whole genome sequenced, and the raw reads were mapped against the 3-2B genome using Breseq to identify the single nucleotide polymorphisms (SNP). On average, there were 13 mutations each in the 15 evolved strains sequenced, with highest number at 33 (Low3-8) and the lowest at five (Low3-3). Most of the mutations were base substitutions (69.7%), followed by deletions (23.1%) and indels (7.2%). Of the total 136 base substitution mutations, there were 119 non-synonymous mutations (87.5%), 2 synonymous mutations (1%), and 15 nonsense mutations (7.7%) (Fig. 3A, Table 3). The three deletions were small fragments of the genome that might be an artifact of the long-read sequencing or mobile elements as two of the fragments contained transposases.Table 3Population 1 Population 2 Population 3# Position Mutation Function 1 2 3 4 5 1 2 3 4 5 1 2 3 4 5Y2122C1 1,225.556 1 1 1 1 1(TAC^TGC)1 1,225,558 0 0 1 0 0 0 1 1 0 1 Y2123N (TAC^AAC)1 1,225,567 0 0 1 0 1 0 1 N2126Y (AAT^TAT)1 1,225,573 0 1 0 0 D2128N (GAT^AAT)1 1,225,573 0 0 0 1 D2128H (GAT^CAT)1 1,225,573 0 0 0 1 D2128Y (GAT^TAT)1 1,225,573 0 1 coding (6382-6383 / 6522 nt)1 1,225,588 1 0 0 1 1 1 1 1 0 1 G2133S (GGT^AGT)1 1,225,589 1 1 0 1 1 0 G2133D (GGT^GAT)1 1,225,594 0 0 0 0 1 0 1 D2135N (GAT^AAT)capFl 1 1,225,594 1 0 0 1 0 0 0 D2135Y (GAT^TAT)1 1,225,600 0 1 0 coding (6409-6410 / 6522 nt)1 1,225,600 0 0 1 coding (6409-6410 / 6522 nt)1 1,225,603 0 0 1 0 0 1 N2138Y (AAC^TAC)1 1,225,615 1 0 0 0 0 1 N2142Y (AAT^TAT)1 1,225,618 1 0 0 0 0 0 A2143T (GCG^ACG)1 1,225,621 0 0 0 1 1 1 1 1 0 0 1 H2144N (CAT^AAT)1 1,225,621 1 0 0 0 0 0 H2144Y (CAT^TAT)1 1,225,627 0 0 0 0 0 1 S2146G (AGT^GGT)1 1,225,627 1 0 0 0 0 0 S2146C (AGT^TGT)1 1,225,628 0 1 0 0 0 S2146N (AGT^AAT)Table 31 1,225,630 1 0 0 0 V2147I (GTC^ATC)1 1,445,362 1 intergenic (-2867-49)1 1,805,375 1 1 G673R (GGG^AGG) tbdrl 1 2,836,156 0 0 0 1 1 C2122Y (TGC^TAC)1 2,836,159 1 1 0 0 1 1 1 S2123N (AGC^AAC)1 2,836,161 0 0 0 0 0 1 N2124D (AAT^GAT)1 2,836,168 1 1 1 1 0 1 0 0 S2126N (AGC^AAC)1 2,836,168 0 1 coding (6377-6378 / 6522 nt)1 2,836,169 0 1 0 S2126S (AGC— > AGT)1 2,836,189 1 1 1 0 0 0 S2133N (AGT^AAT)1 2,836,194 1 coding (6403-6404 / 6522 nt)capF2 1 2,836,195 1 1 1 0 1 0 1 1 0 S2135N (AGT^AAT)1 2,836,200 0 0 0 1 N2137Y (AAT^TAT)1 2,836,204 1 0 0 1 S2138N (AGC^AAC)1 2,836,215 0 0 0 0 0 0 0 1 Y2142N (TAT^AAT)1 2,836,218 0 0 0 0 0 1 T2143A (ACG^GCG)1 2,836,221 1 0 1 0 0 1 0 1 0 0 1 Y2144N (TAT^AAT)1 2,836,227 0 0 0 0 0 1 Y2146D (TAT^GAT)1 2,836,230 0 0 0 0 1 12147V (ATC^GTC)1 3,019,153 1 1 0 1 0 1 C2132Y (TGC^TAC)1 3,019,155 1 0 1 coding (6397-6398 / 6552 nt)1 3,019,156 1 1 1 0 S2133N (AGC^AAC)capF3 1 3,019,158 1 0 1 0 0 1 0 1 Y2134N (TAT^AAT)1 3,019,164 0 0 1 0 0 1 N2136Y (AAT^TAT)1 3,019,185 0 1 coding (6427-6428 / 6552 nt)Table 31 3,019,186 1 0 1 1 0 0 S2143N (AGT^AAT)1 3,019,186 0 0 1 0 S2143I (AGT^ATT)1 3,019,191 0 1 1 N2145Y (AAT^TAT)1 3,019,197 0 1 0 0 0 F2147V (TTT^GTT)1 3,019,197 1 0 0 0 coding (6439-6440 / 6552 nt)1 3,019,198 0 0 1 0 1 0 0 0 0 F2147Y (TTT^TAT)1 3,019,198 0 0 1 0 0 0 0 0 F2147C (TTT^TGT)1 3,019,200 0 0 0 0 0 1 N2148Y (AAC^TAC)1 3,019,212 0 0 0 1 1 coding (6454-6455 / 6552 nt)1 3,019,213 1 1 1 1 1 0 1 0 1 0 0 1 S2152N (AGC^AAC)1 3,019,218 0 0 0 0 0 1 coding (6460-6461 / 6552 nt)1 3,019,224 1 0 0 1 0 0 0 0 0 G2156S (GGT^AGT)1 3,019,224 0 0 0 1 coding (6466-6467 / 6552 nt)1 3,019,224 1 0 0 0 coding (6466-6467 / 6552 nt)1 3,019,225 1 1 0 0 0 1 G2156D (GGT^GAT)1 4,621,157 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 S261* (TCA^TGA) dpp7 1 4,747,607 1 S27S (TCG^TCT) tbdr2 12 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 transposase 13 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 intergenic (- / -)14 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 transposase
[0194] Surprisingly, there was one nonsense mutation in each strain at the same position. The conserved nonsense mutation that was identified in all evolved strains was in a gene encoding S46 family peptidase (Table 3). The change from TCA to TGA resulted in a nonsense mutation (S261*) mapping to the peptidase gene active site. The presence of this SNP was confirmed using Sanger sequencing in evolved strains by amplifying a portion of the gene encoding this peptidase using primers 3-2B_pep_F and 3-2B_pep_R (SEQ ID NOs:5,6). The resulting PCR product was then sequenced with primer 3-2B_pep_F. The same portion of the peptidase gene from the 5-day MiPro evolved isolates was also sequenced as a control and the same SNP was found. Hence this SNP might be selected due to growth in MiPro and not necessarily specific to adaptation in LowCF-MiPro.
[0195] It was found that most of the nonsynonymous mutations were localized in three genes (Fig. 3B). These three genes did not have any predicted function hence were annotated as putative CF Adaptive Protein F (capFl-3). These genes are discussed in more detail below.
[0196] A SNP-based maximum-likelihood phylogeny tree was created that identifies two clusters that divide the strains having higher growth in LowCF-MiPro from strains with relatively lower growth in LowCF-MiPro (Fig. 5A). The ratio of nonsynonymous mutations to synonymous mutations (dN / dS) measures the strength and mode of natural selection acting on the protein coding genes. The dN / dS ratio is calculated by considering the frequency of base substitutions and acts as the indicator of a gene under selection. The observed dN / dS ratio (23.5) of the evolved strain was very high compared to the chance event base substitution value (2.75), hinting towards genes under selection.
[0197] As mentioned above, the nonsynonymous mutations were mapped to three genes (SEQ ID NO:3, 4 and 2), which code for proteins named CapFl, CapF2, and CapF3. The capF gene products were analyzed in detail for their putative functions. These highly homologous genes (Fig. 3C-D) are relatively large (6522 bp for capFl-2 and 6552 bp for capF3) with three putative domains predicted for their gene products by phyre2 viz. galectin, spore-coat protein, and diversity-generating retroelements (DGR) (Fig. 5B).
[0198] DGRs were first discovered in Bordetella phage and have since been found in many bacteria, archaea, and viruses. Ref. (29). They are known to accelerate evolution by mutating the target proteins’ C-terminal variable repeat domains (VR). The galectin fold found in capF genes is another characteristic of DGR effector proteins thought to help these proteins bind to surfacecarbohydrates (30). Along with the VR, DGRs require the presence of a reverse transcriptase (RT) with an upstream intergenic region called template repeat (TR), homologous to the VR. There may or may not be an accessory protein upstream of the RT (30).
[0199] All the mutations in cap genes were mapped to the VR domain of the DGR (Fig. 3D and Fig. 5B). The neighboring regions of capF genes were analyzed and found capF2 to have accessory protein followed by TR and RT downstream, necessary for DGR function (accF2, TR-,frt2, Fig. 3D). All capF genes are in an operonic structure with five conserved genes upstream capA-E, Fig. 3C-D). These capA-E open reading frames flanking the capF genes have no known function and may originate from a prophage. A multiple sequence alignment of CapF proteins (3 from the ancestral bacterial strain and 45 from the evolved bacterial strains) was performed and the mutations were projected on the alphafold3 predicted structure of the CapF proteins using ConSurf (Fig. 5C). The structural alignment showed that the mutated residues are on the surface of the DGR domain. Hence, it is hypothesized that the adaptation might be aiding the binding of CapF to a ligand to protect the cell.
[0200] The read counts of these genes were checked in an existing RNAseq dataset comparing one-hour exposure to Mipro, LowCF, and MedCF (Fig. 5D), and they are expressed at similar levels. It is contemplated that the operonic structure of the cap genes and the biological role of this putative operon may be confirmed experimentally.Example 4
[0201] This example demonstrates that embodiments of the evolved bacterial strains had short-chain fatty acid (SCFA) profiles showing trends similar to the ancestral bacterial strain. The production of SCFA by the ancestral bacterial strain (3-2B) and two of the evolved bacterial strains (Lowl-7 and Lowl-9) was evaluated using supernatant from cultures grown for 24-hour growth in BHIS broth. The chromatograms show similar trends of tested SCFA for all strains (Fig. 4A). These results indicate that the evolved strains are likely producing similar levels of SCFA, including propionate, as the parent strain. Additional work is expected to provide a more accurate quantification of short-chain fatty acids produced by the evolved strains.
[0202] This example demonstrates the ability of evolved bacterial strains to colonize the gut of antibiotic-treated mice. The ancestral bacterial strain, the Lowl-9 evolved strain, or a mixture of both strains were gavaged into CftrF508delmice. It was observed that the evolved strain Lowl-9 colonized the gut of an antibiotic-suppressed, CF mouse to the same level at the ancestralbacterial strain 3-2B, either in monoculture or mixed culture (Fig. 4B). This initial characterization shows that the evolved strain retains the ability to successfully colonization the gut, and together with similar SCFA production, suggest these strains can likely provide the similar immunomodulatory effects that we have published previously for the ancestral bacterial strain. Ref. (12).Example 5
[0203] This example demonstrates that the strain was conditioned with a gradual increase in the percentage of MedCF-MiPro medium. The strain Lowl-7 was passaged for 15 days total over the course of this experiment, starting first with 25% MedCF-MiPro (with 75% MiPro) for 5 days of serial passaging, then doubling the strength of the medium every five days (i.e., 5 days at 50% MedCF-MiPro (with 50% MiPro), then 5 days at 100% MedCF-MiPro (Fig. 6A).Similarly, the strain Lowl-9 was passaged for 10 days total over the course of this experiment, starting first with 50% MedCF-MiPro (with 50% MiPro) for 5 days of serial passaging, then 5 days at 100% MedCF-MiPro (Fig. 6B). The strain Lowl-9 was already able to grow in 50% MedCF-MiPro but did not survive after it was passage into 100% MedCF. Strain Lowl-7 which required some adaptations during the 5-day passage in 50% MedCF-MiPro also shows the similar decline in viable counts when grown in 100% MedCF-MiPro. We concluded that the evolved strain can be further adapted to 50% MedCF-Mipro.Example 6
[0204] This example demonstrates that the evolved strains have better tolerance to chenodeoxy cholic acid and deoxy cholic acid.
[0205] Method:
[0206] MiPro components assay
[0207] The effect of each component of LowCF -MiPro on the growth of 3-2B, Lowl-7, and Lowl-9 strains was assessed by inoculating in 100 pL of MiPro with each of the constituents at the LowCF-MiPro concentrations. The individual conditions were MiPro: 6 g / L mucin, 1 g / L bile salts, pH 6, 0.5% glycerol, 0.5mM sodium nitrate, 0.5mM sodium sulfate, 0.5 mM sodium formate, 1 |1M hydrogen peroxide, or 1 pM Bactrim, and LowCF-MiPro with a negative, uninoculated control for each medium. The cultures were incubated anaerobically for 24 hours. CFUs from each condition were determined at the end of incubation.
[0208] Bile tolerance assays
[0209] The effect of bile on the growth of 3-2B, Lowl -7, and Lowl -9 strains in BHIS and BHISM (with 4g / L mucin) was assessed by inoculating the OD600= 0.05 of BHIS grown cultures in 100 pl BHIS or BHISM containing various concentrations bile salts (0-1 g / L bile salts, 0-1 g / L cholic acid, CA or 0-1 g / L deoxy cholic acid, DCA). The cultures were incubated anaerobically for 24 hours. CFUs were estimated from each condition at the end of incubation.
[0210] To further differentiate between the effects of various bile species, OD600 = 0.05 BHIS grown cultures of 3-2B, Lowl-7, and Lowl-9 strains were inoculated in 100 pl of BHISM with 0.35 g / L various bile acids as indicated in each experiment. The major primary (CA; and chenodeoxycholic acid, CDCA), conjugated (taurine (t) or glycine (g) conjugated CA and CDCA), and secondary (DCA; lithocholic acid, LCA; and ursodeoxycholic acid, UDCA) were tested. The cultures were incubated anaerobically for 24 hours. CFUs were estimated from each condition at the end of the incubation period.
[0211] Internal bile acids estimation
[0212] Internal bile acid concentrations were estimated by performing the bile tolerance assay in BHISM+ 0.35 g / L DCA media. The 24 hour anaerobically incubated cells were either plated for CFUs or pelleted and washed thrice with PBS. The washed cells were resuspended in extraction buffer containing 0.1 % butylated hydroxytoluene in 80% methanol with 100 nM cholic acid-d4 as an internal standard. The samples were sonicated for 5 minutes in a bath sonicator, vortexed for 1 minute, and centrifuged at 10,000 x g for 10 minutes at 4 °C. The supernatant was transferred in new vials and shipped to Michigan State University Mass Spectrometry and Metabolomics Core for analysis of a 21 bile acid panel, as reported (32,33).
[0213] Results:
[0214] The evolved strains have a fitness advantage in the presence of bile, mucin, and low pH
[0215] LowCF-MiPro constituents that differed from the concentrations of those constituents in MiPro were individually supplemented into MiPro to assess for a fitness advantage versus each evolved strain. When comparing parent (3-2B) and evolved (Lowl-7 and Lowl-9) strains, similar viable count values (range: 8-9 log10 CFU / mL ) were observed for most of the conditions, such as MiPro, MiPro with 0.5% glycerol, MiPro with 0.5mM sodium nitrate, MiPro with 0.5mM sodium sulfate, MiPro with 0.5mM sodium formate, MiPro with 1 pM hydrogen peroxide, and MiPro with 1 pM Bactrim (Fig 7A). Bile (MiPro with 1 g / L bile salts) and low pH(MiPro at pH 6) conditions were observed to result in higher viable counts for evolved strains (Parent: 6.6 log10 CFU / mL; Evolved: 7.3 log10 CFU / mL for bile, Parent: 5.6 log10 CFU / mL; Evolved: 6.2 log10 CFU / mL for low pH). Growth in mucin (MiPro with final 6 g / L mucin) showed a slight fitness advantage for the evolved strain (Parent: 8.8 log10 CFU / mL; Evolved: 9 log10 CFU / mL). None of these comparisons were statistically significant with Student’s T-test and adjusted for multiple comparisons using Holm-Bonferroni correction. Even though the results were not statistically significant, the trend of growth in bile acids or acidic media was robust. The fitness advantage in the presence of supplemented bile alone here was examined further.
[0216] Mucin is required for evolved strains’ fitness advantage in the presence of bile acids.
[0217] The growth of parent and evolved strains was assayed in the presence of bile in typical growth media (BHIS) instead of highly complex MiPro to more readily focus on the effects of individual constituents. When grown in BHIS with increasing concentration of bile salts, evolved strains showed similar growth compared to the parent; both strains exhibited a moderate decrease in the CFU counts with increasing bile, reaching no detectable growth at 0.8 g / L bile salt (Fig 7B). This assay was also performed with CA and DCA and the fitness advantage of evolved strains noted above for the MiPro experiments (Fig 9A-9B) was not observed. This finding hinted at the requirement of added mucin in the medium to observe the enhanced fitness of the evolved strain, as there is baseline mucin in MiPro medium (4 g / L).
[0218] Based on the observation above, this assay was repeated using BHISM with increasing levels of bile salts. Both parent and evolved strains showed similar CFUs up 0.6 g / L bile salts, but evolved strains displayed slightly higher viable counts under these conditions (Fig 7C). At 0.7 g / L, the evolved strains (5.0 log10 CFU / mL) displayed significantly higher CFUs compared to the parent (4.3 log10 CFU / mL; Fig 7C). This trend continued till 0.9 g / L, but there was higher variation. Neither strain was able to grow at 1 g / L bile salts, which is the concentration used in LowCF-MiPro.
[0219] The fitness advantage of the evolved strains is specific to deoxycholic acid (DCA) and chenodeoxycholic acid (CDCA).
[0220] No growth inhibition by CA was observed, but DCA alone mimicked the phenotype of the bile acid mix. There are a variety of individual bile acids in the human gut, so this growthphenotype was tested for nine major bile acids. As bile salts in the MiPro or CF-MiPro were a 1: 1 mix of CA and DCA, 0.35 g / L of bile acids, half of the inhibitory concentration (0.7 g / L) observed in the BHISM+bile salts assay was used. Growth inhibition of the parent and fitness advantage of the evolved strains in the presence of DCA (parent: 4.5 log10 CFU / mL; evolved: 5.6 log10 CFU / mL) and CDCA (parent: 5.2 log10 CFU / mL; evolved: 6.8 log10 CFU / mL) (Fig 7D) was observed. All the other tested bile acids did not cause any growth inhibition in either parent or evolved strains. UDCA caused a slight inhibition (~1 log10 CFU / mL) of both the parent and evolved strains compared to other non-inhibitory bile acids.
[0221] The parent strain accumulates DCA
[0222] To understand the mechanism by which DCA-mediated killing occurs, the accumulation of DCA inside the parent and evolved strains in BHISM with 0.35 g / L DCA media was measured. Only four bile acids out of the 21 tested in this assay were detected (Fig. 8). When normalized with the CFUs, the parent (3.3 pmoles / CFU) accumulated significantly more DCA than evolved (0.3 pmoles / CFU). The three other detected bile acids (CA, hyoDCA, and LCA) were detected only at very low concentrations (>0.08 pmoles / CFU), and hyoDCA and LCA showed significant differences between parent and evolved strains.
[0223] Conclusion:
[0224] The evolved strains (Lowl-7 and Lowl-9) display a higher tolerance to DCA and CDCA compared to their parent strain (3-2B); there was no difference between the parent and evolved strains for the other BA tested. Unlike the parent, evolved strains also do not accumulate DCA when grown in the presence of this inhibitor. DCA accumulation has been previously shown to be toxic by impacting ribosome transcription and amino acid metabolism in various gut Bacteroides (33).EQUIVALENTS
[0225] The foregoing written specification is considered to be sufficient to enable one skilled in the art to practice the embodiments. The foregoing description and Examples detail certain embodiments and describes the best mode contemplated. It will be appreciated, however, that no matter how detailed the foregoing may appear in text, the embodiment may be practiced in many ways and should be construed in accordance with the appended claims and any equivalents thereof.
[0226] References discussed in the application, which are incorporated by reference in their entirety, for their intended purpose, which is clear based upon its context.
[0227] 1. Govan JR, Deretic V. 1996. Microbial pathogenesis in cystic fibrosis: mucoid Pseudomonas aeruginosa and Burkholderia cepacia. Microbiol Rev 60:539-74.
[0228] 2. Saiman L, Siegel J. 2004. Infection control in cystic fibrosis. Clin Microbiol Rev 17:57-71.
[0229] 3 Yoon SS, Hassett DJ. 2004. Chronic Pseudomonas aeruginosa infection in cystic fibrosis airway disease: metabolic changes that unravel novel drug targets. Expert Rev Anti Infect Ther 2:611-23.
[0230] 4. Gibson RL, Burns JL, Ramsey BW. 2003. Pathophysiology and management of pulmonary infections in cystic fibrosis. Am J Respir Crit Care Med 168:918-51.
[0231] 5 Price CE, O'Toole GA. 2021. The gut-lung axis in cystic fibrosis. J Bacteriol 203:e0031121.
[0232] 6. Madan JC, Koestler DC, Stanton BA, Davidson L, Moulton LA, Housman ML, Moore JH, Guill MF, Morrison HG, Sogin ML, Hampton TH, Karagas MR, Palumbo PE, Foster JA, Hibberd PL, O'Toole GA. 2012. Serial analysis of the gut and respiratory microbiome in cystic fibrosis in infancy: interaction between intestinal and respiratory tracts and impact of nutritional exposures. mBio 3:e00251-12.
[0233] 7. Antosca KM, Chernikova DA, Price CE, Ruoff KL, Li K, Guill MF, Sontag NR, Morrison HG, Hao S, Drumm ML, MacKenzie TA, Dorman DB, Feenan LM, Williams MA, Dessaint J, Yuan IH, Aldrich BJ, Moulton LA, Ting L, Martinez-Del Campo A, Stewart EJ, Karagas MR, O'Toole GA, Madan JC. 2019. Altered stool microbiota of infants with cystic fibrosis shows a reduction in genera associated with immune programming from birth. J Bacteriol 201:e00274-19.
[0234] 8. Hayden HS, Eng A, Pope CE, Brittnacher MJ, Vo AT, Weiss EJ, Hager KR, Martin BD, Leung DH, Heltshe SL, Borenstein E, Miller SI, Hoffman LR. 2020. Fecal dysbiosis in infants with cystic fibrosis is associated with early linear growth failure. Nat Med 26:215-221.
[0235] 9. Price CE, Hampton TH, Valls RA, Barrack KE, O’Toole GA, Madan JC, Coker MO. 2023. Development of the intestinal microbiome in cystic fibrosis in early life. mSphere 24:e0004623.
[0236] 10. Salerno P, Verster A, Valls R, Barrack K, Price C, O’Toole GA, Ross BD..Persistent delay in maturation of the developing gut microbiota in infants with cystic fibrosis. https: / / www.biorxiv.org / content / 10.1101 / 2023.05.02.539134v1.
[0237] 11. Meeker SM, Mears KS, Sangwan N, Brittnacher MJ, Weiss EJ, Treuting PM, Tolley N, Pope CE, Hager KR, Vo AT, Paik J, Frevert CW, Hayden HS, Hoffman LR, Miller SI, Hajjar AM. 2020. CFTR dysregulation drives active selection of the gut microbiome. PLoS Pathog 16:e 1008251.
[0238] 12. Price CE, Valls RA, Ramsey AR, Loeven NA, Jones JT, Barrack KE, Schwartzman JD, Royce DB, Cramer RA, Madan JC, Ross BD, Bliska J, O'Toole GA. 2024. Intestinal Bacteroides modulates inflammation, systemic cytokines, and microbial ecology via propionate in a mouse model of cystic fibrosis. mBio 15:e0314423.
[0239] 13. Barrack KE, Hampton TH, Valls RA, Surve SV, Gardner TB, Sanville JL, Madan JL, O'Toole GA. 2024. An in vitro medium for modeling gut dysbiosis associated with cystic fibrosis. J Bacteriol 206:e0028623.
[0240] 14. Reasoner SA, Bernard R, Waalkes A, Penewit K, Lewis J, Sokolow AG, Brown RF, Edwards KM, Salipante SJ, Hadjifrangiskou M, Nicholson MR. 2024. Longitudinal profiling of the intestinal microbiome in children with cystic fibrosis treated with elexacaftor-tezacaftor-ivacaftor. mBio 15:e0193523.
[0241] 15. Marsh R, Dos Santos C, Hanson L, Ng C, Major G, Smyth AR, Rivett D, van der Gast C. 2023. Tezacaftor / Ivacaftor therapy has negligible effects on the cystic fibrosis gut microbiome. Microbiol Spectr 11:e0117523.
[0242] 16. Bailey J, Krick S, Fontaine KR. 2022. The changing landscape of nutrition in cystic fibrosis: The emergence of overweight and obesity. Nutrients 14:1216.
[0243] 17. Sanville JL, O’Toole GA, Madan JC, Coker M. 2024. Pre-modulator microbiome alterations associated with post-modulator growth outcomes in cystic fibrosis: Can we predict outcomes? JPGN, in revision.
[0244] 18. Davies JC, Sermet-Gaudelus I, Naehrlich L, Harris RS, Campbell D, Ahluwalia N, Short C, Haseltine E, Panorchan P, Saunders C, Owen CA, Wainwright CE, Group VXI. 2021. A phase 3, double-blind, parallel-group study to evaluate the efficacy and safety of tezacaftor in combination with ivacaftor in participants 6 through 11 years of age with cysticfibrosis homozygous for F508del or heterozygous for the F508del-CFTR mutation and a residual function mutation. J Cyst Fibros 20:68-77.
[0245] 19. Gabel ME, Fox CK, Grimes RA, Lowman JD, McDonald CM, Stallings VA, Michel SH. 2022. Overweight and cystic fibrosis: An unexpected challenge. Pediatr Pulmonol 57 Suppl LS40-S49.
[0246] 20. Pal R, Athamneh AIM, Deshpande R, Ramirez JAR, Adu KT, Muthuirulan P, Pawar S, Biazzo M, Apidianakis Y, Sundekilde UK, de la Fuente-Nunez C, Martens MG, Tegos GP, Seleem MN. 2023. Probiotics: insights and new opportunities for Clostridioides difficde intervention. Crit Rev Microbiol 49:414-434.
[0247] 21. Esposito S, Testa I, Mariotti Zani E, Cunico D, Torelli L, Grandinetti R, Fainardi V, Pisi G, Principi N. 2022. Probiotics administration in cystic fibrosis: What Is the evidence? Nutrients 14:3160.
[0248] 22. van Dorst JM, Tam RY, Ooi CY. 2022. What do we know about the microbiome in cystic fibrosis? Is there a role for probiotics and prebiotics? Nutrients 14.
[0249] 23. Deatherage DE, Barrick JE. 2014. Identification of mutations in laboratory-evolved microbes from next-generation sequencing data using breseq. Methods Mol Biol 1151:165-88.
[0250] 24. Letunic I, Bork P. 2024. Interactive Tree of Life (iTOL) v6: recent updates to the phylogenetic tree display and annotation tool. Nucleic Acids Res doi:10.1093 / nar / gkae268.
[0251] 25. Abramson J, Adler J, Dunger J, Evans R, Green T, Pritzel A, Ronneberger O, Willmore L, Ballard AJ, Bambrick J, Bodenstein SW, Evans DA, Hung CC, O’Neill M, Reiman D, Tunyasuvunakool K, Wu Z, Zemgulyte A, Arvaniti E, Beattie C, Bertolli O, Bridgland A, Cherepanov A, Congreve M, Cowen-Rivers AI, Cowie A, Figurnov M, Fuchs FB, Gladman H, Jain R, Khan YA, Low CMR, Perlin K, Potapenko A, Savy P, Singh S, Stecula A,Thillaisundaram A, Tong C, Yakneen S, Zhong ED, Zielinski M, Zidek A, Bapst V, Kohli P, Jaderberg M, Hassabis D, Jumper JM. 2024. Accurate structure prediction of biomolecular interactions with AlphaFold 3. Nature 630:493-500.
[0252] 26. Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Mol Biol Evol 30:772-780.
[0253] 27. Yariv B, Yariv E, Kessel A, Masrati G, Chorin A Ben, Martz E, Mayrose I, Pupko T, Ben-Tai N. 2023. Using evolutionary data to make sense of macromolecules with a “facelifted” ConSurf. Protein Sci 32.
[0254] 28. Loeven NA, Perault AI, Cotter PA, Hodges CA, Schwartzman JD, Hampton TH, Bliska JB. 2021. The Burkholderia cenocepacia Type VI Secretion System Effector TecA Is a Virulence Factor in Mouse Models of Lung Infection. mBio 12.
[0255] 29. Liu M, Deora R, Doulatov SR, Gingery M, Eiserling FA, Preston A, Maskell DJ, Simons RW, Cotter PA, Parkhill J, Miller JF. 2002. Reverse transcriptase-mediated tropism switching in Bordetella bacteriophage. Science 295:2091-2094.
[0256] 30. MacAdangdang BR, Makanani SK, Miller JF. 2022. Accelerated Evolution by Diversity-Generating Retroelements. Annu Rev Microbiol 76:389-411.
[0257] 31. García-López M, Meier-Kolthoff JP, Tindall BJ, Gronow S, Woyke, T, Kyrpides NC, Hahnke, RL, Göker, M. 2019. Analysis of 1,000 Type-Strain Genomes Improves Taxonomic Classification of Bacteroidetes. Frontiers in Microbiology. 10: 2083.
[0258] O’Toole et al. US Patent 11,351,208 B2
[0259] O’Toole et al. US Pat. App. Pub. 20240177868A1
[0260] Dauner et al. US Pat. App. Pub. 20220204966 Al
[0261] Lim et al. US Pat. App. Pub. 20230119263 Al
[0262] 32. Carmichael MM, Valls RA, Soucy S, Sanville J, Madan J, Surve SV, Sundrud MS, O’Toole GA. 2025. Profiling bile acids in the stools of humans and animal models of cystic fibrosis. Microbiol Spectr e01451-25
[0263] 33. Peng Y-L, Wang S-H, Zhang Y-L, Chen M-Y, He K, Li Q, Huang W-H, Zhang W. 2024. Effects of bile acids on the growth, composition and metabolism of gut bacteria. NPJ Biofilms Microbiomes 10:112.
Claims
What is Claimed is:
1. An isolated cell population comprising evolved bacterial cells of the genera Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, or Veillonella, wherein the evolved bacterial cells have increased viability in a gastrointestinal tract environment characteristic of a cystic fibrosis patient (“CF-GI tract”), as compared with an ancestral bacterial strain.
2. The isolated cell population of claim 1, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a CF Adaptive Protein F (capF) gene.
3. The isolated cell population of claim 1 or 2, wherein the evolved bacterial cells are of the genera Phocaeicola or Bacteroides.
4. The isolated cell population of any of claims 1 to 3, wherein the evolved bacterial cells are Phocaeicola vulgatus or Phocaeicola dorei or Bacteroides vulgatus or Bacteroides dorei.
5. The isolated cell population of any of claims 1 to 4, wherein said at least one nonsynonymous mutation in said evolved bacterial cells is in comparison with a reference genome sequence of Phocaeicola vulgatus or Phocaeicola dorei or Bacteroides vulgatus or Bacteroides dorei.
6. The isolated cell population of claim 5, wherein the reference genome sequence is of P. vulgatus CFPLTA003-2B strain.
7. The isolated cell population of claim 6, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a capF gene in Phocaeicola dorei.
8. The isolated cell population of claim 7, wherein the Phocaeicola dorei is strain CFPLTA003 2B.
9. The isolated cell population of any of claims 1 to 8, wherein the evolved bacterial cells are evolved from an ancestral bacterial cell having at least 80%, 85%, 90%, 95%, 98%, 99%, 99.9%, or 99.99% identity with the genome sequence of GenBank accession number GCA_007896665.1 (SEQ IDNO:!).
10. The isolated cell population of any of claims 1 to 9, wherein the evolved bacterial cells have at least one nonsynonymous mutation in the capFl gene of Phocaeicola dorei strain CFPLTA003 2B (GenBank accession number GCA 007896665.1).
11. The isolated cell population of claim 10, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a capFl gene annotated as BHANDH 05005 in CFPLTA003-2B genome (SEQ ID NO:3).
12. The isolated cell population of any of claims 1 to 11, wherein the evolved bacterial cells have at least one nonsynonymous mutation in the capF2 gene of Phocaeicola dorei strain CFPLTA003 2B (GenBank accession number GCA 007896665.1).
13. The isolated cell population of claim 12, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a capF2 gene annotated as BHANDH 11500 in CFPLTA003-2B genome (SEQ ID NO:4).
14. The isolated cell population of any of the claims 1 to 13, wherein the evolved bacterial cells have at least one nonsynonymous mutation in the capF3 gene of Phocaeicola dorei strain CFPLTA003 2B (GenBank accession number GCA 007896665.1).
15. The isolated cell population of claim 14, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a capF3 gene annotated as BHANDH 12430 in CFPLTA003-2B genome (SEQ ID NO:2).
16. The isolated cell population of any of claims 2 to 15, wherein the one or more nonsynonymous mutations are selected from Table 3.
17. The isolated cell population of any of claims 1 to 16, wherein said evolved bacterial cells produce short-chain fatty acids (SCFA).
18. The isolated cell population of claim 17, wherein said evolved bacterial strains produce SCFA at a level from about 80% to about 150%, or at least about 85%, or 90%, or 95%, of the ancestral bacterial strain.
19. The isolated cell population of claim 17 or 18, wherein the SCFA is propionate.
20. The isolated cell population of any of claims 1 to 19, wherein said evolved bacterial cells produce riboflavin.
21. The isolated cell population of claim 20, wherein said evolved bacterial strains produce riboflavin at a level from about 80% to about 150%, or at least about 85%, or 90%, or 95%, of the ancestral bacterial strain.
22. The isolated cell population of any of claims 1 to 21, wherein said evolved bacterial cells produce D-lactate and / or L-lactate.
23. The isolated cell population of claim 22, wherein said evolved bacterial strains produce D-lactate and / or L-lactate at a level from about 80% to about 150%, or at least about 85%, or 90%, or 95%, of the ancestral bacterial strain.
24. The isolated cell population of any of claims 1 to 23, wherein the evolved bacterial cells have demonstrated capability to colonize a GI tract of a human patient or a mammalian model.
25. The isolated cell population of claim 24, wherein the evolved bacterial cells have demonstrated capability to colonize the GI tract in the presence of an antibiotic.
26. A composition comprising an isolated cell population according to any of claims 1 to 25 in an effective amount to colonize a GI tract of a patient.
27. A composition comprising a therapeutically effective amount of an isolated cell population according to any of claims 1 to 25.
28. A method of altering the intestinal microbiome in a subject, the method comprising: administering a composition comprising the isolated cell population of any of claims 1 to 25 to the subject and allowing the cells to alter the intestinal microbiome.
29. The method of claim 28, wherein the method comprises reducing the risk of, severity of, or delaying at least one cystic fibrosis-associated outcome.
30. The method of claim 29, wherein the cystic fibrosis-associated outcome is pulmonary exacerbation.
31. The method of claim 29, wherein the cystic fibrosis-associated outcome is chronic pathogenic microbial infection.
32. The method of to any of claims 28 to 31, wherein the method further comprises reducing systemic inflammation in the subject.
33. The method of claim 28, wherein the subject is a cystic fibrosis patient.
34. The method of claim 28, wherein the subject is an inflammatory bowel disease (IBD) patient.
35. The method of claim 28, wherein the subject is an ulcerative colitis patient.
36. The method of claim 28, wherein the subject is a Crohn’s disease patient.
37. The method of claim 28, wherein the subject has low abundance of one or more of Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, and / or Veillonella.
38. The method of claim 28, wherein the subject has low abundance of one or more of Phocaeicola and / or Bacteroides.
39. The method of to any of claims 28 to 38, wherein the method further comprises reducing systemic inflammation in the subject.
40. The method of any of claims 28 to 39, wherein, prior to said administering, a fecal sample from the subject has been tested to determine whether the subject has a decreased level of Phocaeicola and / or Bacteroides relative to a healthy control population.
41. The method of claim 40, wherein the composition is administered if the level of Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, and / or Veillonella relative to a healthy control population is about 50% or lower.
42. The method of claim 40, wherein the composition is administered if the level of Phocaeicola, Bacteroides, Bifidobacterium, Roseburia, and / or Veillonella relative to a healthy control population is about 50% or lower.
43. The method of any of claims 28 to 42, wherein, prior to said administering, a fecal sample from the patient has been tested to determine whether the patient has a decreased level of Phocaeicola vulgatus and / or Phocaeicola dorei and / or Bacteroides vulgatus and / or Bacteroides dorei relative to a healthy control population.
44. The method of claim 43, wherein the composition is administered if the level of P. vulgatus and / or P. dorei and / or B. vulgatus and / or B. dorei relative to a healthy control population is about 50% or lower.
45. The method of any of claims 28 to 44, wherein the subject is a pediatric patient.
46. The method of claim 45, wherein the subject is 0 days old to 3 years old, 0 days old to 2 years old, 0 days old to 18 months old, 1 week old to 12 months old, 1 week old to 6 months old.
47. A method of generating an evolved bacterial cell having increased viability in a gastrointestinal tract environment characteristic of a cystic fibrosis patient (“CF-GI tract”), the method comprising:culturing ancestral bacterial cells having insufficient viability in a CF-GI tract in a series of cell culture media, wherein the series comprises differing concentrations of one or more of components characteristic of a CF-GI tract: andisolating an evolved bacterial cell having increased viability in a CF-GI tract.
48. The method of claim 47, wherein said one or more of components characteristic of a CF-GI tract is selected from the group consisting of:lipid (e.g., glycerol);sulfate;nitrate;formate;antibiotic (e.g., Bactrim);peroxide (e.g., H2O2);H₃O+(e.g., lower pH);mucin; andbile salts.
49. The method of claim 47, wherein said one or more of components characteristic of a CF-GI tract is selected from the group consisting of bile salts, mucin and pH.
50. The method of claim 49, wherein the bile salts comprise a 1: 1 mixture of cholic acid and deoxycholic acid.
51. The method of claim 47, wherein the series of cell culture media comprises:sulfate at a concentration of from about 0.1 mM to about 1 mM;nitrate at a concentration of from about 0.1 mM to about 1 mM;formate at a concentration of from about 0.1 mM to about 1 mMglycerol at a concentration of from about 0.1% to about 1%;an antibiotic at a concentration of from about 0.1 pM to about 10 pM;H2O2 at a concentration of from about 0.1 pM to about 10 pM;H3O+at a pH from about 5.5 to 7;mucin at a concentration of from about 1 g / L to about 8 g / L; and / orbile salts at a concentration of from about 0.1 g / L to about 2 g / L.
52. The method of any of claims 47 to 51, wherein the series of cell culture media comprises serially increasing concentrations of each of said one or more components.
53. The method of any of claims 47 to 52, wherein the series of cell culture media is prepared from a base cell culture medium, and the series differ in dilution of the base cell culture medium.
54. The method of claim 53, wherein the base cell culture medium is LowCF-MiPro.
55. The method of claim 53, wherein the base cell culture medium is MedCF-MiPro.
56. The method of any of claims 47 to 55, wherein the bacterial cells are cultured in at least two conditioning periods.
57. The method of claim 56, wherein each of the at least two conditioning periods is from 2 to 10 days, or from 3 to 7 days, or 5 days.
58. The method of claim 56 or 57, wherein the at least two conditioning periods comprise first and second conditioning periods.
59. The method of claim 58, wherein the bacterial cells are cultured in a mixture comprising from 10% to 50%, or about 25%, of a base cell culture medium during the first conditioning period.
60. The method of claim 59, wherein the bacterial cells are cultured in a mixture comprising from 30% to 100%, or about 50%, of a base cell culture medium during the second conditioning period.
61. The method of claim 60, wherein the at least two conditioning periods further comprises a third conditioning period, and the bacterial cells are cultured in a mixture comprising from 75% to 100%, or about 100%, of a base cell culture medium during the third conditioning period.
62. The method of any of claims 47 to 61, further comprising, prior to said culturing, determining that the ancestral bacterial cells have insufficient viability in a CF-GI tract.
63. The method of any of claims 47 to 62, further comprising determining if the evolved bacterial cell produces short-chain fatty acids (SCFA).
64. The method of any of claims 47 to 63, further comprising determining whether the evolved bacterial cell produces SCFA at a level from about 80% to about 150%, or at least 85%, or 90%, or 95%, of the ancestral bacterial cells.
65. The method of any of claims 47 to 64, further comprising determining if one or more of the evolved bacterial cells produce riboflavin.
66. The method of any of claims 47 to 65, further comprising determining if the evolved bacterial strains produce riboflavin at a level from about 80% to about 150%, or at least about 85%, or 90%, or 95%, of the ancestral bacterial strain.
67. The method of any of claims 47 to 66, further comprising determining if the evolved bacterial cells produce D-lactate and / or L-lactate.
68. The method of any of claims 47 to 67, further comprising determining if the evolved bacterial strains produce D-lactate and / or L-lactate at a level from about 80% to about 150%, or at least about 85%, or 90%, or 95%, of the ancestral bacterial strain.
69. The method of any of claims 47 to 68, further comprising expanding the evolved bacterial cell to produce an isolated cell population.
70. The method of any of claims 47 to 69, wherein one or more of the ancestral bacterial cells has at least 80%, 85%, 90%, 95%, 98%, 99%, 99.9%, or 99.99% identity with the genome sequence of GenBank accession number GCA 007896665.1 (SEQ ID NO: 1).
71. The method of any of claims 47 to 70, wherein one or more of the ancestral bacterial cells are of the genera Phocaeicola or Bacteroides.
72. The method of any of claims 47 to 71, wherein one or more of the ancestral bacterial cells are Phocaeicola vulgatus or Phocaeicola dorei or Bacteroides vulgatus or Bacteroides dorei.
73. The method of any of claims 47 to 72, wherein the ancestral bacterial cells comprise Phocaeicola dorei strain CFPLTA003 2B.
74. The method of any of claims 47 to 63, wherein one or more of the ancestral bacterial cells has the genome sequence of GenBank accession number GCA 007896665.1 (SEQ ID NO:1).
75. The method of any of claims 47 to 64, further comprising determining if one or more of the evolved bacterial cells has at least one nonsynonymous mutation in a capF gene, wherein said at least one nonsynonymous mutation is in comparison with a reference genome sequence.
76. The method of claim 75, wherein the reference genome sequence is a genome sequence of one or more of the ancestral bacterial cells.
77. The method of claim 75 or 76, wherein the reference genome sequence is the sequence of GenBank accession number GCA 007896665.1.
78. The method of any of claims 75 to 77, wherein the method comprises determining if one or more of the evolved bacterial cells have at least one nonsynonymous mutation in a capFl gene annotated as BHANDH 05005 in GenBank accession number GCA 007896665.1 (SEQ ID NO:3).
79. The method of any of claims 75 to 78, wherein the method comprises determining if one or more of the evolved bacterial cells have at least one nonsynonymous mutation in a capF2 gene annotated as BHANDH 11500 in GenBank accession number GCA 007896665.1 (SEQ ID NO:4).
80. The method of any of claims 75 to 79, wherein the evolved bacterial cells have at least one nonsynonymous mutation in a capF3 gene annotated as BHANDH 12430 in GenBank accession number GCA 007896665.1 (SEQ ID NO:2).
81. The method of any of claims 48 to 51, wherein the bile salts comprise one or more of cholic acid (CA), chenodeoxycholic acid (CDCA), taurine conjugated CA (tCA), glycine conjugated CA (gCA), taurine conjugated CDCA (tCDCA), glycine conjugated CDCA (gCDCA), deoxycholic acid (DCA), lithocholic acid (LCA), and ursodeoxycholic acid (UDCA).
82. The method of any of claims 48 to 51, wherein the bile salts comprise one or both of chenodeoxycholic acid (CDCA) and deoxycholic acid (DCA).
83. The isolated cell population of any of claims 1 to 25, wherein the evolved bacterial cells have heightened tolerance to one or both of chenodeoxycholic acid (CDCA) and deoxycholic acid (DCA).